Advances in Parasitology Volume 69

SERIES EDITORS D. ROLLINSON Department of Zoology The Natural History Museum London, UK S. I. HAY Spatial Epidemiology ...

Author: D. Rollinson | S.I. Hay

115 downloads 1777 Views 5MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

SERIES EDITORS D. ROLLINSON Department of Zoology The Natural History Museum London, UK

S. I. HAY Spatial Epidemiology and Ecology Group Tinbergen Building Department of Zoology University of Oxford South Parks Road Oxford, OX1 3PS, UK

EDITORIAL BOARD M. COLUZZI Department of Public Health Sciences, Section of Parasitology ‘Ettore Biocca’ ‘Sapienza – Universita` di Roma’ 00185 Roma, Italia

C. COMBES Laboratoire de Biologie Animale, Universite´ de Perpignan, Centre de Biologie et d’Ecologie Tropicale et Me´diterraneénne, 66860 Perpignan Cedex, France

D. D. DESPOMMIER Division of Tropical Medicine and Environmental Sciences, Department of Microbiology, Columbia University, New York, NY 10032, USA

J. J. SHAW Instituto de Cieˆncias Biome´dicas, Universidade de Saõ Paulo, 05508-990, Cidade Universita´ria, Saõ Paulo, SP, Brazil

K. TANABE Laboratory of Malariology, International Research Center of Infectious Diseases. Research Institute for Microbial Diseases, Osaka University, Suita, 565-0871. Japan

Academic Press is an imprint of Elsevier 32 Jamestown Road, London, NW1 7BY, UK 525 B Street, Suite 1900, San Diego, CA 92101-4495, USA 30 Corporate Drive, Suite 400, Burlington, MA 01803, USA Radarweg 29, PO Box 211, 1000 AE Amsterdam, The Netherlands First edition 2009 Copyright # 2009 Elsevier Ltd. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher. Permissions may be sought directly from Elsevier’s Science & Technology Rights Department in Oxford, UK: phone (þ44) (0) 1865 843830; fax (þ44) (0) 1865 853333; email: [email protected]. Alternatively you can submit your request online by visiting the Elsevier web site at http:// elsevier.com/locate/permissions, and selecting Obtaining permission to use Elsevier material. Notice No responsibility is assumed by the publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions or ideas contained in the material herein. Because of rapid advances in the medical sciences, in particular, independent verification of diagnoses and drug dosages should be made. ISBN: 978-0-12-374795-2 ISSN: 0065-308X For information on all Academic Press publications visit our website at www.elsevierdirect.com Printed and bound in UK 09 10 11 12 10 9 8 7 6 5 4 3 2 1

PREFACE

This volume opens with an overview of the biology of what the authors consider to be an understudied parasite, Zygocotyle lunata. Bernard Fried from Lafayette College, Pennsylvania, United States and colleagues Jayne Huffman, Shamus Keeler, and Robert Peoples consider the literature over a 60-year period. Despite the near global distribution of this parasite and its presence in numerous waterfowl and ruminants, they highlight many gaps in basic knowledge. The authors argue that this is a convenient parasite for laboratory study and, for those prepared for this new challenge, this review will be an excellent starting point. Charles Willey described the complete lifecycle of Zygocotyle lunata in 1941 and Fried uses this review to pay a befitting tribute to his memory. The second chapter is an extensive and detailed global overview of Fasciola, lymnaeids and fascioliasis. We are extremely fortunate to have three of the leading experts in the field, Santiago Mas-Coma, Marıá Adela Valero, and Marıá Dolores Bargues from the University of Valencia, Spain contributing to this important review. There has been increased interest in the distribution and spread of fascioliasis and increasing concern about the nature of human fascioliasis and its public health importance. The authors provide a comprehensive account of the many aspects concerning the disease, including aetiology, past and present geographical distribution, epidemiology, transmission, and control. Understanding of the complex interplay between human and animal infection, together with the central role of lymnaeids in transmission, has undoubtedly benefited greatly from the application of techniques of molecular epidemiology. The authors make every effort to link the many different biological components together to provide an authoritative statement of the current position with regard to human fascioliasis. The article concludes with recommendations towards achieving a standard methodology, including techniques and nomenclature, to be used for parasite and snail characterization and molecular epidemiology. This is followed by a contribution from Rafael Toledo and Jose´-Guillermo Esteban also from the University of Valencia, Spain together with Bernard Fried on recent advances in the biology of echinostomes. The article draws attention to the cosmopolitan nature of these intestinal parasitic flatworms and describes much of the biology concerning their complex lifecycles. Developments have taken place on many fronts especially in relation to systematics, immunology, and host–parasite relationships. ix

x

Preface

Echinostomes are good experimental models in the laboratory and this has facilitated important insights into the biology of intestinal helminths. The review also points out those areas such as genome analysis that are in need of greater research effort. The fourth chapter headed by Martin Kasˇny´ and Petr Hora´k form the Charles University, Prague, Czech Republic is a major undertaking detailing peptidases of trematodes from a collaborative group involving the University of California, United States and the University of Technology, Sydney, Australia. Peptidases are important molecules and are recognised as having great potential as drug, vaccine, and diagnostic candidates. The authors are to be congratulated in bringing together the diverse strands of data on the biochemical and molecular features of the major trematode peptidases in this authoritative and comprehensive review, which will be extremely valuable to the research community. In the final chapter, Chris Drakeley and Jackie Cook of the London School of Hygiene and Tropical Medicine, United Kingdom, look at the potential contribution of sero-epidemiological analysis for monitoring malaria control. This was a favoured technique in the global malaria eradication era. The resurgence of interest in the potential for local elimination of malaria prompted the authors to review the historical literature. This timely overview shows how the methods can be improved from their past implementation and how the techniques are poised to make a substantial contribution in future monitoring, notably in low transmission environments and the confirming of malaria-free status. D. ROLLINSON S. I. HAY

CONTRIBUTORS

Marıá Dolores Bargues Departamento de Parasitologıá, Facultad de Farmacia, Universidad de Valencia, 46100 Burjassot, Valencia, Spain. Conor R. Caffrey Sandler Center for Basic Research in Parasitic Diseases, California Institute for Quantitative Biosciences, University of California, San Francisco, CA, USA. Jackie Cook Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London, United Kingdom. John P. Dalton Institute for the Biotechnology of Infectious Diseases, University of Technology Sydney, Ultimo, Sydney, NSW 2007, Australia. Jan Dvorˇa´k Sandler Center for Basic Research in Parasitic Diseases, California Institute for Quantitative Biosciences, University of California, San Francisco, CA, USA. Chris Drakeley Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London, United Kingdom. Jose´-Guillermo Esteban Departamento de Parasitologıá, Facultad de Farmacia, Universidad de Valencia, 46100 Burjassot, Valencia, Spain. Bernard Fried Department of Biology, Lafayette College, Easton, PA 18042, USA. Vladimı´r Hampl Department of Parasitology, Faculty of Science, Charles University in Prague, Prague, Czech Republic. Petr Hora´k Department of Parasitology, Faculty of Science, Charles University in Prague, Prague, Czech Republic.

vii

viii

Contributors

Jane E. Huffman Department of Biological Sciences, Fish & Wildlife Microbiology Laboratory, East Stroudsburg University, East Stroudsburg, PA, USA. Martin Kasˇny´ Department of Parasitology, Faculty of Science, Charles University in Prague, Prague, Czech Republic. Shamus Keeler Southeastern Cooperative Wildlife Disease Study (SCWDS), Department of Population Health, College of Veterinary Medicine, University of Georgia, Athens, GA, USA. Santiago Mas-Coma Departamento de Parasitologıá, Facultad de Farmacia, Universidad de Valencia, 46100 Burjassot, Valencia, Spain. Libor Mikesˇ Department of Parasitology, Faculty of Science, Charles University in Prague, Prague, Czech Republic. Robert C. Peoples Department of Biology, Lafayette College, Easton, PA 18042, USA. Rafael Toledo Departamento de Parasitologıá, Facultad de Farmacia, Universidad de Valencia, 46100 Burjassot, Valencia, Spain. Marıá Adela Valero Departamento de Parasitologıá, Facultad de Farmacia, Universidad de Valencia, 46100 Burjassot, Valencia, Spain.

CHAPTER

1 The Biology of the Caecal Trematode Zygocotyle lunata Bernard Fried,* Jane E. Huffman,† Shamus Keeler,‡ and Robert C. Peoples*

Contents

1.1. Introduction to the Family Zygocotylidae and the Genus Zygocotyle 1.2. Brief Taxonomic Survey of Zygocotylidae and Zygocotyle 1.3. The Biology of Zygocotyle lunata 1.4. Infectivity Studies in Snail First Intermediate Hosts 1.5. Cercarial Encystment on Various Surfaces 1.6. Infectivity of the Metacercarial Cysts to Vertebrate Hosts 1.7. Epizootiology of Zygocotyle lunata 1.8. Pathology of Zygocotyle lunata 1.8.1. Invertebrate hosts 1.8.2. Vertebrate hosts 1.9. Immunology of Zygocotyle lunata in the Vertebrate Host 1.10. Diagnosis 1.11. Treatment and Control 1.12. Encystment and Excystment 1.13. Ultra-Structure 1.14. Development on the Chick Chorioallantois 1.15. Behaviour 1.16. Biochemistry

2 3 6 8 13 14 14 16 16 17 19 21 22 22 30 31 32 32

* Department of Biology, Lafayette College, Easton, PA 18042, USA {

{

Department of Biological Sciences, Fish & Wildlife Microbiology Laboratory, East Stroudsburg University, East Stroudsburg, PA, USA Southeastern Cooperative Wildlife Disease Study (SCWDS), Department of Population Health, College of Veterinary Medicine, University of Georgia, Athens, GA, USA

Advances in Parasitology, Volume 69 ISSN 0065-308X, DOI: 10.1016/S0065-308X(09)69001-1

#

2009 Elsevier Ltd. All rights reserved.

1

2

Bernard Fried et al.

1.17. Ecology 1.18. Concluding Remarks and Future Prospects References

Abstract

34 36 36

This chapter examines the significant studies on the caecal paramphistomid Zygocotyle lunata from mainly 1941 to 2008. This digenean is one of two paramphistomid species in the family Zygocotylidae. Z. lunata has an almost global distribution being found in the wild in numerous waterfowl and various species of ruminants. It infects planorbid snails in the genera Helisoma and Biomphalaria. Because it may involve concurrent infections with Schistosoma mansoni in species of Biomphalaria snails, there is an interest in Z. lunata as a potential control agent against S. mansoni. Z. lunata may have some impact as a pathogen of birds in wildlife diseases, but its real assessment in this role is not fully understood. The cercariae of this paramphistomid when released from snails encyst on a substratum such as vegetation or the shells of aquatic invertebrates in the wild or in the laboratory on the glass or plastic of a container holding the snails. Most studies on the intramolluscan parasitic stages are based on work from snails collected in the wild and experimental studies using laboratory-reared snails are sparse. Numerous experimental mammalian and avian hosts can be infected with the metacercarial cysts of this digenean, but quantitative experimental studies on the adult stages of this parasite using known numbers of cysts and well-defined strains of vertebrate hosts are sparse. Likewise, some studies on the immunology and pathology of this trematode have been done, but for the most part they are fragmentary and do not provide quantitative information on these topics. Published information on the molecular biology of this organism does not exist. The organism is in need of new research efforts at all levels of organization from the molecular to the community.

1.1. INTRODUCTION TO THE FAMILY ZYGOCOTYLIDAE AND THE GENUS ZYGOCOTYLE Zygocotyle lunata is an understudied paramphistomid digenean. Although it is a cosmopolitan trematode found on most continents, it has been mainly studied in North and South America. Larval stages occur in planorbid snails including species of Helisoma and Biomphalaria. Adult worms occur in the caecum and colon of numerous bird and mammal species in the wild. In the laboratory, Z. lunata can be grown experimentally in certain species of planorbid snails and in various vertebrate hosts including domestic chicks, mice, rats and hamsters.

The Biology of the Caecal Trematode Zygocotyle lunata

3

Z. lunata is not a well-known digenean, even to many helminthologists. One purpose of this chapter is to promote this organism as a good model for various studies that range from the molecular to the community level. In this chapter, we point out the availability of this trematode in the wild and how to maintain it in the laboratory. This trematode can be maintained in the encysted metacercarial stage for at least 1 year in cold Locke’s solution and still retain its infectivity to vertebrate definitive hosts. Also, infected planorbid snails that harbour the intra-molluscan stages of this parasite can be maintained for about 1 year in the laboratory and continue to shed viable cercariae during this time. The cycle is easiest to maintain in Helisoma snails and laboratory mice. Cercariae released from infected snails encyst on vegetation in the cultures or on the surfaces of the containers used to maintain the snails. Cysts can be scraped from the containers and maintained in saline at 4 C for long periods until they are ready to be used. Encysted metacercariae can be excysted chemically and the juveniles can be grown on the chick chorioallantois, a fact that makes this organism useful for developmental and behavioural studies. Relatively few non-schistosomatids can be maintained easily in the laboratory for experimental studies. Z. lunata is an intestinal form (mainly from the caecum and colon) that can be maintained throughout its entire lifecycle in the laboratory, thus allowing for manipulation of all stages. This parasite is ubiquitous and cosmopolitan and should be exploited more frequently in the laboratory. Willey (1941) published an excellent monograph on many aspects of the biology of this organism and workers who intend to use this parasite as a model will find the Willey review indispensable for their research. Although the number of publications on this organism based on citation in ISI Web of Science (44 publications from 1950 to 2007), PubMed (23 publications from 1951 to 2008) and CABI (20 publications from 1988 to 2006) are relatively few, there are additional studies in the form of unpublished theses and abstracts that we will refer to in this chapter. We also consider some of our unpublished work in progress.

1.2. BRIEF TAXONOMIC SURVEY OF ZYGOCOTYLIDAE AND ZYGOCOTYLE Jones (2005) considered the family Zygocotylidae as consisting of two genera of paramphistomids. One genus is Wardius with the single species W. zibethicus. The other genus is Zygocotyle with the single species Z. lunata. The taxonomic hierarchy for Z. lunata is shown in Table 1.1. Separation of the two genera in the family is as follows (see Fig. 1.1 and Table 1.1). Z. lunata has a prolonged acetabulum anteriorly with paired posteriad projections and an oesophageal bulb is present; these

4


TABLE 1.1 Taxonomic hierarchy for Z. lunata

Kingdom: Phylum: Class: Sub-class: Order: Sub-order: Super-family: Family: Sub-family:* Genus: Species:

Animalia Platyhelminthes Trematoda Digenea Echinostomida Paramphistomata Paramphistomoidae Zygocotylidae Zygocotylinae Zygocotyle Zygocotyle lunata ¼ Z. ceratosa

Rudolphi, 1808 Carus, 1863

Fischoeder, 1901 Ward, 1917 Ward, 1917 Stunkard, 1916 Stunkard, 1916

Note: *Jones (2005) considered recognition of sub-family as unnecessary since the family only consists of two genera, Zygocotyle and Wardius.

FIGURE 1.1

(Continued)


5

FIGURE 1.1 The family Zygocotylidae consists of two genera of paramphistomids, Wardius zibethicus (A) and Zygocotyle lunata (B). Note: Reproduced from Schell (1985), with permission.

characteristics are absent in W. zibethicus. This latter species has been studied by Murrell (1965). The intra-molluscan stages develop in Helisoma antrosum (¼ H. anceps). Amphistome cercariae released from snails encysted on vegetation or substratum. Metacercarial development to pre-adults occurred experimentally in mice, hamsters and guinea pigs; the natural definitive host of this paramphistomid is the muskrat Ondatra zibetica. Experimental work with this amphistome is essentially nil and no further mention of this species is made in this chapter. The following brief systematic account is now made of Z. lunata. The species was first described as Aphistomum lunatum by Diesing (1836) from the ducks, Anas melanotus and A. impercutiri and the South American deer, Cervus dichotomius. Stunkard (1916) erected the genus Zygocotyle to contain A. lunatum and described a new species Z. lunata on the basis of

6


perceived differences in the shape and size of certain internal organs. Price (1928) discussed the taxonomy of the genus and concluded that Z. ceratosa and Z. lunata were synonymous, in fact describing the same organism. Therefore, Z. lunata (Diesing, 1836; Stunkard 1916) became the type species. Price (1928) also reported this species from the cow Bos taurus from Panama, providing further evidence that this species occurs naturally in mammals as well as birds. Willey (1941) described the complete lifecycle of Z. lunata using ducks and rats as the experimental definitive hosts. A species of amphistome cercariae from H. antrosum (¼ H. anceps) was described by Willey (1936) as Cercaria poconensis. Attempts to establish the lifecycle of C. poconensis in the 1930s by Willey were unsuccessful. In the 1941 study by Willey, the larva initially identified as C. poconensis developed in rats and ducks into the adult stages of Z. lunata. Willey (1941) considered C. poconensis to be a synonym of Z. lunata.

1.3. THE BIOLOGY OF ZYGOCOTYLE LUNATA The lifecycle of Z. lunata is summarized in Figure 1.2. Embryonated eggs are released into the environment in the faeces of infected waterfowl and mammals. The eggs are ovoid and colourless with an operculum at the narrow end. Irregular notches on the operculum and shell closely interdigitate. A 10–15 mm bulge occurs at the broad end of all eggs (Willey, 1941). Willey (1941) examined eggs from numerous experimentally infected hosts and reported the overall average length to be 142 mm with an average width of 96 mm. Willey (1941) reported very little variation in length and width of eggs from different hosts. This contradicted previous observations by Price (1928). The ovum is embedded between vitelline masses towards the narrow end of the egg and measures 20–25 mm. The eggs also contain many granular yolk masses suspended in a transparent fluid. The development of the larvae within the egg is detailed by Willey (1941). Development and hatching takes anywhere from 19 to 40 days. Highly increased ciliary activity precedes the opening of the operculum and release of the miracidia. Wiley (1941) observed a distinct periodicity in the time of day of miracidia hatching. Almost all eggs hatched after 5:00 PM and before 9:00 AM with the majority hatching between 10:00 PM and 2:00 AM. Based on laboratory experiments, darkness does not seem to affect this periodicity. The average length of miracidia is 194 mm and the average width is 55 mm. Willey (1941) reports the morphology of mature miracidia in great detail. After hatching, miracidia actively search for a host and can survive up to 7 h after which the miracidia settles to the bottom and dies. Miracidia are strongly attracted to the shells, mantle and foot of snails and most penetrate the host within 2 h.


7

FIGURE 1.2 Lifecycle of Zygocotyle lunata. Note: Unembryonated eggs (E) are released from the adult (A) and miracidia hatch after a period of development. Miracidia swim to find a suitable snail intermediate host (IM) such as Helisoma spp. After penetrating the snail, the miracidium transforms into a mother sporocyst, which produces mother rediae (R). The mother rediae produce daughter rediae, and these in turn produce cercariae (C) within 60 days of the initial infection. Cercariae leave the snail and settle on aquatic vegetation or shells of snails. There, cystogenous glands in the cercaria secrete a cyst and the parasite becomes a metacercaria (M). The metacercariae can survive for many months, awaiting ingestion by a suitable definitive host (DH). Some of the drawings used in the lifecycle are reproduced from Berger (1957), with permission from the author.

Based on the work by Willey (1941) and Etges (1992), species of Helisoma are the primary intermediate host for Z. lunata throughout North America and parts of South America. The farthest south within

8


the Americas that Helisoma spp. have been reported is Goias, Brazil (Paraense, 1976). Z. lunata has been reported in waterfowl as far south as Argentina (Digiani, 1997; Sutton and Lunaschi, 1987). Ostrowski de Nunez et al. (2003) reported naturally infected Biomphalaria peregrina in South America. Experimental infections determined that four other species of Biomphalaria are susceptible to Z. lunata. Species of Biomphalaria may serve as intermediate hosts particularly in regions lacking Helisoma snails. Within the intermediate host, the miracidia develop into sporocysts within 22–28 days after penetration. The sporocysts are ovoid to elongate with the anterior end being broader than the posterior. The body wall consists of a tegument, a membranous sheet and muscle fibres. The sporocysts contain germ balls and maturing rediae. Rediae develop within the sporocyst and are released. The mature rediae of Z. lunata were described in Willey (1936). Some rediae of Z. lunata contain both daughter rediae and cercariae (Berger, 1957), a situation atypical of most digeneans. Cercariae develop within the daughter rediae and emerge 32–49 days post-miracidia penetration (Willey, 1941). Willey (1936) gave detailed descriptions of cercariae morphology. Emerging cercariae swim vigorously for 30 min to 2 h. Cercariae have been reported to show distinct phototaxis (Willey, 1941). The cercariae settle and encyst on various substrates including invertebrate shells and vegetation. The literature on encystment and metacercarial cyst structure is reviewed in Section 1.12. Vertebrate hosts become infected by ingesting plants or other materials with encysted metacercariae. The definitive hosts for Z. lunata are waterfowl with multiple mammalian hosts acting as incidental hosts. The reported vertebrate hosts of Z. lunata are summarized in Tables 1.2 and 1.3.

1.4. INFECTIVITY STUDIES IN SNAIL FIRST INTERMEDIATE HOSTS The intermediate host of Z. lunata has been determined to be pulmonate snails of the genus Helisoma and Biomphalaria. Natural infections have been reported in H. antrosum (anceps), H. trivolvis and B. peregrina (Gower, 1938a; Ostrowski de Nunez et al., 2003; Willey, 1936, 1937). Willey (1941) experimentally infected H. antrosum (anceps) with laboratory-reared Z. lunata miracidia. Initially, Willey (1941) attempted to infect snails in individual finger bowls with one to 15 miracidia but none of the snails became infected. Mass infections of 20–75 snails with large numbers of miracidia produced infection rates of 10–55%. The miracidia showed strong attraction to the snails, and also their faeces and mucous trails. Miracidia were observed swimming around and

TABLE 1.2 Summary of the documented avian hosts of Z. lunata Scientific name

Common name

Location

References

Amazonetta brasiliensis Anas acuta

Brazilian duck Pintail

McDonald, 1981 Buscher, 1965; Mayberry et al., 2000

Anas americana

American Widgeon White-cheeked pintail Northern shoveller Green-winged teal Blue-winged teal Unknown Falcated teal Grey teal

Eastern South America Manitoba, Canada; Kansas, Arizona and Texas, United States Oklahoma, United States

Anas bahamensis Anas clypeata Anas crecca Anas discors Anas epecutiri Anas falcata Anas gracilis (formerly Anas melanotus) Anas platyrhynchos

Anas platyrhynchos diazi

Mallard

Mexican duck

South America, Caribbean, Galapagos Islands

Texas and Oklahoma, United States Quebec, Canada

Shaw and Kocan, 1980 McDonald, 1981 Broderson et al., 1977; Mayberry et al., 2000 Shaw and Kocan, 1980; Canaris et al., 1981 Hoeve and Scott, 1988

South America Eastern Asia South America

Diesing, 1836

Oklahoma, United States; Quebec, Canada; Texas, United States North central Mexico; southwestern United States

Shaw and Kocan, 1980; Hoeve and Scott, 1988; Dronen et al., 1994

Diesing, 1836

Farias and Canaris, 1986 (continued)

TABLE 1.2

(continued)

Scientific name

Common name

Location

References

Anas querquedula Anas rubripes

Garganey American black duck Southern widgeon Gadwall

Europe Quebec, Canada

Yamaguti, 1971 Hoeve and Scott, 1988

Argentina

Sutton and Lunaschi, 1987

Manitoba, Canada; Kansas and Texas, United States Missouri, United States Texas, United States

Buscher, 1965

Anas sibilatrix Anas strepera Aix sponsa Anser albifrons Anser anser

Wood duck White-fronted goose Greylag goose

Aythya affinis

Lesser scaup

Aythya americana

Redhead duck

Aythya marila Aythya nyroca

Greater scuap Ferruginous duck Canvasback Canada goose Bufflehead duck

Aythya vallisneria Branta canadensis Bucephala albeola

North America, Europe, Asia North, Central and South America Southern and north-eastern United States, the Great Lakes region, northern Mexico and the Caribbean North America, Europe North, Central and South America United States, Canada North America Manitoba, Canada

Drobney et al., 1983 Purvis et al., 1997 McDonald, 1981 McDonald, 1981 McDonald, 1981

McDonald, 1981 Yamaguti, 1971 McDonald, 1981 McDonald, 1981 Ewart and McLaughlin, 1990

Cairina moschata

Muscovy duck

Capella gallinago

Snipe

Chen caerulescens Cygnus buccinator

Snow goose Trumpeter swan

Cygnus metancoryphus

Black-necked swan Black-bellied whistling Duck Domestic chicken Stilt Turkey

Dendrocygna autumnalis Gallus gallus Himantopus wilsoni Meleagris gallopavo Numenius americanus Numenius arquata Phasianus colchicus Recurvirostra americana

Long-billed curlew Eurasian curlew Pheasant American avocet

Mexico, Central and South America Texas and Colorado, United States Texas, United States Vanderhoff, British Columbia Argentina

McDonald, 1981

Texas, United States

George and Bolen, 1975

Pennsylvania, United States South America Oklahoma and Florida, United States Texas, United States

Fried, 1970; Fried and Nelson, 1978; Fried and Gainsburg, 1979, 1980 Diesing, 1836 Self and Bouchard, 1950; Maxfield et al., 1963 Dronen and Badley, 1979

Europe and Asia Nebraska, United States Texas, United States

Yamaguti, 1971 Greiner, 1972 Ahern and Schmidt, 1976

Price, 1928; Deblock and Rausch, 1968 Purvis et al., 1997 Cowan, 1946 Digiani, 1997

12


TABLE 1.3 Summary of the documented mammalian hosts of Z. lunata

Scientific name

Common name

Bos taurus

Cattle

Ovis aries

Domestic sheep Golden hamster Marsh deer

Location

Reference

North America; Europe

Price, 1928; Dawes, 1946; Soulsby, 1965 Yamaguti, 1971

Pennsylvania, United States South America

Huffman et al., 1991

Mice

Pennsylvania, United States

Alces alces

Moose

Rattus norvegicus Odocoileus virginianus

Rat

Alberta and Ontario, Canada Pennsylvania, United States Georgia, New Jersey United States

Huffman et al., 1991; Etges, 1992; Nollen, 1994 Samuel et al., 1976; Hoeve et al., 1988

Mesocricetus auratus Blastocerus dichotomus (formerly Cervus dichotomus) Mus musculus

Whitetailed deer

Diesing, 1836

Huffman et al., 1991 Swanson, 1960; Huffman et al., 1991

between snails often attaching to the shell, mantle or foot of the snail. Penetration of miracidia took 15–120 min. Cercarial emergence was observed 32–49 days after penetration of the miracidia. Infected snails were necropsied at various days post-penetration. Larvae were observed throughout the snail except in the lumen of the intestine, with heavy infection in the digestive gland and gonads. Histological observation of infected snails showed significant destruction of gonadal tissue. None of the infected snails produced eggs. Snails survived infection and shed cercariae for up to 9 months. Resolution of infection was not observed in any of the snails. Willey (1941) did not attempt secondary infections of the snails. Etges (1992) described a method for laboratory maintenance of all stages of Z. lunata that permits further detailed studies of relatively poorly known stages of the life history. The experimental infection of the snail host, H. anceps, was achieved by feeding of incubated eggs of the fluke,


13

rather than exposure to hatched miracidia. Techniques for obtaining maximum numbers of eggs, incubating eggs and storage of encysted metacercariae were also described. Ostrowski de Nunez et al. (2003) reported natural infections of B. peregrina from a pond in Buenos Aires, Brazil. Experimental infections were performed on six species of Biomphalaria found in Brazil. The species were B. straminea, B. peregrina, B. orbignyi, B. tenagophila tenagophila, B. oligoza and B. glabrata. Five of the six species were susceptible to infection, with B. glabrata being the only non-susceptible species. Ostrowski de Nunez et al. (2003) exposed each snail individually to five Z. lunata miracidia. The infection rates varied by species: 73% for B. straminea, 21% for B. peregrina, 80% for B. orbignyi, 53% for B. tenagophila tenagophila, 20% for B. oligoza and 0% for B. glabrata. No mass exposures of any of the species were done. Willey (1941) found that individual exposures were ineffective with nil infectivity rates. It is unknown whether or not infection of B. glabrata would occur under mass exposure conditions. Cercarial emergence occurred for all susceptible Biomphalaria spp. from 20 to 26 days post-infection. Infected Biomphalaria spp. survived up to 6 months post-infection and continued shedding cercariae until death. The Z. lunata infectivity studies of snail intermediate hosts are limited to Willey (1941), Etges (1992) and Ostrowski de Nunez et al. (2003). Many aspects of the interactions between Z. lunata and its intermediate hosts remain to be explored. The effect of temperature and salinity on miracidial and cercarial survival and infectivity is unknown. Willey (1941) reported no response to light by miracidia but no formal experiments were done to confirm his observations. The role of photoperiodic cercarial emergence in Z. lunata is unknown. Willey (1941) utilized histopathological observations to describe the areas of infection within H. anceps. It is unknown whether the pattern of infection is similar in Biomphalaria spp. Z. lunata is capable of infecting seven different species of pulmonate snails but host preference has not been determined The biochemical changes induced within experimentally infected host snails after infection with Z. lunata are unknown, although some work on this topic has been done with naturally infected snails (see Section 1.16 on biochemistry). Biochemical profiles are useful to determine whether enzyme activity is modified by this digenean or whether changes in protein, phospholipid or neutral lipid levels within the host occur (see Section 1.16).

1.5. CERCARIAL ENCYSTMENT ON VARIOUS SURFACES Cercariae of this species encyst on various substrates including invertebrate shells, glass and plastic surfaces, and vegetation. The literature on this topic is reviewed along with our unpublished studies in Section 1.12

14


on encystment and excystment. The ability to obtain cysts on surfaces eliminates the need for a second intermediate host and makes subsequent infectivity studies in the laboratory easier. This digenean can be used as a convenient model to study more economically important digeneans such as Fasciola hepatica and Fascioloides magna, whose cercariae also encyst on substrates and vegetation.

1.6. INFECTIVITY OF THE METACERCARIAL CYSTS TO VERTEBRATE HOSTS Z. lunata occurs naturally in a wide variety of animals. This digenean is frequently encountered in various species of waterfowl (Table 1.2) and mammals (Table 1.3). Parasite establishment, survival and fecundity are affected by host-related factors such as susceptibility, genetic strain and age. Numerous experimental studies with Z. lunata in domestic chicks have been conducted (Fried, 1970; Fried and Nelson, 1978; Fried and Gainsburg, 1979, 1980; Fried et al., 1978). Willey (1941) reported considerable variation in the growth of Z. lunata within hosts of the same species, depending on the number of individuals present. Hosts with few worms had larger parasites than hosts with many worms. Host– parasite relationships have been examined by Price (1928), Gower (1938a), Bacha (1960, 1964) and Huffman et al. (1991). Laboratory mice, rats and golden hamsters were fed metacercarial cysts of Z. lunata to examine infectivity, growth and survival of this trematode (Huffman et al., 1991). All three rodent types became infected with Z. lunata. Eggs of Z. lunata were seen in the faeces of the hamsters by day 21, in mice by day 26 and in rats by day 44. The body areas of sexually mature worms were similar in all three types of rodent species. Worms were recovered from the caecum in hamsters and mice and from the caecum and large intestine in rats. In older infections, parasites were located closer to the tip of the caecum than in younger infections. Hamsters demonstrated the greatest percentage of infection (31%), followed by rats (16.5%) and mice (13%). Z. lunata recovered from mallard ducks (A. platyrhynchos) at day 16 post-infection were not ovigerous. The percentage infection in the ducks was 29% (Huffman et al., 1991).

1.7. EPIZOOTIOLOGY OF ZYGOCOTYLE LUNATA H. trivolvis, one of the intermediate hosts for Z. lunata, ranges throughout North America, from arctic Canada to Florida, and has been introduced sporadically around the world. It is not well adapted to lotic waters, in the


15

southern Atlantic drainages being found primarily in lakes, ponds, swamps and the calmest areas of coastal rivers. It thrives in rich, eutrophic environments, and does not occur in especially acidic waters (Dillon, 2000). H. trivolvis (Gastropoda) snails from 10 lentic ecosystems in New Jersey, United States, were investigated on a seasonal basis from autumn 2003 to autumn 2004 for the presence of larval trematodes by Klockars et al. (2007). Prevalence data from the 10 study sites showed cercariae of Z. lunata from six sites (0.1–7.7%). Z. lunata was recorded in 1984 and 2006, during a long-term analysis of Charlie’s Pond in North Carolina from H. anceps (Negovetich and Esch, 2007). Schmidt and Fried (1997) reported Z. lunata from H. trivolvis from a farm pond in Pennsylvania, United States. The life cycle of Z. lunata is depicted in Figure 1.2. Z. lunata has a wide geographical distribution in Central America, Brazil, Asia and Africa (Sey, 1991). The distribution of Z. lunata can span large areas, because the definitive and intermediate host species live in a broad range of habitats and the definitive hosts may migrate over long distances. The geographical distribution of Z. lunata may be influenced by environmental conditions that affect the distribution of the intermediate hosts. These conditions include biotic variables, such as vegetation cover, and abiotic variables of the lentic environment, such as size, average depth, salinity and characteristics of the sediments. Annual migrations can disseminate avian trematodes and of special importance is the cross-migration and movement of birds following the breeding season and preceding the beginning of autumn migration. This can allow for widespread dissemination of these parasites over the breeding grounds as long as the intermediate hosts are present. Seasonal variation in parasite prevalence can be correlated with changing food habits of the migratory host, as well as the longevity of the adult trematode. Mallards (A. platyrhynchos), pintails (A. acuta) and American widgeons (A. americana) depend on native aquatic vegetation during the summer, but rely on waste grain and cultivated crops during autumn migration and on the wintering ground (Bellrose, 1976). This change in diet may result in the natural loss of Z. lunata as well as affecting the possibility of acquiring new infections (Shaw and Kocan, 1980). The dynamics of the intestinal helminth fauna of some anatids along a North American migratory route and the factors contributing to it were studied by Buscher (1965). Factors influencing the composition and distribution of the helminth fauna included physiological changes in the host corresponding with seasonal migration, age of the host, feeding habits of the host resulting directly from a change in climatic conditions and available food, and the complexity of the parasites lifecycle. Buscher (1965) found Z. lunata in ducks at the wintering grounds along the Gulf Coast and also in ducks arriving at the breeding area near Delta, Manitoba (Canada) in the spring, which may be a carry over from the wintering

16


grounds to the breeding area. Z. lunata is found in the caecum, a protected area of the intestinal tract, which may allow this digenean to remain with the hosts for prolonged periods. Individuals of Z. lunata survive in hosts for 2 years or more (Willey, 1941). The total region of parasite transport has been referred to as the parasite geographic range (PGR) and the total region where infection of the migratory bird host is known as the parasite infective geographic range (PIGR) (Canaris et al., 1981). Turner and Threlfall (1975) found only two specimens of Z. lunata in two of 87 green-winged teal (A. crecca) in eastern Canada; both infected birds were adults. Buscher (1965) reported a higher prevalence for Z. lunata in blue-winged teal (A. discors) collected in Manitoba in the spring than in the winter and he suggested that additional infections probably occurred during spring migration. Crichton and Welch (1972) also reported this parasite from adult and juvenile mallards (A. platyrhynchos) and pintails (A. acuta) in Manitoba. Gower (1938b) reported prevalences for Z. lunata from ducks collected near Augusta, Michigan (United States): spring (17.5%), summer (23%), autumn (4%) and winter (10%). It appears that the PIGR of this parasite extends from the nesting grounds in the north on to the wintering grounds. Geographic barriers may serve to isolate populations of animals, and affect host–parasite systems (Garvon et al., 2005). Migratory hosts, which cover large distances, utilize a mosaic of habitats, and ‘seed’ large areas with infective stages of helminth parasites. Garvon and Fedynich (2004) determined the influence of geographic separation on the helminth communities of blue-winged teal populations from different migratory corridors. The occurrence of Z. lunata in blue-winged teal (A. discors) from both corridors were attributed to the ability of helminths to infect a wide range of closely related waterfowl species, and co-occurring host species within the same migratory corridors that are contributing to the cumulative helminth infective pool.

1.8. PATHOLOGY OF ZYGOCOTYLE LUNATA 1.8.1. Invertebrate hosts The rediae of Z. lunata are found in the digestive and gonadal tissues of the snail intermediate hosts. Willey (1941) observed rediae throughout the snail except in the lumen of the intestines with the heaviest worm burden in the liver and gonads. Z. lunata infection of H. trivolvis produces an amebocytic infiltration in the host tissues (Fig. 1.3). Mechanical compression of digestive cells and lysing of cells also occurs (Fig. 1.4). The cells showed a loss of integrity and there was no rupturing of the tunica propria. Willey (1941) reported severe destruction of gonadal tissue resulting in apparent castration.


17

FIGURE 1.3 Z. lunata infection of H. trivolvis produces an amebocytic infiltration (a) in the host tissue.

FIGURE 1.4 Mechanical compression (mc) of digestive cells and lysing of cells caused by infection of Z. lunata in H. trivolvis.

1.8.2. Vertebrate hosts Z. lunata occurs in various species of waterfowl (Table 1.2). It has been reported from cattle, deer and moose (Samuel et al., 1976; Soulsby, 1965; Swanson, 1960) (Table 1.3). Z. lunata, as with other paramphistomid trematodes, lives in the posterior intestine (colon) or caecum of birds or mammals associated with freshwater habitats.

18


1.8.2.1. Clinical signs No overt sign of disease was noted in rats and hamsters infected with Z. lunata. No behavioural change was observed and the hair coat, appetite and faecal composition remained normal. Mice infected with six or more parasites experienced excessive thirst (polydypsia) (Huffman et al., 1991). George and Bolen (1975) reported no correlation between the parasite load and the physical condition of black-bellied whistling ducks (Dendrocygna autumnalis) in Southern Texas (United States). Z. lunata was not associated with clinical disease in wild turkeys (Meleagris gallopavo) (Davidson and Wentworth, 1992).

1.8.2.2. Gross pathology and histopathology Mortality from infection in domestic ducks was reported by Mettrick (1959). Cowan (1946) reported the death of a trumpeter swan (Cygnus buccinator) due to multiple parasitism. He recovered Z. lunata from the caecum. Z. lunata damages the caecal mucosa, feeds on caecal debris and inhibits the growth of the chick caecum (Fried and Nelson, 1978). The trematode produced overt damage to the caecal villus but did not have host blood in its intestinal caeca. The chronology of the pathological changes associated with Z. lunata is related to the development of the parasite in the definitive host. In ducks, rats and mice, physical damage is incurred at the site of attachment of the strong ventral sucker. The caeca of infected hosts differ in appearance from uninfected hosts ( Joyner and McDaniel, 1970). Gross observation of infected mouse caeca revealed copious liquid host faeces and raised reddened bullus of mucosal tissue at the sites of attachment of the worms. Histological observations indicated the presence of enlarged blood-swollen capillaries adjacent to the basal lamina and an abundance of non-granular and granular leucocytes. Reticular fibres were increased in both the lamina propria and sub-mucosa. The epithelium was modified from simple columnar at the apex of the attachment bulb to simple cuboidal laterally, and was absent in the area near the base. Mucosal glands appeared no less frequently but were abnormally stretched. The histological changes were progressive and their severity related to the age of the infection and the number of worms in the infection ( Joyner and McDaniel, 1970). At necropsy, the internal organs appeared normal, the caecum was visibly pitted and some parasites were visible through the serosal surface. In older infections parasites were located closer to the tip of the caecum than in younger infections. Raised reddened foci occurred at the site of parasite attachment in hamsters, mice and rats. The parasites adhered loosely to the host mucosal surface ( Joyner and McDaniel, 1970). Huffman et al. (1991)


19

reported that the internal organs of golden hamsters, mice and rats infected with Z. lunata appeared normal. The caecum was pitted visibly and some parasites were visible through the serosal surface. Raised reddened foci occurred at the site of parasite attachment in all hosts. The parasites adhered loosely to the host mucosal surface (Huffman et al., 1991). Out-bred (CD-1 strain) mice were infected experimentally with metacercariae of Z. lunata. Caeca of mice with infections of at least 4 weeks’ duration were enlarged with localized mucosal alteration at the site of parasite attachment, but there was no evidence of splenomegaly (Shostak et al., 1993). The histopathological changes that occurred were progressive, and severity was related to the age of the infection and the number of worms in the infection. The progressive changes were due to the chronic irritation caused by the parasite. The parasite produced an ulcer with a raised nodular margin. This area was infiltrated with lymphocytes. The vasculature in the surrounding area was congested. There was no indication of haemorrhage into the lumen of either the caecum or large intestine ( Joyner and McDaniel, 1970). The histopathological responses in hamsters, mice and rats infected with Z. lunata reported by Huffman et al. (1991) were similar to those reported by Joyner and McDaniel (1970).

1.9. IMMUNOLOGY OF ZYGOCOTYLE LUNATA IN THE VERTEBRATE HOST Limited research has been performed on the immune response of vertebrate hosts during Z. lunata infection. Wilhelmi (1940) used rabbits to generate anti-sera against the metacercariae and adult fluke of Z. lunata. Precipitin testing revealed that these two life stages were not serologically distinct. Willey (1941) reported immunity to Z. lunata during secondary infections of rats and ducks. Five ducks and three rats were infected with Z. lunata metacercariae and challenged with 50–150 metacercariae 6–261 days post-infection. After 4–28 days post-challenge, all subjects were necropsied and adult worms were counted and measured. The adults from the primary and challenge infections were differentiated based on the sizes of the trematodes. Adult worms from the challenge infection were only observed in one duck. The duck was accidentally exposed and only infected with a single adult before the challenge. All other subjects were infected with 2–144 adult trematodes before challenge. Willey (1941) concluded that immunity could be gained by exposure to a minimum of two adult trematodes after 6 days postinfection. Immature worms from the challenge infection were observed in the faeces of one of the rats 4 days post-infection. The expelled worms were 2 days old. Based on this observation, Willey (1941) concluded that

20


the host immune response must react to the challenge immediately after excystment. However, Fried and Gainsburg (1979) reported that domestic chicks were susceptible to re-infection with Z. lunata. They also reported that the percentage recovery of worms from the second infection (30%) was lower than the first (63%). This study also demonstrated a lower percentage of recovery with the superimposed infection. An established infection with Z. lunata in rats, hamsters and mice did not prevent a superimposed infection with this parasite (Huffman et al., 1991). The acquisition of apparent host immunity has been observed during infection with several species of the family Paramphistomidae (Boray 1959, 1969; Horak, 1967, 1971; Whitten, 1955). Paramphistomiasis occurs less frequently in older cattle and sheep compared to younger animals within the same herd (Boray, 1959, 1969). Boray (1969) also observed fewer adult Paramphistomum ichikawai is older than younger sheep. Whitten (1955) and Horak (1967) concluded that reduced paramphistomiasis in older cattle may be related to immunity gained through previous infection. Immunity to P. microbothrium has also been reported in domestic ruminants during laboratory trials (Horak, 1971). After initial infection, subjects were protected from severe infection and clinical symptoms after challenge. The worms that did infect hosts after challenge had reduced growth and migration (Horak, 1971). The immunity was dependent on metacercarial dose and adult worm survival (Horak, 1971). The mechanism of host immunity to Z. lunata and other paramphistomids is not clearly defined. Willey (1941) did not attempt to establish the effector mechanisms of the host immunity to Z. lunata. Work on other paramphistomids has indicated that cell-mediated immunity and/or humoural immunity may be involved in expulsion of worms. Histopathology of the intestines of infected ruminants showed significant infiltration of numerous cell types including macrophages, lymphocytes and eosinophils (Horak, 1971; Rolfe et al., 1994; Singh et al., 1984; Shostak et al., 1993). During schistosome infection, macrophages and eosinophils mediate antibody-dependent, cell-mediated cytotoxicity and lymphocytes are involved in immunoglobulin (Ig)E production and further eosinophil activation (Pearce and MacDonald, 2002). It is unknown whether these cell types play a similar role during paramphistomid infection. The role of increased macrophages and lymphocytes during paramphistomid infection has not been studied. Eosinophilia was reported in sheep experimentally infected with P. ichikawai and cell levels correlated with worm expulsion, but the exact role of eosinophils was not determined (Rolfe et al., 1994). Increased numbers of plasma cells have also been reported during paramphistomid infection (Boch et al., 1983; Rolfe et al., 1994). Antibodies to P. microbothrium have also been detected in the sera of sheep, goat and cattle after infection with adult trematodes (Horak, 1967). However, Horak (1967) observed immunity in cattle to P. microbothrium


21

even before increased mucosal plasma cells and circulating antibodies. The role of the secretory antibodies during paramphistomid infection remains unclear. The experimental observations of Willey (1941) indicate acquired immunity of vertebrate hosts to Z. lunata infection. The work on other paramphistomid spp. also supports this observation. Further research is required to understand the effector mechanisms of the host immune response to Z. lunata and other paramphistomids better. The data on the humoural immune response does support a role for secretory antibodies, but the observation by Horak (1967) of fluke expulsion before detectable antibody response indicates that other factors are involved. The role of eosinophils, lymphocytes, macrophages and other cellular mechanisms in the immune response and fluke expulsion requires particular attention. Another area of further research would be the role of various cytokines. The lack of research into the immune response of vertebrate hosts may be related to the perceived low clinical and economic importance of Z. lunata infection. The major vertebrate hosts of Z. lunata are wild birds and ruminants. Infection of domestic ruminants does occur but is associated with minor symptoms and no mortality. Further research into the host immune response to Z. lunata could provide valuable information on the immune mechanisms involved in parasite immunity and expulsion in a variety of intestinal trematodes.

1.10. DIAGNOSIS Analysis of metacercariae and adult stages of Z. lunata using precipitin testing, revealed that larval and adult antigens are not serologically distinct (Wilhelmi, 1940). Serological recapitulation does not occur since larval proteins are as well differentiated as those of the adult. Serological methods may be used to identify the larval stages of Z. lunata; both larval and adult stages of helminths could be used indiscriminately in making antigens either for diagnosis of helminthiasis or for establishing zoological relationships by serological methods (Wilhelmi, 1940). No antibody-based diagnostic test has been developed for Z. lunata. No molecular-based testing has been developed either. Z. lunata rarely infects the small or large intestine. The usual site of this digenean is the caecum. The diagnosis of a trematode infection may be based on the microscopic identification of eggs in stool samples. Willey (1941) has provided photomicrographs of Z. lunata eggs removed from host stools. Faecal samples should not be maintained longer than 72 h, and the faecal sample should be fixed in 10–15 volumes of 10% formalin. Z. lunata identification can be confirmed after fixing and staining adult worms using traditional morphological methods (Pritchard and Kruse, 1982).

22


1.11. TREATMENT AND CONTROL Treatment and control measures for avian trematodes are few, especially for free-range waterfowl. The only practical solution is to remove birds from the source of infection. Control measures could involve reduction of snail intermediate hosts through the use of molluscicides or by draining snail habitats.

1.12. ENCYSTMENT AND EXCYSTMENT Cercariae of Z. lunata encyst on various surfaces after their release from the first intermediate host snail. The encystment process, as described below, is based mainly on descriptions in various sources including Willey (1941), Berger (1957), and Peoples and Fried (2008). Cercariae emitted from planorbid snails, mainly species of Helisoma and Biomphalaria, encyst on the shells of aquatic invertebrates, mainly molluscs and crustaceans, vegetation and various inanimate objects (Peoples and Fried, 2008). Fried et al. (2008) showed that the cercariae of Z. lunata are also able to encyst on the surfaces of the ectosymbiont Chaetogaster limnaei associated with the first intermediate host snail in Pennsylvania (United States). The association is a loose one as the attachment is not firm; thus, C. limnaei is probably not an important mode of transmission of this digenean in the wild. Cercariae of Z. lunata exhibit positive phototactic behaviour prior to encystment and most cysts form on the walls of containers nearest a light source (Fried and Peoples, 2008; Willey, 1941). Upon contact with any surface such as the bottom or sides of the dish nearest the light source or the shell of an intermediate host, the larvae attach by their suckers and encystment occurs (Berger, 1957). During encystment, the cercariae attach by means of their suckers, the tail vibrates from side to side and the cercarial body undergoes rapid back and forth movements. Cystogenous material is released from glands on the dorsal surface of the cercarial body. The cyst walls form rapidly and the tail usually remains attached to the outside of the cyst wall, where it lashes violently for about 1 h prior to its release from the cyst. The tail sinks to the bottom of the vessel, and continues its lashing movements for several hours (Willey, 1941). This activity is probably associated with intrinsic glycogen stores in the tail. The body of the larva within the cyst helps mould the inner cyst wall by twisting and turning during the encystment process. The cyst walls then harden and the larva coils within the cyst and soon becomes relatively quiescent with suckers apposed; the larva may writhe periodically undergoing slight twitching and contractile movements (Willey, 1941). Peoples and Fried (2008) reported that


23

encystment usually began within 5 min after cercarial release from the snail and was concluded within 2 h. Berger (1957) reported a shorter time for the occurrence of the entire encystment process usually taking about 5–10 min. In a polar view, the cyst appears rough at the perimeter of the outer cyst layer, but smoother around the middle and inner cyst layers (Fig. 1.5). During encystment, excystation glands, described by Berger (1957) as elliptical rods on the periphery of the organism, empty their contents onto the surface of the organism. The secretory contents undergo chemical and physical changes upon release from the glands, and form small globules of fluid that soon coalesce to form a continuous covering on the surface of the organism, thus forming the cyst walls. Exact details of the mechanism remain unclear. The cysts are large, dome-shaped hemispheres with thick resistant cyst walls. The cyst appears brown to black because of the melanin in the body of the larva contained within (Fig. 1.5). The cercaria (Fig. 1.6) shows the darkened cercarial body due to the melanin pigment. The position of the larva within the cyst varies. In some cases, the metacercaria is stretched out with the oral sucker and acetabulum apposed (Fig. 1.7);

oc mc ic o

a L

FIGURE 1.5 Polar view of the Z. lunata metacercarial cyst. Note: The cyst appears rough at the perimeter of the outer cyst layer (oc), but smoother around the middle cyst (mc) and inner cyst (ic) layer (a, acetabulum, L, larva; o, oral sucker).

24


FIGURE 1.6 Z. lunata cercaria illustrating the darkened cercarial body (cb) due to melanin pigment. Note: T, tail.

FIGURE 1.7 Stretched out metacercaria of Z. lunata with the oral sucker (o) and acetabulum (a) apposed.


25

in other cysts, the larvae are on their sides (Fig. 1.5) their suckers sometimes adhering to each other (Berger, 1957). The larva within the cyst shows no morphological changes from the cercarial body when examined either 1 day or 20–30 days after encystment. Black pigment, presumably melanin, obscures the observations of most internal structures within the larva; the black pigmented larval eyespots (Fig. 1.8) seen within the cercarial body are retained in the adult worm for up to 3 weeks following worm development in the rat definitive host (Willey, 1941). Fried et al. (1978) described two distinct walls within the Z. lunata metacercarial cyst. The outer cyst wall flared out from the inner cyst wall, which was in close association with the outer wall except at the ventrolateral margin. The presence of a ventral lid on the inner cyst’s dorsal side was noted. This ventral lid was reported to serve as the site for the organism to emerge from during excystation (Fig. 1.9). Fried et al. (1978) performed histological observations on the two cyst layers, and found that the outer cyst wall was basophilic, stained lightly with protein stains, and periodic acid and Schiff’s reagent (PAS)-positive and diastase fast; the inner cyst wall was lightly eosinophilic, stained heavily with protein stains, and was lightly PAS-positive and diastase fast. The dome-shaped region, but not the ventral aspect of the outer wall, was alcian-blue positive. The inner wall was alcian-blue negative. Fried et al. (1978) found that oil

FIGURE 1.8 Black pigmented larval eye spots (es) seen within the cercarial body (cb) of Z. lunata. Note: ex, excretory concretions; o, oral sucker.

26


FIGURE 1.9

Ventral lid (vl) of the metacercarial cyst of Z. lunata.

red O (ORO) staining for neutral lipids was absent from both inner and outer walls and that melanin was detected only in the outer wall. Further studies using transmission electron microscopy (TEM) and histochemistry on the cyst layers of Z. lunata performed by Robbins et al. (1979) confirmed the presence of two generalized inner and outer cyst walls, but stated that both inner and outer cyst walls could be subdivided further into five layers. The outer wall, present in the dorsal and lateral regions, stained safranin-O positive and b-metachromatically with toluidine blue. The outer wall consisted of two layers, I and II; both layers were granular and contained cellular debris apparently trapped in the matrix during encystment. Layer II was in close association with the inner cyst and was more finely granular than layer I. The ventral aspect of the inner cyst of Z. lunata was thickened, stained intensely with Gomori’s trichrome and contained the ventral lid. The inner wall stained with mercuric bromphenol blue and fast green indicating that it was proteinaceous (Fried et al., 1978). TEM observations by Robbins et al. (1979) indicated that the inner cyst wall was lamellated. Whereas the lamellae in the dorsal and lateral aspects were fine, those in the ventral region were thick and dense. The ventral cyst wall contained two layers that were seen ultra-structurally and with differential staining. The outer layer (I) contacted the substratum, it was coarsely granular and electron dense. The inner layer (IV) extended laterally about halfway up the cyst and was thicker in the periphery of the cyst than under


27

the ventral lid. The inner layer did not react distinctly with any of the stains used. Layer IV was more finely granular and less electron dense than layer III. TEM observations on empty cysts following in vitro excystation showed only fragments of the ventral cyst, suggesting that this wall was partially digested during excystation. Willey (1941) first reported artificial digestion of the metacercarial cysts of Z. lunata with pepsin and pancreatin solutions at 37 C and suggested that the final host of this digenean was a warm-blooded animal. With this treatment, the cyst walls became soft and movement of the larva within the cyst was observed after 4 h. The larva within the cyst showed movements and the activity continued for up to 20 h during this treatment, although none of the larvae excysted. In vivo excystation occurred in definitive hosts within 15 h, as proved by Willey’s (1941) experimental feeding of cysts to rats. Willey (1941) also showed that cysts were immediately infective to definitive hosts as determined by experimental infections in rats. Based on studies by Berger (1957) on Z. lunata and Campbell and Todd (1956) on F. hepatica, when cysts of these species are ingested by snails, they pass through the digestive tracts and still retain their viability. Peoples and Fried (2008) studied cercarial tolerance of Z. lunata to adverse chemical and physical conditions and noted that encystment did not occur at 60 C, 80 C or 100 C at which temperatures the cercariae were killed; however, some cysts formed at temperatures of 16 C and 41 C and appeared normal. Willey (1941) found that encysted metacercariae were able to withstand freezing of the water around them for at least 15 h. Some cysts were still viable after 10 days of alternate freezing and thawing. Berger (1957) noted that cysts formed at room temperature (about 23 C) and then cooled to 4 C were viable after 4 days of storage at this temperature. Berger (1957) also noted that cysts formed at room temperature and then cooled to –5 C were non-viable after 4 days of storage at this temperature. Peoples and Fried (2008) showed that cercariae were unable to form cysts at 4 C but upon warming cercariae to room temperature after 24 h of storage at 4 C, these larvae were able to encyst. Encysted metacercariae were unable to withstand prolonged desiccation with some remaining alive after 24 h of desiccation but none were alive after 48 h of desiccation as first noted by Willey (1941). Berger (1957) reported similar findings with regard to prolonged desiccation of the cysts of Z. lunata. Encystment occurred more rapidly in a minimal volume of water (Peoples and Fried, 2008; Willey, 1941), as small as a single drop (4 ml) as noted by Peoples and Fried (2008). Tests on cercarial encystment showed that cercariae preferred to encyst on a smooth rather than a rough glass surface. Cercariae encysted on spike rush (Eleocharis acicularis), plastic Petri dishes, Saran wrap (used for wrapping food), snail mucous, as well as under the physical and chemical conditions (see tables 1 and 2 in Peoples

28


and Fried, 2008). Contrary to what was reported by Berger (1957), encystment did not occur on lettuce in the study of Peoples and Fried (2008). Peoples and Fried (2008) were not able to obtain cercarial encystment of Z. lunata on Elodea spp., maple leaves (Acer spp.), snail faeces, paper towel or filter paper. Measurements reported in Peoples and Fried (2008) showed that the length and width of cysts became less similar to one another as the tonicity of the solution surrounding the cercaria at the time of encystment increased. Cyst length was only 0.8% greater than width for cysts formed in artificial spring water (ASW) (see table 4 in Peoples and Fried, 2008). Length and width measurements on cysts formed in Locke’s 1:1 were less similar to one another with the length greater than the width by 4.4%. Cysts formed in Locke’s full strength showed the greatest difference in length and width measurements with the length being 8.0% greater than the width. Cysts formed in hypertonic media, such as 0.85% NaCl (saline), often retained their cercarial tails for 24–48 h. For cysts formed in ASW, following treatment with an artificial trypsin-bile salts-cysteine (TBC) medium of Saxton et al. (2008), excystation usually occurred when the larva emerged from the open ventral lid associated with the inner cyst (Fig. 1.10). However, cysts formed in hypertonic media were found to excyst spontaneously through any surface of the cyst and did not exit through the ventral lid during excystation. These excysted metacercariae often possessed cystogenous granules

FIGURE 1.10 Larva (l) of Z. lunata emerging from the open ventral lid associated with the inner cyst. Note: o, oral sucker.


29

attached to the surface of their teguments. Other than that, they appeared identical to the metacercariae chemically excysted by Saxton et al. (2008) using the TBC medium described in that paper. Metacercercariae spontaneously excysted in hypertonic saline solutions were usually found in groups, with each organism within 0.1 mm from one another (Fig. 1.11), at the bottom of the Stender dish, showing the probability of wormmediated chemo-attraction as suggested by Fried (1986) who studied chemo-attraction in larval and adult digeneans. Metacercariae of Z. lunata that spontaneously excysted in hypertonic saline solution remained alive and active for up to 3 days. Peoples and Fried (2008) reported that in vitro excystment of Z. lunata cysts may be associated with ion content of the solution containing the encysted metacercariae. When KCl, CaCl2 or NaHCO3 ions were excluded from the Locke’s solution, both encystation and excystation still occurred. When NaCl was excluded from Locke’s, encystment occurred, but excystment did not, indicating that excystment behaviour in Z. lunata is either directly linked to NaCl or the overall tonicity of the solution. Further investigations are needed to determine how certain ions affect encystment and excystment of this organism. Cysts formed in ASW do not excyst spontaneously and need combined treatment with digestive enzymes, bile salts and/or reductants (Fried et al., 1978; Irwin et al., 1993; Saxton et al., 2008). In a three-step procedure, Fried et al. (1978) pre-treated cysts of Z. lunata with acidified pepsin for 15 min followed by 1–2 min in 0.02-M sodium dithionite reductant. Cysts were then transferred to an excystation medium containing 1% sodium glycocholate plus 1% trypsin in Earle’s balanced salt solution (BSS) adjusted to pH 8.8 with tris buffer and were maintained at 41 C for 2 h. Optimal in vitro excystation using this medium was reported at 80%. Irwin et al. (1993) used 5 ml of bicarbonate saline (0.8% w/v sodium chloride and 1.5%

FIGURE 1.11 Larvae (L) of Z. lunata in close contact. Note: e, eye spots; a, acetabulum; o, oral sucker; cm, cast of the metacercarial cyst.

30


w/v sodium bicarbonate) containing 0.8% (w/v) sodium taurocholate and 0.3% (w/v) trypsin to which an equal amount of 0.02-M hydrochloric acid containing 0.8% (w/v) L-cysteine had been added just before its use and reported 70–80% excystment using this medium. When sodium cholate crude ox-bile extract was used instead of the usual sodium taurocholate, 100% excystment was reported by Irwin et al. (1993). Peoples and Fried (2008) used an artificial TBC excystation medium following pre-treatment in acidified pepsin on metacercarial cysts of Z. lunata with optimal excystation in the 40–50% range. This TBC medium was described previously in Saxton and Fried (2008) for the successful chemical excystation of two species of Echinostoma. Instructions for preparation of the medium were based on the A and B solutions of Irwin et al. (1984) and Irwin (1997). The bile salts (lot no. 0806) and trypsin 1-250 (lot no. R14459) were purchased from ICN Pharmaceuticals (Costa Mesa, California, United States), and L-cysteine (lot no. 1265042) was purchased from Sigma-Aldrich (St. Louis, Missouri, United States). To prepare solution A, 40 mg of bile and 15 mg of trypsin were added to 5 ml of a NaCl/NaHCO3 solution. The NaCl/NaHCO3 solution was prepared using 40 mg of NaCl and 75 mg of NaHCO3 that were added to 5 ml of de-ionized water. To prepare a batch of solution B, 40 mg of L-cysteine was added to 5 ml of 0.05-M HCl. Solutions A and B were mixed together in a 1:1 ratio just prior to use. Irwin et al. (1993) reported optimal excystation results (approaching 100%) using their TBC excystation medium following pre-treatment in acidified pepsin. They also reported reasonably good excystation of Z. lunata in the absence of either trypsin or bile salts. In our studies (Fried and Peoples, personal communication) we have not been able to obtain excystation of Z. lunata without the use of both trypsin and bile salts in the medium. Irwin et al. (1993) did not indicate the source of trypsin used in their study. It is known that impurities in trypsin and bile salts often aid in the excystation process of digeneans. Differences in the two studies probably reflect differences either in the source of the cysts or different chemical batches used in these two studies.

1.13. ULTRA-STRUCTURE Irwin et al. (1991) used scanning electron microscopy (SEM) and TEM to examine the tegument of excysted metacercariae and adults of Z. lunata. As noted for studies on other paramphistomids, Z. lunata lacks spines and mitochondria in the tegumentary syncytium and associated cytons. The newly excysted metacercariae, which possesses relatively few tegumental papillae, are cylindrical compared to adults, which were flat. Adults have large numbers of tegumental papillae in the region of the oral sucker and acetabulum.


31

Irwin and Fried (1994) used SEM to study the adults of Z. lunata. SEM revealed a distinct concentration of tegumental papillae in the lumen of the posterior of the buccal mass. The papillae were dome shaped and varied in size, each possessing a single short cilium, and were largely limited to a distinct ridge that encircled the pharynx. The authors speculated on the possible role of these receptors in alimentation and gustation of this digenean. Fujino et al. (1995) used cytochemical localization studies to examine cytochrome-c oxidase in the mitochondria of the tegumental and parenchymal cells in Echinostoma trivolvis, Z. lunata, S. mansoni, F. gigantica, and Paragonimus ohirai, trematodes that inhabit different sites in their vertebrate hosts. Clear differences in enzymes occurred in the mitochondria of these species, probably reflecting the different energy metabolisms of these worms. Marked aerobic metabolism occurred in S. mansoni and P. ohirai adults that inhabit the host mesenteric veins and the lungs, respectively. The tegument and parenchymal cells of S. mansoni possess relatively few, small mitochondria with tubular cristae that are heavily reactive for cytochrome-c oxidase. In P. ohirai, the activity for cytochromec oxidase in tegumental mitochondria increased gradually from juveniles to adults, indicating that the respiratory activity increased with growth and the aerobic metabolism was activated when the worms reached the lungs. P. ohirai juveniles and adults had two types of mitochondria with different shapes and enzyme activities that were located in two different types of parenchymal cells. The intestinal species, E. trivolvis, had mitochondria in the basal aspect of the tegument and some variations in enzyme activity of their mitochondria in the tegumental and parenchymal cells were observed, suggesting that they possess both aerobic and anaerobic metabolic systems. Z. lunata that live in rodent caeca are devoid of mitochondria in the tegument and have many characteristic mitochondria with undeveloped cristae in the parenchymal cells. Mitochondria of F. gigantica showed weak or no activity for cytochrome-c oxidase, suggesting that the worm is well adapted to an anaerobic environment in the host bile duct.

1.14. DEVELOPMENT ON THE CHICK CHORIOALLANTOIS Fried and Nelson (1978) grew the excysted metacercariae of Z. lunata on the chick chorioallantois. Post-metacercarial development was obtained when excysted metacercariae were placed on 10-day-old chick chorioallantoic membranes and maintained there for 5 days at either 39 C or 41 C. These worms were comparable in size and development to those grown in the caecum of domestic chicks for 5 days. Worms were either attached to the chorionic ectoderm by their acetabulum or were free in a lesion on the surface of the chorioallantois. The use of the chorioallantoic

32


technique will be useful to study feeding, behaviour and pathology of this fluke in an ectopic site.

1.15. BEHAVIOUR Nollen (1994) grew Z. lunata in mice; he removed the worms at necropsy, treated them in vitro with 3H-adenosine to label sperm and then transplanted the worms to the caecum of new mice singly or with six to eight unlabelled adults. After 6–10 days, worms were recovered, processed for auto-radiography and observed for radioactive sperm in their seminal receptacles. Adults would not incorporate radioactive thymidine into dividing cells. Tyrosine was utilized only by juvenile worms and then not enough to label germinal cells for mating studies. Four (31%) of 13 worms transplanted singly self-inseminated, whereas nine (90%) of 10 labelled worms in multiple infections self-inseminated. When in groups, the labelled worms cross-inseminated with 14 (33%) of 43 unlabelled worms. This mating pattern was unrestricted in that both self- and cross-insemination took place in multiple infections, much like the mating pattern of other paramphistomids studied. Reddy and Fried (1997) used Z. lunata larvae and other digeneans to examine worm-mediated chemo-attraction in vitro. In vitro pairing studies on rediae of E. trivolvis, E. caproni, Z. lunata, and Ribeiroia ondatra and sporocysts from a species of armatae cercaria were undertaken at 22 C in a Petri dish bioassay containing an agar substratum and a Locke’s 1:1 overlay. Pairing was defined as larvae in contact or within 1 mm of each other. Intra-specific and inter-specific pairing occurred in the bioassay using several larval combinations initially placed 5–10 mm apart. Intraspecific pairing occurred with the rediae of R. ondatra and inter-specific pairing was seen between E. trivolvis or E. caproni and R. ondatra. Intraspecific and inter-specific pairing between rediae of E. trivolvis and E. caproni had been described previously. Armatae sporocysts did not pair intra-specifically or inter-specifically when matched with either E. caproni or E. trivolvis rediae. Intra-specific pairing of Z. lunata or interspecific pairing between Z. lunata rediae and echinostome rediae did not occur. The significance of redial pairing remains unclear but does indicate that worm-mediated chemo-attraction occurs in the larval stages.

1.16. BIOCHEMISTRY Fried et al. (1998) used thin-layer chromatography (TLC) and histochemistry to study neutral lipids in the digestive gland gonad (DGG) complex of H. trivolvis infected with four species of larval trematodes. Two of the


33

species, R. ondatra and Z. lunata, contained rediae, and the two others, Spirorchis sp. and an armatae xiphidiocercaria, contained sporocysts. The DGG infected by each species had its own distinct neutral lipid profile as determined by TLC. All profiles differed from that of the uninfected DGG. Densitometric TLC studies showed some quantitative differences in free sterols in infected versus uninfected DGGs. Visual observations of the chromatograms showed that all four species caused a marked elevation in the triacylglycerol fraction in the DGG as compared with the uninfected controls. ORO histochemistry studies showed that levels of neutral lipids were increased in the DGGs of infected versus uninfected samples. These histochemistry studies showed a variable distribution of neutral fat, ranging from its absence in the cercaria of Z. lunata and the armatae xiphidiocercaria to ORO-positive droplets in the excretory system of R. ondatra. Rediae and sporocysts contained ORO-positive material in the body wall and in the space between cercariae. Lee et al. (1998) used high-performance thin-layer chromatography (HPTLC) to determine chemotaxonomic differences between the neutral lipid content of three trematode species: E. caproni, E. trivolvis and Z. lunata. Visual observations of the chromatograms showed some differences between both the major and minor neutral lipids present in the adults of these worms. Densitometric quantitative analysis showed significant differences between the triacylglycerol content of E. caproni and Z. lunata, and between that of E. caproni and E. trivolvis, but not between the sterol content of any of the species. An important finding of this study is that TLC can be used to distinguish chemotaxonomic differences between trematode species. Lee et al. (1999) used HPTLC to determine neutral lipids in the caecal contents and mucosa of domestic chicks and ICR mice, and in the caecal mucosa of chicks infected with Z. lunata. Silica gel plates were developed with a mobile phase of petroleum ether–diethyl ether–acetic acid (80:20:1), and neutral lipids were detected using phosphomolybdic acid reagent. The cholesteryl ester fraction was quantified by HPTLCdensitometry. HPTLC analyses showed differences in the neutral lipid composition of the caecal contents of ICR mice. There were differences in neutral lipid profiles between the uninfected caecal mucosa of chicks and chick caecal mucosa infected with Z. lunata. These findings showed that Z. lunata can alter the neutral lipid composition of the host caecal mucosa. Further studies are needed on metabolic profiling of Z. lunata adults in rodent hosts, as done recently by Vasta et al. (2008) on E. caproni. Marsit et al. (2000) used HPTLC to analyze the neutral lipids of rediae, cercariae and encysted metacercariae of Z. lunata. Visual observations of the chromatograms showed that the most abundant lipid fractions were free sterols and free fatty acids in all larval stages and triacylglycerols in the metacercariae and rediae. The weight of free sterols (mean standard

34


error of the mean) was 120 20 ng/cercaria, 56 3.8 ng/redia and 5.9 1.5 ng/encysted metacercaria; the weight of triacylglycerols was not detectable in the cercaria, 6.3 0.06 ng/redia, and 13 0.88 ng/encysted metacercariae; and the weight of free fatty acids was 160 17 ng/cercaria, 76 9.1 ng/redia and 4.2 0.46 ng/encysted metacercaria. ORO staining of whole larvae showed the presence of neutral lipids in the rediae but not in the cercariae or encysted metacercariae. A dramatic reduction was seen in the quantity of free sterols and free fatty acids in the encysted metacercariae as compared with the cercariae, suggesting that these neutral lipids are used during transformation from cercaria to metacercaria.

1.17. ECOLOGY Shostak et al. (1993) used a CD-1 strain of mice for experimental infections with metacercariae of Z. lunata obtained from naturally infected H. trivolvis. Growth, survival and fecundity of this digenean in the host were evaluated. Metacercariae from five snail sources produced three patterns of growth and survival: significantly smaller worms that survived less than 4 weeks and did not mature, significantly larger worms that matured but survived less than 6 weeks, and worms of intermediate size that matured and lived at least 19 weeks. Parasite maturation and egg production were similar among infections from the different sources. Caeca of mice with infections of at least 4 weeks old were enlarged with localized mucosal alteration at the site of worm attachment. The differences in infection due to the source of metacercariae within a single final mouse host were similar to differences reported among other species in final hosts. These results suggest that variation associated with the intermediate host may confound studies of specificity to the definitive host. Unpublished observations by Fried and Peoples have noted that different sources of Z. lunata metacercariae can be a factor in the ability to obtain successful chemical excystation in studies on this digenean. Ferrell et al. (2001) tested the energy limitation hypothesis (ELH) by predicting that temperature would have a significant influence on the infectivity of encysted metacercariae of Z. lunata. Snails infected with Z. lunata were collected from ponds in Indiana (United States), isolated at room temperature and examined for the release of cercariae. Newly encysted metacercariae were collected and incubated for 1–30 days at one of five temperatures (0 C, 3 C, 25 C, 31 C and 37 C). Twenty-five cysts were fed to each of five or 10 mice per treatment group. At 17 days’ postinfection, mice were killed, worms were recovered and data were collected on levels of infection in each group and the total body area of each worm. No worms were found in mice fed cysts that had been held at 0 C


35

or 37 C for 30 days. There were no differences in prevalence, infectivity or mean intensity among the 3 C, 25 C and 31 C treatments. Infectivity of metacercariae incubated at 37 C for 1 day was significantly greater than in all other treatments, while infectivity of metacercariae at 37 C for 15 days of treatment was significantly lower than in all others. Mean body area of worms at 37 C for 15 days was significantly greater than at other temperatures, suggesting density-dependent increases in growth. These results, particularly those from the 37 C treatments, are consistent with the ELH; infectivity was lower at high temperatures or when incubated for more time at one temperature. The authors suggested that microhabitat conditions experienced by metacercariae of Z. lunata could contribute to longer larval life, thus influencing this parasite’s temporal dispersal. Fried et al. (2008) collected H. trivolvis snails from a lake in Warren County (New Jersey, United States), in June 2007. These snails possessed the ectosymbiont C. limnaei (Annelida). Some of these snails were also infected with larval stages of Z. lunata. C. limnaei associated with the infected snails fed on the cercariae of Z. lunata. These cercariae were observed in the stomach of C. limnaei (Fig. 1.12) and whole cercariae were loosely attached to the ventral surface of the chaetogasters. Cercariae in the stomachs were digested within 48 h and probably served as a source of nutrients for the annelids. The protective action of the chaetogasters on the transmission of cercariae of Z. lunata to new hosts in the wild needs further study.

FIGURE 1.12

Z. lunata cercaria in the stomach of C. limnaei.

36


1.18. CONCLUDING REMARKS AND FUTURE PROSPECTS It is our hope that this review will stimulate future work on the caecal paramphistomid Z. lunata. This review and the excellent paper by Willey (1941) should provide sufficient background for scientists to explore research topics form the molecule to the community as related to this interesting digenean. Most topics covered in all of the sections of this chapter need further work and there are no documented references on molecular studies done with this organism. This trematode can be found on an almost global basis in the wild from such hosts as ducks and numerous ruminants. The intra-molluscan stages are easy to obtain in snails of the genera, Helisoma and Biomphalaria. Cercariae released from naturally infected snails form large, dark cysts on the inner surfaces of the glass in the vessels in which the snails are kept. These cysts can be scraped from the glass and stored in saline for more than 1 year and still retain their infectivity to various convenient laboratory hosts such as mice, rats, hamsters and domestic chicks. Hence, this is a convenient parasite to maintain in the laboratory. Furthermore, chemically excysted metacercariae can be grown on the chick chorioallantois. Hence, scientists should be able to maintain this organism in the laboratory for their own experimental purposes. Finally, Fried would like to pay tribute to the memory of Dr. Charles H. Willey, the author of the excellent monograph on Z. lunata published in Zoologica in 1941. This monograph touches on many of the topics mentioned in our review. Fried was fortunate to have had Professor Willey as a laboratory instructor in biology at New York University (NYU) in the early 1950s and was introduced to the biology of trematodes by this gifted scientist. Dr. Willey was on the same staff in the Biology Department at NYU with the great American parasitologist Dr Horace W. Stunkard, who also published articles on the biology of Z. lunata.

REFERENCES Ahern, W.B., Schmidt, G.D., 1976. Parasitic helminths of the American avocet Recurvirostra americana; four new species of the families Hymenolepididae and Acoleidae (Cestoda: Cyclophyllidae). Parasitology 73, 381–389. Bacha, W.J., 1960. An experimental study of the caecal trematode Zygocotyle lunata in the white rat with respect to host resistance, excystation and transplantation. Dissert. Abstr. 20, 3028. Bacha, W.J., 1964. Effect of salt solutions on establishment of infections of trematode. Zygocotyle lunata in white rats. J. Parasitol. 50, 546–548. Bellrose, F.C., 1976. Ducks, geese and swans of North America. Stackpole Books, Harrisburg, PA, p. 543. Berger, H., 1957. The Morphology and Development of Redial and Cercarial Stages of Zygocotyle lunata [master’s thesis]. New York University.


37

Boch, J., Schmid, K., Ruckrich, H.U., Erich, E., Keller, B., Weiland, G., et al., 1983. Stomach fluke (Paramphistomum cervi) infection of ruminants. Berl. Munch. Tierarztl. Wochenschr. 96, 338–346. Boray, J.C., 1959. Studies on intestinal amphistomiasis in cattle. Aust. Vet. J. 35, 282–287. Boray, J.C., 1969. Studies on intestinal paramphistomosis in sheep due to Paramphistomum ichikawai, Fukui, 1922. Vet. Med. Rev. 4, 290–308. Broderson, D., Canaris, A.G., Bristol, J.R., 1977. Parasites of waterfowl from Southwest Texas: II. The shoveler, Anas clypeata. J. Wildl. Dis. 13, 435–439. Buscher, H.N., 1965. Dynamics of the intestinal fauna in three species of ducks. J. Wildl. Manag. 29, 772–781. Campbell, W.C., Todd, A.C., 1956. Emission of cercariae and metacercariae in snail feces. Trans. Amer. Micro. Soc. 75, 241–243. Canaris, G., Mena, A.C., Bristol, J.R., 1981. Parasites of waterfowl from Southwest Texas: 111. The green-winged teal, Anas mecca. J. Wildl. Dis. 17, 57–64. Cowan, I.McT., 1946. Death of a trumpeter swan from multiple parasitism. AUK 63, 248–249. Crichton, V.F.J., Welch, H.E., 1972. Helminths from the digestive tracts of mallards and pintails in the Delta Marsh, Manitoba. Can. J. Zoo. 50, 633–637. Davidson, W.R., Wentworth, E.J., 1992. Population influences: Diseases and parasites. In: Dickson, (Ed.), The Wild Turkey Biology and Management, Stackpole Books, Harrisburg, PA, pp. 101–118. Dawes, B., 1946. The Trematoda. Cambridge University Press, Cambridge, United Kingdom. Deblock, S., Rausch, R.L., 1968. Dis Aploparaksis (Cestoda) de Charadriiformes d’Alaska, et quelques autres d’ailleurs. Ann. Parasitol. 43, 429–448. Diesing, K.M., 1836. Monographie der gattungen Amphistoma und Diplodiscus. Mus. Naturg. 1, 235–260. Digiani, M.C., 1997. El cisne de cuello negro Cygnus melancorypha: Nuevo hospedador de Zygocotyle lunata (Diesing) (Trematoda: Paramphistomatidae). Neotropica 43, 84. Dillion, R.T., 2000. The Ecology of Freshwater Molluscs. Cambridge University Press, Cambridge, United Kingdom. Drobney, R.D., Train, C.T., Fredrickson, L.H., 1983. Dynamics of the platyhelminth fauna of wood ducks in relation to food habits and reproductive state. J. Parasitol. 69, 375–380. Dronen, N.O., Badley, J.E., 1979. Helminths of shorebirds from the Texas Gulfcoast. I. Digenetic trematodes from the long-billed curlew, Numenius americanus. J. Parasitol. 65, 645–649. Dronen, N.O., Lindsey, J.R., Ross, L.M., Krise, G.M., 1994. Helminths from mallard ducks, Anas platyrhynchos, wintering in the post-oak savannah of Southcentral Texas. Southwest. Nat. 39, 203–205. Etges, F.J., 1992. Zygocotyle lunata, laboratory maintenance in snails and mice. J. Helminthol. Soc. Wash. 59, 22–24. Ewart, M.J., McLaughlin, J.D., 1990. Helminths from spring and fall migrant bufflehead ducks (Bucephala albeola) at Delta, Manitoba, Canada. Can. J. Zool. 68, 2230–2233. Farias, J.D., Canaris, A.G., 1986. Gastrointestinal helminthes of the Mexican duck (Anas platyrhynchos diazi) from north central Mexico and southwestern United States. J. Wildl. Dis. 22, 51–54. Ferrell, D.L., Negovetich, N.L., Wetzel, E.J., 2001. The effect of temperature on the infectivity of metacercariae of Zygocotyle lunata (Digenea: Paramphistomidae). J. Parasitol. 87, 10–13. Fried, B., 1970. Infectivity, growth, development, excystation, and transplantation of Zygocotyle lunata (Trematoda) in the chick. J. Parasitol. 56, 44–47. Fried, B., 1986. Chemical communication in hermaphroditic digenetic trematodes. J. Chem. Eco. 12, 1659–1677. Fried, B., Nelson, P.D., 1978. Host–parasite relationships of Zygocotyle lunata (Trematoda) in the domestic chick. Parasitology 77, 49–55.

38


Fried, B., Gainsburg, D.M., 1979. Reinfection of domestic chicks with Zygocotyle lunata (Trematoda). Proc. Helminthol. Soc. Wash. 46, 277–278. Fried, B., Gainsburg, D.M., 1980. Concurrent infections of cecal trematods, Zygocotyle lunata, and Notocotylus sp., in the domestic chick and observations on host–parasite relationships of Notocotylus sp. J. Parasitol. 66, 502–505. Fried, B., Robbins, S.H., Nelson, P.D., 1978. In vivo and in vitro excystation of Zygocotyle lunata (Trematoda) metacercariae and histochemical observations on the cyst. J. Parasitol. 64, 395–397. Fried, B., Frazer, B.A., Lee, M.S., Sherma, J., 1998. Thin-layer chromatography and histochemistry analyses of neutral lipids in Helisoma trivolvis infected with four species of larval trematodes. Parasitol. Res. 84, 369–373. Fried, B., Peoples, R.C., Saxton, T.M., Huffman, J.E., 2008. The association of Zygocotyle lunata and Echinostoma trivolvis with Chaetogaster limnaei, an ectosymbiont of Helisoma trivolvis. J. Parasitol. 94, 553–554. Fujino, T., Fried, B., Takamiya, S., 1995. Cytochemical localization of cytochrome C oxidase activity in mitochondria in the tegument and tegumental and parenchymal cells of the trematodes Echinostoma trivolvis, Zygocotyle lunata, Schistosoma mansoni, Fasciola gigantica and Paragonimus ohirai. J. Helminthol. 69, 195–201. Garvon, J.M., Fedynich, A.M., 2004. Influence of host habitat on the helminth communities in blue-winged teal birds. Proc. Am. Assoc. Zoo Vet. 149. Garvon, J.M., Pence, D.B., Fedynich, D.B., 2005. Biogeographic diversity in helminth communities of blue-winged teal. In: Fedynich, (Ed.), Current Research 2004–2005, Caesar Kleberg Wildlife Research Institute, Texas A&M University, Kingsville, TX, p. 86. George, R.R., Bolen, E.G., 1975. Endoparasites of black-bellied whistling ducks in Southern Texas. J. Wildl. Dis. 11, 17–22. Gower, W.C., 1938a. Studies on the trematode parasites of ducks in Michigan with special reference to the mallard. Mich. Agr. Exp. Station Memoir. 3, 1–94. Gower, W.C., 1938b. Seasonal abundance of some parasites in wild ducks. J. Wildl. Manag. 2, 223–232. Greiner, E.C., 1972. Parasites of Nebraska pheasants. J. Wildl. Dis. 8, 203–206. Hoeve, J., Joachim, D.G., Addison, E.M., 1988. Parasites of moose (Alces alces) from an agricultural area of eastern Ontario. J. Wildl. Dis. 24, 371–374. Hoeve, J., Scott, M.E., 1988. Ecological studies on Cyathocotyle bushiensis (Digenea) and Sphaeridiotrema globulus (Digenea), possible pathogens of dabbling ducks in southern Quebec. J. Wildl. Dis. 24, 407–412. Horak, I.G., 1967. Host parasite relationships of Paramphistomum microbothrium in experimentally infected ruminants with particular reference to sheep. Ondestepoort J. Vet. Res. 34, 451–540. Horak, I.G., 1971. Paramphistomiasis of domestic ruminants. Adv. Parasitol. 9, 33–70. Huffman, J.E., Sabol, C., Fried, B., 1991. Infectivity, growth, survival, and pathogenicity of Zygocotyle lunata (Trematoda) in experimental rodent hosts. J. Parasitol. 77, 280–284. Irwin, S.W.B., 1997. Excystation and cultivation of trematodes. In: B. Fried, T. K. Gracyzk, (Eds.), Advances in Trematode Biology, CRC Press, New York, pp. 57–85. Irwin, S.W.B., McKerr, G., Judge, B.C., Moran, I., 1984. Studies on metacercarial excystment in Himasthla leptosoma (Trematoda: Echinostomatidae) and newly emerged metacercariae. Int. J. Parasitol. 4, 415–421. Irwin, S.W.B., McCloughlin, T.J., Fried, B., 1991. Scanning and transmission electron microscopical observations of the tegument of excysted metacercariae and adults of Zygocotyle lunata. J. Helminth. 65, 270–274. Irwin, S.W.B., O’Kane, M.B., Fried, B., 1993. Physico-chemical conditions necessary for the in vitro excystment of Zygocotyle lunata (Trematoda: Paramphistomatidae). Parasitol. Res. 79, 416–420.


39

Irwin, S.W.B., Fried, B., 1994. A concentration of tegumental papillae in the pharynx of Zygocotyle lunata (Trematoda, Paramphistomidae). Parasitol. Res. 80, 170–172. Jones, A., 2005. Family Zygocotylidae. In: A. Jones, R.A. Bray, D.I. Gibson, (Eds.), Keys to the TrematodaVol. 2, CABI Publishing Co., London, United Kingdom, pp. 353–356. Joyner, S., McDaniel, J.S., 1970. Histological observations on mice infected with Zygocotyle lunata. J. Elisha Mitchell Soc. 86, 184. Klockars, J., Huffman, J.E., Fried, B., 2007. Survey of seasonal trematode infections in Helisoma trivolvis (Gastropoda) from lentic ecosystems in New Jersey, U.S.A. Comp. Parasitol. 74, 75–80. Lee, M.S., Fried, B., Sherma, J., 1998. HPTLC determination of neutral lipids in Echinostoma caproni, Echinostoma trivolvis, and Zygocotyle lunata (Platyhelminthes: Trematoda). J. Plan. Chromatog. Mod. TLC. 11, 105–107. Lee, M.S., Fried, B., Sherma, J., 1999. HPTLC analysis of neutral lipids in the ceca of mice and chicks, and in the chick ceca infected with Zygocotyle lunata (Trematoda). J. Liq. Chromatog. Rel. Tech. 119–124. Marsit, C.J., Fried, B., Sherma, J., 2000. Neutral lipids in cercariae, encysted metacercariae, and rediae of Zygocotyle lunata. J. Parasitol. 86, 1162–1163. Maxfield, B.G., Reid, W.M., Hayes, F.A., 1963. Gastrointestinal helminths from turkeys in Southeastern United States. J. Wildl. Manag. 27, 261–271. Mayberry, L.F., Canaris, A.G., Bristol, J.R., Gardner, S.L., 2000. Bibliography of parasites and vertebrate hosts in Arizona, New Mexico and Texas (1893–1984). Available online at: http:// www.museum.unl.edu/research/parasitology/UTEP-UNL/utep.pdf (last accessed 26 March 2009). McDonald, M.E., 1981. ‘‘Key to Trematodes Reported in Waterfowl’’. Resource publication 142, United States Department of the Interior, U.S. Fish and Wildlife Service, Washington, DC. Mettrick, D.F., 1959. Zygocotyle lunata. A re-description of Zygocotyle lunata (Diesing, 1836) Stunkard, from Anas platyrhynchos domesticus in southern Rhodesia. Rhod. Agric. J. 56, 197–198. Murrell, K.D., 1965. Stages in life cycle of Wardius zibethicus Barker 1915. J. Parasitol. 51, 600–604. Negovetich, N.J., Esch, G.W., 2007. Long-term analysis of Charlie’s Pond: Fecundity and trematode communities of Helisoma anceps. J. Parasitol. 93, 1311–1318. Nollen, P.M., 1994. The mating behaviour of Zygocotyle lunata adults grown in mice. J. Helminthol. 68, 327–329. Ostrowski de Nunez, M., Spatz, L., Gonzalez Cappa, S.M., 2003. New intermediate hosts in the life cycle of Zygocotyle lunata in South America. J. Parasitol. 89, 193–194. Paraense, L.W., 1976. A natural population of Helisoma duryi in Brazil. Malacologia 15, 369–376. Pearce, E.J., MacDonald, A.S., 2002. The immunobiology of schistosomiasis. Nat. Rev. Immunol. 2, 499–511. Peoples, R.C., Fried, B., 2008. The effects of various chemical and physical factors on encystment and excystment of Zygocotyle lunata. Parasitol. Res. 103, 669–671. Price, E.W., 1928. The host relationships of the trematode genus Zygocotyle. J. Agr. Res. 36, 911–914. Pritchard, M.H., Kruse, G.O.W., 1982. The Collection and Preservation of Animal Parasites. University of Nebraska Press, Lincoln, NE. Purvis, J.R., Gawlik, D.E., Dronen, N.O., Silvy, N.J., 1997. Helminths of wintering geese in Texas. J. Wildl. Dis. 33, 660–663. Reddy, A., Fried, B., 1997. Intra- and interspecific pairing of rediae and sporocysts of five species of digenetic trematodes. J. Helminthol. 71, 263–264.

40


Robbins, S.H., Hammett, M., Fried, B., 1979. Light and transmission electron microscopical studies and amino acid analysis of the metacercarial cysts of Zygocotyle lunata (Trematoda). Int. J. Parasitol. 9, 257–260. Rolfe, P.F., Boray, J.C., Collins, G.H., 1994. Pathology of infection with Paramphistomum ichikawai in sheep. Int. J. Parasitol. 24, 995–1004. Samuel, W.M., Barrett, M.W., Lynch, G.M., 1976. Helminths in moose in Alberta. Can. J. Zool. 43, 307–312. Saxton, T.M., Fried, B., 2008. Excystation of the metacercarial cysts of Echinosotoma caproni in a frozen and thawed trypsin-bile salts-cysteine medium. Parasitol. Res. 102, 809–810. Saxton, T.M., Fried, B., Peoples, R.C., 2008. Excystation of the encysted metacercariae of Echinostoma trivolvis and Echinostoma caproni in a typsin-bile salts-cysteine medium and morphometric analysis of the excysted larvae. J. Parasitol. 94m, 669–671. Schell, S.C., 1985. Handbook of Trematodes of North America North of Mexico. University Press of Moscow, Idaho, USA. Schmidt, K.A., Fried, B., 1997. Prevalence of larval trematodes in Helisoma trivolvis (Gastropoda) from a farm pond in Northampton County, Pennsylvania with special emphasis on Echinostoma trivolvis (Trematoda) cercariae. J. Helminthol. Soc. Wash. 64, 157–159. Self, J.T., Bouchard, J.L., 1950. Parasites of the wild turkey, Meleagris gallopavo intermedia Sinnet, from the Wichita Mountains Wildlife Refuge. J. Parasitol. 36, 502–503. Sey, O., 1991. Handbook of the Zoology of Amphistomes. CRC Press, Boca Raton, FL. Shaw, M.G., Kocan, A.A., 1980. Helminth fauna of waterfowl in central Oklahoma. J. Wildl. Dis. 16, 59–64. Shostak, A.W., Dharampaul, S., Belosevic, M., 1993. Effects of source of metacercariae on experimental infection of Zygocotyle lunata (Digenea: Paramphistomidae) in CD-1 mice. J. Parasitol. 79, 922–929. Singh, R.P., Sahai, B.N., Jha, G.J., 1984. Histopathology of the duodenum and rumen of goats during experimental infections with Paramphistomum cervi. Vet. Parasitol. 15, 39–46. Soulsby, E.J.L., 1965. Textbook of Veterinary Clinical Parasitology. F. A. Davis & Co., Philadephia. Stunkard, H.W., 1916. On the anatomy and relationships of some North American trematodes. J. Parasitol. 3, 21–27. Sutton, C.A., Lunaschi, L.I., 1987. Sobre algunos digeneos hallados en vertebrados silvestres argentinos. Neotropica 33, 89–95. Swanson, D.O., 1960. A study of helminth parasites of the George Reserve deer herd. Wildl. Rev. 98, 74. Turner, B.C., Threlfall, W., 1975. The metazoan parasites of green-winged teal (Anas crecca L.) and blue-winged teal (Anas discors L.) from Eastern Canada. Proc. Helminthol. Soc. Wash. 42, 157–169. Vasta, J.D., Fried, B., Sherma, J., 2008. High performance thin layer chromatographic analysis of neutral lipids in the urine of BALB/c mice infected with Echinostoma caproni. Parasitol. Res. 102, 625–629. Whitten, L.K., 1955. Paramphistomiasis in sheep. N. Zeal. Vet. J. 3, 144. Wilhelmi, R.W., 1940. Serological reactions and species specificity of some helminths. Biol. Bull. 79, 64–90. Willey, C.H., 1936. The morphology of the amphistome cercaria, Cercaria poconensis Willey, 1930, from the snail Helisoma antrosum. J. Parasitol. 22, 68–75. Willey, C.H., 1937. The development of Zygocotyle from Cercaria poconensis Willey, 1930. J. Parasitol. 23, 571. Willey, C.H., 1941. The life history and bionomics of the trematode, Zygocotyle lunata (Paramphistomidae). Zoologica 26, 65–92. Yamaguti, S., 1971. Synopsis of Digenetic Trematodes of Vertebrates. Interscience Publishers, Inc., New York.

CHAPTER

2 Fasciola, Lymnaeids and Human Fascioliasis, with a Global Overview on Disease Transmission, Epidemiology, Evolutionary Genetics, Molecular Epidemiology and Control Santiago Mas-Coma, Marıá Adela Valero, and Marıá Dolores Bargues

Contents

2.1. 2.2. 2.3. 2.4.

2.5. 2.6.

2.7. 2.8.

44 45 47 48 48 50

Introduction The Present Epidemiological Baseline The Problem of Being a Neglected Disease Heterogeneity of Human Fascioliasis 2.4.1. Epidemiological scenarios 2.4.2. Transmission patterns Control Problems Related to Human Fascioliasis Heterogeneity Evolutionary Genetics and Molecular Epidemiology 2.6.1. The digenean family Fasciolidae Origin and Evolution of Fasciola Species in Pre-Domestication Times Evolution of Fasciola Species in the Post-Domestication Period 2.8.1. Recent spread of Fasciola hepatica

51 53 53 56 67 68

Departamento de Parasitologıá, Facultad de Farmacia, Universidad de Valencia, 46100 Burjassot, Valencia, Spain Advances in Parasitology, Volume 69 ISSN 0065-308X, DOI: 10.1016/S0065-308X(09)69002-3

#


41

42

Santiago Mas-Coma et al.

2.8.2. 2.8.3. 2.8.4. 2.8.5. 2.8.6.

Initial step in the Near East Westwards spread into Europe Eastwards spread into Asia Southwards spread into Africa Transoceanic spread into Oceania and the Americas 2.8.7. Recent spread of Fasciola gigantica 2.8.8. Westwards and southwards spread throughout Africa 2.8.9. Northwards spread and transit between Africa and the Near East 2.8.10. Eastwards spread into Asia and the Pacific 2.9. Distributional Overlap of Both Species 2.10. Overlap Situations: The Roles of Livestock Transportation, Transhumance and Trade 2.10.1. Areas with only one Fasciola species 2.10.2. Areas where both Fasciola species co-exist 2.11. Molecular Characterization of Fasciolids 2.11.1. Intraspecific and interspecific variation of F. hepatica and F. gigantica 2.11.2. Gene expression and the problems of hybrids 2.11.3. Liver fluke phenotypes 2.11.4. The species question in fasciolids 2.11.5. Fasciolid-lymnaeid specificity 2.11.6. The worldwide lymnaeid molecular characterization initiative 2.12. Conclusions and Standardization Proposal Acknowledgements References

Abstract

68 69 71 73 77 80 80 82 83 84 85 87 90 92 96 108 111 118 120 123 126 130 130

Fascioliasis, caused by liver fluke species of the genus Fasciola, has always been well recognized because of its high veterinary impact but it has been among the most neglected diseases for decades with regard to human infection. However, the increasing importance of human fascioliasis worldwide has re-launched interest in fascioliasis. From the 1990s, many new concepts have been developed regarding human fascioliasis and these have furnished a new baseline for the human disease that is very different to a simple extrapolation from fascioliasis in livestock. Studies have shown that human fascioliasis presents marked heterogeneity, including different epidemiological situations and transmission patterns in different endemic areas. This heterogeneity, added to the present emergence/re-emergence of the disease both in humans and animals in many regions, confirms a worrying global scenario. The huge negative impact of fascioliasis on human communities

Fasciola, Lymnaeids and Fascioliasis

43

demands rapid action. When analyzing how better to define control measures for endemic areas differing at such a level, it would be useful to have genetic markers that could distinguish each type of transmission pattern and epidemiological situation. Accordingly, this chapter covers aspects of aetiology, geographical distribution, epidemiology, transmission and control in order to obtain a solid baseline for the interpretation of future results. The origins and geographical spread of F. hepatica and F. gigantica in both the ruminant pre-domestication times and the livestock postdomestication period are analyzed. Paleontological, archaeological and historical records, as well as genetic data on recent dispersal of livestock species, are taken into account to establish an evolutionary framework for the two fasciolids across all continents. Emphasis is given to the distributional overlap of both species and the roles of transportation, transhumance and trade in the different overlap situations. Areas with only one Fasciola spp. are distinguished from local and zonal overlaps in areas where both fasciolids co-exist. Genetic techniques applied to liver flukes in recent years that are useful to elucidate the genetic characteristics of the two fasciolids are reviewed. The intra-specific and interspecific variabilities of ‘pure’ F. hepatica and ‘pure’ F. gigantica were ascertained by means of complete sequences of ribosomal deoxyribonucleic acid (rDNA) internal transcribed spacer (ITS)-2 and ITS1 and mitochondrial deoxyribonucleic acid (mtDNA) cox1 and nad1 from areas with only one fasciolid species. Fasciolid sequences of the same markers scattered in the literature are reviewed. The definitive haplotypes established appear to fit the proposed global evolutionary scenario. Problems posed by fasciolid cross-breeding, introgression and hybridization in overlap areas are analyzed. Nuclear rDNA appears to correlate with adult fluke characteristics and fasciolid/lymnaeid specificity, whereas mtDNA does not. However, flukes sometimes appear so intermediate that they cannot be ascribed to either F. hepatica-like or F. gigantica-like forms and snail specificity may be opposite to the one deduced from the adult morphotype. The phenotypic characteristics of adults and eggs of ‘pure’ F. hepatica and F. gigantica, as well as of intermediate forms in overlap areas, are compared, with emphasis on the definitive host influence on egg size in humans. Knowledge is sufficient to support F. hepatica and F. gigantica as two valid species, which recently diverged by adaptation to different pecoran and lymnaeid hosts in areas with differing environmental characteristics. Their phenotypic differences and ancient pre-domestication origins involve a broad geographical area that largely exceeds the typical, more local scenarios known for sub-species units. Phenomena such as abnormal ploidy and aspermic parthenogenesis in hybrids suggest that their separate evolution in pre-domestication times allowed them to achieve almost total genetic isolation. Recent sequencing results suggest that present assumptions on fasciolid-lymnaeid

44


specificity might be wrong. The crucial role of lymnaeids in fascioliasis transmission, epidemiology and control was the reason for launching a worldwide lymnaeid molecular characterization initiative. This initiative has already furnished useful results on several continents. A standardized methodology for fasciolids and lymnaeids is proposed herein in order that future work is undertaken on a comparable basis. A complete understanding of molecular epidemiology is expected to help greatly in designing global actions and local interventions for control of fascioliasis.

2.1. INTRODUCTION Fascioliasis is a parasitic disease caused by liver fluke species of the genus Fasciola, with F. hepatica as the main cause because of its very wide distribution in Europe, Africa, Asia, Oceania and the Americas; F. gigantica appears to be of secondary importance because it is restricted to the Old World (Mas-Coma and Bargues, 1997). The di-heteroxenous lifecycle of F. hepatica was the first to be elucidated among trematodes (Andrews, 1999) and has already been the subject of several extensive reviews. The lifecycle of F. gigantica is essentially similar to that of F. hepatica (Graczyk and Fried, 1999; Mas-Coma and Bargues, 1997). Both fasciolid species use freshwater snails of the family Lymnaeidae as intermediate hosts (Bargues et al., 2001). The term vector is increasingly used when referring to the snails in trematode diseases, although it is evident that snails are not true vectors inoculating the parasite into the definitive host. Where present, these fasciolids use to be frequent in livestock giving rise to high economic losses in the animal husbandry industry because of their pathogenicity (Torgerson and Claxton, 1999). This is why this disease has been well known for many years in the veterinary field. With respect to public health, human fascioliasis was considered a secondary disease until the end of the 1990s, with only around 2,000 cases being reported in the previous 1970–1990 period (Chen and Mott, 1990). This latter fact led to this distomasis being included in the list of neglected diseases. However, the situation changed from the end of the decade of the 1980s, when the headquarters of the World Health Organization (WHO) began to suspect that something was wrong because of reports coming from different countries indicating that fasciolid infection in humans was probably more frequent than previously accepted. At that time, WHO decided to launch an investigation. The studies, performed initially on the island of Corsica and later on the Northern Bolivian Altiplano, were the first steps of what later became a worldwide initiative against human fascioliasis, including both multi-disciplinary research and control (Mas-Coma, 2008). Due to this WHO initiative, our knowledge of human fascioliasis has not only been greatly improved, but it has been shown that many aspects


45

of human infection by fasciolids were not as previously believed, whether because of lack of concrete knowledge about the disease in humans or because of the simple extrapolation from what was known about the disease in animals. A number of reviews by various authors concerning different aspects of fascioliasis, including human fascioliasis, have been published in recent years. For general background on human fascioliasis, the following reviews are recommended: Chen and Mott (1990), Mas-Coma (2004a,b, 2005), Mas-Coma and Bargues (1997), Mas-Coma et al. (1999a,b, 2003, 2005, 2007), World Health Organization (1995). For a general overview of animal fascioliasis by both F. hepatica and F. gigantica, the comprehensive multi-disciplinary book edited by Dalton (1999) is the most valuable general source. The human fascioliasis situation has changed significantly in recent years. Its increasing public health importance in South, Central and North America, Europe, Africa and Asia has re-launched interest in fascioliasis. There are already many different research teams applying modern genetic tools in fascioliasis endemic areas. The present review focuses on aspects of human fascioliasis that have shown significant developments since the 1990s. New approaches regarding aetiology, geographical distribution, epidemiology, transmission and control are analyzed to provide a baseline for crucial future research on evolutionary genetics and molecular epidemiology. These, together with the global framework and standardized methodology proposed herein, are expected to furnish a firm basis for the interpretation of future studies, as well as be useful tools for the fight against this emerging/re-emerging disease in many parts of the world.

2.2. THE PRESENT EPIDEMIOLOGICAL BASELINE Many new concepts have been developed regarding human fascioliasis from the 1990s up to 2009. Key aspects are the following: In many areas, human fascioliasis is truly endemic, varying from hypo-

to hyper-endemic (Mas-Coma et al., 1999a), which is very different from the old concept of humans only becoming infected sporadically in animal endemic areas. In those endemic areas, high prevalences in humans (to over 70% by coprology and even reaching 100% by serology) do not necessarily appear to be related to high prevalences in domestic animals (Mas-Coma et al., 1999c). In human endemic areas, fascioliasis mainly affects children and females, with flukes infecting even at a very early age (1–2-year-old children), usually showing a peak around 9–11 years and declining

46


thereafter, although high prevalences may be maintained in adults also (up to 40% in some communities) (Esteban et al., 1997a,b, 1999, 2002, 2003; Mas-Coma et al., 1999b). Worldwide estimates increased from the 2,000 reports of 1990 (Chen and Mott, 1990) to 2.4 million people (Rim et al., 1994; World Health Organization, 1995), 17 million people (Hopkins, 1992) and may even be higher at present if the almost total lack of knowledge about the situation of this disease in humans in many African and Asian countries is taken into account (Mas-Coma, 2004a). Human infection has been reported in 51 different countries from five continents, showing how geographically spread the problem might be (Esteban et al., 1998). Analysis of the distribution of the disease has shown that fascioliasis is the vector-borne parasitic disease showing the greatest latitudinal, longitudinal and altitudinal distribution known (Mas-Coma, 2004b; Mas-Coma et al., 2003). Such a broad distribution, ranging from below sea level (as in the Caspian area) up to the very high altitude of 4,200 m at the Paso del Condor in Venezuela, is a consequence of the great capacity of both liver flukes and lymnaeid vectors to colonize new areas (Gasnier et al., 2000; Mas-Coma et al., 1999b, 2003, 2005). It is also due to their great capacity for adaptation to very different environments, habitats and climates, even to extreme conditions as in the very-high-altitude regions of the Andes (Mas-Coma et al., 2001), where mathematical models of fascioliasis in the lowlands of the Northern Hemisphere indicated that the disease could not exist (Fuentes et al., 1999). In human endemic areas, intensities, estimated as numbers of eggs per gram of faeces (epg), may exceed 5,000 and counts over 400 epg may be frequent in some communities (Esteban et al., 1999; Mas-Coma et al., 1999c), which is very different from the very low burdens (usually from less than 1 epg to 1–2 epg) reported before the 1990s. Domestic animal species other than the usual sheep and cattle may also play an important role as reservoirs for humans in many different endemic areas, especially pigs, donkeys and buffaloes, depending on the region (Mas-Coma et al., 1997). DNA sequencing data have shown the lymnaeid snail family to be in systematic-taxonomic chaos, such that even expert malacologists have been sometimes impeded in determining the correct classification of snail specimens; classification errors also involve the concept of fasciolid-lymnaeid specificity, which must, therefore, be revisited (Bargues et al., 2001). Lymnaeid species linked to disease transmission in many human endemic areas were erroneously classified as local lymnaeid species when in fact lymnaeid vector species imported from other continents


47

were involved. This, together with importation/exportation of fasciolid-infected livestock, has given an international dimension to the public health problem in many areas where the disease previously only had local repercussions (Mas-Coma et al., 2001). The aforementioned observations mean that a new baseline is required for the analysis and interpretation of the human disease, which is very different from simply extrapolating from the traditional knowledge of fascioliasis in livestock. Unfortunately, sufficient importance is not always given to this new baseline or it is not considered at all and, consequently, incorrect interpretations and erroneous conclusions are increasingly appearing in the literature.

2.3. THE PROBLEM OF BEING A NEGLECTED DISEASE Fascioliasis has been considered a well-known disease of livestock for decades. Owing to its economic importance, its well-known lifecycle and transmission, and the large size of flukes that facilitates many kinds of studies, fascioliasis has been the subject of numerous multi-disciplinary studies in the veterinary field over many years. This situation contrasts sharply with human fascioliasis, knowledge of which has been based on data from patients sporadically infected in animal fascioliasis-endemic areas of developed countries and, where information on several aspects was lacking, it has been assumed to be similar to animal fascioliasis (Chen and Mott, 1990). The rarity of human infection by fasciolids is the reason why this disease has been neglected. It only received attention in France between the 1950s and 1990s because of the several thousands of patients being diagnosed in hospitals during that period (Danis et al., 1985; Gaillet, 1982; Gaillet et al., 1983). Globally, it can be concluded that fascioliasis was one of the most neglected among neglected diseases. Although the situation has changed since the 1990s, the traditional concept of a ‘disease of sheep and cows’ still remains. This not only causes problems when trying to convince political and health authorities about the importance of human infection in some countries, and the need to implement control measures, but also causes problems in the expert scientific and health literature. Thus, in textbooks covering a broad spectrum of diseases, as is the case of books on tropical medicine or human parasitic diseases, usually only little space is given to fascioliasis, and authors tend to make less effort in updating knowledge on secondary diseases compared with the primary ones. Sometimes, incorrect information, misunderstandings or mistakes are made in review papers published in even high-impact, speciality journals. This is related to the emergence of human fascioliasis in recent years such that it has

48


now become a fashionable disease. As a consequence, journals are commissioning reviews by authors who have no personal experience of human fascioliasis, or perhaps only local experience in one area or country, experience in hospitals but none in endemic areas, or only experience of animal fascioliasis. Several aspects of human fascioliasis have only been elucidated recently and the literature on human fascioliasis is so minimal when compared to the extremely broad literature on animal fascioliasis, that important knowledge is sometimes overlooked or key publications are not taken into account or are misinterpreted. All efforts to improve the diffusion of knowledge on the public-health problem currently posed by fascioliasis are welcome and the publication of reviews certainly helps to do this, but care needs to be taken not to retain old errors or introduce new ones into the literature. The present review aims to provide a solid foundation on aspects of fasciolid aetiology, lymnaeid vectors and epidemiology, and thus to minimize flaws in the literature.

2.4. HETEROGENEITY OF HUMAN FASCIOLIASIS 2.4.1. Epidemiological scenarios After 10 years of studies in different areas where human infection by fasciolid liver flukes is present in South and Central America, Europe, Africa and Asia, the classification of epidemiological scenarios proposed by Mas-Coma et al. (1999a) still appears to be fully valid and useful: Imported cases: human cases diagnosed in a zone lacking fascioliasis

(lacking even in animals) but who were previously infected in an area where fascioliasis transmission occurs. Authochthonous, isolated, non-constant cases: humans acquire the infection in an area where they live and where animal fascioliasis is also present; these human cases appear sporadically, without any constancy. Endemic: three types of endemic scenarios can be distinguished according to prevalence in the human population, based on coprological diagnosis (data from serological tests may be somewhat higher): ○ Hypo-endemic: prevalence of less than 1%; arithmetic mean intensity less than 50 epg; high eggs per gram of faeces numbers only in sporadic cases; human participation in transmission through egg shedding may be rare; hygiene-sanitation status usually including latrines and waste or sewage disposal facilities; outdoor defecation is not commonly practiced. ○ Meso-endemic: prevalence of between 1% and 10%; 5–15-year-old children may present higher prevalences (holo-endemic); arithmetic mean intensity in human communities usually 50–300 epg;


49

individual high eggs per gram of faeces numbers can be found, although intensities over 1,000 epg are rare; human subjects may participate in transmission through egg shedding; hygienesanitation status may or may not include latrines and waste or sewage disposal facilities; outdoor defecation may be practiced. ○ Hyper-endemic: prevalence of more than 10%; 5–15-year-old children usually present higher prevalences (holo-endemic); arithmetic mean intensity in human communities usually more than 300 epg; very high eggs per gram of faeces numbers are encountered in individuals, intensities over 1,000 epg being relatively frequent; human subjects participate significantly in transmission through egg shedding; hygiene-sanitation status does not include the use of latrines; no proper waste or sewage disposal facilities available; indiscriminate defecation is commonly practiced. Epidemic: there are different types of outbreaks according to the

endemic/non-endemic situation of the zone: ○ Epidemics in animal but non-human endemic areas: outbreaks appearing in zones where previous human reports have always been isolated and sporadic; such outbreaks usually concern a very few subjects infected from the same contamination source (family or small-group reports; contaminated wild, home-grown or commercially grown watercress or other metacercariae-carrying vegetables). ○ Epidemics in human endemic areas: outbreaks appearing in zones presenting human endemics; a higher number of subjects may be concerned; usually related to previous climatic conditions having favoured both the parasite and the snail lifecycles; epidemics can take place in hypo-endemic, meso-endemic and hyper-endemic areas. The aforementioned epidemiological classification was amended recently regarding the threshold of 400 epg for considering a patient massively infected (World Health Organization, 2007). This threshold was established in parallel to that used in schistosomiasis. As in schistosomiasis, the Kato-Katz technique, which is now standardized, commercially available, easy to perform and cheap, appears to be the most appropriate method for such quantification. Although not expected before the 1990s, it is now known that high intensities are usually found in numerous persons in human endemic areas. Massively infected subjects, mainly children and females, shedding more than 400 epg are frequent in human hyper-endemic areas such as in Bolivia (Esteban et al., 1999), Peru (Esteban et al., 2002) and Egypt (Periago et al., unpublished data). The previous record of more than 5,000 epg in Bolivian children (Esteban et al., 1999) has been broken by an 8,000 epg detected in another child from the Bolivian locality of Huacullani, also in the Northern Altiplano (Aguirre et al., unpublished data), underlining the great human health problem in those human endemic areas.

50


Quantitative analysis in fascioliasis relies on deducing how many adult flukes may be present in the patient. Although the direct relationship between adult fluke burden in the liver and the amount of egg shedding is known to be unreliable (Happich and Boray, 1969), indirect tests, whether serological or antigen-detecting coprological, unfortunately appear to be even less useful for a quantitative approach (Valero et al., 2008), in spite of reports asserting their analytical usefulness (Shehab et al., 1999). In humans, although found in both biliary canals and the gall bladder, fasciolids may also aggregate in the choledoc and, in heavy infection, adult flukes may also appear crowded in the main biliary canals near to the choledoc. Treatment with a high drug dose may sweep the flukes along and concentrate them in the choledoc or a neighbouring biliary canal, potentially obstructing biliary drainage and giving rise to a serious biliary colic.

2.4.2. Transmission patterns Research performed in recent years has shown that different transmission patterns may be distinguished within the various human endemic areas (Mas-Coma, 2005): 1. A very-high-altitude pattern related to only F. hepatica transmitted by imported Galba truncatula in Andean countries following transmission throughout the year; within this category, two sub-patterns may be distinguished according to physiographic and seasonal characteristics: a. The altiplanic pattern, with transmission throughout the whole year (e.g. in the Northern Bolivian Altiplano and the Puno Altiplano). b. The valley pattern, with seasonality and prevalences and intensities related to altitude (e.g. in the Peruvian valleys of Cajamarca and Mantaro). 2. A Caribbean insular pattern, with reduced but repeated outbreaks in human hypo-endemic areas and lymnaeid species other than the main vector species being involved in the transmission (e.g. the Pinar del Rio Province in Cuba). 3. A pattern related to Afro-Mediterranean lowlands, including overlapping F. hepatica and F. gigantica and several Galba-Fossaria and Radix lymnaeids together with secondary transmitting Pseudosuccinea, and where seasonality is typical (e.g. the Behera Governorate in Nile Delta region in Egypt). 4. A pattern occurring in areas surrounding the Caspian, including human hypo-endemic areas in which large epidemics occur, occasionally involving up to 10,000 people and with overlapping of F. hepatica and F. gigantica and several Galba-Fossaria, Radix and stagnicoline lymnaeids (the area of Rasht and Bandar-e Anzali in the Gilan province in Iran).


51

The characteristics of the human fascioliasis situation in Vietnam (De et al., 2006; Le et al., 2008) merits a different, new pattern to be added to the above: 5. A pattern very recently detected in Vietnam, which remains to be elucidated and which may perhaps be extrapolated to other neighbouring South-east Asian countries; preliminary information suggests that it concerns lowland areas, is able to give rise to large human epidemics and is related to only/mainly F. gigantica and consequently Radix lymnaeids. The marked heterogeneity of human fascioliasis regarding different epidemiological scenarios and transmission patterns throughout the world should be noted. It may be concluded that well-known situations and patterns of fascioliasis may not always explain the disease characteristics in a given area. Thus, when dealing with an endemic zone not studied previously, the scenarios and patterns of human infection above must always be considered merely as the starting point. Only once the epidemiology and transmission characteristics of the new area have been adequately assessed, can appropriate control measures be designed for the zone concerned. The relationships between the lymnaeid vector species and the transmission pattern in question needs to be emphasised. Lymnaeids have greatly differing ecological and ethological characteristics depending on the species, and factors such as the type of water collection habitats, population dynamics, temperature thresholds, seasonality or susceptibility regarding liver fluke infection are crucially important for fascioliasis. All this indicates that, as for other well-known vector-borne parasitic diseases, lymnaeids may constitute excellent markers of disease, useful for differentiating between the various human fascioliasis scenarios and patterns, and consequently also as determinants for the design of appropriate control strategies.

2.5. CONTROL PROBLEMS RELATED TO HUMAN FASCIOLIASIS HETEROGENEITY In human fascioliasis, establishing general control measures is a problem because of the heterogeneity of the epidemiological characteristics and transmission patterns in significantly different situations, for instance: Presence of only one (F. hepatica or F. gigantica), or both species

(endemic area presenting either total, partial or no overlap of the two fasciolid species), or the two species plus hybrids. Presence of only one lymnaeid species transmitting one fasciolid species, several lymnaeid species transmitting one fasciolid species, two lymnaeid species transmitting the two fasciolids or several transmitting each one of the two fasciolids in an area where the species overlap.

52


One or more domestic animal species playing a reservoir role. Wild mammals species playing a reservoir role. Seasonal or permanent transmission. A stable endemic situation or an emergent one. Physiographically uniform or heterogeneous endemic area. One or more human infection sources. Potential issues with diagnostic methods (impossibility of getting blood samples in the endemic area so not allowing serological tests; peculiar fluke characteristics related to absence of egg shedding or shedding of only a very reduced number of eggs; to date, the impossibility of differentiating fluke hybrids using coprological and serological diagnostic techniques). Rare or usual massive infections in humans. Children or adults as the subjects mainly infected. The heterogeneity is so huge, that convenient, simplified and uniform control schemes do not appear feasible. For many areas or countries, basic control measures should be recommended which may include several measures specific only for that area or country. WHO has already recognized the heterogeneity and accordingly has implemented different pilot strategies in each of the initially selected countries of Peru, Bolivia, Egypt and Vietnam (World Health Organization, 2007). Accordingly, the question immediately arises of how to define different control measures for each area. If several years are needed for the appropriate multi-disciplinary assessment each time an area with human fascioliasis is detected, the global process will be too long. The great impact of the disease on individuals as well as on human communities underlines the need for fast action to help the people affected. Moreover, listing the many different control measure packages according to the various transmission patterns and epidemiological situations known would give rise to a complicated list, which could easily lead to confusion within the national health authorities in charge of implementing the control measures in each country. Pragmatism indicates the utility of finding markers that could easily and quickly distinguish each type of transmission pattern and epidemiological scenario. It is evident that if appropriate markers could be found that could be used to distinguish the different types of situations, this would lead both to acceleration of the global process and to facilitation of the general protocol for human fascioliasis control. Given that all aforementioned differential characteristics are likely to be related to different combinations of different species and strains of both liver flukes and lymnaeid vectors, genetic markers appear to be the obvious first targets, with climatic-physiographic markers as secondary. Given that the latter markers necessitate prior field and experimental characterization of flukes


53

and snails to enable accurate mathematical modelling, remote sensing and geographical information systems (GIS) (Mas-Coma et al., 2008a,b), only genetic markers that are useful for elucidating the molecular epidemiology of fascioliasis are considered below.

2.6. EVOLUTIONARY GENETICS AND MOLECULAR EPIDEMIOLOGY 2.6.1. The digenean family Fasciolidae Fasciolidae Railliet, 1895 incorporates large worms, which inhabit the liver and bile ducts of wild and domestic herbivorous mammals, although two genera are intestinal parasites and some species occur in omnivores, occasionally including humans. Several species are cosmopolitan while others show a relatively restricted distribution. The lifecycle includes a metacercarial stage that encysts on pasture and other vegetation (Jones, 2002). Fasciolidae contains three subfamilies and six genera ( Jones, 2002; Yamaguti, 1971) including species infecting Artiodactyla and perissodactyl Proboscidea, to which humans shall be added in the case of only the three species F. hepatica, F. gigantica and Fasciolopsis buski (Mas-Coma et al., 2005).

2.6.1.1. Protofasciolinae Skrjabin, 1948 Protofasciolinae Skrjabin, 1948 (caeca simple, testes entire, intestinal parasites, intermediate snail host unknown): includes only one genus: Protofasciola Odhner, 1926, includes only one species, P. robusta (Lorenz,

1881) Odhner, 1926 from the intestine of African elephants Loxodonta africana (Odhner, 1926; Van Den Berghe, 1943);

2.6.1.2. Fasciolopsinae Odhner, 1910 Fasciolopsinae Odhner, 1910 (caeca simple, testes branched, parasites of intestine, liver or bile ducts, planorbid snail vectors): includes two genera: Fasciolopsis Looss, 1899, with only one species, the intestinal F. buski

(Lankester, 1857) Stiles, 1901 found throughout Asia in pigs and humans and rarely reported in rhesus monkeys, and transmitted by small planorbid species of the genera Segmentina, Hippeutis and Gyraulus (Mas-Coma et al., 2005). Parafasciolopsis Ejsmont, 1932, also mono-specific, with the bile duct species P. fasciolaemorpha Ejsmont, 1932 from the European elk Alces alces and other European ungulates and transmitted by the planorbid Planorbarius corneus (Lachowicz, 1988). This species originally infects

54


A. alces in the range from the Ural Mountains to Poland, and has recently been detected to expand in Central Europe, probably introduced with imported elk from Russia (Majoros and Erdelyi, 2004).

2.6.1.3. Fasciolinae Stiles et Hassall, 1898 Fasciolinae Stiles et Hassall, 1898 (caeca branched, testes dendritic, in liver and more rarely duodenum and lungs, transmitted by lymnaeids): includes three genera: Fascioloides Ward, 1917, with only one species, the large American liver

fluke F. magna (Bassi, 1875) Ward, 1917 parasitizing North American and European bovids and cervids: Boselaphus tragocamelus, and species of Cervus, Odocoileus, Bison, Alces and Capreolus (Slusarski, 1955; Yamaguti, 1971). Eggs apparently not discharged in faeces of cattle, but full development in sheep. Cercariae in lymnaeid species of Fossaria, Galba, Pseudosuccinea, Stagnicola and Hinckleyia (Yamaguti, 1971). Historical information indicates that F. magna was introduced into Europe before 1875 and is currently spreading in Central Europe (Majoros and Erdelyi, 2004); Tenuifasciola Yamaguti, 1971, proposed by Yamaguti (1971) for Fasciola tragelaphi Pike et Condy, 1966 from the bile ducts of the sitatunga Tragelaphus spekei in Zimbabwe (Pike and Condy, 1966) and which has also been found in cattle (Mukaratirwa and Brand, 1999); Fasciola Linnaeus, 1758, including four species considered valid at present (Yamaguti, 1971): ○ F. hepatica Linnaeus, 1758, found in the large biliary passages and gall bladder of ruminants, especially sheep, goats, cattle and buffaloes, but also in a large variety of other domestic animals such as horses, donkeys, mules, New and Old World camelids and pigs, as well as wild animals such as deer, wild sheep, wild pigs, various marsupials, rabbits, hares, nutria and rarely others such as monkeys and rodents. It is distributed mainly in temperate and subtropical zones of: Europe; North, Central and South America; northern and central Asia; Oceania; and northern, eastern and southern Africa; and also in large islands, including New Zealand, Tasmania, the United Kingdom, Iceland, Cyprus, Corsica, Sardinia, Sicily, Japan, Papua New Guinea, the Philippines and several islands of the Caribbean (Boray, 1982; Mas-Coma and Bargues, 1997; Pantelouris, 1965); ○ F. gigantica Cobbold, 1855, originally described from Giraffa camelopardalis from Sub-Saharan Africa found in a travelling menagerie in England (Cobbold, 1855) and somewhat later re-described from cattle in Senegal (Raillet, 1895). It is a common parasite of the bile


55

ducts and gall bladder of domestic and wild herbivorous animals, especially ruminants, in Africa and Asia, such as sheep, goats, cattle, buffaloes, camels, pigs, horses, donkeys, larger antelopes, deer, giraffes and zebras; many other African wild animals have been found naturally infected (Losos, 1986; Round, 1968); occasionally reported in nutria and monkeys. In Africa, it is present in large areas, from the Nile Delta in the north to the Cape Provinces of South Africa in the south, including Sudan, Senegal, Chad, GuineaBissau, Ghana, Togo, Niger, Central African Republic, Tanzania and Kenya, as well as Mozambique, Ethiopia, Ivory Coast, Liberia, Sierra Leone, Nigeria, Zimbabwe and Angola (Losos, 1986; Schillhorn Van Veen, 1980), in addition to Rwanda and Burundi, Malawi, Rhodesia, Uganda, southern Africa, Zaire, Cameroon, Gabon, Zambia, Egypt and Mali, and also in the islands of Cabo Verde, Zanzibar and Madagascar. In Asia, major endemic areas are tropical Asia, Southeast Asia, and the Pacific regions, including old Union of Soviet Socialist Republics (USSR; Tashkent, Uzbekistan, Turkmenia, Samarkand region), Iran, Iraq, China, Korea, Japan, India, Pakistan, Vietnam, Thailand, Laos and finally in the Pacific, Malaysia, Philippines and Hawaii. Infection by F. gigantica is one of the most important diseases threatening the livestock populations of India, Pakistan, Indonesia, Indochina and the Philippines. Less important endemic zones are south-east European areas including Turkey, the Near East and some Caucasian countries such as Armenia, Azerbaijan and Georgia (Boray, 1982; Mas-Coma and Bargues, 1997); ○ F. nyanzae Leiper, 1910 in the bile ducts of only Hippopotamus amphibius, and transmitted by the lymnaeid Radix natalensis in Africa (Dinnik and Dinnik, 1961); ○ F. jacksoni (Cobbold, 1869) in the liver of the Asian elephants Elephas indicus and E. maximus in India, Burma, Sri Lanka and Indochina (Bhalerao, 1933; Yamaguti, 1971). It may be a synonym of Cladocoelium elephantis (Diesing, 1858) Diesing, 1892 if the synonymy proposed by Bhalerao (1933) is correct, thus becoming F. elephantis (Diesing, 1958) Bhalerao, 1933 (Yamaguti, 1971). The placement of F. jacksoni in Fascioloides has recently been suggested based on results from ribosomal DNA 28S (partial sequence), ITS-1 and ITS-2, as well as from mtDNA nad1 (partial sequence) (Lotfy et al., 2008), although unfortunately these results may only be considered preliminary, for a number of reasons: first, because of the inclusion in the samples of F. hepatica and F. gigantica from areas where there is overlap of both species, such as in Egypt (Bargues et al., unpublished data; Periago et al., 2007) and Iran (Ashrafi et al., 2006), together with the fact that hybridization between both species appears to be a normal process in all areas where the species overlap; second, the absence of the two

56


key species F. nyanzae and T. tragelaphi; and third, the inclusion of a mitochondrial marker which is not appropriate for the phylogenetic analysis of such old species, as the problems posed by mtDNA genes related to their nucleotide saturation and other aspects have recently come to light (Mas-Coma and Bargues, 2008). Three additional species were described but these have been synonymized: F. californica Sinitsin, 1933 from the lymnaeid L. bulimoides in California

and adult experimentally obtained in rabbits (Sinitsin, 1933). This species has traditionally been synonymized with F. hepatica. F. halli Sinitsin, 1933 found in the liver of cattle and sheep in Texas and Louisiana, transmitted by the lymnaeid L. bulimoides and experimental adults obtained in sheep (Sinitsin, 1933). This species has also been synonymized with F. hepatica; F. indica Varma, 1953 from the liver of Bos indicus, B. bubalus, Capra hircus and Sus cristatus in India (Varma, 1953), transmitted by the lymnaeid Lymnaea acuminata in Lucknow, India, and successfully passaged in guinea pigs by experimental infection (Thapar and Tandon, 1952). This species was later synonymized with F. gigantica (Kendall, 1965; Kendall and Parfitt, 1959; Sarwar, 1957).

2.7. ORIGIN AND EVOLUTION OF FASCIOLA SPECIES IN PRE-DOMESTICATION TIMES The particular composition of Fasciolidae, with a paucity of only nine, mostly geographically restricted species in total, distributed in three subfamilies including five mono-specific genera and only one multi-specific genus suggests that this is an old family in which many members should have disappeared throughout its evolution. This evolution has allowed fasciolids to spread throughout the Old World, with only one member, F. magna, showing an origin in the Nearctic Region. Anyway, the absence of fasciolids in the Neotropical Region (all indications are that the presence of only F. hepatica in South America is the consequence of a recent introduction by humans—discussed later) supports the origin of Fasciolidae after the fragmentation of Gondwanaland into Africa and South America occurred around 90–100 million years ago (mya) (Pitman et al., 1993). The results of a recent phylogenetic approach support the logical evolution of Fasciolidae members, including adult intestinal parasites with non-ramified caeca transmitted by planorbid snails, initially in Africa with subsequent spread into Asia and the rest of the Holarctic


57

Region, and with progressive adaptation to the liver micro-habitat and to transmission by lymnaeid snails (Lotfy et al., 2008). The origin of F. hepatica in Eurasia is generally accepted because of the evident preference of this fasciolid species for the lymnaeid Galba truncatula with ecological characteristics related to mild and cold climatics (Mas-Coma and Bargues, 1997). With regard to the origin of the definitive host, comparative data on infectivity, life span, egg shedding and immunity indicate that F. hepatica is more adapted to sheep than to the other host species. In sheep, the life span of F. hepatica can be as long as 11 years, egg output of the adult flukes is relatively high and there is no evidence that sheep or goats acquire immunity against F. hepatica. In cattle, the disease is self-limiting, most of the flukes being eliminated within 9–12 months, the duration of egg production is short and high egg output lasts for only a few weeks, and resistance is acquired during primary infection (Boray, 1969; Dawes and Hughes, 1964; Mas-Coma and Bargues, 1997; Spithill et al., 1999). These data suggest that the origin of F. hepatica is in Eurasian ovicaprines, preferentially in species of Ovis. With regard to the origin of F. gigantica, the assumption that ‘a host switch from planorbids to lymnaeids occurred in Eurasia and that this favoured the emergence of the Fasciolinae, with colonization of Africa occurring secondarily, both by F. gigantica and an apparent ancestor of F. nyanzae in hippos and T. tragelaphi in sitatungas’ (Lotfy et al., 2008), does not appear to fit with current knowledge. Fasciola gigantica is distributed throughout western, sub-Saharan and eastern Africa as a result of the wide distribution of its specific lymnaeid vector species Radix natalensis (the only lymnaeid species present in western, sub-Saharan and central Africa; other lymnaeid species present throughout eastern up to southern Africa as G. truncatula and Pseudosuccionea columella, are purely the result of recent introductions—Brown, 1994) and throughout the Near East, southern Asia, India and South-east Asia thanks to Radix spp. of the so-called ‘auricularia super-species’ (Hubendick, 1951). The detection of hybridization with F. hepatica in areas of overlap, where appropriate molecular techniques have been applied, argues strongly against a Euro-asian origin for F. gigantica. Moreover, the developmental minimum temperature thresholds of 10 C for F. hepatica and 16 C for F. gigantica (Malone et al., 1998; Yilma and Malone, 1998) explains the distribution of F. hepatica in temperate zones and the evident link of F. gigantica to warmer climates. In addition to domestic cattle, sheep and goats in Africa, F. gigantica has been reported in 16 species of wild herbivores (Boray, 1985), primarily in the following wild ruminants: Alcelaphus buselaphus (in Uganda and Congo), Connochaetes taurinus (Kenya) and Damaliscus korrigum (Sudan) (Alcelaphinae); Kobus defassa (Congo), Kobus kob (Uganda, Congo) and Kobus varondi (Zambia) (Reduncinae); and the water buffalo Syncerus caffer (Uganda, Sudan) (Bovinae) (Bindernagel, 1972; Losos, 1986; Round, 1968). Interestingly, it has also

58


been reported from Hippopotamus amphibius (Zambia), the original and unique host of F. nyanzae (Round, 1968). Prevalences of F. gigantica infection as high as 58%, 47% and 47%, respectively, have been found in African buffalo, kob K. kob and Jackson’s hartebeest A. buselaphus in Uganda (Bindernagel, 1972). There is evidence from that country that F. gigantica infection can be maintained in wildlife in the absence of domestic ruminants, and it would seem that the giraffe at least could be an efficient reservoir host, as the parasite can survive in this host for several years (Hammond, 1972). Summing up, an African origin, well isolated from Eurasian F. hepatica, fits better for F. gigantica. Fasciola nyanzae probably appeared during the same African evolutionary radiation of fasciolids in which F. gigantica originated. The peculiar morpho-anatomic characteristics of T. tragelaphi suggest an independent derivation for this species. Regarding the origin of the definitive host, F. gigantica appears to be better adapted to cattle than to sheep in that it is more infective and lives longer in the former host. Acquired resistance, and indeed high levels of resistance to F. gigantica have been observed in sheep (Spithill et al., 1999), and resistance to F. gigantica has also been observed in goats (Haroun and Hillyer, 1986). Although in cattle most F. gigantica adults survive less than 1 year, some may survive for at least 3–4 years (Hammond and Sewell, 1974), and with the same infecting dose, faecal egg counts are up to 80% lower in buffaloes than in cattle (Spithill et al., 1999). These data suggest that the origin of F. gigantica is in African ruminant groups that differ from ovicaprines and are somewhat close to bovines. Likely candidates are within Giraffidae, Reduncinae or kobs, and Alcelaphinae or gnus. Giraffids were widely distributed in northern Africa and Eurasia during the young Miocene, Reduncinae were also distributed in Asia during the Pliocene, and Alcelaphinae also reached the Near East where they remained until recent times. The African water buffalo Syncerus, another potential spreader of F. gigantica, also expanded to the Near East and the Eurasian water buffalo Bubalus was found in central Europe during the warm Pleistocene periods (Thenius, 1980). Both the distribution of the ruminant definitive host candidates in Europe, the Near East and southern Asia during these geological periods, and the present absence of F. gigantica in Europe despite the broad distribution of R. auricularia in this continent, are facts that do not support an evolutionarily old introduction of F. gigantica from Africa into Eurasia. The spread of this fasciolid from Africa into Asia is, thus, more likely to be related to human activities, most probably during the first periods of animal domestication, a relatively recent phenomenon, which fully fits the lack of mutations in the rDNA ITS1 sequence and the paucity of mutations in the rDNA ITS-2 sequence of this species throughout its Asian distribution when compared to the ITS sequences known in Africa (Tables 2.1 and 2.2).

TABLE 2.1 Variable positions found in the complete rDNA ITS-1 sequence of F. hepatica (Fh) and F. gigantica (Fg) Haplotype code

Variable positions

a

Accession Nos.b

Country

c

Reference Nos.d

11111222233334444444 11111111122612288044800662223333 12345678901234578925852839948727282890123 FhITS1-A FhITS1-A FhITS1-A FhITS1-A

ATCATTACCTGAAAACTA-CAATGAGCGCTTCTGTTACGTA ..................-...-.-..-..-.-.-...... ******............-..................**** ******............-......................

a EF612467 b c

Spain, Fra, Irl, Iran, Japan, Kor, Vietnam, Aus, Egypt, Bol, Ur Egypt China Spain, Andorra, Niger

1,2,3,4,10,11,pp 10 7 6,9

FgITS1-A FgITS1-A FgITS1-A FgITS1-A FgITS1-A FgITS1-A FgITS1-A FgITS1-A

..................-T.T....T..A.T......... ..................-Y.W....Y..W.Y......... ******............-T.T....T..A.T......... *******...........-T.T....T..A.T.....**** ******............-Y.W....Y..W.Y.....**** ..................-T.T....T..A.T......... ******............-T-T.-.-T.-A.-.-.A***** **************GTAGAT.T....T..A.T.........

d e AM900371 AJ628425 f g AJ628043 EF027104

Burkina Faso, Egypt, Kenya, Iran, Vietnam Korea, Japan, Vietnam Niger China China Zambia, Indonesia, Thailand, Japan, Korea China India

2,5,10,11,pp 3,4,11 9 7 7 3,4 7 8

Notes: a Variable positions: Numbers (to be read in vertical) refer to positions obtained in the alignment; . ¼ Identical, - ¼ insertion/deletion, * ¼ not sequenced; boldfaced ¼ diagnostic positions for species differentiation; undefined positions: Y= C/T; W= A/T. b Accession Nos.: a ¼ AB207139, AB207140, AB207141, AB207145, AB211236, AB385611, AJ243016, EF612468, EF612469; b ¼ AJ628431, AJ628432; c ¼ AM709498-AM709500, AM709609-AM709622, AM709643-AM709649, AM707030, AM900370; d ¼ AB385612, AB385614, AJ853848, EF612470-EF612472; e ¼ AB207147, AB211237, AB385613; f ¼ AJ628426-AJ628428; g ¼ AB207142-AB207144, AB207146, AB211238. c Country: Fra ¼ Corsica, France; Irl ¼ Ireland; Kor ¼ Korea; Aus ¼ Australia; Bol ¼ Bolivia; Ur ¼ Uruguay. d Reference Nos.: 1 ¼ Mas-Coma et al., 2001; 2 ¼ Bargues et al., 2002a; 3 ¼ Itagaki et al., 2005a; 4 ¼ Itagaki et al., 2005b; 5 ¼ Bargues and Mas-Coma, 2005b; 6 ¼ Alasaad et al., 2007; 7 ¼ Lin et al., 2007; 8 ¼ Prasad et al., 2008; 9 ¼ Ali et al., 2008; 10 ¼ Lotfy et al., 2008; 11 ¼ Itagaki and Sakaguchi, 2008; pp ¼ present paper.

TABLE 2.2 Variable positions found in the complete rDNA ITS-2 sequence of Fasciola hepatica (Fh) and F. gigantica (Fg) Haplotype a code

Variable positions

b

Accession c Nos.

Country

d

Reference e Nos.

1112222222333333333 111122223333357890281234778003344445 123457345601290123538383650146397140745782 FhITS2-1 FhITS2-1 FhITS2-1 FhITS2-1 FhITS2-1 FhITS2-2 FhITS2-2 FhITS2-3 FhITS2-4

CTTATACACGCCCTCGTGCGTGGTCGTTTGCCCTATGTACCT ********************..-..............***** *......................................... **************************.............*** ***....................................... ................................T......... ********************..-.........T....***** ***..................................AT... ***.................................A.....

a nn nn nn b c nn d EU260069

Spain, Pol, Iran, Jap, Kor, Egypt, Niger, Aus, Bol Hungary Belorussia, Ukraine, Russia, Armenia, Turkmenistan Korea Vietnam, Australia Spain, Andorra, Uruguay Mexico France, China Vietnam

2,3,5,6,7,8,10,14,16,18,19,pp 1 12 4 17 3,14,pp 1 9 17

FgITS2-1 FgITS2-1 FgITS2-1 FgITS2-2 FgITS2-2 FgITS2-2 FgITS2-3 FgITS2-3 FgITS2-3 FgITS2-4 FgITS2-4 FgITS2-5 FgITS2-nn FgITS2-nn FgITS2-nn FgITS2-nn

............................C.TT...-A..... ..........................Y.C.TTY..-AY.... ..........................Y.C.TT...-A..... ..........................C.C.TT...-A..... ***.......................C.C.TT...-A..... ************************..C.C.TT...-A***** ***.......................CCC.TT...-A..... ..........................CCC.TT...-A..... ************************..CCC.TT...-A***** ..........................C.C.TT...-AAT... ***.......................C.C.TT...-AAT... ............................C.TT.C.-A..... ............................A....C.-...... ***.....................--..C-TT..--AAT... ..........................YYY.YY.......... *GCTA.----AGAGAAGAG.........C.TT...-A....C

e nn nn f g nn h i nn AM900371 j AB010976 AB010975 AJ557571 AB207153 DQ383512

Burkina Faso, Kenya, Egypt, Iran, Tajikistan Turkmenistan Uzbekistan India, Malaysia, Japan, Indonesia Vietnam, Indonesia Malaysia, Indonesia Vietnam Japan, Korea Japan, Korea Niger China Zambia Zambia China Japan Egypt

6,11,12,18,pp 12 12 2,3,10,15 17 1 17 3,10 1,4 16 9,17 3 3 9 10 13

Notes: a Haplotype code: nn ¼ no number assigned. b Variable positions: Numbers (to be read in vertical) refer to positions obtained in the alignment; . ¼ Identical, - ¼ insertion/deletion, * ¼ not sequenced; boldfaced ¼ diagnostic positions for species differentiation; undefined positions: Y= C/T. c Accession Nos.: a ¼ AB010978, AB207148, AB207150, AJ272053, AM709498, AM709499, AM709609-16, AM709618, AM709619, AM709643-49, AM900370, EF612479-80, EF612481, EU391412-24; b ¼ AM707030, AM709500, EU2600620-22, EU260064-68, EU260071, EU260073; c ¼ AB010974, AM709617, AM709620; d ¼ AJ557567, AJ557568, AJ557570; e ¼ AJ853848, EF612482-84; f ¼ AB010977, AB207149, AB207152, EF027103; g ¼ EU260057, EU260059, EU260060, EU260072, EU260075, EU260076, EU260078, EU260080; h ¼ EU260061, EU260063, EU260070, EU260074, EU260077; i ¼ AB010979, AB207151; j ¼ AJ557569, EU260079; nn ¼ no number because sequence not deposited in databases. d Country: Pol ¼ Poland; Jap ¼ Japan; Kor ¼ Korea; Aus ¼ Australia; Bol ¼ Bolivia. e Reference Nos.: 1 ¼ Adlard et al., 1993; 2 ¼ Hashimoto et al., 1997; 3 ¼ Itagaki and Tsutsumi, 1998; 4 ¼ Agatsuma et al., 2000; 5 ¼ Mas-Coma et al., 2001; 6 ¼ Bargues et al., 2002a; 7 ¼ Periago et al., 2004; 8 ¼ Artigas et al., 2004; 9 ¼ Huang et al., 2004; 10 ¼ Itagaki et al., 2005a; 11 ¼ Bargues and Mas-Coma, 2005b; 12 ¼ Semyenova et al., 2005; 13 ¼ Taha, 2006; 14 ¼ Alasaad et al., 2007; 15 ¼ Prasad et al., 2008; 16 ¼ Ali et al., 2008; 17 ¼ Le et al., 2008; 18 ¼ Lotfy et al., 2008; 19 ¼ Ghavami et al., 2008; pp ¼ present paper.


61

Lymnaeidae appear to be a very old gastropod group. The existence of three lymnaeid groups based on ITS-2 lengths, with Galba presenting the shortest sequences, has already been highlighted (Bargues et al., 2001). The oldest lymnaeid fossil known is Galba from the Jurassic, between 146 and 208 mya (Zilch, 1959–1960), which suggests that a shorter ITS-2 would be the plesiomorphic condition and that an increase in ITS-2 length has occurred during lymnaeid evolution. In this way, Radix and Galba may be considered the oldest taxa (370–406 base pair (bp) lengths), and Lymnaea s. str., European Stagnicola and Omphiscola (468–491 bp lengths) the most recent, with American Stagnicola and Hinkleyia being intermediate (434–450 bp lengths) (Bargues et al., 2001). This hypothesis fully agrees with the only previously published phylogeny of lymnaeids proposed by Inaba (1969) basing on palaeontological data, chromosome numbers and radular dentition. A molecular clock assessment based on a nucleotide evolutionary rate of 1.8% nucleotide substitutions per 100 million years, which is generally accepted for the 18S rDNA gene in eukaryotes (Bargues et al., 2000), suggests a divergence between G. truncatula and R. auricularia, based on their 18S sequences (Bargues and Mas-Coma, 1997), of between 61.1 mya (if both substitutions and indels are counted) and 24.4 mya (if only substitutions are counted). Such a datation fits well with the evolutionarily relatively recent divergence between F. hepatica and F. gigantica of about 19 mya estimated according to sequence analysis of cathepsin L-like cysteine proteases (Irving et al., 2003). This suggests that the Fasciola ancestor common to both F. hepatica and F. gigantica was a species infecting the liver of one or more ancient artiodactyls geographically distributed from Africa up to the Near East and transmitted by old lymnaeids (probably of the genus Radix) during the end of the Oligocene and the beginning of the Miocene periods. The two current Fasciola spp. originated then in isolation of one another, F. hepatica by adapting to G. truncatula and probably Caprinae ruminants (mainly sheep species of the genus Ovis) in the Near East, and F. gigantica by adapting to R. natalensis and ruminants (Giraffidae, Reduncinae, Alcelaphinae) in sub-Saharan Africa. Such a hypothesis for the origin of both Fasciola spp. fits perfectly with the datation of the major radiation events of ruminants during the Tertiary period. Extant Ruminantia includes two infra-orders with six mono-phyletic families: (i) the mono-phyletic Pecora (higher ruminants; generally those possessing horns, antlers or ossicones) including Giraffidae (giraffes and okapis), Antilocapridae (pronghorns), Moschidae (musk deer), Cervidae (deer) and Bovidae (cattle, sheep, goats and antelopes), and (ii) Tragulina (lower ruminants) including only Tragulidae (chevrotains or mouse deer). Antilocapridae is a sister group to Giraffidae, constituting the superfamily Giraffoidea, which in turn appears to be the sister group of a clade

62


clustering Bovidae and Cervoidea (Hernandez Fernandez and Vrba, 2005). The ruminants emerged in the Eocene radiation of selenodont artiodactyls, and are now the only really successful product of that radiation (Webb and Taylor, 1980). Their rapid diversification and geographic expansion during the Cenozoic was one of the most impressive aspects of mammalian evolution, resulting in the current most diverse group of large mammals. A composite phylogeny incorporating morphological, molecular, behavioural and palaeontological data has shown that six successive rapid cladogenesis events occurred within the infra-order Pecora during the Oligocene to middle Pliocene, which coincided with periods of global climatic change (Hernandez Fernandez and Vrba, 2005). The beginning of the pecoran radiation (33.2 mya) coincided broadly with a major glacial event at the onset of the Oligocene (Zachos et al., 2001). The clades containing the five extant pecoran families each originated in the early Oligocene between 32.0 and 28.1 mya. This rapid radiation of Pecora spanned around 4 million years and was followed by five different diversification events of around 0.5–3 million years for the Cervidae and Bovidae, whose extant sub-families and tribes began to differentiate in the early Miocene and were developed between 25.4 and 13.5 mya. The first major series of splits in the bovids may have taken place between 25.4 and 22.3 mya, giving rise to Bovinae, Antilopinae and Aepycerotinae, probably as a consequence of the abrupt climatic change events that occurred during the Oligocene/Miocene transition. The second episode resulted in an explosive radiation during the early Miocene (20.2–16.9 mya), which gave rise to the majority of extant cervid and bovid sub-families and also resulted in the origin of the Bovinae tribes. This cladogenesis was essentially associated with the coolest episode in the relatively warm climate of the early Miocene, which is related to the glacial event Mi1b (Wright and Miller, 1993; Zachos et al., 2001). The third phase comprised the split of Reduncinae and Peleinae (13.5 mya) and the diversification of Caprinae and Cervinae, with the origin of their modern tribes (14.7–14.5 mya), in a period marked by important global cooling concurrent with the development of the East Antarctica ice-sheet (Zachos et al., 2001). The fourth radiation event was the diversification of Capreolinae during the middle Miocene to late Miocene transition (11.0–10.8 mya), which coincides with the significant isotopic shift Mi5 (Wright and Miller, 1993). A fifth burst of mostly intra-generic cladogenesis took place around 2.5 mya, coincident with the major climatic crisis that triggered the onset of the Plio-Pleistocene glacial cycles (Shackleton, 1995). All these Neogene climatic events were associated with major sea level lowering and their additional consequences were large dispersal events between the Palaearctic and Nearctic (Anchitherium event, around 18 mya; ‘Hipparion’ event, 11 mya; elephant/Equus event, 2.5 mya) or Palaeotropical (proboscidean event, 18 mya; Conohyus/Pliopithecus event, 14 mya;


63

elephant/Equus event, 2.5 mya) biogeographical realms, which allowed the spread of ruminant faunas across continents (Hernandez Fernandez and Vrba, 2005). The ancestor of the two fasciolids being considered here may be found in an ancient fasciolid form infecting old Artiodactyla and living in Africa during the early Oligocene between 32.0 and 28.1 mya when the first pecoran radiation occurred. This may explain the capacity of present F. gigantica to develop a long life span in giraffes. From that ancient fasciolid, an adaptation to Tragelaphus ancestors gave rise to Tenuifasciola and a later derivation was the origin of F. nyanzae in hippopotamids of the early Miocene. It should be noted that hippopotamids colonized southern Europe and Mediterranean islands, and that the present Hippopotamus amphibius was still present in Palestina in the Neolithic and even until very recently in the northern Nile river basin. This relationship with hippopotamids may explain the capacity of present F. hepatica and F. gigantica to develop in pigs, which are evolutionarily related to hippopotami (Thenius, 1980). The origin of F. gigantica was probably the result of an adaptation of this ancient fasciolid to bovids, such as ancestors of Alcelaphinae, Reduncinae and Bovinae, during the second pecoran episode, resulting in an explosive radiation during the early Miocene (20.2–16.9 mya). The present distribution of F. gigantica suggests that such an origin was probably in a warm, tropical, eastern African region, owing to the apparent regional pattern of refugia followed by these bovids to survive climatic fluctuations (Arctander et al., 1999; Birungi and Arctander, 2000). The well-known migrating gnus, but also the African buffalo expansion from eastern to southern Africa (Van Hooft et al., 2002), were perhaps involved in the initial spread of F. gigantica throughout the regions of East and South Africa (Fig. 2.1). The origin of F. hepatica was probably in the Eurasian Near East region, as a derivation from the same ancient fasciolid or a F. gigantica-close old form introduced with ruminants from Africa somewhat later during a major sea-level lowering in the early Miocene (Tassy, 1990; Van Der Made, 1999), which fits with the estimation of around 19 mya obtained using the cathepsin molecular clock (Irving et al., 2003). In the Near East, this African old fasciolid was able to adapt due to the presence of local forms of R. auricularia as R. gedrosiana in Iran, which have been shown to transmit F. gigantica in the field (Ashrafi et al., 2004; Sahba et al., 1972). Present Iranian R. gedrosiana has proved to be identical molecularly to R. auricularia H1 according to the rDNA ITS-2 sequence (Bargues et al., 2002b) and has been found to be relatively susceptible to infection by F. hepatica (Arfaa et al., 1969; 32.5% experimental infectivity was reported by Cruz-Reyes and Malek, 1987). However, these results are still considered controversial and need to be confirmed by molecular characterization of both fluke and lymnaeid species and strains (Ashrafi et al., 2004;

Fertile Crescent

Far East exchange

Ancient Egypt Transaharan centre Nubia Bantu radiation

Southeast Asian exchange

Hawaii

Lowlands of East Africa

Proto-Khoisan spread S.M.-C.

FIGURE 2.1 Main geographical spread routes followed by Fasciola gigantica in the post-domestication period. Notes: Origin and initial dispersal with wild pecoran bovids and Radix natalensis in the lowlands of tropical East Africa during pre-domestication times included in the yellow circle. Regions playing a key role for subsequent radiation included within orange circles. Post-domestication spread throughout western Africa from around 4,000 years BC and later also thanks to tran-saharan caravan routes during the 7th to 15th centuries. Beginning of


65

Massoud and Sadjadi, 1980). In the latter geographic region, the original African fasciolid was able to colonize colder areas by adapting to Galba truncatula and early Euro-Asiatic ovicaprine ancestors that lived in that period (Hernandez Fernandez and Vrba, 2005) and gave rise to F. hepatica (Fig. 2.2). Similarly to, and together with, its African ruminant hosts, the original African old fasciolid or F. gigantica-close form would have disappeared from the Eurasian Near East region because it was not possible for it to survive the major global cooling that followed, so allowing F. hepatica to evolve independently and spread throughout colder regions of Eurasia. The origin of F. hepatica, thus, is likely to be the result of colonization of, and subsequent adaptation to, a new, more northern and temperate-colder region, as well as the result of two host capture phenomena to smaller lymnaeid species of another lineage such as Galba and to mid-sized ruminants. Consequently, the origin of F. hepatica would be somewhat more recent than that of F. gigantica, which would explain its less-marked specificity at both intermediate snail host and mammalian definitive host levels. The greater mobility of such mid-sized ruminants and the adaptation to a globally rich lymnaeid lineage have been crucial in facilitating its later geographic spread in both ruminant predomestication and livestock post-domestication times. The initial spread throughout the temperate and cold regions of Europe, Near East and Asia northern to the Himalaya chain, where G. truncatula was present (Ashrafi et al., 2007; Bargues et al., 2001; Kruglov, 2005), could have taken place due to the diversification of Caprinae which occurred 14.7–14.5 mya and, related to its scarce specificity, to the use of other mild-cold habitat adapted bovids such as the mainly grass-eating, flatland-inhabiting Bos and Bison and perhaps also to less forest-adapted cervines. The divergence of Ovis and Capra 11.3 mya and later species

southwards African spread in the third and second milleniums before Christ (BC), later facilitated by Bantu peoples in west and central Africa and by Proto-Khoisan peoples into South Africa from 1 millennium BC. Northwards spread by means of the animal transit carried out by ancient Nubians and Egyptians all along the Nile from the fourth and third milleniums BC. Transit between Africa and the Near East taken place due to exchange between ancient Egypt and peoples of the Fertile Crescent during these periods BC and adaptation to Eurasian R. auricularia. Eastwards spread into Asia following a route southern to the Himalayas up to South-east Asia probably already from the 3,000–1,000 BC period and another northern to the Himalayas through Turkmenistan, Uzbekistan, Tajikistan and Kirgizstan, up to China and the Far East occurred probably more recently, between the 2nd Century BC and the 15th Century after Christ (AC), with subsequent exchange between Far Eastern and South-east Asian regions. Colonizations of islands such as Madagascar, Indonesia, Japan and Hawaii from unestablished mainland origins in more recent times (blue lines). For details, see text.

Western Europe

Fertile Crescent

Iberia Caribbean

Ancient Egypt Nubia Proto-Khoisan spread

S.M.-C.

FIGURE 2.2 Main geographical spread routes followed by Fasciola hepatica in the post-domestication period. Notes: Origin and initial dispersal with wild ovicaprines and Galba truncatula in the Near East during pre-domestication times included in the yellow circle. Regions playing a key role for subsequent radiation included within orange circles. Post-domestication spread throughout the Old World originated in the Fertile Crescent from around 6,000 years before Christ (BC) (black lines). A westwards spread into central and northern Europe originated through the Balkans and Turkey-Greece probably in the fourth and at least third milleniums BC. Another westward route was by sea through the Mediterranean probably as early as with the Phoenicians (but perhaps also later with Romans) from the Levant up to colonize northwest Africa and Iberia from the 8th Century BC. The eight-hundred-year long Moorish occupation of Iberia shall have played a role of liver fluke exchange


67

diversification within these two genera 5.1–6.8 mya (Hernandez Fernandez and Vrba, 2005) may have facilitated the initial dispersal of this fasciolid species. However, the absolute lack of mutations in the ITS-1 sequence and the very scarce mutations in ITS-2 throughout the Palaearctic Region (Tables 2.1 and 2.2) suggest that such an initial spread was very restricted and that the main geographic expansion of F. hepatica has mainly happened more recently, most probably during the post-domestication period.

2.8. EVOLUTION OF FASCIOLA SPECIES IN THE POST-DOMESTICATION PERIOD Numerous recent genetic studies have revealed the remarkably complex picture of domestication in both Old World and New World livestock. Comparison of the mitochondrial and nuclear DNA sequences of modern breeds with their potential wild and domestic ancestors, together with archaeological and historical data, have provided new insights into the timing and location of domestication events that have produced the present farm animals with their geographical distribution of today: a surprisingly high number of domestication events in diverse locations have taken place (Bruford et al., 2003; Hernandez Fernandez and Vrba, 2005). Taking all this into account may greatly help in understanding the present distribution of F. hepatica, F. gigantica, their genotypes and their phenotypically intermediate or genetically hybrid forms.

with north-western Africa through Gibraltar. The eastward spread into Asia also followed two routes, a geographically restricted one southwards through highlands of Afghanistan and only up to Pakistan, probably in the fourth and third milleniums BC, and another longer one through Turkmenistan, Uzbekistan, Tajikistan and Kirgizstan, up to China and the Far East taken place more recently, probably between the 2nd Century BC and the 15th Century after Christ (AC). Initial southwards spread through Egypt into Africa was apparently only a transit (thin black lines), as the fluke species did not successfully colonize Egypt from Europe until the 20th Century (introduction line not figured). However, it probably adapted to ancient Nubia around the fourth and third milleniums BC from where it further expanded southwards to areas of present Kenya and Tanzania with Nubians in the third millennium BC, and even more southwards up to South Africa with the Proto-Khoisan peoples from 1 millennium BC. Transoceanic spread routes for the colonization of Oceania and the New World taken place in the recent 500 years (blue lines). Secondary colonization routes followed within the Palaearctic Region and the Americas, and spread of F. hepatica-like introgressed hybrid forms in the Indian subcontinent, South East Asia and the Far East not included. For details, see text.

68


2.8.1. Recent spread of Fasciola hepatica The almost total lack of mutations in the rDNA ITS-1 and ITS-2 sequences in F. hepatica (see below) supports an evolutionarily very recent spread from its origin in the Eurasian Near East area to the rest of the world, which is undoubtedly related to human activity. This includes passive exportation/importation involving (i) initially, mid-sized and readily mobile sheep and goats, (ii) secondarily, several large-sized herbivore species, all of which are also good definitive hosts for liver flukes, including cattle but also oxen, buffaloes, yaks, horses, donkeys and mules, which were used for the terrestrial transport of goods and merchandise over both short and long distances (even between different countries), (iii) later, colonizations of other continents by ancient Europeans, together with the introduction of European livestock and equids, and also adaptation to new host species that were also used for transportation, such as Andean camelids (mainly llamas), and (iv) more recently, to the progressive livestock trade, as well as to (v) different lymnaeid vector introductions (Mas-Coma et al., 2003).

2.8.2. Initial step in the Near East Wild herbivore domestication began around 10,000 years ago at the dawn of the Neolithic in the region known as the Fertile Crescent, a formerly fertile, now partly desert, area in the Near and Middle East that was an agricultural region extending from the Levant (lands bordering the Eastern shores of the Mediterranean and Aegean seas) eastwards including modern-day Israel, Jordan, Lebanon and western Syria, into south-east Turkey and, along the Tigris and Euphrates rivers, into Iraq and the western flanks of Iran (Mac Hugh and Bradley, 2001). The Neolithic period was an era of major changes in human life. Goats, in the form of their wild progenitor (the bezoar Capra aegagrus) were the first wild herbivores to be domesticated. Sheep and goat domestication played an important role in the phenomenon of neolithization occurring in the late prehistory of the Near and Middle East, during the climatic optimum (between 9000 and 5000 BC), giving rise to a sedentary way of life. Data from the numerous neolithic human settlements found throughout this region strongly point to it as a major domestication centre for livestock species, mainly goats and sheep, but also cattle and pigs (Pedrosa et al., 2005). The Neolithic culture expanded out of the Near East into the Balkans, Greece and into Northern Central Europe after 6400 BP (Fig. 2.2). By adapting to early-domesticated animals in the Fertile Crescent, F. hepatica took an initial crucial step that would enable it to spread from that region, to colonize almost the whole world as seen today. Such spread took place westwards into Europe, eastwards into Asia and


69

southwards into Africa, with specific characteristics in each one of these continents. Galba truncatula should have been present in the early Fertile Crescent and in fact the ITS-2 haplotype H2 found today in Iran (Ashrafi et al., 2007; Bargues et al., 2002a) is widely distributed in Europe (Portugal, Spain, France and The Netherlands) (Bargues et al., 2001).

2.8.3. Westwards spread into Europe The presence of G. truncatula throughout Europe (Gloer and Meier-Brook, 1998) constitutes the main factor in understanding the successful colonization of this continent. Evidence suggests that sheep, goats and cattle all played a major role in spread. Recent molecular studies on livestock species indicate that two main routes were followed from the Near East, one widespread through central Europe and reaching the most northwestern territories and another southern, most probably using marine routes throughout the Mediterranean Sea (Fig. 2.2). The findings of Fasciola eggs in human coprolites collected in archaeological sites in France, The Netherlands, Denmark, Germany, Austria, Poland and Switzerland (see review in Mas-Coma et al., 2005) and dated back to the Stone Age, the end of the Mesolithic period (5,000–5,100 years ago), Neolithic, Bronze Age, Gallo-Roman period and Middle Ages (Bouchet et al., 2003) support European colonization by F. hepatica in prehistoric times. Appropriate genetic studies on F. hepatica comparing northern and southern European populations should be carried out to verify whether old imprints can still be detected and to trace the different European routes taken by F. hepatica. In the only study of this kind using flukes from naturally infected sheep and cattle (Walker et al., 2007), haplotype frequencies showed a leptokurtic distribution (a few very frequent haplotypes and many rare haplotypes), with 35 distinct mitochondrial haplotypes recorded in Ireland (from where the great majority of the samples were sourced), seven in Greece (five original and two shared with Ireland), and two in The Netherlands (both original), indicating evidence of a geographical effect. Interestingly, the presence of two haplotypes in both the Irish and Greek populations suggested that these haplotypes were especially ancient. The very high level of diversity observed, both within individual hosts and between hosts, suggested an unusually high rate of nucleotide substitution in F. hepatica, haplotype divergence estimates ranging between 8,500 years and 2.5 mya. These authors found it difficult to support the fact that such a degree of variation could have arisen in northern Europe in only 10,000 years since the last Ice Age. It was, therefore, concluded that these lineages must have developed in pre-glacial mammalian hosts in southern Eurasia or Africa, and were later introduced into Europe and Ireland in the post-glacial period. This may have occurred either in association with wild definitive hosts such as

70


deer, aurochsen or bison, or after the domestication of cattle and sheep and their introduction into Europe in the Neolithic (Walker et al., 2007). These results suggest that an initial diversification of F. hepatica populations already took place in pre-domestication times, probably in the Near East, and that several of these old genotypes would have been transported with livestock movements during the post-domestication period. This agrees with the numerous recent genetic studies indicating different domestication events for each livestock species. Up to five original sheep mtDNA lineages have been found in the Near East, suggesting different domestication events around a Neolithic centre located in the Levant (Meadows et al., 2007). Clade A appears to be a mixture from the Middle East, Asia and Europe. The very common clade B, with relationships to European mouflon (Ovis musimon), dominates in Europe, as in many other parts of the world (Hiendleder et al., 2002; Meadows et al., 2006). Clade C has been reported in Portugal. The genetic diversity in Portuguese sheep, which is substantially above that observed in central Europe and including lineages only found in the Middle East and Asia, is worth mentioning. This has been related to ancient introductions, suggesting a flow from the Fertile Crescent to the Iberian Peninsula. Besides prehistoric contacts, a possible influx of domestic sheep could have occurred with the Phoenicians, Greeks and/ or Romans. The most plausible explanation is the extensive use of a Mediterranean route by sea and/or along Mediterranean coastal regions in the 11th and 12th Centuries, without forgetting the well-documented exchange between Iberia and the Maghreb during the Moslem period. Anyway, more recent introgressions from imported oriental breeds over the past 150 years cannot be disregarded (Pereira et al., 2006). Clade D, from north Caucasus, appears to branch with the eastern mouflon (Ovis orientalis), urial (O. vignei), and argali (O. ammon) sheep, and clade E has been found to link groups A and C (Meadows et al., 2007). The goat was one of the first animals to be domesticated around 10,000 years ago during the Neolithic in the Fertile Crescent. The ancient divergence time over 200,000 years ago and the different geography of the three major mtDNA lineages (the most common A in all continents; B in India, Mongolia and south-east Asia; C in Mongolia, Switzerland and Slovenia) (Luikart et al., 2001) suggested either multiple domestication events or introgression of additional lineages after the original domestication (Mac Hugh and Bradley, 2001). A domestication site in southern Turkey, another in the Near Eastern Zagros region and a more recent one in the Indus Basin have been proposed (Luikart et al., 2001). Previous studies, revealing an unexpectedly high diversity in breeds of Iberian domestic goats (Pereira et al., 2005) and a differential cattle migration along the Mediterranean coast (Cymbron et al., 2005), further substantiate the importance of the Mediterranean in past livestock movements by


71

connecting Iberia to the Near East, North Africa and southern Europe, together with the climatic similarities of Iberia and the Near East. This most probably involved domestic sheep and goats, given their environmental adaptability and the ease with which they can be transported (Pereira et al., 2006). It is generally accepted that the first steps towards cattle domestication occurred in south-west Asia and that domesticated cattle entered Europe with shepherds migrating from this region (Caramelli, 2006). A high frequent ancestral sequence supports the early post-domestication expansion of cattle in Europe (Mac Hugh et al., 1999). Although it is known that the wild ancestor of cattle (the aurochs Bos primigenius) ranged widely throughout Europe, inference from Neolithic and Bronze Age European B. taurus mtDNA from archaeological sites along the route of Neolithic expansion, from Turkey to North-central Europe and the United Kingdom, suggests that bovine maternal lineages (at least) have a Near Eastern rather than a local origin (Bollongino et al., 2006). However, local hybridization with male aurochsen has left a paternal imprint on the genetic composition of modern central and north European breeds (Go¨therstro¨m et al., 2005). In Portuguese cattle, both African and European taurine haplotypes have been found. This African influence may reflect an inter-continental admixture in the initial origins of Iberian breeds, or an introgression dating from the long Moorish occupation of Iberia (Cymbron et al., 1999). However, no strong evidence for an African influence in Iberian cattle was detected subsequently (Beja-Pereira et al., 2003).

2.8.4. Eastwards spread into Asia Biogeographic, climatic and lymnaeid faunal data indicate that two different main routes from the Fertile Crescent and eastwards separated by the large Himalayan chain need to be considered. One includes the spread of F. hepatica through the Caspian Sea area northwards and also eastwards through the region of Iran, Turkmenistan, Uzbekistan, Tajikistan and Kirgizstan, up to China, Mongolia and the Far East. Another expanding area was offered by the southern Asian region, although the restriction of G. truncatula to highlands in countries such as Afghanistan and Pakistan (Kendall, 1954) and its absence as well as the lack of appropriate lymnaeids for the development of F. hepatica in India and South-east Asia, suggest that it found an insurmountable climatic barrier to its spread further eastwards in southern Asia (Fig. 2.2). The history of ruminant movements fits with such a spreading dichotomy. In the North, Chinese sheep, including modern (Guo et al., 2005; Meadows et al., 2007) and ancient sheep (Cai et al., 2007), showed haplotypes A, B and C. This, together with the weak structuring observed either

72


among Chinese indigenous sheep or between Asian and European sheep is attributable to extensive long-term gene flow induced by historical human movements (Chen et al., 2006). In the south, goats range from the high altitudes of the Himalayas to Rajasthan deserts and the humid coastal areas of India. The 123 million or so goats in India make up approximately 20% of the world’s goat population. All Indian domestic goat lineages fall into a mono-phyletic group derived from an unknown, rare or extinct population. Goats probably accompanied the Indo-Aryan speakers who entered India about 3,500 years ago. The Pashmina goats that adapted to living in a cold environment at high altitudes in the Himalayas appear to have had a different demographic history from the other breeds (Joshi et al., 2004). With regard to cattle, evidence supports at least two domestication events from two different wild auroch races of Bos primigenius which diverged between 1 million and 200,000 years ago: taurine cattle Bos taurus arose in the Near East and possibly North Africa, while zebu Bos indicus had domestic origins in India (probably in the Baluchistan region) (Loftus et al., 1994). Analyses revealed a B. taurus influence in the Indian sub-continent, part of a broad geographic pattern of introgression with a cline in admixture stretching through the fringes of Europe, Anatolia and the Middle East towards India, explained by either an ancient or a more recent introduction of B. taurus into the Indian sub-continent. Archaeological evidence for long-distance trade indicates that there has been continuous contact between the Indus region and Mesopotamia since the fourth millennium BC. During the third millennium, some subsistence species spread westwards, including Asian water buffaloes. The dispersal of B. taurus cattle into South Asia, and the counter-flow of B. indicus into Mesopotamia and the Levant are part of the prehistoric transfer of subsistence species between these two primary centres of agricultural innovation (Kumar et al. 2003). Taurine clusters suggested timelines of 11,768, 10,928 and 8,904 years for Europe, Near East and Africa, respectively, whereas two star-like events suggested population expansions in zebu, with estimates indicating Neolithic transition and independent domestication in India (Baig et al., 2005). Cattle from north-east Asia have been shown to be closely related to cattle from Europe and Africa, suggesting their recent divergence, but appear to be well separated from Indian zebus (Kim et al., 2003). The domestication history of modern Asian domestic cattle can be explained by male-mediated introgression. The existence of mtDNA types, such as the Bali-zebu in Indonesia and the yak-zebu in Nepal, suggests that genetic introgression also occurred from other genera into domestic cattle during the process of domestication (Kikkawa et al., 2003). More recently, the so-called Silk Road, which was active over 15 centuries, from around 138 years BC until the 15th Century, connected


73

the eastern city of Changan (today called Xian) in China with the central Asian city of Samarkand and other more western localities of the Near East by three routes through Kirgizstan, Tajikistan, Uzbekistan and Turkmenistan in the north and another southern to the Himalayas through India (De la Brosse, 2008). Camels, taurine and zebu cattle were mainly used for the transportation of goods and merchandise, while dromedaries were later incorporated into the most southern routes of the Silk Road through Afghanistan, Pakistan and India because of their better adaptation to warmer climates (Bulliet, 2004). In the Uzbekistanian Samarkand, F. hepatica was found in 45, F. gigantica in 25, and both species in 11 inhabitants of a total of 81 examined post-mortem and in whom fascioliasis infection was found incidentally in all subjects (Sadykov, 1988). More northwards, the so-called Fur Road enabled a trade between forest areas of Poland, Russia and Siberia (Chapoutot-Remadi and Daghfous, 2004), which may have participated in a fasciolid exchange between Asia and northern Europe up to the Balkans and Scandinavia.

2.8.5. Southwards spread into Africa The present distribution of F. hepatica and G. truncatula in Africa may be divided into three different regions (Fig. 2.2): The north-western African region includes the present countries of

Morocco, Algeria and Tunisia, characterized by seasonally mild temperatures that enable the development of G. truncatula over at least several months as well as in the southern altitudes of the Atlas mountains (Brown, 1994; Goumghar et al., 2004; Khallaayoune et al., 1991) and by the absence of R. natalensis and R. auricularia. In the Maghreb, sheep and goats have been documented from the eighth millennium before present period (Clark, 2004). Sub-fossil data from Algeria and Chad suggest that G. truncatula has been there for a relatively long time and was even able to spread somewhat southwards during the Late Pleistocene and Holocene into areas that are now desert. Radix natalensis inhabited areas of the Saharan region before it was a desert during the Late Pleistocene and Holocene but later disappeared from the northwest and Saharan areas. Radix auricularia does not appear to have been introduced from Europe into this north-west African region (Brown, 1994; Van Damme, 1984). The absence of F. hepatica in Egypt at the beginning of the 20th Century (Looss, 1896) suggests that it did not enter north-western Africa from north-eastern Africa, but was most probably introduced from the Levant. This was either through a Mediterranean maritime route during the prehistoric times of the Phoenicians and Greeks, or somewhat later in the Roman period, or later still due to

74


the medieval common Mediterranean market during the 11th and 12th Centuries, or also through the Gibraltar Strait during the several centuries the Arabs occupied Iberia. The large western, sub-Saharan and central African region is characterized by the presence of only one lymnaeid species, R. natalensis (Brown, 1994), a snail distributed throughout Africa except in the coastal region of East Africa and Namibia (Van Damme, 1984). This snail is resistant to F. hepatica infection (Cruz-Reyes and Malek, 1987), which a priori would not allow the introduction and successful colonization by this liver fluke species. Eastern Africa from its extreme northern Mediterranean shore to southern Africa includes one area of distribution in Egypt, another large but isolated area in Ethiopia, another area to the south including Kenya and Tanzania, and finally a larger area in South Africa and Lesotho (Brown, 1994). This eastern region comprising isolated foci is characterized by the presence of G. truncatula, in the irrigated flat lowlands of the Nile Delta in Egypt (Van Damme, 1984) where F. hepatica only began to appear from the mid-1990s in introduced (i.e. non-authochthonous) animals (El-Azazy and Schillhorn Van Veen, 1983), in the milder highlands of the equatorial eastern countries (Brown, 1994), and in South Africa, where the introduction of Pseudosuccinea columella, which was first noted during the 1940s (Brown, 1994; Van Damme, 1984), may also be involved in transmission (Appleton, 2003). It has recently been confirmed that domesticated sheep and goats entered Africa from South-east Asia, but this was not the case for cattle, which had already been independently domesticated by inhabitants of the eastern Sahara 9,800–8,000 years ago. Data indicate that this African cattle domestication took place in Egypt, due to the improving climatic conditions between 12,000 and 5,000 years ago, with records of domesticated cattle appearing already in the Egyptian Predinastic period. Sheep and goats entered somewhat later, as deduced from their absence in the prehistoric period in the Lower Nile region (Bo¨ko¨nyi, 2004). Cattle and sheep are documented in northern Egypt and the Neolithic of Fayum from the seventh millennium BC (Clark, 2004). These small ruminants progressively expanded because of their better adaptation to the increasingly drier conditions of that area during the Neolithic (Bo¨ko¨nyi, 2004). Domestic sheep in Africa appear to belong to the most widespread worldwide haplotype (Meadows et al., 2006). It is worth noting that the Mediterranean Sea acted as a natural corridor connecting the north-east of Africa to Iberia, southern Europe and the Near East, either through long-distance movement or shorter routes through Gibraltar (Pereira et al., 2006).


75

In Africa, the earliest cattle domesticated were humpless B. taurus and they may have shared a common origin with the ancestors of European cattle in the Near East. Alternatively, local strains of the wild ox, the aurochs, may have been adopted by peoples in either continent either before or after the cultural influence from the Levant. Sequences from extant bovines from Africa, Europe and India cluster into continental groups, indicating a B. taurus nature for both European and African ancestors. Estimates suggest the domestication of different aurochsen strains as the origins of each continental population. Results showed a separate African domestication of taurine cattle, revealing that the earlier cattle in Africa originated within the continent and were the subject of later introgressions from Europe and the Near East (Hanotte et al., 2002; Loftus et al., 1999; Mac Hugh et al., 1997). The initial expansion of African B. taurus was likely to have been from a single region of origin. Patterns indicative of population expansions (probably associated with the domestication process) are discernible in Africa (Bradley et al., 1996). Bos taurus reached the southern part of the continent via an eastern route rather than a western one. The genetic signatures of African cattle pastoralism, its origins, secondary movements and differentiation were revealed in indigenous cattle breeds spanning the present cattle distribution in Africa (Hanotte et al., 2002). Domesticated taurine cattle were thought to have entered Africa in successive waves from south-west Asia, while zebu cattle seems to have moved in great numbers into Africa at a later date from Arabia and India. Arab settlements from the end of the 7th Century may represent a major entry point through the Horn and the east coast of Africa followed by introgression in the continent (Caramelli, 2006; Hanotte et al., 2002). Introgression of zebu-specific alleles in African cattle afforded a highresolution perspective on the hybrid nature of African cattle populations (Mac Hugh et al., 1997). The clustering of all African zebu mtDNA sequences within the taurine lineage is attributed to ancestral crossbreeding with the earlier B. taurus inhabitants of the continent (Loftus et al., 1994). The indicine allele dominates today in the Abyssinian region, a large part of the Lake Victoria region and the sahelian belt of West Africa. The taurine allele is most common only among the sanga breeds of the southern African region and the trypanotolerant taurine breeds of West Africa. Human migration, phenotypic preferences by shepherds, adaptation to specific habitats and specific diseases are factors explaining the present-day distribution of the alleles in sub-Saharan Africa (Hanotte et al., 2000). In Ethiopia, the dry flatlands between the Nile mid-valley and the plateaus, including the Sudanese Nile valley south to Nubia, were continuously occupied in prehistoric times, at least from the fourth millennium BC. During this period, domesticated livestock in these flatlands included

76


cattle, sheep and goats. In the third millennium and mainly mid-second millennium BC, Ancient Egypt already had strong trade relationships with southern civilizations in which pastoralism and transhumance involving domesticated cattle and small-sized livestock has been initiated a long time before. In Sudan, small livestock were bred in the western part of the Nile in the flatlands and even close to the present northern limit of the forest. In contrast, cattle only appeared much more recently in drier parts, eastwards from the Nile (Diop-Maes et al., 2004). In Ethiopia and Somalia, domesticated cattle, sheep and goats appeared in the period 3,000 to 1,000 years BC, these animals undoubtedly deriving from the North probably because of southwards movements forced by increasing drought. With regard to cattle, initially, only taurines were involved, but zebus and also camels began to appear somewhat later. Data suggest that zebus were not frequent before the first half of the first millennium BC. In the Ethiopian plateaus, taurine cattle were already being used for ploughing 3,000 years ago, which is significantly before the European colonization. Domesticated bovids were shown to be in Central Ethiopia during the second millennium BC (Diop-Maes et al., 2004). With regard to Kenya and northern Tanzania, people appear to have domesticated cattle and small ruminants from the second millennium BC, whether initially linked to areas around lakes or later to nomad pastoralism as a consequence of increasing drought (Diop-Maes et al., 2004). In the most southern parts of East Africa, livestock only appeared in the last part of the second millennium BC. Taking into account that cattle, sheep and goats were undoubtedly of northern origin, the chronological sequence indicates slow movement from north-east Africa towards south-east Africa. In the Neolithic period in East Africa, taurine cattle appeared first in the southern-most regions, whereas zebus seem only to have appeared in Kenya in the more recent centuries BC (Diop-Maes et al., 2004). The chronology of the aforementioned events describing livestock spread throughout eastern Africa allows an understanding of the present distribution of F. hepatica and G. truncatula, with a first focus linked to the plateaus of Ethiopia, a second large focus related to the highlands of Kenya and Tanzania and a third large endemic area in South Africa. This dispersed distribution suggests, first, that both F. hepatica and G. truncatula were introduced from South-east Asia, most probably together with sheep and goats. The absence of F. hepatica in Egypt later, as deduced from studies at the end of the 19th Century (Looss, 1896), may be explained by its disappearance (assuming it did once establish there) due to increasing temperatures and drought. One sub-fossil finding of G. truncatula in Lower Egypt and another in Upper Egypt are noted by Van Damme (1984). The re-appearance of both the fasciolid and the lymnaeid in Egypt today may be explained by a very recent introduction


77

(El-Azazy and Schillhorn Van Veen, 1983; Soliman, 1998), which succeeded thanks to the new, suitable environmental conditions arising from human-made irrigation systems after construction of the Aswan dam. The present absence of both the fasciolid and the lymnaeid in Sudan may be explained similarly, the high temperatures and drought of Sudanese flatlands not allowing their survival and having led to their disappearance, although livestock of old Nubian civilizations during the fourth, third and second millenniums were likely to have been infected by F. hepatica if G. truncatula was able to establish due to appropriate climatic conditions. In the more southern plateaus of Ethiopia and highlands of Kenya and Tanzania, climatic characteristics such as milder temperatures and sufficient rainfall explain their survival until now (Malone et al., 1998; Yilma and Malone, 1998), after having been introduced by livestock from a northern origin during the third and second millenniums BC. The presence of sub-fossil G. truncatula in a southern Ethiopian locality near Lake Stephanie, close to the border with Kenya (Piersanti, 1941), supports such an introduction long ago. Present records of G. truncatula at moderately high altitudes on both sides of the Rift Valley in Ethiopia suggest that it may also occur at lower altitudes as for instance in Tanganyika (MandahlBarth, personal communication in Brown, 1965, p. 49). Finally, their present occurrence in South Africa (De Kock et al., 2003; Pantelouris, 1965) appears to have been the consequence of a more recent introduction. In southern Africa, sheep appeared already in the first centuries of the Christian period (Clark, 2004). The southwards spread of the ProtoKhoisan peoples from areas of Tanzania, Zambia, Malawi and Mozambique during the first millennium AC (Gamrasni, 2008), may have perhaps also contributed in the transportation of F. hepatica and G. truncatula towards the aforementioned more southern latitudes, where it was easier to establish because of lower temperatures (De Kock et al., 2003).

2.8.6. Transoceanic spread into Oceania and the Americas The spread of F. hepatica into Oceania and the Americas was marked by human colonizations (Fig. 2.2). The success of these colonizations was due to (i) the adaptation of F. hepatica to different lymnaeid species authochthonous to these continents, such as L. tomentosa in Australia and New Zealand (Boray, 1969; 1982) or members of the Galba/Fossaria group in Latin America (Bargues et al., 2007b), as well as to (ii) the introduction of susceptible, exotic lymnaeid vector species, including P. columella in Australia (Boray, 1978) or both P. columella and G. truncatula in New Zealand (Boray, 1978) and South America (Malek, 1985; MasComa et al., 2001, 2003, 2005, 2007). The successful introductions benefited not only from the livestock transported by the initial colonizers, but also from the adaptation of the liver fluke to susceptible, native mammalian

78


hosts: wild kangaroos and other marsupials in Australia (Spratt and Presidente, 1981) and Andean camelids in South America (Cafrune et al., 1996; Guerrero and Leguia, 1987; Rickard and Bishop, 1991; Timoteo et al., 2005), llamas and alpacas having been actively involved in subsequent fascioliasis spread because of their use for transporting goods and merchandise transportation throughout the Andean highlands. It should be noted that during a radiographical review of 60 livers from pre-Columbian, Peruvian mummies, one liver of a child between 3 and 10 years of age from 1,200 years ago showed remains of a necrotic parasite with spines and a cuticle with an immature ovary seen in some sections. This parasite was ascribed to F. hepatica, although no eggs were found in the faeces to confirm the diagnosis (Wells et al., 2003). Unfortunately, this finding suggesting ‘immature F. hepatica’ was never published in a scientific journal and the insufficient information available does not allow a definitive conclusion on whether F. hepatica was present in the New World around 700 years prior to the arrival of the European colonizers. Even accepting that the reference to a cuticle was simply a mistake of terminology (trematodes have no cuticle but a tegument), it becomes very difficult to accept the existence of F. hepatica in South America 1,200 years ago. If it was there so long ago, how and from where could it have arrived and which were the animals acting as normal definitive hosts and maintaining its lifecycle? Present knowledge about South American authochthonous herbivore mammals susceptible to F. hepatica infection and living in Peru indicate that Andean camelids should be considered only very recent hosts owing to the very high pathogenicity of the liver fluke in them, and Andean rodents such as Caviidae and Cricetidae do not appear to have sufficient body size to play the role of an appropriate definitive host. This, together with the fact that no eggs were found, suggests that another helminth, probably not able to develop to maturity in humans, was involved. The colonization events of both Oceania and the Americas were launched from the western countries of Europe, which means that the F. hepatica foci present in Spain, Portugal, France, the United Kingdom and also The Netherlands during the 15th to the 19th Centuries were presumably the population origins for such introductions through the oceans. Sheep and cattle were the livestock species most transported by human colonizers, although goats were also included in the ships. Two domestic sheep lineages in New Zealand were characterized as of Asian (clade A) or European (clade B) origin (Hiendleder et al., 1998). Another domestic sheep lineage was likely to have been founded following the domestication of European breeds and was used to trace the recent transportation of animals to both Australia and the Caribbean


79

(Meadows et al., 2006). An Iberian sheep breed, the carpet-wool Churra, was very important in the colonization of the New World and was the first sheep to be introduced into the Americas (Pereira et al., 2006). With regard to North America, cattle from the colonial Spanish era were introduced and still persist in small numbers in the south-west and south-east of the United States (Sponenberg et al., 1992). Most of the zebu cattle that entered the United States were breeds originating in India, although the large majority of zebu that entered during the last 100 years belonged to the Indu-Brazil breed developed in Brazil (Sanders, 1980). A major contribution of the matrilineages of taurus origin has been shown in the pure bred American zebu (Meirelles et al., 1999). In the Caribbean, a founding population of approximately 300 Iberian taurine cattle was first introduced by Spanish explorers in 1493 (Mirol et al., 2003). During the first two decades of the colonization, Europeans introduced a relatively small number of animals. However, by 1525, Spanish cattle had already spread throughout the Caribbean and much of Central and South America. Cattle taken by the Spanish mostly originated in Andalucıá and belonged to the long-horned breeds of Western Europe, which corresponds to the Celtic breeds located mainly in Southwest Iberia, whereas cattle taken by the Portuguese to Brazil belonged to the solid-coloured breeds of Central Europe, mainly distributed in the north-west of Spain and Portugal (Mirol et al., 2003). West African cattle are also thought to have entered during the 16th and 18th Centuries, as a consequence of slave trade routes, whereas zebu, mainly males from India, were imported in the 19th and 20th Centuries. European-related and African-related haplotypes were found in native Argentinean and Brazilian cattle breeds descended from Iberia. Iberian cattle appear to have been influenced by eastern Sahara B. taurus descendants before the spread of B. indicus in Africa (Mac Hugh et al., 1997), which is consistent with the history of the Iberian Peninsula. Given that all the American native cattle have their roots in the Iberian B. taurus, it follows that mitochondria of European and African origin may be expected in them (Miretti et al., 2002). The zebu Y-chromosome haplotype showed highest frequencies in Brazil, was absent in Uruguay and Argentina, and exhibited intermediate values in Bolivia. This east/west and north/south gradient of male zebu introgression can be explained by historical events and environmental factors (Giovambattista et al., 2000). African sequences were also found in Argentinean and Bolivian Creole cattle that were direct descendants of animals brought by the Spanish and Portuguese during the 16th Century. Animals could have been moved from Africa to Spain during the lengthy Arabian occupation, which started in the 7th Century, and from Iberia to the Americas eight centuries later. However, since African haplotypes were not found in the Spanish sample studied, the possibility of cattle being transported directly from

80


Africa could not be disregarded (Mirol et al., 2003). Alleles of B. taurus and B. indicus seen in Creole cattle of the Caribbean islands may reflect zebu introgressions from either direct importation from Africa or India (Magee et al., 2002), or indirectly introduced from Iberia (Miretti et al., 2004). Both African and European taurine haplotypes are present in Portuguese cattle, which is consistent with historical records (Cymbron et al. 1999), although there was no strong evidence for an African influence in Iberian cattle analyzed subsequently (Beja-Pereira et al., 2003). Moreover, other hosts introduced by Europeans may also have played a role in liver fluke diffusion in South America and the Caribbean, such as equids (Apt et al., 1993; Mas-Coma et al., 1997). Horses and mules were traditionally used for long-distance transportation of both humans and goods. A pattern of multiple domestication events has been proposed for horses, including one cluster well represented in Iberian and north-west African breeds, which may be the consequence of the Arab presence in Iberia for centuries (Jansen et al., 2002). Donkeys are still numerous in many human endemic areas in Andean countries and are usually used for short-distance transportation even today (Mas-Coma et al., 1997). The existence in Spain of divergent donkey lineages of African origin has been confirmed (Aranguren-Mendez et al., 2004). Pigs significantly contribute to the transmission of the disease in human endemic areas in the Andean altiplanos and valleys (Apt et al., 1993; Mas-Coma et al., 1997) and on the island of Cuba (De la Fe Rodriguez et al., 2007). Recent genetic data have revealed multiple centres of pig domestication across Eurasia, and that European, rather than Near Eastern, wild boars are the principal source of modern European domestic pigs (Larson et al., 2005).

2.8.7. Recent spread of Fasciola gigantica The restriction of F. gigantica to the Old World may be explained by the absence of lymnaeid species of the genus Radix in the New World. Although Radix spp. such as R. auricularia have been introduced into the United States (Bargues et al., 2001; Hubendick, 1951), there are only very scarce and isolated populations. Three key phases can be distinguished in the spread of F. gigantica throughout Africa and Asia from its origin in the East African region.

2.8.8. Westwards and southwards spread throughout Africa Spread throughout Africa south to the Sahara, in areas where R. natalensis was present, probably occurred only in recent times by means of domesticated cattle, sheep and goats, reaching western Africa up to Senegal (Amoah et al., 2005; Ndiaye et al., 2004; Schillhorn Van Veen, 1980; Vassiliades, 1978) and giving rise to very high prevalences in these


81

domestic species in West Africa (Spithill et al., 1999). The Sahara was a key region during the recent Pleistocene, because of the great changes induced by climatic fluctuations. At the peak of glaciation, the Sahara was extremely dry and uninhabited. At the end of the Pleistocene and beginning of the Holocene, living conditions improved and the Sahara became colonized again in the north and south. Around 10,000 years ago, the Sahara had much more rainfall than today, with dispersed large marshes and lagoons. In the western Sahara, it is thought that sheep were already present 9,000 years ago and that, in the seventh millenium BP a successful pastoral economy developed based on the breeding of cattle and small livestock. When desert conditions returned, somewhat later than 5,000 years ago, shepherds were pushed southwards to the Sahel and savannah, together with their cattle, sheep and goats (Clark, 2004). This explains the sub-fossil, Late Pleistocene-Holocene findings of R. natalensis throughout the present Sahara desert, which it colonized when climatic conditions were suitable, although this lymnaeid apparently never reached the northern latitudes of Morocco, Algeria and Tunisia (Van Damme, 2004), probably because of the unfavourable cooler temperatures there (Fig. 2.1). The ancient Egyptian civilization was also connected with western Saharan human settlements. The westwards spread of livestock and shepherds is evidenced by findings in northern Niger where shepherds with cattle were present in the fourth millennium BC. Increasing desertification pushed shepherds and livestock southwards in the third and second millenniums BC. African trypanosomiasis and the distribution of tsetse flies were perhaps the reason for the delay in domesticated livestock and shepherds reaching more southern latitudes in western Africa (Diop-Maes et al., 2004). During the seventh to 15th centuries, livestock breeding and agriculture co-existed, with certain nomadic tribes becoming specialized in large-scale breeding of cattle, sheep and camels. Economic activities in western Africa were dominated by trade, with the region of present Niger in the centre of large commercial trans-saharan caravan routes between north and south, east and west (Fig. 2.1). Good transportation was assured by donkeys and cattle as well as slaves. Sudanese gold and Saharan gem salt underpinned this flourishing trade (Cissoko, 2004). Starting from areas in the river Niger basin, the present Nigeria and Cameroun in the first millennium BC, Bantu peoples, farmers and shepherds, spread throughout central and southern Africa along the so-called Iron routes during the 1st centuries AC (De la Brosse, 2008) and perhaps contributed to the spread of F. gigantica and R. natalensis throughout these broad African regions. The southwards spread of Proto-Khoisan peoples from Tanzania, Zambia, Malawi and Mozambique from the first millennium AC (Gamrasni, 2008) may have subsequently contributed to the

82


further spread of F. gigantica and R. natalensis to more southern latitudes (Fig. 2.1). In Madagascar, fascioliasis is only caused by F. gigantica, which appears to have been introduced very recently and spread throughout the island only during the second half of the 20th Century (Touratier, 1988), due to the presence of R. natalensis (Stothard et al., 2000).

2.8.9. Northwards spread and transit between Africa and the Near East The present distribution of F. gigantica in Asia does not appear to be the consequence of spread from the Near East region at the time when it was there during the early Miocene. If this was the case, it would be reasonable to expect nucleotide differences at the rDNA ITS-2 sequences between Asian and African populations of this species at a level similar to the differences between F. gigantica and F. hepatica. The absence of base differences shown by Near East populations (Ashrafi et al., 2007; Bargues et al., 2002a) and the only one to three differences in central Asian (Semyenova et al., 2005), Indian (Prasad et al., 2008), south-east Asian (Le et al., 2008) and Far East (Agatsuma et al., 2000; Itagaki and Tsutsumi, 1998; Itagaki et al., 2005a,b) populations when compared to African populations suggests that the spread of F. gigantica into Asia took place only very recently. The spread of F. gigantica into the Near East and Asia must thus have occurred in post-domestication times from a second northwards colonization wave originating in Africa, and the very few, aforementioned ITS-2 differences may be interpreted as adaptive mutations related to the colonization of new environments. The Nile River through Sudan and Egypt (El Azazy and Schillhorn Van Veen, 1983) may have been instrumental in the recent northwards spread of this fasciolid from its East African origin, by means of the animal movements undertaken by ancient Nubians and Egyptians all along the Nile (Fig. 2.1). The presence of L. cailliaudi, a synonym of R. natalensis (Hubendick, 1951), in East Africa from Sudan up to the Nile Delta (Brown, 1994; Brown et al., 1984; Van Someren, 1946), shows how R. natalensis was able to spread northwards in eastern Africa to colonize northern Egypt, whereas it never did so in north central and northwestern Africa despite the Sahara desert offering appropriate conditions during the period between the 10th and 3rd milleniums BC. Very early reports showed that F. gigantica was the only fasciolid present in Egypt (Looss, 1896) and still the only one in Egyptian authochthonous mammals many years later, with F. hepatica beginning to appear only in introduced domestic livestock in that country at the mid-20th Century (El Azazy and Schillhorn Van Veen, 1983). The finding of a fasciolid in the liver of an Egyptian mummy and tentatively ascribed to F. hepatica (David, 1997) was


83

probably F. gigantica. The detection of F. gigantica-like larval stages in a planorbid as Biomphalaria alexandrina in Egypt (El-Shazly et al., 2002; Farag and El Sayad, 1995) demonstrates the ability of this species to infect planorbid snails, which are the snail hosts of the originating African fasciolid species from which it would have been derived in sub-Saharan Africa (although a completely different explanation related to the widening of the intermediate snail host spectrum in fasciolid hybrid forms cannot be disregarded—discussed later). Additionally, the ancient Egyptians may also have played a role in the further spread of F. gigantica more northwards into the Near East and subsequently eastwards into the rest of Asia, because of the trade Egyptians carried out with other people of the Fertile Crescent (Fig. 2.1). Its entry into the Near East was facilitated by the presence in that region of R. auricularia, a lymnaeid better adapted to less warm environments than R. natalensis. Once in the Near East, adaptation to different domesticated livestock species opened the possibility for relatively quick subsequent spread throughout Eurasia. However, the warmer temperature range requirement for its intra-molluscan development and its specificity for Radix lymnaeids became important restrictions. The temperature thresholds offer an explanation as to why it did not colonize the colder European western countries, despite the presence of potentially susceptible Radix vectors in Europe (Bargues et al., 2001). Its present most northern geographical range is located between the Black and Caspian Seas, in the countries of Armenia and Georgia. In the latter case, there are only a very few reports of its presence historically (Gigitashvili, 1969, 1985). The absence of F. gigantica in southern European areas, such as the Iberian Peninsula, despite the livestock trade through the Mediterranean Sea direct from the Levant, may be explained by the very low probability of success in finding one of the rare and isolated populations of R. auricularia in Iberia.

2.8.10. Eastwards spread into Asia and the Pacific Climatic and specificity characteristics also explain its limited spread eastwards into Asia. Two different waves of spread can be glimpsed, separated by the Himalayas (Fig. 2.1). Northwards spread appears restricted to milder countries such as Iran, Turkmenistan, Uzbekistan, Tajikistan and Kirgizstan (Semyenova et al., 2005), and leading up to areas of China (Huang et al., 2004; Zhou et al., 2008) and the Far East, Korea and Japan (Adlard et al., 1993; Agatsuma et al., 2000; Hashimoto et al., 1997; Itagaki and Tsutsumi, 1998) where R. auricularia forms and other Radix spp. are present (Hubendick, 1951; Kruglov, 2005). Southwards spread appears to have been less restricted because of the more permissive temperatures and presence of Radix spp. in the lowlands

84


of Afghanistan, Pakistan, India and South-east Asia (Hubendick, 1951; Kendall, 1954; Pemola Devi and Jauhari, 2008; Remigio and Blair, 1997a; TropMed Technical Group, 1986). This spread should have been facilitated by the extensive trade between the two primary centres of India and the Fertile Crescent during the 4,000–1,000 BC period (Kumar et al., 2003) and the later, very intense and long-distance commercial exchanges between those southern Asian countries and Near East countries such as Iran, Armenia, Georgia and others en route to Europe, for instance, through the southern routes of the Silk Road (Bulliet, 2004; De la Brosse, 2008). It is believed that cattle appeared in South-east Asia around 7,000 years ago but this has only been confirmed from 5,500 years ago, whereas other domesticated species arrived later from India or China (Bo¨ko¨nyi, 2004), this representing the portal of the entry of F. gigantica. Ancient livestock trade is known to have taken place between South-east Asia and other far-off regions such as Mongolia or India and, through the latter, with the Near East (Luikart et al., 2001). That these routes enabled animals to transit between regions as far away from one another as the Near East and South-east Asia is supported by the recent molecular demonstration of the presence of the same Radix spp. in both Turkey and Vietnam (Bargues et al., unpublished data). Livestock exchange between South-east Asia and China, Korea and Japan, where Radix vectors as R. viridis and L. ollula were present (Hubendick, 1951; Remigio and Blair, 1997a), should have allowed the spread of F. gigantica in both directions, a genetic exchange that could explain the similar abnormal ploidy and aspermic-parthenogenetic hybrid forms known in both Southeast and Far East Asia (Terasaki et al., 1982, 1998, 2000). Trade was probably also the way it reached the Pacific islands and Indonesia (Intong et al., 2003) where different Radix spp. are present (Remigio and Blair, 1997a). It was also able to colonize Hawaii (Alicata, 1938, 1953; Stemmermann, 1953), where it is transmitted by L. ollula (Remigio and Blair, 1997a). Molecular studies to define whether the Hawaiian fluke is a ‘pure’ F. gigantica or an intermediate hybrid form are still pending, but the detection of abnormal spermatogenetic fasciolids in Hawaii (Terasaki et al., 1982) suggests that introgressed hybrid forms may be there.

2.9. DISTRIBUTIONAL OVERLAP OF BOTH SPECIES The consequence of the spread of both liver fluke species due to human activities in post-domestication times has led to their present overlap in many areas of Africa and Asia where lymnaeids are suitable for the development of both species. Generally, in tropical countries where they co-exist, F. hepatica is endemic in the highlands while F. gigantica is


85

endemic in the lower regions (Mas-Coma and Bargues, 1997). Overlap is being increasingly described also in areas where there is no overlap of suitable lymnaeid species for both parasites to co-exist. This human-forced overlap of two species such as F. hepatica and F. gigantica, which (i) originated independently of one another on different continents (Eurasia/Africa), (ii) in different environments (temperate/warm) and (iii) phylogenetically very different lymnaeids (Galba/ Radix), but (iv) deriving evolutionarily recently from a common ancestor (only five differences in each of the two ITS-1 and ITS-2) and (v) presenting low definitive host specificity because of their recent origin (19 mya) but (vi) with ecological preference for the most widespread, diversified and successful mammalian group, the herbivorous ruminants, to which the original definitive hosts belonged, is allowing both fasciolids to use many different host species in the same area, so giving rise to these different situations worldwide. Thus, these overlap situations are the consequence of human activities such as livestock domestication, pastoralism, transportation and management. The additional problem is that all these overlap events are occurring with two fasciolid species that do not appear to have had sufficient evolutionary time to become fully genetically isolated species, as the few nucleotide differences at the level of the two ITSs clearly indicate. Their low specificity at the level of definitive mammalian host species enables both fasciolids frequently to meet in the liver of the same ruminant specimen. In this situation, cross-breeding between adults of the two species may take place, despite them being hermaphroditic trematodes (Hurtrez-Bousses et al., 2004). This explains the detection of co-infections by both species in the same animal, the common findings of intermediate forms, and the recent genetic descriptions of hybrid forms presenting DNA introgressions in such areas of overlap.

2.10. OVERLAP SITUATIONS: THE ROLES OF LIVESTOCK TRANSPORTATION, TRANSHUMANCE AND TRADE When analyzing the mammalian host species involved in transmission in human endemic areas as well as in only animal endemic areas, the following domesticated species mainly appear: sheep, goats, taurine and zebu cattle, buffaloes, pigs and donkeys. Additionally, other secondary animals may have more local importance, such as horses, mules, yaks, camels, dromedaries, llamas and alpacas. All these domesticated animals share the characteristics of frequently being involved in human activities, having been traditionally used for thousands of years across the world: transportation, transhumance and trade.

86


The use of livestock species for the transportation of humans, goods and merchandise dates from the beginnings of human civilizations. Transportation routes across very long distances provided the possibility for liver flukes to expand quickly throughout very wide geographical areas within a continent or a broad intra-continental region. Many of these livestock species are still used today for transportation at a more reduced local scale and represent important means by which fasciolids spread. Transhumance is a livestock management system related to pastoralism and is used to avoid the negative effects of unsuitable climatic factors (mainly extremely cold or warm temperatures, or excessive rainfall or drought) in certain seasons and in specific areas. Seasonal migration of livestock, and the people who tend them, between lowlands and adjacent mountains has been a tradition for many years and is still practised today in many areas of Europe, similarly to the long-distance seasonal migrations of livestock and their keepers in Africa. Another kind of livestock movement is the so-called ‘transestance’, which refers to the periodic movement of flocks or herds from one area to another neighbouring area because of, for instance, grass requirements and this may also facilitate fluke spread if not controlled. Trade in livestock species has always been carried out by humans in post-domestication times, at a local, regional, intra-continental or even intercontinental level. Going on foot by terrestrial routes, by ship following sea routes, by means of motor vehicles, or even today using aeroplanes, livestock importation/exportation has been practised for a long time. The repercussions that such human activities may have over long distances have already been stressed above regarding the continental introductions of liver flukes by the first colonizers. Moreover, livestock importation and exportation between different countries is frequent nowadays. Such trans-border movements are sometimes appropriately controlled by the respective governments, but in other cases it appears to be clandestine, done privately and without the governmental officials being notified, even on a daily basis in an unobserved way. Even when importation has been notified, liver-fluke infection may not necessarily be looked for in the national quarantine stations and of course will not have been previously mentioned to the herd purchaser by the original owner. Problems related to these trade movements are present in several areas and countries, involving not only the risk of spreading flukes but also making it difficult to get coherent genetic results in studies with molecular markers. Sometimes, populations of liver flukes may have undergone such extensive mixing that genetic results may become difficult to interpret because of the impossibility of tracing the origins and routes followed by the flukes (Semyenova et al., 2006; Walker et al., 2007), at least with the present scarcity of available molecular markers offering accurate and significant results for Fasciola spp.


87

Such livestock movements do not only facilitate fasciolid spread, but also participate in snail vector expansion, as lymnaeid species live closely with livestock because they share similar habitats. This is the case for G. truncatula, a snail usually found in very reduced water bodies and mud poached by livestock hooves, which was dispersed throughout the whole island of Corsica (Oviedo et al., 1992, 1996) and introduced into the Bolivian Altiplano (Mas-Coma et al., 2001). Evidence suggests that G. truncatula specimens may remain in dried mud stuck to the feet of ruminants, then go into hibernation or estivation during the drought, and be able to reactivate once in a new location following contact with water. The introductions of other lymnaeids may not always happen in this way, as the American P. columella in Africa, Australia or Europe (Pointier et al., 2007), because of its more aquatic ecology. All in all, these livestock movements and their subsequent effects may occur everywhere and change the status quo in all types of endemic areas. Depending on the lymnaeid species present, either (i) only able to transmit one Fasciola spp. or (ii) able to transmit both fluke species in the endemic area invaded, the consequences of the introduction may differ. Moreover, fasciolid introductions may have taken place long ago, repeatedly over time, or only recently, and these varying situations may give rise to different overlap and accumulative introgressions with a wide spectrum of possible consequences for both the liver fluke and the disease.

2.10.1. Areas with only one Fasciola species Different examples of areas where lymnaeids are only able to transmit one Fasciola species will illustrate what may happen in such situations. A simple situation is the one detected on Corsica, where there is only one transmitting lymnaeid species, G. truncatula (Oviedo et al., 1996). Studies have shown that cattle owners use to practise transhumance from the lowland flatlands located along the island periphery up to the neighbouring mountains during the hot summer. Field studies showed the presence of G. truncatula populations in both the lowlands and highlands, which explained why appropriate annual herd treatments and management in the lowland farms were useless because the cattle became re-infected in the mountains, F. hepatica transmission having been verified to occur throughout the whole year on that island (Mas-Coma et al., unpublished data). A trans-boundary introduction has been detected recently between Argentina and Bolivia. Lymnaeids from Mendoza proved to belong to the same combined haplotype of G. truncatula than the one responsible for the hyper-endemic area of the Northern Bolivian Altiplano known to present the highest human prevalences and intensities (Bargues et al.,

88


2006b, 2007a). Animal exchanges between these two countries have been known since colonial times (Giovambattista et al., 2000; Mirol et al., 2003). The presence of G. truncatula in Andean Argentina may represent a higher risk for human infection owing to its anthropophilic ecology, which is different from the local species L. viatrix, hitherto known in that area (Mera et al., unpublished data). More complex are the consequences of the potential introductions of F. gigantica in North America. Present F. hepatica appears to have been in the New World for only about 500 years after its introduction by European colonizers (Bargues et al., unpublished data; Mas-Coma et al., 2001). During this period, a few importations of zebu cattle and buffaloes from India and perhaps also from Africa took place (Meirelles et al., 1999; Mirol et al., 2003; Sanders, 1980). Importations into the Gulf coast area from India carried out in the years 1875 and 1906 may explain the presence of three different Fasciola types in animals in the United States, distinguished by Price (1953): those from various parts of the United States that are identical to F. hepatica, those from Texas and Florida approaching F. gigantica, and those from the Gulf coast area which appear to be intermediate forms. The description of F. halli in cattle and sheep in Texas and Louisiana and perhaps also that of F. californica in California by Sinitzin (1933), both characterized by a metacercarial cyst diameter larger than that of F. hepatica, may in fact have been similar intermediate forms. Such forms may have been the result of introgressions of imported F. gigantica into United States-native F. hepatica. Although F. gigantica was unable to adapt to the United States, because of the absence of Radix spp., cross-breeding could have occurred within the livers of the initially imported animals (at that time, directly released into the field without prior quarantine, as in many different developing countries today) enabling the Indian F. gigantica to encounter native F. hepatica, with consequent DNA introgression. Afterwards, hybrids unable to develop in United States-native lymnaeids were eliminated, but others retained viability due to their capacity to use United States-native lymnaeids and have been maintained by keeping viable introgressed sequences. Liver fluke introductions with imported livestock are being progressively detected in recent times. The description of F. hepatica in addition to F. gigantica verified by ITS sequencing in Niger (Ali et al., 2008), is an example. The hot climate explains the presence of R. natalensis as the only lymnaeid in this country (Brown, 1994). Neither climate thresholds (Malone et al., 1998; Yilma and Malone, 1998) nor snail host (an introduction by G. truncatula in such a hot environment is a priori difficult to accept) would presumably allow the transmission of ‘pure’ F. hepatica in that area. Hence, this F. hepatica report is probably related to imported livestock and intermediate, hybrid fasciolid forms. Unfortunately, neither a morphometric study of adult-stage characteristics, nor mtDNA marker


89

sequences in the same fluke individuals, nor even information about the origin (place of birth) of the animals necropsied, were noted. In Vietnam, only two Radix spp. known to inhabit South-east Asia have been found in fascioliasis transmission areas by Vietnamese malacologists: R. viridis and R. swinhoei (Hubendick, 1951; TropMed Technical Group, 1986). Despite the temperate climate of the northern part of this long country, these lymnaeid vectors are a priori not permissive for the transmission of F. hepatica, so that F. gigantica may be considered the native and only species. However, the two fasciolids have been distinguished and reported in Vietnam (Anderson et al., 1999). The recent confirmation of hybrid forms showing DNA introgression explains why flukes from animals and humans in Vietnam fall morphologically into two categories, one typical of F. gigantica and another resembling F. hepatica (Le et al., 2008). Importation from other countries of livestock infected by ‘pure’ F. hepatica or intermediate-hybrid forms explain this situation. Such entries may be linked, not only to recent importations related to the recent policy of the Vietnamese government aimed at the expansion of dairy cattle production (Suzuki et al., 2006), but also to earlier livestock exchanges between South-east Asia and far-off regions such as Mongolia or India and through the latter with the Near East (Luikart et al., 2001), which may have been expected to lead to established introgressions from F. hepatica and/or F. hepatica-like flukes into Vietnamese F. gigantica. In addition, this does not rule out the possibility of hybrids being present within the first fasciolid colonizers that arrived in Vietnam in postdomestication times BC. Such an historical scenario provides for extensive back-crossing of hybrids and of subsequent generations, which may underlie the processes leading to the phenomena of polyploidy and parthenogenesis known in many Asian countries (Le et al., 2008), with the evolutionary bottleneck forced by the only Radix vectors present. Situations similar to that of Vietnam may a priori be expected in other south-east Asian countries and India, where the lymnaeids present appear appropriate for the transmission of F. gigantica but not of F. hepatica. In India, F. gigantica is the fasciolid species present throughout and the buffalo appears to be a common very susceptible definitive host, as in other areas and countries where F. gigantica is present, although sporadic findings have been ascribed to F. hepatica (Kumar et al., 1982; Sharma et al., 1989; Swarup and Pachauri, 1987). The presence of F. gigantica in north-eastern India has been supported by ITS sequencing (Prasad et al., 2008), although unfortunately no mtDNA marker was used to assess whether the flukes studied were hybrid forms or not. The F. hepatica-like specimens found in animals and also rarely in humans (Kumar et al., 1995) are likely to be hybrid forms. An F. gigantica-like introgressed intermediate form most probably preceded the original description of F. indica (Varma, 1953), later synonymized with

90


F. gigantica (Kendall, 1965; Kendall and Parfitt, 1959; Sarwar, 1957). References to F. hepatica in humans in India fit into the range of intermediate forms according to their egg size (Narain et al., 1997), although accurate studies are needed in northern parts of India near to Pakistan, where F. hepatica is known in altitude zones (Kendall, 1954; Kendall and Parfitt, 1959), to ascertain whether lymnaeids enabling the transmission of ‘pure’ F. hepatica may perhaps occur (Sharma et al., 1989). Flukes showing abnormal spermatogenesis, suggesting a hybrid origin, have already been detected in India, Nepal, Thailand and Vietnam, as in the Philippines, Taiwan, Japan and Korea (Terasaki et al., 1982).

2.10.2. Areas where both Fasciola species co-exist Two different overlap situations can be distinguished: (i) local overlap, in places where climatic characteristics throughout the year enable the coexistence of Galba and Radix species in the same locality, nearby water bodies and even sometimes the same water body, thus allowing transmission and consequent infection of livestock and humans living sedentarily in the locality by both F. hepatica and F. gigantica; (ii) zonal overlap, in areas with different altitudes so that highlands offer the necessary coldmild weather conditions for G. truncatula and F. hepatica, and lowlands offer the warm-hot climate necessary for Radix spp. and F. gigantica, definitive hosts becoming co-infected by both fasciolids when moving from lowlands to neighbouring highlands and vice-versa (animals because of inter-zonal transhumance, transportation and trade; humans when moving around for different reasons). The low flatlands of the Nile Delta region in Egypt are a typical example of local overlap. Galba truncatula and R. natalensis caillaudi are found in different water bodies nearby one another and around the same locality where livestock and humans show infection. Both fasciolid species and intermediate forms used to appear in the liver of the same animal (Periago et al., 2007). Studies indicate that this overlap in Egypt is only a very recent phenomenon occurring over not more than 30–40 years (El-Azazy and Schillhorn Van Veen, 1983; Looss, 1896; Mas-Coma and Agramunt, unpublished data; Soliman, 1998). Seasonality of fascioliasis transmission (Farag et al., 1993) is a key factor to consider in this overlap situation. In the Nile Delta, the milder temperatures of winter, beginning of spring and end of autumn are favourable for G. truncatula and F. hepatica, whereas the warm-hot temperatures of the end of spring, summer and beginning of autumn appear appropriate for R. natalensis cailliaudi and F. gigantica. The long life span of adult flukes enables specimens of the two species and of different hybrids transmitted by one or other lymnaeid species to meet in the same definitive host. Cross-breeding of ‘pure’ specimens, of ‘pure’ flukes with hybrid forms,


91

and of different hybrids have progressively given rise to an accumulation of hybrid intermediate forms, leading to the very large complex of introgressed forms infecting livestock and humans today (Bargues et al., unpublished data). These Egyptian hybrid flukes appear to be fully fertile, producing a number of eggs similar to the ‘pure’ forms, and shown to be viable, at least those tested experimentally to date (Bargues et al., unpublished data). Although no appropriate cytogenetic studies have been performed on Egyptian flukes to date, it appears that the very short time elapsed has not been sufficient for the development of abnormal ploidy and aspermic-parthenogenetic hybrid forms as found in Far East Asia (Terasaki et al., 1982, 1998). This overlap phenomenon appears restricted to the milder Nile Delta region, as the presence of R. natalensis as the only lymnaeid in warmer Upper Egypt does not allow adaptation of F. hepatica. Asian countries such as Iran and Pakistan provide examples of zonal overlap. In these countries, G. truncatula appears mainly in mountainous areas, whereas different R. auricularia forms appear restricted to the warmer lowlands. In Iranian Gilan, G. truncatula is frequent in the Talesh mountains where it has been found transmitting F. hepatica in nature (Ashrafi et al., 2007), whereas R. gedrosiana is well distributed in the lowlands and does not appear higher up (Ashrafi et al., 2004). This explains why F. gigantica is the most prevalent species (91.1%) in the human endemic area around the cities of Rasht and Bandar-Anzali, whereas the scarcity of F. hepatica in animals in these lowlands (8.9%) might be the consequence of F. hepatica-infected animal transportation from the highlands to the lowlands or be hybrid-intermediate, long since introgressed flukes showing an F. hepatica-like form (Ashrafi et al., 2006). Although altitudinal livestock transhumance does not appear to take place in Gilan nowadays, it might have been practised in the past. Moreover, the possibility for G. truncatula from the highlands to make sporadic descents and temporarily adapt to the lowlands in cold and rainy years cannot be ruled out for the moment. A similar picture may be applied to the situation in Pakistan (Kendall, 1954; Kendall and Parfitt, 1959). Thus, when comparing Iran and Egypt, the epidemiological situations and transmission characteristics are very different, as reflected in the nonoverlap results obtained in adult fluke phenotypic analyses (Fig. 2.3), and indicate that disease characteristics and corresponding control measures cannot be extrapolated from one situation to another (Periago et al., 2007). Zonal overlap has also been described in East Africa. In countries such as Ethiopia, Kenya and Tanzania, F. gigantica is generally the causative agent of fascioliasis but there have been reports of F. hepatica in cattle from highland regions. Recent studies in Tanzania have proved the presence of G. truncatula and F. hepatica in the Southern Highlands, and of R. natalensis and F. gigantica at lower altitudes. Although a priori the existence of

92


“Pure” F. gigantica

8

F. gigantica Egypt Fasciola sp. Egypt

Burkina Faso

3

CDF 2

EGYPT F. gigantica Iran

F. hepatica Egypt

0 Fasciola sp. Iran

−3

Spain

France

IRAN F. hepatica Iran

−8

“Pure” F. hepatica

−10

−5

0

5

CDF 1

FIGURE 2.3 Scatter-plots (represented by respective perimeters) of the discriminant scores of specimens belonging to Fasciola populations from Egypt and Iran compared to ‘pure’ F. hepatica from Europe (Spain and France) and ‘pure’ F. gigantica from Burkina Faso. Notes: Canonical discriminant functions 1 and 2 had statistically significant values, included 79.4% of the accumulate variance, and were derived using combinations of the 23 variables (BL/BW, TA, PhA, BR, A-VS, VS min, VSA, VS max, CL, BW, BA, BWOv, CW, PhW, BP, BL, BL/VS-P, VS-P, PhL, TW, TL, OSA/VSA and OSA), which best separated the fasciolid populations studied. Characters BL/BW, BR, VSA, VS min and PhA most strongly associated with function y1. Characters VS-P, BL, VS-Vit, BP, TL, TP, Vit-P, BA, TA, VS max and BL/VS-P most strongly associated with function y2.

hybrids may be expected because of the proximity of the highland and lowland localities studied, hybrid forms could not be revealed because the 618-bp 28S rDNA sequence used was not sufficient to assess potential introgression (Walker et al., 2008). Studies applying rDNA and mtDNA markers are needed to clarify this aspect and thus deduce whether or not livestock exchange or transhumance between the highlands and lowlands is giving rise to introgressed hybrids.

2.11. MOLECULAR CHARACTERIZATION OF FASCIOLIDS The above-described evolutionary genetics framework during pre- and post-domestication times furnishes a new baseline from which to interpret the results of modern genetic techniques (random amplified


93

polymorphic DNA - RAPDs, microsatellites, etc.) and DNA sequence analyses (rDNA and mtDNA markers) applied to Fasciola and lymnaeids from different regions of the world. Researchers are strongly encouraged to take this framework into account when interpreting the results of their genetic studies, and when results do not fit, to suggest an appropriate modification to the framework. This becomes crucial for the correct understanding of a currently emerging disease which is causing important public health problems and which involves very heterogeneous epidemiological situations and transmission patterns throughout. A solid molecular epidemiology baseline will help greatly in designing global control measures and local interventions. Different technical approaches have been used to analyze the genetic variability of liver flukes in recent years (Alasaad et al., 2008; Itagaki et al., 1995). For genetic characterization of fasciolids, two aspects must be considered from the start: (i) F. hepatica and F. gigantica are very close to one another and have diverged evolutionarily only recently, and (ii) their present geographical distribution is the consequence of spreading events that have taken place recently, but mostly in pre-historical times. This implies that the markers to be used need to be able to differentiate very closely related units. Two kinds of genetic techniques appear to be convenient: (i) techniques furnishing information at the population level such as RAPD and microsatellite markers, and (ii) techniques offering the highest resolution for accurate genotyping of specimens such as appropriately selected markers of nuclear rDNA and mtDNA. RAPD markers have already shown their general usefulness in detecting genetic heterogeneity in F. hepatica. A RAPD study in different host species in Chile showed a high level of polymorphism, including genetic variability between host species, within a host species and also within a host individual (Vargas et al., 2003). Another study in Europe showed that the majority of genetic diversity occurred within, rather than between, hosts and was also greater within than between populations. Individual cows were infected by numerous genetically different liver flukes (Semyenova et al., 1995, 2003). Other RAPD studies have been performed more recently (Aldemir, 2006; Gunasekar et al., 2008; Ramadan and Saber, 2004). The results of these studies suggest the key influence to be mainly migrations and transportation of definitive hosts. Unfortunately, it is already well known that RAPD results should be used with great caution in comparative analyses and that they present a problem concerning reproducibility, because they are susceptible to contamination with extraneous DNA (cycling conditions used have low stringency) and results obtained in one laboratory may not be easily reproduced in another (Backeljau et al., 1995). Thus, RAPDs do not appear to furnish the resolution required to establish a baseline of genetic units. However, an interesting polymerase chain reaction (PCR)-based method

94


for distinguishing F. hepatica and F. gigantica has recently been developed by using primers based on RAPD-derived sequences (McGarry et al., 2007). This method, validated with genetically ‘pure’ specimens of each fasciolid species, is still pending its evaluation with hybrid, introgressed specimens from overlap areas. Micro-satellites offer similar population information and appear to be more accurate than RAPD. However, to date only a very few microsatellite markers have been shown to be useful in liver flukes. Five of six microsatellite markers appeared polymorphic in F. hepatica from Bolivia. No genetic differentiation between sampling sites or between definitive host species (sheep, cattle or pigs) was found (Hurtrez-Bousses et al., 2004). Efforts are needed to find additional microsatellite markers to enable significant population genetics studies of fasciolids. Among the nuclear rDNA operon, the 5.8S gene (155 bp and 53.55% of GC content—Bargues et al., unpublished data) and the 18S gene (1,941 bp and 50.79% of GC content—Fernandez et al., 1998) do not appear to be useful markers because of their slow evolutionary rates (Mas-Coma and Bargues, 2008). The six polymorphic sites including five mutations and one indel, which appear when comparing the 18S sequence of F. hepatica (GenBank Acc. No. AJ004969, Fernandez et al., 1998) and that of F. gigantica (GenBank Acc. No. AJ011942, Littlewood and Herniou, 1999) and the even higher number of differences when using the other incomplete, 1,918-bp long 18S sequence of F. gigantica (GenBank Acc. No. AJ004804, Herniou et al., 1998) are surprising, mainly because the much faster evolving ITSs show the same number of nucleotide differences between the two fasciolid species. This all suggests the advisability of reconfirming the 18S sequence of F. gigantica by new sequencing. Sequences of the 18S gene have, however, been used to develop a nucleic acid probe capable of sensitive and specific detection of F. hepatica in lymnaeid transmitting snails (Rognlie et al., 1994; Shubkin et al., 1992), although the value of these probes for distinguishing between F. hepatica and F. gigantica was never evaluated because each liver-fluke species uses different lymnaeid species as vectors. The 28S rDNA is 4,171 bp long and highly conserved in both F. hepatica and F. gigantica, with few inter-specific nucleotide differences. Based on this, a fragment of 618 bp at the 50 gene end, including four nucleotide differences between both species, was selected for a PCR-restriction fragment length polymorphism (PCR-RFLP) assay using the restriction enzymes AvaII and DraII (Marcilla et al., 2002). Six differences were detected between F. hepatica from sheep in Ipswich in Australia and F. gigantica from cattle in Malaysia in the 28S gene D1 domain fragment (Barker et al., 1993). More recently, a nucleotide position on a 510-bp-long fragment of the 28S gene allowed the differentiation of anthelminticresistant and susceptible fluke specimens in Spain (Vara del Rio et al., 2007).


95

The intergenic transcribed spacers ITS-1 and ITS-2 are excellent markers for the differentiation of species (Mas-Coma and Bargues, 2008) and have also shown their usefulness for liver flukes. The complete sequence of the ITS-1 of F. hepatica proved to be 432 bp long. It appeared initially to be very conserved intra-specifically owing to the lack of nucleotide differences between specimens from Bolivia and Spain (Mas-Coma et al., 2001). Only five nucleotide mutations appeared between the ITS-1 of F. hepatica and that of F. gigantica from Iran (Bargues et al., 2002a; Periago et al., 2004) and Egypt (Periago, 2004). ITS-1 sequences have been obtained from fasciolids from other areas more recently (see analysis below), although in fasciolids this marker has been less used than ITS-2. Only fragments of variable lengths of the ITS-2 of F. hepatica and F. gigantica could initially be sequenced (Adlard et al., 1993) until the complete 364-pb-long sequence for F. hepatica and almost complete (one nucleotide lacking) 363-bp-long sequence for F. gigantica of specimens from different continents were obtained (Itagaki and Tsutsumi, 1998). Nucleotide differences at ITS-2 level between F. hepatica and F gigantica are few in number but, contrary to ITS-1, show a slight variability between five and eight. When compared to ITS-1, many studies on that marker have been undertaken (see analysis below). Interestingly, polymorphism among ITS-2 copies, including the ITS-2 of each species within the same fluke individual have been found (Huang et al., 2004; Le et al., 2008). In contrast, the complete ITS-2 sequence of F. hepatica from areas as far away from one another as Spain and Bolivia proved to be identical (Mas-Coma et al., 2001). The very few nucleotide differences between the two ITSs of F. hepatica and F. gigantica support the recent divergence of both species, estimated to be only around 19 mya, according to sequence analysis of cathepsin L-like cysteine proteases (Irving et al., 2003). An approximate evolutionary rate of one mutation per 3.8 million years for each ITS is deduced, although the influence of humans forcing rapid transportation with domesticated animals and consequent fast adaptation to new lymnaeid vector species, regions and environments may have accelerated this rate during the recent 12,000 years. With regard to mitochondrial DNA, only partial sequences of only two genes were used initially, cytochrome c oxidase sub-unit 1 (cox1) and the NADH dehydrogenase sub-unit 1 (nad1) (Hashimoto et al., 1997; Itagaki et al., 1998). Surprisingly, despite the sequencing and availability of the whole mitochondrial genome of F. hepatica (Le et al., 2001), only short sequences of nad1 and cox1 have been used to date, with the additional problem that the different fragments and sometimes their different lengths make it difficult or impossible to undertake comparative analyses (Dosay-Akbulut et al., 2005; Itagaki et al., 2005a,b; Le et al., 2002, 2008; Morozova et al., 2004; Semyenova et al., 2006). Moreover, it is recognized

96


that dealing with incomplete, short sequences poses significant problems regarding the results of analyses and phylogenies obtained (Mas-Coma and Bargues, 2008).

2.11.1. Intraspecific and interspecific variation of F. hepatica and F. gigantica To ascertain the intraspecific and interspecific variability of ‘pure’ F. hepatica and ‘pure’ F. gigantica, fasciolid materials collected from eight different hosts were used: sheep, taurine cattle, zebu, pigs, bison (Bison bonasus), llamas (Lama glama), Capra pyrenaica and Rupicapra pyrenaica. To ensure that the fasciolids were genetically ‘pure’, that is, to avoid the possibility of including unnoticed introgressed intermediate, hybrid forms, a total of 168 adult specimens were included from areas of 14 different countries where only one fasciolid species occurs because of the presence of only lymnaeid species enabling the survival of that fasciolid species. For ‘pure’ F. hepatica, 143 fluke individuals representing 39 populations from Spain, Poland, Peru, Argentina, Bolivia, Chile, Venezuela, Ecuador, Mexico and Uruguay were used. For ‘pure’ F. gigantica, 25 fluke individuals representing four populations from Burkina Faso, Niger, Nigeria and Senegal were used. For genetic characterization by combined haplotyping, the complete sequences of ITS-2 and ITS-1 were obtained following appropriate methods (Mas-Coma et al., 2001) and mtDNA cox1 and nad1 genes were similarly obtained according to sequences of the complete mitochondrial genome of F. hepatica (GenBank Accession No. NC002546—Le et al., 2001). Sequences were aligned using CLUSTAL-W 1.8 (Thompson et al., 1994), and pair-wise alignment comparisons were made with MEGA 3.1 (Kumar et al., 2004).

2.11.1.1. DNA characterization of ‘pure’ F. hepatica

rDNA ITS-2: is 364 bp long and has two haplotypes differing in only one mutation at position 287. Haplotype 1 (48.35% GC content) has ‘C’ (MasComa et al., 2001), whereas a ‘T’ appears in haplotype 2 (48.08% GC content). This position is 874 in the alignment of the complete 951-bplong intergenic region including ITS-1, 5.8S and ITS-2. The haplotype distribution shows geographical overlap in several countries and areas: FhITS2-H1 in Castelloń and Corunã (Spain), Corsica (France), Poland, Peru, Argentina, Chile, Bolivia, Venezuela, Ecuador, Mexico and Uruguay; FhITS2-H2 in Corunã (Spain), Peru, Argentina, Bolivia, Mexico and Uruguay. rDNA ITS-1: always has the same 432-bp-long sequence (51.85% GC content), which corresponds to haplotype code FhITS1-HA (Mas-Coma et al., 2001). The whole intergenic region including ITS-1, 5.8S and ITS-2 is


97

951 bp long, with a 50.78% and 50.37% GC content in the combined haplotypes CH1A and CH2A, respectively. mtDNA cox1: is 1,533 bp long and with an average GC content of 37.24% (36.79–37.59%) in all individuals analyzed, providing a total of 69 different haplotypes (Fhcox1-1 to Fhcox1-69). In the sequence alignment of these 69 haplotypes, a total of 78 polymorphic sites appeared, representing 5.09% intraspecific variability, of which 27 (1.76%) were parsimony informative positions and 51 (3.33%) were singleton mutations (singlenucleotide polymorphisms - SNPs). Total character differences in pairwise distance comparisons of all haplotypes ranged between 1 and 18 (mean 8.55), of which 1–15 (mean 6.17) were transitions (ts) and 1–7 (mean 2.37) were transversions (tv). Synonymous and non-synonymous positions ranged 0–16 (mean 6.92) and 0–6 (mean 1.63), respectively. Mutations appeared more frequently in the third codon position, with an average of five ts and two tv (ratio ts/tv ¼ 2.5) in this codon position. The COX1 protein is 510 aa long, with start/stop codons of ATG/TAG in all individuals analyzed. A total of 23 different haplotypes were found (FhCOX1-1 to FhCOX1-23). A total of 27 (5.29%) variable positions appeared, being 4 (0.78%) parsimony informative and 23 (4.51%) singleton sites. In a pair-wise comparison, amino acid differences ranged from 0 to 6 (mean 1.59). Of the 23 COX1 protein haplotypes, one is the most abundant and present in all countries studied, whereas several countries such as Spain, Argentina, Bolivia, Peru and Mexico have exclusive haplotypes not detected in any of the other countries studied. mtDNA nad1: is 903 bp long, with 34.83% average GC content (34.44– 35.21%) in all individuals analyzed, providing a total of 51 different haplotypes (Fhnad1-1 to Fhnad1-53). In the sequence alignment of these 51 haplotypes, a total of 34 polymorphic sites appeared, representing 3.76% intra-specific variability, of which, 17 (1.88%) were parsimony informative positions and 17 (1.88%) were singleton mutations (SNPs). Total character differences in pairwise distance comparisons of all haplotypes ranged between 1 and 13 (mean 5.11), of which 1–10 (mean 4.32) were ts and 0–4 (mean 0.78) were tv. Synonymous and non-synonymous positions ranged 1–9 (mean 3.97) and 0–4 (mean 1.13), respectively. Mutations appeared more frequently in the third codon position, with an average of three ts and zero tv (ratio ts/tv ¼ 7.6) in this codon position. The NAD1 protein is 300 aa long, with start/stop codons of GTG/TAG in all individuals analyzed. A total of 15 different haplotypes were described (FhNAD1-1 to FhNAD1-15). A total of nine (3.00%) variable positions appeared, being five (1.66%) parsimony informative and four (1.33%) singleton sites. In a pairwise comparison, amino acid differences ranged 0–4 (mean 1.13). Of the 15 NAD1 protein haplotypes, five were exclusive to Argentina, two to Bolivia, two to Peru, one to Mexico, and another to Europe (Spain and Poland). The other haplotypes were shared by different countries.

98


2.11.1.2. DNA characterization of ‘pure’ F. gigantica

rDNA ITS-2: Only one haplotype has been detected in all specimens analyzed (FgITS2-1). It is 363 bp long, with 47.93% GC content (Bargues and Mas-Coma, 2005b). rDNA ITS-1: Similarly, only one haplotype was detected in all specimens studied (FgITS1-A). It is 432 bp long, with 51.16% GC content (Bargues and Mas-Coma, 2005b). The complete intergenic region including ITS-1, 5.8S and ITS-2 of the combined haplotype 1A is 950 bp long, with 50.30% GC content. mtDNA cox1: is 1,533 bp long, with 36.23% mean GC content (36.01– 36.46%) in the individuals analyzed, providing a total of 11 different haplotypes (Fgcox1-1 to Fgcox1-11). Sequence alignment of these haplotypes showed a total of 31 polymorphic sites, representing 2.02% intraspecific variability, of which 16 (1.04%) were parsimony informative positions and 15 (0.98%) were singleton mutations (SNPs). Total character differences in pairwise distance comparisons of all haplotypes ranged between 2 and 18 (mean 10.84), of which 1–15 (mean 8.58) were ts and 0–15 (mean 2.25) were tv. Synonymous and non-synonymous positions ranged between 1 and 16 (mean 9.16) and zero and four (mean 1.67), respectively. Mutations appeared more frequently in the third codon position, with an average of seven ts and two tv (ratio ts/tv ¼ 4.3) in this codon position. The COX1 protein is 510 aa long, with a start/stop codon of ATT/TAG in all individuals analyzed. The detection of isoleucine (ATT) as a start codon in F. gigantica is an important difference with respect to F. hepatica, although ATT has already been reported as the COX1 starting codon in other metazoans (Okimoto et al., 1992). A total of five different haplotypes were found (FgCOX1-1 to FgCOX1-5). Only four (0.78%) variable positions appeared, being three (0.59%) parsimony informative and one (0.19%) singleton sites. In a pairwise comparison, amino acid differences ranged between zero and four (1.67). Of the five COX1 protein haplotypes, two of them were exclusive to Burkina Faso and Senegal and other two to Niger. The last haplotype is shared by Burkina Faso, Niger and Nigeria, but is absent in Senegal. mtDNA nad1: is 903 bp long, with 36.64% mean GC content (36.43– 36.77%) in the individuals analyzed, providing a total of 15 different haplotypes (Fgnad1-1 to Fgnad1-15). In the sequence alignment of these 15 haplotypes, a total of 23 polymorphic sites appeared, representing 2.55% intraspecific variability, of which 12 (1.33%) were parsimony informative positions and 11 (1.22%) were singleton mutations (SNPs). Total character differences in pairwise distance comparisons of all haplotypes ranged between 1 and 12 (mean 6.16), of which 1–9 (mean 4.30) were ts and 0–4 (mean 1.87) were tv. Synonymous and non-synonymous positions ranged one to eight (mean 4.12) and zero to four (mean 2.04),


99

respectively. Mutations appeared more frequently in the third codon position, with an average of three ts and one tv (ratio ts/tv ¼ 3.1) in this codon position. The NAD1 protein is 300 aa long, with a start/stop codon of GTG/ TAG in all individuals analyzed. The NAD1 start codon is the same as seen in F. hepatica. A total of 10 different haplotypes were found (FgNAD1-1 to FgNAD1-10). A total of eight (2.66%) variable positions appeared, being four (1.33%) parsimony informative and four (1.33%) singleton sites. In a pairwise comparison, amino acid differences ranged between zero and four (mean 2.04). Of the 10 haplotypes found, four of them were exclusive to Burkina Faso, two to Niger, two to Nigeria, and the last two ones were shared by all four countries.

2.11.1.3. Comparison of ‘pure’ F. hepatica versus ‘pure’ F. gigantica When comparing ITS-2 sequences, the two haplotypes of F. hepatica (FhITS2-H1 and FhITS2-H2) with the only one of F. gigantica (FgITS2H1), five polymorphic sites enable the two species to be distinguished (1.34% interspecific variation): four ts in positions 234, 273, 279 and 337, and one indel in position 330 (Table 2.3). When comparing ITS-1 sequences, the only haplotype of F. hepatica (FhITS1-HA) differs from the only haplotype of F. gigantica (FgITS1-HA) also in five polymorphic sites in positions 24, 114, 208, 286 and 306, including three ts and two tv (1.16% interspecific variation) (Table 2.3). Thus, the 10 positions differing between the two fasciolid species represent 1.05% interspecific variation. When comparing the 69 cox1 haplotypes of F. hepatica with the 11 cox1 haplotypes of F. gigantica, the only two complete sequences of the same gene of F. hepatica available in the GenBank were also included because their geographic origins were from endemic areas in which F. gigantica is not present: one haplotype (GenBank Acc. No. M93388) from cattle, Salt Lake City, Utah, United States (Garey and Wolstenholme, 1989) and another haplotype (GenBank Acc. No. AF216697) of the Geelon strain from Australia (Le et al., 2001). In the alignment of the 82 haplotypes, a total of 194 (12.65%) variable positions appeared, being 151 (9.85%) parsimony informative and 43 (2.80%) singleton sites. Among them, 113 (7.37%) differing sites scattered along the entire gene (i.e. no hot spot was detected) allowed the two species to be distinguished (Table 2.4). In the alignment of the 23 COX1 protein haplotypes of F. hepatica with the five COX1 haplotypes of F. gigantica, plus the two COX1 protein haplotypes available in the GenBank (Garey and Wolstenholme, 1989; Le et al., 2001), a total of 52 (10.20%) variable positions appeared, being 29 (5.62%) parsimony informative and 23 (4.51%) singleton sites. The comparison showed that 22 (4.31%) variable amino acid positions

TABLE 2.3 Pairwise comparison of the nucleotide sequences of the nuclear rDNA ITS-1 and ITS-2 and the whole intergenic region between ‘pure’ F. hepatica and ‘pure’ F. gigantica Fasciolid species

Fasciola hepatica Fasciola gigantica

Polymorphic sites

Intergenic region (ITS-1, 5.8S, ITS-2) 24 114 208 286

306

821

860

866

917

924

ITS-1 24 C

114 A

208 C

286 T

306 C

ITS-2 234 T

273 C

279 C

330 T

337 G

T

T

T

A

T

C

T

T

–

A

TABLE 2.4 Positions of the mtDNA cox1 gene sequence including nucleotides allowing the differentiation of Fasciola hepatica and F. gigantica Species

Length Differing positions

F. hepatica F. gigantica

bp 1,533 1,533

Species



bp 1,533 1,533

Species



bp 1,533 1,533

Species



bp 1,533 1,533

3 G T

9 21 G G A A

52 54 69 72 93 94 96 117 123 138 G T G G G G G A A T T G T A T A T G T G

147 165 168 177 178 183 201 207 222 237 243 246 247 A T T G A A G G T G C/T A T G G G T G T A T G A T G C

249 252 255 306 G A G/T A T G T G

307 309 330 342 349 351 363 375 400 402 420 444 459 489 503 513 519 531 544 546 556 561 573 579 585 609 625 651 657 696 T G/T T A G A A G/A A G G G A A A G G G C A/G G A A/G T G A G A G G C T G G A G G C G T A T G G G T T A T G A G T G A G A T T T

702 717 723 726 754 780 804 927 930 939 945 951 966 984 1002 1009 1011 1014 1018 1026 1080 1095 1146 1158 1180 1185 1188 1197 1209 1218 T G A A/C G G A G/A T C C G G A G A A G A A T A A C G G T T C A/G G A G T A A G T/C G T T A T T A G T T G G G T T T A T G G T G

1221 1228 1275 1285 1286 1287 1290 1296 1299 1302 1320 1350 1360 1368 1371 1380 1390 1396 1419 1426 1434 1437 1452 1455 1482 1491 1514 1515 1521 T G C G C G G T C G G T C G A C G A A T C T G T G/A A T T C/T G T T T G T T G T T T A T T T T T G T C T G T G T G C G T

Notes: Total of 119 differing positions deduced from an alignment including 71 F. hepatica haplotypes (39 populations from 10 countries, including the haplotype GenBank Acc. No. M93388 from Salt Lake City, Utah, United States of Garey and Wolstenholme, 1989, and the haplotype GenBank Ac. No. AF216697 corresponding to the Geelon strain from Australia of Le et al., 2001) and 11 F. gigantica haplotypes (four populations from four countries). Nucleotides in 113 positions (7.37%) allow species differentiation (in the position where two different nucleotides are noted, the first is the majority one). Other six positions, in which the majority (>75%) of the F. hepatica haplotypes also present a differing nucleotide, are additionally included: positions 243 (T in only 22.5%), 255 (T in 22.5%), 309 (T in 22.5%), 546 (G in 14.1%), 1,218 (G in 4.2%) and 1,521 (T in 9.8%). bp, base pairs.

102


distinguish between both species and that these variations are scattered along the entire protein (Table 2.5). When comparing the 51 nad1 haplotypes of F. hepatica, the 15 nad1 haplotypes of F. gigantica, and the two F. hepatica nad1 haplotypes from the United States (M93388) (Garey and Wolstenholme, 1989) and Australia (AF216697) (Le et al., 2001), a total of 113 (12.51%) variable positions appeared, being 91 (10.08%) parsimony informative and 22 (2.44%) singleton sites. Among them, 70 (7.75%) polymorphic sites scattered along the entire gene (i.e. no hot spot was detected) allowed the two species to be distinguished (Table 2.6). In the alignment of the 14 NAD1 protein haplotypes of F. hepatica with the 10 NAD1 haplotypes of F. gigantica, plus the two NAD1 protein haplotypes available in the GenBank (Garey and Wolstenholme, 1989; Le et al., 2001), a total of 31 (10.33%) variable positions appeared, being 25 (8.33%) parsimony informative and only six (2.00%) singleton sites. The comparison showed that 19 (6.33%) variable amino acid positions distinguish between both species and that these variations are also scattered along the entire protein (Table 2.7).

2.11.1.4. ITS comparison of ‘pure’ F. hepatica and F. gigantica with other Fasciola samples When comparing sequences of ‘pure’ F. hepatica and ‘pure’ F. gigantica with those of other populations of both species available today, unfortunately, cox1 and nad1 cannot be used because of their incomplete sequences and different lengths. Consequently, any comparison is restricted to ITSs. ITS-1 of F. hepatica appears to be fully uniform everywhere (FhITS1-A). Not one nucleotide difference has been found in the 40 sequences compared (Table 2.1). The gaps found in the Egyptian EF612467 sequence (Lotfy et al., 2008) should be reassessed, as a gap has never been found in the ITS-1 sequence obtained from very numerous F. hepatica specimens analyzed from different areas of Egypt to date (Bargues et al., unpublished data). The reports of sequences lacking six nucleotides at the 50 end (Alasaad et al., 2007; Ali et al., 2008; Lin et al., 2007) and four nucleotides at the 30 end (Lin et al., 2007) probably relate to the same FhITS1-A sequence. ITS-1 of F. gigantica also seems to be uniform (FgITS1-A) across the 22 sequences compared (Table 2.1). The differences in the only sequence from India (Prasad et al., 2008) are undoubtedly due to reading errors at the 50 end, one of which represents an insertion in position 22 that generates a one-position shift in all the subsequent nucleotides. The gaps and one mutation at the incomplete 30 end of the AJ628043 sequence from Guangxi, China (Lin et al., 2007) suggest an unrevised sequence. A priori nothing indicates that differences might be present in the undefined

TABLE 2.5 Positions of the mtDNA COX1 protein sequence including amino acids which allow the differentiation of F. hepatica and F. gigantica Length Differing positions Species

aa

1

18 32 60 61 117 134 168 186 209 252 328 337 340 394 410 429 454 464 466 476 505


510 510

M I

V L

V I

I V

M I

V M

S G

D G

V I

G S

V M

M I

M V

I V

V I

V F

A C

L F

V L

I V

C R

V A

Notes: Total of 22 differing positions (4.31%) deduced from an alignment including 25 F. hepatica haplotypes (39 populations from 10 countries, including the haplotype GenBank Acc. No. M93388 from Salt Lake City, Utah, United States, of Garey and Wolstenholme, 1989, and the haplotype Ac. No. AF216697 corresponding to the Geelon strain from Australia of Le et al., 2000) and five F. gigantica haplotypes (four populations from four countries). aa, amino acids.

TABLE 2.6 Positions of the mtDNA nad1 gene sequence including nucleotides allowing the differentiation of Fasciola hepatica and F. gigantica Species



bp 903 903

Species



bp 903 903

Species



bp 903 903

12 19 20 22 33 36 39 78 120 132 153 157 168 174 189 276 283 295 306 316 345 351 369 375 414 G G C/T T T A/G T A G G A T G G A C G T T A G T G A T T T T C G T G C A T G C T T G T T C A G T G T G G

417 441 447 474 480 486 509 514 516 519 523 525 527 528 543 544 558 579 588 600 609 627 630 633 636 C T G T G A T T T G G T A A A A A G A C A T A T A T G T C A T C A G A A G T/G T G T G T G T C/T G/A G G G

639 657 675 687 699 706 715 726 727 741 754 755 756 762 763 765 772 798 816 825 845 871 893 A T T A A A A A T A A G G C/T T/C A G G A T G T T G G G G G G G G C G G A A T C/T G T/G T G G C G G

Notes: Total of 73 differing positions deduced from an alignment including 53 F. hepatica haplotypes (39 populations from 10 countries, including the haplotype Acc. No. M93388 from Salt Lake City, Utah, United States of Garey and Wolstenholme, 1989, and the haplotype Ac. No. AF216697 corresponding to the Geelon strain from Australia of Le et al., 2001) and 15 F. gigantica haplotypes (four populations from four countries). Nucleotides in 70 positions (7.75%) allow species differentiation (in the position where two different nucleotides are noted, the first is the majority one). Other three positions, in which the majority (>75%) of the haplotypes also present a differing nucleotide, are additionally included: positions 20 (T in only 19.6% of the F. hepatica haplotypes), 762 (T in 3.9% of the F. hepatica haplotypes) and 763 (C in 15.6% of the F. hepatica haplotypes whereas T in 13.3% of the F. gigantica haplotypes). bp, base pairs.

TABLE 2.7 Positions of the mtDNA NAD1 protein sequence including amino acids which allow the differentiation of Fasciola hepatica and F. gigantica Species

Length

Differing positions


aa 300 300

4 L F

7 A/V F

8 F L

12 L F

95 V L

99 F L

106 S G

170 V A

172 C/R S

175 G S

176 E V/G

182 M L

236 I V

239 I V

243 F L

252 S E/G

282 S T

291 L V

298 F C

Notes: Total of 19 differing positions (6.33%) deduced from an alignment including 16 F. hepatica haplotypes (39 populations from 10 countries, including the haplotype Acc. No. M93388 from Salt Lake City, Utah, United States of Garey and Wolstenholme, 1989, and the haplotype Acc. No. AF216697 corresponding to the Geelon strain from Australia of Le et al., 2001) and 10 F. gigantica haplotypes (four populations from four countries). In the position where two different nucleotides are noted, the first is the majority one. aa, amino acids.

106


nucleotides in the sequences from Japan (Itagaki et al., 2005a), Korea (Itagaki et al., 2005b), China (Lin et al., 2007) and Vietnam (Itagaki and Sakaguchi, 2008) at the five positions differentiating both species. A review by respective authors should be undertaken, similarly with respect to the nucleotides lacking at the 50 and 30 ends of sequences from India (Prasad et al., 2008), Niger (Ali et al., 2008) and China (Lin et al., 2007). Whereas ITS-1 seems to be non-informative, the low variability of the ITS-2 sequence in both fasciolid species appears to furnish valuable information. If one excludes the nucleotides lacking at the 50 end (Adlard et al., 1993; Agatsuma et al., 2000; Huang et al., 2004; Le et al., 2008) and 30 end (Adlard et al., 1993; Agatsuma et al., 2000), then a few different haplotypes can be distinguished in both species. With regard to the 76 F. hepatica ITS-2 sequences available (Table 2.2), the most frequent ITS-2 haplotype (FhITS2-1) shows a widespread distribution indicating that this is the main haplotype involved in the spread of F. hepatica throughout all continents. This is the complete opposite of what was recently reported on the basis of a very few samples (Alasaad et al., 2007). In Europe this haplotype has been detected in Hungary (Adlard et al., 1993), Spain (Alasaad et al., 2007; Mas-Coma et al., 2001) and Poland (Artigas et al., 2004). Its distribution in Spain includes provinces in the North (Lugo, Oviedo, Logronõ, Bilbao, Lerida and Barcelona), Centre (Avila, Segovia and Toledo), East (Castellon and Valencia), South (Granada and Cadiz) and islands (Mediterranean Mallorca and Atlantic Tenerife). In eastern Europe and Asia, it is present in the continuum of Belorussia, Ukraine, Russia, Armenia and Turkmenistan (Semyenova et al., 2005). In the Near East, it has been found in Iran (Bargues et al., 2002a; Ghavami et al., 2008), in the Far East in Japan (Itagaki and Tsutsumi, 1998; Itagaki et al., 2005a) and Korea (Agatsuma et al., 2000), and in South-east Asia in Vietnam (Le et al., 2008). In Africa, it is present in Egypt (Periago, 2004) and Niger (Ali et al., 2008). It has, moreover, been reported from Australia in Oceania (Hashimoto et al., 1997; Itagaki et al., 2005a; Le et al., 2008) and Bolivia in the Americas (Mas-Coma et al., 2001). The second most frequent F. hepatica ITS-2 haplotype (FhITS2-2) differs by a transition in position 287 of the alignment of the two species. It is also widely distributed but appears to be less common. Up to the present it has been found in the northern and eastern provinces of A Corunã, Valladolid, La Rioja, Pamplona, Lerida and Castellon in Spain (Bargues et al., unpublished data; Alasaad et al., 2007) and Andorra (Alasaad et al., 2007) in western Europe, in Oceania including Australia and New Zealand (Adlard et al., 1993), and the New World in Mexico (Adlard et al., 1993) and Uruguay (Itagaki and Tsutsumi, 1998). Thus, this haplotype appears to be involved in the colonizations of both Oceania and the Americas from eastern European areas. It is, anyway, impossible to speculate about its origin until sequences from other European areas,


107

north-western Africa and the region of the old Levant and Fertile Crescent become available. A third F. hepatica haplotype (FhITS2-3) including two transversions in positions 344 and 345 has been reported from China and France (Huang et al., 2004). The extremes of this distribution are somewhat surprising, mainly because this haplotype has never been found in the numerous geographically intermediate countries of Europe and Asia from which fasciolids have been sequenced. This may be a sporadic haplotype arising from the ancient livestock exchange between Europe and China, but it would be sensible to check the sequence from France. Anyway, this haplotype may be related to the spread of F. hepatica-like hybrids into China, as the same mutations have been found also in a F. gigantica haplotype from the same country (Le et al., 2008). The last F. hepatica haplotype (FhITS2-4) is characterized by a transition in position 337 found in an hybrid from Vietnam (Le et al., 2008). The same nucleotide A involved in this position in F. gigantica indicates that hybridization is involved in this haplotype. When comparing the 41 F. gigantica ITS-2 sequences available (Table 2.2), accurate analysis of the frequencies of the different ITS-2 haplotypes cannot be made because studies in Asia greatly outnumber those in Africa. The most geographically widespread haplotype (FgITS2-1) appears to be the so-called ‘pure’ one reported in Burkina Faso (Bargues and MasComa, 2005b), widely distributed in Egypt (Bargues et al., unpublished data), present in Kenya (Lotfy et al., 2008) and also introduced in near eastern Iran (Bargues et al., 2002a) and central Asian Tajikistan (Semyenova et al., 2005). Sequences from Turkmenistan and Uzbekistan differing by only two or three undefined nucleotides (Semyenova et al., 2005) are likely to relate to the same haplotype. This haplotype was most likely to have been involved in the main spread of F. gigantica throughout Africa and northwards through Egypt, having entered the Near East and spread even further eastwards into Asia, and north to the Himalayas. A second F. gigantica ITS-2 haplotype (FgITS2-2), defined by a transition in position 210, has been reported in India (Prasad et al., 2008), Malaysia (Adlard et al., 1993; Hashimoto et al., 1997), Vietnam (Le et al., 2008), Indonesia (Itagaki and Tsutsumi, 1998; Itagaki et al., 2005a) and Japan (Hashimoto et al., 1997; Itagaki et al., 2005a). This haplotype is the one that has to be linked to the spread of F. gigantica throughout southern Asia through the Indian sub-continent and South-east Asia. The history of animal exchange between South-east Asia and the Far East and Pacific islands explains its further spread into Japan and Indonesia. The third F. gigantica ITS-2 haplotype (FgITS2-3) is derived from the previous one, FgITS2-2, by the accumulation of an additional transition in position 221. FgITS2-3 apparently seems to be restricted to Vietnam (Le et al., 2008), Korea (Agatsuma et al., 2000) and Japan (Adlard et al.,

108


1993; Itagaki and Tsutsumi, 1998; Itagaki et al., 2005a). This third haplotype was involved in the historical human exchange between South-east Asia and the more northern Far East. The fourth F. gigantica ITS-2 haplotype (FgITS2-4) also seems to be derived from FgITS2-2 by the accumulation of two additional transversions in positions 344 and 345. FgITS2-4 has been found in China (Huang et al., 2004; Le et al., 2008), suggesting that different haplotypes were involved in the exchange between South-east Asia and the Far East. The recent report of this haplotype in Niger (Ali et al., 2008) is difficult to understand and suggests the need to review this African sequence. A fifth F. gigantica ITS-2 haplotype (FgITS2-5) can be ascribed to a sequence found in Zambia (Itagaki and Tsutsumi, 1998), which only differs from the ‘pure’ FgITS2-1 by a transition in position 301. Taking geography into account, this haplotype might perhaps be close to the original F. gigantica that originated millions of years ago in that eastern part of Africa. Sequencing of fasciolids infecting wild ruminants in east Africa is needed to verify such an hypothesis. Another F. gigantica ITS-2 haplotype (AB010975) also detected in Zambia (Itagaki and Tsutsumi, 1998), appears in fact to be closer to F. hepatica from which it differs only by a transversion in position 234, a transition in position 301 and a deletion in position 330, the latter being the only real difference from F. gigantica. Although this sequence appears to be unique at the moment, caution suggests it is better not to ascribe a definitive code to this specific haplotype until it can be confirmed. Despite F. hepatica never having been reported from Zambia, this does not mean that it can be present in that country. Field work to ascertain whether G. truncatula has been introduced from neighbouring Tanzania into Zambia is recommended. Present records of G. truncatula at moderately high altitudes on both sides of the Rift Valley in Ethiopia suggest that it may also occur at lower altitudes, as is the case of the area of Tanzania around the southern part of Lake Tanganyika neighbouring Zambia (MandahlBarth, personal communication in Brown, 1965, p. 49). Finally, rare gaps in a sequence (AB010975) from China (Huang et al., 2004), several undefined nucleotides in another (AB207153) from Japan (Itagaki et al., 2005a) and a curious sequence (DQ383512) from Egypt (Taha, 2006) never previously found in that country despite the sequencing of numerous fasciolids (Bargues et al., unpublished data), suggests it would be better also to leave these three F. gigantica ITS-2 sequences without a definitive haplotype ascription (Table 2.2).

2.11.2. Gene expression and the problems of hybrids Introgression refers to the incorporation of genes from one set of differentiated populations into another, that is, the incorporation of alien genes into a new, reproductively integrated population system (Dowling and Secor,


109

1997). The possible explanations of selection and drift on introgression have been discussed (Ballard and Whitlock, 2004). Introgression may concern the whole mitochondrial genome, that is, substitution of the complete parenteral mtDNA by the complete mtDNA of the other interbreeding species (or subspecies, or population), or only part of the mitochondrial genome, as for instance certain genes. The finding of an introgressed specimen in nature does not necessarily mean that (i) it is an F1 hybrid directly descending from two parents belonging to different evolutionary units (species, subspecies or populations), but (ii) it may also represent a stable, long-term established, successful introgression, that is a result of incomplete mtDNA lineage sorting, where sequences of the two ancestors are still retained (Mas-Coma and Bargues, 2008). The easiest way to detect hybrids is by finding a nuclear rDNA sequence of one species and a mtDNA sequence of another species in the same specimen. If moreover only one sequence of a rapidly evolving nuclear rDNA such as an ITS is found, it may be deduced that the specimen contains stable, long-term, successfully introgressed sequences. A recent introgression can be deduced if two different nuclear rDNA sequences co-exist in the same individual, because this means that concerted evolution has not yet had sufficient time for the rDNA operon to become uniform (Mas-Coma and Bargues, 2008). Fasciolid adults are hermaphroditic and thus able to produce viable eggs by selfing. However, results obtained in genetic studies indicate that they also crossbreed (Hurtrez-Bousses et al., 2004) and the usual detection of introgressed hybrids in endemic areas where F. hepatica and F. gigantica overlap suggests that crossbreeding may be very frequent. In fact, the finding of adults of both species in the liver of the same individual animal is the rule in many places in Africa and Asia, such as Egypt and Iran (Ashrafi et al., 2006; Periago et al., 2007), and it may be similar in humans as is seen in Uzbekistan (Sadykov, 1988). This capacity for selfing and crossbreeding means that the eggs found in stools of an individual host co-infected by adults of both species, may be F. hepatica, others F. gigantica and others hybrids. Thus, it is evident that in an area of overlap, eggs found in stools of a definitive host individual may not necessarily be genetically identical to the adult fluke parents harboured in the liver of this host individual. In other terms, faecal eggs of a given combined hybrid haplotype do not necessarily mean that the adult flukes infecting the patient are of the same combined hybrid haplotype, and that hybrid eggs in stools may in fact be produced by ‘pure’ flukes of both species present in the same liver. This was taken into account when phenotyping fasciolid eggs from African and Asian areas (Valero et al., 2009). As many hybrids appear to be viable, according to both recent experimental work (Bargues et al., unpublished data) and field studies detecting long-term introgressions such as in specimens with only one ITS sequence, an accumulation of many genetically different introgressed

110


hybrid forms may be expected in an area of overlap. In such an accumulative evolution of introgressed hybrids, lymnaeid species present in the endemic area must play a crucial bottleneck role depending on their distribution, frequency, ecology and fasciolid/lymnaeid specificity. In fasciolids in overlap areas, it seems that long-term introgressed hybrids are common, but findings of fasciolids simultaneously presenting two different ITS (Huang et al., 2004; Le et al., 2008) indicate that hybridization phenomena may still occur today in several areas. Such recent hybridizations may evidently mainly occur in areas in which co-existence of Galba and Radix lymnaeids enable the transmission of both F. hepatica (and/or F. hepatica-like forms) and F. gigantica (and/or F. gigantica-like forms). However, livestock introductions may initiate hybridization or increase the already existing introgression complex in an area in which present lymnaeids a priori only enable the transmission of one fasciolid species. Events in the United States (Price, 1953) and Vietnam (Le et al., 2008) are good examples. Nuclear rDNA and mtDNA sequences have traditionally been considered neutral markers, although the extensive information available today is quickly changing concepts (Mas-Coma and Bargues, 2008). Although these makers a priori have no direct relationship with morphological and biological phenotypes, it should be emphasized that nuclear rDNA appears to correlate with adult fluke characteristics and fasciolid/lymnaeid specificity, whereas mtDNA does not. However, within the very large variability of intermediate adult flukes detectable in an overlap area, several are so intermediate in shape and size that they cannot be ascribed to F. hepatica-like or F. gigantica-like forms, even though only one sequence of each nuclear rDNA ITS-1 and ITS-2 is found in the fluke specimen and these sequence data indicate this specimen to belong to one or the other species (Bargues et al., unpublished data). With regard to biological phenotypes, hybrid flukes with F. hepatica ITS occurring in Vietnam (Le et al., 2008), where only Radix lymnaeids are present, similarly suggest that sometimes snail specificity may be the opposite of that deduced from the adult morphotype. Thus, the use of one or more markers of only nuclear rDNA or only mtDNA is not appropriate for the classification of fasciolid specimens and the genetic characterization of intermediate forms in overlap areas. One specimen can only be correctly catalogued by combined haplotyping, with a minimum of a nuclear rDNA sequence and a mtDNA sequence. However, it should be noted that hybrids may be overlooked if they only include partial introgression that does not involve the mtDNA gene which is used in the study. Consequently, quick diagnostic molecular techniques based on only one kind of DNA marker (Huang et al., 2004; Marcilla et al., 2002) are insufficient in those areas, although when based on nuclear rDNA they may be useful for clinical and pathological assessment of patients, for


111

distinguishing between the usually smaller, less pathogenic F. hepatica-like hybrids and the larger, more pathogenic F. gigantica-like hybrids, because of the correlation between nuclear rDNA and adult morphotype. The consequences of long-term introgressions such as those giving rise to the phenomena of abnormal ploidy and aspermic parthenogenesis (Terasaki et al., 2000) and the subsequent problems in coprological diagnosis of patients because of the absence or scarcity of eggs in stools are already known (Valero et al., unpublished data). Numerous additional and important questions posed by hybrids remain to be elucidated, regarding their aetiology, epidemiology, clinical disease and pathology, diagnostics, treatment and control in both human and animal fascioliasis.

2.11.3. Liver fluke phenotypes 2.11.3.1. Phenotypic characterization of adults of ‘pure’ F. hepatica and F. gigantica The most frequently used criterion for systematic studies on flukes of the genus Fasciola has been morphology. The differences most frequently highlighted between the two species are the increased length in F. gigantica and the general appearance of the body, which is narrower and elongated in F. gigantica and shorter, broader and curved in the shape of a lancet in F. hepatica (Kendall, 1965). It has also been noted that these two species differ in the shape and size of their cuticular scales (Varma, 1953). Other authors have differentiated both species on the basis of the ramification patterns of the reproductive organs and intestines (Bergeon and Laurent, 1970; Jackson, 1921; Watanabe, 1962), but the natural branching shape of these structures make this characteristic impractical. Surprisingly, although many morphometric studies have dealt with F. hepatica, very few have focused on F. gigantica (Srimuzipo et al., 2000), and even fewer studies have focused on a comparison of the two species. Unfortunately, studies that have compared both species have used specimens from countries where both species overlap, such as the Philippines (Kimura et al., 1984), Iran (Sahba et al., 1972), Thailand (Srimuzipo et al., 2000) and Egypt (Lotfy et al., 2002). Fasciolid species differentiation in areas where both species overlap is a very complicated task: Reports in the literature have not used standardized measurements and

therefore results cannot be compared.

Studies on variability have not taken allometric growth into account. Classical measurements of adults and eggs in many cases demonstrate

an overlap between both species, although conclusions cannot be drawn because the parasite materials used are mixtures from different host species and measurements have not been separated accordingly.

112


Recent exhaustive morphometric comparisons of adults and eggs of

natural fasciolid populations from different host species, and adults and eggs obtained experimentally in Wistar rats infected with isolates from different natural hosts revealed that the definitive host species decisively influences the size of adults and eggs, and that this influence does not persist in a heterologous host (Valero et al., 2001). In areas of overlap, intermediate forms usually appear that cannot be ascribed to one or the other species. In Asian countries, a wide range of morphological types is detected, some resemble F. hepatica, others F. gigantica, and others are intermediate forms. These three morphological types included diploid (2n ¼ 20), triploid (2n ¼ 30) and mixoploid (both 20 and 30 chromosomes within a single fluke) chromosomal types, with abnormal spermatogenesis and no fertilization (Terasaki et al., 1982), later confirmed to reproduce by parthenogenesis (Agatsuma et al., 1994). Studies indicated that the different parthenogenetic lines in Asia may have arisen through independent hybridization events between strains and were different from the Mendelian, spermic populations of American and Australian diploid strains (Agatsuma et al., 1994). The application of rDNA and mtDNA makers later confirmed that hybrid forms were involved in these flukes. The finding of an aspermic triploid, asexually reproducing, liver fluke isolate in the United Kingdom suggests that facultative gynogenesis may not be restricted to Asia (Fletcher et al., 2004). An accurate morphometric study has recently been performed in order to establish whether F. hepatica and F. gigantica can be phenotypically differentiated (Periago et al., 2006): (i) the geography of snail hosts regarding lymnaeid specificity was taken into account, so that flukes used were from origins where only ‘pure’ fasciolid species were expected to be present because of the absence of lymnaeids enabling the transmission of the other fasciolid species: materials from areas with G. truncatula from continental (Spain) and insular (Corsica) origins for F. hepatica, and from areas with R. natalensis in Burkina Faso for F. gigantica; (ii) to avoid definitive host species bias, only adult flukes found in the same host (naturally infected bovines) were used; (iii) to avoid technical bias, worms were fixed, stained and mounted using the same methodology, and eggs were analyzed without fixation from filtered faeces or bile; (iv) a computer image analysis system (CIAS) was used, enabling uni-, bi- and tri-dimensional measurements and providing useful ratios for specific biometric parameters (Valero et al., 2005); (v) standardized methodology was used for measurements (Valero et al., 1996, 2001) of both adults and eggs (Fig. 2.4); (vi) to ensure accurate morphometric comparison, it was assumed that morphometric differences attributable to age may appear when natural adult populations of different ages are studied and, consequently, only the allometric growth of a given biometric measurement as

113


A

B

BW

BW

BWOv

BWOv TW

TW

CW

Ph

YS

CL

OS

Ph

OS-YS A-YS

OS

OS-YS

A-YS

CL

CW

YS Ov

TL

Yit-P

TL

T

Yit

Yit-P

Yit

BL

Yit

YS-P

Yit

YS-Yit

YS-Yit

BL

YS-P

Ov T

FIGURE 2.4 Standardized measurements in gravid fasciolid adults which can be obtained with a microscope. Notes: (A) Fasciola hepatica. (B) Fasciola gigantica: body length (BL), maximum body width (BW), body width at ovary level (BWOv), cone length (CL), cone width (CW), maximum diameter of oral sucker (OS max), minimum diameter of oral sucker (OS min), maximum diameter of ventral sucker (VS max), minimum diameter of ventral sucker (VS min), distance between the anterior end of the body and the ventral sucker (A-VS), distance between the oral sucker and the ventral sucker (OS-VS), distance between the ventral sucker and the union of the vitelline glands (VS-Vit), distance between the union of the vitelline glands and the posterior end of the body (Vit-P), distance between the ventral sucker and the posterior end of the body (VS-P), pharynx length (PhL), pharynx width (PhW), testicular space (taking both testes together)

114


a function of another biometric measurement was taken into account (Valero et al., 1991, 1996, 1998, 1999).

2.11.3.1.1. Adult size analysis Allometric analyses of F. gigantica were described for the first time. The study showed that when only morphometric characteristics were considered, without taking allometric growth into account, all the values of classical measurements applied to adult flukes overlap in the two fasciolids, except for the distance between the ventral sucker and the posterior end of the body (VS-P), which proved to be a useful tool for species differentiation. From the allometric perspective, the maximum values of most measures related to body length (BL) and the vertical growth gradient from the ventral sucker to the posterior end of the body are usually much larger in F. gigantica than those detected in F. hepatica, especially the distance between the union of the vitelline glands and the posterior end of the body (Vit-P). In contrast, F. hepatica showed maximum values in the measurements related to maximum body width (BW) and the horizontal growth gradient: BW body width at ovary level (BWOv), distance between the anterior end of the body and the ventral sucker (A-VS), and testicular space width (TW). These maximum measures highlight the characteristically longer length of F. gigantica when compared to F. hepatica. Although the measurements anterior to the ventral sucker do not seem to vary greatly between the two species, the allometric study showed different morphological traits which enable one to distinguish between both F. hepatica and F. gigantica adults in the same host species. Despite the overlap of most of the morphometric values, results obtained showed 11 significant allometric differences (Periago et al., 2006). 2.11.3.1.2. Adult shape analysis With regard to shape, body roundness (BR ¼ BP2/4pBA) in both species proved to be a good species differentiation tool, since its ranges do not overlap between the two species and it does not vary with age. Study of the variation of the different ratios with development showed that the only ratio useful for species differentiation was BL/BW. Even though the body area (BA) of both species overlaps, length (TL), and testicular space width (TW). Ratios include body length over body width (BL/BW), body width at ovary level over cone width (Bow/CW), and body length over the distance between the ventral sucker and the posterior end of the body (BL/VS-P). Computer image analysis system (CIAS) technology allows to additionally obtain: body perimeter (BP), and testicular space perimeter (TP), body area (BA), oral sucker area (OSA), ventral sucker area (VSA), pharynx area (PhA), and testicular space area (TA), plus the ratio of oral sucker area over ventral sucker area (OSA/VSA) and the body roundness (BR ¼ BP2/4pBA) to quantify the body shape.


115

F. hepatica tends to be wider while F. gigantica tends to be much longer, giving each species its characteristic body shape (Periago et al., 2006).

2.11.3.2. Phenotypic characterization of eggs of ‘pure’ F. hepatica and F. gigantica In the study of allopatric areas such as Europe and Africa, results showed that, although the morphometric values of eggs overlap somewhat, there were significant differences between the two species in egg length (EL), egg perimeter (EP) and egg area (EA) (Periago et al., 2006). Unfortunately, large variations were observed in the size of F. hepatica eggs in livestock from different geographical locations (Tinar, 1984), and in sympatric areas where both liver fluke species are found, such as in Asian countries, a large overlap of egg measurements have been detected (Kimura et al., 1984; Sahba et al., 1972; Srimuzipo et al., 2000; Watanabe, 1962). Moreover, fasciolid eggs measurements are known to differ significantly between different host species, and experimental studies have shown that the size of F. hepatica eggs isolated from a given host changed when experimentally transferred to a different host species (Valero et al., 2001).

2.11.3.3. Phenotypic characterization of fasciolids in overlap areas Especially surprising are the very different pictures seen when comparing the phenotypic characteristics of fasciolids in endemic areas where both F. hepatica and F. gigantica overlap, such as in Iran and Egypt (Fig. 2.3) (Ashrafi et al., 2006; Periago et al., 2007). The question immediately arises as to which local driving forces are involved in order to understand such differences. The different overlap situations of Galba and Radix lymnaeids in local areas may explain such differences fully or partly. Quantification of the size and shape of adults and eggs of ‘pure’ F. hepatica and ‘pure’ F. gigantica from sources with no overlap (Periago et al., 2006) is expected to provide a basis on which comparative morphometric studies of fasciolids in sympatric areas can be carried out, enabling even potential intermediate forms to be distinguished. Emerging morphometric concepts provide appropriate tools for phenotyping adults and eggs, by offering the possibility of performing comparisons based on standardized measurements from which statistically significant results can be obtained. The first application of this method was to characterize fasciolids from naturally infected bovines from Gilan, Iran (Ashrafi et al., 2006). In this area, both F. hepatica and F. gigantica co-exist in individual cattle and buffaloes (Sahba et al., 1972), and intermediate forms have been described (Ashrafi et al., 2006; Moghaddam et al., 2004). Although morphometric values showed great overlap, there were clear differences in allometric growth. Results obtained showed that Iranian F. hepatica-like specimens

116


are larger than the F. hepatica standard (from Bolivia) and Iranian F. gigantica-like specimens are longer and narrower than the F. gigantica standard (from Burkina Faso), but with a smaller body area. Measurements which permit specific differentiation in allopatric populations (VSP, BL/BW) overlap in the specimens from Gilan, thus proving the presence of intermediate forms. The allometrics of intermediate fasciolid forms were described for the first time. When compared to standard populations, the different Iranian fasciolid morphs showed differences in F. gigantica-like specimens greater than those in F. hepatica-like specimens. Moreover, this study showed that simple, traditional microscopic measurements may be sufficient for current morphometric characterization, so that CIAS methodology need not necessarily be applied in analyses conducted by local health workers (Ashrafi et al., 2006). A second approach underlined the usefulness of CIAS for phenotypic characterization of adult flukes from a specific endemic area, with results distinguishing the presence of F. hepatica, F. gigantica and intermediate forms in cattle and buffaloes in Egypt (Periago et al., 2007). Comparison of the three groups, obtained through the application of BR, BL/BW and VSP values, showed that, additionally, the values of BL, BP and VS-Vit do not overlap between F. hepatica and F. gigantica in flukes from Egypt. Egyptian F. hepatica specimens showed higher maximum values in most of the measurements compared not only to the standard measurements from Europe (Periago et al., 2006), but also to specimens from Australia, Mexico and Bolivia. Moreover, Egyptian F. gigantica specimens showed maximum values mostly lower than those from Burkina Faso, but similar to those from Thailand. Amongst Egyptian Fasciola sp. specimens, there are not only individuals intermediate in size and shape, but also individuals with the typical shape of F. hepatica and typical size of F. gigantica (Periago et al., 2007). When applying CIAS measurement criteria (BR, BL/BW and VS-P) to specimens from Iran, the presence of F. hepatica, F. gigantica and Fasciola sp. was confirmed (Periago et al., 2007), which agrees with observations obtained by traditional techniques (Ashrafi et al., 2006; Moghaddam et al., 2004). Comparison of the three groups, obtained through the application of BR, BL/BW and VS-P, showed that all values of the remaining measurements overlap between F. hepatica and F. gigantica in Iran, indicating a wider range of intermediate forms in Iran than in Egypt. Comparison with specimens from other Asian countries showed that Iranian specimens are the longest and narrowest among all Asian populations studied in bovines to date. Interestingly, Fasciola sp. specimens from Iran, unlike intermediate forms from Egypt, were predominantly intermediate in shape, but closer in size to F. hepatica. This demonstrated the need to consider not only shape but also size in order to avoid erroneous classification of Fasciola specimens. BR, BL/BW, and VS-P provided useful tools for studying inter- and


117

intraspecific morphological diversity in Fasciola adults (Fig. 2.4). The application of these markers to specimens from areas where F. hepatica and F. gigantica co-exist, such as Egypt and Iran, suggests strong populationlevel variation in Fasciola adult morphology (Periago et al., 2007).

2.11.3.4. Phenotypic characterization of fasciolid eggs shed by humans In fascioliasis, the usual diagnosis during the biliary stage of infection is based on the classification of eggs found in stools, duodenal contents or bile. Because fascioliasis has traditionally been considered a worldwide veterinary problem, the egg size range reported in the literature regarding human diagnosis was in fact obtained through the analysis of samples from domestic animal hosts: F. hepatica 130–148/60–90 mm (Boray, 1982), 130–145/70–90 mm (World Health Organization, 1991) or 130–150/6390 mm (Mas-Coma and Bargues, 1997), and F. gigantica 150–196/90– 100 mm (Boray, 1982; Mas-Coma and Bargues, 1997). So, the threshold of differentiation between the two species was traditionally considered 150 mm in length and 90 mm in width. The large intraspecific variability found in eggs from livestock from different geographic origins (Tinar, 1984), the pronounced influence of the definitive host species on egg size (Valero et al., 2001), and the existence of intermediate forms and genetic hybrids in overlap areas in both human and animal endemic areas of Africa and Asia mean it is problematic to use egg characteristics as a tool for the differential diagnosis of the two fascioliases. A specific example of this problem was recently highlighted in human diagnosis (Inoue et al., 2007). A recent study was undertaken to validate the identification of Fasciola species based on the shape and size of eggs shed by humans, characterizing their morphometric traits using CIAS (Valero et al., 2009). The influence of both geographical location and host (human and livestock) were analyzed. Coprological sampling was carried out in human endemic areas, where only F. hepatica is present (Northern Bolivian Altiplano and Cajamarca valley in Peru), and where F. hepatica and F. gigantica co-exist (Kutaisi region in Georgia, Nile Delta in Egypt and Quy Nhon province in Vietnam). The study revealed that humans have a decisive influence on the size of F. hepatica and F. gigantica eggs, showing greater variation than the above-mentioned classic range, that is, in humans F. hepatica eggs are bigger and F. gigantica eggs are smaller than the classic ranges reported. Consequently, these measurements overlap when compared independently. The material analyzed showed that the size of eggs shed by humans from Georgia and Egypt corresponds to the F. hepatica morph, while those from Vietnam correspond to the F. gigantica morph. Measurements of F. hepatica and F. gigantica eggs originating from humans and animals from sympatric areas overlap, and, therefore, cannot be considered a differential diagnostic criterion. The following egg length/width results obtained should be a useful tool for clinicians especially since the

118


application of the classic egg size range in human samples may lead to erroneous conclusions (Valero et al., 2009): Areas where F. gigantica is absent (as in the Americas and Europe):

F. hepatica egg data are 100.6–162.2/65.9–104.6 mm in humans and 73.8– 156.8/58.1-98.1 mm in animals. Areas where both fasciolid species are present (as in parts of Africa and Asia): F. hepatica egg data are 106.5–171.5/63.9–95.4 mm in humans and 120.6–163.9/69.2–93.8 mm in animals, and F. gigantica data are 150.9–182.2/85.1–106.2 mm in humans and 130.3–182.8/74.0–123.6 mm in animals. The size of eggs shed by humans may be intermediate between the above-mentioned data for F. hepatica and F. gigantica in humans and such situations may be interpreted as infections by intermediate or hybrid forms. Areas where F. hepatica is absent (as in parts of Africa): F. gigantica egg data should be increased to 129.6–204.5/61.6–112.5 mm in animals. Future studies in other areas may perhaps widen these ranges for fasciolid eggs shed in human stools, but the exhaustive study performed suggests that only very slight differences will be found, if any (Valero et al., 2009).

2.11.4. The species question in fasciolids In such a morphometric and genetic scenario, the question immediately arises as to whether we are dealing with two different species or not. F. hepatica and F. gigantica were described as such based on the traditional concept of species created by Linnaeus and perpetuated to date by most taxonomists. Even though the use of valuable new methods and techniques applied to systematic studies may go much further, many having been applied already to the two fasciolids (Mas-Coma et al., 2005), one is still faced with the simplicity and general application of this species concept (Kunz, 2002; Mas-Coma and Bargues, 2008). The systematic classification of Fasciola species is based mainly on adult morphology, egg size, definitive and intermediate host specificity, and geographical distribution. With regard to adult morphology, the numerous (11) allometric and few (VS-P, BR and BL/BW) morphometric differences detected (Periago et al., 2006) may help in distinguishing F. hepatica and F. gigantica as two species. The same conclusion may be reached based on eggs, because of the significant morphometric differences detected in three of the measurements analyzed (EL, EP, EA), egg size having always been a very important characteristic for the differentiation of trematode species. With regard to definitive hosts, F. hepatica and F. gigantica share a wide spectrum of main and alternative, herbivorous and omnivorous


119

mammalian hosts (Mas-Coma, 2004a; Mas-Coma and Bargues, 1997). Although susceptibility and pathological changes caused by fasciolids vary considerably from host to host, both susceptibility and pathology as well as host preferences suggest that the original definitive host of F. hepatica may be found in Eurasian ovicaprines, whereas that of F. gigantica is probably related to East African bovids, such as ancestors of Alcelaphinae, Reduncinae and Bovinae. Studies showing different definitive host species susceptibility also suggest similar conclusions (Chen et al., 2000; Roberts et al., 1997; Yadav et al., 1999; Zhang et al., 2004). Enzyme specificity studies suggest that F. hepatica and F. gigantica separated approximately 19 mya (Irving et al., 2003), around the time that the ancestors of the present day definitive pecoran host lineages diverged. Although such a divergence clearly supports the distinction of two different species, the existence of only five differing positions in the ITS-1 and also only five positions in the ITS-2 suggests, as in many invertebrate groups, that such minimal differences may be considered within a level of intraspecific variability and typical of organisms which are able to crossbreed successfully (Mas-Coma and Bargues, 2008; Remigio and Blair, 1997b), as is the case for these two fasciolids. Evidence suggests that F. hepatica is linked to the species of the originally Holarctic and Neotropical Galba/Fossaria group, with G. truncatula as the most probable original intermediate host species. In contrast, F. gigantica appears to be related to species of the Radix group, mainly R. natalensis in Africa and the superspecies R. auricularia in the Palaearctic (Bargues et al., 2001, 2005, 2007b). Unfortunately, current knowledge on the susceptibility of several secondary lymnaeid vector species to either of the two fasciolids cannot be used for this assessment (discussed later). This lymnaeid snail specificity explains the present geographical distribution of both fasciolid species. Whereas F. hepatica was able to spread from its European origin to all the five continents, F. gigantica has always been restricted to Africa and Asia (plus Hawaii), a biogeographical phenomenon which appears to parallel the inability thus far of the Radix group to expand and colonize continents other than those two. The ecological requirements of the respective lymnaeid vectors also explain why F. hepatica is more prevalent in temperate zones and therefore prevalent throughout Europe, the Americas and Oceania, while F. gigantica is environmentally adapted to the tropical and humid zones that are predominant in Africa and Asia. Summing up, present knowledge is sufficient to support F. hepatica and F. gigantica as two valid species, which diverged due to adaptation to different definitive herbivorous mammals and intermediate lymnaeid snail hosts in geographical areas with different environmental characteristics. However, the two fasciolid species are undoubtedly recently diverged evolutionary units whose phenotypic differences and ancient

120


pre-domestication origins involve a broad geographical range that largely exceeds the typical, more local scenarios known for subspecies units (Mas-Coma and Bargues, 2008). The evolutionarily very recent hydridization events in Asia and Africa, a general rule wherever contact occurs between adults of the two species within the liver of the same individual definitive host, is in fact only the consequence of an overlap situation imposed by humans in post-domestication times for two recently diverged species. They still retain the capacity to crossbreed successfully because a period of only a few million years that has elapsed from their origins has not yet been sufficient to achieve total genetic isolation. Anyway, the phenomena of abnormal ploidy and aspermic parthenogenesis (Terasaki et al., 2000) that long-time hybrids of the two fasciolid species have developed in such a short evolutionary period as the one elapsed in postdomestication times, may be interpreted as evidence indicating that their 19 million years of separate evolution was in fact soon to reach total genetic isolation.

2.11.5. Fasciolid-lymnaeid specificity With regard to biological phenotyping, as in other vector-borne diseases, the specificity of each fasciolid species regarding certain lymnaeid species is a crucial aspect because of (i) its importance in transmission patterns and epidemiological situations in endemic areas, and (ii) the capacity of the disease to spread to new areas due either to the availability of susceptible lymnaeid species in the new area or to the potential of different lymnaeid vector species to spread into new areas (Mas-Coma et al., 2003, 2005). Trematode-snail specificity is a complex biological phenomenon related to concepts such as infectivity, susceptibility, resistance, immunity, compatibility, host finding, host recognition, host attraction, phylogeny and genetic variability. Although the implications of this phenomenon are only beginning to be understood, co-evolution of snails and trematodes is becoming increasingly apparent at the population level (Lockyer et al., 2004), indicating that specificity is a molecular phenomenon beyond species limits. Present knowledge about the lymnaeid vector species spectrum of F. hepatica and F. gigantica is based on results from both field studies and experimental infection assays. The broad information acquired over many decades indicates a clear preference of F. hepatica for Galba and of F. gigantica for Radix, but the limits of the vector host spectrum for each fasciolid species do not appear to be clear (Bargues and Mas-Coma, 2005a; Bargues et al., 2001). Opposing results obtained by different authors on the vectorial capacity of a certain lymnaeid species to transmit a fasciolid species were always thought to be related to different susceptibilities of


121

different populations inhabiting allopatric geographical areas. However, the genetic complexity of both fasciolids and lymnaeids that is progressively being discovered with the aid of precise DNA sequencing, is giving rise to a new scenario that suggests that present assumptions on fasciolidlymnaeid specificity might be wrong and include errors at different levels. On the one hand, F. hepatica and F. gigantica show very large intraspecific genetic variability throughout their large distribution areas. Moreover, in Asia and Africa, their capacity to crossbreed and introgress poses a question about the specificity of the hybrid forms to which they give rise. Although not all hybrids may necessarily be viable and local lymnaeids may act as the first eliminating filter, experimental assays have already proved that many hybrid forms from both livestock and humans are viable and able to be transmitted successfully by local lymnaeids, such as in Egypt (Bargues et al., unpublished data). Additionally, the detection of fasciolid hybrids presenting long-term introgressions in different Asian countries (Agatsuma et al., 2000; Itagaki and Tsutsumi, 1998; Itagaki et al., 2005a,b) indicate that several hybrid forms have been able to perpetuate themselves for many years, even perhaps hundreds or thousands of years if the spread of fasciolids throughout Asia in post-domestication times is taken into account. The finding of fasciolids with different ITS sequences in the same individual fluke (Huang et al., 2004; Le et al., 2008) indicates that concerted evolution of the rDNA operon has had insufficient time to impact on the sequences (Mas-Coma and Bargues, 2008) and consequently suggests that in several places in Asia hybridization phenomena are still occurring in recent times, as has been happening in the last 30 years in Egypt. The few Egyptian hybrid forms whose viability has been verified have shown that they retain the capacity to be transmitted by lymnaeids in accordance with their rDNA grouping (Bargues et al., unpublished data). However, nothing is known yet about whether the more or less introgressed forms are able to modify or enlarge their vector species spectrum, perhaps incorporating the capacity to be transmitted additionally by lymnaeids related to the other fasciolid parent. The findings in nature of larval stages, classified as F. gigantica, successfully developing in a planorbid such as Biomphalaria alexandrina in Egypt (El-Shazly et al., 2002; Farag and El Sayad, 1995) could perhaps be the consequence of such a widening of the vector species spectrum of a F. gigantica-like hybrid. The demonstration of the existence of a very wide spectrum of introgressed hybrid F. gigantica-like forms in Egypt and the absence of the detection of ‘pure’ F. gigantica despite the very large number of flukes analyzed (Bargues et al., unpublished data) supports the theory that these fasciolids naturally developing in B. alexandrina might be hybrid F. gigantica-like forms.

122


On the other hand, population genetics studies have shown that a large range of situations can be found within lymnaeids, from heterogeneous, polymorphic populations (Coutellec-Vreto et al., 1994; Jarne and Delay, 1990a; Rudolph and Burch, 1989) to completely homogeneous, monomorphic populations (Jabbour-Zahab et al., 1997; Meunier et al., 2001; Trouve et al., 2000), a phenomenon related to both the selfing and crossing capacities of these freshwater snails ( Jarne and Delay, 1990b; Jarne et al., 1993). Sequencing of rDNA and mtDNA markers have shown that our knowledge of members of Lymnaeidae was far from being adequate (Bargues and Mas-Coma, 1997, 2005; Bargues et al., 1997, 2001, 2003, 2006a,b, 2007a,b; Remigio, 2002; Remigio and Blair, 1997a,b). Analyses of lymnaeid sequences mainly of rDNA ITS-2 have shown different kinds of issues. At the species level: Sequence results demonstrated that the classifica-

tion of lymnaeid specimens presents a number of anomalies. Sometimes, even experts cannot conclude to which species specimens should be ascribed because of the general uniformity of lymnaeids, their few morpho-anatomical characteristics useful for classification, and their large intraspecific variability shown by shell and anatomical features of well-known systematic value in other molluscs. Thus, situations have been reported in which two different lymnaeid species were distinguished in a given area where, in fact, only one species with large intraspecific variability was present, while in contrast, different sympatric populations originally classified as belonging to only one species, sometimes comprised even more than two different species (Bargues et al., 2001). Above the species level: Classifications of lymnaeids have never reached a minimum consensus among experts. Several authors refer to only one large genus Lymnaea sensu lato, owing to the lack of characteristics with sufficient systematic value to enable the validity of supra-specific taxa to be supported, whereas other authors distribute the species in two, a few, or sometimes numerous genera (Bargues et al., 2001; Hubendick, 1951). The absence of an appropriate classification represents an additional difficulty for specimen identification. The existence of two genetically well-separated lineages within a group always considered uniform such as the stagnicolines, the chaotic ascribing of certain species to one or another genus by different specialists, or the classification within the same species of specimens differing by such a very large number of nucleotide differences that different genera should in fact be involved, exemplify the confusion in which this family is immersed. Below the species level: Both rDNA and mtDNA markers show that the situation at the infraspecific level is also far from being simple. On the one hand, there are species with a relatively narrow geographical


123

distribution that show pronounced intraspecific genetic variability, including numerous haplotypes, suggesting old species which have not been able to spread further. On the other hand, there are species showing a very wide distribution, even comprising different continents, which show surprising genetic uniformity, suggesting that they spread only very recently (Bargues et al., 2001, 2003, 2006a,b). It is evident that present knowledge does not provide a minimum basis for adequately assessing fasciolid-lymnaeid specificity. A large amount of future work is required to re-evaluate fasciolid-lymnaeid specificity both in the field and in experimental assays, by applying rDNA and mtDNA markers enabling appropriate genetic characterization of natural populations, laboratory strains and introgressed hybrid forms of fasciolids, as well as of natural populations, geographic and laboratory strains, and species of lymnaeids.

2.11.6. The worldwide lymnaeid molecular characterization initiative Differences in ecology, behaviour and parasite specificity in species and populations of lymnaeid vectors were shown early on to be influential in different transmission patterns and epidemiological situations of human fascioliasis (Mas-Coma, 2005; Mas-Coma et al., 1999a). More recently, mathematical modelling and remote sensing-GIS methods have also shown the need to distinguish between different strains of molluscan vectors of schistosomiasis that unexpectedly respond to climate changes and control initiatives in different ways (Seto et al., 2002; Zhou et al., 2002). In fascioliasis, the question immediately arises as to whether hybrid fasciolids still retain one or the other minimum temperature thresholds of 10 C and 16 C traditionally used in mathematical modelling and remote sensing-GIS forecast methods of F. hepatica and F. gigantica, respectively (Malone et al., 1998; Yilma and Malone, 1998), or whether they in fact have another, probably intermediate threshold. It is evident that experimental assays are needed to re-assess this threshold by using hybrid fasciolids appropriately characterized by combined haplotyping. If hybrid fasciolids show thresholds different from the two noted above, results obtained in previous forecast modelling should be re-evaluated when considering the fasciolid overlap areas of Africa and Asia where hybridization phenomena are known. The crucial implications of lymnaeid vectors for fascioliasis transmission, epidemiology and control demonstrate the importance of developing new tools to facilitate specimen classification, genetic characterization of natural populations and laboratory strains, and to elucidate the systematics and taxonomy of the Lymnaeidae. The failure of all malacological and non-malacological tools used to date suggests it would be

124


worthwhile to analyze whether DNA sequences and phylogenetic methods could be useful. The first attempt made by a research collaboration of parasitologists, molecularists and malacologists was successful (Bargues et al., 2001). This success, together with the rapid realization that locally restricted studies were insufficient because of the very large geographical distribution and spreading capacities of many lymnaeids belonging to very confusing groups such as Galba/Fossaria and Radix, suggested early on that large, trans-boundary studies would be needed. In view of this, a worldwide lymnaeid molecular characterization initiative was instigated (Bargues and Mas-Coma, 2005a; Mas-Coma et al., 2008c). Studies in Europe covering many countries and all species considered valid by malacologists have been on-going for many years and several data sets have already been made available (Bargues and MasComa, 1997; Bargues et al., 1997, 2001, 2003, 2006a). These results have shown that this continental-wide approach is the appropriate framework for each large step of such a worldwide initiative. In South America, although studies covering almost all countries have been undertaken for several years, for various reasons, initial publications have only been concerned with areas of key importance in human fascioliasis (Bargues and Mas-Coma, 1997; Bargues et al., 1997, 2006b, 2007a,b; Mas-Coma et al., 2001). In North America, a restricted analysis mainly focused on stagnicolines (Bargues et al., 2003; Meier-Brook and Bargues, 2002). In Central America and the Caribbean, the two key species L. cubensis and P. columella have already been the objective of preliminary analyses (Bargues et al., 2007b; Vigo et al., 2000a,b). Studies on lymnaeids in Africa and Asia are also at an advanced stage. The great spreading capacity of lymnaeids means that sometimes not even the continental scale is sufficient, and intercontinental sequence comparisons are needed to classify specimens correctly, as the sympatric L. viatrix and L. cubensis that are involved in the high hyperendemic area of the Bolivian Altiplano (Ueno et al., 1975) and which later were proved to only involve morphologically variable G. truncatula of European origin (Bargues and Mas-Coma, 1997; Bargues et al., 1997; Mas-Coma et al., 2001). The intercontinental spreading of lymnaeids and its role in fascioliasis dissemination is well known (Boray, 1978; Mas-Coma et al., 2003, 2005; Pointier et al., 2007). Of the different DNA markers used so far in lymnaeids, the 18S rRNA gene appears to be too conserved and its few variable positions may only be useful at generic and suprageneric taxon levels (Bargues and MasComa, 1997, 2005a; Stothard et al., 2000). The ITS-2 and secondarily ITS-1 are the most useful sequences for this purpose: (i) classification of lymnaeid specimens, (ii) characterization of lymnaeid intraspecific genetic interpopulational variability to furnish the genetic base on which to understand fasciolid-lymnaeid specificity, different susceptibilities or


125

compatibilities of geographical strains or even resistances, (iii) establishment of valid species and their geographical distributions, and (iv) assessment of species inter-relationships to arrange a natural systematic-taxonomic classification, which will allow an analysis of coevolution with fasciolids (Bargues and Mas-Coma, 2005a). Interestingly, one mutation at the level of the ITS-1 and another at ITS-2 have proved useful to distinguish between resistant and susceptible populations of P. columella in Cuba (Gutierrez et al., 2003), although nothing evidently suggests that these mutations are linked to resistance/susceptibility. Within mtDNA, only fragments of the 16S and cox1 have been sequenced in lymnaeids (Bargues et al., 2007b; Remigio, 2002; Remigio and Blair, 1997a). Recent knowledge indicates that mtDNA markers, including both mitochondrial genes and the ribosomal 12S and 16S genes, should be used with great caution when dealing with species belonging to different genera and even those well-separated within the same genus. Of particular concern is the saturation of nucleotide positions. Additionally, it has also been seen that incomplete gene sequences do not necessarily contain a sufficiently significant portion of the whole gene, that is, parts of the gene presenting evolutionary hot spots may be missed (Mas-Coma and Bargues, 2008). Consequently, the use of mtDNA markers for this initiative is restricted to (i) sequence comparisons and phylogenetic analyses of only close species within the same genus, (ii) studies of intraspecific variability of species by sequence comparisons of individuals and populations, (iii) genetic characterization of laboratory strains, (iv) studies on the spread of populations of a species and (v) studies on genetic exchange between different neighbouring populations. This worldwide initiative is facing three additional, important but uncommon problems which unavoidably give rise to delays in the diffusion of results: Numerous original descriptions of old species were insufficient to

deduce what did in fact old scientists have in their hands. Related to this, there are long lists of synonyms that are often difficult to follow. To ascertain which specific names are valid and which are synonymous can take a long time because of the need to revise very old literature that is not easy to find. The long-time used but today synonymized species R. peregra and R. ovata and the re-validation of fully forgotten specific names as R. balthica, R. lagotis and R. labiata within the European lymnaeid fauna are good examples (Bargues et al., 2001, 2003). The ascription of a specific name to an obtained DNA sequence may pose great problems, especially in cases when there is no specific classification of the specimens sequenced, and also when samples originate far away from the well-established geographical range of a species. In such cases, the only definitive way to solve the situation is the

126


sequencing of specimens collected in the type locality of the species, a solution that is unfortunately not always available. Moreover, for several old species there is no type locality given but a very large area or even a full country, or there might be no lymnaeid population there any more (i.e. as in habitat destruction by human activities) or the original population found 200 years ago may have disappeared and another lymnaeid species may have colonized the same place. For such situations, description and genetic characterization of neotypes and GPS detailing of (new) location may be a solution. The use of a different systematic and taxonomic lymnaeid classification by the dynamic Russian school has arisen due to isolation related to language so today two parallel classifications exist, the Russian one being used throughout eastern Europe and a great part of Asia (Kruglov, 2005). A great effort, already under way, will be needed to establish valid species and synonyms between the two classifications.

2.12. CONCLUSIONS AND STANDARDIZATION PROPOSAL The necessary, progressive accumulation of data to reach a global picture of evolutionary genetics and molecular epidemiology of fascioliasis useful for disease characterization and the design of control measures appropriate for each endemic area will take a titanic effort over many years. In this endeavour, contributions of scientists will be welcome but care must be taken to work with tools furnishing results of significant value and comparable characteristics. A standard methodology is necessary for this purpose. Researchers are recommended to consider the points noted in the following: 1. Minimum information about materials analyzed: Definitive host species, and whenever possible also livestock strain, shall be noted including geographic origin. This is particularly difficult sometimes when using materials collected from animals killed in slaughterhouses in countries where individual animals are not marked and are mixed in the slaughterhouse before and/or after killing. Animals might come from very far away (even from a different country) and the veterinarian in the slaughterhouse may sometimes erroneously confuse different origins. In given countries, owners and/or veterinarians may be put in a delicate situation when forced to tell the true origin of infected animals because of national laws or campaigns. A similar situation can be found in animals killed in illegal, uncontrolled slaughterhouses or privately. Animals more or less freely grazing in a place may have been in fact imported from other areas or even countries a few years before, still keep liver flukes acquired in their original areas and the researcher


127

may miss this possibility. The probability to include such errors usually increases when researchers working in one country use materials from another country without visiting that country and obtaining the materials personally, but receive them after collection and sending by inexperienced, local people. If the origin cannot be assured, it should be noted in the publication. Geographic origins should include localities of sufficient importance as to be found in maps. If locality names not appearing in maps are used, a map should be included in the publication. Another solution is georeferencing, for which today mobile telephones including global positioning systems (GPS) might be sufficient if the error range furnished by the device is sufficiently accurate, although of course a specialized GPS device is always better because of assuring more accurate data. Not only latitude and longitude shall be noted, but whenever possible also altitude, a crucial factor in fascioliasis. If phenotyping of fasciolids is included, clear details about adult fluke fixation and mounting methods are needed. When eggs are measured, the original materials from which they were collected (host stools, bile from gall bladder, last part of fluke uterus when expelled through the genital pore after pressure, from fluke uterus after dissection) shall be mentioned. 2. Genetic markers for fasciolid characterization: The continent from which fasciolid specimens come from shall be taken into account. For fasciolids from Europe, the Americas and Oceania where F. gigantica is not present, a minimum of the complete sequence of the ITS-2 shall be included, because ITS-2 variability furnishes more information than the hitherto always uniform ITS-1 sequence. However, a combination of ITS-2 and one mtDNA marker for the characterization of each fluke specimen by combined haplotyping is strongly recommended. Nad1 or cox1 may be used, but the complete sequence of the gene selected should be obtained. For fasciolids in the Americas, it should be taken into account that partial sequences of the mtDNA nad1 or cox1 become insufficiently informative when analyzing F. hepatica population dynamics. Even when comparing complete mtDNA gene sequences, bootstraps obtainable in network and phylogenetic analyses are always non-significant (Bargues et al., unpublished data). This is because F. hepatica is present in the Americas only after 500 years, a too short evolutionary period to be assessed from such genes. Faster evolving molecular markers will be needed in the Americas for local population dynamic studies. This also applies to F. hepatica from Oceania. For fasciolids from Africa and Asia where both species overlap, whenever possible the use of at least three markers is recommended, including the complete sequences of each ITS-2, nad1 and cox1.

128


Although ITS-1 does hitherto appear to always show a uniform sequence, further research is encouraged to verify this uniformity in as many areas as possible. The future inclusion of other, additional mtDNA genes is also encouraged, in the way to expand the possibility to detect hybrid flukes with only potential, partial introgression not detectable by means of nad1 and cox1 sequences. When dealing with laboratory strains of fasciolids to be used in experimental purposes, the four-marker characterization by means of the complete sequences of each ITS-2, ITS-1, nad1 and cox1 is needed. Whenever possible, the addition of other mtDNA marker sequences is encouraged. 3. Phenotypic markers for fasciolid characterization: In research activities in Africa and Asia, a minimum morphometrical study of adult flukes and eggs is strongly recommended to be included within genetic characterization papers. Measurements (range and mean) on adult flukes should at least include BL, maximum BW, BL/BW ratio, VS-P distance and Vit-P distance. If a CIAS is available, BR and BA should be added to the abovementioned characteristic measures in fluke adults. For egg measurements, EL and maximum EW should be given, and, when a CIAS is available, EP and EA should be added. 4. Genetic markers for lymnaeid characterization: A minimum of the complete sequence of ITS-2 is needed to verify (or allow) precise specimen classification. The complete sequence of the ITS-1 might be added to facilitate species and subspecies assessment and characterization by combined ITS haplotyping, as well as to achieve more significant results in phylogenetic analyses when applying both ITS markers together. The complete sequence of the 18S gene may be used for analyses of supraspecific relationships, mainly when concerning species phylogenetically distant from one another. Mitochondrial DNA markers as cox1 and 16S may be used for (i) comparison of close species within the same genus, and (ii) to differentiate populations or to analyze genetic exchange between populations or distribution of populations within the same species. Unfortunately, primers for only partial mtDNA gene sequences are available today, so that studies in the way to permit the obtaining of complete sequences are strongly encouraged. For laboratory strains of lymnaeids, a genetic characterization using as many DNA markers as possible becomes appropriate, and should at least include ITS-2.


129

When a minimum malacological description within a publication on genetic characterization of lymnaeid specimens becomes not possible, it is recommended to at least include a photograph showing a typical shell in ventral and dorsal views accompanied by the necessary scale bar. 5. Haplotype code nomenclature: The composite haplotype (CH) nomenclature here proposed expands the terminology proposed for lymnaeids (Bargues and Mas-Coma, 2005a) and agrees with the one proposed for vectors of other diseases (Mas-Coma and Bargues, 2008). This nomenclature considers DNA regions able to furnish valuable information on fasciolid and lymnaeid species. The code follows an order according to the information capacity of the different DNA markers, related to the speed of their evolutionary rates (markers evolving slower ought to be noted in front). For instance, the code CH-rDNA: ITS2-2, ITS1-B, 28SD1-a, 28SD2-d, 28SD3-b/mtDNA: 12S-3, 16S-D, cox1-cII, nad1-fIV, Cyt b-aI will refer to haplotype 2 according to ITS-2, haplotype B after ITS-1, and haplotypes a, d and b after the first, second and third variable domains D1, D2 and D3 of the 28S gene, respectively (other variable domains of the 28S gene can successively be added in this way, if needed). References to haplotypes of mitochondrial genes are ordered after the dash, including the ribosomal genes 12S (named by a number) and 16S (named by a capital letter) followed by the mitochondrial genes (named by a small letter and a Roman number for the nucleotide and amino acid sequences, respectively). This nomenclature allows simplicity in an article dealing with different markers, because it allows shortening by abbreviation (i.e. CH-2,B,a,d,b/3,D,cII,fIV,aI for the above-mentioned example). This nomenclature is useful for fasciolids and lymnaeids but can only be applied if the complete sequence of the gene or spacer has been obtained. This nomenclature is thought to only include definitive codes useful for future significant comparison studies. No haplotype code can be applied to partial sequences or gene fragments because such a code for a partial sequence would only be preliminary until the complete sequence is known, would introduce confusion, and give rise to great comparison difficulties. The deposit of DNA sequences of fasciolids and lymnaeids in databases as GenBank, EMBL or DDBJ to enable other authors to perform comparisons is strongly recommended. When depositing sequences, authors are asked to only deposit one sequence when the sequences obtained from different materials (different specimens, hosts or geographic origins) are identical and not to put a different haplotype code to the sequence they deposit when the sequence is identical to another

130


already existing one; the code of the previous or first one shall be used in those cases and no deposit of identical sequences is therefore needed.

ACKNOWLEDGEMENTS Study supported by project No. SAF2006-09278 of the Spanish Ministry of Science and Technology, Madrid, Spain; the Red de Investigacioń de Centros de Enfermedades Tropicales—RICET (grants No. C03/04, No. PI030545 and No. RD06/0021/0017 of the Program of Redes Tema´ticas de Investigacioń Cooperativa) and project No. PI030545, both FIS, Spanish Ministry of Health, Madrid, Spain; and project Nos. 03/113, GV04B-125 and GVCOMP2006106 of Conselleria d’Empresa, Universitat i Ciencia, Generalitat Valenciana, Valencia, Spain. Field work activities performed within the worldwide initiative of WHO (headquarters Geneva, Switzerland) against human fascioliasis. Co-ordination activities in Latin American countries also carried out within project No. RLA5049 of IAEA (headquarters Vienna, Austria). The support by Dr. L. Savioli, Dr. D. Engels, Dr. A. Montresor and Dr. A. Gabrieli (PVC/CPE, WHO, headquarters Geneva) and Dr. G. J. Viljoen (Animal Production and Health Section, Department of Nuclear Sciences and Applications, IAEA, Headquarters Vienna) is greatly acknowledged for their help in facilitating the international collaboration necessary for the research activities developed. Members of the Department of Parasitology of the University of Valencia co-working with the authors on fascioliasis after many years as M. V. Periago, P. Artigas, M. Khoubbane, I. Perez-Crespo and I. R. Funatsu have participated in the obtaining of results which progressively furnished the large background for the global contents of the present paper. At a national level, the authors want to thank the collaboration by the very numerous researchers from different countries, mainly Bolivia, Peru, Venezuela, Argentina, Chile, Uruguay, Ecuador, Cuba, Mexico, United States, Spain, Italy, France, Germany, Poland, Georgia, Egypt, Burkina Faso, Niger, Nigeria, Senegal, Iran, Vietnam and Sri Lanka.

REFERENCES Adlard, R.D., Barker, S.C., Blair, D., Cribb, T.H., 1993. Comparison of the second internal transcribed spacer (ribosomal DNA) from populations and species of Fasciolidae (Digenea). Int. J. Parasitol. 23, 422–425. Agatsuma, T., Arakawa, Y., Iwagami, M., Honzako, Y., Cahyaningshi, U., Kang, S.Y., et al., 2000. Molecular evidence of natural hybridization between Fasciola hepatica and F. gigantica. Parasitol. Int. 49, 231–238. Agatsuma, T., Terasaki, K., Yang, L., Blair, D., 1994. Genetic variation in the triploids of Japanese Fasciola species, and relationships with other species in the genus. J. Helminthol. 68, 181–186. Alasaad, S., Huang, C.Q., Li, Q.Y., Granados, J.E., Garcıá-Romero, C., Pe´rez, J.M., et al., 2007. Characterization of Fasciola samples from different host species and geographical localities in Spain by sequences of internal transcribed spacers of rDNA. Parasitol. Res. 101, 1245–1250. Alasaad, S., Li, Q.Y., Lin, R.Q., Martıń-Atance, P., Granados, J.E., Diez-Banõs, P., et al., 2008. Genetic variability among Fasciola hepatica samples from different host species and geographical localities in Spain revealed by the novel SRAP marker. Parasitol. Res. 103, 181–186. Aldemir, O.S., 2006. Differentiation of cattle and sheep originated Fasciola hepatica by RAPD-PCR. Revue Me´d. Ve´t. 157, 65–67.


131

Ali, H., Ai, L., Song, H.Q., Ali, S., Lin, R.Q., Seyni, B., et al., 2008. Genetic characterisation of Fasciola samples from different host species and geographical localities revealed the existence of F. hepatica and F. gigantica in Niger. Parasitol. Res. 102, 1021–1024. Alicata, J.E., 1938. Observations on the life history of Fasciola gigantica, the common liver fluke of cattle in Hawaii, and the intermediate host, Fossaria ollula. Hawaii Agric. Exp. Station Bull. 80, 1–22. Alicata, J.E., 1953. Human fascioliasis in the Hawaiian Islands. Hawaii Med. J. 12, 196–201. Amoah, P., Drechsel, P., Abaidoo, R.C., 2005. Irrigated urban vegetable production in Ghana: Sources of pathogen contamination and health risk infection. Irrigat Drain 54(S1), 49–61. Anderson, N., Luong, T.T., Vo, N.G., Bui, K.L., Smooker, P.M., Spithill, T.W., 1999. The sensitivity and specificity of two methods for detecting Fasciola infections in cattle. Vet. Parasitol. 83, 15–24. Andrews, S.J., 1999. The life cycle of Fasciola hepatica. In: Dalton (Ed.), Fasciolosis, CAB International Publishing, Wallingford, United Kingdom, pp. 1–29. Appleton, C.C., 2003. Alien and invasive freshwater gastropoda in South Africa. Afr. J. Aquat. Sci. 28, 69–81. Apt, W., Aguilera, X., Vega, F., Alcaino, H., Zulantay, I., Apt, P., et al., 1993. Prevalencia de fascoliasis en humanos, caballos, cerdos y conejos silvestres en tres provincias de Chile. Bol. Oficina Sanit. Panam 115, 405–414. Aranguen-Mendez, J., Beja-Pereira, A., Avellanet, R., Dzama, K., Jordana, J., 2004. Mitochondrial DNA variation and genetic relationships in Spanish donkey breeds (Equus asinus). J. Anim. Breed. Genet. 121, 319–330. Arctander, P., Johansen, C., Coutellec-Vreto, M.A., 1999. Phylogeography of three closely related African bovids. Mol. Biol. Evol 16, 1724–1739. Arfaa, F., Movafagh, K., Mahdavi, M., 1969. Lymnaea gedrosiana, an intermediate host of Fasciola hepatica in Iran. J. Parasitol. 55, 134–135. Artigas, P., Periago, M.V., Kiziewicz, B., Bargues, M.D., Mas-Coma, S., 2004. Molecular characterization of Fasciola hepatica from the wild natural host Bisson bonasus of Poland. In: Mas-Coma, Bargues, Esteban, Valero (Eds.), II K.E. Mott Symposium on Schistosomiasis and Distomatoses. Multidisciplinarity for Parasites, Vectors and Parasitic Diseases, IX European Multicolloquium of Parasitology (EMOP 9). J. Aguilar S.L. Press, Valencia, Spain, pp. 287–288. Ashrafi, K., Massoud, J., Holakouei, K., Mahmoodi, M., Joafshani, M.A., Valero, M.A., et al., 2004. Evidence suggesting that Fasciola gigantica might be the most prevalent causal agent of fascioliasis in northern Iran. Iranian J. Publ. Health 33, 31–37. Ashrafi, K., Massoud, J., Holakouei Nainei, K., Jo-Afshani, M.A., Mahmoodi, M., Ebedati, N., et al., 2007. Nuclear ribosomal DNA ITS-2 sequence characterization of Fasciola hepatica and Galba truncatula. Iranian J. Publ. Health 36, 42–49. Ashrafi, K., Valero, M.A., Panova, M., Massoud, J., Mas-Coma, S., 2006. Phenotypic analysis of adults of Fasciola hepatica, Fasciola gigantica and intermediate forms from the endemic region of Gilan, Iran. Parasitol. Int. 55, 249–260. Backeljau, T., De Bruyn, L., De Wolf, H., Jordaens, K., Van Dongen, S., Vehagen, R., et al., 1995. Random amplified polymorphic DNA (RAPD) and parsimony methods. Cladistics 11, 119–130. Baig, M., Beja-Pereira, A., Mohammad, R., Kulkarni, K., Farah, S., Luikart, G., 2005. Phylogeography and origin of Indian domestic cattle. Curr. Sci. 89, 38–40. Ballard, J.W.O., Whitlock, M.C., 2004. The incomplete natural history of mitochondria. J. Mol. Evol. 13, 729–744. Bargues, M.D., Mas-Coma, S., 1997. Phylogenetic analysis of lymnaeid snails based on 18S rDNA sequences. Mol. Biol. Evol. 14, 569–577. Bargues, M.D., Mas-Coma, S., 2005a. Reviewing lymnaeid vectors of fascioliasis by ribosomal DNA sequence analyses. J. Helminthol. 79, 257–267.

132


Bargues, M.D., Mas-Coma, S., 2005b. GenBank Accession Number AJ853848. Bargues, M.D., Artigas, P., Jackiewicz, M., Pointier, J.P., Mas-Coma, S., 2006a. Ribosomal DNA ITS-1 sequence analysis of European stagnicoline Lymnaeidae (Gastropoda). In: Gloër, Falkner (Eds.), Beitra¨ge zur Su¨ßwasser-Malakologie, Heldia (Mu¨nchner Malakologische Mitteilungen), Munich, Germany, 6, 29–40. Bargues, M.D., Artigas, P., Mera y Sierra, R.L., Pointier, J.P., Mas-Coma, S., 2007b. Characterisation of Lymnaea cubensis, L. viatrix and L. neotropica n. sp., the main vectors of Fasciola hepatica in Latin America, by analysis of their ribosomal and mitochondrial DNA. Ann. Trop. Med. Parasitol. 101, 621–641. Bargues, M.D., Fuentes, M.V., Mansoorian, A.B., Moghaddam, A.S., Ashrafi, K., Savioli, L., et al., 2002a. Determinacioń especı´fica de los para´sitos implicados en la Fascioliasis humana y animal en la provincia de Gilań, Irań, mediante secuenciacioń del ADN ribosomal nuclear. In: III Congreso de la Sociedad Espanõla de Medicina Tropical y Salud Internacional, Libro de Resu´menes, Cuenca, Spain, p. 165. Bargues, M.D., Fuentes, M.V., Mansoorian, A.B., Moghaddam, A.S., Ashrafi, K., Savioli, L., et al., 2002b. Secuenciacioń de los espaciadores transcritos internos del ADN ribosomal de los Lymnaeidos (Mollusca: Gastropoda) de la zona de Fascioliasis humana en Bandar-e Anzali (provincia de Gilań, Irań). In: III Congreso de la Sociedad Espanõla de Medicina Tropical y Salud Internacional, Libro de Resu´menes, Cuenca, Spain, pp. 164–165. Bargues, M.D., Horak, P., Patzner, R.A., Pointier, J.P., Jackiewicz, M., Meier-Brook, C., et al., 2003. Insights into the relationships of Palaearctic and Nearctic lymnaeids (Mollusca: Gastropoda) by rDNA ITS-2 sequencing and phylogeny of stagnicoline intermediate host species of Fasciola hepatica. Parasite 10, 243–255. Bargues, M.D., Mangold, A.J., Munõz-Antoli, C., Pointier, J.P., Mas-Coma, S., 1997. SSU rDNA characterization of lymnaeid snails transmitting human fascioliasis in South and Central America. J. Parasitol. 83, 1086–1092. Bargues, M.D., Marcilla, A., Ramsey, J., Dujardin, J.P., Schofield, C.J., Mas-Coma, S., 2000. Nuclear rDNA-based molecular clock of the evolution of Triatominae (Hemiptera: Reduviidae), vectors of Chagas disease. Mem. Inst. Oswaldo Cruz 95, 567–573. Bargues, M.D., Mera y Sierra, R.L., Go´mez, H.G., Artigas, P., Mas-Coma, S., 2006b. Ribosomal DNA ITS-1 sequencing of Galba truncatula (Gastropoda: Lymnaeidae) and its potential impact on fascioliasis transmission in Mendoza, Argentina. Anim. Biodivers. Conserv. 29, 191–194. Bargues, M.D., Mera y Sierra, R.L., Go´mez, H.G., Artigas, P., Mas-Coma, S., 2007a. Caracterizacioń molecular de Galba truncatula, vector principal de la Fascioliasis, en Argentina. Implicaciones en salud pu´blica. Enferm. Emerg. 9, 77–82. Bargues, M.D., Vigo, M., Horak, P., Dvorak, J., Patzner, R.A., Pointier, J.P., et al., 2001. European Lymnaeidae (Mollusca: Gastropoda), intermediate hosts of trematodiases, based on nuclear ribosomal DNA ITS-2 sequences. Infect. Genet. Evol. 1, 85–107. Barker, S.C., Blair, D., Garret, A.R., Cribb, T.H., 1993. Utility of the D1 domain of nuclear 28S rRNA for phylogenetic inference in the Digenea. Syst. Parasitol. 26, 181–188. Beja-Pereira, A., Alexandrino, P., Bessa, I., Carretero, Y., Dunner, S., Ferrand, N., et al., 2003. Genetic characterization of southwestern European bovine breeds: A historical and biogeographical reassessment with a set of 16 microsatellites. J. Hered. 94, 243–250. Bergeon, P., Laurent, M., 1970. Diffe´rences entre la morphologie testiculaire de Fasciola hepatica et Fasciola gigantica. Rev. Elev. Med. Vet. Pays Trop. 23, 223–227. Bhalerao, G.D., 1933. The trematode parasites of the Indian elephant, Elephas indicus. Indian J. Vet. Sci. Anim. Husb. 3, 103–155. Bindernagel, J.A., 1972. Liver fluke Fasciola gigantica in African buffalo and antelopes in Uganda, East Africa. J. Wildl. Dis. 8, 315–317.


133

Birungi, J., Arctander, P., 2000. Large sequence divergence of mitochondrial DNA genotypes of the control region within populations of the African antelope, kob (Kobus kob). Mol. Ecol. 9, 1997–2008. Bo¨ko¨nyi, S., 2004. Domesticacioń de los animales del inicio de la produccioń de alimentos hasta hace aproximadamente 5.000 anõs: Una visioń general. In: De Laet (Ed.), Historia de la Humanidad, Prehistoria e Inicios de la Civilizacioń. La Aparicioń del Hombre, Editorial Planeta—UNESCO, Paris, France, vol. 1, 392–398. Bollongino, R., Edwards, C.J., Alt, K.W., Burger, J., Bradley, D.G., 2006. Early history of European domestic cattle as revealed by ancient DNA. Biol. Lett. 2, 155–159. Boray, J.C., 1969. Experimental fascioliasis in Australia. Adv. Parasitol. 7, 95–210. Boray, J.C., 1978. The potential impact of exotic Lymnaea spp. on fascioliasis in Australia. Vet. Parasitol. 4, 127–141. Boray, J.C., 1982. Fascioliasis. In: Hillyer, Hopla (Eds.), Handbook Series in Zoonoses. Section C. Parasitic Zoonoses, CRC Press, Boca Raton, FL, vol. 3, 71–88. Boray, J.C., 1985. Flukes of domestic animals. In: Gaafar, Howard, Marsh (Eds.), Parasites, Pests and Predators, Elsevier, New York, NY, 179–278. Bouchet, F., Harter, S., Le Bailly, M., 2003. The state of the art of palaeoparasitological research in the old World. Mem. Inst. Oswaldo Cruz 98(Suppl.), 95–101. Bradley, D.G., Machugh, D.E., Cunningham, P., Loftus, R.T., 1996. Mitochondrial diversity and the origins of African and European cattle. Proc. Natl. Acad. Sci. USA. 93, 5131–5135. Brown, D., 1994. Freshwater Snails of Africa and Their Medical Importance. Second ed. Taylor & Francis Ltd, London, United Kingdom. Brown, D.S., 1965. Freshwater gastropod mollusca from Ethiopia. Bull. Br. Mus. Nat. Hist. (Zool.) 12, 39–94. Brown, D.S., Fison, T., Southgate, V.R., Wright, C.A., 1984. Aquatic snails of the Jonglei region, southern Sudan, and transmission of trematode parasites. Hydrobiologia 110, 247–271. Bruford, M.W., Bradley, D.G., Luikart, G., 2003. DNA markers reveal the complexity of livestock domestication. Nat. Rev. Genet. 4, 900–910. Bulliet, R.W., 2004. Comunicacioń y transporte. In: Al-Bakhit, Bazin, Cissoko (Eds.), Historia de la Humanidad, Del Siglo VII al Siglo XVI. Del Nacimiento del Islam al Descubrimiento de Ame´rica, Editorial Planeta—UNESCO, Paris, France, vol. 4, 95–109. Cafrune, M.M., Rebuffi, G.E., Gaido, A.B., Aguirre, D.H., 1996. Fasciola hepatica in semicaptive vicunas (Vicugna vicugna) in north west Argentina. Vet. Rec. 139, 97. Cai, D.W., Han, L., Zhang, X.L., Zhou, H., Zhu, H., 2007. DNA analysis of archaeological sheep remains from China. J. Archaeol. Sci. 34, 1347–1355. Caramelli, D., 2006. The origins of domesticated cattle. Hum. Evol. 21, 107–122. Chapoutot-Remadi, M., Daghfous, R., 2004. Sociedad y cultura material del mundo isla´mico. In: Al-Bakhit, Bazin, Cissoko (Eds.), Historia de la Humanidad, Del Siglo VII al Siglo XVI. Del Nacimiento del Islam al Descubrimiento de Ame´rica, Editorial Planeta—UNESCO, Paris, France, vol. 4, 312–327. Chen, L., Daugschies, A., Wang, B., Mao, X., 2000. Blood eicosanoids and immune indices during fasciolosis in water buffaloes. Parasitol. Int. 49, 273–278. Chen, S.Y., Duan, Z.Y., Sha, T., Xiangyu, J., Wu, S.F., Zhang, Y.P., 2006. Origin, genetic diversity, and population structure of Chinese domestic sheep. Gene 376, 216–223. Chen, M.G., Mott, K.E., 1990. Progress in assessment of morbidity due to Fasciola hepatica infection: A review of recent literature. Trop. Dis. Bull. 87, R1–R38. Cissoko, S.M., 2004. Africa occidental: La economıá. In: Al-Bakhit, Bazin, Cissoko (Eds.) , Historia de la Humanidad, Del Siglo VII al Siglo XVI. Del Nacimiento del Islam al Descubrimiento de Ame´rica, Editorial Planeta—UNESCO, Paris, France, vol. 4, 489–492.

134


Clark, D., 2004. Africa. In: De Laet (Ed.), Historia de la Humanidad, Prehistoria e Inicios de la Civilizacioń. La Aparicioń del Hombre, Editorial Planeta—UNESCO, Paris, France, vol. 1, 210–224. Cobbold, T.S., 1855. Description of a new trematode worm (Fasciola gigantica). Edinbourg N. Phil. J., N. S., 2, 262–266. Coutellec-Vreto, M.A., Guiller, A., Daguzan, J., 1994. Allozyme variation in some populations of the freshwater snails Lymnaea peregra, L. auricularia and L. stagnalis (Gastropoda: Pulmonata). J. Molluscan Stud. 60, 393–403. Cruz-Reyes, A., Malek, E.A., 1987. Suitability of six lymnaeid snails for infection with Fasciola hepatica. Vet. Parasitol. 24, 203–210. Cymbron, T., Freeman, A.R., Malheiro, M.I., Vigne, J.D., Bradley, D.G., 2005. Microsatellite diversity suggests different histories for Mediterranean and Northern European cattle populations. Proc. R. Soc. B 272, 1837–1843. Cymbron, T., Loftus, R.T., Malheiro, M.I., Bradley, D.G., 1999. Mitochondrial sequence variation suggests an African influence in Portuguese cattle. Proc. R. Soc. B 266, 597–603. Dalton, J.P., ed. 1999. Fasciolosis. CAB International Publishing, Wallingford, United Kingdom. Danis, M., Nozais, J.P., Chandenier, J., 1985. La distomatose a` Fasciola hepatica. II: La fasciolose humaine en France. Action Vet 907, VII–VIII. David, A., 1997. Disease in Egyptian mummies, the contribution of new technologies. Lancet 349, 1760–1763. Dawes, B., Hughes, D.L., 1964. Fascioliasis: The invasive stage of Fasciola hepatica in mammalian hosts. Adv. Parasitol. 2, 97–168. De, N.V., Hoa, L.T., Waikagul, J., 2006. Plant-borne trematode (fascioliasis) in Vietnam. In: V Seminar on Food- and Water-borne Parasitic Zoonoses (5th FBPZ), Mahidol University, Bangkok, Thailand. De la Brosse, G., 2008. En suivant le fil de la soie. In: Blandin (Ed.), L’Atlas des Migrations— Les Routes de l’Humanite´, Le Monde Hors-Se´rie, Monde SA, Malesherbes Publications SA and Sciences-Po, Paris, France, 38–39. De la Fe Rodriguez, P., Brito Alberto, E., Aguiar Sotelo, J., Rodriguez, L., Hernandez, J.A., 2007. Estudio de la prevalencia de las endoparasitosis que afectan a los cerdos en el territorio de Cuba. REDVET 8, 1–15. de Kock, K.N., Wolmarans, C.T., Bornman, M., 2003. Distribution and habitats of the snail Lymnaea truncatula, intermediate host of the liver fluke Fasciola hepatica, in South Africa. J. S. Afr. Vet. Assoc. 74, 117–122. Dinnik, J.A., Dinnik, N.N., 1961. On the morphology and life history of Fasciola nyanzae Leiper from the hippopotamus. J. Helminthol. (Leiper Suppl.), 53–62. Diop-Maes, L.M., Lam, T., Phillipson, D.W., Sall, B., 2004. Africa, a excepcioń del valle del Nilo. In: Dani, Mohen (Eds.), Historia de la Humanidad, Del Anõ 3000 A.C. al 700 A.C. La Invencioń de la Escritura, Editorial Planeta—UNESCO, Paris, France, vol. 1, 387–404. Dosay-Akbulut, M., Trudgett, A., Stanhope, M., 2005. Understanding genetic diversity in the liver fluke, Fasciola hepatica. Z. Naturforsch. 60, 774–778. Dowling, T.E., Secor, C.L., 1997. The role of hybridization and introgression in the diversification of animals. Annu. Rev. Ecol. Systemat. 28, 593–619. El-Azazy, O.M.E., Schillhorn Van Veen, T.W., 1983. Animal fascioliasis and schistosomiasis in Egypt and Sudan. Helminthol. Abstr., Series A, 52, 421–428. El-Shazly, A.M., Helmy, M.M.F.M., Haridy, F.M., El-Sharkawy, E.M.A., Morsy, T.A., 2002. Fasciola immature stages sought in Lymnaea species and Biomphalaria species in the water bodies of Dakahlia Governorate. J. Egypt. Soc. Parasitol. 32, 109–118. Esteban, J.G., Bargues, M.D., Mas-Coma, S., 1998. Geographical distribution, diagnosis and treatment of human fascioliasis: A review. Res. Rev. Parasitol. 58, 13–42.


135

Esteban, J.G., Flores, A., Angles, R., Mas-Coma, S., 1999. High endemicity of human fascioliasis between Lake Titicaca and La Paz valley, Bolivia. Trans. R. Soc. Trop. Med. Hyg. 93, 151–156. Esteban, J.G., Flores, A., Angles, R., Strauss, Aguirre, C., Mas-Coma, S., 1997b. A populationbased coprological study of human fascioliasis in a hyperendemic area of the Bolivian Altiplano. Trop. Med. Int. Health 2, 695–699. Esteban, J.G., Flores, A., Aguirre, C., Strauss, W., Angles, R., Mas-Coma, S., 1997a. Presence of very high prevalence and intensity of infection with Fasciola hepatica among Aymara children from the Northern Bolivian Altiplano. Acta Trop. 66, 1–14. Esteban, J.G., Gonzalez, C., Bargues, M.D., Angles, R., Sanchez, C., Na´quira, C., et al., 2002. High fascioliasis infection in children linked to a man-made irrigation zone in Peru. Trop. Med. Int. Health 7, 339–348. Esteban, J.G., Gonzalez, C., Curtale, F., Munõz-Antoli, C., Valero, M.A., Bargues, M.D., et al., 2003. Hyperendemic fascioliasis associated with schistosomiasis in villages in the Nile Delta of Egypt. Am. J. Trop. Med. Hyg. 69, 429–437. Farag, H.F., El Sayad, M.H., 1995. Biomphalaria alexandrina naturally infected with Fasciola gigantica in Egypt. Trans. R. Soc. Trop. Med. Hyg. 89, 36. Farag, H.F., Salem, A., Khalil, S.S., Farahat, A., 1993. Studies on human fascioliasis in Egypt. 1—Seasonality of transmission. J. Egypt. Soc. Parasitol. 23, 331–340. Fernandez, M., Littlewood, D.T.J., Latorre, A., Raga, J.A., Rollinson, D., 1998. Phylogenetic relationships of the family Campulidae (Trematoda) based on 18S rRNA sequences. Parasitology 117, 383–391. Fletcher, H.L., Hoey, E.M., Orr, N., Trudgett, A., Fairweather, I., Robinson, M.W., 2004. The occurrence and significance of triploidy in the liver fluke, Fasciola hepatica. Parasitology 128, 69–72. Fuentes, M.V., Valero, M.A., Bargues, M.D., Esteban, J.G., Angles, R., Mas-Coma, S., 1999. Analysis of climatic data and forecast indices for human fascioliasis at very high altitude. Ann. Trop. Med. Parasitol. 93, 835–850. Gaillet, P., 1982. Contribution a l’Etude de la Distomatose Humaine a` Fasciola hepatica en France Metropolitaine. A Propos de Quelques 10.000 Cas. The`se Doctorale, Fac. Me´dicine, Cre´teil University, France, pp. 1–164. Gaillet, P., Liance, M., Rivollet, D., Houin, R., 1983. Situation de la fasciolose humaine en France, enqueˆte retrospective portant sur les 30 dernie`res anneés. Bull. Soc. Fr. Parasitol. 1, 79–82. Gamrasni, M., 2008. Chroniques africaines. In: Blandin (Ed.), L’Atlas des Migrations—Les Routes de l’Humanite´, Le Monde Hors-Se´rie, Monde SA, Malesherbes Publications SA and Sciences-Po, Paris, France, 28–29. Garey, J.R., Wolstenholme, D.R., 1989. Platyhelminth mitochondrial DNA: Evidence for early evolutionary origin of a tRNA ser AGN that contains a dihydrouridine arm replacement loop, and of serine-specifying AGA and AGG codons. J. Mol. Biol. 28, 374–387. Gasnier, N., Rondelaud, D., Abrous, M., Carreras, F., Boulard, C., Diez-Banõs, P., et al., 2000. Allopatric combination of Fasciola hepatica and Lymnaea truncatula is more efficient than sympatric ones. Int. J. Parasitol. 30, 573–578. Ghavami, M.B., Rahimi, P., Haniloo, A., Biglari, A.R., 2008. GenBank Accession Numbers EU391412-EU391424. Gigitashvili, M., 1969. About human fascioliasis in Georgia. S. Virsaladze Sci. Res. Inst. Med. Parasitol. Trop. Med. 3, 26–27. Gigitashvili, M., 1985. Cases of human fascioliasis caused by Fasciola gigantica. Soviet Med. 6, 51–52. Giovambattista, G., Ripoli, M.V., De Luca, J.C., Mirol, P.M., Liron, J.P., Dulout, F.N., 2000. Male-mediated introgression of Bos indicus genes into Argentine and Bolivian Creole cattle breeds. Anim. Genet. 31, 302–305.

136


Gloër, P., Meier-Brook, C., 1998. Su¨sswassermollusken. Ein Bestimmungsschlu¨ssel fu¨r die Bundesrepublik Deutschland. Twelfth ed. Deutscher Jugendbund fu¨r Naturbeobachtung, Hamburg, Germany. Go¨therstro¨m, A., Anderung, C., Hellborg, L., Elburg, R., Smith, C., Bradley, D.G., et al., 2005. Cattle domestication in the Near East was followed by hybridization with aurochs bulls in Europe. Proc. R. Soc. B 272, 2345–2350. Goumghar, M.D., Vignoles, P., Rondelaud, D., Dreyfuss, G., Benlemlih, M., 2004. Relations entre l’amphibiose de Galba truncatula (Mollusca Gastropoda: Lymnaeidae), l’altitude et la nature de ses habitats dans le centre du Maroc. Revue Med. Vet. 155, 97–103. Graczyk, T.K., Fried, B., 1999. Development of Fasciola hepatica in the intermediate host. In: Dalton (Ed.), Fasciolosis, CAB International Publishing, Wallingford, United Kingdom, 31–46. Guerrero, C.A., Leguia, G., 1987. Enfermedades producidas por trematodes. Rev. Came´lidos Sudamericanos Lima 4, 52–58. Gunasekar, K.R., Tewari, A.K., Sreekumar, C., Gupta, S.C., Rao, J.R., 2008. Elucidation of genetic variability among different isolates of Fasciola gigantica (giant liver fluke) using random-amplified polymorphic DNA polymerase chain reaction. Parasitol. Res. 103, 1075–1081. Guo, J., Du, L.X., Ma, Y.H., Guan, W.J., Li, H.B., Zhao, Q.J., et al., 2005. A novel maternal lineage revealed in sheep (Ovis aries). Anim. Genet. 36, 331–336. Gutierrez, A., Pointier, J.P., Fraga, J., Jobet, E., Modat, S., Perez, R.T., et al., 2003. Fasciola hepatica: Identification of molecular markers for resistant and susceptible Pseudosuccinea columella snail hosts. Exp. Parasitol. 105, 211–218. Hammond, J.A., 1972. Infections with Fasciola spp. in wildlife in Africa. Trop. Anim. Health Prod. 4, 1–13. Hammond, J.A., Sewell, M.M.H., 1974. The pathogenic effect of experimental infections with Fasciola gigantica in cattle. Br. Vet. J. 130, 453–464. Hanotte, O., Bradley, D.G., Ochieng, J.W., Verjee, Y., Hill, E.W., Rege, J.E.O., 2002. African pastoralism: Genetic imprints of origins and migrations. Science 296, 336–339. Hanotte, O., Tawah, C.L., Bradley, D.G., Okomo, M., Verjee, Y., Ochieng, J., et al., 2000. Geographic distribution and frequency of a taurine Bos taurus and an indicine Bos indicus Y specific allele amongst sub-Saharan African cattle breeds. Mol. Ecol. 9, 387–396. Happich, F.A., Boray, J.C., 1969. Quantitative diagnosis of chronic fasciolosis. The estimation of daily total egg production of Fasciola hepatica and the number of adult fluke in sheep by faecal egg counts. Aust. Vet. J. 45, 329–331. Haroun, E.M., Hillyer, G.V., 1986. Resistance to fascioliasis—a review. Vet. Parasitol. 20, 63–93. Hashimoto, K., Watanabe, T., Liu, C.X., Init, I., Blair, D., Ohnishi, S., et al., 1997. Mitochondrial DNA and nuclear DNA indicate that the Japanese Fasciola species is F. gigantica. Parasitol. Res. 83, 220–225. Hernandez Fernandez, M., Vrba, E.S., 2005. A complete estimate of the phylogenetic relationships in Ruminantia: A dated species-level supertree of the extant ruminants. Biol. Rev. 80, 269–302. Herniou, E.A., Pearce, A.C., Littlewood, D.T., 1998. Vintage helminths yield valuable molecules. Parasitol. Today 14, 289–292. Hiendleder, S., Kaupe, B., Wassmuth, R., Janke, A., 2002. Molecular analysis of wild and domestic sheep questions current nomenclature and provides evidence for domestication from two different subspecies. Proc. R. Soc. B 269, 893–904. Hiendleder, S., Mainz, K., Plante, Y., Lewalski, H., 1998. Analysis of mitochondrial DNA indicates that domestic sheep are derived from two different ancestral maternal sources. No evidence for contributions from urial and argali sheep. J. Hered. 89, 113–120. Hopkins, D.R., 1992. Homing in on helminths. Am. J. Trop. Med. Hyg. 46, 626–634.


137

Huang, W.Y., He, B., Wang, C.R., Zhu, X.Q., 2004. Characterisation of Fasciola species from mainland China by ITS-2 ribosomal DNA sequence. Vet. Parasitol. 120, 75–83. Hubendick, B., 1951. Recent Lymnaeidae. Their variation, morphology, taxonomy, nomenclature, and distribution. Kungl. Svenska Vetensk. Akad. Handl. 3, 1–223. Hurtrez-Bousses, S., Durand, P., Jabbour-Zahab, R., Guegan, J.F., Meunier, C., Bargues, M.D., et al., 2004. Isolation and characterization of microsatellite markers in the liver fluke (Fasciola hepatica). Mol. Ecol. Notes 4, 689–690. Inaba, A., 1969. Cytotaxonomic studies of lymnaeid snails. Malacologia 7, 143–168. Inoue, K., Kanemasa, H., Inoue, K., Matsumoto, M., Kajita, Y., Mitsufuji, S., et al., 2007. A case of human fasciolosis: Discrepancy between egg size and genotype of Fasciola sp. Parasitol. Res. 100, 665–667. Intong, J.D., Abella, J.A.C., Intong, R.L., Frank, B.R., 2003. Evaluation of an extension program to control fasciolosis (Fasciola gigantica) among cattle and buffaloes in Bukidnon province, southern Philippines. CMU J. Sci. 11, 73–94. Irving, J.A., Spithill, T.W., Pike, R.N., Whisstock, J.C., Smooker, P.M., 2003. The evolution of enzyme specificity in Fasciola spp. J. Mol. Evol. 57, 1–15. Itagaki, T., Sakaguchi, K., 2008. GenBank Accession Numbers AB385611, AB385612, AB385613 and AB385614. Itagaki, T., Tsutsumi, K., 1998. Triploid form of Fasciola in Japan: Genetic relationships between Fasciola hepatica and Fasciola gigantica determined by ITS-2 sequence of the nuclear rDNA. Int. J. Parasitol. 28, 777–781. Itagaki, T., Kikawa, M., Sakaguchi, K., Shimo, J., Terasaki, K., Shibahara, T., et al., 2005a. Genetic characterization of parthenogenetic Fasciola sp. in Japan on the basis of the sequences of ribosomal and mitochondrial DNA. Parasitology 131, 679–685. Itagaki, T., Kikawa, M., Terasaki, K., Shibahara, T., Fukuda, K., 2005b. Molecular characterization of parthenogenic Fasciola sp. in Korea on the basis of DNA sequence of ribosomal ITS1 and mitochondrial NDI gene. J. Vet. Med. Sci. 67, 1115–1118. Itagaki, T., Tsutsumi, K.I., Ito, K., Tsutsumi, Y., 1998. Taxonomic status of the Japanese triploid forms of Fasciola: Comparison of mitochondrial ND1 and COI sequences with F. hepatica and F. gigantica. J. Parasitol. 84, 445–448. Itagaki, T., Tsutsumi, K.I., Sakamoto, T., Tsutsumi, Y., Itagaki, H., 1995. Characterization of genetic divergence among species within the genus Fasciola by PCR-SSCP. Japanese J. Parasitol. 44, 233–246. Jabbour-Zahab, R., Pointier, J.P., Jourdane, J., Jarne, P., Oviedo, J.A., Bargues, M.D., et al., 1997. Phylogeography and genetic divergence of some lymnaeid snails, intermediate hosts of human and animal fascioliasis, with special reference to lymnaeids from the Bolivian Altiplano. Acta Trop. 64, 191–203. Jackson, H.G., 1921. A revision on the genus Fasciola with particular reference to F. gigantica (Cobbold) and F. nyanzae (Leiper). Parasitology 13, 48–56. Jansen, T., Forster, P., Levine, M.A., Oelke, H., Hurles, M., Renfrew, C., et al., 2002. Mitochondrial DNA and the origins of the domestic horse. Proc. Natl. Acad. Sci. USA. 99, 10905–10910. Jarne, P., Delay, B., 1990a. Population genetics of Lymnaea peregra (Mu¨ller) (Gastropoda: Pulmonata) in Lake Geneva. J. Molluscan Stud. 56, 317–322. Jarne, P., Delay, B., 1990b. Inbreeding depression and self-fertilization in Lymnaea peregra (Gastropoda: Pulmonata). Heredity 64, 169–175. Jarne, P., Vianley-Liaud, M., Delay, B., 1993. Selfing and crossing in hermaphrodite freshwater gastropods (Basommatophora): Where, when and why. Biol. J. Linn. Soc. 49, 99–125. Jones, A., 2002. Family Fasciolidae Raillet 1895. In: Gibson, Jones, Bray (Eds.), Keys to the Trematoda, CAB International Publishing, Wallingford and the Natural History Museum, London, United Kingdom, vol. 1, 79–85.

138


Joshi, M.B., Rout, P.K., Mandal, A.K., Tyler-Smith, C., Singh, L., Thangaraj, K., 2004. Phylogeography and origin of Indian domestic goats. Mol. Biol. Evol. 21, 454–462. Kendall, S.B., 1954. Fascioliasis in Pakistan. Ann. Trop. Med. Parasitol. 48, 307–313. Kendall, S.B., 1965. Relationships between the species of Fasciola and the molluscan hosts. Adv. Parasitol. 3, 59–98. Kendall, S.B., Parfitt, J.W., 1959. Studies on the susceptibility of some species of Lymnaea to infection with Fasciola gigantica and F. hepatica. Ann. Trop. Med. Parasitol. 53, 220–227. Khallaayoune, K., Stromberg, B.E., Dakkak, A., Malone, J.B., 1991. Seasonal dynamics of Fasciola hepatica burdens in grazing Timahdit sheep in Morocco. Int. J. Parasitol. 21, 307–314. Kikkawa, Y., Takada, T., Sutopo, Nomura, K., Namikawa, T., Yonekawa, H., Amano, T., 2003. Phylogenies using mtDNA and SRY provide evidence for male-mediated introgression in Asian domestic cattle. Anim. Genet. 34, 96–101. Kim, K.I., Lee, J.H., Lee, S.S., Yang, Y.H., 2003. Phylogenetic relationships of northeast Asian cattle to other cattle populations determined using mitochondrial DNA D-loop sequence polymorphism. Biochem. Genet. 41, 91–98. Kimura, S., Shimizu, A., Kawano, J., 1984. Morphological observation on liver fluke detected from naturally infected carabaos in the Philippines. Sci. Rept. Fac. Agr. Kobe Univ. 16, 353–357. Kruglov, N.D., 2005. Molluscs of the Family Lymnaeidae (Gastropoda, Pulmonata) in Europe and Northern Asia. SGPU Publishing, Smolensk, Russia. Kumar, A., Gautam, A., Chaturvedi, S., 1995. Obstructive jaundice due to Fasciola hepatica. Indian J. Gastroenterol. 14, 79–80. Kumar, M., Pathak, K.M.L., Pachauri, S.P., 1982. Clinico-pathological studies on naturally occurring bovine fasciolosis in India. Br. Vet. J. 138, 241–246. Kumar, P., Freeman, A.R., Loftus, R.T., Gaillard, C., Fuller, D.Q., Bradley, D.G., 2003. Admixture analysis of South Asian cattle. Heredity 91, 43–50. Kumar, S., Tamura, K., Nei, M., 2004. MEGA 3: Integrate software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5, 150–163. Kunz, W., 2002. When is a parasite species a species? Trends Parasitol. 18, 121–124. Lachowicz, J., 1988. Development of Parafasciolopsis fasciolaemorpha Ejsmont, 1932 from eggs derived from sheep. Acta Parasitol. Pol. 33, 169–175. Larson, G., Dobney, K., Albarella, U., Fang, M., Matisoo-Smith, E., Robins, J., et al., 2005. Worldwide phylogeography of wild boar reveals multiple centers of pig domestication. Science 307, 1618–1621. Le, T.H., Blair, D., McManus, D.P., 2001. Complete DNA sequence and gene organization of the mitochondrial genome of the liver fluke, Fasciola hepatica L. (Plathelminthes; Trematoda). Parasitology 123, 609–621. Le, T.H., De, N.V., Agatsuma, T., Nguyen, T.G.T., Nguyen, Q.D., McManus, D.P., et al., 2008. Human fascioliasis and the presence of hybrid/introgressed forms of Fasciola hepatica and Fasciola gigantica in Vietnam. Int. J. Parasitol. 38, 725–730. Lin, R.Q., Dong, S.J., Nie, K., Wang, C.R., Song, H.Q., Li, A.X., et al., 2007. Sequence analysis of the first internal transcribed spacer of rDNA supports the existence of an intermediate Fasciola between F. hepatica and F. gigantica in mainland China. Parasitol. Res. 101, 813–817. Littlewood, D.T., Herniou, E.A., 1999. GenBank Accession Number AJ011942. Lockyer, A.E., Jones, C.S., Noble, L.R., Rollinson, D., 2004. Trematodes and snails: An intimate association. Can. J. Zool. 82, 251–269. Loftus, R.T., Ertugrul, O., Harba, A.H., El-Barody, M.A.A., Mac Hugh, D.E., Park, S.D.E., et al., 1999. A microsatellite survey of cattle from a centre of origin: The Near East. Mol. Ecol. 8, 2015–2022. Loftus, R.T., Mac Hugh, D.E., Bradley, D.G., Sharp, P.M., Cunningham, E.P., 1994. Evidence for two independent domestications of cattle. Proc. Natl. Acad. Sci. USA. 91, 2757–2761.


139

Looss, A., 1896. Recherches sur la faune parasitaire de l’Egypte. Premie`re Partie. Mem. Inst. Egypt 3, 1–252. Losos, G.J., 1986. Infectious Tropical Diseases of Domestic Animals. Longman Scientific & Technical, Essex, United Kingdom. Lotfi, W.M., Brant, S.V., De Jong, R.J., Le, T.H., Demiaskiewicz, A., Rajapakse, R.P., et al., 2008. Evolutionary origins, diversification, and biogeography of liver flukes (Digenea, Fasciolidae). Am. J. Trop. Med. Hyg. 79, 248–255. Lotfi, W.M., El-Morshedy, H.N., El-Hoda, M.A., El-Tawila, M.M., Omar, E.A., Farag, H.F., 2002. Identification of the Egyptian species of Fasciola. Vet. Parasitol. 103, 323–332. Luikart, G., Gielly, L., Excoffier, L., Vigne, J.D., Bouvet, J., Tabernet, P., 2001. Multiple maternal origins and weak phylogeographic structure in domestic goats. Proc. Natl. Acad. Sci. USA. 98, 5927–5932. Mac Hugh, D.E., Bradley, D.G., 2001. Livestock genetic origins: Goats buck the trend. Proc. Natl. Acad. Sci. USA 98, 5382–5384. Mac Hugh, D.E., Shrive, M.D., Loftus, R.T., Cunningham, P., Bradley, D.G., 1997. Microsatellite DNA variation and the evolution, domestication and phylogeography of taurine and zebu cattle (Bos taurus and Bos indicus). Genetics 146, 1071–1086. Mac Hugh, D.E., Troy, C.S., McCormick, F., Olsaker, I., Eythorsdottir, E., Bradley, D.G., 1999. Early medieval cattle remains from a Scandinavian settlement in Dublin: Genetic analysis and comparison with extant breeds. Phil. Trans. R. Soc. Lond. B 354, 99–109. Magee, D.A., Meghen, C., Harrison, S., Troy, C.S., Cymbron, T., Gaillard, C., et al., 2002. A partial African ancestry for the Creole cattle populations of the Caribbean. J. Hered. 93, 429–432. Majoros, G., Erdelyi, K., 2004. A natural focus of exotic fluke species in Central Europe. In: Mas-Coma, Bargues, Esteban, Valero (Eds.), Symposium on Wildlife and Parasite Faunas. Multidisciplinarity for Parasites, Vectors and Parasitic Diseases, IX European Multicolloquium of Parasitology (EMOP 9). J. Aguilar S.L. Press, Valencia, Spain, p. 585. Malek, E.A., 1985. Snail Hosts of Schistosomiasis and Other Snail-Transmitted Diseases in Tropical America: A Manual. Pan American Health Organization, Washington. Malone, J.B., Gommes, R., Hansen, J., Yilma, J.M., Slingenberg, J., Snijders, F., et al., 1998. A geographic information system on the potential distribution and abundance of Fasciola hepatica and F. gigantica in east Africa based on Food and Agriculture Organization databases. Vet. Parasitol. 78, 87–101. Marcilla, A., Bargues, M.D., Mas-Coma, S., 2002. A PCR-RFLP assay for the distinction between Fasciola hepatica and F. gigantica. Mol. Cell. Probes 16, 327–333. Mas-Coma, S., 2004a. Human fascioliasis: Epidemiological patterns in human endemic areas of South America, Africa and Asia. Southeast Asian J. Trop. Med. Publ. Health 35(Suppl. 1), 1–11. Mas-Coma, S., 2004b. Human fascioliasis. In: Cotruvo, Dufour, Rees, Bartram, Carr, Cliver, Craun, Fayer, Gannon (Eds.), Waterborne Zoonoses: Identification, Causes and Control. World Health Organization (WHO), IWA Publishing, London, United Kingdom, vol. 1, 305–322. Mas-Coma, S., 2005. Epidemiology of fascioliasis in human endemic areas. J. Helminthol. 79, 207–216. Mas-Coma, S., 2008. The worldwide initiative against human fascioliasis. In: Special Issue for the 3rd K.E. Mott Symposium on Flukes and Schistosomes, EMOP 10, J. Helminthol, Paris, France. Mas-Coma, S., Bargues, M.D., 1997. Human liver flukes: A review. Res. Rev. Parasitol. 57, 145–218. Mas-Coma, S., Bargues, M.D., 2008. Populations, hybrids and the systematic concepts of species and subspecies in Chagas disease triatomine vectors inferred from nuclear ribosomal and mitochondrial DNA. Acta Trop. 110, 112–136.

140


Mas-Coma, S., Angles, R., Esteban, J.G., Bargues, M.D., Buchon, P., Franken, M., et al., 1999c. The Northern Bolivian Altiplano: A region highly endemic for human fascioliasis. Trop. Med. Int. Health 4, 454–467. Mas-Coma, S., Artigas, P., Bargues, M.D., 2008c. Filogenia de los Lymnaeidae vectores de Fasciola hepatica. In: Memorias del Seminario Internacional ACOFACIEN-ACCEFYN, Tendencias y Futuro de la Investigacioń en Parasitologıá y en Productos Naturales Bogota´, Colombia, pp. 141–157. Mas-Coma, S., Bargues, M.D., Esteban, J.G., 1999b. Human fasciolosis. In: Dalton (Ed.), Fasciolosis, CAB International Publishing, Wallingford, United Kingdom, 411–434. Mas-Coma, S., Bargues, M.D., Valero, M.A., 2005. Fascioliasis and other plant-borne trematode zoonoses. Int. J. Parasitol. 35, 1255–1278. Mas-Coma, S., Bargues, M.D., Valero, M.A., 2007. Plantborne trematode zoonoses: Fascioliasis and fasciolopsiasis. In: Murrell, Fried (Eds.), World Class Parasites: Food-Borne Parasites, Fish and Plant-Borne Parasites, Springer Verlag, New York, vol. 11, 293–334. Mas-Coma, S., Bargues, M.D., Valero, M.A., Fuentes, M.V., 2003. Adaptation capacities of Fasciola hepatica and their relationships with human fascioliasis: From below sea level up to the very high altitude. In: Combes, Jourdane (Eds.), Taxonomy, Ecology and Evolution of Metazoan Parasites, Presses Universitaires de Perpignan, Perpignan, France, vol. 2, 81–123. Mas-Coma, S., Esteban, J.G., Bargues, M.D., 1999a. Epidemiology of human fascioliasis: A review and proposed new classification. Bull. World Health Organ. 77, 340–346. Mas-Coma, S., Funatsu, R., Bargues, M.D., 2001. Fasciola hepatica and lymnaeid snails occurring at very high altitude in South America. Parasitology 123, S115–S127. Mas-Coma, S., Rodriguez, A., Bargues, M.D., Valero, M.A., Coello, J.R., Angles, R., 1997. Secondary reservoir role of domestic animals other than sheep and cattle in fascioliasis transmission in the Northern Bolivian Altiplano. Res. Rev. Parasitol. 57, 39–46. Mas-Coma, S., Valero, M.A., Bargues, M.D., 2008a. Effects of climate change on animal and zoonotic helminthiases. Rev. Sci. Tech. 27, 443–457. Mas-Coma, S., Valero, M.A., Bargues, M.D., 2008b. Climate change effects on trematodiases, with emphasis on zoonotic fascioliasis and schistosomiasis. Vet. Parasitol. doi:10.1016/ j.vetpar.2009.03.024. Massoud, J., Sadjadi, S., 1980. Susceptibility of different species of Lymnaea snails to miracidia of Fasciola gigantica and Fasciola hepatica in Iran. J. Helminthol. 54, 201–202. McGarry, J.W., Ortiz, P.L., Hodgkinson, J.E., Goreish, I., Williams, D.J.L., 2007. PCR-based differentiation of Fasciola species (Trematoda: Fasciolidae), using primers based on RAPD-derived sequences. Ann. Trop. Med. Parasitol. 101, 415–421. Meadows, J.R.S., Cemal, I., Karaca, O., Gootwine, E., Kijas, J.W., 2007. Five ovine mitochondrial lineages identified from sheep breeds of the Near East. Genetics 175, 1371–1379. Meadows, J.R.S., Hanotte, O., Drogemuller, C., Calvo, J., Godfrey, R., Coltman, D., et al., 2006. Globally dispersed Y chromosomal haplotypes in wild and domestic sheep. Anim. Genet. 37, 444–453. Meier-Brook, C., Bargues, M.D., 2002. Catascopia, a new genus for three Nearctic and one Palaearctic stagnicoline species (Gastropoda: Lymnaeidae). Folia Malacol. 10, 83–84. Meirelles, F.V., Rosa, A.J.M., Lobo, R.B., Garcıá, J.M., Smith, L.C., Duarte, F.A.M., 1999. Is the American zebu really Bos indicus? Genet. Mol. Biol. 22, 543–546. Meunier, C., Tirad, C., Hurtrez-Bousses, S., Durand, P., Bargues, M.D., Mas-Coma, S., et al., 2001. Lack of molluscan host diversity and the transmission of an emerging parasitic disease in Bolivia. Mol. Ecol. 10, 1333–1340. Miretti, M.M., Dunner, S., Naves, M., Contel, E.P., Ferro, J.A., 2004. Predominant Africanderived mtDNA in Caribbean and Brazilian Creole cattle is also found in Spanish cattle (Bos taurus). J. Hered. 95, 450–453.


141

Miretti, M.M., Pereira, H.A., Poli, M.A., Contel, E.P.B., Ferro, J.A., 2002. African-derived mitochondria in South American native cattle breeds (Bos taurus): Evidence of a new taurine mitochondrial lineage. J. Hered. 93, 323–330. Mirol, M., Giovambattista, G., Liron, J.P., Dulout, F.N., 2003. African and European mitochondrial haplotypes in South American Creole cattle. Heredity 91, 248–254. Moghaddam, A.S., Massoud, J., Mahmoodi, M., Mahvi, A.H., Periago, M.V., Artigas, P., et al., 2004. Human and animal fascioliasis in Mazandaran province, northern Iran. Parasitol. Res. 94, 61–69. Morozova, E.V., Chrisanfova, G.G., Arkhipov, A., Semyonova, S.K., 2004. Polymorphism of the ND1 and CO1 mitochondrial genes in populations of liver fluke Fasciola hepatica. Genetika 40, 817–820. Mukaratirwa, S., Brand, A., 1999. Fasciola tragelaphi in a beef cow. Zimbabwe Vet. J. 30, 67–69. Narain, K., Biswas, D., Rajguru, S.K., Mahanta, J., 1997. Human distomatosis due to Fasciola hepatica infection in Assam, India. J. Comm. Dis. 29, 161–165. Ndiaye, P.I., Miquel, J., Ba, C.T., Marchand, B., 2004. Spermiogenesis and ultrastructure of the spermatozoon of the liver fluke Fasciola gigantica Cobbold, 1856 (Digenea: Fasciolidae), a parasite of cattle in Senegal. J. Parasitol. 90, 30–40. Odhner, T., 1926. Protofasciola n. g. ein Prototypus des grossen Leberegels. Arkiv. Zool. 20 (18 A), 1–7. Okimoto, R., Macfarlane, J.L., Clary, D.O., Wostenholme, D.R., 1992. The mitochondrial genomes of two nematodes, Caenorhabditis elegans and Ascaris suum. Genetics 130, 471–498. Oviedo, J.A., Bargues, M.D., Mas-Coma, S., 1996. The intermediate snail host of Fasciola hepatica on the Mediterranean island of Corsica. Res. Rev. Parasitol. 56, 217–220. Oviedo, J.A., Mas-Coma, S., Dominici, J.L., Roche, B., 1992. Distribution and ecology of Lymnaea truncatula (Mu¨ller, 1774) (Gastropoda: Basommatophora: Lymnaeidae), intermediate host of Fasciolosis, in the island of Corsica (France). In: VIth European Multicolloquium of Parasitology (EMOP VI), The Hague, The Netherlands, p. 218. Pantelouris, E.M., 1965. The Common Liver Fluke Fasciola hepatica. Pergamon Press, London, United Kingdom. Pedrosa, S., Uzun, M., Arranz, J.J., Gutierrez-Gil, B., San Primitivo, F., Bayon, Y., 2005. Evidence of three maternal lineages in near eastern sheep supporting multiple domestication events. Proc. R. Soc. B 272, 2211–2217. Pemola Devi, N., Jauhari, R.K., 2008. Diversity and cercarial shedding of malaco fauna collected from water bodies of Ratnagiri district, Maharashtra. Acta Trop. 105, 249–252. Pereira, F., Davis, S.J.M., Pereira, L., McEvoy, B., Bradley, D.G., Amorim, A., 2006. Genetic signatures of a Mediterranean influence in Iberian Peninsula sheep husbandry. Mol. Biol. Evol. 23, 1420–1426. Pereira, F., Pereira, L., Van Asch, B., Bradley, D.G., Amorim, A., 2005. The mtDNA catalogue of all Portuguese autochthonous goat (Capra hircus) breeds: High diversity of female lineages at the western fringe of European distribution. Mol. Ecol. 14, 2313–2318. Periago, M.V., 2004. Detection of a broad spectrum of variable genotypes in human and animal fasciolids from the Nile Delta (Egypt), an area of endemic fascioliasis. In: MasComa, Bargues, Esteban, Valero (Eds.), II K.E. Mott Symposium on Schistosomiasis and Distomatoses. Multidisciplinarity for Parasites, Vectors and Parasitic Diseases, IX European Multicolloquium of Parasitology (EMOP 9). J. Aguilar S.L. Press, Valencia, Spain, 268. Periago, M.V., Artigas, P., Khoubbane, M., Moghaddam, A.S., Ashrafi, K., Mansoorian, A.B., et al., 2004. Genotypic analysis of adult liver flukes from Iran based on the ribosomal DNA markers ITS-1 and ITS-2. In: Mas-Coma, Bargues, Esteban, Valero (Eds.) , II K.E. Mott Symposium on Schistosomiasis and Distomatoses. Multidisciplinarity for Parasites, Vectors and Parasitic Diseases, IX European Multicolloquium of Parasitology (EMOP 9). J. Aguilar S.L. Press, Valencia, Spain, pp. 286–287.

142


Periago, M.V., Valero, M.A., El Sayed, M., Ashrafi, K., El Wakeel, A., Mohamed, M.Y., et al., 2007. First phenotypic description of Fasciola hepatica/Fasciola gigantica intermediate forms from the human endemic area of the Nile Delta, Egypt. Infect. Genet. Evol. 8, 51–58. Periago, M.V., Valero, M.A., Panova, M., Mas-Coma, S., 2006. Phenotypic comparison of allopatric populations of Fasciola hepatica and Fasciola gigantica from European and African bovines using a computer image analysis system (CIAS). Parasitol. Res. 99, 368–378. Piersanti, C., 1941. Mollusca. Missione Biol. Sagan-Omo 12, 263–281. Pike, A.W., Condy, J.B., 1966. Fasciola tragelaphi sp. Nov. From the sitatunga, Tragelaphus spekei Rothschild, with a note on the prepharyngeal pouch in the genus Fasciola. Parasitology 56, 511–520. Pitman, W.C., Cande, S., La Brecque, J., Indell, S.C., 1993. Fragmentation of Gondwana: The separation of Africa and South America. In: Goldblatt (Ed.), Biological Relationships between Africa and South America, Yale University Press, New Haven, pp. 15–37. Pointier, J.P., Coustau, C., Rondelaud, D., Theron, A., 2007. Pseudosuccinea columella (Say, 1817) (Gastropoda, Lymnaeidae), snail host of Fasciola hepatica: First record for France in the wild. Parasitol. Res. 101, 1389–1392. Prasad, P.K., Tandon, V., Biswal, D.K., Goswami, L.M., Chatterjee, A., 2008. Molecular identification of the Indian liver fluke, Fasciola (Trematoda: Fasciolidae) based on the ribosomal internal transcribed spacer regions. Parasitol. Res. 103, 1247–1255. Price, E.W., 1953. The fluke situation in North American ruminants. J. Parasitol. 39, 119–134. Railliet, A., 1895. Sur une forme particulie`re de douve he´patique provenant du Seńe´gal. Compt. Rend. Soc. Biol. 47, 338–340. Ramadan, N.I., Saber, L.M., 2004. Detection of genetic variability in nonhuman isolates of Fasciola hepatica and Fasciola gigantica by the RAPD-PCR technique. J. Egypt. Soc. Parasitol. 34, 679–689. Remigio, E.A., 2002. Molecular phylogenetic relationships in the aquatic snail genus Lymnaea, the intermediate host of the causative agent of fascioliasis: Insights from broader taxon sampling. Parasitol. Res. 88, 687–696. Remigio, E.A., Blair, D., 1997a. Molecular systematics of the freshwater snail family Lymnaeidae (Pulmonata: Basommatophora) utilising mitochondrial ribosomal DNA sequences. J. Molluscan Stud. 63, 173–185. Remigio, E.A., Blair, D., 1997b. Relationships among problematic North American stagnicoline snails (Pulmonata: Lymnaeidae) reinvestigated using nuclear ribosomal DNA internal transcribed spacer sequences. Can. J. Zool. 75, 1540–1545. Rickard, L.G., Bishop, J.K., 1991. Helminth parasites of llamas (Lama glama) in the Pacific Northwest. J. Helminthol. Soc. Wash. 58, 110–115. Rim, H.J., Farag, H.F., Sornmani, S., Cross, J.H., 1994. Food-borne trematodes: Ignored or emerging? Parasitol. Today 10, 207–209. Roberts, J.A., Estuningsih, E., Widjayanti, S., Wiedosari, E., Partoutomo, S., Spithill, T.W., 1997. Resistance of Indonesian thin tail sheep against Fasciola gigantica and F. hepatica. Vet. Parasitol. 68, 69–78. Rognlie, M.C., Dimke, K.L., Knapp, S.E., 1994. Detection of Fasciola hepatica in infected intermediate hosts using RT-PCR. J. Parasitol. 80, 748–755. Round, M.C., 1968. Check list of the helminth parasites of african mammals of the orders Carnivora, Tubulidentata, Proboscidae, Hyracoidea, Artiodactyla and Perissodactyla. Tech. Comm. Commonwealth Bureau Helminthol St. Albans 38, 1–251. Rudolph, P.H., Burch, J.B., 1989. Electrophorectic analysis of enzymes in three species of Stagnicola (Pulmonata: Lymnaeidae). J. Med. Appl. Malacol. 1, 57–64. Sadykov, M., 1988. Occurrence of Fasciola in deceased individuals in the Samarkand region. Med. Parazitol. Parazit. Bol. 4, 71–73 (in Russian). Sahba, G.H., Arfaa, F., Farahmandian, I., Jalali, H., 1972. Animal fascioliasis in Khuzestan, southwestern Iran. J. Parasitol. 58, 712–716.


143

Sanders, J.O., 1980. History and development of zebu cattle in the United States. J. Anim. Sci. 50, 1188–1200. Sarwar, M.M., 1957. Fasciola indica Varma, a synonym of Fasciola gigantica Cobbold. Biologia 3, 168–175. Schillhorn Van Veen, T.W., 1980. Fascioliasis (Fasciola gigantica) in West Africa: A review. Vet. Bull. 50, 529–533. Semyenova, S.K., Morozova, E.V., Chrisanfova, G.C., Asatrian, A.M., Movsessian, S.O., Ryskov, A.P., 2003. RAPD variability and genetic diversity in two populations of the liver fluke, Fasciola hepatica. Acta Parasitol. 48, 125–130. Semyenova, S.K., Morozova, E.V., Chrisanfova, G.C., Gorokhov, V., Arkhipov, A., Moskvin, A.S., et al., 2006. Genetic differentiation in eastern European and western Asian populations of the liver fluke, Fasciola hepatica, as revealed by mitochondrial nad1 and cox1 genes. J. Parasitol. 92, 525–530. Semyenova, S.K., Morozova, E.V., Vasilyev, A., Gorokhov, V., Moskvin, A.S., Movsessian, S.O., et al., 2005. Polymorphism of internal transcribed spacer 2 (ITS-2) sequences and genetic relationships between Fasciola hepatica and F. gigantica. Acta Parasitol. 50, 240–243. Semyenova, S.K., Romanova, E.A., Benediktov, I., Ryskov, A.P., 1995. Analysis of genetic variability of Fasciola hepatica using the polymerase chain reaction with random primers. Genetika-Moskova 31, 273–275. Seto, E., Xu, B., Liang, S., Gong, P., Wu, W.P., Davis, G., et al., 2002. The use of remote sensing for predictive modeling of schistosomiasis in China. Photogramm. Eng. Rem. Sens. 68, 167–174. Shackleton, N.J., 1995. New data on the evolution of Pliocene climatic variability. In: Vrba, Denton, Partridge, Burckle (Eds.), Paleoclimate and Evolution, with Emphasis on Human Origins, Yale University Press, New Haven, pp. 242–248. Sharma, R.L., Dhar, D.N., Raina, O.K., 1989. Studies on the prevalence and laboratory transmission of fasciolosis in animal in the Kashmir valley. Br. Vet. J. 145, 57–61. Shehab, A.Y., Abou Basha, L.M., El-Morshedy, H.N., Abdel-Fattah, M., Osman, M.M., Farag, H.F., 1999. Circulating antibodies and antigens correlate with egg counts in human fascioliasis. Trop. Med. Int. Health 4, 691–694. Shubkin, C.D., White, M.W., Abrahamsen, M.S., Ronglie, M.C., Knapp, S.E., 1992. A nucleid acid-based test for detection of Fasciola hepatica. J. Parasitol. 78, 817–821. Sinitsin, D.F., 1933. Studien u¨ber die Phylogenie der Trematoden. VI. The life histories of some American liver flukes. Z. Parasitenk. 6, 170–191. Slusarski, W., 1955. Studies on the European representatives of the fluke Fasciola magna (Bassi, 1875) Stiles, 1894. Acta Parasitol. Pol. 3, 1–59. Soliman, M.S., 1998. Control of veterinary fascioliasis. In: Angelico, Rocchi (Eds.), Infectious Diseases and Public Health. A Research and Clinical Update, Balaban Publishers, Philadelphia, L’Aquila, pp. 334–346. Spithill, T.W., Smooker, P.M., Copeman, D.B., 1999. Fasciola gigantica: Epidemiology, control, immunology and molecular biology. In: Dalton (Ed.), Fasciolosis, CAB International Publishing, Wallingford, United Kingdom, pp. 465–525. Sponenberg, D.P., Olson, T.A., 1992. Colonial Spanish cattle in the USA: History and present status. Arch. Zootecnia 41(154), 401–414. Spratt, D.M., Presidente, P.J.A., 1981. Prevalence of Fasciola hepatica infection in native mammals in southeastern Australia. Exp. Biol. Med. Sci. 59, 713–721. Srimuzipo, P., Komalamisra, C., Choochote, W., Jitpakdi, A., Vanichthanakorn, P., Keha, P., et al., 2000. Comparative morphometry, morphology of egg and adult surface topography under light and scanning electron microscopies, and metaphase karyotype among three size-races of Fasciola gigantica in Thailand. Southeast Asian J. Trop. Med. Publ. Health 31, 366–373.

144


Stemmermann, G.N., 1953. Human infestation with Fasciola gigantica. Am. J. Pathol. 29, 731–759. Stothard, J.R., Bremond, P., Andriamaro, L., Loxton, N.J., Sellin, B., Rollinson, D., 2000. Molecular characterization of the freshwater snail Lymnaea natalensis (Gastropoda: Lymnaeidae) on Madagascar with an observation of an unusual polymorphism in ribosomal small subunit genes. J. Zool. 252, 303–315. Suzuki, K., Kanameda, M., Inui, K., Ogawa, T., Nguyen, V.K., Dang, T.T.S., Pfeiffer, D.U., 2006. A longitudinal study to identify constraints to dairy cattle health and production in rural smallholder communities in Northern Vietnam. Res. Vet. Sci. 81, 177–184. Swarup, D., Pachauri, S.P., 1987. Epidemiological studies on fasciolosis due to Fasciola gigantica in buffalo in India. Buffalo Bull. 6, 4–9. Taha, H.A., 2006. GenBank Accession Number DQ383512. Tassy, P., 1990. The ‘‘Proboscidean Datum Event’’: How many proboscideans and how many events. In: Lindsay, Fahlbusch, Mein (Eds.), European Neogene Mammal Chronology, Plenum Press, New York, pp. 237–248. Terasaki, K., Akahane, H., Habe, S., 1982. The geographical distribution of common liver flukes (the genus Fasciola) with normal and abnormal spermatogenesis. Nippon Juigaku Zasshi 44, 223–231. Terasaki, K., Moriyama-Gonda, N., Noda, Y., 1998. Abnormal spermatogenesis in the common liver fluke (Fasciola sp.) from Japan and Korea. J. Vet. Med. Sci. 60, 1305–1309. Terasaki, K., Noda, Y., Shibahara, T., Itagaki, T., 2000. Morphological comparisons and hypotheses on the origin of polyploids in parthenogenetic Fasciola sp. J. Parasitol. 86, 724–729. Thapar, G.S., Tandon, R.S., 1952. On the life history of liver fluke, Fasciola gigantica Cobbold, 1955 in India. Indian J. Helminthol. 4, 1–36. Thenius, E., 1980. Grundzu¨ge der Faunen- und Verbreitungsgeschichte der Saügetiere. Gustav Fischer Verlag, Stuttgart, Germany. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: Improving the sensitivity and progressive multiple sequence alignment through sequence weighting, positionsspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Timoteo, O., Maco, V., Neyra, V., Yi, P.J., Leguia, G., Espinoza, J.R., 2005. Characterization of the humoral immune response in alpacas (Lama pacos) experimentally infected with Fasciola hepatica against cysteine proteinases Fas1 and Fas2 and histological findings. Vet. Immunol. Immunopathol. 106, 77–86. Tinar, R., 1984. Yumurta boyutlarina gore Fasciola gigantica ile Fasciola hepatica’ nin ayirimi uzerinde arastirmalar. Vet. Fak. Ankara Univ. 31, 207–229. Torgerson, P., Claxton, J., 1999. Epidemiology and control. In: Dalton (Ed.), Fasciolosis, CAB International Publishing, Wallingford, United Kingdom, pp. 113–149. Touratier, L., 1988. Note sur la place du nitroxynil dans la lutte inte´greé contre la fasciolose bovine a` Fasciola gigantica a` Madagascar. Rev. Elev. Med Vet. Pays Trop. 41, 181–189. TropMed Technical Group, 1986. Snails of medical importance in Southeast Asia. Southeast Asian J. Trop. Med. Publ. Health 17, 282–322. Trouve, S., Degen, L., Meunier, C., Tirard, C., Hurtrez-Bousses, S., Durand, P., et al., 2000. Microsatellites in the hermaphroditic snail, Lymnaea truncatula, intermediate host of the liver fluke, Fasciola hepatica. Mol. Ecol. 9, 1662–1663. Ueno, H., Arandia, R., Morales, G., Medina, G., 1975. Fascioliasis of livestock and snail host for Fasciola in the Altiplano region of Bolivia. Natl. Inst. Anim. Health Q. 15, 61–67. Valero, M.A., Darce, N.A., Panova, M., Mas-Coma, S., 2001. Relationships between host species and morphometric patterns in Fasciola hepatica adults and eggs from the Northern Bolivian Altiplano hyperendemic region. Vet. Parasitol. 102, 85–100. Valero, M.A., De Renzi, M., Mas-Coma, S., 1991. Ontogenetic trajectories: A new approach in the study of parasite development, with special reference to Digenea. Res. Rev. Parasitol. 51, 125–138.


145

Valero, M.A., Marcos, M.D., Mas-Coma, S., 1996. A mathematical model for the ontogeny of Fasciola hepatica in the definitive host. Res. Rev. Parasitol. 56, 13–20. Valero, M.A., Marcos, M.D., Comes, A.M., Sendra, M., Mas-Coma, S., 1999. Comparison of adult liver flukes from highland and lowland populations of Bolivian and Spanish sheep. J. Helminthol. 73, 341–345. Valero, M.A., Marcos, M.D., Fons, R., Mas-Coma, S., 1998. Fasciola hepatica development in experimentally infected black rat, Rattus rattus. Parasitol. Res. 84, 188–194. Valero, M.A., Panova, M., Mas-Coma, S., 2005. Phenotypic analysis of adults and eggs of Fasciola hepatica by computer image analysis system. J. Helminthol. 79, 217–225. Valero, M.A., Perez-Crespo, I., Periago, M.V., Khoubbane, M., Mas-Coma, S., 2009. Fluke egg characteristics for the diagnosis of human and animal fascioliasis by Fasciola hepatica and F. gigantica in human endemic areas. Acta Trop. doi:10.1016/j.actatropica.2009.04.005. Valero, M.A., Ubeira, F.M., Khoubbane, M., Artigas, P., Muinõ, L., Mezo, M., et al., 2008. MM3-ELISA evaluation of coproantigen release and serum antibody production in sheep experimentally infected with Fasciola hepatica and F. gigantica. Vet. Parasitol. 159, 77–81. Van Damme, D., 1984. The freshwater mollusca of Northern Africa—distribution, biogeography and paleoecology. Dr. W. Junk Publishers, Dordrecht, The Netherlands. Van Den Berghe, L., 1943. Enqueˆte parasitologique. II. Helminthes parasites Mission (van den Berghe). Exploration au Parc Naturel Albert (1936), 3–30. Van Der Made, J., 1999. Intercontinental relationship Europe-Africa and the Indian Subcontinent. In: Ro¨ssner, Heissig (Eds.), The Miocene Land Mammals of Europe, Verlag Dr. Friedrich Pfeil, Munich, Germany, pp. 457–472. Van Hooft, W.F., Groen, A.F., Prins, H.H.T., 2002. Phylogeography of the African buffalo based on mitochondrial and Y-chromosomal loci: Pleistocene origin and population expansion of the Cape buffalo subspecies. Mol. Ecol. 11, 267–279. Van Someren, D., 1946. The habitats and tolerance ranges of Lymnaea (Radix) caillaudi, the intermediate snail host of the liver fluke in East Africa. J. Anim. Ecol. 15, 170–197. Vara del Rio, M.P., Villa, H., Martinez-Valladares, M., Rojo-Vazquez, F.A., 2007. Genetic heterogeneity of Fasciola hepatica isolates in the northwest of Spain. Parasitol. Res. 101, 1003–1006. Vargas, D., Vega, M., Gonzalez, C.G., 2003. Aproximacioń a una caracterizacioń molecular de Fasciola hepatica por la tećnica RAPDs-PCR. Parasitol. Latinoam. 58, 11–16. Varma, A.K., 1953. On Fasciola indica n. sp. with some observations on F. hepatica and F. gigantica. J. Helminthol. 27, 185–198. Vassiliades, G., 1978. Capacite´ de re´sistance a` la sećheresse de la limneé (Limnaea natalensis), mollusque hoˆte interme´diaire de Fasciola gigantica, au Seńe´gal. Rev. Elev. Med. Vet. Pays Trop. 31, 57–62. Vigo, M., Bargues, M.D., Yong, M., Arenas, J.A., Naquira, C., Paraense, W.L., et al., 2000a. Molecular characterisation of a snail species transmitting fascioliasis, Lymnaea columella (Gastropoda: Lymnaeidae), from Cuba, Guadeloupe, Venezuela, Peru and Brazil. In: VX International Congress for Tropical Medicine and Malaria, Cartagena de Indias, Colombia, vol. 2, p. 96. Vigo, M., Bargues, M.D., Yong, M., Pointier, J.P., Mas-Coma, S., 2000b. Ribosomal DNA ITS2 characterisation of populations of Lymnaea cubensis (Gastropoda: Lymnaeidae), main snail species transmitting human fascioliasis in Cuba. In: VX International Congress for Tropical Medicine and Malaria, Cartagena de Indias, Colombia, vol. 2, p. 156. Walker, S.M., Makundi, A.E., Namuba, F.V., Kassuku, A.A., Keyyu, J., Hoey, E.M., et al., 2008. The distribution of Fasciola hepatica and Fasciola gigantica within southern Tanzania—constraints associated with the intermediate host. Parasitology 135, 495–503. Walker, S.M., Pro¨dohl, P.A., Fletcher, H.L., Hanna, R.E.B., Kantzoura, V., Hoey, E.M., et al., 2007. Evidence for multiple mitochondrial lineages of Fasciola hepatica (liver fluke) within infrapopulations from cattle and sheep. Parasitol. Res. 101, 117–125.

146


Watanabe, S., 1962. Fascioliasis of ruminants in Japan. Bull. Off. Int. Epizoot 58, 313–322. Webb, S.D., Taylor, B.E., 1980. The phylogeny of hornless ruminants and a description of the cranium of Archaeomeryx. Bull. Am. Museum Nat. Hist. 167, 117–158. Wells, L., Allison, M.J., Gerszten, E., 2003. Helminthic diseases in the liver in ancient cultures. In: 26th Scientific Session of the Paleopathology Club in conjunction with the United States and Canadian Academy of Pathology. Washington D.C., United States, Newsletter No. 93. Available online at: http://views.vcu.edu/pat/research/paleo/(last accessed 27 March 2009). World Health Organization, 1991. Basic Laboratory Methods in Medical Parasitology. World Health Organization, Geneva, Switzerland. World Health Organization, 1995. Control of foodborne trematode infections. World Health Organ. Tech. Rep. Ser. 849, 1–157. World Health Organization, 2007. Report of the WHO Informal Meeting on use of Triclabendazole in Fascioliasis Control. World Health Organization, Geneva, Switzerland. Wright, J.D., Miller, K.G., 1993. Southern Ocean influences on Late Eocene to Miocene deepwater circulation. In: Kennet, Warnke (Eds.), The Antarctic Paleoenvironment: A Perspective on Global Change, American Geophysical Union, Washington, DC, pp. 1–25. Yadav, S.C., Sharma, R.L., Kalicharan, A., Mehra, U.R., Dass, R.S., Verma, A.K., 1999. Primary experimental infection of riverine buffaloes with Fasciola gigantica. Vet. Parasitol. 82, 285–296. Yamaguti, S., 1971. Synopsis of Digenetic Trematodes of Vertebrates, Vol. 1 and 2. Keigaku Publishing Co, Tokyo, Japan. Yilma, J.M., Malone, J.B., 1998. A geographic information system forecast model for strategic control of fascioliasis in Ethiopia. Vet. Parasitol. 78, 103–127. Zachos, J., Pagani, M., Sloan, L., Thomas, E., Billups, K., 2001. Trends, rhythms, and aberrations in global climate 65 ma to present. Science 292, 686–693. Zhang, W., Moreau, E., Huang, W., Chauvin, A., 2004. Comparison of humoral response to Fasciola hepatica and Fasciola gigantica experimental infection in sheep. Parasite 11, 153–159. Zhou, P., Chen, N., Zhang, R.L., Li, R.Q., Zhu, X.Q., 2008. Food-borne parasitic zoonoses in China: Perspective for control. Trends Parasitol. 24, 190–196. Zhou, X.N., Lin, D.D., Yang, H.M., Chen, H.G., Sun, L.P., Yang, G.J., et al., 2002. Use of Landsat TM satellite surveillance data to measure the impact of the 1998 flood on snail intermediate host dispersal in the lower Yangtze River basin. Acta Trop. 82, 199–205. Zilch, A., 1959. Gastropoda (Euthyneura). In: Schindewolf (Ed.), Handbuch der Paleozoologie, Borntraeger, Berlin, Germany, vol. 6, 91–102.

CHAPTER

3 Recent Advances in the Biology of Echinostomes Rafael Toledo,* Jose´-Guillermo Esteban,* and Bernard Fried†

148 149 149 162 168 168 173 178 192 192

Contents

3.1. Introduction 3.2. General Information on Echinostomes 3.2.1. Lifecycle and development 3.2.2. Current taxonomy 3.3. Host–Parasite Relationships 3.3.1. In the first intermediate host 3.3.2. In the second intermediate host 3.3.3. In the definitive host Acknowledgments References

Abstract

This chapter examines the significant literature on the biology of echinostomes. The members of the family Echinostomatidae are medically and veterinary-important parasitic flatworms that invade humans, domestic animals and wildlife and also parasitize in their larval stages numerous invertebrate and cold-blooded vertebrate hosts. All echinostomes possess a complicated lifecycle expressed by: (i) alternation of seven generations known as the adult, egg, miracidium, sporocyst, redia, cercaria and metacercaria, and (ii) inclusion of three host categories known as the definitive host and first and second intermediate hosts. Moreover, echinostomes have served as experimental models in parasitology at all levels of organization. We discuss recent advances in several areas

* Departamento de Parasitologıá, Facultad de Farmacia, Universidad de Valencia, 46100 Burjassot, {

Valencia, Spain Department of Biology, Lafayette College, Easton, PA 18042, USA


#


147

148

Rafael Toledo et al.

of the biological sciences that feature studies on echinostomes. Initially, we consider aspects of the lifecycle, development and systematics of selected members of the Echinostomatidae. We then highlight host–parasite interactions between echinostomes and their intermediate and definitive hosts with emphasis on the application of novel techniques to these topics.

3.1. INTRODUCTION Echinostomes are cosmopolitan intestinal parasitic flatworms that invade humans, domestic animals and wildlife, and also parasitize, in their larval stages, numerous invertebrate and cold-blooded vertebrate hosts. Interest in echinostomes in parasitology comes from a variety of topics, such as systematics, human parasitology and the effects of parasites on wild populations of anurans. Species of Echinostomatidae exhibit a substantial taxonomic diversity (91 nominal genera have been described) and are associated with a broad range of final hosts; these species also have a wide geographical distribution. The systematics of echinostomes have long been problematical because of both the inter-specific homogeneity of characters to differentiate species and the poor differential diagnoses of newly established taxa (Kostadinova and Gibson, 2000). Consequently, this group of digeneans has been the subject of continuous systematic revisions that have added new species and/or synonymized others (Toledo et al., 2000). Their taxonomic identification, however, is still in a confused state. Recent systematic approaches, using molecular information, are providing new light on the taxonomy of this group. Human echinostomiasis is endemic in South-east Asia and the Far East and there are about 20 species belonging to eight genera of Echinostomatidae involved in human disease. The prevalence of human infection ranges from 65% in Taiwan and 44% in the Philippines to 5% in mainland China and from 50% in Northern Thailand to 20% in Korea (Fried et al., 2004a). Trematode infections of anurans have been the subject of increasing interest in recent years. These observations have raised concerns about the importance of echinostome infections in determining the survival of tadpoles and their subsequent recruitment into frog populations. As will be discussed later, a number of recent papers have investigated this topic in detail. Apart from their interest in general parasitology, echinostomes have been extensively used as experimental models. The lifecycle of echinostomes is easy to maintain in the laboratory as larval and adult worm stages and they have been used as models at all levels of organization, from the molecular to the community. There is not a single area of experimental parasitology where echinostomes are not represented, and

Recent Advances in the Biology of Echinostomes

149

a number of recent findings using echinostomes as models may be important for present and future developments in parasitology, particularly in the study of host–parasite relationships (Toledo and Fried, 2005; Toledo et al., 2007). Furthermore, the application of novel techniques is moving the echinostomes to the front line of parasitology in fields such as systematics, vertebrate and invertebrate immunobiology, proteomics and other areas. However, the biological characteristics of echinostomes indicate that further use of these trematodes as experimental models may enable us to increase our knowledge of various aspects of host–parasite relationships. The purpose of this chapter is to examine the most salient literature in relation to different aspects of the biology of echinostomes. Emphasis is placed on the application of novel techniques in the field of echinostome biology and use of these digeneans in the analysis of host–parasite relationships. Most of the literature cited in this review pertains to members of the genus Echinostoma, particularly those species in the ‘revolutum’ group; however, we refer to the literature on other members of the Echinostomatidae as needed.

3.2. GENERAL INFORMATION ON ECHINOSTOMES 3.2.1. Lifecycle and development Echinostomes possess a complicated lifecycle expressed by: (i) alternation of seven generations known as the adult, egg, miracidium, sporocyst, redia, cercaria and metacercaria; and (ii) inclusion of three host categories known as the definitive (final) host, and first and second intermediate hosts (Fig. 3.1). Final hosts are vertebrate animals in which the adult worms develop. First intermediate hosts are freshwater and marine snails where sporocysts, rediae and cercariae develop. Second intermediate hosts are invertebrates and some amphibian vertebrates in which metacercariae develop (Esteban and Munõz-Antoli, 2009; Huffman and Fried, 1990; Kanev et al., 2000). In the wild, the lifecycle is maintained when avian and mammal hosts release eggs with their stools into lakes, farm ponds and streams. The fertilized eggs are undeveloped when laid and take about 2–3 weeks at 22 C to reach the fully developed miracidial stage. Miracidia hatch from eggs and actively locate the first intermediate snails host in response to host signals and emitted products (Haas et al., 1995a; Haberl et al., 2000). Several species of planorbids, lymnaeids and bulinids have been recorded as first intermediate hosts of echinostomes. Miracidia usually enter the head foot region of the snail, shed their ciliated plates and transform into sporocysts in the heart. Shortly after larval entry, the primary germinal


st ho ve iti fin

infe

cti o

no

ft he

(a)

Water

fir st i

nt e

(b)

st ho

Ing

te ia

es tio

n

de

Act ive

Definitive host

ed rm

by

150

(c)

(d) (h) (e) Second intermediate host

(f) First intermediate host

Water (g)

Act

ive in

fectio n

of the second intermedia

o te h

st

FIGURE 3.1 Generalized lifecycle of Echinostoma spp. Note: (a) adult worms that inhabit the small intestine of several vertebrates hosts, including humans. (b) Eggs are voided with the host faeces. (c) Miracidia hatch in fresh water and actively infect snails. (d) sporocysts, (e) mother rediae and (f) daughter rediae are the intra-molluscan stages. (g) Cercariae are released and swim to locate the second intermediate host (snails, amphibians, bivalves, fishes) in which they encyst to become metacercariae. (h) Metacercariae are ingested by the definitive host and excyst to become adults. Reproduced, with permission, from Toledo and Fried, 2005.

cells of the sporocyst start to develop into mother rediae (Ataev et al., 1997). Mother rediae initially reside within the ventricle and aorta of the snail, although when these sites became filled, these rediae begin to colonize the ovotestis of the snail (Ataev et al., 1997). Mother rediae reproduce asexually and produce daughter rediae that develop in the digestive gland–ovotestis complex. Cercariae begin to emerge from infected snails 4–6 weeks post-infection (wpi). Echinostome cercariae show a low degree of host specificity and several species of snails, frogs, tadpoles, and fish may serve as second intermediate host. The free-living cercariae respond to environmental cues and locate their second intermediate host by chemical signals emitted from the host (Haas, 1994; Haas et al., 1995b; Ko¨rner and Haas, 1998a,b; Munõz-Antoli et al., 2003). Cercariae enter the cloacal opening of a tadpole or the excretory pore of a snail and encyst mainly in the tadpole kidney and kidney/pericadial cavity of the snails (Anderson and Fried, 1987; Fried et al., 1997a,b;


151

Toledo et al., 1999a). Moreover, metacercariae may be found in the foot, mantle cavity and body surface of snails (Anderson and Fried, 1987). Definitive hosts become infected after ingestion of the second intermediate host harbouring encysted metacercariae. Echinostomes do not undergo tissue migration in the definitive host. Following infection of the definitive host, the metacercariae excyst in the duodenum and the juvenile parasites migrate to the small intestine where they attach to the mucosa by the ventral sucker (Fried and Huffman, 1996). Numerous vertebrates, including humans (Chai, 2009; Fried et al., 2004a; Graczyk and Fried, 1998), can serve as definitive hosts for echinostomes. The release of eggs from the definitive host starts at 10–16 days post-infection. Although the release of eggs is continuous from the first day of the patent period, significant variations over the course of the infections in egg output have been documented (Toledo et al., 2003a).

3.2.1.1. Eggs and miracidia The eggs of echinostome when laid consist of a fertilized ovum surrounded by yolk granules. It is typically oval in shape, variable in size, and yellow, dark brown or silver white in colour. It has an operculum at one end and a distinct knob at the abopercular end (Kanev et al., 2000). Embryonation occurs in an aquatic environment (Fig. 3.2A). Specific differences in relation to size and the aboperculun region can be detected. Eggshell structures appear to be uniform between echinostome species (Fujino et al., 2000). The miracidium of echinostomes is of about 100 mm in length, broad anteriorly and tapering posteriorly to a blunt end. The tegument is ciliated and possesses a variable number of ciliated epidermal plates and argentophilic papillae with a particular arrangement. Retractile apical papillae followed by a pyriform gland have been described. Two dark eye spots, consisting of two pairs of pigmented bodies are located at both sides (Esteban and Munõz-Antoli, 2009; Kanev et al., 2000). Pinheiro et al. (2004) described the morphology and topography of Echinostoma paraensei miracidium. A total of 19 papilla-like structures are arranged in three axes and four groups are observed at the terebratorium. This number and arrangement of the papilla-like structures are different from those observed in Echinostoma trivolvis, E. jurini and E. caproni. The ultra-structural organization of E. paraensei miracidium has been described in detail by Pinheiro et al. (2005). A number of secretory, germinal and undifferentiated cells are located in the posterior body of the miracidium. Undifferentiated cells develop into germinal cells that can also divide to produce embryos and, finally, give rise to progeny. Specific differences in the intra-molluscan stages have been observed in relation to the germinal cells (Ataev et al., 2001). The hatching of miracidia is mediated by different factors, with light the major stimulus, though the effect appears to be different in each species.

152


FIGURE 3.2 Embryonated egg (A) and sporocyst in ventricle of snail (B) of Echinostoma friedi. Notes: A: egg observed between slide and cover-slip; B: fixed in Bouin’s fluid under cover-slip pressure, stained with Grenacher’s borax carmine, mounted in Canada balsam, and observed with interference contrast microscopy. Scale bars: A, 30 mm; B, 100 mm.

Whereas E. paraensei and E. caproni hatch in a strict diurnal pattern between 11.00 and 16.00 hours, E. trivolvis does not show a daily pattern. Maldonado et al. (2001) observed that E. paraensei miracidia hatched after 10 days of incubation in the dark and a quick 1-h exposure to incandescent light. The effect of snail-conditioned water from Biomphalaria glabrata on hatching rates of E. caproni was studied by Fried and Reddy (1999). A significantly greater rate of hatching was observed when snails were maintained in the snail-conditioned water. After hatching, the miracidia swim and respond to environmental stimuli such as light and gravity. The miracidia of E. caproni and E. trivolvis showed a negative geotaxis and positive phototaxis. In contrast, E. paraensei did not show geo-orientation and only weak photo-orientation (Esteban and MunõzAntoli, 2009). Echinostome miracidia find and invade the first intermediate host. The chemical host signals for identification of the host by miracidia are still not well understood. There is evidence that miracidia of echinostomatids can distinguish between different snail species (Toledo et al., 1999b). Moreover, it is known that echinostome miracidia can detect and utilize macromolecular components that diffuse from surface


153

mucus covering snails to locate the potential host snails in the aquatic environment (Haas et al., 1995a; Haberl et al., 2000). However, this chemotaxis does not appear to operate in a specific manner. In this sense, there are several evidences. First, it has been shown that the presence of molecules emitted by non-host snails may induce a significant decoy effect on E. friedi (Munõz-Antoli et al., 2003). Second, E. caproni miracidia were not able to distinguish among products emitted by different snail species (Haberl et al., 2000). Third, Sapp and Loker (2000a, 2000b) compared the miracidial attachment of E. caproni and E. trivolvis by arranging encounters with host and non-host snail species (B. glabrata, Helisoma trivolvis, Lymnaea staganalis, Stagnicola elodes and Helix aspersa). Miracidia attached and attempted penetration in both compatible and noncompatible hosts. However, higher penetration rates of host species was observed when assessing the number of miracidia achieving snail penetration (Sapp and Loker, 2000a,b). All these facts suggest that echinostome miracidia do not discriminate between compatible and non-compatible snails in the host-finding processes and numerous events (i.e. penetration and/or interaction with the host internal milieu and the host immune response) play a major role in the establishment. The infectivity of the echinostome miracidia depends on several factors. Munõz-Antoli et al. (2000) showed the existence of a pre-infective period in the miracidia of Hypoderaeum conoideum immediately after hatching. This period may be related to the maturation of mechanisms involved in the infection of the snail and may facilitate miracidial dispersion. In contrast, E. friedi did not show a pre-infective period, probably in relation to the low specificity shown by this miracidial species (Munõz-Antoli et al., 2002). Toledo et al. (2004a) found that the age of adult worms from which miracidia were derived influenced the miracidial infectivity of E. friedi. Infective miracidia only were obtained from adults in the worm age range from 4 to 9 weeks. These authors suggested that adult worms producing viable eggs require additional maturation to yield eggs containing infective miracidia. In contrast, infectivity of E. caproni did not show differences in relation to adult worm age (Fried and Bandstra, 2005). Although it was suggested that each species of echinostome infects only one or few closely related snail species (Kanev, 1994; Kanev et al., 1995a,b), recent studies have shown that the spectrum of first intermediate host species for each echinostome species may be broader than previously expected (Kostadinova et al., 2000; Munõz-Antoli et al., 2006; Toledo et al., 2000). Maldonado et al. (2001) infected three sympatric snail species belonging to Planorbidae (B. glabrata), Physidae (Physa marmorata) and Lymnaeidae (Lymnaea columnella), with a Brazilian isolate of E. paraensei. Recently, Munõz-Antoli et al. (2006) showed that E. friedi miracidia are able to infect and develop in snail species belonging to three different families and different geographical origins.

154


3.2.1.2. Sporocysts and rediae Sporocysts and rediae are the parasitic stages in the first intermediate host and they are formed after miracidial infection and transformation. Miracidia usually enter via the head-foot region of the snail, shed their ciliated plates and transform into sporocysts at the site of penetration, typically the mantle collar, the foot and head covering, the mantle cavity, and the oral cavity. The sporocysts are sac-like structures, about 100 mm long (Fig. 3.2B), that produce rediae after 5–8 days (Kanev et al., 2000). The ventricle and the aorta are the final sites of infection after migration (Esteban and Munõz-Antoli, 2009). The behaviour patterns and the host cues for the site finding remain unknown, though sporocysts appear to be able to recognize these sites (Haas, 2000). During E. caproni sporocyst development, every primary germinal cell gives rise to a redial embryo, whereas undifferentiated cells give rise to both somatic and secondary generative cells. Each sporocyst produces about 15 rediae of first generation (mother rediae). Development of the E. caproni sporocyst consists of five developmental stages: (i) resting; (ii) migration; (iii) growth; (iv) reproduction and (v) degeneration (Ataev et al., 1997). Echinostome mother rediae are elongate structures with an anterior mouth, pharynx, sac-like gut, a tegumentary collar-like structure at the anterior end and two posteriorly located ambulatory buds (Fig. 3.3A)

FIGURE 3.3 Echinostoma friedi. Notes: A, anterior third region of the second-generation redia; B, cercaria. A, fixed in Bouin’s fluid under cover-slip pressure, stained with Grenacher’s borax carmine, mounted in Canada balsam, and observed with interference contrast microscopy; B, scanning electron micrograph. Scale bars: A, B, 100 mm.


155

(Esteban and Munõz-Antoli, 2009). Sebelova´ et al. (2004) investigated the musculature and associated innervations of E. caproni rediae and detected a somatic and pharyngeal muscle and a well-developed muscular body comprising a mesh of numerous well-organized outer circular fibres and fewer, but thicker, inner longitudinal fibres. The neuroactive elements were mainly restricted to the central nervous system, comprising a bi-lobed cerebral ganglion or brain, and paired longitudinal nerve cords. Rediae initially reside within the ventricle and aorta of the snail; they begin to colonize the ovotestis when the ventricle and aorta become filled. The mother rediae produce a second generation of rediae called daughter rediae. Initially, daughter rediae produce redoid embryos, forming later cercariae. The germinal masses in the sporocysts are responsible for multiplication and development of generative elements in all generations (Ataev et al., 2005, 2006). In the case of Echinostoma paraensei, the development of a so-called precocious mother redia has been observed under laboratory conditions (Sapp et al., 1998). This precocious mother redia attaches to the ventricle and remains with the sporocyst for 31 days or more. This developmental stage has not been observed in other echinostome species; the presence of this precocious mother redia reduces the success rate of subsequent E. paraensei sporocysts in establishing in the ventricle of the snail host (Sapp et al., 1998). Although the events occurring after the miracidium–host encounter are of great importance to determine the success of the infection, little is known about the physiological interactions between echinostomes and their snail first intermediate hosts. Echinostomes exploit host internal milieu, which depends on complex physiological conditions including the availability of nutriments as well as physico-chemical parameters. Digeneans utilize carbohydrates as an energy source and also take up free amino acids from host haemolymph (Cheng, 1968). Fried and Amatrawani (1992) reported that daughter rediae of E. trivolvis are haematophagous and also noted the presence of a black particulate matter in the gut derived from haemoglobin degradation. Pinheiro et al. (2004) detected the presence of mitochondria and secretory bodies in the outer syncytium, suggesting that this tegument plays a major role in nutrient absorption of E. paraensei. Pisciotta et al. (2005) reported that E. trivolvis daughter rediae produced haemozoin crystals within the snail host, H. trivolvis. In contrast, E. caproni did not produce this pigment though its snail host, B. glabrata, utilizes haemoglobin. It is known that physico-chemical differences exist in the internal milieu of molluscs and that the physiological requirements of different digeneans may vary. However, there is no current evidence for the notion that such parameters are of importance in determining the parasite–host specificity and the success of echinostome infections. In contrast, there is evidence to suggest that the importance of physiological parameters for

156


intra-molluscan development of digeneans is limited (reviewed by Coustau et al., 2009). Several so-called ‘co-cultivation studies’ have investigated the ability of digeneans to develop under in vitro conditions (Ataev et al., 1998; Coustau and Yoshino, 2000; Coustau et al., 1997, 2009; Yoshino and Laursen, 1995). These studies revealed that advanced development of intra-molluscan larvae was achieved in the presence of B. glabrata embryonic (Bge) cells regardless of the phylogenetical distance separating B. glabrata from their natural host species. In this context, the success or failure of an echinostome infection appears to depend largely on immunobiological interaction as will be discussed below.

3.2.1.3. Cercariae The echinostome cercaria is typically distomate, gymnocephalous with an oral collar containing spines and a simple tail (Fig. 3.3B). The main excretory ducts of the excretory system are simple and short, containing a large number of excretory granules. The cercarial tail of most Echinostoma spp. has fin-fold structures. Moreover, there are a number of morphological features that are of importance in the diagnosis, such as the number and arrangement of flame cells, para-oesophageal and penetration glands and the tegumentary papillae (Kanev, 1994; Kanev et al., 1995a,b, 2000; Kostadinova, 1999; Nakano et al., 2003; Toledo et al., 1998a,b). The general morphology of the echinostome cercariae has been reviewed by Kanev et al. (2000). The free-swimming cercariae escape from their first intermediate host 4–6 wpi. The cercarial emergence patterns have been little studied (Maldonado et al., 2001; McCarthy, 1999a; Schmidt and Fried, 1996; Toledo et al., 2000). In general, the cercariae emerge in the light and the rhythm is circadian. This rhythm is synchronized mainly by the light– dark cycles as shown in experiments with changed light–dark cycles (Toledo et al., 1999c). Echinostome cercariae swim to infect the second intermediate host. The specificity of echinostomes towards this host is low and numerous species of snails, clams, tadpoles, frogs and fish, other invertebrates, and even products such as snail’s mucus may serve as second intermediate host (Huffman and Fried, 1990; Keeler and Huffman, 2009). In 2005, an ecto-symbiotic flatworm, Temnocephala chilensis, was found naturally infected with metacercariae of Echinoparyphium megacirrus (Viozzi et al., 2005). Echinostome cercariae use different cues to identify their host than do the miracidia. Cercariae respond non-specifically to low-molecularweight host-emitted signals (Haberl et al., 2000). This response appears to be more related to the total amount of host-emitted amino acids than to the composition of the products emitted (Haas et al., 1995b; Haberl et al., 2000; Ko¨rner and Haas, 1998a,b). Cercariae do not differentiate between the products emitted by different snail species, fish or tadpoles if the


157

amino acids are adjusted to the same total concentration (Haberl et al., 2000). This may be related to the low degree of specificity shown by the cercariae. The composition of a snail community may be of importance to determine the cercarial transmission. Studies on Euparyphium albuferensis and E. friedi cercarial infectivity towards different snail communities composed of combinations of up to four sympatric snail species showed that high densities of low compatible hosts reduced the level of parasite transmission. In contrast, the presence of gastropods of high compatibility contributes to an increase in the susceptibility of low-compatible snails (Munõz-Antoli et al., 2008). The cercariae are short-lived and rarely survive beyond 48 h. Temperature appears to be the major factor determining the cercarial survival, probably in relation to a higher glucose consumption (McCarthy, 1999b; Toledo et al., 1999d). In fact, addition of glucose to artificial spring water extended the survival time of E. caproni and E. trivolvis (Fried et al., 1998; Pechenik and Fried, 1995; Ponder and Fried, 2004). The infectivity of echinostome cercariae is markedly age dependent (Munõz-Antoli et al., 2002; Toledo et al., 1999d). The infectivity gradually increases during the first few hours after emergence, reaching a peak after a prior period of aging. The existence of this pre-infective period may represent a dispersal phase that aids cercarial dissemination, thus reducing super-infection and parasite-associated mortality of the first intermediate host (Munõz-Antoli et al., 2002; Toledo et al., 1999d). The survival and infectivity of echinostome cercariae may also be influenced by the presence of pollutants in the aquatic environment. Evans (1982) and Morley et al. (2002) studied the toxic effects of copper and zinc, and cadmium and zinc on the transmission of Echinoparyphium recurvatum cercariae. The exposure of different snail species caused a differential susceptibility to E. recurvatum cercariae. Reddy et al. (2004) investigated the effects of copper on cercariae of E. caproni and E. trivolvis, as well as on the survival of B. glabrata, and suggested that copper sulphate, used in concentrations sufficient to kill juvenile snails was also sufficient to eliminate the cercariae of both echinostomes. Koprivnicar et al. (2006) analyzed the effects of the herbicide Atrazine on longevity, activity and infectivity of E. trivolvis cercariae, and observed that the viability of the cercariae was compromised by the exposure to the herbicide.

3.2.1.4. Metacercariae Mechanisms of encystment either in vivo or in vitro for species of Echinostomatidae are not well understood. Cercariae of Echinostomatidae contain a complex array of tegumentary papillae and a complicated neuromusculature. Additionally, cystogenous glands are present

158


FIGURE 3.4 Metacercariae of Echinostoma friedi (A) and Euparyphium albuferensis (B) observed between slide and cover-slip with interference contrast microscopy. Notes: Scale bars: A, B, 50 mm.

throughout the cercarial body (Fig. 3.4) (Fried and Fujino, 1987; Humphries et al., 2000; Sebelova´ et al., 2004; Toledo et al., 2000). Co-ordination of the sensory, nervous and muscular systems with the cystogenous gland network seems to be involved in cercarial encystment (Keeler and Huffman, 2009). The echinostome cyst is transparent and contains two or three cyst walls (Keeler and Huffman, 2009). Most echinostomes have an outer cyst wall, which may be smooth or rough in appearance and often has been associated with host-derived collagen fibres (Keeler and Huffman, 2009). The cyst shape varies between the echinostome species from spherical (i.e. Echinoparyphium spp. and Echinostoma spp.) to oval (i.e. Echinochasmus spp.) and elliptical (i.e. Himasthla spp.) (Kanev et al., 2000; Keeler and Huffman, 2009). The diameter of the cysts ranges from 100 to 400 mm (Kanev et al., 2000). The larva within the cyst is transparent in viable organisms and excretory concretions and cephalic spines are visible. Further morphological details of echinostome metacercariae have been recently reviewed by Keeler and Huffman (2009). Echinostome cercariae enter via the cloacal opening of a tadpole or excretory pore of a snail and encyst mainly in the kidneys and gonads of tadpoles and in the kidney/pericardial cavity of snails (Anderson and


159

Fried, 1987; Fried et al., 1987; Keeler and Huffman, 2009; Toledo et al., 1999a). Moreover, metacercariae may be found in the foot, mantle cavity and body surface of snails (Anderson and Fried, 1987). In bivalves, the cercariae have preference for the gills, gonads, and the skin (Laruelle et al., 2002) and for the skin, sub-tegument and musculature in fish (Keeler and Huffman, 2009). The factors determining the metacercarial site location remain unknown, though there are some factors that affect the site of encystment. Morley et al. (2004) showed that encystment of E. recurvatum was restricted to the peripheral organs in smaller specimens of Lymnaea peregra, but as snails increased in size metacercariae were distributed throughout the tissues. Morley et al. (2007) investigated the effect of temperature on the encystment site of E. recurvatum in L. peregra. Temperatures at the lower and the upper ranges (14 and 29 C) caused a significant reduction in encystment in the mantle cavity but not in the pericardium or the kidney. Metacercariae of some echinostomes become infective to the definitive host within 4 h of encystment in the second intermediate host, and others require a longer period (from 7 to 20 days) of maturation to be infective (Esteban and Munõz-Antoli, 2009; Keeler and Huffman, 2009). Cysts may remain viable within the second intermediate host for months. Survival of E. caproni and E. trivolvis reached 4 and 6 months within a planorbid intermediate host, respectively (Esteban and Munõz-Antoli, 2009). Increasing attention is being paid to the anurans as second intermediate hosts of echinostomes. Thiemann and Wassersurg (2000a) examined the distribution of echinostomatid metacercariae in Rana sylvatica and R. clamitans tadpoles. There was a significant left:right bias in the distribution of metacercariae, with trematodes preferentially encysting in nephric structures in the right side. Trematodes preferentially encysted in the head kidneys of R. clamitans, which regress at metamorphosis. Despite the preference to encyst in the head kidney, there was no correlation between the number of cysts in the right kidney and the number in the right head kidney. This suggests that limited space in the head kidney does not influence metacercarial formation in the kidney proper. The high frequency of unilateral encystment may be the result of a co-evolved relationship that ultimately benefits both the host and parasite by ensuring host survival (Thiemann and Wassersurg, 2000a).

3.2.1.5. Adults The definitive hosts of echinostomes are vertebrates that become infected when they ingest the second intermediate host harbouring the metacercariae. Within the definitive host, metacercariae excyst usually in the ileum and the newly emerged juveniles establish in the intestine within 4 h. The excysted metacercariae gradually mature into adults

160


FIGURE 3.5 Low-magnification scanning electron micrographs of the forebody of an adult worm of Echinostoma caproni collected from hamster at 4 weeks post-infection showing the spined collar. Note: Scale bar, 200 mm.

(Esteban and Munõz-Antoli, 2009; Toledo, 2008a). The main characteristic feature of the adult worms of echinostomes is the presence of a circumoral collar armed with one or two crowns of spines (Fig. 3.5). Other morphological features of echinostomes have been summarized by Kanev et al. (2000) and Fried (2001). For adult echinostomes, the main factor influencing the host specificity is host behaviour, particularly the feeding habits. The broad host specificity of echinostomes towards the definitive host appears to be the result of phylogenetic, physiological and ecological accommodations between the parasite and the host in an evolutionary process (Fried and Huffman, 1996; Graczyk, 2000; Huffman and Fried, 1990; Toledo, 2008a). Echinostomes have been reported in a wide range of species of birds, and domestic and wild mammals such as rodents, pigs, dogs and foxes, and also in humans. Huffman (2000) and Esteban and Munõz-Antoli (2008) listed in detail the natural and experimental definitive hosts for the major species of Echinostoma. The course of an infection with a single species of echinostome largely depends on host-related factors (Toledo and Fried, 2005). In highly compatible hosts, echinostome infections become chronic, whereas the worms are rapidly expelled in low compatible hosts. Furthermore, infections in hosts of high compatibility are characterized by a higher egg release and greater worm growth than in low compatible hosts (Balfour et al., 2001; Munõz-Antoli et al., 2004, 2007; Stillson and Platt, 2007; Toledo and Fried, 2005; Toledo et al., 2004b). Moreover, host strain-related differences in the


161

course of the infection have been observed in Echinostoma hortense (Lee et al., 2004). This suggests that susceptibility to echinostome infections is dependent on the genetic and immunological background of the host. The stage of the echinostomes in the definitive host includes a number of processes such as metacercarial excystment, establishment, habitat selection, adult development, mating and release of eggs. Echinostome infections begin with the excystation of the metacercariae in the digestive tract of the definitive host. Much is known about the activation and the excystment of metacercariae (Fried, 1994, 2000). During excystation, the organism breaches the lamellated layer to disrupt the outer cyst finally. Different host cues, such as pH, bile components, carbon dioxide and various enzymes stimulate the metacercarial encystment (Fried, 1994; Toledo, 2009a). After excystation, several factors may influence the parasite establishment. Fried et al. (2004b) observed that acidic pepsin environment of a definitive host would be detrimental to the survival of the excysted metacercariae of E. caproni, but prolonged survival in alkaline trypsin-bile salts (TBs) would facilitate establishment in the mucosa of host small intestine. Furthermore, Fried et al. (2004b) demonstrated in an in vitro experiment that the addition of exogenous glucose to the incubation medium increased the survival of the excysted metacercariae, probably in relation to the use of the glucose as energy source by the juvenile worms. Echinostoma spp. remain as browsers in the intestine of the definitive host. However, relatively few studies have considered how echinostomes select their habitat. In fact, it is not known what mechanisms and host cues govern this orientation. It is well established that echinostomes have specific niches within the small intestine of the definitive host. Echinostomes are typically dispersed in the initial phases of the infection (Nollen, 1996a,b) and, thereafter, they become confined to a small area of the intestine. Reviews by Huffman and Fried (1990) and Fried and Huffman (1996) reported the distribution of E. trivolvis and E. caproni in avian hosts. E. trivolvis occupies numerous sites in the intestine of chicks, such as the ileum, rectum, cloaca, caecum and the bursa of Fabricius. In ducks (Anas platyrhynchus), E. trivolvis was located in the cloaca and lower ileum (Mucha et al., 1990). E. caproni infects the mid third of the intestine of chicks, between the gizzard and the cloaca (Huffman, 2000). The distribution of several species of echinostomes in the intestine of rodents also has been well established. E. caproni and E. paraensei show great specificity for the ileum and duodenum, respectively (Odaibo et al., 1988, 1989; Toledo, 2009a; Yao et al., 1991). E. trivolvis can be clustered but spread along the entire intestine tract (Hosier and Fried, 1986) and E. friedi occupies the jejunum (Toledo et al., 2000).

162


As mentioned above, the course of echinostome infections is host dependent. This has been studied in detail in several rodent species (Toledo and Fried, 2005). Hamsters and mice are considered as highly compatible with E. caproni. The rates of infection of E. caproni in both host species are almost 100% (Balfour et al., 2001; Fried and Peoples, 2008; Munõz-Antoli et al., 2007; Toledo et al., 2004b) and the worm recovery is high. Moreover, E. caproni induces chronic infections that may reach up to 23 wpi (Fried and Peoples, 2008; Munõz-Antoli et al., 2007; Toledo et al., 2004b). In contrast, rats are considered hosts of low compatibility with E. caproni (Toledo and Fried, 2005). E. caproni infections in rats are characterized by a low worm recovery and worm expulsion at 7–8 wpi (Toledo et al., 2004b). In the case of E. trivolvis, the compatibility with hamsters is greater than with mice. Infection in hamsters is characterized by a 100% of infection and longer worm survival (17 wpi) than in mice (4 wpi) (Franco et al., 1986; Hosier and Fried, 1986). E. friedi shows a higher degree of compatibility with hamsters than with rats. The rate of infection in rats (48%) is significantly lower than in hamsters (100%) (Munõz-Antoli et al., 2004; Toledo et al., 2003a, 2006a). Moreover, the infection is expelled at 4 wpi in rats, whereas the longevity of the worms in hamsters is of at least 12 wpi (Toledo et al., 2003a).

3.2.2. Current taxonomy The echinostomes and, particularly, the members of the genus Echinostoma, constitute a group of digeneans characterized by a long history of confusion regarding their systematics. This is attributable to both the inter-specific heterogeneicity and the poor differential diagnosis of newly established taxa, together with historical nomenclatural problems (Kostadinova and Gibson, 2000). As a consequence, a large number of species have been described within this group with no reliable morphological characters enabling species distinction. Consequently, the genus Echinostoma has been the subject of continuous revisions that have added new species and/or synonymized others (e.g. see Beaver, 1937; Fried and Graczyk, 2004; Iskova, 1985; Kanev, 1994; Kanev et al., 1995a,b; Kostadinova et al., 2000, 2003; Toledo et al., 2000). Although much progress has been made in recent years, the systematics of this genus still remains in a confused state. Recent studies have demonstrated that molecular analysis may improve our understanding on this topic. However, such analysis is also subject to similar problems associated to the morphological study (Fried and Toledo, 2004). In the present section, we briefly review the current status of the systematics of Echinostoma, with emphasis on the 37-collar spined group or ‘revolutum’ group. We will focus on the factors leading to the confused status of the taxonomy of this group.


163

3.2.2.1. Biodiversity The genus Echinostoma has became rather complex and includes a large number of morphologically similar species. More than 120 nominal species have been described within this genus (Kostadinova and Gibson, 2000). However, a critical examination of the literature suggests that Echinostoma is characterized by a long history of inadequate and/or specific diagnosis, extensive synonymy and nomenclatural problems (Kostadinova and Gibson, 2000). Loss of type materials, its inaccessibility or, simply, the non-existence further complicate this situation. All these problems make it difficult to ascertain the number of valid species in the ‘revolutum’ group. A large number of morphologically similar species have been described within this group. Beaver (1937) was the first to suggest the hypothesis of polymorphism of the species, which he identified as E. revolutum, the type species of Echinostoma. From the 20 species in the ‘revolutum’ group, he considered nine as synonyms of E. revolutum, and the remainder were considered as species inquirienda. More than 20 other species possessing 37 collar spines have been thereafter added to the ‘revolutum’ group. The specific diagnosis is not straightforward because the existing data are confusing and even contradictory. As a consequence, great attention has been paid to clarify the systematics of this group. Iskova (1985) included five valid species from the Ukraine (E. revolutum, E. paraulum, E. miyagawai, E. robustum and E. nordiana) and presented a key based on the adult morphology. However, the utility of this key due to the absence of biological and ecological parameters, questionable significance of the discriminating features and geographical limitations. Probably, the most extensive attempt to clarify the systematic of the ‘revolutum’ group is that conducted by Kanev and co-workers (see Kanev, 1994; Kanev et al., 1995a,b and references therein). These authors considered only five valid species (E. revolutum, E. echinatum, E. trivolvis, E. caproni and E. jurini) that were mainly characterized on the basis of morphological features of the cercaria (number of pores and paraoesophageal glands), specificity towards the first intermediate host (at the familial level), the ability to infect mammals and/or birds, and the geographical distribution at continental level. However, recent studies have demonstrated that the conclusions of Kanev and co-workers were inconsistent and constitutes an over simplification of the real situation. Kostadinova et al. (2000) revised the diagnostic features proposed by Kanev and co-workers for distinguishing the species of the ‘revolutum’ group and concluded that these were not adequately studied or described. Furthermore, studies based on DNA sequences have demonstrated that the ‘revolutum’ group is composed of more than the five species suggested by Kanev and co-workers (discussed in more detail in

164


the Section 3.2.2.4) (Kostadinova et al., 2003; Morgan and Blair, 1995, 1998a,b; Sorensen et al., 1998). In this context, Kostadinova and Gibson (2000) considered eight valid species (E. revolutum, E. jurini, E. trivolvis, E. paraensei, E. caproni, E. miyagawai, E. parvocirrus and E. friedi) according to the current knowledge. Thereafter, two new species have been described within the ‘revolutum’ group: E. deserticum (Kechemir et al., 2002) and E. luisreyi (Maldonado et al., 2003). In summary, the composition of the ‘revolutum’ group is far from certain and further studies are needed on the morphology, ecology and DNA sequences to determine and classify the species of this group.

3.2.2.2. Biogeography Echinostomes are cosmopolitan parasites and members of Echinostomatidae have been cited worldwide. However, the geographical distribution of the species of Echinostomatidae is difficult to determine in relation to taxonomic problems of this group. This is particularly emphasized in the ‘revolutum’ group. Geographical distribution was considered as one of the most important diagnostic characters by Kanev and co-workers (see Kanev, 1994; Kanev et al., 1995a,b). These authors considered that the five species considered valid exhibit generally non-overlapping distribution pattern on a continental, with only two sympatric combinations (E. revolutum, E. echinatum and E. jurini in Europe; and E. echinatum, E. trivolvis and E. caproni in America). However, this distribution cannot be considered valid in relation to the problems entailed with the systematic classification of the ‘revolutum’ group by Kanev and co-workers. Moreover, a number of recent findings have provided evidence that constitutes a simplification. E. revolutum has been recorded in America (Sorensen et al., 1997, 1998), the validity of E. paraensei and E. miyagawai has been restored (Kostadinova and Gibson, 2000; Kostadinova et al., 2000) and new species have been described in Europe, the USA and Africa (Kechemir et al., 2002; Maldonado et al., 2003; Toledo et al., 2000). This shows a picture rather different from the earlier concept of the biogeography of the members of the ‘revolutum’ group. In Table 3.1, the geographical distribution of the species of the ‘revolutum’ group currently considered as valid is shown, together with other biological features.

3.2.2.3. Phylogeny Molecular analysis in the ‘revolutum’ group is in its infancy (Morgan and Blair, 2000). Only 474 DNA sequences are available in the databases (Marcilla, 2009), from which 358 correspond to the unique EST project in echinostomes performed with E. paraensei sporocysts RNA (Nowak and Loker, 2005). The remaining sequences mainly represent molecules used in taxonomy and/or phylogenetic studies, such as ribosomal

TABLE 3.1

Characteristic features of the 37-collar spined species of Echinostoma belonging to the ‘revolutum’ group

Echinostoma species

E. caproni

First intermediate hosts

E. jurini

Biomphalaria, Bulinus Bulinus Lymnaea, Radix, Gyraulus, Biomphalaria, Bulinus Viviparus

E. luisreyi

Physa

E. miyagawai

E. deserticum E. friedi

Second intermediate hosts

Definitive hosts

Geographical distribution

Freshwater gastropods, tadpoles Freshwater gastropods Freshwater gastropods

Birds, mammals

Africa, Madagascar

Birds, mammals Birds, mammals

Africa Europe

Molluscs, frogs, freshwater gastropods Freshwater gastropods

Mammals

Europe, Asia

Rodents

Freshwater gastropods

Birds, mammals

E. paraensei

Planorbis, Planorbarius, Anisus, Lymnaea Biomphalaria, Physa

Brazil (South America) Europe, Asia

Freshwater gastropods

Mammals

E. parvocirrus E. revolutum

Biomphalaria Lymnaea

Freshwater gastropods Freshwater gastropods, Bivalves, fish, tadpoles, freshwater turtles

Birds Birds

Brazil (South America) Guadeloupe Europe, Asia, North America (continued)

TABLE 3.1 (continued)

Echinostoma species

First intermediate hosts

E. trivolvis

Helisoma

Second intermediate hosts

Definitive hosts

Geographical distribution

Freshwater gastropod, pulmonate and prosobranch snails, mussels, planarians, tadpoles, fishes, amphibian larvae, freshwater turtles

Birds, mammals

North America


167

(rDNA) or mitochondrial molecules (mtDNA) (Marcilla, 2009). Most of the ribosomal molecules sequences correspond to internal transcribed spacers (ITS-1 and ITS-2) (with 13 species sequenced), 18S and 5.8S genes (10 species), and partial sequences of the 28S gene (11 species). With regards to mitochondrial markers, they include the sequences of the nicotinamide adenine dinucleotide dehydrogenase (NADH) sub-unit 1 (ND1) from 14 species and those of the cytochrome oxidase 1 (CO-1) from seven species (Marcilla, 2009). Regardless of these facts, the picture of the molecular analysis of the ‘revolutum’ group is too incomplete to provide criteria for species characterization and to make an approach of the phylogenetic relationships within the group. Moreover, molecular analysis is also subjected to the same taxonomic problems associated with this group (Fried and Toledo, 2004). For example, Kostadinova et al. (2003) showed that several available DNA sequences are based on specimens inadequately identified and there is no specimen available for morphological analysis. Morgan and Blair (1995) distinguished five species of Echinostoma using ITS sequences. They confirmed the identity of three African isolates of E. caproni and verified the distinct specific status of E. paraensei. However, these authors detected rather low inter-specific variability among rDNA sequences within the ‘revolutum’ group. Morgan and Blair (1998a) observed that Echinostoma spp. exhibit higher sequence divergence across mtDNA genes and the ND1 gene is more suitable marker for species in the group. Using this marker, Morgan and Blair (1998b) identified three isolates as strains of E. revolutum, one isolate as a strain of E. paraensei and other three unidentified species using the same materials than Morgan and Blair (1995). Although these facts are consistent with the hypothesis of the species boundaries by Kanev and co-workers, the results obtained by Sorensen et al. (1998) invoke uncertainty with respect to the materials used in previous studies. Sorensen et al. (1998) showed that rDNA sequence variation between isolates of E. revolutum and E. trivolvis is comparable to that observed between different species. Apart from other factors, these discrepancies may be the result of misidentification of the materials studied. These authors identified their materials on the basis of the criteria listed by Kanev and co-workers and, as mentioned above, these criteria were elaborated using a mixture of species (Kostadinova, 1995; Kostadinova et al., 2000, 2003). This fact stressed the need that molecular analysis should be carried out in conjunction with detailed phenotypical characterization (Fried and Toledo, 2004). In this context, Kostadinova et al. (2003) performed an integrative analysis by attempting the phenotypical identification of the materials and adding further ND1 sequences from 17 European isolates of Echinostomatidae. The data set presented by these authors showed a phylogenetic structure for the first time in the group. These results have served to

168


clarify the phylogenetic relationships between several common genera of Echinostomatidae (Echinostoma, Echinoparyphium, Hypoderaeum and Isthmiophora). The phylogenetic trees from the ND1 data helped to clarify the genetic adscription of all isolates and confirmed the morphological identifications. Regarding the relationships within the ‘revolutum’ group, the ITS provided insufficient resolution to analyze the group in detail. However, the ND1 data served to elucidate the specific status of some of the E. revolutum isolates previously studied. According to the above information, it seems clear that molecular analysis can advance our understanding of the phylogenetic relationships within the Echinostomatidae. However, a wider sampling of species and isolates is required in order to address questions of host–parasite relationships and geographical origin of the group. Furthermore, an integrated analysis, including phenotypical and molecular data, may be of importance for the understanding and genetic diversity of the Echinostomatidae and to yield further insight in the relationships between echinostomes and particularly those within the ‘revolutum’ group.

3.3. HOST–PARASITE RELATIONSHIPS Echinostomes have served as models for experimental parasitology for many years, particularly with regard to the study of the host–parasite relationships (Toledo and Fried, 2005; Toledo et al., 2007). The use of echinostomes has facilitated studies in several aspects of the relationships between helminths and invertebrate and vertebrate hosts. Herein, we review in detail recent studies in which echinostome have been important to gain further insight on these topics.

3.3.1. In the first intermediate host In the present section, we consider some aspects of the host–parasite relationships in the first intermediate host level that have been the subject of study during recent years. It should be noted that echinostomes have been extensively used as experimental models for the study of the development of larval trematodes in snails (Toledo et al., 2007). The main interest of echinostomes as models for the study of interactions with molluscs comes from the fact that several species of Echinostoma (i.e. E. caproni and E. paransei) use B. glabrata as the first intermediate host and this is one of several species transmitting the human blood fluke, Schistosoma mansoni.


169

3.3.1.1. Immunobiology of the infection As mentioned above, the success of an echinostome infection in the first intermediate host depends largely on the immunobiological interactions between the host and the parasite. This provides a tool for the study of the immunobiology of the snails against parasitic infections. Analysis of the immunobiological interactions between echinostomes and B. glabrata has reported useful information (Coustau et al., 2009; Toledo et al., 2007). Snails are not passive hosts for echinostomes because they have a potent internal system that can manage and eliminate pathogens (Loker and Adema, 1995). In vitro studies have shown that echinostomes are vulnerable to effector substances elaborated by snail hosts (Adema et al., 1994) and, furthermore, that non-susceptibility of some snail species or strains is mediated by immunological factors (Ataev and Coustau, 1999). Pathogens are recognized as non-self by lectins. These are nonenzymatic proteins that specifically bind particular carbohydrates (Vasta et al., 2004). The pattern recognition model proposes that even a limited set of non-changing lectins (encoded by a modest number of genes in the genome of invertebrates) could afford an effective system for non-selfrecognition in the context of (invertebrate) innate immunity. Groups of pathogens are characterized by so-called pathogen-associated molecular patterns. Thus, lectins with non-changing specificity for a particular pathogen-associated molecular pattern can serve as pattern recognition receptors to not only detect invaders but also identify the type of pathogen, and activate an innate immune response (Coustau et al., 2009; Medzhitov and Janeway, 2000). In the case of B. glabrata, the immune system relies on both cellular and humoral factors that co-operate in the recognition and elimination of nonself invaders (Coustau et al., 2009; Lardans and Dissous, 1998; Yoshino and Vasta, 1996). Circulating haemocytes are the major effector cells responsible for parasite encapsulation and killing. Several types of haemocytes have been identified. The major haemocyte type is called a granulocyte, Type A cell or adherent cell (Coustau and Yoshino, 1994; Coustau et al., 2009; Loker and Bayne, 1986; Yoshino and Granath, 1985). This cell type is phagocytic, spread on glass and is involved in the formation of the multi-layer capsules around multi-cellular invaders (Loker and Bayne, 1986). Other types of identified cells are the hyalinocytes and ‘round’ cells, though it is not well known if they are undifferentiated stages of granulocytes or ontologically different cells (Loker and Bayne, 1986). For this reason, several studies have focused on the protein profiles in haemocytes from susceptible and resistant strains of B. glabrata. Using a proteomic approach, Bouchut et al. (2006a) identified several proteins differentially represented in haemocytes collected from susceptible and resistant strains. Moreover, Bouchut et al. (2006b), focusing on

170


genes involved in adhesion processes, revealed the potential importance of several genes such as those encoding dermatopontins and matrilinlike proteins. Bouchut et al. (2007) developed a complementary transcriptomic approach by constructing substractive libraries to reveal novel candidate transcripts that were differentially expressed between strains of B. glabrata. Among these newly identified genes those encoding proteases, protease inhibitors, a lectin, an aplysianin-like protein and cell adhesion molecules could be involved in immune processes. Guillou et al. (2007a) focused their study on transcripts that are regulated during the process of parasite encapsulation. These authors identified several gene candidates of interest, such as detoxification enzymes, antimicrobial proteins, protease inhibitors, calcium-binding proteins and C-type lectins. Using an in situ hybridization technique, a cystatin-like protein was found to be over-expressed in haemocytes involved in parasite encapsulation or aggregation (Guillou et al., 2007a). Another focus of interest has been the fibrinogen-related proteins (FREPs). FREPs possess a unique molecular structure, having one or two immunoglobulin super-family domains (IgSFs) at the N-terminus and a fibrinogen domain at the C-terminus (Leónard et al., 2001; Zhang et al., 2001). FREPs are encoded by a large gene family documented first in the snail B. glabrata and have been also found in other genera of snails (Adema et al., 1997). These proteins exhibit extensive variation in the IgSFs regions. These domains are diversified at the genomic level at higher rates than those recorded for control genes and the sequence variants are derived from a small set of source sequences by point mutation and recombinatorial processes (Zhang et al., 2004). FREPs are thought to function in the immune response of B. glabrata because some family members are up-regulated following exposure to E. paraensei (Hertel et al., 2005; Loker and Hertel, 1987; Zhang et al., 2008a,b), have lectin-like capabilities to bind carbohydrates (Monroy and Loker, 1993; Monroy et al., 1992), precipitate parasite antigens (Adema et al., 1997) and are capable of binding to the surface of miracidia, sporocysts and rediae of E. paraensei (Adema et al., 1997). Recently, it has been shown that FREP proteins are able to bind E. paraensei sporocysts and their excretory/ secretory products (ESPs), and a variety of microbes (Zhang et al., 2008b). Furthermore, this binding capability showed evidence of specificity with respect to pathogen type; for example, 65–75-kDa FREPs (mainly FREP4) bind to E. paraensei sporocysts and their FREPs whereas 95-kDa and 125-kDa FREPs bind the microbes assayed. These results suggest that FREPs can recognize a wide range of pathogens, from prokaryotes to eukaryotes, and different categories of FREPs seem to exhibit functional specialization with respect to the pathogen encountered (Zhang et al., 2008a). Although considerable data on the structure, diversity and


171

expression of FREPs have been accumulated during the past years (Hertel et al., 2005; Jiang et al., 2006; Leónard et al., 2001; Zhang and Loker, 2003, 2004; Zhang et al., 2001, 2004, 2008a,b) the precise role of FREPs and, probably, other functions in the snail physiology need further research. The success of echinostome infections appears to be related to the capacity of the parasite to evade the host immune response and its effector mechanisms. In contrast to schistosomes, which mainly employ evasive strategies to prevent recognition, echinostomes seem to be able to interfere with the snail internal defence system. Studies focused on E. paraensei and E. caproni suggest that echinostome immuno-evasion relies on suppression of host cellular functions and the ESP released by the parasite appears to play a major role. Haemocytes collected from E. paraensei-infected B. glabrata showed significant lower adhesion and spreading and phagocytic capabilities than haemocytes from control snails (Noda and Loker, 1989a,b). Adema et al. (1994) reported that haemocytes closest to E. paraensei sporocysts and rediae were more affected when closer than more distant, suggesting that the parasite releases active factors to generate a gradient of interference around it. DeGaffe and Loker (1998) showed that susceptibility of B. glabrata to infection with E. paraensei is correlated with the ability of ESPs to interfere with the spreading behaviour of host haemocytes. Whereas the mechanism by which ESPs inhibit haemocyte function remains to be resolved, interference may be effected though interaction with signal transduction pathways of the snail (Walker, 2006). The in vitro exposure of B. glabrata haemocytes to E. paraensei sporocysts or their ESPs yields a calcium wave in the cytoplasm of adherent haemocytes (indicative of activation of signalling pathways that employ calcium ions as second messenger) prior to the rounding up of these cells. Thus, E. paraensei may affect haemocyte function in different ways (Hertel et al., 2000). Similarly, ESPs collected from in vitro-transformed E. caproni sporocysts induced a total loss of B. glabrata haemocyte defence functions encompassing adhesion, spreading and phagocytosis (Humbert and Coustau, 2001). Interestingly, this immune suppressive effect of E. paraensei and E. caproni ESPs may significantly contribute to the specificity of host– parasite compatibility, as the potency of ESPs to affect haemocytes correlated with echinostome infectivity (DeGaffe and Loker, 1998); the degree to which haemocyte function was interfered was less in snails exposed to, but not infected with, echinostomes (Noda and Loker, 1989b) and ESPs failed to affect haemocytes from non-host species (Adema et al., 1994) or from genetically selected resistant strains of host species (Humbert and Coustau, 2001).

172


3.3.1.2. Proteomics of echinostomes in the first intermediate host As mentioned above, echinostomes and S. mansoni employ different strategies to evade the immune response of B. glabrata. Thus, proteomic approaches have been performed to compare the expression profiles to characterize the molecular processes underlying echinostome immune evasion. Guillou et al. (2007b) compared the proteome of ESPs from sporocysts of E. caproni and S. mansoni. Interestingly, most of the proteins identified from both species after 24 h of in vitro culture belonged to the same functional groups: (i) proteins involved in detoxification of oxidative stress and (ii) glycolytic enzymes involved in the Embden-MeyerhofParnas pathway. These proteins may act as anti-oxidants and protect sporocysts from oxidative damage (Coustau et al., 2009; Guillou et al., 2007b). Additionally, other glycolytic enzymes (enolase and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)) were also identified from E. caproni and S. mansoni. These proteins could bind plasminogen and facilitate migration in the host tissues (Bergmann et al., 2004; Jolodar et al., 2003; Kolberg et al., 2006). Moreover, a Mikal-like protein was exclusively detected in E. caproni. This protein may be involved in immune evasion strategies, particularly in the inhibition of adhesion and phagocytosis of haemocytes (Coustau et al., 2009; Guillou et al., 2007b; Humbert and Coustau, 2001). As shown above, the proteome profile of both E. caproni and S. mansoni consists mainly in proteins that provide protection against oxidative stress by reactive oxygen species (ROS). This may be useful since immune activation of haemocytes induces the release of toxic ROS that play a crucial role in the killing of parasites (Adema et al., 1994; Bayne et al., 2001; Bender et al., 2005; Hahn et al., 2001). The release of anti-oxidant factors may protect to larval stages of E. caproni and S. mansoni from initial host responses. The parasite is likely to be vulnerable during the early transformation into the sporocyst stage. The early protective strategy against cytotoxicity may help the parasite to mount a secondary immune evasion strategy relying on immunosuppressive strategy (Coustau et al., 2009; Guillou et al., 2007b). It is intriguing that ESPs from both E. caproni and S. mansoni in B. glabrata include similar sets of proteins, although they show different strategies for immune evasion. Probably, the differences in the strategies are affected by entirely different molecular mechanisms (Coustau et al., 2009). This difference is underscored by the realization that none of the gene transcripts specific to the sporocyst stage of E. paraensei, for which in vivo expression was confirmed by hybridization involving cDNA extracted from parasites developed in B. glabrata, had significant similarity to any of over 200,000 sequences derived from S. mansoni.


173

Furthermore, only 21 of 69 sequences from E. paraensei displayed similarity to any of the known sequences present in GenBank (Nowak and Loker, 2005).

3.3.2. In the second intermediate host Echinostomes target a diverse collection of second intermediate hosts both taxonomically (gastropod and bivalve molluscs, amphibian larvae and fish), and behaviourally and ecologically (lentic, pelagic and sessile). Echinostomes can impact on the behaviour and general condition of the host, and also can be determinants of animal community structure and function (Keeler and Huffman, 2009). The main aspects of the interactions between echinostome metacercariae and the second intermediate host are reviewed below.

3.3.2.1. Pathology The pathogenicity of encysted echinostomes will depend on several aspects such as their localization in the host and the density of encysted metacercariae. The echinostome penetration and encystment do not cause much mortality of second intermediate hosts in nature unless the density of metacercariae is high. The pathological effects of echinostomes have been studied in several second intermediate hosts. Although snails are commonly used as experimental intermediate hosts of echinostomes, the pathology in these hosts has not been well studied. The snail size appears to be a determinant in the course of the infection. Kuris and Warren (1980) reported that E. caproni caused high mortality in juvenile specimens of B. glabrata after 4–6 days of continuous exposure to 150 cercariae per snail per day, whereas larger snails withstood cercarial penetration longer and significant mortality only was observed after 16 days of exposure. The pathology induced by echinostome metacercariae also has been studied in oysters and mussels. Encysted metacercariae infect the gonoducts of oysters, beyond taking up space and eliciting localized haemocytic responses to necrotic worms, caused no significant damage to the host (Winstead et al., 2004). Bower et al. (1994) observed that echinostome infections in marine mussels were non-pathogenic, though such infections cause compression of adjacent tissues, reduce byssal production and induce pearl formation. In Zebra mussels (Dreissena polymorpha), echinostome infections caused signs of inflammation and haemocyte inflammation, though encapsulation was not observed (Laruelle et al., 2002). Amphibians have been the main subject for studies on the pathology induced by echinostome metacercariae. The pathology of echinostomes in amphibians can be severe and it is related to the stage at which tadpoles

174


are exposed to parasites as well as the intensity of the infection ( Johnson and McKenzie, 2009). Echinostome metacercariae enter the tadpoles via the cloacal opening and form metacercarial cysts in the kidney, pronephroi, mesonephroi and Wolffian ducts (Schotthoeffer et al., 2003; Thiemann and Wassersurg, 2000a). Inside the cloaca, cercariae drop their tails, enter the mesonephric ducts, crawl towards the kidneys, form a cyst wall and become infective to the definitive host within 6 h (Fried et al., 1997b). Metacercarial infection causes oedema, growth inhibition and mortality of the tadpoles (Fried et al., 1997b; Schotthoefer et al., 2003). Martin and Conn (1990) reported that in the kidneys of leopard frogs (Rana pipiens), and green frogs (Rana clamitans) infected with echinostomatid metacercariae fibrosis was always focal. The degree of fibrosis varied between individual hosts and between different cysts within the same host. Some heavily encapsulated cysts were darkened and contained disintegrating worms. In heavily infected kidneys, confluence of fibrotic or inflammatory foci resulted in the displacement of functional renal tissue. These findings suggest that infection by echinostomatids may impair renal function and that the host’s response affects parasite viability (Martin and Conn, 1990). Schotthoefer et al. (2003) found that the early stage of R. pipiens tadpoles (Gosner stage 25) suffers the highest mortality due to E. trivolvis infection relative to later-stage tadpoles and the developmental stage of the kidney plays a major role in this mortality. Early-stage tadpoles have only small pronephroi and these fragile organs are more susceptible to lethal pathology than the mesonephroi of laterstage tadpoles (Schotthoefer et al., 2003). In a histological study, Holland et al. (2006) presented similar results with E. revolutum infection in R. clamitans tadpoles and attributed host mortality to the loss of renal function. These authors observed signs of oedema and granulomas surrounding the metacercariae. Furthermore, Holland et al. (2006) reported that metacercarial renal infection may induce a reduction in the number of glomeruli. Histological sections from uninfected Gosner-stage-33 tadpoles contained 10–20 glomeruli, while glomeruli were not apparent from infected tadpoles of the same stage. The walls of ducts within infected renal tissues consisted of a thick columnar epithelium, which were not observed in uninfected renal tissue. No overall differences in the leukocyte populations between infected and uninfected histological sections were found (Holland et al., 2006). Thiemann and Wassersurg (2000a) observed a right-side bias in echinostome infections in tadpoles of Rana sylvatica and R. clamitans. These authors suggested that the parasites have evolved a mechanism to reduce initial pathology by leaving the left kidney relatively uninfected so that metacercariae may become infective to the definitive host before tadpoles die due to the infection. Schotthoefer et al. (2003) did not


175

observe this right-side bias but noted some non-significant patterns of asymmetry in kidney infection.

3.3.2.2. Echinostomes as re-emerging disease Trematode infections of anurans have been the subject of increasing interest during recent years (Johnson and McKenzie, 2009). A species closely related to echinostomes (Ribeiroia ondatrae) was implicated as causing limb deformities in frog populations (Johnson and Sutherland, 2003; Johnson et al., 1999). These observations raised concerns about the importance of echinostome infections in determining the survival of tadpoles and their subsequent recruitment into frog populations. Johnson and Sutherland (2003) found that ponds in which anurans were heavily infected with echinostomes showed a lower recruitment of tadpoles than ponds that had lower levels of echinostome infections. Beasley et al. (2005) studied factors related to the decline of Northern cricket frogs (Acris crepitans) in Illinois, United States, and found that juvenile frogs were infected with echinostomes in all the sites examined. The prevalence of echinostomes reached 100% in some of the sites examined and the intensity of the infection was high. In one of these sites, the majority of the infected frogs had high-intensity infections where more than the 50% of the kidney tissue was occupied by echinostome metacercariae. This level of infection indicates that tadpoles were exposed to multiple thousands of cercariae during their development in the aquatic environment. Beasley et al. (2005) observed decreased cricket frog recruitment in those sites heavily impacted by echinostomes. They suggested that high mortality due to infections was likely to be an important factor. Koprivnikar et al. (2008) studied the effect of population density and the infection with E. trivolvis on the growth and development of R. pipiens. Mean mass and mean development stage of larval frogs were reduced under high rearing densities. The presence of parasitized conspecifics had no significant effect, but there was a significant interaction between host density and parasitism presence on host mass, due to the fact that parasitized con-specifics grew sparsely at high densities. This result indicates that infected hosts compete as much as uninfected frogs for resources, even though infected individuals have reduced mass under high-density conditions. Skelly et al. (2006) suggested that echinostome infection is an emerging disease in green frogs (R. clamitans) in urbanized environments. This study demonstrated that echinostome infection prevalence in some urban ponds can approach 100%, with mean infection intensities ranging from hundreds to thousands of metacercariae. The presence of predators also may influence the severity of echinostome infections in wetlands. Thiemann and Wassersurg (2000b) observed that presence of fishes promoted higher levels of echinostome infections. These authors suggested

176


that decreased activity of tadpoles to avoid attracting attention of predators allows the sedentary hosts to be taken advantage of. Several authors have observed high activity of tadpoles in response to cercariae when predators are absent, suggesting that they have ability to reduce infection by shaking cercaria off or escaping a cloud of cercariae when they are not under high pressure of predators (Schotthoefer et al., 2003; Taylor et al., 2004; Thiemann and Wassersurg, 2000b). The widespread introduction of fish in many small ponds and wetlands could potentially compound parasite infection of amphibians at the landscape level (Johnson and McKenzie, 2009). Johnson and McKenzie (2009) stated that echinostomiasis can be considered an emerging disease in amphibians, though the current evidence for increasing levels of the infection is still scant. These authors suggested that environmental changes are the major cause of the emerging echinostomiasis. Such changes alter the abundance and distribution of hosts, their susceptibility to infection or the abundance and productivity of the parasite. Johnson and McKenzie (2009) listed the main environmental changes that may increase the level of echinostome infections in amphibians as: (i) changes in land use and wetland characteristics, (ii) nutrient pollution, (iii) pesticide contamination, (iv) loss of biodiversity and (v) climate change. The potential role of these factors to enhance transmission of echinostomes was also discussed.

3.3.2.3. Effect of toxins on echinostome metacercariae The environmental conditions play a major role in the cercarial transmission and metacercarial cyst formation. Anthropogenic changes in the environment may alter the dynamics between the echinostome cercariae and the second intermediate host (Keeler and Huffman, 2009). In this context, several studies have attempted to analyze the effect of herbicides and pollution on cercarial transmission. Morley et al. (2004) studied the effect of anti-fouling biocides Tributyltin (TBTO), copper and Irgarol 1051 (irgarol) at a concentration of 10 mg/l on the parasite viability of Echinoparyphium recurvatum and snail mortality of L. peregra and Physa frontinalis. The results suggested that parasite viability is correlated with survival of the snail host. A greater effect of exposure to toxicants was found in cysts within P. frontinalis, probably in relation to the greater mortality observed in this snail species. The effect of copper sulphate toxicity on several aspects of the biology of E. trivolvis and E. caproni and the snail B. glabrata was studied by Reddy et al. (2004). The results showed that solutions containing 1.0%, 0.1% and 0.01% CuSO4 were lethal within 2 h for both parasite species. Treatment with 0.01% CuSO4 caused a significant reduction in the ability of both species to encyst in snails. Excysted metacercariae of both species were killed by 2 h in either 0.1% or 0.01% CuSO4. Regarding the snail host, Reddy et al. (2004)


177

showed that concentrations greater than 0.001% CuSO4 increased snail mortality. Griggs and Belden (2007) analyzed the effect of the herbicides metolachlor and atrazine on the survivorship and infectivity of E. trivolvis cercariae towards H. trivolvis and Rana spp. tadpoles. High concentrations of these herbicides resulted in a decline in parasite survival. The mixture of both herbicides had no significant effect on the echinostome load in the second intermediate host. The effect of environmental contamination with the organophosphate insecticide malathion also has been the subject of study. Budischak et al. (2008a) analyzed the effect of embryonic exposure of R. palustris to malathion on the later infection of tadpoles with E. trivolvis. After 7 weeks of development in water with no malathion, tadpoles previously exposed as embryos for 96 h to 60–600-mg/l malathion, suffered increased parasite encystment rates compared with non-exposed tadpoles. These findings suggest that embryonic development is a sensitive window for establishing later latent susceptibility to infection. Conversely, Budischak et al. (2008b) studied the effect of E. trivolvis infection on the susceptibility of R. palustris tadpoles to malathion. These authors did not find differences in susceptibility to malathion in relation to infection. However, they consider that it is important to investigate this question using other pesticides and host–parasite systems. Recent work has been concerned with food-borne trematode infections and their transmission to human and animals by encysted metacercariae (see review by Chai, 2009). However, attempts to block transmission of these cysts to the definitive hosts by use of agents that kill metacercariae are relatively few. In this context, echinostomes can be useful to study the effect of marinades and physical and chemical factors on encysted metacercariae. Wiwanitkit (2005) found that freshly killed freshwater fish (Cyclocheilichthys armatus), purchased from a local market in Thailand were infected with large numbers of Echinostoma metacercariae. These infected fish were used to evaluate the effect of traditional food preparation on the viability of the metacercariae. The metacercariae in situ were evaluated using the following parameters: i) left to dry at room temperature, ii) frozen, iii) refrigerated, iv) marinated in saline and v) marinated in 5% acetic acid solution. Degeneration of the metacercariae was slowed by cooling: degeneration of all metacercariae took approximately 10 h in the refrigerated or frozen fish, compared with 4 h in all other dishes left at room temperature and in the marinades. Various physical and chemical factors were studied by Fried and Peoples (2007) to determine their effects on the viability of encysted metacercariae of E. caproni. Viability was equated with chemical excystation in an alkaline TB medium. Of numerous marinades tested, the one that was most harmful to isolated and in situ cysts was vinegar. Concentrated solutions of saline and sucrose had no effect on the viability of isolated and in situ cysts, suggesting that

178


their use in food preparations for molluscs would not be effective in killing echinostomatid cysts in tainted snail tissues. In terms of eating habits, humans are infected with echinostomes by eating raw fish that are often dipped in a salt and vinegar mixture known as kinilaw. Other methods of fish preparation are tinola (boiled), ginataan (stewed in coconut milk) and sinugba (charcoal grilled). All echinostomeinfected patients had a history of having eaten snails, kuhol and kiambuay, prepared raw with coconut milk and lime juice (kinilaw), especially when found in greater abundance during the rainy season. This suggests that various types of marinades and food preparations may not affect the viability of echinostome metacercariae (Belizario et al., 2007).

3.3.3. In the definitive host Echinostomes are ideal models for the study of the biology of intestinal helminths (Toledo and Fried, 2005). Recently, a number of findings have shown that echinostomes may be of great importance for future developments in the analysis of intestinal helminth–vertebrate host relationships.

3.3.3.1. Development The growth and development of pre-ovigerous echinostomes have been studied in detail for E. caproni (Fried and Huffman, 1996; Fried et al., 1988; Manger and Fried, 1993). Excysted metacercariae are non-progenetic and contain only genital anlage. Pre-ovigerous adults from rodent or chicks show distinct testes from 2–3 days post-infection (dpi), an ovary distinct from the ootype by 4 dpi and coiling of the uterus by day 5; the vitellaria are present by 6 dpi and the worms become ovigerous by 7–8 dpi. During development from the excysted metacercariae to ovigerous adult in rodents and chicks, the worm body area may increase some 80 times (Fried and Huffman, 1996; Fried et al., 1988; Manger and Fried, 1993). The main features of the development of ovigerous adults over time have been studied for E. caproni, E. trivolvis and E. friedi (Franco et al., 1988; Humpries et al., 1997; Munõz-Antoli et al., 2004, 2007; Odaibo et al., 1988; Stillson and Platt, 2007; Toledo et al., 2003a, 2004b; Yao et al., 1991). To this purpose, different methodologies and morphological markers have been used. In general, most of the morphometrical variables show a rapid increase during the first 2–3 wpi. Thereafter, the values continue to show the increase at a lower rate or even to become stable. Probably of particular interest is the work in which the growth of the echinostomes is studied in relation to other variables. In this context, echinostomes have served for studies on the influence of host species and the population density on the growth of digenetic trematodes. Because most echinostomes can develop in different host species displaying different degrees of compatibility, they are good subjects for


179

studies on the effect of host species on the development of digeneans. Toledo et al. (2004b) made a comparative study on the development of E. caproni in hosts of high (hamster) and low (rat) compatibility with the parasite. This study showed that the host species has a dramatic effect on most of the morphometrical features analyzed. The values were significantly greater in hamsters than in rats. Furthermore, time–host species interactions were detected for several variables, indicating that the kinetics of worm growth in each host species is different. The curves for all these variables showed a different pattern in hamsters and rats. Similar results were reported for E. friedi in the hamster (high compatible host) and the rat (low compatible host) (Munõz-Antoli et al., 2004). As mentioned above, echinostomes also have served for studies on the crowding effect in trematodes. Franco et al. (1988) studied the effect of crowding on adults of E. trivolvis in hamster. Their study reported that increased dosage levels and thus infra-population size influences several aspects of worm development, including a delay in maturation. Yao et al. (1991) found that E. caproni adults in golden hamsters fed a large number of cysts (200 cysts/hamster) were stunted compared with worms obtained from hosts only fed 15 cysts per host. Balfour et al. (2001) reported that E. caproni adult worms in mice infected with 100 metacercariae showed lower wet and dry weight than those collected from mice infected with 25 metacercariae. Stillson and Platt (2007) made one of the most interesting approaches to the effect of population density or crowding on the morphometrical variability of E. caproni in mice. The hosts were infected with 25, 100 and 300 metacercariae each and a total of 31 morphometrical variables (25 direct measurements and six ratios) were evaluated at 22 dpi. Uni-variate and multi-variate statistical analysis revealed significant differences between worms from all three groups. A total of 27 characters showed significant intra-groups differences, with the primary differences between worms from 25/100 versus 300 cysts infection. In general, there was an inverse relationship between inoculum size and worm size as described in previous studies. Reproductive structures were most sensitive to the crowding effect. This fact had been previously reported (Balfour et al., 2001; Munõz-Antoli et al., 2004; Toledo et al., 2004b; Yao et al., 1991). Future studies on the effect of population size on the development of echinostomes may be of great interest for further understanding of host–parasite relationships in helminth infections.

3.3.3.2. Reproduction and fecundity The easy handling of echinostomes in the laboratory makes them suitable subjects for the study of the reproductive patterns and the fecundity of intestinal helminths in the definitive host. The structure and development

180


of the reproductive system, together with the oogenesis, vitellogenesis, spermiogenesis and egg formation were reviewed by Nollen (2000). Echinostomes can either self- or cross-inseminate. In single infections with E. trivolvis, E. paraensei and E. caproni, self-insemination resulted in viable eggs. In multiple infections, including several individuals of each species, individuals cross- and self-inseminate, though the percentage of cross- and self-insemination varied widely among species (Nollen, 2000). Regarding concurrent infections, including individuals of different species, echinostomes appear to lack a marked mate attraction. The three species studied (E. trivolvis, E. paraensei and E. caproni) showed interspecies mating. Additionally, echinostomes can identify partners of their own species and inter-species mating does not occur when individuals of the same species are available (Nollen, 2000; Toledo, 2009a). Nollen (1996b) studied the mating behaviour between E. caproni and E. paraensei in concurrent infections in mice, though no inter-species mating was found. In contrast, Nollen (1997) investigated the mating patterns of E. caproni and E. trivolvis in hamsters, and observed that inter-species mating occurred when E. trivolvis acted as sperm donor. The ability of echinostomes to identify mating partners was confirmed using different strains (originated from different geographic areas) of E. caproni (Trouve et al., 1996). In simultaneous infections of a single mouse with two individuals of two different strains, each individual exhibited an unrestricted mating behaviour involving both cross- and self-insemination. In contrast, the association in mice of two adults of the same strain and one adult of another strain showed a marked mate preference between individuals of the same isolate. This pre-zygotic isolation seems to be followed by a post-zygotic isolation characterized by hybrid breakdown. It has been shown that the hybrids of the second and third generations display lower fecundity compared to both parental isolates and to the F1 (Trouve et al., 1998). Similar results were obtained by Trouve et al. (1999) suggesting that this fact may be useful to avoid this hybrid breakdown. These results emphasized the important and synergistic roles of selfing and, inbreeding depression, and hybrid breakdown in the evolution of reproductive strategies of echinostomes. These facts evidence the existence of chemical communication between adult stages to enhance pairings with other individuals for maintaining a viable species. Several efforts have been made to investigate the processes of chemical attraction and mate finding in echinostomes (see Toledo, 2009a). The ESPs of adult worms appear to act as chemical cue for mate finding. Trouve and Coustau (1998) investigated the differences in the same strains of E. caproni previously mentioned by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDSPAGE). These strains shared most of the polypeptides, but a few were strain specific. The authors suggested that these specific bands could be of


181

importance in evolutionary processes such as assertive mating or local host adaptation. Trouve and Coustau (1999) showed that echinostomes attract each other and tend to pair in vitro, suggesting that this pairing can occur in absence of external factors and depends exclusively on cues emitted by the worms. The fecundity of the helminths and the factors that affect parasite fecundity are key aspects in the study of the transmission dynamics of helminths. Much work has been carried out to investigate the transmission dynamics of echinostomes under experimental conditions. This work has been focused on reproductive output of echinostomes to quantify the transmission of the parasite (see review by Toledo, 2009a). The fecundity of echinostomes has been studied on the basis of egg counts. Egg output depends on the parasite species and population density (Christensen et al., 1990; Huffman, 2000; Mahler et al., 1995). Recently, several studies have analyzed the egg output in relation to the age of the infection and the host species. The length of time for an echinostome species to begin the release of eggs ranges from 8 to 15 days, though it depends on the host species. Munõz-Antoli et al. (2004) showed that the pre-patent period of E. friedi is significantly longer in a low compatible host (rat) that in a high compatible host (hamster). The kinetics of egg release is similar for all the echinostome species studied. Egg release rapidly increases during the first weeks post-infection to reach a maximum. Thereafter, the values become stable and, finally, steadily decrease (Christensen et al., 1990; Mahler et al., 1995; Munõz-Antoli et al., 2004, 2007; Toledo et al., 2003a, 2004b). The decline of egg release may be attributed to a decrease in the number of worms due to mortality. However, there is evidence suggesting the involvement of other factors. Toledo et al. (2003a) suggested that the decline in egg output of E. friedi is also a consequence of functional changes in the adult worms affecting their fecundity. This observation is confirmed by the kinetics of viable eggs release, a parameter that does not depend on the number of worms surviving. The percentage of viable eggs steadily declined from 9 wpi, though the worm recovery remained stable. Host species also plays an important role in the egg output of echinostomes. Usually, the egg output of an echinostome species is greater in hosts of high compatibility than in low compatible hosts. Mahler et al. (1995) showed that the number of E. caproni eggs released is significantly greater in hamsters than in jirds. Toledo et al. (2004b) compared the number of eggs of E. caproni released in experimentally infected hamsters and rats during the course of the infection and concluded that the number of eggs released is dependent on time post-infection and host species. The kinetics of egg release were similar in both host species, though the number of eggs released was significantly greater in hamsters. In the case of E. caproni, the lower number of eggs released in rats was correlated with a lower value of worm recovery in this host species. However, the

182


results obtained with E. friedi suggest that the host species affects the functional processes of echinostome adult worms related to their capacity to produce eggs. Munõz-Antoli et al. (2004) found that the weekly worm recovery of E. friedi in hamsters and rats was similar during the first 4 wpi (period of survival of E. friedi in rat). Despite this fact, the number of eggs released weekly was significantly lower in rats than in hamsters indicating that the egg release of an echinostome species is host species dependent and is not only related to the number of adult worms established in each host species. As shown above, the fecundity of echinostomes is the result of a complex set of inter-relating factors. This makes it difficult to make estimations of the reproductive output of an echinostome in a host species and also for any other intestinal helminth. The approximations on the basis of egg counts may not reflect the dynamics of the reproductive output in trematode infections since other parameters should be taken into account (Whitfield et al., 1986). This suggests the need for further studies on the reproductive output and the standardization of the experimental procedures and criteria for elucidating the parasite fecundity. In this context, echinostomes may be of great utility. In an attempt to complete and standardize the studies on the parasite fecundity in echinostome infections, Mahler et al. (1995) defined the reproductive capacity of E. caproni in a particular host species considering the percentage of parasite establishment, the survival of adult worms and the egg production rates. Using these parameters, the authors showed that the reproductive capacity of E. caproni in hamsters is significantly greater than in jirds. This method may be useful, but it cannot constitute a measure of the reproductive success since the total egg production is considered and only the output of viable eggs should be considered. In this context, Toledo et al. (2003a) formulated a simple method to describe the population dynamics of E. friedi in hamsters from metacercariae to viable eggs. They calculated the reproductive success of E. friedi defined as the total number of viable eggs produced by the cohort of adult worms infecting a host per metacercariae at which the host was exposed. This parameter takes into account all the variables that influence the reproductive output of a digenean trematode in the definitive host. Furthermore, they developed the concept of weekly reproductive success, which may be defined as the total number of viable eggs produced each week per metacercariae at which the host was exposed. The results obtained showed that the reproductive success of E. friedi in hamsters is not constant over time attaining its maximum at 4 wpi. This variation seems to be related to changes in egg output and the viability of the eggs produced over time. Moreover, the authors suggested that the transmission of E. friedi in hamsters is only viable from 3 to 8 wpi.


183

This methodology provides a framework for measuring the reproductive success of an echinostome throughout the phase of the lifecycle from metacercaria to egg and its variations over the course of the infection. However, the parameters used by Toledo et al. (2003a) only give a partial view of the ability of a host species to transmit an echinostome (or other helminth) to the next host and, thereby, to maintain its supra-population. Transmission success of an echinostome is also determined by other factors, that is, the infectivity of the miracidia produced and its variations over time. In this sense, Toledo et al. (2004a) investigated the effect of aging of E. friedi adult worms on the miracidia yielded. Miracidia were obtained after hatching of eggs collected from adults of different ages. Miracidial infectivity, measured in terms of percentage of infection in Lymnaea peregra, was significantly influenced by the age of the adult worms from which the miracidia were derived. Infective miracidia were only obtained from adult worms in the age range of 4–9 wpi, with a maximal infectivity in the miracidia from adults of 8–9 wpi. This observation shows that the miracidial infectivity should be considered to measure the capacity of a host to transmit an echinostome species to the next host in its lifecycle. Using E. friedi as an experimental model, Toledo et al. (2006a) developed the concept of experimental transmission success defined as the number of hosts, B, that became infected after exposure to a number of infective stages derived from a host, A, per unit of inoculation at which host A was exposed. In the case of echinostomes, this concept can be simply defined as the number of snail first intermediate hosts that become infected per unit of inoculation (metacercariae) to which the definitive host was exposed. Toledo et al. (2006a) calculated the experimental transmission success of E. friedi in hamsters and rats experimentally infected. The results of this study showed that E. friedi is better adapted to pass successfully through this phase of its lifecycle when using hamsters as final host rather than rats. The advantages of hamsters as final host are the result of a greater life span, egg output and viable egg production that resulted in an experimental transmission success of 91:1 with respect to rats. Moreover, Toledo et al. (2006a) calculated the experimental transmission success of E. friedi for each week of the infection in both host species (weekly experimental transmission success). The results suggested that although the maturation of E. friedi in hamsters is slower, they are able to transmit E. friedi for a longer period than rats and with higher experimental transmission success values. The application of experimental transmission success allows for the quantification of rates under experimental conditions of transmission of a helminth in a definitive host and estimation of the contribution of a host species in the maintenance of a parasite population. Moreover, this method allows comparative studies between different hosts of a particular echinostome species to improve the efficacy

184


in lifecycle maintenance in the laboratory. The development of the experimental transmission success concept constitutes an example of how echinostomes may serve as experimental models in the study of population dynamics of helminths.

3.3.3.3. Immunological aspects The immunology of echinostome infections has been recently reviewed by Toledo et al. (2006b) and Toledo (2009b). In this section, the emphasis will be on the most recent advances on this topic elucidating the host protective immune responses. In general, echinostomes are able to infect a wide range of hosts. However, the parasite can be rapidly cleared or, in contrast, induce chronic infections depending on the host species. As such, these parasites are excellent models for studying the hostdependent factors determining the worm expulsion. Several manifestations of resistance to echinostome infection in relation to the host immune response can be observed. Toledo (2009b) reported that resistance to echinostome infections can be manifested by: (i) natural expulsion of primary infections, (ii) increased worm burden after immunosuppression of the host, (iii) generation of resistance to homologous or heterologous secondary infections, (iv) reduction of fecundity of adult worms and (v) changes in the morphology of adult echinostomes. A complex set of interacting and inter-related factors appears to govern the immune responses against echinostome infections. Furthermore, these responses may be different for each echinostome–vertebrate host combination. In the intestine of infected hosts, Echinostoma spp. induce changes at the cellular level and in the expression of certain glycoconjugates that may be of importance in the regulation of worm populations (Toledo et al., 2006b). These changes can be summarized as follow: (i) mastocytosis, (ii) eosinophilic infiltration, (iii) increasing in goblet cell numbers, (iv) alteration of goblet cell function by modification of the mucin’s terminal sugar and (v) an increase in the number of mucosal neutrophils and mononuclear inflammatory cells in the mesentery. Mast cell hyperplasia in the intestinal tissues of rodents infected with Echinostoma spp. is well recognized (Fujino et al., 1993a, 1996a,b, 1998a; Tani and Yoshimura, 1988). However, there are conflicting data in relation to its role in worm expulsion since reduction of mastocytosis by immunosuppression of E. trivolvis-infected mice did not affect the kinetics of worm expulsion (Fujino et al., 1993a, 1998b). In the E. caproni-rodent model, increases of mast cell numbers have been observed during the first week post-infection, though this not appear to be a determinant for the expulsion of the worms. Infected mice and hamsters develop similar mast cell kinetics, though the worm survival in each host differs (MunõzAntoli et al., 2007; Toledo et al., 2006c). A similar situation was described in the E. hortense-rodent model. Mast cell hyperplasia has been described


185

both in rats and mice, but E. hortense induces long-lasting infections in rats and the worms are rejected earlier in mice (Kim et al., 2000; Park et al., 2005). Eosinophilic infiltration in the intestinal tract is a common feature in rodents infected with Echinostoma spp. (Bindseil and Christensen, 1984; Fujino et al., 1996a; Munõz-Antoli et al., 2007; Ryang et al., 2007; Toledo et al., 2006c). Several observations suggest that eosinophilia may be involved in worm expulsion. High levels of eosinophilic infiltration were observed in E. caproni-infected rats in which the parasite is rapidly expelled. Similarly, the levels of intestinal eosinophilia in E. caproniinfected mice are higher than in hamster, concomitantly with a lower worm burden (Munõz-Antoli et al., 2007; Toledo et al., 2006c). However, Ryang et al. (2007) showed that immunosuppressant treatment of E. hortense-infected mice inhibited the eosinophilia but this only resulted in slight changes in worm recovery. This suggests that other immune mechanisms as of greater importance in the regulatory mechanisms against adult echinostomes. Increased mucus production in association with goblet cell hyperplasia appears to be more implicated in echinostome adult worm rejection (Toledo, 2009b; Toledo et al., 2006b). E. caproni chronic infections have been associated with reduced numbers of goblet cells, whereas worm expulsion usually coincides with an increase in the goblet cells numbers (Fujino and Fried, 1993a; Fujino et al., 1993, 1996a,c, 1997; Munõz-Antoli et al., 2007; Park et al., 2005; Ryang et al., 2007; Toledo et al., 2006c). Although the involvement of goblet cells in the expulsion of echinostome infections seems evident, Frazer et al. (1999) showed that the situation is more complex. These authors observed a marked goblet cell response in RAG-2 mice, though E. caproni adult worms survived as they did in conventional ICR mice. Moreover, Park et al. (2005) did not find a relationship between the differences in the kinetics of goblet cell numbers and the E. hortense worm expulsion in C3H/HeN and BALB/c mice. These facts suggest that worm expulsion of echinostome infections cannot be explained exclusively on the basis of goblet cell numbers. In this context, intestinal worm rejection was noted to be regulated by the alteration of goblet cell function through modification of the mucin’s terminal sugar, specially the expression of N-acetyl-D galactosamine (Ishikawa et al., 1993, 1994). Fujino and Fried (1993b) studied the lectin labelling patterns in the small intestine of C3H mice infected with either E. trivolvis or E. caproni. They noted marked differences in the distribution of glycoconjugates in infected hosts. In E. trivolvis-infected mice the quantity of mucins, including N-acetyl-D galactosamine, sialic acid and N-acetyl-D glucosamine, were strongly expressed together with the increase in goblet cell numbers. In E. caproni-infected mice, the binding of most of the lectins was reduced in association with a low number of goblet cells. Interestingly, E. trivolvis-

186


infected hamsters did not show goblet cell hyperplasia or increase in the glycoconjugates and chronic infections were developed (Fujino and Fried, 1996). Similarly, immunostaining of the intestine of E. hortense-infected mice showed a significant increase of lectin-binding goblet cells, suggesting that these cells may regulate worm expulsion by altering the mucin’s terminal sugar (Park et al., 2005). A similar situation was described for Nippostrongylus braziliensis. Ishikawa et al. (1994) showed that the expulsion of this nematode is associated with T-cell-dependent goblet cell hyperplasia together with a T-cell-independent alteration of goblet cell mucins. Accordingly, the goblet cell number and the alteration of sugar residues of these cells seem to play a critical role in the expulsion of adult echinostome worms. Significant differences in relation to the presence of mucosal neutrophils and mesenteric inflammatory cells have been detected between E. caproni-infected hosts (Toledo et al., 2006c). A marked inflammatory cell infiltration, together with increased numbers of mucosal neutrophils, was observed in a high compatible host (hamsters), but not in a host of low compatibility. This suggests that greater local inflammatory responses may be associated with the development of E. caproni chronic infections (Toledo et al., 2006c). Apart from changes in local cellular populations, echinostome infections may induce significant antibody responses (Toledo, 2009b; Toledo et al., 2006b). However, these responses depend on the host–parasite combination. E. caproni induced rapid and strong immunoglobulin (Ig)G responses in mice (Agger et al., 1993; Graczyk and Fried, 1994; Sotillo et al., 2007; Toledo et al., 2005). Significant levels of IgG were detected from 1–2 wpi and the values progressively increased over the course of the infection. In hamsters, the responses were greater but slower than in mice and positive levels of IgG were observed from 7 wpi (Simonsen et al., 1991; Toledo et al., 2004c). In contrast, rats developed a weak IgG response against E. caproni and only low levels of IgG were detected from 7 wpi (Toledo et al., 2003b, 2004d; Sotillo et al., 2007). Similarly, E trivolvis and E. hortense elicited strong serum IgG responses in mice (Cho et al., 2007; Graczyk and Fried, 1994). E. friedi induced greater responses in hamsters than in rats (Carpena et al., 2007; Toledo et al., 2003b). Cho et al. (2007) studied the IgG1, IgG2a, IgE and IgA responses in the sera of C3H/HeN and BALB/c mice infected with E. hortense. The levels of IgG1 were higher than those of IgG2a, IgE and IgA. The titres peaked at 3–4 wpi and were higher in BALB/c mice at every week post-infection. Increased IgE and IgA were also observed but there were no differences in between strains of mice. Sotillo et al. (2007) compared the kinetics of IgM, IgA and IgG sub-classes in two host species of E. caproni displaying a different degree of compatibility with the parasite, that is, mice in which the parasite induces chronic infections and rats, in which the parasite is


187

rejected earlier. The early response was of the IgM class in both host species showing the maximum level at 1–2 wpi. The intense response of IgM suggested the presence of thymus-independent antigens on E. caproni that interact early with the host immune system. This was supported by the intense IgG3 response observed in mice. Responses mediated by IgG3 are related to carbohydrate thymus-independent antigens that can induce an IgG3 class switch (Snapper et al., 1992). The kinetics of serum total IgG response was markedly greater in mice than in rats. Furthermore, the kinetics of serum IgG1 and IgG2a were also different in both host species. The results suggested a markedly biased response towards a Th2 phenotype in mice, characterized by a strong production of IgG1 from 3 wpi and beyond. In rats, an initial dominance of IgG2a response occurred, though a slight increase of IgG1 levels was detected from 7 wpi and beyond, suggesting that worm expulsion might be associated with balanced Th1/Th2 systemic responses and the development of long-lasting infections associated with a dominance of systemic Th2 responses with high levels of serum IgG1. The kinetics of circulating IgA were also different in mice and rats. In the serum of mice, a progressive increase was observed over the course of the infection, whereas in rats, IgA peaked at 1–2 wpi and returned thereafter to negative values. This appears to confirm the dominance of systemic Th2 systemic responses in relation to chronic infections, since expression of IgA is mediated by Th2 cytokines such as interleukin (IL)-5, IL-6 or IL-10 (Ramsay, 1995). The target antigens of circulating antibodies in E. caproni infections were studied by Sotillo et al. (2008) using an immune proteomic approach. A total of four proteins (enolase, actin, heat shock protein (Hsp)-70 and aldolase) were recognized by serum IgM, IgA, IgG and or IgG1 of mice, though the recognition profile was specific for each isotype. This issue will be discussed in further detail in Section 3.3.3.4. The influence of systemic antibody responses is not known. In E. caproni infections, stronger responses have been observed in host species in which long-lasting infections developed (Toledo et al., 2006b). This suggests that circulating antibody responses constitute a collateral consequence of the infection. Toledo et al. (2004c) suggested that differences in the systemic antibody responses were related to differences in the local inflammatory responses. Juvenile and adult worms secrete antigens that can cross the intestinal mucosa, to reach the circulatory system and induce serum responses by B-cell stimulation. It is known that the passage of antigens through the intestinal mucosa is mediated by local inflammation (Yu and Perdue, 2001). Thus, differences in mucosal inflammatory responses may result in differences in systemic antibody responses. In this sense, high levels of E. caproni sero-antigens concomitantly with strong serum antibody responses have been observed in mice and

188


hamsters, whereas low levels of antigens and antibodies were observed in the serum of rats (Toledo et al., 2004c, 2005). Toledo et al. (2006c) detected marked differences in local inflammatory responses in E. caproni-infected hamsters and rats. A strong inflammatory cell infiltration, together with increased numbers of mucosal neutrophils, was observed in hamsters but not in rats. Under these conditions, the maintenance of epithelial barriers may be disrupted resulting in an increased passage of worm antigens through the intestinal mucosa. Furthermore, Toledo et al. (2006c) performed an immunohistochemical study using polyclonal anti-ESPs of E. caproni antibodies. The results showed greater antibody binding in the intestine of E. caproni-infected hamsters then in E. caproni-infected rats confirming the greater antigen passage. This was suggested as the responsible factor for the higher systemic antibody responses. In this context, the local antibody response appears to be of greater importance. However, this topic has not been well studied. Agger et al. (1993) analyzed the antibody response in the intestinal wall and lumen of mice infected with E. caproni. Significant increases of IgG, IgA and IgM were detected in the intestinal tissue, whereas only IgA was detected in the lumen. Sotillo et al. (2007) studied the antibody response in the intestine of E. caproni-infected mice and rats. A response of IgM was observed by 8 wpi in mice but not in rats. This late rise in local IgM suggests that this response may be involved in the reduced worm burden observed from 8 wpi and beyond in mice (Munõz-Antoli et al., 2007). The IgM class is a major complement-fixing antibody and antibody has been suggested as one of the potential effector immune mechanisms against E. caproni (Simonsen and Andersen, 1986). However, there are two reasons that prevent us from considering IgM as a major immune mechanism involved in the rejection of E. caproni adult worms: (i) the effective role of complement in the intestinal lumen appears to be limited; and (ii) the lack of IgM response in rats, together with the earlier expulsion of E. caproni, suggests that the role of IgM in parasite clearance can only be secondary. The IgG1 and IgG2a local responses in mice and rats were slower and less intense than in serum. In mice, increases of both sub-classes were observed, probably as reflected in a balanced Th1/Th2 response. In contrast, rats only developed an IgG2a response, which suggests that local cellular mechanisms can be of great importance in the parasite expulsion. Interestingly, worm expulsion coincides with a maximum level of IgG2a at 7–8 wpi (Sotillo et al., 2007). Local IgA was only observed in mice. Positive values were observed by 2 wpi with a maximum at 8 wpi. This indicates that IgA secretion is not sufficient for E. caproni rejection (Sotillo et al., 2007). The induction of IgA might be the consequence of local production of Th2 cytokines, which suggests that the development of local Th2 responses may be associated with chronic E. caproni infections.


189

Little is known about the role of antibodies against echinostomes. Simonsen and Andersen (1986) showed that antibodies in the serum of mice infected with E. caproni bound to surface antigens of the parasite. However, they were rapidly expelled due to the turnover rate of surface antigens, which was suggested as a strategy to avoid antibody attack (Andresen et al., 1989; Simonsen and Andersen, 1986; Simonsen et al., 1990). The cytokine profile during echinostome infections, generating the responses described has been rarely studied. Brunet et al. (2000) examined the preferential development of either Th1 or Th2 responses during early stages of E. caproni infection in mice by studying cytokine production in spleen and mesenteric lymph node cells using an enzyme-linked immunosorbent assay (ELISA) technique. Whereas spleen cells failed to respond to antigen stimulation, mesenteric lymph node cells produced interferon (IFN)-g and to a lesser extent IL-4. Furthermore, IL-5 levels were elevated during the period of study (3 wpi) suggesting a balanced Th1/Th2 phenotype at the local level. Moreover, Brunet et al. (2000) treated mice with a single injection of anti-IFN-g monoclonal antibodies at 2 wpi to assess the role of this cytokine in protective immunity. A significant reduction in worm burden was found, which suggested that IFN-g may be important in the establishment of E. caproni chronic infections. However, Noland et al. (2008) did not detect significant increases in the levels of IFN-g in E. caproni-infected mice as determined by ELISA using the supernatant of splenocyte cultures. The production of Th1/Th2 cytokines in the splenocytes of E. hortenseinfected C3H/HeN and BALB/c mice was studied using semiquantitative reverse transcription polymerase chain reaction (RT-PCR) by Cho et al. (2007). Regardless the mouse strain, the messenger ribonucleic acid (mRNA) expression of the Th1 cytokines IFN-g and IL-12 were weak. In contrast, the expression of IL-4 and IL-5 mRNA was increased in both strains. The mRNA expression of IL-4 peaked at 6 h after antigenic stimulation. The expression of IL-5 lasted longer than that of IL-4. The secretion of cytokines from splenocytes was studied by ELISA and the results were similar to those observed by RT-PCR (Cho et al., 2007). Ryang et al. (2007) also studied the levels of tumour necrosis factor (TNF)-a and IL-1b in by RT-PCR in the spleen of the same strains of E. hortense-infected mice, though only weak increases in the levels of mRNA expression of these Th1 cytokines were observed, confirming the dominance of Th2 responses in E. hortense-infected mice.

3.3.3.4. Proteomics of adult worms Currently a few studies have been concerned with the proteomics of echinostome adult worms, though this information may be useful to understand the physiological and pathological effects of echinostome

190


infections better. Moreover, the lack of a genome sequence project and the low number of sequences deposited in databases makes proteomic studies difficult, although good spectromic data can be obtained (Marcilla, 2009). The first studies on protein analysis on echinostomes simply used mono-dimensional SDS-PAGE to analyze mixtures of proteins such as ESPs. These studies allowed for the detection of a number of proteins that could be of interest in the context of the host–parasite relationships. However, this methodology provides a poor protein characterization, which makes it difficult to obtain conclusive data. Toledo et al. (2004d) characterized the ESPs and somatic antigens of E. caproni experimentally obtained from rats by western immunoblot from SDS-PAGE. These authors defined by western immunoblot 11 and seven major antigenic polypeptides in somatic and excretory/secretory products, respectively, that were recognized by sera from experimentally infected rats. Only two of these polypeptides were common to both types of antigens. A total of nine antigenic polypeptides, ranging from 24 to 137 kDa, were found to be characteristic of somatic products, whereas five polypeptides, weighing from 28 to 117 kDa, were characteristics of excretory/secretory antigens. Of particular interest was a 37-kDa polypeptide. This polypeptide was detected at 6 wpi although its intensity progressively decreased during the course of infection. This suggested that this polypeptide may be specifically expressed during the juvenile phases of the parasite and may be of interest since ESPs released by newly excysted metacercariae seem to be involved in the early stimulation of the B-cell mediated responses in E. caproni infections. In a similar study, Carpena et al. (2007) compared the ESPs and somatic antigens of E. friedi experimentally obtained from rats and hamsters. They observed the existence of several polypeptides that were specifically expressed depending on the host species. Eleven polypeptides were exclusively detected in materials of E. friedi collected from hamsters and seven were specifically expressed by rats infected with E. friedi. Recently, the application of more modern technologies, such as twodimensional SDS-PAGE or liquid chromatography followed by mass spectrometry, have allowed for the identification of several proteins in ESPs that may be of further aid to solve biological questions related to echinostome infections. These approaches have been focused on the identification of proteins implicated in the host–parasite interface and the host immune response (Marcilla, 2009). Bernal et al. (2006) identified 10 proteins from the ESPs of E. friedi obtained from rats (acute infection) and hamsters (chronic infection), including cytoskeletal proteins such as actin, tropomyosin and paramyosin; glycolitic enzymes, such as enolase, glyceraldehydes 3P dehydrogenase and aldolase; detoxifying enzymes such as glutathione S-transferase


191

(GST) and stress proteins such as Hsp70. Interestingly, both actin and, to a lesser extent, Hsp70, exhibited differential expression patterns between chronic and acute infections, suggesting that these proteins may play a role on the parasite survival within the host. Further studies on the Hsp70 were performed by Higoń et al. (2008), who cloned and expressed E. caproni Hsp70 in Escherichia coli. Moreover, they demonstrated the presence of this protein in the parasite surface and in other structures, including eggs, by immunochemistry. Studies of protein and mRNA expression revealed a distinct pattern depending on the host (low or high compatible). Higoń et al. (2008) showed a higher level of transcription and Hsp70 secretion from E. caproni from a high compatible host (hamster) compared with a low compatible host (rat). Since no differences were observed in the amount of E. caproni Hsp70 either in somatic lysates or surface materials, the increase of transcription in E. caproni from hamsters could correlate with a higher secretion of the molecule, which in turn could facilitate the parasite establishment in the host of, and/or modulate, the host response. In support of this notion, Toledo et al. (2006c) showed an enrichment of parasite ESP in the intestinal mucosa in the host together with a higher mucosal damage by E. caproni in hamsters than in rats. Marcilla et al. (2007) expressed and functionally characterized the enolase from ESPs of E. caproni. One of the most interesting features is the presence of enolase in ESPs. The predicted amino acid sequence of the E. caproni enolase did not reveal a signal peptide, although a conserved region at the N-terminus was suggested to act as a signal peptide for Trichinella spiralis enolase (Nakada et al., 2005). The presence of enolase in ESPs of E. caproni was suggested to be of important since: (i) it is one of the most expressed proteins in ESPs and (ii) it may play an essential role in the host–parasite interactions. To characterize the E. caproni enolase functionally both the recombinant protein and the native one (in ESP extracts) were subjected to a plasminogen-binding in vitro assay. This assay has been used to demonstrate the potential of binding and activating human plasminogen and produce plasmin-mediated proteolysis such as degradation of host’s extracellular matrix (Marcilla et al., 2007). The ability of E. caproni enolase to bind plasminogen may be of great importance for worm establishment in the host, allowing the attachment to the mucosa or the erosion of the villi. Recently, Sotillo et al. (2008) identified several antigenic proteins from E. caproni ESPs recognized by IgM, IgA and IgG sub-classes from the sera of E. caproni-infected mice using an immunoproteomic approach. Eleven protein spots from those recognized by these immunoglobulin classes after two-dimensional SDS-PAGE and western-blot analysis of ESPs of E. caproni were accurately identified. These spots corresponded to four different proteins (enolase, Hsp70, actin and aldolase). Enolase was recognized in eight different spots of which seven were detected in the


191

(GST) and stress proteins such as Hsp70. Interestingly, both actin and, to a lesser extent, Hsp70, exhibited differential expression patterns between chronic and acute infections, suggesting that these proteins may play a role on the parasite survival within the host. Further studies on the Hsp70 were performed by Higoń et al. (2008), who cloned and expressed E. caproni Hsp70 in Escherichia coli. Moreover, they demonstrated the presence of this protein in the parasite surface and in other structures, including eggs, by immunochemistry. Studies of protein and mRNA expression revealed a distinct pattern depending on the host (low or high compatible). Higoń et al. (2008) showed a higher level of transcription and Hsp70 secretion from E. caproni from a high compatible host (hamster) compared with a low compatible host (rat). Since no differences were observed in the amount of E. caproni Hsp70 either in somatic lysates or surface materials, the increase of transcription in E. caproni from hamsters could correlate with a higher secretion of the molecule, which in turn could facilitate the parasite establishment in the host of, and/or modulate, the host response. In support of this notion, Toledo et al. (2006c) showed an enrichment of parasite ESP in the intestinal mucosa in the host together with a higher mucosal damage by E. caproni in hamsters than in rats. Marcilla et al. (2007) expressed and functionally characterized the enolase from ESPs of E. caproni. One of the most interesting features is the presence of enolase in ESPs. The predicted amino acid sequence of the E. caproni enolase did not reveal a signal peptide, although a conserved region at the N-terminus was suggested to act as a signal peptide for Trichinella spiralis enolase (Nakada et al., 2005). The presence of enolase in ESPs of E. caproni was suggested to be of important since: (i) it is one of the most expressed proteins in ESPs and (ii) it may play an essential role in the host–parasite interactions. To characterize the E. caproni enolase functionally both the recombinant protein and the native one (in ESP extracts) were subjected to a plasminogen-binding in vitro assay. This assay has been used to demonstrate the potential of binding and activating human plasminogen and produce plasmin-mediated proteolysis such as degradation of host’s extracellular matrix (Marcilla et al., 2007). The ability of E. caproni enolase to bind plasminogen may be of great importance for worm establishment in the host, allowing the attachment to the mucosa or the erosion of the villi. Recently, Sotillo et al. (2008) identified several antigenic proteins from E. caproni ESPs recognized by IgM, IgA and IgG sub-classes from the sera of E. caproni-infected mice using an immunoproteomic approach. Eleven protein spots from those recognized by these immunoglobulin classes after two-dimensional SDS-PAGE and western-blot analysis of ESPs of E. caproni were accurately identified. These spots corresponded to four different proteins (enolase, Hsp70, actin and aldolase). Enolase was recognized in eight different spots of which seven were detected in the


193

Ataev, G.L., Dobrovol’skii, A.A., Fournier, A., Jourdane, J., 1997. Migration and development of mother sporocysts of Echinostoma caproni (Digenea: Echinostomatidae). J. Parasitol. 83, 444–453. Ataev, G.L., Dobrovol’skii, A.A., Isakova, N.P., 2005. [Development of the partenitae infrapopulation of Echinostoma caproni (Trematoda: Echinostomatidae)]. Parazitologiia 39, 124–136 (in Russian). Ataev, G.L., Isakova, N.P., Dobrovol’skii, A.A., 2006. [Development of mother sporocysts of Echinostoma caproni (Trematoda: Echinostomatidae)]. Parazitologiia 40, 47–56 (in Russian). Balfour, C.D., Rossi, M., Fried, B., 2001. Effects of a 100 metacercarial cyst inoculum on the host–parasite relationship of Echinostoma caproni and ICR mice. J. Helminthol. 75, 321–324. Bayne, C.J., Hahn, U.K., Bender, R.C., 2001. Mechanisms of molluscan host resistance and of parasite strategies for survival. Parasitology 123, S159–S167. Beasley, R., Faeh, S.A., Wikoff, B., Eisold, J., Nichols, D., Cole, R., et al., 2005. Risk factors and the decline of the cricket frog, Acris crepitans: Evidence for involvement of herbicides, parasitism, and habitat modifications. In: Lannoo, (Ed.), Amphibian Declines: The Conservation Status of United States Species, University of Chicago Press, Chicago, pp. 75–87. Beaver, P.C., 1937. Experimental studies on Echinostoma revolutum (Froelich) a fluke from birds and mammals. Ill. Biol. Monogr. 15, 1–96. Belizario, Y., Geronilla, G.G., Anastacio, M.B.M., de Leon, W.U., Suba-an, A.P., Sebastian, A.C., et al., 2007. Echinostoma malayanum infection, in the Philippines. Emerg. Infect. Dis. 13, 1130–1131. Bernal, D., Carpena, I., Espert, A.M., De la Rubia, J.E., Esteban, J.G., Toledo, R., Marcilla, A., 2006. Identification of proteins in excretory/secretory extracts of Echinostoma friedi (Trematoda) from chronic and acute infections. Proteomics 6, 2835–2843. Bender, R.C., Broderick, E.J., Goodall, C.P., Bayne, C.J., 2005. Respiratory burst of Biomphalaria glabrata hemocytes: Schistosoma mansoni-resistant snails produce more extracellular H2O2 than susceptible snails. J. Parasitol. 91, 275–279. Bergmann, S., Rohde, M., Hammerschmidt, S., 2004. Glyceraldehyde-3-phosphate dehydrogenase of Streptococcus pneumoniae is a surface-displayed plasminogen-binding protein. Infect. Immun. 72, 2416–2419. Bindseil, E., Christensen, N.O., 1984. Thymus-independent crypt hyperplasia and villous atrophy in the small intestine of mice infected with the trematodecc Echinostoma revolutum. Parasitology 88, 431–438. Bouchut, A., Coustau, C., Gourbal, B., Mitta, G., 2007. Compatibility in the Biomphalaria glabrata/Echinostoma caproni model: New candidate genes evidenced by a suppressive subtractive hybridization approach. Parasitology 134, 575–588. Bouchut, A., Roger, E., Coustau, C., Gourbal, B., Mitta, G., 2006a. Compatibility in the Biomphalaria glabrata/Echinostoma caproni model: Potential involvement of adhesion genes. Int. J. Parasitol. 36, 175–184. Bouchut, A., Sautiere, P.E., Coustau, C., Mitta, G., 2006b. Compatibility in the Biomphalaria glabrata/Echinostoma caproni model: Potential involvement of proteins from hemocytes revealed by a proteomic approach. Acta Trop. 98, 234–246. Bower, S.M., McGladdery, S.F., Price, I.M., 1994. Synopsis of infectious diseases and parasites of commercially exploited shellfish. Ann. Rev. Fish Dis. 4, 1–199. Brunet, L.R., Joseph, S., Dunne, D.W., Fried, B., 2000. Immune responses during the acute stages of infection with the intestinal trematode Echinostoma caproni. Parasitology 120, 565–571. Budischak, S.A., Belden, L.K., Hopkins, W.A., 2008a. Effects of Malathion on embryonic development and latent susceptibility to trematode parasites in ranid tadpoles. Environ. Toxicol. Chem. 27, 2496–2500.

194


Budischak, S.A., Belden, L.K., Hopkins, W.A., 2008b. Relative toxicity of Malathion to trematode-infected and noninfected Rana palustris tadpoles. Arch. Environ. Contam. Toxicol. 56, 123–128. Carpena, I., Espert, A., Munõz-Antoli, C., Marcilla, A., Esteban, J.G., Toledo, R., 2007. Antigenic characterization of Echinostoma friedi (Trematoda) in hamsters and rats experimentally infected. Rev. Iber. Parasitol. 67, 127–134. Chai, J.Y., 2009. Echinostomes in humans. In: Fried, Toledo, (Eds.), The Biology of Echinostomes, Chap. 7, Springer, New York, pp. 147–183. Cheng, T.C., 1968. The compatibility and incompatibility concept as related to trematodes and molluscs. Pac. Sci. 12, 141–160. Cho, Y.K., Ryang, Y.S., Kim, I.S., Park, S.K., Im, J.A., Lee, K.J., 2007. Differential immune profiles following experimental Echinostoma hortense infection in BALB/c and C3H/hen mice. Parasitol. Res. 100, 1053–1061. Christensen, N.O., Simonsen, P.E., Odaibo, A.B., Mahler, H., 1990. Establishment, survival and fecundity of Echinostoma caproni (Trematoda) infections in hamsters and jirds. J. Helm. Soc. Wash. 57, 104–107. Coustau, C., Ataev, G., Jourdane, J., Yoshino, T.P., 1997. Schistosoma japonicum: In vitro cultivation of miracidium to daughter sporocysts using a Biomphalaria embryonic cell line. Exp. Parasitol. 8, 77–87. Coustau, C., Yoshino, T.P., 2000. Flukes without snails: Advances in the in vitro cultivation of intramolluscan stages of trematodes. Exp. Parasitol. 94, 62–66. Coustau, C., Yoshino, T.P., 1994. Schistosoma mansoni: Modulation of hemocyte surface polypeptides detected in individual snails, Biomphalaria glabrata, following larval exposure. Exp. Parasitol. 79, 1–10. Coustau, C., Gourbal, B., Mitta, G., Adema, C., 2009. Echinostomes and snails: Exploring complex interactions. In: Fried, Toledo, (Eds.), The Biology of Echinostomes, Chap. 2, Springer, New York, pp. 35–59. DeGaffe, G., Loker, E.S., 1998. Susceptibility of Biomphalaria glabrata to infection with Echinostoma paraensei: Correlation with the effect of parasite secretory-excretory products on host hemocyte spreading. J. Invertebr. Pathol. 71, 64–72. Esteban, J.G., Munõz-Antolı´, C., 2009. Echinostomes: Systematics and life cycles. In: Fried, Toledo, (Eds.), The Biology of Echinostomes, Chap. 1, Springer, New York, pp. 1–34. Evans, N.A., 1982. Effects of copper and zinc upon the survival and infectivity of Echinoparyphium recurvatum cercariae. Parasitology 85, 295–303. Franco, J., Huffman, J.E., Fried, B., 1986. Infectivity, growth, and development of Echinostoma revolutum (Digenea: Echinostomatidae) in the golden hamster, Mesocricetus auratus. J. Parasitol. 72, 142–147. Franco, J., Huffman, J.E., Fried, B., 1988. The effects of crowding of adults of Echinostoma revolutum (Digenea: Echinostomatidae) in experimentally infected golden hamsters, Mesocricetus auratus. J. Parasitol. 74, 240–243. Frazer, B.A., Fried, B., Fujino, T., Sleckman, B.P., 1999. Host–parasite relationships between Echinostoma caproni and RAG-2-deficient mice. Parasitol. Res. 85, 337–342. Fried, B., 1994. Metacercarial excystment of trematodes. Adv. Parasitol. 33, 91–144. Fried, B., 2000. Maintenance, cultivation, and excystation of echinostomes. In: Fried, Gracyzk, (Eds.), Echinostomes as Experimental Models for Biological Research, Kluwer Academic Publishers, Dordrecht, pp. 99–118. Fried, B., 2001. Biology of echinostomes except Echinostoma. Adv. Parasitol. 49, 163–210. Fried, B., Awatramani, R., 1992. Light and scanning electron microscopic observations of the daughter rediae of Echinostoma trivolvis (Trematoda). Parasitol. Res. 78, 257–259. Fried, B., Bandstra, S.R., 2005. Age of adult worms of Echinostoma caproni does not affect development of miracidia. J. Parasitol. 91, 1220–1221.


195

Fried, B., Fujino, M.C., 1987. Argentophilic and scanning electron microscopic observation of the tegumentary papillae of Echinostoma revolutum (Trematoda) cercariae. J. Parasitol. 73, 1169–1174. Fried, B., Graczyk, T.K., 2004. Recent advances in the biology of Echinostoma species in the ‘‘revolutum’’ group. Adv. Parasitol. 58, 139–195. Fried, B., Huffman, J.E., 1996. The biology of the intestinal trematode Echinostoma caproni. Adv. Parasitol. 38, 311–368. Fried, B., Peoples, R.C., 2007. Effects of various physical and chemical factors on excystation of the encysted metacercariae of Echinostoma caproni. J. Parasitol. 93, 1388–1391. Fried, B., Peoples, R.C., 2009. Longevity of Echinostoma caproni in Balb/c mice. J. Helminthol. 82, 95–96. Fried, B., Reddy, A., 1999. Effects of snail-conditioned water from Biomphalaria glabrata on hatching of Echinostoma caproni miracidia. Parasitol. Res. 85, 155–157. Fried, B., Toledo, R., 2004. Criteria for species determination in the ‘‘revolutum’’ group of Echinostoma. J. Parasitol. 90, 917. Fried, B., Donovick, R.A., Emili, S., 1988. Infectivity, growth and development of Echinostoma liei (Trematoda) in the domestic chick. Int. J. Parasitol. 18, 179–181. Fried, B., Emili, S., Ettinger, W.S., 1987. Experimental infection of Corbicula fluminea (Bivalvia: Corbiculidae) with Echinostoma revolutum cercariae. J. Parasitol. 73, 655–656. Fried, B., Eyster, L.S., Pechenik, J.A., 1998. Histochemical glycogen and neutral lipid in Echinostoma trivolvis cercariae and effects of exogenous glucose on cercarial longevity. J. Helminthol. 72, 83–85. Fried, B., Frazer, B.A., Reddy, A., 1997a. Chemoattraction and penetration of Echinostoma trivolvis and E. caproni cercariae in the presence of Biomphalaria glabrata, Helisoma trivolvis, and Lymnaea elodes dialysate. Parasitol. Res. 83, 193–197. Fried, B., Graczyk, T.K., Tamang, L., 2004a. Food-borne intestinal trematodiases in humans. Parasitol. Res. 93, 159–170. Fried, B., Pane, P.L., Reddy, A., 1997b. Experimental infection of Rana pipiens tadpoles with Echinostoma trivolvis cercariae. Parasitol. Res. 83, 666–669. Fried, B., Schneck, J.L., Ponder, E.L., 2004b. Effects of tonicity, digestive enzymes and biles salts, and nutrient media on the survival of excysted metacercariae of Echinostoma caproni. Parasitol. Res. 93, 1–4. Fujino, T., Fried, B., 1996. The expulsion of Echinostoma trivolvis from C3H mice: Differences in glycoconjugates in mouse versus hamster small intestinal mucosa during infection. J. Helminthol. 70, 115–121. Fujino, T., Fried, B., 1993a. Expulsion of Echinostoma trivolvis (Cort, 1914) Kanev, 1985 and retention of E. caproni Richard, 1964 (Trematoda, Echinostomatidae) in C3H mice: Pathological, ultrastructural, and cytochemical effects on the host intestine. Parasitol. Res. 79, 286–292. Fujino, T., Fried, B., 1993b. Echinostoma caproni and E. trivolvis alter the binding of glycoconjugates in the intestinal mucosa of C3H mice as determined by lectin histochemistry. J. Helminthol. 67, 179–188. Fujino, T., Fried, B., Tada, I., 1993. The expulsion of Echinostoma trivolvis: Worm kinetics and intestinal cytopathology in conventional and congenitally athymic BALB/c mice. Parasitology 106, 297–304. Fujino, T., Fried, B., Ichikawa, H., Tada, I., 1996a. Rapid expulsion of the intestinal trematodes Echinostoma trivolvis and E. caproni from C3H mice by trapping with increased goblet cell mucins. Int. J. Parasitol. 26, 319–324. Fujino, T., Ichikawa, H., Fried, B., 1998b. The immunosuppressive compound FK506 does not affect expulsion of Echinostoma trivolvis in C3H mice. Parasitol. Res. 84, 519–521. Fujino, T., Ichikawa, H., Fried, B., Fukuda, K., 1996b. The expulsion of Echinostoma trivolvis: Suppressive effects of dexamethasone on goblet cell hyperplasia and worm rejection in C3H/HeN mice. Parasite 3, 283–289.

196


Fujino, T., Ichikawa, H., Fried, B., Fukuda, K., 1997. The expulsion of Echinostoma trivolvis: Worm kinetics and intestinal reactions in C3H/hen mice treated with dexamethasone. J. Helminthol. 71, 257–259. Fujino, T., Ichikawa, H., Fukuda, K., Fried, B., 1998a. The expulsion of Echinostoma trivolvis caused by goblet cell hyperplasia in severe combined immunodeficient (SCID) mice. Parasite 5, 219–222. Fujino, T., Nakano, T., Washioka, H., Tonosaki, A., Ichikawa, H., Fried, B., 2000. Comparative ultrastructure of eggs in Echinostoma paraensei, E. caproni and E. trivolvis (Trematoda: Echinostomatidae). Parasitol. Res. 86, 427–430. Fujino, T., Yamada, M., Ichikawa, H., Fried, B., Arizono, N., Tada, I., 1996c. Rapid expulsion of the intestinal trematodes Echinostoma trivolvis and E. caproni from C3H/hen mice after infection with Nippostrongylus brasiliensis. Parasitol. Res. 82, 577–579. Graczyk, T.K., 2000. Immunobiology and immunodiagnosis of echinostomiasis. In: Fried, Gracyzk, (Eds.), Echinostomes as Experimental Models for Biological Research, Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 229–244. Graczyk, T.K., Fried, B., 1994. ELISA method for detecting anti-Echinostoma caproni (Trematoda: Echinostomatidae) immunoglobulins in experimentally infected ICR mice. J. Parasitol. 80, 544–549. Graczyk, T.K., Fried, B., 1998. Echinostomiasis: A common but forgotten food-borne disease. Am. J. Trop. Med. Hyg. 58, 501–504. Griggs, J.L., Belden, L.K., 2007. Effects of atrazine and metolachlor on the survivorship and infectivity of Echinostoma trivolvis trematode cercariae. Arch. Environ. Contam. Toxicol. 54, 195–202. Guillou, F., Mitta, G., Galinier, R., Coustau, C., 2007a. Identification and expression of transcripts generated during an anti-parasitic response in Biomphalaria glabrata. Dev. Comp. Immunol. 31, 657–671. Guillou, F., Roger, E., Mone´, Y., Rognon, A., Grunau, C., Theroń, A., et al., 2007b. Excretorysecretory proteome of larval Schistosoma mansoni and Echinostoma caproni, two parasites of Biomphalaria glabrata. Mol. Biochem. Parasitol. 155, 45–56. Haas, W., 1994. Physiological analyses of host-finding behaviour in trematode cercariae: Adaptations for transmission success. Parasitology 109, S15–S29. Haas, W., Haberl, B., Kalbe, M., Ko¨rner, M., 1995a. Snail-host finding by miracidia and cercariae: Chemical host cues. Parasitol. Today 11, 468–472. Haas, W., Ko¨rner, M., Hutterer, E., Wegner, M., Haberl, B., 1995b. Finding and recognition of the snail intermediate hosts by 3 species of echinostome cercariae. Parasitology 110, 133–142. Haas, W., 2000. The behavioral biology of echinostomes. In: B. Fried, T. K. Gracyzk, (Eds.), Echinostomes as Experimental Models for Biological Research, Kluwer Academic Publishers, Dordrecht, pp. 175–197. Haberl, B., Ko¨rner, M., Spengler, Y., Hertel, J., Kalbe, M., Haas, W., 2000. Host-finding in Echinostoma caproni: Miracidia and cercariae use different signals to identify the same snail species. Parasitology 120, 470–496. Hahn, U.K., Bender, R.C., Bayne, C.J., 2001. Involvement of nitric oxide in killing of Schistosoma mansoni sporocysts by hemocytes from resistant Biomphalaria glabrata. J. Parasitol. 87, 778–785. Hertel, L.A., Adema, C.M., Loker, E.S., 2005. Differential expression of FREP genes in two strains of Biomphalaria glabrata following exposure to the digenetic trematodes Schistosoma mansoni and Echinostoma paraensei. Dev. Comp. Immunol. 29, 295–303. Hertel, L.A., Stricker, S.A., Loker, E.S., 2000. Calcium dynamics of hemocytes of the gastropod Biomphalaria glabrata: Effects of digenetic trematodes and selected bioactive compounds. Invertebr. Biol. 119, 27–37.


197

Holland, M.P., Skelly, D.K., Kashgariam, M., Bolden, S.R., Harrison, L.M., Cappello, M., 2006. Echinostome infection in green frogs (Rana clamitans) is stage and age dependent. J. Zool. 271, 455–462. Hosier, D.W., Fried, B., 1986. Infectivity, growth, and distribution of Echinostoma revolutum (Trematoda) in Swiss webster and ICR mouse. Proc. Helminthol. Soc. Wash. 53, 173–176. Huffman, J.E., 2000. Echinostomes in veterinary and wildlife parasitology. In: Fried, Gracyzk, (Eds.), Echinostomes as Experimental Models for Biological Research, Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 59–82. Huffman, J.E., Fried, B., 1990. Echinostoma and echinostomiasis. Adv. Parasitol. 29, 215–269. Humbert, E., Coustau, C., 2001. Refractoriness of host haemocytes to parasite immunosuppressive factors as a putative resistance mechanism in the Biomphalaria glabrata–Echinostoma caproni system. Parasitology 122, 651–660. Humphries, J.E., Mousley, A., Maule, A.G., Halton, D.W., 2000. Neuromusculature structure and functional correlates. In: Fried, Gracyzk, (Eds.), Echinostomes as Experimental Models for Biological Research, Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 213–227. Humphries, J.E., Reddy, A., Fried, B., 1997. Infectivity and growth of Echinostoma revolutum (Froelich, 1802) in the domestic chick. Int. J. Parasitol 27, 129–130. Ishikawa, N., Horii, Y., Nawa, Y., 1993. Immune-mediated alteration of the terminal sugars of goblet cell mucins in the small intestine of Nippostrongylus brasiliensis-infected rats. Immunology 78, 303–307. Ishikawa, N., Horii, Y., Oinuma, T., Suganuma, T., Nawa, Y., 1994. Goblet cell mucins as the selective barrier for the intestinal helminths: T-cell-independent alteration of goblet cell mucins by immunologically ‘damaged’ Nippostrongylus brasiliensis worms and its significance on the challenge infection with homologous and heterologous parasites. Immunology 81, 480–486. Iskova, N.I., 1985. Trematoda. Vol. 4. Echinostomata. In Fauna Ukrainy, Naukova Dumka, Kiev, Russia, p. 198. Jiang, Y., Loker, E.S., Zhang, S.M., 2006. In vivo and in vitro knockdown of FREP2 gene expression in the snail Biomphalaria glabrata using RNA interference. Dev. Comp. Immunol. 30, 855–866. Johnson, P.T., McKenzie, V.J., 2009. Effects of environmental change on helminth infections in amphibians: Exploring the emergence of Ribeiroia and Echinostoma infections in North America. In: Fried, Toledo, (Eds.), The Biology of Echinostomes, Chap. 11, Springer, New York, pp. 249–280. Johnson, P.T., Sutherland, D.R., 2003. Amphibian deformities and Ribeiroia infection: An emerging helminthiasis. Treds Parasitol. 19, 332–335. Johnson, P.T.J., Lunde, K.B., Ritchie, E.G., Launer, A.E., 1999. The effect of trematode infection on amphibian limb development and survivorship. Science 284, 802–804. Jolodar, A., Fischer, P., Bergmann, S., Bu¨ttner, D.W., Hammerschmidt, S., Brattig, N.W., 2003. Molecular cloning of an alpha-enolase from the human filarial parasite Onchocerca volvulus that binds human plasminogen. Biochem. Biophys. Acta 1627, 111–120. Kanev, I., 1994. Life-cycle, delimitation and redescription of Echinostoma revolutum (Fro¨lich, 1802) (Trematoda: Echinostomatidae). Syst. Parasitol. 28, 125–144. Kanev, I., Fried, B., Dimitrov, V., Radev, V., 1995a. Redescription of Echinostoma trivolvis (Cort, 1914) (Trematoda, Echinostomatidae) with a discussion on its identity. Syst. Parasitol. 32, 61–70. Kanev, I., Fried, B., Dimitrov, V., Radev, V., 1995b. Redescription of Echinostoma jurini (Skvortzov, 1924) with a discussion of its identity and characteristics. Ann. Nat. Museums Wien B 97, 37–53. Kanev, I., Sterner, M., Radev, V., Fried, B., 2000. An overview of the biology of Echinostomes. In: Fried, Gracyzk, (Eds.), Echinostomes as Experimental Models for Biological Research, Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 1–29.

198


Kechemir, N., Jourdane, J., Mas-Coma, S., 2002. Life cycle of a new African echinostome species reproducing by parthenogenesis. J. Nat. Hist. 36, 1777–1784. Keeler, S.P., Huffman, J.E., 2009. Echinostomes in the second intermediate host. In: Fried, Toledo, (Eds.), The Biology of Echinostomes, Chap. 3, Springer, New York, pp. 61–87. Kim, I., Im, J.A., Lee, K.J., Ryang, Y.S., 2000. Mucosal mast cell responses in the small intestine of rats infected with Echinostoma hortense. Korean J. Parasitol. 38, 139–143. Kolberg, J., Aase, A., Bergmann, S., Herstad, T.K., Rdal, G., Frank, R., et al., 2006. Streptococcus pneumoniae enolase is important for plasminogen binding despite low abundance of enolase protein on the bacterial cell surface. Microbiology 152, 1307–1317. Koprivnikar, J., Forbes, M.R., Baker, R.L., 2006. Effects of atrazine on cercarial longevity, activity, and infectivity. J. Parasitol. 92, 306–311. Koprivnikar, J., Forbes, M.R., Baker, R.L., 2008. Larval amphibian growth and dvelopment under varying density: Are parasitized individuals poor competitors? Oecologia 155, 641–649. Ko¨rner, M., Haas, W., 1998a. Chemo-orientation of echinostome cercariae towards their snail-hosts: Amino acids signal a low host-specificity. Int. J. Parasitol. 28, 511–516. Ko¨rner, M., Haas, W., 1998b. Chemo-orientation of echinostome cercariae towards their snail-hosts: The stimulating structure of amino acids and other attractans. Int. J. Parasitol. 28, 517–525. Kostadinova, A., 1995. Echinostoma echinatum (Zeder, 1803) sensu Kanev 1932 (Digenea: Echinostomatidae): A note of caution. Syst. Parasitol. 32, 23–26. Kostadinova, A., 1999. Cercarial chaetotaxy of Echinostoma miyagawai Ishii, 1932 (Digenea: Echinostomatidae), with a review of the sensory patterns in the ‘‘revolutum’’ group. Syst. Parasitol. 44, 201–209. Kostadinova, A., Gibson, D.I., 2000. The systematics of the echinostomes. In: Fried, Gracyzk, (Eds.), Echinostomes as Experimental Models for Biological Research, Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 31–57. Kostadinova, A., Gibson, D.I., Biserkov, V., Chipev, N., 2000. Re-validation of Echinostoma miyagawai Ishii, 1932 (Digenea: Echinostomatidae) on the basis of the experimental completion of its life-cycle. Syst. Parasitol. 45, 81–108. Kostadinova, A., Herniou, E.A., Barrett, J., Littlewood, D.T.J., 2003. Phylogenetic relationships of Echinostoma Rudolphi, 1809 (Digenea: Echinostomatidae) and related genera re-assessed via DNA and morphological analyses. Syst. Parasitol. 54, 159–176. Kuris, A.M., Warren, J., 1980. Echinostome cercarial penetration and metacercarial encystment as mortality factors for a second intermediate host, Biomphalaria glabrata. J. Parasitol. 66, 630–635. Lardans, V., Dissous, C., 1998. Snail control strategies for reduction of schistosomiasis transmission. Parasitol. Today 14, 413–417. Laruelle, F., Molloy, D.P., Roitman, A., 2002. Histological analysis of trematodes in Dreissena polymorpha: Their location, pathogenicity, and distinguishing morphological characteristics. J. Parasitol. 88, 856–863. Lee, K.J., Park, S.K., Im, J.A., Kim, S.K., Kim, G.H., Kim, G.Y., et al., 2004. Susceptibility of several strains of mice to Echinostoma hortense infection. Korean J. Parasitol. 42, 51–56. Leónard, P.M., Adema, C.M., Zhang, S.M., Loker, E.S., 2001. Structure of two FREP genes that encode igsf and fibrinogen domains, with comments on diversity of the FREP gene family in the snail Biomphalaria glabrata. Gene 269, 155–165. Loker, E.S., Adema, C.M., 1995. Schistosomes, echinostomes and snails: Comparative immunobiology. Parasitol. Today 11, 120–124. Loker, E.S., Bayne, C.J., 1986. Immunity to trematode larvae in the snail Biomphalaria. Symp. Zool. Soc. Lond. 56, 199–220. Loker, E.S., Hertel, L.A., 1987. Alterations in Biomphalaria glabrata plasma induced by infection with the digenetic trematode Echinostoma paraensei. J. Parasitol. 73, 503–513.


199

Mahler, H., Christensen, N.O., Hindsbo, O., 1995. Studies on the reproductive capacity of Echinostoma caproni (Trematoda) in hamsters and jirds. Int. J. Parasitol. 25, 705–710. Maldonado, A., Jr., Vieria, G.O., Garcia, J.S., Rey, L., Lanfredi, R.M., 2001. Biological aspects of a new isolate of Echinostoma paraensei (Trematoda: Echinostomatidae): Susceptibility of sympatric snails and the natural vertebrate host. Parasitol. Res. 87, 853–859. Maldonado, A., Vieira, G.O., Lanfredi, R.M., 2003. Echinostoma luisreyi n. sp. (Playthelminthes: Digenea) by light and scanning electron microscopy. J. Parasitol. 89, 800–808. Manger, P.M., Jr., Fried, B., 1993. Infectivity, growth and distribution of preovigerous adults of Echinostoma caproni in ICR mice. J. Helminthol. 67, 158–160. Marcilla, A., 2009. Echinostomes: Genomics and proteomics. In: Fried, Toledo, (Eds.), The Biology of Echinostomes, Chap. 9, Springer, New York, pp. 207–228. Martin, T.R., Conn, D.B., 1990. The pathogenicity, localization, and cyst structure of echinostomatid metacercariae (Trematoda) infecting the kidneys of the frogs Rana clamitans and Rana pipiens. J. Parasitol. 76, 414–419. McCarthy, A.M., 1999a. Photoperiodic cercarial emergence patterns of the digeneans Echinoparyphium recurvatun and Plagiorchis sp. from a mixed infection in Lymnaea peregra. J. Helminthol. 73, 63–65. McCarthy, A.M., 1999b. The influence of temperature on the survival and infectivity of the cercariae of Echinoparyphium recurvatun (Digenea: Echinostomatidae). Parasitology 118, 383–388. Medzhitov, R., Janeway, C., Jr., 2000. Innate immune recognition: Mechanisms and pathways. Immunol. Rev. 173, 89–97. Monroy, F., Hertel, L.A., Loker, E.S., 1992. Carbohydrate-binding plasma proteins from the gastropod Biomphalaria glabrata: Strain specificity and the effects of trematode infection. Dev. Comp. Immunol. 16, 355–366. Monroy, F.P., Loker, E.S., 1993. Production of heterogeneous carbohydrate-binding proteins by the host snail Biomphalaria glabrata following exposure to Echinostoma paraensei and Schistosoma mansoni. J. Parasitol. 79, 416–423. Morgan, J.A.T., Blair, D., 1995. Nuclear rdna ITS sequence variation in the trematode genus Echinostoma: An aid to establishing relationships within the 37-collar-spine group. Parasitology 111, 609–615. Morgan, J.A.T., Blair, D., 1998a. Mitochondrial ND1 gene sequence used to identify echinostome isolates from Australia and New Zealand. Int. J. Parasitol. 28, 493–502. Morgan, J.A.T., Blair, D., 1998b. Relative merits of nuclear ribosomal internal transcribed spacers and mitochondrial CO1 and ND1 genes for distinguishing among Echinostoma species (Trematoda). Parasitology 116, 289–297. Morgan, J.A.T., Blair, D., 2000. Molecular biology of echinostomes. In: Fried, Gracyzk, (Eds.), Echinostomes as Experimental Models for Biological Research, Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 245–266. Morley, N.J., Adam, M.E., Lewis, J.W., 2007. The effects of temperature on the distribution and establishment of Echinoparyphium recurvatum metacercariae in Lymnaea peregra. J. Helminthol. 81, 311–315. Morley, N.J., Crane, M., Lewis, J.W., 2002. Toxic effects of cadmium and zinc on the transmission of Echinoparyphium recurvatum cercariae. J. Helminthol. 76, 157–163. Morley, N.J., Leung, K.M.Y., Morritt, D., Crane, M., 2004. Toxicity of anti-fouling biocides to encysted metacercariae of Echinoparyphium recurvatum (Digenea: Echinostomatidae) and their snail hosts. Chemosphere 56, 353–358. Mucha, K.H., Huffman, J.E., Fried, B., 1990. Mallard ducklings (Anas platyrhynchos) experimentally infected with Echinostoma trivolvis (Digenea). J. Parasitol. 76, 590–592. Munõz-Antoli, C., Carpena, I., Espert, A., Esteban, J.G., Toledo, R., 2004. The effect of host species on the development of Echinostoma friedi (Trematoda: Echinostomatidae) adult worms. Rev. Iber. Parasitol. 64, 81–87.

200


Munõz-Antolı´, C., Marin, A., Vidal, A., Toledo, R., Esteban, J.G., 2008. Euparyphium albuferensis and Echinostoma friedi (Trematoda: Echinostomatidae): Experimental cercarial transmission success in sympatric snail communities. Folia Parasitol. 55, 122–126. Munõz-Antoli, C., Sotillo, J., Monteagudo, C., Fried, B., Marcilla, A., Toledo, R., 2007. Development and pathology of Echinostoma caproni in experimentally infected mice. J. Parasitol. 93, 854–859. Munõz-Antolı´, C., Toledo, R., Esteban, J.G., 2000. The life cycle and transmission dynamics of the larval stages of Hypoderaeum conoideum. J. Helminthol. 74, 165–172. Munõz-Antolı´, C., Trelis, M., Espert, A., Toledo, R., Esteban, J.G., 2002. Survival and infectivity of Echinostoma friedi (Trematoda: Echinostomatidae) miracidia and cercariae under experimental conditions. Helminthologia 39, 149–154. Munõz-Antolı´, C., Trelis, M., Gozalbo, M., Toledo, R., Haberl, B., Esteban, J.G., 2003. Interactions related to non-host snails in the host-finding process of Euparyphium albuferensis and Echinostoma friedi (Trematoda: Echinostomatidae) miracidia. Parasitol. Res. 91, 353–356. Munõz-Antolı´, C., Trelis, M., Toledo, R., Esteban, J.G., 2006. Infectivity of Echinostoma friedi miracidia to different snail species under experimental conditions. J. Helminthol. 80, 323–325. Nakada, T., Nagano, I., Wu, Z., Takahashi, Y., 2005. Molecular cloning and functional expression of enolase from Trichinella spiralis. Parasitol. Res. 96, 354–360. Nakano, T., Fujino, T., Washioka, H., Tonosaki, A., Goto, K., Fried, B., 2003. Tegumentary papillae of Echinostoma caproni cercariae (Trematoda: Echinostomatidae). Parasitol. Res. 89, 446–450. Noda, S., Loker, E.S., 1989a. Effect of infection with Echinostoma paraensei on the circulating hemocyte population of the host snail Biomphalaria glabrata. Parasitology 98, 35–41. Noda, S., Loker, E.S., 1989b. Phagocytic activity of hemocytes of M-line Biomphalaria glabrata snails: Effect of exposure to the trematode Echinostoma paraensei. J. Parasitol. 75, 261–269. Noland, G.S., Urban, J.F., Fried, B., Kumar, N., 2008. Counter-regulatory anti parasite cytokine responses during concurrent Plasmodium yoelii and intestinal helminth infections in mice. Exp. Parasitol. 119, 272–278. Nollen, P.M., 1996a. The mating behavior of Echinostoma paraensei grown in mice. J. Helminthol. 70, 43–45. Nollen, P.M., 1996b. Mating behavior of Echinostoma caproni and E. paraensei in concurrent infections in mice. J. Helminthol. 70, 133–136. Nollen, P.M., 1997. Mating behavior of Echinostoma caproni and E. trivolvis in concurrent infections in hamsters. Int. J. Parasitol. 27, 71–75. Nollen, P.M., 2000. Reproductive physiology and behavior of echinostomes. In: Fried, Gracyzk, (Eds.), Echinostomes as Experimental Models for Biological Research, Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 137–148. Nowak, T.S., Loker, E.S., 2005. Echinostoma paraensei: Differential gene transcription in the sporocyst stage. Exp. Parasitol. 109, 94–105. Odaibo, A.B., Christensen, N.O., Ukoli, F.M.A., 1988. Establishment, survival and fecundity in Echinostoma caproni (Trematoda) infections in NMRI mice. Proc. Helminthol. Soc. Wash. 55, 265–269. Odaibo, A.B., Christensen, N.O., Ukoli, F.M.A., 1989. Further studies on the population regulation in Echinostoma caproni infections in NMRI mice. Proc. Helminthol. Soc. Wash. 56, 192–198. Park, K.Y., Lee, K.J., Kim, S., Yang, E.J., Lim, S.J., Lim, B.H., et al., 2005. Reaction of mast cells and goblet cells in the small intestine of C57BL/6 and C3H/hen mice infected with Echinostoma hortense. Korean J. Biomed. Lab. Sci. 11, 259–266. Pechenik, J.A., Fried, B., 1995. Effect of temperature on survival and infectivity of Echinostoma trivolvis cercariae: A test of the energy limitation hypothesis. Parasitology 111, 373–378.


201

Pisciotta, J.M., Ponder, E.L., Fried, B., Sullivan, D., 2005. Hemozoin formation in Echinostoma trivolvis rediae. Int. J. Parasitol. 35, 1037–1042. Pinheiro, J., Maldonado, A., Lanfredi, R.M., 2004. Light and scanning electron microscopy of the miracidium of Echinostoma paraensei (Trematoda, Echinostomatidae). Vet. Parasitol. 121, 265–275. Pinheiro, J., Maldonado, A., Atias, M., Lanfredi, R.M., 2005. Ultrastructure of the miracidium of Echinostoma paraensei Lie and Basch, 1967 (Trematoda, Echinostomatidae). Parasitol. Res. 97, 367–372. Ponder, E.L., Fried, B., 2004. Effects of glucose on survival, infectivity and linear movement of the cercariae of Echinostoma caproni. J. Helminthol. 78, 185–187. Ramsay, A.J., 1995. Genetic approaches to the study of cytokine regulation of mucosal immunity. Immunol. Cell Biol. 73, 484–488. Reddy, A., Ponder, E.L., Fried, B., 2004. Effects of copper sulfate toxicity on cercariae and metacercariae of Echinostoma caproni and Echinostoma trivolvis and on the survival of Biomphalaria glabrata snails. J. Parasitol. 90, 1332–1337. Ryang, Y.S., Yang, E.J., Kim, J.L., Lee, K.J., Sung, H.J., Kim, J.B., et al., 2007. Immune response and inhibitory effect of ketotifen on the BALB/c and C3H/hen mice infected with Echinostoma hortense. Parasitol. Res. 101, 1103–1110. Sapp, K.K., Loker, E.S., 2000a. Mechanisms underlying digenean-snail specificity: Role of miracidial attachment and host plasma factors. J. Parasitol. 86, 1012–1019. Sapp, K.K., Loker, E.S., 2000b. A comparative study of mechanisms underlying digeneansnail specificity: in vitro interactions between hemocytes and digenean. J. Parasitol. 86, 1020–1029. Sapp, K.K., Meyer, K.A., Loker, E.S., 1998. Intramolluscan development of the digenean Echinostoma paraensei: Rapid production of a unique mother redia that adversely affects development of conspecific parasites. Invertebr. Biol. 117, 20–28. Schmidt, K.A., Fried, B., 1996. Emergence of cercariae of Echinostoma trivolvis from Helisoma trivolvis under different conditions. J. Parasitol. 82, 674–676. Schotthoefer, A.M., Cole, R.A., Beasley, R., 2003. Relationship of tadpole stage to location of echinostome cercariae encystment and the consequences for tadpole survival. J. Parasitol. 89, 475–482. Sebelova´, S., Stewart, M.T., Mousley, A., Fried, B., Marks, N.J., Halton, D.W., 2004. The musculature and associated innervation of adult and intramolluscan stages of Echinostoma caproni (Trematoda) visualised by confocal microscopy. Parasitol. Res. 93, 196–206. Simonsen, P.E., Andersen, B.J., 1986. Echinostoma revolutum in mice; dynamics of the antibody attack to the surface of an intestinal trematode. Int. J. Parasitol. 16, 475–482. Simonsen, P.E., Estambale, B.B., Agger, M., 1991. Antibodies in the serum of golden hamsters experimentally infected with the intestinal trematode Echinostoma caproni. J. Helminthol. 65, 239–247. Simonsen, P.E., Vennervald, B.J., Birch-Andersen, A., 1990. Echinostoma caproni in mice: Ultrastructural studies on the formation of immune complexes on the surface of an intestinal trematode. Int. J. Parasitol. 20, 935–491. Skelly, D.K., Bolden, S.R., Holland, M.P., Friedenburg, L.K., Friedenfelds, N.A., Malcom, T.R., 2006. Urbanization and disease in amphibians. In: Collinge, Ray, (Eds.), Disease Ecology: Community Structure and Pathogen Dynamics, Oxford University Press, Cary, NC, United States, pp. 153–167. Snapper, C.M., McIntyre, T.M., Mandler, R., Pecanha, L.M.T., Finkelman, F.D., Mond, J.J., 1992. Induction of igg3 secretion by interferon-g: A model for T cell-independent class switching in response to T cell-independent type 2 antigens. J. Exp. Med. 175, 1367–1371. Sorensen, R.E., Curtis, J., Minchella, D.J., 1998. Intraspecific variation in the rdna ITS loci of 37-collar-spined echinostomes from North America: Implications for sequence-based diagnoses and phylogenetics. J. Parasitol. 84, 992–997.

202


Sorensen, R.E., Kanev, I., Fried, B., Minchella, D.J., 1997. The occurrence and identification of Echinostoma revolutum from North American Lymnaea elodes snails. J. Parasitol. 83, 169–170. Sotillo, J., Munõz-Antoli, C., Marcilla, A., Fried, B., Esteban, J.G., Toledo, R., 2007. Echinostoma caproni: Kinetics of IgM, IgA and IgG subclasses in the serum and intestine of experimentally infected rats and mice. Exp. Parasitol. 116, 390–398. Sotillo, J., Valero, L., Sańchez del Pino, M.M., Fried, B., Esteban, J.G., Marcilla, A., et al., 2008. Identification of antigenic proteins from Echinostoma caproni (Trematoda: Echinostomatidae) recognized by mouse immunoglobulins M, A and G using an immunoproteomic approach. Parasite Immunol. 30, 271–279. Stillson, L.L., Platt, T.R., 2007. The crowding effect and morphometric variability in Echinostoma caproni (Digenea: Echinostomatidae) from ICR mice. J. Parasitol. 93, 242–246. Tani, S., Yoshimura, K., 1988. Spontaneous expulsion of Echinostoma hortense Asada, 1926 (Trematoda: Echinostomatidae) in mice. Parasitol. Res. 74, 495–497. Taylor, C.N., Oseen, K.L., Wassersug, R.J., 2004. On the behavioural response of Rana and Bufo tadpoles to echinostomatoid cercariae: Implications to synergistic factors influencing trematode infections in anurans. Can. J. Zool. 82, 701–706. Thiemann, G.W., Wassersug, R.J., 2000a. Biased distribution of trematode metacercariae in the nephric system of Rana tadpoles. J. Zool. 252, 534–538. Thiemann, G.W., Wassersug, R.J., 2000b. Patterns and consequences of the behavioural responses to predators and parasites in Rana tadpoles. Biol. J. Linn. Soc. Lond. 71, 513–528. Toledo, R., 2009a. Echinostomes in the definitive host: A model for the study of host–parasite relationships. In: Fried, Toledo, (Eds.), The Biology of Echinostomes, Chap. 4, Springer, New York, pp. 89–109. Toledo, R., 2009b. Immunology and pathology of echinostome infections in the definitive host. In: Fried, Toledo, (Eds.), The Biology of Echinostomes, Chap. 8, Springer, New York, pp. 185–206. Toledo, R., Fried, B., 2005. Echinostomes as experimental models in adult parasite–vertebrate host interactions. Trends Parasitol. 21, 251–254. Toledo, R., Esteban, J.G., Fried, B., 2006b. Immunology and pathology of intestinal trematodes in their definitive hosts. Adv. Parasitol. 63, 285–365. Toledo, R., Carpena, I., Espert, A., Sotillo, J., Munõz-Antoli, C., Esteban, J.G., 2006a. A quantitative approach to the experimental transmission success of Echinostoma friedi (Trematoda: Echinostomatidae) in rats. J. Parasitol. 92, 16–20. Toledo, R., Espert, A., Carpena, I., Munõz-Antoli, C., Esteban, J.G., 2003a. An experimental study of the reproductive success of Echinostoma friedi (Trematoda: Echinostomatidae) in the golden hamster. Parasitology 126, 433–441. Toledo, R., Espert, A., Carpena, I., Munõz-Antoli, C., Fried, B., Esteban, J.G., 2004b. The comparative development of Echinostoma caproni (Trematoda: Echinostomatidae) adults in experimentally infected hamsters and rats. Parasitol. Res. 93, 439–444. Toledo, R., Espert, A., Carpena, I., Trelis, M., Munõz-Antoli, C., Esteban, J.G., 2004a. Echinostoma friedi: The effect of age of adult worms on the infectivity of miracidia. J. Helminthol. 78, 91–93. Toledo, R., Espert, A., Munõz-Antoli, C., Fried, B., Esteban, J.G., 2004d. Immunological characterization of somatic and excretory/secretory antigens of Echinostoma caproni (Trematoda: Echinostomatidae) in experimentally infected rats. Comp. Parasitol. 71, 42–48. Toledo, R., Espert, A., Munõz-Antoli, C., Marcilla, A., Fried, B., Esteban, J.G., 2003b. Development of an antibody-based capture enzyme-linked immunosorbent assay for detecting Echinostoma caproni (Trematoda) in experimentally infected rats: Kinetics of coproantigen excretion. J. Parasitol. 89, 1227–1231.


203

Toledo, R., Espert, A., Munõz-Antoli, C., Marcilla, A., Fried, B., Esteban, J.G., 2004c. Kinetics of Echinostoma caproni (Trematoda: Echinostomatidae) antigens in feces and serum of experimentally infected hamsters and rats. J. Parasitol. 90, 752–758. Toledo, R., Espert, A., Munõz-Antoli, C., Marcilla, A., Fried, B., Esteban, J.G., 2005. Kinetics of antibodies and antigens in serum of mice experimentally infected with Echinostoma caproni (Trematoda: Echinostomatidae). J. Parasitol. 91, 978–980. Toledo, R., Monteagudo, C., Espert, A., Fried, B., Esteban, J.G., Marcilla, A., 2006c. Echinostoma caproni: Intestinal pathology in the golden hamster, a highly compatible host, and the Wistar rat, a less compatible host. Exp. Parasitol. 112, 164–171. Toledo, R., Munõz-Antolı´, C., Esteban, J.G., 1998a. Cercarial chaetotaxy differences among Hypoderaeum conoideum (Bloch, 1782) (Trematoda: Echinostomatidae) from various European localities. Res. Rev. Parasitol. 58, 83–89. Toledo, R., Munõz-Antolı´, C., Esteban, J.G., 1999c. Production and chronobiology of emergence of the cercariae of Euparyphium albuferensis (Trematoda: Echinostomatidae). J. Parasitol. 85, 263–267. Toledo, R., Munõz-Antolı´, C., Esteban, J.G., 2000. The life-cycle of Echinostoma friedi n. Sp. (Trematoda: Echinostomatidae) in Spain and a discussion on the relationships within the ‘‘revolutum’’ group based on cercarial chaetotaxy. Syst. Parasitol. 45, 199–217. Toledo, R., Munõz-Antolı´, C., Fried, B., 2007. The use of echinostomes to study host–parasite relationships between larval trematodes and invertebrate and cold-blooded vertebrate hosts. Parasitol. Res. 100, 1177–1185. Toledo, R., Munõz-Antolı´, C., Pe´rez, M., Esteban, J.G., 1999a. Encystment sites of metacercariae of Hypoderaeum conoideum (Trematoda: Echinostomatidae) in freshwater gastropods. Folia Parasitol. 46, 157–158. Toledo, R., Munõz-Antolı´, C., Pe´rez, M., Esteban, J.G., 1999b. Miracidial infectivity of Hypoderaeum conoideum (Trematoda: Echinostomatidae): Differential susceptibility of two lymnaeid species. Parasitol. Res. 85, 212–215. Toledo, R., Munõz-Antolı´, C., Pe´rez, M., Esteban, J.G., 1999d. Survival and infectivity of Hypoderaeum conoideum and Euparyphium albuferensis cercariae under laboratory conditions. J. Helminthol. 73, 177–182. Toledo, R., Munõz-Antolı´, C., Sańchez, L., Bayssade-Dufour, Ch., Esteban, J.G., 1998b. Cercarial chaetotaxy of Euparyphium albuferensis Esteban et al., 1997 (Trematoda: Echinostomatidae), with a review of some genera of the Echinostomatinae. Syst. Parasitol 39, 35–44. Trouve, S., Coustau, C., 1998. Differences in adult excretory-secretory products between geographical isolates of Echinostoma caproni. J. Parasitol. 84, 1062–1065. Trouve, S., Coustau, C., 1999. Chemical communication and mate attraction in echinostomes. Int. J. Parasitol. 29, 1425–1432. Trouve, S., Renaud, F., Durand, P., Jourdane, J., 1996. Selfing and outcrossing in a parasitic hermaphrodite helminth (Trematoda, Echinostomatidae). Heredity 77, 1–8. Trouve, S., Renaud, F., Durand, P., Jourdane, J., 1998. Experimental evidence of hybrid breakdown between genetically distinct populations of Echinostoma caproni. Parasitology 117, 133–135. Trouve, S., Renaud, F., Durand, P., Jourdane, J., 1999. Reproductive and mate choice strategies in the hermaphroditic flatworm Echinostoma caproni. J. Hered. 90, 582–585. Vasta, G.R., Ahmed, H., Odom, E.W., 2004. Structural and functional diversity of lectin repertoires in invertebrates, protochordates and ectothermic vertebrates. Curr. Opin. Struct. Biol. 14, 617–630. Viozzi, G., Flores, V., Rauque, C., 2005. An ectosymbiotic flatworm, Temnocephala chilensis, as second intermediate host for Echinoparyphium megacirrus (Digenea: Echinostomatidae) in Patagonia (Argentina). J. Parasitol. 91, 229–231.

204


Walker, A.J., 2006. Do trematode parasites disrupt defence-cell signalling in their snail hosts? Trends Parasitol. 22, 154–159. Whitfield, P.J., Anderson, R.M., Bundy, D.A.P., 1986. Host-specific components of the reproductive success of Transversotrema patialense (Digenea: Transversotrematidae). Parasitology 92, 683–698. Winstead, J.T., Volety, A.K., Tolley, S.G., 2004. Parasitic and symbiotic fauna in oysters (Crassostrea virginica) collected from the Caloosahatchee River and estuary in Florida. J. Shellfish Res. 23, 831–840. Wiwanitkit, V., 2005. Motility of intestinal fluke, Echinostoma spp. metacercariae in fish dishes prepared by different uncooked methods. Internet J. Infect. Dis. 4. Yao, G., Huffman, J.E., Fried, B., 1991. The effects of crowding on adults of Echinostoma caproni in experimentally infected golden hamsters. J. Helminthol. 65, 248–254. Yoshino, T.P., Granath, W.O., Jr., 1985. Surface antigens of Biomphalaria glabrata (Gastropoda) hemocytes: Functional heterogeneity in cell subpopulations recognized by a monoclonal antibody. J. Invertebr. Pathol. 45, 174–186. Yoshino, T.P., Vasta, G.R., 1996. Parasite–invertebrate host immune interaction. In: Cooper, (Ed.), Advances in Comparative and Environmental Physiology, vol. 24, Springer-Verlag, Berlin, Germany, 125–167. Yoshino, T.P., Laursen, J.R., 1995. Production of Schistosoma mansoni daughter sporocysts from mother sporocysts maintained in synxenic cultures with Biomphalaria glabrata embryonic (Bge) cells. J. Parasitol. 81, 714–722. Yu, L.C., Perdue, M.H., 2001. Role of mast cells in intestinal mucosal function: Studies in models of hypersensitivity and stress. Immunol. Rev. 179, 61–73. Zhang, S-M., Adema, C.M., Kepler, T.B., Loker, E.S., 2004. Diversification of Ig superfamily genes in an invertebrate. Science 305, 251–254. Zhang, S.-M., Loker, E.S., 2003. The FREP gene family in the snail Biomphalaria glabrata: Additional members, and evidence consistent with alternative splicing and FREP retrosequences. Fibrinogen-related proteins. Dev. Comp. Immunol. 27, 175–187. Zhang, S.-M., Loker, E.S., 2004. Representation of an immune responsive gene family encoding fibrinogen-relatedproteins in the freshwater mollusc Biomphalaria glabrata, an intermediate host for Schistosoma mansoni. Gene 341, 255–266. Zhang, S.-M., Leónard, P.M., Adema, C.M., Loker, E.S., 2001. Parasite responsive igsf members in the snail Biomphalaria glabrata: Characterization of novel genes with tandemly arranged igsf domains and a fibrinogen domain. Immunogenetics 53, 684–694. Zhang, S.-M., Nian, H., Zeng, Y., Dejon, R.J., 2008a. Fibrinogen-bearing protein genes in the snail Biomphalaria glabrata: Characterization of two novel genes and expression studies during ontogenesis and trematode infection. Dev. Comp. Immunol. 32, 1119–1130. Zhang, S.-M., Zeng, Y., Loker, E.S., 2008b. Expression profiling and binding properties of fibrinogen-related proteins (FREPs), plasma proteins from the schistosome snail host. Biomphalaria glabrata. Innate Immunol. 14, 175–189.

CHAPTER

4 Peptidases of Trematodes Martin Kasˇny´,* Libor Mikesˇ,* Vladimı´r Hampl,* Jan Dvorˇa´k,† Conor R. Caffrey,† John P. Dalton,‡ and Petr Hora´k*

Contents

Abstract

206 208

4.1. Introduction 4.2. General Classification of Peptidases 4.3. Peptidases of Trematodes—Brief History of Research 4.4. Peptidases of Trematodes—Current Status 4.4.1. Serine peptidases (SPs) of trematodes 4.4.2. Cysteine peptidases (CPs) of trematodes 4.4.3. Aspartic peptidases (APs) of trematodes 4.4.4. Metallopeptidases (MPs) of trematodes 4.4.5. Threonine peptidases (TPs) of trematodes 4.4.6. Phylogeny remarks 4.5. Conclusion Acknowledgements References

208 215 215 238 265 271 273 277 278 279 279

Among human and veterinary parasitic diseases the trematodiases (e.g. schistosomiasis, fascioliasis) represent a problem of global importance with vast social, economic and public health impacts, especially in developing countries. Therefore, host–parasite (host– trematode) interactions represent a key topic in many research laboratories, and modern approaches and technologies allow us to study the molecular basis of these interactions. As a consequence, key molecules produced by trematodes in order to ensure parasite

* Department of Parasitology, Faculty of Science, Charles University in Prague, Prague, Czech Republic {

{

Sandler Center for Basic Research in Parasitic Diseases, California Institute for Quantitative Biosciences, University of California, San Francisco, CA, USA Institute for the Biotechnology of Infectious Diseases, University of Technology Sydney, Ultimo, Sydney, NSW 2007, Australia


#


205

206

Martin Kasˇny´ et al.

invasion and survival within a hosts can be characterized. Trematode peptidases certainly belong to such molecules; as they are indispensable biocatalysts in a number of basal biological processes in trematodes (e.g. tissue invasion/migration, nutrition, immune evasion or other host–parasite interactions). Schistosoma mansoni cercarial elastase (CE) (penetration enzyme), cathepsin B (CB) (mainly nutrition enzyme) and Fasciola hepatica cathepsin L (CL) (nutrition, immune evasion enzyme) are probably the most studied trematode peptidases with well-characterized critical functions. Due to the importance of peptidases in host–parasite interactions they are considered to be promising targets for the development of novel chemotherapeutic drugs and vaccines against a number of trematodiases, including schistosomiasis, fascioliasis, paragonimiasis and opisthorchiasis. The present chapter summarizes the data on the biochemical and molecular features of the major trematode peptidases, and describes their role in trematode biology and host–parasite interactions based on proteolysis (peptidolysis).

4.1. INTRODUCTION Trematodes are members of the phylum Platyhelminthes (or flatworms). Within this phylum the species of veterinary and medical importance belong to the sub-class Digenea.1 These digenean trematodes represent a rich group of around 18,000 species parasitizing all classes of vertebrates (Cribb et al., 2001) and impairing almost all tissues of vertebrate body (Mehlhorn, 2001). At least 118 trematode species belonging to 20 families are causative agents of human infections, affecting significant proportions of the population in many countries (e.g. Ashford and Crewe, 1998; Hotez et al., 2006; World Health Organization, 2004). Flukes of the genus Schistosoma (family Schistosomatidae) are important in terms of human medicine as causative agents of human schistosomiasis as the disease leads to 11,000 deaths per year, although this number may be an under-estimation.2 Over 200 million people are infected with 500–800 million people living at risk (Molyneux, 2006; Muller, 2002; Steinmann et al., 2006; World Health Organization, 2001; World Health Organization Expert Committee, 2002).3 1

Trematodology (as a branch of parasitology) was established by Steenstrup (1813–1897), the Danish scientist who started new wave of viewing reproduction and life cycle aspects of trematodes. He discovered the principle of the alternation of generations in some parasitic worms described in his classical work in 1842. 2 The disease is known for its (likely grossly under-estimated; King et al., 2005) chronicity with duration in untreated individuals of over 30 years (Vieira et al., 2007). 3 The whole family Schistosomatidae includes 14 genera and about 100 species (Brant et al., 2006; Kola´rˇova´, 2007; Lockyer et al., 2003). Several species of the genus Schistosoma are able to infect man, for example, S. mansoni and S. japonicum causing intestinal/hepatic schistosomiasis, and S. haematobium causing urinary schistosomiasis. Even in 21st century, new human schistosomes are being discovered (e.g., S. guineensis; for schistosome relationships see Webster et al., 2006). Human schistosomes are prevalent in many parts of Africa, the Middle East, South America, China, Southeast Asia and the Philippines (King, 2007).

Peptidases of Trematodes

207

There are also other globally important groups of zoonotic trematodes (e.g. the fasciolids, family Fasciolidae). The number of animals infected by Fasciolidae has been estimated at 600–700 million with the annual economic loss in cattle and sheep stocks around $2.0–3.2 billion. Fascioliasis has emerged as a significant zoonosis in several countries, including Bolivia, Peru, Ecuador, Iran, Turkey and Egypt (McManus and Dalton, 2006; Rinaldi et al., 2008; Spithill et al., 1999).4 Digenetic trematodes have complex life strategies, involving changes between asexually and sexually reproducing developmental stages that are found in the intermediate hosts (mostly snails) and the definitive hosts (many vertebrate species), respectively. Besides other important molecules produced by flukes (e.g. eicosanoids causing local immunosuppression or vasodilatation, carbohydrates serving for molecular mimicry), proteins in general, and peptidases in particular, play a number of pivotal roles during the lifecycle of each trematode species.5 Trematode peptidases have been identified as essential enzymes of immature (larval) as well as mature (adult) stages (Cesari et al., 2000; Dalton and Brindley, 1997; Dvorˇa´k et al., 2005; Sajid et al., 2003). They are critical to many host– parasite interactions such as invasion, migration through the tissues, degradation of nutritional proteins (e.g. haemoglobin), immune evasion, activation and modulation of inflammation (Caffrey et al., 2004; Delcroix et al., 2007; Donnelly et al., 2006; He et al., 2005; Hora´k and Kola´rˇova´, 2005; Hora´k et al., 2008; Koehler et al., 2007; McKerrow et al., 2006; Trap and Boireau, 2000). The necessity of peptidases for trematode survival places these molecules as prime targets for the development of new drugs (e.g. cysteine peptidase (CP) inhibitor K11777; Abdulla et al., 2007; McKerrow et al., 2006) or as components of molecular vaccines (e.g. cathepsins L1 and L2 of Fasciola hepatica; McManus and Dalton, 2006). Several powerful sources accumulating and cataloguing information on enzymes of organisms are available for trematodologists dealing with peptidases (e.g. MEROPS—the peptidase database, http://merops. sanger.ac.uk/, Rawlings et al., 2008; BRENDA—the comprehensive enzyme information system, http://www.brenda-enzymes.info/; Chang et al., 2009; UniProt(KB)—central access point for extensive curated protein information, www.uniprot.org; The UniProt Consortium, 2008; or the Handbook of Proteolytic Enzymes, Vol. 2.; Barrett et al., 2004). Although the MEROPS, BRENDA or UniProt(KB) databases comprise 4

Fasciola hepatica is probably the best described representative of the Fasciolidae family. This liver fluke of sheep is distributed worldwide and can infect other mammals including humans. It is the main causative agent of fascioliasis (Muller, 2002). 5 Although the terms proteolytic enzymes, proteases, peptide hydrolases or proteinases are still frequently used and generally understood, in 1992 the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB) published the Enzyme Nomenclature in which the term peptidase was recommended as a general designation for all enzymes hydrolyzing peptide bonds (Academic Press NC-IUBMB, http://www.chem.qmul.ac.uk/iupac/jcbn/; Rawlings et al., 2008). The term peptidase will therefore be universally used in this text.

208


information on peptidases in general, specific views and links to parasites (trematodes) are often incomplete. In contrast, the second edition of the Handbook of Proteolytic Enzymes, though containing comprehensive descriptions of peptidases of parasitic organisms, was published back in 2004. At present, a rapid application/introduction of new techniques in life sciences (e.g. genome database data mining, micro-array analysis or biotransformation) yields a continuous influx of data. Therefore, an up-todate review of trematode peptidases of great importance for medical and veterinary parasitology is now warranted. This present review contains up-to-date information on trematode peptidases (molecular biology, biochemistry, biology, etc.) as a stimulus for further activities in the research of these key molecules and their role in host–parasite interactions.

4.2. GENERAL CLASSIFICATION OF PEPTIDASES Peptidases are usually summarized according to the three main criteria: ‘place of action’ within the peptide/protein substrate, mechanism of catalysis and molecular structure. In general peptidases catalyze hydrolysis of peptide bonds, but the position or ‘where they act’ is different: ‘inside’ (endo-)/‘outside’ (exo-) or in particular position of the polypeptide chain (Table 4.1). The mechanism of catalysis is determined by chemical properties of side groups of the amino acids (AAs) that reside in the peptidase active site; these are responsible for the cleavage of peptide bonds and determining specificity of the enzyme (Table 4.2).6 The classification of peptidases according to molecular structure, homology and function was introduced by Rawlings and Barrett (1993) and is currently considered the most relevant approach to distinguish and group peptidases (this system is based mainly on primary and tertiary structures of peptidases (Table 4.3; see also MEROPS for further information, Rawlings et al., 2008).

4.3. PEPTIDASES OF TREMATODES—BRIEF HISTORY OF RESEARCH Because of their central functions in cellular biology and their potential medical and industrial application peptidases have been interesting subjects of many branches of science for decades. Of course, peptidases became attractive molecules also in the fields of parasitology, including 6

Catalytic type of peptidase is determined according to chemical mechanisms of catalysis related to reactive group in the active site of peptidase.


TABLE 4.1

209

Basic classification of peptidases by the ‘place of action’

Endopeptidases

Exopeptidases

Omegapeptidases

Cleave internal peptide alpha-bonds of polypeptide chain away from N-terminus or C-terminus. Oligo-peptidases Cleave shorter peptides and no proteins.a Cleave peptide a-bonds adjacent to N-terminus or C-terminus of polypeptide chain. Aminopeptidases Cleave a single AA residue from N-terminus. Carboxypeptidases Cleave a single AA residue from C-terminus. DipeptidylCleave a dipeptide from peptidases N-terminus. TripeptidylCleave a tripeptide from peptidases N-terminus. PeptidylCleave a dipeptide from dipeptidases C-terminus. Dipeptidases Cleave dipeptides. Typically require both termini to be free. Cleave peptide a-bonds with no preference for N-terminus or C-terminus. They can cleave also isopeptide bonds.b

Notes: a Peptide a-bonds are bonds where NH2 or COOH are directly attached to the a-carbon of the amino acid (AA). b Isopeptide bonds are bonds where one or both of the NH2 and COOH- groups are not directly attached to the a-carbon of the AA.

trematodology, since they play important roles in acute and chronic phases of many parasitic diseases (e.g. schistosomiasis, malaria, leishmaniasis, Chagas disease and African sleeping sickness McKerrow et al., 2006; World Health Organization, 2004).7,8 Until the end of the first half of the 20th Century, many of publications or ‘classical works’ referring to the details of lifecycles of various species of trematodes were released (e.g. Cort, 1944; Rue et al., 1926; Steenstrup, 1842), but no trematode peptidase was under study. During the second half of the 20th Century, peptidases of trematodes successively became

7

In the PubMed database (www.pubmed.com), 621 citations for key words ‘proteolytic enzymes trematodes’ are found (to date January 2009). The majority of them directly touched the trematode peptidases. Indeed, in many low-income countries it is more common to be infected than not (Awasthi et al., 2003).

8

210


TABLE 4.2 Basic classification of peptidases according to catalytic typea

Serine Cysteine Threonine

S C T

Aspartic Metallo

A M

Glutamic

Unknown

The nucleophile attack during catalysis is facilitated by reactive group at AA side chain, a hydroxyl group (OH) of serine and TPs or a sulphydryl group (SH) of CPs. Catalytic triad of serine peptidases: Ser195, Asp102, His57 (numbered for chymotrypsin, e.g. Hedstrom, 2002) Catalytic triad of CPs: Cys25, His159, Asn175 (numbered for papain, e.g. Lecaille et al., 2002) Catalytic triad of TPs: Thr is conserved in active sites of all proteasomes (Guerra-Sa´ et al., 2005). All known threonine-type peptidases are N-terminal nucleophile peptidases (Rawlings et al., 2008). The nucleophile attack during catalysis is usually facilitated by an activated water molecule and followed by formation of tetrahedral intermediate.b The water molecule is bound by the side chains of aspartic residues of APs or by metal ions (e.g. one or two zinc ions, Zn2þ) of MPs Catalytic diad of APs: Asp32 and Asp 215 (numbered for pepsin (e.g. Dunn, 2002) Catalytic zinc site of MPs is usually formed by His, Glu, Asp or Cys, which supply ligands for zinc (e.g. Auld, 2004). The mechanisms of catalysis are similar to APs including an activated water molecule and tetrahedral intermediate. The water molecule is bound by the side chains of glutamic acid and glutamine residues Catalytic diad of APs: Gln24 and Glu110 (numbered for aspergilloglutamic peptidase (e.g. Rawlings et al., 2008). The peptidases of unknown catalytic type, that is, proteins where the sequence is known to belong to peptidases, but the mechanisms of catalysis are not determined (Rawlings et al., 2008).

Notes: a Catalytic type of peptidase is determined according to chemical mechanisms of catalysis related to the reactive group in the active site of peptidase. b Tetrahedral intermediate of AP catalysis is a formation that provides proton transfer from a water molecule to an aspartic acid dyad and another proton transfer from a dyad to a carbonyl oxygen of cleaved peptide bond (Polga´r, 1987; see Fig. 4.1). A tetrahedral intermediate of MP is formed after attack of a zinc-bound water molecule towards the carbonyl group of the cleaved peptide bond. This intermediate is further decomposed by transfer of glutamic acid proton to leaving the group (Rawlings and Barrett, 1993). AP, aspartic peptidase; CP, cysteine peptidase; MP, metallopeptidase; TP, threonine peptidase.

211


Covalent catalysis NH2

a) R⬘ S−

C29

CP

O−

NH+

C29

H199

S

CP

C

NH+

R

NH

R⬘

b) H2O O c) R C

OH

H199

N H

N H

R

O C

D33

N H

C

O

H

AP

O

C

O

O

H

O D231

C

H

H

AP

H

O C

D33

H

O

O

D231

Tetrahedral intermediate

R⬘

O

O

R

O C

N H

R⬘

R C

O

NH R⬘

a) H2O b) R⬘⬘ c) R

NH2 O C OH

Non-covalent catalysis

FIGURE 4.1 Chemical mechanisms of peptidase catalysis. Notes: Five catalytic types of peptidases are generally defined by two chemical mechanisms determining how the tetrahedral intermediate is established. (The tetrahedral intermediate reaction is a chemical process during which the trigonal double-bonded carbon atom is converted to tetrahedral one.) The nucleophilic attack of cysteine, serine and threonine peptidases is mediated via reactive group (OH, S) of the peptidase side chain (covalent catalysis), whereas for MPs and APs nucleophilic attack is provided by an activated water molecule (non-covalent catalysis). Pink oval: CP, cysteine peptidase (T. regenti cathepsin B1, Q4VRW9); green oval: AP, aspartic peptidase (S. mansoni cathepsin D, P91802). Scissors show the cleaved peptide bond of peptide substrate. In yellow and purple, catalytic residues of CP active site Cys29/His199; in orange: catalytic residues of AP active site Asp33/Asp231. Letters a–c; refer to the order of molecules ‘entering’ and ‘leaving’ the reaction (water and products of cleavage/reaction). The example of reaction scheme of peptide substrate degradation by ‘CP peptidase group’ (pink oval) shows how the nucleophilic thiolate of cysteine attacks the double-bonded carbon leading to a tetrahedral intermediate formation. This reaction step is followed by an additional intermediate step, not included in peptidase–substrate reactions of the ‘AP peptidase group’. The tetrahedral intermediate is transformed into an acyl-enzyme intermediate (acylation; release of C-terminal substrate part), which is subsequently hydrolyzed via water molecule to the second tetrahedral intermediate, and finally transformed to the recovered enzyme (deacylation; release of N-terminal substrate part) (not shown). The tetrahedral intermediate is formed by mediation of Asp231 AA—deprotoning the water molecule and Asp33 AA—protoning carbonyl oxygen atoms of the cleaved peptide bond. It is followed by hydrogen transfer from the Asp231 residue to the nitrogen of the peptide bond, which leads to breaking of the peptidase bond, releasing two products (C-terminal substrate and N-terminal substrate part) and simultaneous enzyme recovery.

212


TABLE 4.3 Basic classification of peptidases according to molecular structure, homology and functions

Clana

Family

Unique peptidase

Clan comprises a group of families probably sharing evolutionary ancestry, despite lack of statistically significant similarities in AA sequence. Distant relationship comes primarily from linear order of catalytic-site residues in polypeptide chains, and tertiary structure.b The name of each clan is formed from the letter for the catalytic type of peptidases (S, C, T, A, G, M or U, as for families) followed by second capital letter (e.g. CA). The family comprises peptidase members with evolutionary relationships based on primary structure similar to at least one another member of the family. Each family is named by a letter denoting the catalytic type (S, C, T, A, G, M or U) followed by number (e.g. C1).c Unique peptidase is, in general, a single peptidase or a set of proteins all of which display a particular type of peptidase activity, and are closely related by sequence (e.g. C01.062).d

Notes: a The idea of using the terms ‘family’ and ‘clan’ for the groups of peptidases came from ecological strategy of bee-eaters (Merops apiaster), because bee-eaters group their nests into families and clans. The inhabitants of each nest occupy a different part of the colony and have their own discrete area where the members hunt flying insects (Rawlings et al., 2008). b Tertiary structure recognized by modelling is crucial for activity of many peptidases. For example, the polypeptide chain of papain forms two domains with a large cleft of the active site that blocks the pro-region part (Illy et al., 1997; Musil et al., 1991; Fig. 4.2). c Primary structure of peptidase determines statistically significant relationships in amino acid (AA) sequence with respect to a representative member, especially to its unit (peptidase unit is a part of the enzyme responsible for peptidase activity, Rawlings et al., 2008). d For example, cathepsin B-like peptidase, clan CA, family C1A, peptidase C01.062 (according to MEROPS classification).

deeply researched biomolecules. The essential role of lytic enzymes in the lifecycle of trematodes was revealed in the 1950s, when various researchers demonstrated proteolytic activity and developed hypotheses regarding the importance of proteolytic activity in parasite biology, especially in the mostly studied trematode species Schistosoma mansoni (e.g. Lee and Lewert, 1956; Stirewalt and Kruidenier, 1960; Timms and Bueding, 1959). This stream of activity gained impetus in the 1960s and 1970s when methods to characterize composition and activity of trematode peptidase mixtures became feasible by employing basic chromatographic and spectrophotometric methods with various kinds of basic dye-impregnated protein substrates (e.g. azocoll). The activity of several enzymes of the most


213

His18

Pro-CB1a

Pro-CB1b

Active-CB1

Occluding loop

Glu88 Asn86

Active site (His/Cys)

Val87

His 18

Glu88 Pro-region Asn86

L

R

lle89

Val87

Trans-activation In vitro - by AE and CC In vivo - unclear

AE

CC

FIGURE 4.2 Processing of S. mansoni pro-cathepsin B1 in vitro. Notes: Zymogen CB1 (pro-CB1a) is trans-processed by asparaginyl endopeptidase (AE, yellow) to pro-CB1b that contains just two of the remaining amino acids (AAs) (Val87-Glu88) of the propeptide. These AAs are subsequently removed by rat cathepsin C (as a catalytic substitute for SmCC, green) to yield a fully processed peptidase (active-CB1). The pro-region of CB1 is in grey; the mature CB1 in blue; the active site in red; the occluding loop in green. The active site residues of AE and CC are coloured; Cys, in yellow; His, in purple; Asn, in pink. The predicted three-dimensional models: model of human pro-cathepsin B1 was taken from website (www.delphi.phys.univ-tours.fr/Prolysis/Images/procatbrib.jpeg) and adjusted (human and SmCB1 show around 50% similarity, ExPASy Proteomics Server, CLUSTALW aligment). The three-dimensional model examples of AE (human caspase 1*) and CC (S. japonicum CC) were constructed online at www.cbs.dtu.dk/services/ CPHmodels-2.0 website. * The caspase 1 belongs to clan CD, family C14, which shows significant sequence similarity and three-dimensional protein folding to family C13, the legumain peptidases (AE, Chen et al., 1998b). Because the construction of the SmAE three-dimensional model failed (three-dimensional template of AE does not exist), the three-dimensional model of human caspase 1 was adopted. The scheme is based on the information published by Sajid et al. (2003) and Caffrey et al. (2004) with amendments by Kasˇny´.

important human and animal pathogens such as S. mansoni or F. hepatica was detected and biochemically characterized (haemoglobinase-like, elastase-like and collagenase-like) (Asch and Dresden, 1977; Dresden and

214


Deelder, 1979; Foster and Hall, 1978; Howell, 1966; Rupova and Keilova, 1979; Stirewalt and Austin, 1973; Zussman and Bauman, 1971). Rapid developments in molecular biology, biochemistry and immunotechnology (particularly the development of monoclonal antibodies) in the late 1970s and 1980s provided new tools to investigate proteolytic enzymes of trematodes. The first particular peptidases were characterized in trematode worm extracts or their excretory/secretory products (ESPs) according to the type of specific peptidase activity (based on specific substrates and inhibitors), as well as pH optimum, isoelectric point (pI) and molecular weight. Peptidases of several trematode species were purified (e.g. CE of S. mansoni, Landsperger et al., 1982; McKerrow et al., 1985; or possible CB- or CL-like of F. hepatica; Dalton and Heffernan, 1989; Heffernan et al., 1991; Smith et al., 1993). Many enzymes were biochemically characterized in detail, the first trematode peptidases were sequenced (e.g. S. mansoni haemoglobinase—asparaginyl endopeptidase (AE), Davis et al., 1987; S. mansoni CE, Newport et al., 1988), and some of them (e.g. AE, CB in schistosomes) were evaluated as vaccines and diagnostic markers (Chapell and Dresden, 1988; Idris and Ruppel, 1988; Ruppel et al., 1987; Zerda et al., 1987). During the late 1980s and 1990s these studies continued and included the idea of peptidases as potential targets for chemotherapy of the most dangerous trematode infections such as schistosomiasis, fascioliasis, paragonimiasis and opisthorchiasis (e.g. Ring et al., 1993; Ruppel et al., 1985; Tort et al., 1999; Truden and Boros, 1987; Wasilewski et al., 1996; Yamakami and Hamjima, 1990).9 In 1987, the first recombinant peptidases of trematodes were cloned for S. mansoni (Davis et al., 1987; Klinkert et al., 1987). Originally termed Sm31 and Sm32 (Ruppel et al., 1987), these peptidases were eventually sequenced to identify a CB1 and a ‘haemoglobinase’, respectively, the latter of which is now known as S. mansoni AE (legumain) (Caffrey et al., 2000). Several important reviews comprising schistosome peptidase sequences, their localization within the worm body and possible functions were published in the late 1980s and 1990s (e.g. Dalton et al., 1995; 9

Praziquantel (PZQ; 2-cyclohexylcarbonyl-1,3,4,6,7,11b-hexahydro-2H-pyrazino (2,1-a)isoquinoline-4-one) is the main drug to treat schistosomiasis. The compound is also used to treat echinococcosis, cysticercosis, and human and animal intestinal tapeworm infections (e.g. Go¨nnert and Andrews, 1977; McMahon and Kolstrup, 1979). Other schistosomicidal anthelmintics, such as hycanthone and oxamniquine, have been used, but the former is now withdrawn due to hepatotoxicity whereas the latter is primarily available in Brazil, but its use is now eclipsed by PZQ (Caffrey, 2007). 10 Extensive progress of molecular biology and other life sciences during the 1990s, covering peptidases of trematodes, initiated systematization of these enzymes leading to foundation of the online peptidase databases such as MEROPS (version 1.101) in October 1996. The need for systematic classification of the enzymes was highlighted already during the 2nd International Symposium on Intracellular Protein Catabolism in Ljubljana, Slovenia in 1975. The symposium was stimulated by Turk and Marks to publish the first review at 1977 about intra-cellular proteins introducing also the proteolytic enzymes (23 proteolytic enzymes were presented). This activity was followed by later books of Barrett and McDonald—Mammalian Proteases: A Glossary and Bibliography, Vol. 1: Endopeptidases (1980) and Vol. 2: Exopeptidases (1986; it contains 173 proteolytic enzymes). The full systematic overview, ‘Evolutionary families of peptidases’ organizing the proteolytic enzymes (peptidases) has been published by Rawling and Barrett (1993). The authors allocated enzymes to evolutionary families. By December 2008, MEROPS contained information about more than 2,000 peptidases (Rawlings et al., 2008).


215

Go¨tz and Klinkert, 1993; Li et al., 1996; McKerrow, 1989; McKerrow and Doenhof, 1988; McKerrow et al., 1991; Tort et al., 1999).10 Consequently, a large number of parasitological teams were drawn into the field and followed the headway in characterization of individual peptidases with the intention to complete the mosaic of trematode enzyme functions. Understanding of trematode peptidase function and how these are important in host–parasite interactions and adaptation is currently (in 2000s) the key focus in this field.

4.4. PEPTIDASES OF TREMATODES—CURRENT STATUS In this article, we review trematode peptidases with respect to their biological roles, biochemical and molecular properties, and their possible use as effective vaccine components or immunodiagnostic markers of diseases caused by trematodes.11 For a clear and readable presentation, the peptidases have been presented in tables based on annotations in MEROPS 8.2—peptidase database (Rawlings et al., 2008) and UniProtKB—protein database (The UniProt Consortium, 2008). Not discussed in this article are those peptidases that are only annotated in various genome or protein databases but for which biochemical and molecular information is unknown. The peptidases are organized in chapters according to the mechanism of catalysis that defines the peptidase classes (Table 4.2). The Latin names of trematode species and other organisms are usually abbreviated when their particular peptidases are referred to in the text below (e.g. Schistosoma mansoni cathepsin B1 ¼ SmCB1 etc.).

4.4.1. Serine peptidases (SPs) of trematodes Almost one third of all peptidases can be classified as serine peptidases (SP) (Table 4.4). These peptidases possess the catalytic triad His/Asp/Ser (e.g. His57/Asp102/Ser195 as known for chymotrypsin A of Bos taurus, annotation numbers (AN): MEROPS—MER000002 and UniProtKB/ TrEMBL—P00766; Hedstrom, 2002). Serine peptidases are synthesized as inactive precursors or zymogens and, therefore, their structure universally consists of three domains: catalytic, substrate binding and zymogen activation domains. To become a fully active enzyme it is necessary that the zymogen domain (N-terminal extension) is cleaved off (processed) (Hedstrom, 2002; Rawlings and Barrett, 2004b). 11

The general importance of peptidases is documented by the fact that approximately 18% of sequences in the SwissProt database (http://www.expasy.org/sprot/) belongs to peptidases. More than 80 peptidase sequences of 12 trematode species are annotated in MEROPS database 8.2. (Rawlings et al., 2008).

TABLE 4.4

Serine peptidases (SP)

To 2009, there are 13 clans and 31 families of serine peptidases in the MEROPS database 8.2 and there are other three sub-clans of peptidases of mixed mechanisms of catalysis that comprise another 14 serine peptidase families.a In total, there are 892 different serine peptidase sequences in the MEROPS database 8.2, but only a minority apply to trematodes (nine, around 1.0%, Rawlings et al., 2008). Accession number

Peptidase (catalytic triad) CHYMOTRYPSIN-LIKE (His/Asp/Ser) Cercarial elastase (Newport et al., 1988) (Pierrot et al., 1995) (Salter et al., 2002)

SmCE SmCE1a SmCE1b SmCE1c SmCE2a

Species (stage)

MEROPS

Other properties (pH optimum of activity, preferred MW (kDa) UniProtKB/ practical/ MEROPS substrates, biological TrEMBL theoretical (ID) Clan, family function)

Schistosoma mansoni (C,Sp,A)

MER03620, MER016426 MER031529

P12546, Q26553 Q8MUW0 Q26552 Q26553 Q8MUV8

25/29,28 25/29 25/29 -/28 25/29

S01.144

PA(S),S1 PA(S),S1A

pH optimum 4–10.5 preferred substrates: Z-Ala-Ala-Pro-PheAMC trematode CE facilitates invasion of schistosome larvae (cercariae) by cleavage of macromolecular substrates of the host skin named due to CE ability to cleave insoluble elastin, the major component of skin dermis, may modulate immune system

MER031528 MER035518

Q8MUV7 Q8MUV6

25/29 25/29

S01.144

PA(S),S1A

-

Q8MUV5 Q8MUV4

25/15p 25/15p

S01.144

PA(S),S1A

SdCE1b TsCo*(C?) Trichobilharzia ocellata (C) (¼ Trichobilharzia szidati details on taxonomy see Rudolfova´ et al., 2005)

Q8MUV3

25/5p 30/-

-

-

SmCE2b ShCE1a ShCE1b SdCE1a

(Bahgat et al., 2001)b

Schistosoma haematobium (C) Schistosomatium douthitti (C)

(Bahgat and Ruppel 2002)b (Dolecˇkova´ et al., 2007) Kallikrein-like

(Cocude et al., 1997-sub) (Cocude, 1998-sub) (Carvalho et al., 1998)

endopeptidase proteolysis SmSP1

Schistosoma mansoni (C,A)

MER004387

Q16007, Q9TYH3, Q9TYH4

21/17p

-

PA(S),S1A

pH optimum around 9 preferred substrates: Abz-Ala-Phe-ArgPhe-Ser-Gln-EDDnp

variety of physiological functions, processing of bioactive peptides, blood coagulation and enhancement of

(continued)

TABLE 4.4 (continued) Accession number

Peptidase (catalytic triad)

Species (stage)

MEROPS

Enterokinase-like

-

Schistosoma mansoni (A,Sc)

(El-Bassiouni et al., 1999-sub) (Liu et al., 2006)

-

Schistosoma japonicum MER098912 (A,Sc)

CARBOXYPEPTIDASE Y-LIKE (His/Asp/Ser) Carboxypeptidase A-like (Liu et al., 2006) LYSOSOMAL PRO-XAA CARBOXYPEPTIDASELIKE Dipeptidyl-peptidase II

MER013674

Other properties (pH optimum of MW (kDa) activity, preferred UniProtKB/ practical/ MEROPS substrates, biological TrEMBL theoretical (ID) Clan, family function)

Q9XYW2

-/24

-

PA(S),S1A

Q5D9V2

-/26

-

PA(S),S1A

glycosylation of IgEbinding factors function of S. mansoni SP1 and its location are unknown pH optimum 6–9 preferred substrates: ? activation of pro-enzymes

SC,S10 -

Schistosoma japonicum MER117770 (A)

Q5DB18

-/48

S10.002

SC,S10

-

SC,S28

-

Schistosoma japonicum MER119870 (A)

Q5DC37

-/54

S28.002

SC,S28

-

(Liu et al., 2006) Unassigned peptidase or nonpeptidase homologues and othersc

U00/N01

Schistosoma mansoni

-

-

-

-

-

(Bentley et al., 2003)

U05/N02 U00/N01

Schistosoma japonicum Schistosoma haematobium

-

-

-

-

(Liu et al., 2006) (Hu et al., 2003)

U00/N01

Schistosoma bovis

-

-

-

-

-

-

Notes: a Mixed clans (PA, PB, PC) contain peptidase families of more than one of the catalytic types (e.g. serine, threonine and cysteine). PA, peptidase families are assigned to this clan on the basis of similar protein folds or similarly arranged catalytic residues. PB, peptidase families are assigned to this clan on the basis of similar protein folds or an N-terminally placed catalytic nucleophile. PC, peptidase families are assigned to this clan on the basis of catalytic dyad occurs in the order Cys(or Ser)/His in the sequence. For more details see the MEROPS database (http://merops.sanger.ac). b The serine peptidase referred to by Bahgat et al. (2001) and Bahgat and Ruppel (2002) is probably not CE, but snail contamination (*Co, contamination) (see Note 17). c These peptidases are annotated in MEROPS database as ‘unassigned peptidases’ or as ‘non-peptidase homologues’ or are not relevant due to missing of data. A, adults; C, cercariae; ID, identification; IgE, immunoglobulin E; N, number of non-peptidase homologues; Sc, schistosomula; Sp, sporocysts; U, number of unassigned peptidases; 21/17p—‘p’ here means the theoretical molecular weight (MW) of partial sequence; e.g. Cocude et al., 1997-sub—‘sub’ here indicates that sequence is submitted to the database (UniProtKB/TrEMBL) without link to relevant publication; MW (kDa) practical—two numbers shown, e.g. 33,38/24p, mean MW of pro-peptidase and mature peptidase. Database links: MEROPS, http://merops.sanger.ac.uk; UniProtKB/TrEMBL, http://www.expasy. org/sprot; S. mansoni ESTs databases, www.compbio.dfci.harvard.edu (CompBio-S.mansoni) or www.schistodb.org (both Schistosoma mansoni genome databases are based on TIGR project).

220


Three main activity types of S1 family of peptidases have been described: (i) chymotrypsin-like: peptidases expressing this activity prefer one of the hydrophobic AA at P1 position, Phe over Ala by around 50,000 times (ii) trypsin-like: preference Arg or Lys at P1 position of the cleaved substrates and (iii) elastase-like: they generally prefer small aliphatic AA such as Ala at P1 position (Hedstrom, 2002; Rawlings and Barrett, 2004b; Rawlings et al., 2008) (for nomenclature of ‘P’ positions of substrates and ‘S’ positions of peptidases see Fig. 4.3).12 Serine peptidases are effective reaction catalysts that accelerate the reaction speed of protein (peptide) hydrolysis around 1010-times (Hedstrom, 2002). Serine peptidases are responsible for many critical physiological processes in vertebrates (e.g. digestion, blood coagulation, immune response - complement cascade) and invertebrates, particularly insects, in which they function in digestion, development and innate immunity (Krem and Di Cera, 2002; Zou et al., 2006). By contrast, serine peptidases in trematodes seem not to be as numerous with most studies having focused on a few chymotrypsin-like peptidases, in particular the S. mansoni cercarial elastase (see below).

4.4.1.1. Chymotrypsin-like peptidases (clan PA(S), family S1) Peptidases of the chymotrypsin-like family (S1) are the most abundant endopeptidases in living organisms (e.g. Hedstrom, 2002; Rawlings and Barrett, 1993, 2004b).

4.4.1.1.1. Cercarial elastase (CE) This S1(A) family enzyme is one of the most studied trematode peptidases. The CE gene was identified in three species of trematodes, S. mansoni, S. haematobium and Schistosomatium douthitti (Newport et al., 1988; Pierrot et al., 1995; Salter et al., 2002).13 General biochemical properties and specificity. Schistosome CE possesses typical serine peptidase catalytic triad in the active site (His68/Asp126/ Ser218; numbering for SmCE; AN: MER03620, P12546; Rawlings et al., 2008). It exhibits the ability to degrade a variety of skin macromolecules including collagen, gelatin, keratin, fibronectin, laminin and peptide backbone of proteoglycans or cell–cell contacts in the epidermis

12

The chymotrypsin-trypsin-elastase paradigm declares that specificity of these peptidases is determined by a few structural elements only. Hedstrom (2002) refers that common peptidase mutations preclude transfer of the specificity features of one serine peptidase onto another. 13 Schistosomatium douthitti is a visceral (mesenteric veins) schistosome parasitizing mainly in muskrats and voles in North America (Basch, 1991; Rollinson and Simpson, 1987). Although the CE of S. douthitti is annotated in the UniProtKB/TrEMBL database, serious doubts exist about existence/expression of the enzyme in this schistosome species; Dvorˇa´k, unpublished. 14 Some editors of biochemical journals rejected the name ‘cercarial protease’ or ‘cercarial peptidase’ because elastin is a unique macromolecular substrate for these schistosome peptidases; the other elastases are structural homologues as referred to by McKerrow (2003). Hence, the name ‘cercarial elastase’ is derived from elastin substrate and does not indicate phylogenetic relationship to other elastases (Dvorˇa´k et al., 2008). 15 Elastin is an insoluble structural protein of connective tissues found e.g. in the skin, blood vessels, heart, lungs, intestines, tendons and ligaments.


P4

P3

P2

P1

+

P1⬘

Substrate: - Phe - Arg 0 NH

C

CH

P2⬘

P3⬘

221

P4⬘

T. regenti cathepsin B1.1

0 NH

CH

C

NH

CH2

CH2

CH2 CH2

NH2

C NH2+

E24

5

W221 S2 9 N21

S1

S1

- Phe - Arg -

NH2

S2

Q23 C29

H199 Peptidase: Cathepsin B S4

S3

S2

S1

−

S1⬘

S2⬘

S3⬘

S4⬘

FIGURE 4.3 The scheme of cysteine (papain-like) peptidase interaction with the oligo-peptide substrate. Notes: Catalytic triad (of T. regenti cathepsin B1) is marked, Cys29 in yellow, His199 in purple and Asn219 in pink. Gln23 (forming the oxidation hole) in green. P4–P40 ; nomenclature of substrate labelling. S4–S40 ; nomenclature of peptidase labelling (nomenclature according to Schechter and Berger, 1967). Scissors show the scissile bond. The panel of T. regenti cathepsin B1.1 shows three-dimensional model of peptidase ‘active site cleft’ (highlighted in blue) in complex with the Z-Phe-Arg-AMC substrate. From Dvorˇa´k et al. (2005) with amendments by Kasˇny´. The part of figure ‘T. regenti cathepsin B1.1’ was reprinted with permission of Elsevier.

(McKerrow and Salter, 2002; McKerrow et al., 1985; Salter et al., 2002). The main interest in CE is due to its ability to cleave another fundamental skin component—dermal elastin (Salter et al., 2000; Fig. 4.4).14,15 Consequently, the elastases from cercarial penetration glands are suggested to play pivotal roles during penetration of the cercariae into their hosts (Curwen and Wilson, 2003; Hansell et al., 2008; He et al., 2005; McKerrow, 2003; McKerrow and Salter, 2002; McKerrow et al., 2006). 16

CE has been proved to play a significant role in immune evasion via depletion of host immunoglobulins. In parallel, SmCE-like schistosomulum peptidase was demonstrated to degrade rather host (mouse) Fc of IgE than IgG (Aslam et al., 2008; Pleass et al., 2000, 2008). These results do not correspond to the premise that only the increased level of host IgE is associated with worm infection. There is a possibility of varying IgE/IgG levels during primary and later phase responses to S. mansoni infection (McKerow et al., 2006; Pleass et al., 2000).

222


10 MRSLTAAARR 70 KPAKPGVGGL 130 GGVGGLGVST 190 PTGAGVKPKA

20 PEVLLLLLCI 80 VGPGLGAEGS 140 GAVVPQLGAG 200 QVGAGAFAGI

30 LQPSQPGGVP 90 ALPGAFPGGF 150 VGAGVKPGKV 210 PGVGPFGGQQ

40 GAVPGGVPGG 100 FGAGGGAAGA 160 PGVGLPGVYP 220 PGLPLGYPIK

50 VFFPGAGLGG 110 AAAYKAAAKA 170 GGVLPGAGAR 230 APKLPAGYGL

60 LGVGGLGPGV 120 GAAGLGVGGI 180 FPGIGVLPGV 240 PYKTGKLPYG

250 FGPGGVAGSA 310 IPGIGGIAGV 370 GVGVPGVGVP 430 TFGLGPGGFP 490 GIPAAAAAKA 550 AAAKSAAKAA 610 TLAAAKAAKF 670 LGVGGLGAVP 730 KPFGGALGAL

260 GKAGYPTGTG 320 GAPDAAAAAA 380 GVGVPGVGVP 440 GIGDAAAAPA 500 AAKAAQFGLG 560 AKAQFRAAAG 620 GPGGVGALGG 680 GAVGLGGVSP 740 GFPGGACLGK

270 VGPQAAAAAA 330 AAAKAAKFGA 390 GVGVPGVGVP 450 AAAAKAAKIG 510 PGVGVAPGVG 570 LPAGVPGLGV 630 VGDLGGAGIP 690 AAAAKAAKFG

280 KAAAKLGAGG 340 AGGLPGVGVP 400 GALSPAATAK 460 AGGVGALGGV 520 VVPGVGVVPG 580 GAGVPGLGVG 640 GGVAGVVPAA 700 AAGLGGVLGA

290 AGVLPGVGVG 350 GVGVPGVGVP 410 AAAKAAKFGA 470 VPGAPGAIPG 530 VGVAPGIGLG 590 AGVPGLGVGA 650 AAAAKAAAKA 710 GQPFPIGGGA

300 GPGIPGAPGA 360 GVGVPGVGVP 420 RGAVGIGGIP 480 LPGVGGVPGV 540 PGGVIGAGVP 600 GVPGPGAVPG 660 AQFGLGGVGG 720 GGLGVGGKPP

SOGRKRK

FIGURE 4.4 Elastin. Notes: The position of S. mansoni elastase cleaving sites (Phe206#Gly207, Tyr228#Gly229, and Tyr232#Lys233, Salter et al., 2000) are marked (arrowheads) in elastin sequence (Bos taurus, GenBank, AC: NP 786966).

Schistosome CE may also help the cercariae evade the host immune response (Darani et al., 1997; Ghendler et al., 1996; McKerrow et al., 1991).16 Schistosoma mansoni CE (SmCE 25–31 kDa) was isolated and its biochemical, functional and molecular properties (such as pH optimum, cleavage of macromolecular or oligo-peptide substrates, localization, gene organization) were studied by many authors (e.g. Baghat et al., 2002; Darani et al., 1997; Dvorˇa´k et al., 2008; Ghendler et al., 1996; McKerrow et al., 1985; Newport et al., 1988; Pierrot et al., 1995; Salter et al., 2000, 2002). Several 17

Mis-interpretations in the research of schistosome elastase: (i) localization—circumacetabular versus postacetabular glands. In former studies the activity of SmCE was localized usually in both types of penetration glands and on the surface of cercariae and schistosomula (Fishelson et al., 1992; Marikovsky et al., 1990). Later it was proved and accepted that SmCE activity originates from cercarial circumacetabular glands only (Dvorˇa´k et al., 2008; McKerrow et al., 1991; Salter et al., 2000); (ii) contamination—cercarial versus snail peptidases. The activity of the assumed SmCE and T. ocellata CE (¼ T. szidati, Rudolfova´ et al., 2005) from ESP was measured by Bahgat and Ruppel (2002) with Boc-Val-Leu-Gly-Arg-pNA substrate. This ‘trypsin substrate’ (with Arg at P1 position) was described as not preferred by SmCE (Salter et al., 2002). Salter et al. (2000) also detected trypsin-like activity in S. mansoni cercarial ESP with Boc-Val-Leu-Gly-Arg-pNA substrate but they differentiated this kind of activity from chymotrypsin-like one, using the ‘chymotrypsin substrate’ Suc-Ala-Ala-Pro-Phe-pNA (with Phe at P1 position). Although the trypsin-like activity measured by Salter et al. (2000) was 30-fold higher than the chymotrypsin-like one (SmCE), the fraction with trypsin-like activity did not cleave elastin. That trypsin-like activity probably originated as a contamination from the intermediate snail host. This possibility was supported by fluorometric and molecular data analysis with other species—the bird schistosomes Trichobilharzia regenti and T. szidati (Dolecˇkova´ et al., 2007; Kasˇny´ et al., 2007; unpublished) and their snail intermediate hosts (Mikesˇ and Klimpellova´, unpublished).


223

controversial data on CE activity type and substrate specificity were published and led to mis-identification of CE peptidase in some cases.17 Chymotrypsin-like activity is typical for SmCE (Salter et al., 2002). The large hydrophobic side chain of AA at P1 position is crucial for SmCE activity (Salter et al., 2000, 2002). Screening with positional scanningsubstrate combinatorial libraries revealed that AA in other positions (P2–3) play a secondary role for SmCE selectivity (Phe at P2, and combination of Trp and Ser at P3 or P4 positions, Salter et al., 2002). The fluorogenic substrate Suc-Ala-Ala-Pro-Phe-pNA is used as standard marker of SmCE activity at pH optimum >9.0 (Dvorˇa´k et al., 2008; Salter et al., 2002). Using this substrate, the activity in cercarial ESPs of S. mansoni and S. douthitti was recorded, but not in S. japonicum, Trichobilharzia regenti and T. szidati (T. ocellata ¼ T. szidati; see Rudolfova´ et al., 2005) (Dvorˇa´k et al., 2008; Kasˇny´ et al., 2007; personal communication).18 Inhibition. The CE activity in S. mansoni and S. douthitti cercarial ESP was completely inhibited by 10 M inhibitor Z-Ala-Ala-Pro-Phe-CMK (Dvorˇa´k et al., 2008). When cercariae were incubated with inhibitors in a medium containing Suc-Ala-Ala-Pro-Phe-CMK (CE-specific chloromethylketone inhibitor) and placed on human skin, a significant inhibition of penetration (>75%) was observed. This provided indirect evidence for the presence of CE in ESP and its function in S. mansoni cercarial penetration (Lim et al., 1999; Salter et al., 2000). Identification, localization and function. The presence of 25–30 kDa CE was confirmed by labelled substrate bnLeu-Val-Pro-Leup(OPh)2 in both S. mansoni and S. douthitti ESPs (Dvorˇa´k et al., 2008). The incubation of S. mansoni cercarial ESP with radioactive serine peptidase probe [3H]diisopropyl-phosphofluoridate (H-DFP) showed reaction with a 27–29 kDa band, probably CE (Darani et al., 1997; Verwaerde et al., 1986). An unknown 70 kDa possible serine peptidase was revealed in S. japonicum cercarial ESP, but no CE or other serine peptidase was detected by these methods in extracts of T. regenti and T. szidati (Dvorˇa´k et al., 2008; Sajid and Kasˇny´, personal communication). The immunoblot of protein extracts of S. mansoni, T. szidati and T. regenti cercariae with anti-SmCE antibodies revealed positive reaction of around 25–28 kDa bands in S. mansoni samples only (Darani et al., 1997; Dvorˇa´k et al., 2008; Mikesˇ et al., 2005; Salter et al., 2002). Immunohistochemistry with anti-SmCE-1a antibody localized SmCE in circumacetabular (also known as preacetabular) penetration glands of S. mansoni, but not in S. japonicum cercariae (Chlichlia et al., 2005; Dvorˇa´k et al., 2008). Similarly, reactivity with anti18 Trichobilharzia regenti is a neuropathogenic nasal schistosome of waterfowl. Trichobilharzia regenti larvae can enter the peripheral nerves, and subsequently the spinal cord to reach the brain and ultimately the nasal cavity, where they mature and lay eggs. Trichobilharzia szidati is a visceral schistosome related to T. regenti parasitizing similar spectrum of waterfowl. Cercariae of T. szidati can also penetrate into non-specific hosts— mammals including humans. Cercariae of T. szidati, similarly to T. regenti, cause cercarial dermatitis in humans (Chanova´ and Hora´k, 2007; Hora´k et al., 1998, 2002, 2008; Kourˇilova´ et al., 2004; Lichtenbergova´ et al., 2008).

224


SmCE antibodies absented on sections of T. regenti and T. szidati cercariae (Mikesˇ et al., 2005). Several isoforms of CE have been isolated and cloned using the complementary deoxyribonucleic acid (cDNA) templates of three schistosome species: S. mansoni (SmCE), S. haematobium (ShCE) and S. douthitti (SdCE) (Bahgat et al., 2002; Newport et al., 1988; Pierrot et al., 1995; Salter et al., 2002). A proteomic approach—mass spectrometry (MS) analysis—also revealed multiple CE isoforms in secretions of S. mansoni (Curwen et al., 2006; Hansell et al., 2008; Knudsen et al., 2005). The isoforms of CE such as SmCE-1a (AN: Q8MUW0), SmCE-1b and SmCE-1c identified by Salter et al. (2002) are identical to the products of CE genes (AN: P12546, Q26552, Q26553) reported by Newport et al. (1988) and Pierrot et al. (1995).19 Salter et al. (2002) recorded that ShCE and SdCE are orthologous enzymes to SmCE. SmCE is also one of the major transcripts of S. mansoni sporocyst stage determined by micro-array analysis, and subsequently transcripts encoding CE were found in eggs and adults (females) of S. mansoni ( Jolly et al., 2007; Pierrot et al., 1996).20 For the principal member of the ‘Asian’ schistosome group— S. japonicum—no orthologous CE has been identified by PCR or MS analysis (Dvorˇa´k et al., 2008). No CE gene orthologue has been identified in the S. japonicum ESTs or genomic databases, despite the fact that more than 70% identity of S. mansoni and S. japonicum genome data are available (e.g. Dvorˇa´k et al., 2008; Peng et al., 2003; Verjovski et al., 2007; CompBio-S.mansoni and www.schistodb.org). The apparent absence of CE activity in S. japonicum seems not to be of significance for penetration of host skin as this species penetrates skin more rapidly (hours) than either S. mansoni or S. haematobium (approximately 1 day; He et al., 2005; Ruppel et al., 2004; Wang et al., 2005). Similar to S. japonicum, no CE gene was found by use of PCR and T. regenti/T. szidati cDNA templates reverse-transcribed from messenger ribonucleic acid (mRNA) isolated from cercarial germ balls (Dolecˇkova´ et al., 2007; Kasˇny´, unpublished, see Table 4.4, SP).21 Therefore, we hypothesize that T. regenti and T. szidati, in terms of the peptidases employed for skin penetration, are more similar to S. japonicum than to S. mansoni. Instead of CE, the main peptidase possibly facilitating penetration by T. regenti, T. szidati and S. japonicum belong to CP class—most probably papain-like, for example, CB, as suggested by Dalton et al. 19

The two main SmCE peptidase isoforms expressed are SmCE-1a (AN: Q8MUW0) and SmCE-1b (AN: Q26552), which together comprise 90% of the released peptidolytic activity (Salter et al., 2000). The 7335-oligo-nucleotide micro-array chip was based on previously available ESTs from databases ( Jolly et al., 2007). 21 Two serine peptidases were cloned and their sequences blasted with non-trematode serine peptidase sequences, which suggests contamination of T. regenti and T. szidati cDNA by snail intermediate host cDNA (Radix sp. and Lymnaea stagnalis). The two contaminating snail serine peptidases are already annotated (RpS1, AN: A1ED51 and RpS2, A1ED52; Dolecˇkova´ et al., 2007; Kasˇny´, unpublished). 22 Serial analysis of gene expression (SAGE) performed by Williams et al. (2007) revealed expression of three novel types of trypsin-like gene transcripts in S. mansoni miracidia and 6-day cultured mother sporocysts. 20


225

(1997), Dolecˇkova´ et al. (2009), Dvorˇa´k et al. (2008), Kasˇny´ et al. (2007) and Ruppel et al. (2004).22 Phylogeny. A recent study of schistosome CE phylogeny in the context of other known serine peptidases disclosed a close relationship among S. mansoni CE isoforms and their orthologues in S. haematobium and S. douthitti, but not with other members of S1 serine peptidase family (e.g. Homo sapiens tryptase/pancreatic elastase, Bos taurus tryptase, Trichinella spiralis serine peptidase, Drosophila melanogaster trypsin-like peptidase, Dvorˇa´k et al., 2008; see Fig. 4.5). On this basis, it has been suggested that schistosome CEs diverge considerably from other serine peptidases, and that CPs may represent the more common molecular tool employed by primitive metazoa for tissue invasion and migration (Dvorˇa´k et al., 2008; Pleass et al., 2008).

4.4.1.1.2. Kallikrein-like peptidase In general, three forms of kallikrein have been described: plasma, tissue and prostate specific. Mammalian kallikreins are common serine endopeptidases (22–66 kDa, pH optimum around 4), which participate in a variety of physiological functions such as processing of bioactive peptides or blood coagulation (Iwata et al., 1983). In the MEROPS database, there are around 142 entries for kallikrein-like peptidases mostly annotated for human, mouse or rat, but there is only one kallikrein-like peptidase from trematodes, that is, S. mansoni (SmSP1; AN: MER004387, O16007, Rawlings et al., 2008; Table 4.4, SP). Using RT-PCR, Cocude et al. (1997) identified the SmSP1 mRNA in adults and cercariae/schistosomula of S. mansoni, although the detection of SmSP1 by Northern blot analysis was not successful. Sequence analysis showed that SmSP1 is more related to mammalian kallikreins (e.g. 42% similarity to vampire bat tissue plasminogen activator) than to SmCE (26%; Cocude et al., 1997). Immunolocalization of the native protein (SmSP1) with anti-sera raised in rats showed reaction in dorsal tubercles covering the surface of male worms and in parenchyma of both sexes. This localization coupled with homology of SmSP1 to human factor I (participating in complement pathway regulation) suggests that the role of SmSP1 is in modulation/evasion of the host immune response (Cocude et al., 1999). The activity of a purified kallikrein-like peptidase of S. mansoni adults (66 kDa) was detected with d-Pro-Phe-Arg-p-nitroanilide substrate and its inhibition profile characterized by common serine peptidase inhibitors, such as phenylmethylsulphonyl fluoride (PMSF), aprotinin or soybean trypsin inhibitor (Carvalho et al., 1998). The same S. mansoni kallikreinlike peptidase of adults was shown to cleave bradykinin and induce reduction of the arterial blood pressure of experimental animals (rats), probably due to a peripheral vasodilatation effect (Carvalho et al., 1998). The

226


FIGURE 4.5 Schematic tree illustrating phylogenetic relationships and AA sequential diversity of trematode peptidases covered by this review (127 representatives). Notes: The peptidases are split into 18 groups (connected by a bold dashed line). The branches of trematode peptidases are highlighted by bold lines and bold labels. For spatial reasons, clades of robustly classified peptidase representatives listed in Tables 4.2, 4.5, 4.6, 4.7 and 4.8 were substituted by black triangles with a label of one selected representative; number of sequences represented by the triangle is indicated. Only the unclassified, incorrectly classified or non-trematode sequences are individually labelled;


227

parasite enzyme might have a similar influence on visceral vasculature and capillary permeability of natural hosts (Carvalho et al., 1998).

4.4.1.1.3. Enterokinase-like peptidase Blast analysis revealed that a S. mansoni peptidase composed of 214 AA presented in the MEROPS database (AN: MER013674, classified as unassigned peptidase of the sub-family S1A) is identical to S. mansoni enterokinase-like peptidase annotated in the UniProtKB database (AN: Q9XYW2). The S. japonicum enterokinaselike peptidase is annotated in the MEROPS database as an unassigned peptidase (AN: MER098912) and in the UniProtKB database as unknown SJCHGC03379 protein (AN: Q5D9V2); transcripts were found in schistosomula and adult worms (Liu et al., 2006; Rawlings et al., 2008; see Table 4.4, SP). According to the AA sequence, this protein is recognized as S. japonicum enterokinase-like peptidase with 91% sequence similarity to the enterokinase-like peptidase of S. mansoni (ExPASy Proteomics Server, CLUSTALW alignment). There is only one entry in the MEROPS database for an enterokinase/enteropeptidase of Homo sapiens (AN: MER002068, P98073; Rawlings et al., 2008). The physiological function of human enterokinase (AN: P98073) is to initiate activation of pancreatic proteolytic pro-enzymes such as trypsin, chymotrypsin and carboxypeptidase A (e.g. Kitamoto et al., 1995). It catalyzes conversion of trypsinogen to trypsin, which in turn activates other pro-enzymes, including chymotrypsinogen, pro-carboxypeptidases branches of the non-trematode sequences were often merged into a single branch labelled by the higher group (Metazoa or Insecta). Bootstrap values are given on selected nodes (asterisk designates value Boc-Val-Leu-Lys-NHMec > Z-Phe-ArgNHMec > Z-Pro-Arg-NHMec (Brady et al., 2000b; Dalton et al., 2004; Kim et al., 2000; Lee et al., 2006; Robinson et al., 2008b; Stack et al., 2008). As stated above, Z-Arg-Arg-AMC is a very poor substrate for CL, but is readily accommodated by CB; this difference in substrate specificity allows us to distinguish CB from CL peptidase activities (Brady et al., 2000b; Kirschke and Barrett, 1987; Sajid and McKerrow, 2002). SmCL2, FhCL1/FhCL2 inability to cleave the Z-Arg-Arg-AMC substrate is caused by the restrictions in the active site cleft, namely in peptidase S2 pocket, which is not able to accommodate polar guanidinogroup of arginine (Brady et al., 2000a,b; Dalton et al., 2003a; Sajid and McKerrow, 2002). The CLs in general prefer aromatic AA (Arg, Phe and Tyr) at the P1 position and aliphatic AAs (Val, Leu) at the P2 position (Choe et al., 2006; Kirschke and Barrett, 1987). The S3 pocket has a crucial effect on peptidase specificity; for example, in SmCL2 it is narrowed by two AAs (Tyr60 and Gly61), in contrast to the S3 pocket of SmCF where these AAs were absent from the sequence (Brady et al., 2000b). The pH optimum of SmCL2 activity monitored by cleavage of Z-PheArg-NHMec/(AMC) is in acidic area between pH 3.0 and pH 6.5, with the peak at pH 5.35; SmCLs are almost non-active at pH values above 7.0 (Brady et al., 2000a; Dalton and Brindley, 1997). Robinson et al. (2008b) and Stack et al. (2008) referred to the activity of FhCL1/FhCL2 screened by a triplet of peptide substrates (Z-Leu-Arg-AMC, Z-Phe-Arg-AMC, Z-Pro-Arg-AMC) with focus on S2 sub-site preference. Both enzymes showed similarly lower affinity at pH 7.3 than at pH 5.5 (affinity of FhCL1: Z-Leu-Arg-NHMec > Z-Phe-Arg-NHMec Z-Pro-Arg-NHMec; affinity of FhCL2: Z-Leu-Arg-NHMec Z-Phe-Arg-NHMec Z-Pro-ArgNHMec; Robinson et al., 2008b; Stack et al., 2008).45 The low activity of SmCL2 (Brady et al., 2000a) or FhCL1/FhCL2 (Robinson et al., 2008b; Stack et al., 2008) at alkaline pH (>8) is in accordance with mammalian CL homologues (Mason et al., 1985), where the cells are protected by the phenomenon of pH-dependent activity of lysosomal (pH around 4) peptidases that are non-active after accidental influx to cytosol (pH around 7).46 45

The above referred CL activity could be enhanced by dithiothreitol (DTT), a reducing agent used to protect the nucleophilic thiol group of cysteine in the CP active site (Cleland, 1964); it works analogically with CBs. The pH optimum of PwCL is interestingly shifted close to the neutral pH of 7.5 (Na et al., 2006).

46


249

Peptidase activity uniquely associated with lectin-like activity of a probable CL from D. pseudospathaceum cercarial extracts has been described. A dominant double protein band appeared in the 22–24-kDa region in polyacrylamide gels; the protein was later cloned and identified as DpCL (Dolecˇkova´ et al., personal communication; Mikesˇ and Man, 2003). The theoretical molecular mass of the DpCL pro-peptidase and mature peptidase is 38 and 24 kDa, respectively (Dolecˇkova´ et al., personal communication). The pH optimum with Z-Phe-Arg-AMC is surprisingly high for a Clan CA peptidase, between 7.5 and 8.0; its pI is approximately 10. The affinity label, DCG-04, also bound to DpCL (Mikesˇ and Man, 2003; Mikesˇ, unpublished). Putative CL (or CF) activity was found in T. regenti and T. szidati cercarial extracts, because CP activity was not completely inhibited by the CB-selective CA-074 inhibitor (Dolecˇkova´ et al., 2007; Kasˇny´ et al., 2007; Mikesˇ et al., 2005). However, attempts to identify CL genes of T. regenti and T. szidati have not yet been successful. CP activity (possibly CB or CL) was recorded in the ESP of F. magna (see above), therefore, it can be hypothesized that some of the twodimensional immunolocalized major protein antigens (e.g. Fm 40 kDa) could be papain-like peptidases, too (e.g. CL—FmCL1, AN: B5AXI5) (Novobilsky´ et al., 2007b). Inhibition. E-64, Z-Phe-Ala-CHN2 (Mason et al., 1985) and Z-Phe-PheCHN2 (Mason et al., 1985) effectively inhibit the activity of trematode CLs (Brady et al., 2000a; Brindley et al., 1997; Caffrey and Ruppel, 1997b; Sajid and McKerrow, 2002).47 Likewise, the specific inhibitors of mammalian cathepsins L (Z-Phe-TyrO(But)-CHN2) and K (1-[N-benzyloxycarbonylleucyl]-5-[N-Boc-phenylalanyl-leucyl]carbohydrazide, cathepsin K inhibitor II) are also effective inhibitors of trematode CLs (e.g. FhCLs) (McGinty et al., 1993; Stack et al., 2008).48,49 Identification, localization and function. Purified SmCL2 migrates in SDSPAGE between 31 and 33 kDa, FhCL1/FhCL2 as 27.5/29.0 kDa, CsCL as 27 kDa and PwCL as 27 kDa (Brady et al., 2000a; Collins et al., 2004; Dalton et al., 2004; Lee et al., 2006; Park et al., 2001; Stack et al., 2008). 47

The inhibition effect of cathepsin K inhibitor II on FhCL1/FhCL2 activity is 20 times higher than the effect of the Z-Phe-Ala-CHN2 inhibitor (Stack et al., 2008). The genome projects (S. mansoni, S. japonicum and F. hepatica), and subsequent genome database data mining, are robust tools/approaches that can solve the problems of peptidase origin faster and can also be potent in the prediction of vaccine candidates or sero-diagnostic markers, based on sequentially determined gene function (McManus and Dalton et al., 2006). 49 Smith et al. (1994) observed that the inhibition of CLs activity could also be raised by antibodies produced against these CPs, as was documented for anti-FhCL. 50 The prokaryotic systems of expression based on Escherichia coli are not suitable for production of functionally active F. hepatica CLs, but the expression of these enzymes in the yeast systems with Pichia pastoris or Saccharomyces cerevisiae leads to functional enzyme (Dalton et al., 2003a). 51 The sequence analyses of FhCL did not reveal any potential N-glycosylation site (Dalton et al., 2003a). SmCL2 sequence contains one potential N-glycosylation site, however, this may not be glycosylated as it occurs close to the active site (Dalton et al., 1996; Michel et al., 1995). 48

250


Their theoretical molecular weights (according to AA sequences) are for SmCL2 24.3 kDa, FhCL1/FhCL2 24.17/24.45 kDa, CsCL 24 kDa and proPwCL 37 kDa (Brady et al., 2000a; Collins et al., 2004; Dalton et al., 2004; Lee et al., 2006; Park et al., 2001; Stack et al., 2008; see Table 4.5, CP).50,51 Several studies with the aim to localize SmCL2, in particular, developmental stages have been performed. Analysis of S. mansoni transcriptome confirmed SmCL2 among the enzymes expressed by cercariae ( Jolly et al., 2007). Besides, Dalton et al. (1997) immunolocalized SmCL2 in vesicles of postacetabular penetration glands of S. mansoni cercariae and suggested its involvement in penetration of the skin. SmCL2 was localized by immunostaining and in situ hybridization in structures associated with the reproductive system of females and subtegumental region of the gynaecophoric canal of males (Dillon et al., 2006; Michel et al., 1995). This suggests that SmCL2 is probably not involved in the blood digestion cascade, but has a special function in the reproductive apparatus; the content of SmCL2 was approximately five times higher in ESP from adult females than males, but its amount was lower than that of CF in both sexes (Brady et al., 2000a; Dalton and Brindley, 1997). In contrast, Bogitsh et al. (2001) immunolocalized SmCL2 peptidase in gastrointestinal tissue, similarly to SmCF (formerly SmCL1). Other studies show that CLs (i.e. L1 and L2) are localized in the gut of other invertebrates, for example, shrimps, Drosophila melanogaster larvae, and trematodes of the species F. hepatica, F. gigantica or P. westermani (Collins et al., 2004; Grams et al., 2001; Tort et al., 1999). In the case of P. westermani and F. magna adults, several isoforms of PwCLs and the first FmCL (FmCL1, 38 kDa) were discovered in ESP of adult worms by MS (Brady et al., 2000a; Kasˇny´ et al., unpublished; Lee et al., 2006). In fasciolids FhCL/FgCL/FmCL are likely to be the predominant peptidase activities secreted by the migrating juveniles and adults (Dalton et al., 2003a, 2004; Kasˇny´ et al., unpublished; Robinson et al., 2008b; Stack et al., 2008). Moreover, they represent the major blood digestive peptidases of F. hepatica and F. gigantica, localized in secretory vesicles within the gastrodermis (Dalton et al., 2003a; Grams et al., 2001; Robinson et al., 2008b; Stack et al., 2008).52 FhCL/FgCL or PwCL (PwNTP) can cleave macromolecular substrates such as collagen III and IV, laminin, fibronectin, haemoglobin and IgG (Berasaıń et al., 1997; Collins et al., 2004; Yamakami et al., 1995).

52

The F. hepatica CL is expressed as a pro-enzyme and is further trans-activated in a two-step process (Robinson et al., 2008a) that differs from that formerly described for SmCB1 trans-activated by AE (Sajid et al., 2003). CL is in the first step trans-pre-activated by AE, which can cleave the peptide bonds involving Asn AA in the region between the CL pro-domain and the domain of the mature enzyme. In the second step, the trans-pre-activated CL is able to cleave out the pro-sequence of other CL molecules by breaking the bond between Ser-His of Pro-Ser-His motif. It leads to the exponential activation of other pro-CL peptidases (Dalton et al., 2009; Robinson et al., 2008a).


251

In mice and cattle, FhCL1/FhCL2 probably modulate the host immune responses by cleavage of immunoglobulins, detachment of eosinophils or suppression of Th1 cell response and IFNg production (Berasaıń et al., 1997; Dalton et al., 2003a; O’Neill et al., 2000). A similar function was documented for FgCL1/FgCL2 or PwCL, where a delay of the host immune response is apparent after the treatment with the above peptidase (Grams et al., 2001; Hamajima et al., 1994). A novel localization of CL was discovered in the case of the fish eye fluke, D. pseudospathaceum; using mono-specific antibodies against the purified enzyme, its occurrence was confirmed in the dilated apical parts of penetration gland ducts. Its role in the penetration of fish skin was suggested (Mikesˇ and Man, 2003). Diagnostics and vaccines. Trematode CLs are considered to act as significant biomolecules at the trematode–host interface. They are also highly immunogenic and possibly useful for immunodiagnostics. Recombinant FhCL was successfully used by Cornelissen et al. (2001) for diagnosis of F. hepatica infection in sheep and cattle. The specificity and sensitivity of FhCL-ELISA was greater than 96.5% for both sheep and cattle (Cornelissen et al., 2001). Using ELISA with purified FhCL1 as antigen, human fascioliasis can be diagnosed (sensitivity 100%, Strauss et al., 1999). SmCL2 elicits an immune response in patients chronically infected with schistosomiasis, in contrast to CB1 for which specific IgG can be detected much earlier in the infection prior to the onset of egg laying (Grogan et al., 1997). PwCL as an immunodominant antigen was also tested as a component of serodiagnostic set for human paragonimiasis (Lee et al., 2006). Several of studies are devoted to trematode CLs as antigens in vaccination trials. Vaccines based on mixtures of peptidases belonging to various clans are the most potent ones (see above); indeed, CLs alone are very effective stimuli (Dalton et al., 2003b; McManus and Dalton, 2006). In a vaccine trial against cattle and sheep fascioliasis, vaccination with FhCL1/FhCL2 induced a high protection level (up to 72% in cattle and 79% in sheep) (Dalton et al., 2003a; Mulcahy et al., 1998; Piacenza et al., 1999). Protection of 76% was reached with rats immunized by FhCL3 DNA vaccine constructs (Harmsen et al., 2004).53 Schistosome CLs were examined for this purpose only several years ago (McManus, 2005; Wu et al., 2005). Phylogeny. The phylogenetic analysis of the C1 family of CPs revealed that SmCL2, FhCL1/FhCL2 and consequently FgCL1/FgCL2 and PwCL belong to one of three separate clades (CLs clade) of the evolutionary tree of the papain family, and are related to vertebrate cathepsins L, S and K 53

The reached values of protection are fluctuating at the level of beneficial effectiveness (80%) required by the pharmaceutical industry to ensure the economic benefit (Dalton, personal communication).

252


(Tort et al., 1999; see also Fig. 4.5). Robinson et al. (2008b) analyzed 24 F. hepatica and eight F. gigantica CL full-length sequences and revealed that the sequences are separated into five clades that arose through gene duplication 135 million years ago. This divergence correlates with the evolutionary separation of rodents, ruminants, higher mammals and probably enables the broad host specificity of F. hepatica and F. gigantica worms (Robinson et al., 2008b). The alignment performed by Sajid and McKerrow (2002) verified that parasite/trematode CLs are less similar to each other compared to CBs in terms of their conserved sequence motifs (Sajid and McKerrow, 2002).

4.4.2.1.3. Cathepsin F (CF) In this section, CFs are described with regard to the nomenclature changes of cathepsins SmCL1/SjCL1 to SmCF/SjCF (see Section 4.4.2.1.2.). CF sequence data were obtained for five trematode species (see Table 4.5, CP), but only four recombinant enzymes were characterized biochemically. The Metagonimus yokogawai partial sequence of CF (AN: MER016108, Q9BPL9) occurs in the MEROPS database 8.2, but other details are not available (Rawlings et al., 2008).54 The alignments of all CFs (around 309 AA) showed the highest sequence similarity between SmCF (AN: MER002332, Q26534) and SjCF (AN: MER02260, Q8MUU1; 84%), PwCF (AN: MER012043, Q9U0C8) and SjCF (57%), PwCF and SmCF (54%), and similarity of the remaining sequences is around 50%.55 The sequences of CFs commonly show low similarity to CLs (79%, Andersen et al., 1990; Scott and McMannus, 2000). General biochemical properties and specificity. Two main isoforms of CaNp with different ion sensitivities are recognized; the mCaNp requires micromolar and mCaNp millimolar concentrations of Ca2þ (Sorimachi, 2004). CaNps are heterodimers composed of a large approximately 80 kDa catalytic domain and approximately 30 kDa regulatory sub-unit. Both CaNp ‘80’ and ‘30’ domains possess together six sub-domains/sub-units (I–VI), where sub-domain II of CaNp ‘80’ domain is responsible for CP activity similar to papain-like peptidases such as CBs or CLs. The sub-domain II is defined (like CBs and CLs) by two other sub-sub-domains IIa and IIb, with the active site cleft and the catalytic AA triad of active site distributed between both sub-sub-domains IIa and IIb (IIa—Cys105, IIb—His262 and Asn286, numbering for rat CaNp, Hosfield et al., 1999; Sorimachi, 2004). These observations indicate that the CaNp ‘30’ sub-unit is not essential for peptidase activity. For SmCaNp (86.86 kDa) and SjCaNp (86.61 kDa) the active site AAs typical for papain-like peptidases were detected in positions Cys154 and His313 (SjCaNp numbering) and the isoelectric point of 5.34 assessed (Andersen et al., 1990; Scott and McMannus, 2000). Although the biological role of CaNp is more regulatory than peptidolytic, both properties were characterized in detail for S. mansoni and S. japonicum (Andersen et al., 1990; Ohta et al., 2004; Suzuki et al., 2004). In general CaNp(s) as peptidases have pH optimum at around 7.5 recorded, for example, by Mkwetshana et al. (2002) for CaNp purified from ostrich brain and using casein as a substrate. The fluorogenic substrates, such as Suc-Leu-Tyr-AMC, Boc-Val-Leu-Lys-AMC, Suc-LeuLeu-Val-Tyr-AMC and H-Glu(EDANS)-Pro-Leu-Phe-Ala-Glu-Arg-Lys (DABCYL)-OH, are routinely used for monitoring of CaNp activity (e.g. Mkwetshana et al., 2002; Sigma-Aldrich, www.sigmaaldrich.com; BACHEM, www.bachem.com). Inhibition. As mentioned above, the calpastatins are specific endogenous (cytosolic) CaNp inhibitors, showing broad mass range of up to 300 kDa (e.g. Suzuki et al., 2004; Wang and Yuen, 1999). Calpastatin was first cloned from rabbit liver by Emori et al. (1987), but no trematode orthologues have been recorded yet. The relevant data about trematode CaNp(s) synthetic inhibitors are also missing. Due to sequence similarities of trematode CaNp(s) with CaNp(s) of vertebrates we can suppose that the spectrum of inhibitors (calpastatin, calpain inhibitor I [N-acetyl-LeuLeu-non-leucinal] or calpain inhibitor II [N-acetyl-Leu-Leu-methional]) and their effect could be similar. Identification, localization and function. Northern blot and recent transcriptomic analyses (based on S. mansoni or S. japonicum ESTs) revealed that both enzymes are expressed in adult worms (Andersen et al., 1990;

258


Jolly et al., 2007; Liu et al., 2006; Scott and McManus, 2000; CompBio-S. mansoni and www.schistodb.org). Moreover, transcripts of SmCaNp were detected in sporocysts, cercariae and schistosomula, and minutely in eggs (Andersen et al., 1990; Caffrey et al., 2004; Jolly et al., 2007; Liu et al., 2006; CompBio-S.mansoni and www.schistodb.org). Reactivity of SjCaNp with specific monoclonal antibodies was found also in cercarial glands (probably the head gland) and in cercarial ESP in the form of ‘kissing marks’ or ‘foot prints’ (Kumagai et al., 2005; for ‘kissing marks’ or ‘foot prints’ see Mikesˇ et al., 2005). Moreover, Dvorˇa´k et al. (2008) identified three SjCaNp(III) protein fragments and Knudsen et al. (2005) SmCaNp(-large chain) in cercarial ESP by MS analysis, although these SmCaNp fragments may originate from the cercarial tegument.61 Siddiqui et al. (1993) purified the SmCaNp from worm extract and immunolocalized the enzyme in the tegument of adults. Rao et al. (2002) showed that SmCaNp of ESP and tegumental origin could induce eosinophilia and release histamine from mast cells and basophils. Accordingly, they postulated that SmCaNp may contribute to the development of allergic inflammation—cercarial dermatitis.62 Diagnostics and vaccines. Since SmCaNp or SjCaNp are abundant schistosome antigens they were tested in experimental immunization trials. Immunization of mice with recombinant SmCaNp and SjCsNp provided over 39% and over 41% protection, respectively (decrease of worm burden) (Hota-Mitchell et al., 1999; Ohta et al., 2004). Comparable protection was obtained in mice immunized with recombinant SmCaNp (80-kDa domain) plasmid DNA construct (39%), and the protection was increased up to 57% when the SmCaNp plasmid DNA construct was co-administered with plasmids encoding interleukin (IL)-2 (Th1-response-promoting cytokine) (Siddiqui et al., 2003). The experiment was repeated by Siddiqui et al. (2005) with a group of baboons (‘experimental model more related to humans’) immunized with SmCaNp together with IL-2 (both in plasmid DNA construct), but only 21–34% decrease in living schistosomula in infected animals was recorded. Phylogeny. The phylogenetic analysis showed that schistosome CaNps cluster together as a separate node containing CaNps of mice, humans, filariae, etc. (Rao et al., 2002; see also Fig. 4.5).

61

Smith and Dodd (2007) suggested that calpain could play a significant role in protein degradation by proteasome—calpain activation increases proteasome-dependent proteolysis (recorded with rats, see also Section 4.4.5.). 62 Matsumura et al. (1991) considered possible involvement of protein kinase C and Ca2þ ions in peptidase expulsion from the penetration glands of S. mansoni cercariae enabled by muscle contractions. Although we did not detect CaNp in T. regenti or T. szidati ESPs, we recorded results similar to Matsumura et al. (1991) in terms of cercarial motoric behaviour after addition of Ca2þ ionofor into cercarial suspension (Mikesˇ et al., 2005). This behaviour might also be caused by increased Ca2þ ion levels in the sarcoplasm followed by a protein kinase C effect via CaNp (Orwig et al., 1994; Rao et al., 2002).


259

4.4.2.3. Asparaginyl-like peptidases (legumains; clan CD, family C13) The CD clan of peptidases contains, besides the family C13 (legumains), five other families: C11—clostripain, C14—caspase-1, C25—gingipain R, C50—separase and C80—RTX self-cleaving toxin (Rawlings et al., 2008). They are classified within the CD clan on the basis of AA sequence similarities and AA in the catalytic dyad. Clan CD peptidases of the legumain family contain catalytic AA residues within the active site that are organized reversely (His156/Cys197) to clan CA peptidases (Cys/ His) (numbering for SmAE; AN: MER060472, P09841). The combination of AA residues His-Gly-//-Ala-Cys places the legumain-like peptidases (e.g. SmAE, see below) to the proximity of caspases that share the same motif (Chen et al., 1998a,b).

4.4.2.3.1. Asparaginyl endopeptidase (AE) AE is synonymous with the term legumain. Earlier, in the context of schistosome peptidases, the enzyme had been termed ‘haemoglobinase’ due to its localization in the parasite gut and putative function in digestion of host blood proteins (reviewed by Caffrey et al., 2004). Its identity as a peptidase was not known at the time when its prominence as the larger of two immunodominant proteins (Sm31/32) in human or experimental animal infections came to light in the mid-1980s (Klinkert, 1987, 1989; Ruppel et al., 1985; 1987). Davis et al. (1987) first cloned and sequenced SmAE. However, its confirmation as a peptidase (it was the first description of an entirely new type of peptidase) had to wait until an orthologue was identified in leguminous plants (Canavalia ensiformis, jack bean legumain; e.g. AN: P49046) (Abe et al., 1993), hence the subsequent use of the term ‘legumain’. Since then AEs have been described in most eukaryotic organisms, including plants, animals, fungi and protists (see MEROPS database 8.2— clan CD, family C13; Rawlings et al., 2008). AEs are associated with vacuoles of plants (processing and degradation of proteins; Hara-Nishimura et al., 1993; Mu¨ntz et al., 2002), and in mammalian lysosomes (processing of antigens in major histocompatibility complex (MHC)-II presenting cells; Chen et al., 1997; Schwar et al., 2002).63 The peptidase databases (e.g. MEROPS database 8.2) contain annotation for AEs in at least five trematodes (S. mansoni, S. japonicum, F. hepatica, F. gigantica and Opishtorchis viverrini; see Table 4.5, CP, Rawlings et al., 2008).64 Recently, an AE of P. westermani was characterized, but it is not annotated within the public databases (Choi et al., 2006). All the 63 Caffrey et al. (2000) identified two transcripts for SmAE encoding active and inactive forms of the peptidase, and expressed both forms heterologously in Pichia pastoris. Interestingly, the inactive form of SmAE is actively translated (Delcroix et al., 2007) leading to the suggestion that this inactive peptidase homologue may have some regulatory function in the hydrolysis of host proteins by the parasite (Delcroix et al., 2007). 64 Opisthorchis viverrini is a South-east Asian zoonotic liver fluke related to C. sinensis, which could cause, similarly to C. sinensis, cancer of bile ducts (cholangiocarcinoma) in humans (e.g. Ashford and Crewe, 1998).

260


trematode AEs show significant AA sequence similarity, between 50% and 70% (Adisakwattana et al., 2007; Caffrey et al., 2000; Choi et al., 2006; El-Meanawy et al., 1990; Tkalcevic et al., 1995). General biochemical properties and specificity. AE is mainly known for its ability to process other peptidases (i.e. remove the pro-peptide from zymogens). In contrast, AE can also auto-catalytically process itself, by cleaving at the Asn (SmAE Asn329) and removing a C-terminal propeptide under acidic conditions (e.g. for SmAE at pH 4.5; Caffrey et al., 2000; El-Meanawy et al., 1990). AEs have a restricted cleavage specificity for Asn at P1 (Dando et al., 1999; Mathieu et al., 2002). The sub-site specificity of SmAE was investigated using a positional scanning-synthetic combinatorial library with Asn fixed at P1 position. It revealed the preferred AA at P2 and P3 positions (P2: Ala>Thr>Val>Asn and P3: Thr>Ala>Val>Ile; Mathieu et al., 2002). It was also shown that SmAE has a broader specificity for AAs at P3 than at P2 (Mathieu et al., 2002). Additionally, Mathieu et al. (2002) recorded a significant difference between SmAE (AN: P09841) and human AE (AN: Q99538) in AA preferences at P3 position, a detail that could be exploited for designing potent and selective SmAE inhibitors. According to the information above, Z-Ala-Ala-Asn-AMC is a widely used substrate for monitoring of AE.65 SmAE cleaves this substrate preferably at pH optimum around 6.8, and reducing agents (e.g. DTT) do not or only slightly increase AE activity (known for SmAE; Caffrey et al., 2000; Dalton et al., 1995, 2004). The pH optimum for PwAE, however, is between 3.0 and 5.5 (Choi et al., 2006). Recombinant PwAE did not degrade native proteins including collagen, fibrinogen and fibronectin (Choi et al., 2006), but PwAE and SmAE degrade haemoglobin (Choi et al., 2006; Delcroix et al., 2006). Inhibition. The peptidase activity of AE against Z-Ala-Ala-Asn-AMC is inhibited by several alkylating agents, such as N-ethylmaleimide and iodoacetamide, and by the macromolecular inhibitor, cystatin-C (AlvarezFernandez et al., 1999). Clan CA CP inhibitors such as E-64 and Z-Phe-AlaCHN2 are less effective (Caffrey et al., 2000; Dalton et al., 2004; Sajid et al., 2003). Selective inhibition and visualization of AEs after SDS-PAGE is possible with peptidyl affinity labels such as those containing the acyloxymethyl ketone reactive site group (Delcroix et al., 2006; Kato et al., 2005). For S. mansoni and a number of other parasitic organisms, the possible function of AE as a pro-protein processor of other peptidases (see Section 4.4.2.1.1., Note 41 and in paragraph below) involved in the degradation of host proteins makes it an attractive drug target (Caffrey et al., 2004). A number of reports detail the mechanism and structure–activity 65

SmAE activity monitored with Z-Arg-Arg-Asn-AMC substrate was the first record of AE activity in animal tissues (Dalton et al., 1995).


261

relationships of selective peptidyl inhibitors of parasite AEs with a view to mapping the catalytic specificity of these enzymes fully (e.g. Ekici et al., 2004; Go¨tz et al., 2008; James et al., 2003). Identification, localization and function. As noted above, SmAE is an immunodominant 32-kDa protein associated with the adult (Ruppel et al., 1987, 1991) and the rudimentary gut and protonephridia of cercariae (Skelly and Shoemaker, 2001). AE localization in the gut was observed in adult worms of F. gigantica and P. westermani (Adisakwattana et al., 2007; Choi et al., 2006). AEs transcripts are expressed predominantly in male and female worms, but not in eggs or miracidia (Caffrey et al., 2004; Liu et al., 2006; Jolly et al., 2007; CompBio-S.mansoni and www.schistodb.org). After soaking of adult S. mansoni with SmAE-specific double-stranded RNA (dsRNA), a 98% loss of AE activity monitored in worm extracts using the AE specific substrate (Z-Ala-Ala-Asn-AMC) was noted (Delcroix et al., 2006). In the same worms the activity of SmCB1 (monitored by Z-ArgArg-AMC substrate) was also decreased (20%), which suggests some interconnectivity, perhaps by decreased activation and processing of SmCB1 zymogen as shown earlier to occur in vitro by Sajid et al. (2003) (see Figs. 4.2 and 4.6). In contrast, Krautz-Peterson and Skelly (2008) obtained no decrease of activity of SmCB1 in soluble extracts of RNAi-treated worms (using the same Z-Arg-Arg-AMC CB-specific substrate) after suppression of SmAE in adult worms by RNAi (>90%). Therefore, the authors concluded that SmAE may not be necessary for trans-activation of SmCB1 in vivo and speculate about a role of other/unknown enzymatic ‘transactivator’. However, knockdown of AE was not total and it is still possible that sufficient AE activity remained to allow processing of proSmCB1. Alternatively, activation of pro-SmCB1 in vivo may be autocatalytic. Thus, the hypothesis of the role of AE in trans-activation of SmCB1 and (possibly) other peptidase zymogens remains to be tested definitively. The recent results of Dalton et al. (2009) and Robinson et al. (2008a) support the role of AE peptidase as trans-activator of FhCL1 (recorded in vitro; see Note 41). Diagnostics and vaccines. SmAE of adult worms is a well-characterized serodiagnostic marker of schistosomiasis (e.g. Chappell and Dresden, 1986; Ruppel et al., 1991). This is supported in work by Planchart et al. (2007) who detected a major 31/32-kDa protein double band in ‘vomitus’ of S. mansoni adults using immunoblot analysis with sera of infected mice or humans. The importance of AE in trematode proteolysis and nutrition has encouraged vaccination trials in mammals using recombinant AE (inactive form) and AE cDNA constructs. Chlichlia et al. (2001) vaccinated mice with SmAE cDNA constructs and induced a modest, yet significant, 37% decrease of egg production. Phylogeny. The legumain family and the other families of clan CD are evolutionarily diverse, but they probably derived from a common

TABLE 4.6

Aspartic peptidases (AP)

The MEROPS database 8.2 includes around 176 different sequences of aspartic peptidases (AP). They are divided into seven clans (AA, AB, AC, AD, AE, AF, A-) and 14 families with nearly half of the peptidase members (76) placed into the clan AA, family A1 – pepsin A-like peptidases (according to pepsin A of Homo sapiens). The peptidase sequences of five trematodes are also classified in the A1 family (Rawlings et al., 2008). Accession number Peptidase (catalytic triad)

Species (stage)

MEROPS

UniProtKB/ TrEMBL

MW (kDa) practical/ theoretical

MEROPS (ID)

PEPSIN-LIKE (Asp,/Asp)

Cathepsin D (Wong et al., 1997) (Silva et al., 2005-sub) (Verity et al., 1999) (CompBio-S. mansoni) (www. schistodb. org)

Clan, family AA,A1(A)

SmCD

Schistosoma mansoni (A)

MER003498

P91802

46/47

A01.009

AA,A1(A)

SmCD2

Schistosoma mansoni (A) Schistosoma mansoni (A)

MER062900

Q2Q0I8

46/45

A01.009

AA,A1(A)

MER118121

B0L5P6

SmCD3

Other properties (pH optimum of activity, preferred substrates, biological function) pH optimum around 3.5 specific substrate: H-Phe-Ala-Ala-4nitro-Phe-Phe-ValLeu-pyridin-4-yl methyl ester

specific inhibitor: pepstatin SjCD

Schistosoma japonicum (A)

MER001959, MER101078

Q26515, Q5DI07

41,46/47

A01.009

AA,A1(A)

(Becker et al., 1995)

( Jarzabowski et al., 2006-sub) (Lee et al., 2001-sub) (Huong et al., 2005-sub)

cathepsins D are associated with digestion in the gut of trematode adults and larvae (schistosomula), they may participate in immune evasion FhCD

Fasciola hepatica (A)

MER080861

A0FIJ5

-/47

A01.009

AA,A1(A)

CsCD

Clonorchis sinensis (A) Opisthorchis viverrini(A)

MER016092

Q95VA2

-/46

A01.009

AA,A1(A)

MER052779

Q45HJ6

-/46

A01.009

AA,A1(A)

-

-

-

-

-

-

-

-

-

-

OvCD

endopeptidase proteolysis

Unassigned peptidase or nonpeptidase homologues and othersa

U01/ N00 U02/ N00

Schistosoma mansoni Schistosoma japonicum

(continued)

TABLE 4.6 (continued) Accession number Peptidase (catalytic triad) (Copeland et al., 2003) (Liu et al., 2006) (Liu et al., 2008-sub) (Bae et al., 2001-sub)

U01/ N00

Species (stage)

MEROPS

UniProtKB/ TrEMBL

Clonorchis sinesis

-

-


MEROPS (ID)

Clan, family

Other properties (pH optimum of activity, preferred substrates, biological function)

-

-

-

-

Notes: A, adults; ID, identification; N, number of non-peptidase homologues; U, number of unassigned peptidases; e.g. Cocude et al., 1997-sub—‘sub’ here indicates that sequence is submitted to the database (UniProtKB/TrEMBL) without link to relevant publication; MW (kDa) practical—two numbers shown, e.g. 33,38/24p, mean MW of pro-peptidase and mature peptidase. Database links: MEROPS, http://merops. sanger.ac.uk; UniProtKB/TrEMBL, http://www.expasy.org/sprot; S. mansoni ESTs databases, www.compbio.dfci.harvard.edu (CompBio-S.mansoni) or www.schistodb.org (both Schistosoma mansoni genome databases are based on TIGR project). a These peptidases are annotated in MEROPS database as ‘unassigned peptidases’ or as ‘non-peptidase homologues’ or are not relevant due to missing of data.


265

ancestor (e.g. Chen et al., 1998a; Tort et al., 1999; see also Fig. 4.5). AEs represent one component of a larger group of proteins structurally organized around a ‘caspase-haemoglobinase fold’ with distant members found in the Archaea (Aravind and Koonin, 2002).

4.4.3. Aspartic peptidases (APs) of trematodes The APs are enzymes with different mechanism of catalysis from the above cases (Table 4.6). Whereas for serine and CPs, the nucleophile attack (during catalysis) is facilitated by a reactive group of the AA side chain (–OH or –SH), for APs the nucleophile attack is initiated by an activated water molecule via the side chain of Asp (Dunn, 2002; James, 2004; see Fig. 4.1).

4.4.3.1. Pepsin A-like peptidases (clan AA, family A1(A)) Peptidases of the family A1 have been described only in eukaryotes. They comprise the well-known enzymes pepsin and chymosin and their lysosomal homologues, cathepsins D (Dunn, 2002). Uniquely, the A1 family shows duplication of the main peptidase domain that arose due to gene duplication. Each duplicated domain possesses its own catalytic AA (Asp32 and Asp215, numbered for human pepsin, AN: P00790) driving the cleavage of peptide substrates (Dunn, 2002; Rawlings et al., 2008). The other important AA linked with the peptidase–substrate interaction is Tyr137, which interacts with a b-hairpin sequence component termed ‘the flap’, that covers the active site and contributes to peptidase specificity (Dunn, 2002). All A1 peptidase family members are endopeptidases that are active at strictly acidic pH around 3.5 (Conner et al., 2004; Rawlings et al., 2008).

4.4.3.1.1. Cathepsin D (CD) In the MEROPS database 8.2 there are sequence entries of five trematode CDs, but only CDs of S. mansoni and S. japonicum were characterized as purified and recombinant enzymes (see Table 4.6, AP; Rawlings et al., 2008). The sequence identity of the known trematode CD orthologues is greater than 39%, different mostly in the pro-region of peptidases. Slightly lower similarities have been found when homologous vertebrate enzymes were included in alignment analysis (e.g. human CD around 33% similarity, AN: P07339; ExPASy Proteomics Server, CLUSTALW alignment). The Asp33/Asp231 responsible for specificity of SmCD (AN: MER003498, P91802) and SjCD (AN: MER001959, Q26515) are highly conserved active site AA residues for both peptidases. Significant sequence differences of SmCD/SjCD were recorded in the glycosylated parts (Wong et al., 1997). The conserved AA Lys203 of SjCD (similarly to CDs of humans, chickens, mosquitoes) is substituted by Gln203 in the case of SmCD (similarly to bovine CD). It has been suggested that

266


schistosome CDs (SmCD/SjCD) can be expressed in at least in two forms with or without a COOH-terminal extension (around 40 AA), the extension possibly influences the sorting of the enzymes into lysosomes and/or leads to their various physiological functions (Wong et al., 1997). The alignment performed with published/annotated SmCD/SjCD sequences (Becker et al., 1995; Liu et al., 2006-sub; Silva et al., 2005-sub; Wong et al., 1997-sub, see Table 4.6, AP; see Table 4.6, AP; Rawlings et al., 2008) verified this hypothesis, identifying both forms of enzymes (ExPASy Proteomics Server, CLUSTALW alignment). General biochemical properties, specificity and inhibition. The relatively ‘wide’ active site cleft of CDs preferably interacts with hydrophobic AA of larger CD-specific oligo-peptide substrates (e.g. Boc-Phe-Ala-Ala-pnitro-Phe-Phe-Val-Leu-4-hydroxymethyl pyridine, Cesari et al., 1998). The recombinant SmCD and SjCD have the pH optimum for cleavage of the above substrate of 3.8 and 3.5, respectively (Becker et al., 1995; Cesari et al., 1998). Pepstatin is a potent CD inhibitor with greater than 80% inhibition effect (Becker et al., 1995; Caffrey et al., 1998, 2005; Cesari et al., 1998; Verity et al., 1999). Pepstatin affinity chromatography is widely used for purification of CDs from protein extracts or expression system media. Employing this technique, the auto-activated 40-kDa SmCD/SjCD peptidases were isolated (Brindley et al., 2001; Verity et al., 1999). Using homology-modelling of the SjCD–pepstatin complex and peptidyl statin inhibitors, Caffrey et al. (2005) demonstrated differences in the active site cleft topography and potency of inhibition compared to both the human cathepsin D and the secreted AP 2 of the pathogenic yeast, Candida albicans. These differences may provide for the development of specific SjCD inhibitors. Identification, localization and function. Both SmCD and SjCD have been localized in the gastrodermis of adult worms using immunohistochemical or molecular techniques (Bogitsh and Kirschner, 1987; Brindley et al., 2001; Verity et al., 1999). In addition to this, Verity et al. (1999) detected CD activity (by use of a specific substrate) and CD negligible transcription (by RT-PCR) in eggs and miracidia of S. japonicum. A significant level of SmCD transcription was observed only in adult worms (Caffrey et al., 2004; Hu et al., 2003; Jolly et al., 2007; Liu et al., 2006; CompBio-S.mansoni and www.schistodb.org).66 Trematode CD function has been investigated mainly with regard to worm nutrition. CD is intimately involved in the degradation of host haemoglobin (Brindley et al., 2001; Caffrey et al., 2004; Delcroix et al., 66 We have cloned CD genes from T. regenti and T. szidati cDNA using mRNA isolated from cercarial germ balls and PCR with degenerate primers according to Dalton and Brindley (1997). The deduced TrCD/TsCD AA sequences were more than 95% similar but they did not significantly blast with any known trematode CD sequences (Kasˇny´ et al., unpublished).


267

2007; Koehler et al., 2007; Verity et al., 1999; see Fig. 4.6). Employing specific chemical inhibitors of various peptidase classes and RNAi, Delcroix et al. (2006) measured the contribution of CB/CL and CD activities of adult S. mansoni to the digestion of haemoglobin and serum albumin. It was determined that both cysteine and aspartic activities contribute to the digestion of both proteins, albeit with some substratespecific preferences. These activities along with SmAE form a network of peptidases designed to cleave ingested proteins as a source of nutrients efficiently (Delcroix et al., 2006). Morales et al. (2008) employed similar RNAi techniques with S. mansoni schistosomula and revealed a significant decrease in CD transcription following specific RNAi. In addition, rather than the normal brown–black pigmentation of the parasite gut (demonstrative of digestion of haemoglobin) the gut pigment was red, perhaps suggestive of decreased haemoglobinolysis overall (Morales et al., 2008). The active sites of SmCD and SjCD specifically cleave the human haemoglobin a-chain between the Phe36-Pro37 AAs. Therefore, the substrates with Pro AA at P1 position are highly attractive for SmCD/SjCD or other APs (Brinkworth et al., 2001; Koehler et al., 2007; Silva et al., 2002). The cleavage of a haemoglobin tetramer by SmCD/SjCD produces peptide dimers of 16 kDa and subsequently monomers of around 6 kDa, which are then cleaved by other peptidases of the haemoglobin digestion network (see Fig. 4.6, Delcroix et al., 2006; Koehler et al., 2007). SmCD/ SjCD cleave haemoglobin optimally at low pH of around 3.5 consistent with AP activity measured against haemoglobin in extracts of adult S. mansoni and S. japonicum (Caffrey et al., 1998). As this low pH optimum differs from the estimated pH 6.0–6.4 in the schistosome gut lumen, the hypothesis of the existence of acidic ‘micro-environments’ in the gut (see Section 4.4.2.1.1. for SmCB) was raised to explain how CD could contribute efficiently to haemoglobinolysis (Brindley et al., 2001; Delcroix et al., 2006; Sajid et al., 2003). Besides digestion, schistosome CD can effectively cleave human IgG by removing Fc fragments, or degrade C3 factor of the complement, all of which points to the role of schistosome CD in immune evasion (Verity et al., 2001a). Diagnostics and vaccines. Verity et al. (2001b) recorded modest (21–38%) worm burden reduction in mice treated with recombinant SjCD. Subsequently, SmCD/SjCD antigens have been tested as immunodiagnostic markers of schistosomiasis. Interestingly, rabbit sera raised against SmCD/SjCD did not recognize recombinant bovine CD and vice versa. This indicates a possibility to design a selective SmCD/SjCD specific inhibitor for treatment of schistosomiasis (Valdivieso et al., 2003). Phylogeny. Morales et al. (2004) constructed a phylogenetic tree to show the relationship of SmCD and its orthologue SjCD with CDs of

TABLE 4.7

Metallopeptidases (MPs)

To 2009, there are 511 different metallopeptidase sequences of 15 clans and 54 families annotated in the MEROPS database 8.2. The referred high family number demonstrates extreme diversification of this peptidase class. There are 10 various sequences of five trematode species classified in seven clans and nine families (10, around 2.0%, Rawlings et al., 2008). Accession number

Peptidase (catalytic triad) DIPEPTIDYL-PEPTIDASE III-LIKE (His/Glu/His/Glu) Di-peptidyl-peptidase III FtsH-LIKE PEPTIDASES (His/Glu/His/Asp) Afg3-like protein 2 (He et al., 2001-sub) STE24-LIKE PEPTIDASE (His/Glu/His/Glu) Farnesylated-proteinconverting enzyme 1 THIMET-LIKE-OLIGOPEPTIDASE (His/Glu/Xaa/Xaa/His) Thimet oligo-peptidase (Liu et al., 2006) PITRILYSIN-LIKE PEPTIDASE (His/Glu/Xaa/Xaa/His) Nardilysin peptidase (Liu et al., 2006)

Species (stage)

MEROPS

UniProtKB/TrEMBL

MW (kDa) practical/ MEROPS theoretical (ID)

Clan, family


M-,M49 SmDPIII Schistosoma mansoni (A)

MER004253

-

-/-

M49.001

M-,M49 MA,M41

-


MER035521

Q86DM6

-/51

M41.007

MA,M41

-

MA,M48 -


MER002645

-

-/-

M48.003

MA,M48

-

MA,M03

-


MER103219

Q5C1N0

-/37p

M03.001

MA,M03

-

ME,M16

-


MER123316

Q5DD24

-/127

M16.005

ME,M16

-

METHIONYL AMINOPEPTIDASE 1-LIKE (His/Asp/Asp/His/Glu/ Glu) Methionyl aminopeptidase 2 (Hu et al., 2003) O-SIALOGLYCOPROTEIN -LIKE PEPTIDASE (His/His) Mername-AA018 peptidase

(Liu et al., 2006) POH1-LIKE PEPTIDASE (Glu/His/His/Asp) Poh1 peptidase (Nabhan et al., 2001) (Liu et al., 2006)

MG,M24

-

MER035520

Q86ES3

-/39

M24.002

MG,M24

MK,M22

-


MER080432

Q3KZ70

-/12p

M22.004

MK,M22

-

MP,M67 -

26S proteasome non-ATPase regulatory sub-unit 7 (Hu et al., 2003) (Cho et al., 2007) Unassigned peptidase or non-peptidase homologues and othersa


SmLAP

SjLAP

Schistosoma mansoni (A) Schistosoma japonicum (A) Schistosoma japonicum (A) Clonorchis sinensis Schistosoma mansoni (A) Schistosoma japonicum (A)

MER021971

O16154

-/35

M67.001

MP,M67

MER125222

Q5DI41

-/35

M67.001

MP,M67

MER035522

Q86F68

-/40

M67.973

MP,M67

MER126181

A7XWR6

-/28p

M67,-

MP,M67

MER003499

P91803

-/56

-

MF,M17

SmLAP and SjLAP

MER015278

Q9GQ37

-/54

-

MF,M17

pH optimum around 8.25 specific substrate:

-

(continued)

TABLE 4.7 (continued) Accession number

Species (stage)


MEROPS

UniProtKB/TrEMBL

MW (kDa) practical/ MEROPS theoretical (ID)

Clan, family


(Mernath, 1994-sub)

FhLAP

Fasciola hepatica MER079520 (A)

Q17TZ3

-/56

-

MF,M17

H-Leu-AMC

(Hancoc et al., 1997-sub) (Acosta et al., 2004-sub)

PwLAP

Paragonimus westermant (A)

A1Z0K2

-/60

-

MF,M17

specific inhibitor: bestatin

U04/ N03

Schistosoma japonicum

MER081108

(Song et al., 2007-sub)

(Hu et al., 2003)

(Liu et al., 2006) (He et al., 2001-sub) (Wang et al., 2000-sub)

they are associated with the digestion activity of trematode adults and larvae (schistosomula), membrane re-modelling

exo-/endopeptidase, proteolysis

Notes: A, adults; ID, identification; 21/17p—‘p’ here means the theoretical molecular weight (MW) of partial sequence; e.g. Cocude et al., 1997-sub—‘sub’ here indicates that sequence is submitted to the database (UniProtKB/TrEMBL) without link to relevant publication; MW (kDa) practical—two numbers shown, e.g. 33,38/24p, mean MW of pro-peptidase and mature peptidase. Database links: MEROPS, http://merops. sanger.ac.uk; UniProtKB/TrEMBL, http://www.expasy.org/sprot; S. mansoni ESTs databases, www.compbio.dfci.harvard.edu (CompBio-S.mansoni) or www.schistodb.org (both Schistosoma mansoni genome databases are based on TIGR project). a These peptidases are annotated in MEROPS database as ‘unassigned peptidases’ or as ‘non-peptidase homologues’ or are not relevant due to missing of data.


271

other eukaryotic organisms. SmCD/SjCD clustered with the clade of insect (e.g. CDs of Drosophila melanogaster and Aedes aegypti) and mammalian CDs (e.g. Homo sapiens and Bos taurus) and, interestingly, CDs of other parasitic organisms (e.g. CD of Plasmodium falciparum and Haemonchus contortus) were located on more distant branches (see also Fig. 4.5).

4.4.4. Metallopeptidases (MPs) of trematodes The nucleophilic attack of peptide bond during MP catalysis is mediated by water molecules (similarly to AP; Auld, 2004; Rawlings and Barrett, 2004c; see Fig. 4.1; Table 4.7). The water molecule is activated via divalent metal cations of the active site centre (mostly Zn2þ and/or Co2þ, Mn2þ, Ni2þ or Cu2þ). Metal cations are kept in their positions by AAs of a conserved extra-folded AA structure (usually by His, Glu, Asp and Lys); these binding sites are, therefore, required for successful catalysis (Auld, 2004; Lowther and Matthews, 2002). MPs act as exopeptidases when they possess only one metal cation, or they can act as exo- or endopeptidases when two metal cations are included (Auld, 2004). In some cases, co-operation of two metal cations is essential for full peptidase activity.67 MPs exhibit a quite broad range of specificity to peptide substrates, usually defined by P1 and P1’ substrate AAs (e.g. Lowther and Matthews, 2002). Of the trematode MPs only two, leucyl aminopeptidase (LAP) and DPP III, have been characterized extensively. The remaining trematode MPs are annotated as partial sequences in the EST databases.

4.4.4.1. Leucyl aminopeptidase-like peptidases (clan MF, family M17) 4.4.4.1.1. Leucyl aminopeptidase (LAP) LAP was the first identified twometal-cation MP (Burley et al., 1990). The sequence identity of S. mansoni, S. japonicum, F. hepatica and P. westermani LAPs was greater than 34% in multiple alignment (Table 4.7, MP, ExPASy Proteomics Server, CLUSTALW alignment). All LAP sequences of the above trematode species are misclassified in the MEROPS database 8.2. as unassigned peptidases of clan MF, family M17 or non-peptidase homologues (see Table 4.7, MP). The active site motif ‘NTDAEGR’ of highly conserved C-terminal domain was identified in all four AA sequences of SmLAP, SjLAP, FhLAP and PwLAP (Kim and Lipscomb, 1993).68 67

For many of MPs the motif ‘HEXXH’ is typical (His-Glu-Xaa-Xaa-His; e.g. thimet-like oligo-peptidase) via which a tetrahedral intermediate is formed. The two His residues bind to the metal atom, and the Glu residue has a catalytic role. The zinc atom can be bound also by a third AA residue such as Glu, Asp or His and the fourth binding molecule is water, mediating the nucleophilic attack at the scissile peptide bond. 68 The Zn2þ-binding AAs are also highly conserved (for all LAPs). For one sub-unit of SmLAP/SjLAP these residues were identified: ‘Asp289/Asp367/Glu369’ for the first atom and ‘Asp289/Lys284/Asp307/Glu369’ for the second Zn2þ atom (McCarthy et al., 2004).

272


LAPs are widely distributed cytosolic exopeptidases that possess six sub-units with 12 Zn2þ cations; that is, two Zn2þ for each sub-unit of around 56 kDa for SmLAP/SjLAP, around 60 kDa for PwLAP and around 56 kDa for FhLAP. The purified SmLAP/SjLAP proteins are 57.5 kDa and 52 kDa (Acosta et al., 2004-sub; McCarthy et al., 2004; Song et al., 2007-sub, see Table 4.7, MP; Rawlings et al., 2008). As its name predicts, the LAP peptidase prefers the Leu AA at P1 position of the substrate: substrates with Asp and Gly at P1 position are not cleaved by LAP. Selectivity for AA at P1’ is restricted for large hydrophobic AAs such as Tyr and Phe (Lowther and Matthews, 2002). L-Leu-AMC is generally used as a diagnostic substrate for monitoring LAP activity. For SmLAP/SjLAP the substrate preferences have been recorded; these were: L-Leu-AMC >> L-Tyr-AMC > L-Ala-AMC at pH optimum of 8.25 and in the presence of Mn2þ. The most potent SmLAP/ SjLAP inhibitor was bestatin (99.9%) >> 1,10-phenanthroline > metal chelators (ethylenediaminetetraacetic acid (EDTA)) (McCarthy et al., 2004). SmLAP/SjLAP were immunolocalized predominantly in the gastrodermis and sub-tegument of adults (McCarthy et al., 2004). Abouel-Nour et al. (2005) localized LAP activity in S. mansoni eggs. Thus, schistosome LAP may participate in haemoglobin digestion and surface membrane re-modelling (see Fig. 4.6; McCarthy et al., 2004). LAP activities were also detected in the S. mansoni cercarial and schistosomular protein extracts, and transcription analyses revealed that these peptidases are significantly expressed by all developmental stages (Auriault et al., 1982; Damonneville et al., 1982; Jolly et al., 2007; Liu et al., 2006; McCarthy et al., 2004).69 MPs were identified by MS analysis of S. mansoni and S. japonicum cercarial ESPs, and at least one of the characterized fragments was determined as clan MF family M17 peptidase, potentially LAP (Curwen et al., 2006; Dvorˇa´k et al., 2008). Sheep immunized by recombinant FhLAP alone showed significant protection (>89%) against the infection by metacercariae (Piacenza et al., 1999). Recently, FhLAP has been recognized as a potential immunodominant diagnostic marker, reacting with sera from fascioliasis patients (Marcilla et al., 2007).

4.4.4.2. Dipeptidyl peptidase III-like peptidases (clan M-, family M49) 4.4.4.2.1. Dipeptidyl peptidase III (DPP III) Although there is one annotation in the MEROPS database 8.2 for SmDPPIII 86-AA sequence fragment, expression of this enzyme by trematodes is disputable. The DPP III sequences have been found only in the S. mansoni genome database and 69 McGonigle et al. (2008) and Rinaldi et al. (2008) recently showed that RNAi operates in trematodes other than Schistosoma by decreasing the expression of CPs and LAP in F. hepatica, respectively.


273

the SmDPPIII transcription was noted by Verjovski-Almeida et al. (2003). Few nucleotide sequences of the DPP III gene of S. japonicum adults can be found in EST databases. Potential DPP III activity was measured by Hola-Jamriska et al. (1999) in adult S. mansoni and S. japonicum soluble extracts using H-Arg-ArgNHMec substrate (a substrate routinely used for monitoring CP-like activities such as CB1). Although the activity was inhibited by 1,10-phenathroline and EDTA (a metal ion chelator) the biochemical characteristics of this possible SmDPPIII/SjDPPIII need to be verified. The authors also suggested that haemoglobin digestion by this enzyme is questionable.

4.4.5. Threonine peptidases (TPs) of trematodes Most members of TPs belong to one of the mixed clans—PB (Table 4.8). They vary in their primary AA sequence, but show some significant similarities in three-dimensional structure. The nucleophile attack during catalysis by TPs can be facilitated by the reactive group of cysteine (SH), serine (OH) or threonine (OH) (Kisselev et al., 2000; Rawlings and Barrett, 2004d; see Fig. 4.1). Although the literature on trematode TPs is sparse, several pioneering works on schistosome TPs have been published. TPs of S. japonicum and S. mansoni are presented in Table 4.8, TP (based on the MEROPS database 8.2; Rawlings et al., 2008). All of them are proteasome components of the ‘20S core particle’; one S. mansoni TP of ‘a sub-unit’ and three S. japonicum TPs of the catalytically active ‘b subunit’ (see Fig. 4.8, Hu et al., 2003; Rawlings et al., 2008). Nabhan et al. (2007) identified at least 31 putative proteasome sequences of both a/b sub-units in the S. mansoni genome database and Castro-Borges et al. (2007), by employing MS methods, recorded 14 S. mansoni proteasome peptidases (seven of a and seven of b sub-unit). The proteasome is in general an intra-cellular multi-catalytic peptidase complex composed of two ‘19S’ regulatory particles and one ‘20S’ core structure particle; the second particle contains at least 15 non-identical subunits (e.g. a, b) forming a highly ordered ring-shaped structure (Fig. 4.8; e.g. Murata et al., 2009; Tanaka, 2009).70 The proteasome peptidolytic activity is adenosine triphosphate (ATP)-dependent, and for recognition of proteins assigned for degradation in proteasome the proteins are tagged by ubiquitin in reactions catalyzed by ubiquitin ligases (UniProtKB/TrEMBL database, Murata et al., 2009; Tanaka, 2009). The proteasome peptidases are generally able to cleave peptide substrates with Arg, Phe, Tyr, Leu and Glu AA residues (e.g. the activity of purified cercarial/adult Sm20S with fluorogenic 70

‘S’ of sub-units 19S, 20S, and 26S is the unit named after the Swedish chemist Theodor Svedberg (1884–1971). It is defined as the time necessary for sedimentation of particle during centrifugation, known as the Svedberg sedimentation coefficient.

TABLE 4.8

Threonine peptidases (TPs)

There are around 79 threonine peptidase sequences registered in the MEROPS database 8.2; these are divided into one clan plus one mixed and comprise five families together (Rawlings et al., 2008). There are four various trematode peptidase sequences in MEROPS database (four, around 5.1%, Rawlings et al., 2008). Accession number


Species (stage)

PROTEASOMELIKE Proteasome sub-unit a

Proteasome sub-unit 1 (Hu et al., 2003) Proteasome sub-unit 2 (Hu et al., 2003) Proteasome sub-unit 3 (Hu et al., 2003)

MEROPS

UniProtKB/ TrEMBL


MEROPS (ID)

Clan, family PB,T1


MER000504

-

-/-

T01.975

PB,T1

SjProt1


MER035524

Q86DZ2

-/24

T01.010

PB,T1

SjProt2


MER035526

Q86F39

-/24

T01.984

PB,T1

SjProt3


MER035525

Q86E06

-/24

T01.983

PB,T1

Other properties (pH optimum of activity, preferred substrates, biological function) pH optimum at neutral or slightly basic specific substrate: broad spectrum; e.g. Suc-Leu-Leu-Val-Tyr-AMC, Z-Gly-Gly-Arg-AMC, N-CbzLeu-Leu-Glu- b-NA

specific inhibitor: e.g. MG-115, MG-132, epoxomicin and lactacystin

proteasome is a multi-catalytic cytosolic peptidase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu

Unassigned peptidase or nonpeptidase homologues and othersa (Laha et al., 2006-sub)

U00/ N01

Opisthorchis viverini (A)

-

-

-

-

-

-

Notes: A, adults; ID, identification; N, number of non-peptidase homologues; U, number of unassigned peptidases;; e.g. Cocude et al., 1997-sub—‘sub’ here indicates that sequence is submitted to the database (UniProtKB/TrEMBL) without link to relevant publication; MW (kDa) practical—two numbers shown, e.g. 33,38/24p, mean MW of pro-peptidase and mature peptidase. Database links: MEROPS, http://merops. sanger.ac.uk; UniProtKB/TrEMBL, http://www.expasy.org/sprot; S. mansoni ESTs databases, www.compbio.dfci.harvard.edu (CompBio-S.mansoni) or www.schistodb.org (both Schistosoma mansoni genome databases are based on TIGR project). a These peptidases are annotated in MEROPS database as ‘unassigned peptidases’ or as ‘non-peptidase homologues’ or are not relevant due to missing of data.

276


Ubiquitinated protein

26S proteasome

20S proteasome

+ ATP

Peptides

FIGURE 4.8 Scheme of eukaryote proteasome structure (20S and 26S core particle). Notes: orange: two heptameric rings of a-sub-units; yellow: two heptameric rings of catalytically active b-sub-units (chymotryptic, tryptic and peptidyl-glutamyl-peptidase activities); blue: two 19S regulatory sub-units (substrate recognition, protein unfolding and removal of ubiquitin). The a-sub-units together with b-sub-units form the 20S and a-sub-units, b-sub-units together with 19S regulatory sub-units form the 26S core particle of proteasome. Ubiquitinated proteins are transported into proteasome and peptides are released. ATP, adenosine triphosphate. (See Page 6 in Color Section at the back of the book.)

substrates was recorded at neutral or slightly basic pH: Suc-Leu-Leu-ValTyr-AMC > Z-Gly-Gly-Arg-AMC > N-Cbz-Leu-Leu-Glu- b-NA) (Guerra-Sa´ et al., 2005; Nabhan et al., 2007). The activity of cercarial/adult Sm20S measured with Suc-Leu-Leu-Val-Tyr-AMC substrate was effectively inhibited (58–95%) by proteasome selective inhibitors—MG-115 (Z-leucyl-leucylnorvaline-H), MG-132 (Na-benzyloxycarbonyl-L-leucyl-L-leucyl-leucinal), epoxomicin and lactacystin (Guerra-Sa´ et al., 2005). Harrop et al. (1999) expressed the recombinant S. mansoni ‘S5a sub-unit’ of the proteasome 19S regulatory particle, and using the specific antibodies they immunolocalized the ‘S5a sub-unit’ in the tegument of S. mansoni cercariae. Ram et al. (2003) showed that the same ‘S5a sub-unit’ interacts with an 8-kDa S. mansoni calcium-binding protein suggesting that proteasome activity may be modulated by calcium ions. The RT-PCR analysis revealed significant proteasome sub-unit expression levels in S. mansoni cercariae, schistosomula and adult worms with probable gradient of up-regulation from early developmental stages to adults (e.g. Nabhan


277

et al., 2007). In the RNAi experiment, the S. mansoni schistosomula were treated with dsRNA, specific for cDNA encoding SmRPN11/POH1—one sub-unit of proteasome 19S regulatory particle (Nabhan et al., 2002), which led to a significant decrease in SmRPN11/POH1 expression, followed by a decrease of worms viability (Nabhan et al., 2007). This suggests that the schistosome proteasome sub-units may be promising therapeutic targets. Proteins modified by proteasome proteolysis are believed to influence important cell processes (cell cycle progression or transcription control regulated mainly via unneeded protein degradation) in eukaryotes (e.g. Murata et al., 2009; Tanaka, 2009) including trematodes (Castro-Borges et al., 2007; Guerra-Sa´ et al., 2005; Nabhan et al., 2007). Nabhan et al. (2007) recorded more than 80% sequence identity between S. mansoni and S. japonicum proteasome sub-unit orthologues. They also revealed that, in the phylogenetic tree, the schistosome TP represented by proteasome sub-units clustered together with orthologous proteins of, for example, Homo sapiens, Mus musculus, Caenorhabditis elegans, Arabidopsis thaliana and Saccharomyces cerevisiae. The characterization of proteasomes, including the trematode proteasome machinery of, for example, schistosomes, represents a challenge for future research of trematodologists.

4.4.6. Phylogeny remarks The evolutionary origin and diversity of 127 representatives of trematode peptidases covered by this review was analyzed by methods of molecular phylogenetics (Fig. 4.5). The peptidases split into 18 well-supported phylogenetic clades (connected by a dashed line). These clades are either unrelated or related very distantly, so that their relationship cannot be traced with certainty. The most diverse clade (cathepsins B, C, F, F-like— including CsCp3 peptidases) consists of 72 trematode sequences. Eight of the total 18 clades are represented by only a single trematode sequence. Every trematode peptidase shows demonstrable sequence similarity to an enzyme of other metazoans, that is, there seems not to be a unique trematode type of peptidases. However, several trematode peptidases, namely CEs, cathepsins C, L and F-like, including CsCp3 peptidases, formed distinguished sub-clades that were relatively distantly related to other peptidases; they had relatively long stem branch. The phylogenetic analyses suggest group affiliation of many previously unassigned peptidases (e.g. Paragonimus westermani unassigned CP—PwUC[AN: Q9U0D0] was on this basis classified as CF-like peptidase). Most of unassigned peptidases fell into the CsCp3 peptidase sub-clade, which was according to the phylogenetic tree re-classified more correctly as the CF-like subclade (see Fig. 4.7 and text to figure). In the case, of PwCL(AN: O46177) the analyses indicated former misclassification of this enzyme.

278


Kinase activity (3.6%) Nucleosome assembly (4.1%) Unknown function (4.1%) Lyase activity (4.1%) Hydrolase activity (5.9%)

Structural constituent of ribosome (34.1%)

Heat shock protein activity (9%)

Nucleic acid binding (9.7%)

Transferase activity (12.5%)

Oxidoreductase activity (12.7%)

FIGURE 4.9 Gene ontology analysis of the most abundant protein classes in adult worms of S. mansoni. Notes: Functional classification of S. mansoni protein groups containing more than 500 tags/functional classes. From Ojopi et al. (2007). The figure was reprinted with permission of BioMed Central publishing house and Dr. Elida P. B. Ojopi from Laboratory of Neurosciences, Institute of Psychiatry, Faculty of Medicine, University of Sao Paulo, Brazil.

On the presented phylogenetic tree we wanted to demonstrate the diversification of trematode peptidases discussed above without broader contextual comments (version of the tree with full details is available at www.schistosomes.cz/peptidase-tree.pdf).

4.5. CONCLUSION Trematodiases are a significant group of diverse parasitic diseases of global medical and veterinary importance. The need for novel anti-trematode drugs/vaccines, not least for treatment/prevention of schistosomiasis, requires participation and co-operation of specialized research teams in all over the world, and continuous support from funding agencies (both public and philanthropic) to orchestrate these endeavours. This review has attempted to present a timely discussion of the salient points regarding trematode peptidases and provide ample evidence that they are fundamental to the biology of trematodes and their interactions with the host, and are of demonstrated utility with respect to disease chemotherapy and diagnosis. The on-going genome sequencing and annotation projects (e.g. S. mansoni, S. japonicum and F. hepatica), together with completion of various ESTs databases, will be a primary source for future in silico post-genomic functional characterization of peptidase genes (e.g. Fig. 4.9). Partially annotated genome information on S. mansoni is already available for scrutiny at ‘Schistosoma mansoni GeneDB’ website (http://www.genedb.


279

org/genedb/smansoni/, co-ordinated by The Wellcome Trust Sanger Institute) and written communications on the first pass sequence assemblies of both the S. mansoni and S. japonicum genomes are expected in 2009. For the former, information on the ‘degradome’ (an organism’s entire complement of peptidases) is included, which will vastly expand the information available, and hopefully, spur increased interest in these molecules, not least their potential as drug, vaccine and diagnostic candidates.

ACKNOWLEDGEMENTS The research of Petr Hora´k, Libor Mikesˇ, Martin Kasˇny´, Vladimı´r Hampl and their students has recently been supported by the Czech Science Foundation (Grant No. 206/07/0233 and 206/09/H026) and the Czech Ministry of Education (Grant No. MSM 0021620828 and MSM LC06009). Conor R. Caffrey and Jan Dvorˇa´k are supported by the Sandler Foundation. John P. Dalton is currently supported by the National Health and Medical Research Council of Australia Project (Grant No. 352912) and he is a recipient of a NSW Government BioFirst Award 2004. We would like to thank Dr. Elida P. B. Ojopi and Dr. Emmanuel Dias-Neto (Laboratory of Neuroscience, Institute of Psychiatry, Faculty of Medicine, University of Sao Paulo, Brazil) for permission to reprint Fig. 4.9 from Ojopi et al. (2007).

REFERENCES Abdulla, M.H., Lim, K. Ch., Sajid, M., McKerrow, J.H., Caffrey, C.R., 2007. Schistosomiasis mansoni: Novel chemotherapy using a cysteine protease inhibitor. PLoS Med. 4, 130–138. Abe, Y., Shirane, K., Yokosawa, H., Matsushita, H., Mitta, M., Kato, I., et al., 1993. Asparaginyl endopeptidase of jack bean seeds. Purification, characterization, and high utility in protein sequence analysis. J. Biol. Chem. 268, 3525–3529. Abouel-Nour, M.F., Lotfy, M., El-Kady, I., El-Shahat, M., Doughty, B.L., 2005. Localization of leucine aminopeptidase in the Schistosoma mansoni eggs and in liver tissue from infected mice. J. Egypt. Soc. Parasitol. 35, 147–156. Adisakwattana, P., Viyanant, V., Chaicumpa, W., Vichasri-Grams, S., Hofmann, A., Korge, G., et al., 2007. Comparative molecular analysis of two asparaginyl endopeptidases and encoding genes from Fasciola gigantica. Mol. Biochem. Parasitol. 156, 102–116. Alvarez-Fernandez, M., Barrett, A.J., Gerhartz, B., Dando, P.M., Ni, J., Abrahamson, M., 1999. Inhibition of mammalian legumain by some cystatins is due to a novel second reactive site. J. Biol. Chem. 274, 19195–19203. Andresen, K., Tom, D.T., Strands, M., 1990. Characterization of cDNA clones encoding a novel calcium-activated neutral proteinase from Schistosoma mansoni. J. Biol. Chem. 266, 15085–15090. Aravind, L., Koonin, E.V., 2002. Classification of the caspase-hemoglobinase fold: Detection of new families and implications for the origin of the eukaryotic separins. Proteins 46, 355–367. Asch, H.L., Dresden, M.H., 1977. Schistosoma mansoni: Inhibition of cercarial ‘penetration’ proteases by components of mammalian blood. Comp. Biochem. Physiol. 58, 89–95. Ashford, R. W., Crewe, W., 1998. The parasites of Homo sapiens: An Annotated Checklist of the Protozoa, Helminths and Arthropods for which we are Home. CRC Press, London.

280


Aslam, A., Quinn, P., McIntosh, R.S., Shi, J., Ghumra, A., McKerrow, J.H., et al., 2008. Proteases from Schistosoma mansoni cercariae cleave IgE at solvent exposed interdomain regions. Mol. Immunol. 45, 567–574. Auld, D.S., 2004. Catalytic mechanisms of metallopeptidases. In: Barrett, Rawlings, Woessner, (Eds.), Handbook of Proteolytic Enzymes, 2nd edn. Elsevier, Amsterdam, The Netherlands, pp. 268–289. Auriault, C., Pierce, R., Cesari, I.M., Capron, A., 1982. Neutral protease activities at different developmental stages of Schistosoma mansoni in mammalian hosts. Comp. Biochem. Physiol. 72, 377–384. Awasthi, S., Bundy, D.A.P., Savioli, L., 2003. Helminthic infections. Br. Med. J. Clin. Rev. 327, 431–433. Bahgat, M., Ruppel, A., 2002. Biochemical comparison of the serine protease (elastase) activities in cercarial secretions from Trichobilharzia ocellata and Schistosoma mansoni. Parasitol. Res. 88, 495–500. Bahgat, M., Chlichlia, K., Schirrmacher, V., Ruppel, A., 2002. Antibodies induced in mice by a DNA-construct coding for the elastase of Schistosoma mansoni recognize the enzyme in secretions and preacetabular glands of cercariae. Parasitology 124, 301–306. Bahgat, M., Francklow, K., Doenhoff, M.J., Li, Y.L., Ramzy, R.M., Kirsten, C., et al., 2001. Infection induces antibodies against the cercarial secretions, but not against the cercarial elastases of Schistosoma mansoni, Schistosoma haematobium, Schistosoma japonicum and Trichobilharzia ocellata. Parasite Immunol. 23, 557–565. Barrett, A.J., Rawlings, N.D., Woessner, J.F., 2004. ‘‘Handbook of Proteolytic Enzymes’’. 2nd edn. Elsevier, Amsterdam, The Netherlands. Basch, P.F., 1991. ‘‘Schistosomes: Development, Reproduction and Host Relations’’. Oxford University Press, Oxford, United Kingdom. Becker, M.M., Harrop, S.A., Dalton, J.P., Kalinna, B.H., McManus, D.P., Brindley, P.J., 1995. Cloning and characterization of the Schistosoma japonicum aspartic proteinase involved in hemoglobin degradation. J. Biol. Chem 270, 24496–24501. Erratum in J. Biol. Chem. 272, 17246. Beckham, S., Law, R.H.P., Smooker, P.M., Quinsey, N.S., Caffrey, C.R., McKerrow, J.H., et al., 2006. Production and processing of a recombinant Fasciola hepatica cathepsin B-like enzyme (FhcatB1) reveals potential processing mechanisms in the parasite. Biol. Chem. 387, 1053–1061. Benson, D.A., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., Wheeler, D.L., 2008. GenBank. Nucleic Acids Res. 36, 25–30. Bentley, G.N., Jones, A.K., Agnew, A., 2003. Mapping and sequencing of acetylcholinesterase genes from the platyhelminth blood fluke Schistosoma. Gene 314, 103–112. Berasaıń, P., Gon˜i, F., McGonigle, S., Dowd, A., Dalton, J.P., Frangione, B., et al., 1997. Proteinases secreted by Fasciola hepatica degrade extracellular matrix and basement membrane components. J. Parasitol. 83, 1–5. Bogitsh, B.J., Dresden, M.H., 1983. Fluorescent histochemistry of acid proteases in adult Schistosoma mansoni and Schistosoma japonicum. J. Parasitol. 69, 106–110. Bogitsh, B.J., Kirschner, K.F., 1987. Schistosoma japonicum: Immunocytochemistry of adults using heterologous antiserum to bovine cathepsin D. Exp. Parasitol. 64, 213–218. Bogitsh, B.J., Dalton, J.P., Brady, C.P., Brindley, P.J., 2001. Gut-associated immunolocalization of the Schistosoma mansoni cysteine proteases, SmCL1 and SmCL2. J. Parasitol. 87, 237–241. Bogyo, M., Verhelst, S., Bellingard-Dubouchaud, V., Toba, S., Greenbaum, D., 2000. Selective targeting of lysosomal cysteine proteases with radiolabeled electrophilic substrate analogs. Chem. Biol. 7, 27–38.


281

Brady, C.P., Brindley, P.J., Dowd, A.J., Dalton, J.P., 2000a. Schistosoma mansoni: Differential expression of cathepsins L1 and L2 suggests discrete biological functions for each enzyme. Exp. Parasitol. 94, 75–83. Brady, C.P., Brinkworth, R.I., Dalton, J.P., Dowd, A.J., Verity, C.K., Brindley, P.J., 2000b. Molecular modeling and substrate specificity of discrete cruzipain-like and cathepsin L-like cysteine proteinases of the human blood fluke Schistosoma mansoni. Arch. Biochem. Biophys. 380, 46–55. Brady, C.P., Dowd, A.J., Brindley, P.J., Ryan, T., Day, S.R., Dalton, J.P., 1999. Recombinant expression and localization of Schistosoma mansoni cathepsin L1 support its role in the degradation of host hemoglobin. Infect. Immun. 67, 368–374. Brant, S.V., Morgan, J.A., Mkoji, G.M., Snyder, S.D., Rajapakse, R.P., Loker, E.S., 2006. An approach to revealing blood fluke life cycles, taxonomy, and diversity: Provision of key reference data including DNA sequence from single life cycle stages. J. Parasitol. 92, 77–88. Brindley, P.J., Pearce, E.J., 2007. Genetic manipulation of schistosomes. Int. J. Parasitol. 37, 465–473. Brindley, P.J., Kalinna, B.H., Dalton, J.P., Day, S.R., Wong, J.Y.M., Smythe, M.L., et al., 1997. Proteolytic degradation of host hemoglobin by schistosomes. Mol. Biochem. Parasitol. 89, 1–9. Brindley, P.J., Kalinna, B.H., Wong, J.Y., Bogitsh, B.J., King, L.T., Smyth, D.J., et al., 2001. Proteolysis of human hemoglobin by schistosome cathepsin D. Mol. Biochem. Parasitol. 112, 103–112. Brinkworth, R.I., Prociv, P., Loukas, A., Brindley, P.J., 2001. Hemoglobin-degrading, aspartic proteases of blood-feeding parasites: Substrate specificity revealed by homology models. J. Biol. Chem. 276, 38844–38851. Bro¨mme, D. (2004). Cathepsin F. In Barrett, Rawlings, and Woessner, (Eds.), Handbook of Proteolytic Enzymes, 2nd edn. Elsevier, Amsterdam, The Netherlands. pp. 1087–1088. Burley, S.K., David, P.R., Taylor, A., Lipscomb, W.N., 1990. Molecular structure of leucine aminopeptidase at 2.7-A resolution. Proc. Natl. Acad. Sci. USA 87, 6878–6882. Butler, R., Michel, A., Kunz, W., Klinkert, M.Q., 1995. Sequence of Schistosoma mansoni cathepsin C and its structural comparison with papain and cathepsins B and L of the parasite. Protein Pept. Lett. 2, 313–320. Caffrey, C.R., 2007. Chemotherapy of schistosomiasis: Present and future. Curr. Opin. Chem. Biol. 11, 433–439. Caffrey, C.R., Ruppel, A., 1997a. Affinity isolation and characterization of the cathepsin B-like proteinase Sj31 from Schistosoma japonicum. J. Parasitol. 82, 1112–1118. Caffrey, C.R., Ruppel, A., 1997b. Cathepsin B-like activity predominates over cathepsin L-like activity in adult Schistosoma mansoni and S. japonicum. Parasitol. Res. 83, 632–635. Caffrey, C.R., Engel, A., Gsell, C., Goehring, K., Ruppel, A., 1998. Schistosoma japonicum and S. mansoni: Effect of cyclosporin A on aspartic and cysteine hemoglobinolytic activities. Parasitol. Int. 47, 11–19. Caffrey, C.R., Mathieu, M.A., Gaffney, A.M., Salter, J.P., Sajid, M., Lucas, K.D., et al., 2000. Identification of a cDNA encoding an active asparaginyl endopeptidase of Schistosoma mansoni and its expression in Pichia pastoris. FEBS Lett. 466, 244–248. Caffrey, C.R., McKerrow, J.H., Salter, J.P., Sajid, M., 2004. Blood ‘n’ guts: An update on schistosome digestive peptidases. Trends Parasitol. 20, 241–248. Caffrey, C.R., Placha, L., Barinka, C., Hradilek, M., Dosta´l, J., Sajid, M., et al., 2005. Homology modeling and SAR analysis of Schistosoma japonicum cathepsin D (SjCD) with statin inhibitors identify a unique active site steric barrier with potential for the design of specific inhibitors. Biol. Chem. 386, 339–349.

282


Caffrey, C.R., Rheinberg, C.E., Mone´, H., Jourdane, J., Li, Y.L., Ruppel, A., 1997. Schistosoma japonicum, S. mansoni, S. haematobium, S. intercalatum, and S. rodhaini: Cysteine-class cathepsin activities in the vomitus of adult worms. Parasitol. Res. 83, 37–41. Caffrey, C.R., Salter, J.P., Lucas, K.D., Khiem, D., Hsieh, I., Lim, K.C., et al., 2002. SmCB2, a novel tegumental cathepsin B from adult Schistosoma mansoni. Mol. Biochem. Parasitol. 121, 49–61. Carvalho, W.S., Lopes, C.T., Juliano, L., Coelho, P.M.Z., Cunha-Melo, J.R., Beraldo, W.T., et al., 1998. Purification and partial characterization of kininogenase activity from Schistosoma mansoni adult worms. Parasitology 117, 311–319. Casida, J.E., Quistad, G.B., 2005. Serine hydrolase targets of organophosphorus toxicants. Chem. Biol. Interact. 157–158, 277–283. Castro-Borges, W., Cartwright, J., Ashton, P.D., Braschi, S., Guerra-Sa´, R., Rodrigues, V., et al., 2007. The 20S proteasome of Schistosoma mansoni: A proteomic analysis. Proteomics 7, 1065–1075. Cesari, I.M., Ballen, D.E., Perrone, T., Oriol, O., Hoebeke, J., Bout, D., 2000. Enzyme activities in Schistosoma mansoni soluble egg antigen. J. Parasitol. 86, 1137–1140. Cesari, I.M., Valdivieso, E., Schre´vel, J., 1998. Biochemical characterization of cathepsin D from adult Schistosoma mansoni worms. Mem. Inst. Oswaldo Cruz 93, 165–168. Chanova´, M., Hora´k, P., 2007. Terminal phase of bird schistosomiasis caused by Trichobilharzia regenti (Schistosomatidae) in ducks (Anas platyrhynchos f. domestica). Folia Parasitol. 54, 105–107. Chappell, C.L., Dresden, M.H., 1986. Schistosoma mansoni: Proteinase activity of ‘hemoglobinase’ from the digestive tract of adult worms. Exp. Parasitol. 61, 160–167. Chappell, C.L., Dresden, M.H., 1988. Antibody response to a purified parasite proteinase (SMw32) in Schistosoma mansoni infected mice. Am. J. Trop. Med. Hyg. 39, 66–73. Chappell, C.L., Dresden, M.H., Gryseels, B., Deelder, A.M., 1990. Antibody response to Schistosoma mansoni adult worm cysteine proteinases in infected individuals. Am. J. Trop. Med. Hyg. 42, 335–341. Chen, J.M., Dando, P.M., Rawlings, N.D., Brown, M.A., Young, N.E., Stevens, R.A., et al., 1997. Cloning, isolation, and characterization of mammalian legumain, an asparaginyl endopeptidase. J. Biol. Chem. 272, 8090–8098. Chen, J.M., Dando, P.M., Stevens, R.A., Fortunato, M., Barrett, A.J., 1998b. Cloning and expression of mouse legumain, a lysosomal endopeptidase. Biochem. J. 335, 111–117. Chen, J.M., Rawlings, N.D., Stevens, R.A., Barrett, A.J., 1998a. Identification of the active site of legumain links it to caspases, clostripain and gingipains in a new clan of cysteine endopeptidases. FEBS Lett. 441, 361–365. Chen, Y.X., Wang, L.X., Tang, L.F., Zhang, S.K., Zhang, J., Zeng, X.F., et al., 2005. Boost effect of recombinant IL-4 on protection of Schistosoma japonicum cathepsin B DNA vaccine in mice against the parasite. Chinese J. Parasitol. Parasitic Dis. 23, 65–68. Chlichlia, K., Bahgat, M., Ruppel, A., Schirrmacher, V., 2001. DNA vaccination with asparaginyl endopeptidase (Sm32) from the parasite Schistosoma mansoni: Anti-fecundity effect induced in mice. Vaccine 20, 439–447. Chlichlia, K., Schauwienold, B., Kirsten, C., Doenhoff, M.J., Fishelson, Z., Ruppel, A., 2005. Schistosoma japonicum reveals distinct reactivity with antisera directed to proteases mediating host infection and invasion by cercariae of S. mansoni or S. haematobium. Parasite Immunol. 27, 97–102. Cho, P.Y., Kim, T.I., Li, S., Hong, S.J., Choi, M.H., Hong, S.T., et al., 2007. Metacercarial proteins interacting with WD40-repeat protein of Clonorchis sinensis. Korean J. Parasitol. 45, 229–232. Choe, Y., Leonetti, F., Greenbaum, D.C., Lecaille, F., Bogyo, M., Bro¨me, D., et al., 2006. Substrate profiling of cysteine proteases using a combinatorial peptide library identifies functionally unique specificities. J. Biol. Chem. 281, 12824–12832.


283

Choi, J.H., Lee, J.H., Yu, H.S., Jeong, H.J., Kim, J., Hong, Y.Ch., et al., 2006. Molecular and biochemical characterization of hemoglobinase, a cysteine proteinase, in Paragonimus westermani. Korean J. Parasitol. 44, 187–196. Cleland, W.W., 1964. Dithiothreitol, a new protective reagent for SH groups. Biochemistry 3, 480–482. Cocude, C., Pierrot, C., Cetre, C., Fontaine, C., Godin, A., Capron, A., et al., 1999. Identification of a developmentally regulated Schistosoma mansoni serine protease homologous to mouse plasma kallikrein and human factor I. Parasitology 118, 389–396. Cocude, C., Pierrot, C., Cetre, C., Godin, C., Capron, A., Khalife, J., 1997. Molecular characterization of a partial sequence encoding a novel Schistosoma mansoni serine protease. Parasitology 115, 395–402. Collins, P.R., Stack, C.M., O’Neill, S.M., Doyle, S., Ryan, T., Brennan, G.P., et al., 2004. Cathepsin L1, the major protease involved in liver fluke (Fasciola hepatica) virulence: Propeptide cleavage sites and autoactivation of the zymogen secreted from gastrodermal cells. J. Biol. Chem. 297, 17038–17046. Conner, G.E., 2004. Cathepsin D. In: Barrett, Rawlings, Woessner, (Eds.), Handbook of Proteolytic Enzymes, 2nd edn. Elsevier, Amsterdam, The Netherlands, pp. 43–52. Copeland, C.S., Brindley, J.P., Heyers, O., Michael, S.F., Johnston, D.A., Williams, D.L., et al., 2003. Boudicca, a retrovirus-like long terminal repeat retrotransposon from the genome of the human blood fluke Schistosoma mansoni. J. Virol. 77, 6153–6166. Cornelissen, J.B., Gaasenbeek, C.P., Borgsteede, F.H., Holland, W.G., Harmsen, M.M., Boersma, W.J., 2001. Early immunodiagnosis of fasciolosis in ruminants using recombinant Fasciola hepatica cathepsin L-like protease. Int. J. Parasitol. 31, 728–737. Correnti, J.M., Brindley, P.J., Pearce, E.J., 2005. Long-term suppression of cathepsin B levels by RNA interference retards schistosome growth. Mol. Biochem. Parasitol. 143, 209–215. Cort, W.W., 1944. The germ cell cycle in the digenetic trematodes. Q. Rev. Biol. 19, 275–284. Cribb, T.H., Bray, R.A., Littlewood, D.T.J., Pichelin, S.P., Herniou, E.A., 2001. The Digenea. In: Littlewood Bray, (Eds.), Interrelationships of the Platyhelminthes, Taylor and Francis, London, United Kingdom, pp. 168–185. Curwen, R.S., Wilson, R.A., 2003. Invasion of skin by schistosome cercariae: Some neglected facts. Trends Parasitol. 19, 63–66. Curwen, R.S., Ashton, P.D., Sundaralingam, S., Wilson, R.A., 2006. Identification of novel proteases and immunomodulators in the secretions of schistosome cercariae that facilitate host entry. Mol. Cell. Proteomics 5, 835–844. Cygler, M., Mort, J.S., 1997. Proregion structure of members of the papain superfamily. Mode of inhibition of enzymatic activity. Biochimie 79, 645–652. Dalton, J.P., Brindley, P.J., 1997. Proteases of trematodes. In: Fried Graczyk, (Eds.), Advances in Trematode Biology, CRC Press, New York, pp. 265–307. Dalton, J.P., Heffernan, M., 1989. Thiol protease released in vitro by Fasciola hepatica. Mol. Biochem. Parasitol. 35, 161–166. Dalton, J.P., Brindley, P.J., Donnelly, S., Robinson, M.W., 2009. The enigmatic asparaginyl endopeptidase of helminth parasites. Trends Parasitol. 25, 59–61. Dalton, J.P., Brindley, P.J., Knox, D.P., Brady, C.P., Hotez, P.J., Donnelly, S., et al., 2003b. Helminth vaccines: From mining genomic information for vaccine targets to systems used for protein expression. Int. J. Parasitol. 33, 632–640. Dalton, J.P., Clough, K.A., Jones, M.K., Brindley, P.J., 1996. Characterization of the cathepsinlike cysteine proteinases of Schistosoma mansoni. Infect. Immun. 64, 1328–1334. Dalton, J.P., Clough, K.A., Jones, M.K., Brindley, P.J., 1997. The cysteine proteinases of Schistosoma mansoni cercariae. Parasitology 114, 105–112. Dalton, J.P., McKerrow, J.H., Brindley, P.J., 2004. Trematode cysteine endopeptidases. In: Barrett, Rawlings, Woessner, (Eds.), Handbook of Proteolytic Enzymes, 2nd edn. Elsevier, Amsterdam, The Netherlands, pp. 1176–1182.

284


Dalton, J.P., Neill, S.O., Stack, C., Collins, P., Walshe, A., Sekiya, M., et al., 2003a. Fasciola hepatica cathepsin L-like proteases: Biology, function, and potential in the development of first generation liver fluke vaccines. Int. J. Parasitol. 33, 1173–1181. Dalton, J.P., Smith, A.M., Clough, K.A., Brindley, P.J., 1995. Digestion of haemoglobin by schistosomes: 35 years on. Parasitol. Today 11, 299–303. Damonneville, M., Auriault, C., Pierce, R.J., Capron, A., 1982. Antigenic properties of Schistosoma mansoni aminopeptidases: Evolution during the development in mammalian hosts. Mol. Biochem. Parasitol. 6, 265–275. Dando, P.M., Fortunato, M., Smith, L., Knight, C.G., McKendrick, J.E., Barrett, A.J., 1999. Pig kidney legumain: An asparaginyl endopeptidase with restricted specificity. Biochem. J. 339, 743–749. Darani, Y.H., Curtis, R.H.C., McNeice, C., Price, H.P., Sayers, J.R., Doenhoff, M.J., 1997. Schistosoma mansoni: Anomalous immunogenic properties of a 27 kDa larval serine protease associated with protective immunity. Parasitology 115, 237–247. Davis, A.H., Nanduri, J., Watson, D.C., 1987. Cloning and gene expression of Schistosoma mansoni protease. Biochem. Mol. Biol. 262, 12851–12855. Day, S.R., Dalton, J.P., Clough, K.A., Leonardo, L., Tiu, W.U., Brindley, P.J., 1995. Characterization and cloning of the cathepsin L proteinases of Schistosoma japonicum. Biochem. Biophys. Res. Comm. 217, 1–9. Delcroix, M., Medzihradsky, K., Caffrey, C.R., Fetter, R.D., McKerrow, J.H., 2007. Proteomic analysis of adult S. mansoni gut contents. Mol. Biochem. Parasitol. 154, 95–97. Delcroix, M., Sajid, M., Caffrey, C.R., Lim, K.C., Dvorˇa´k, J., Hsieh, I., et al., 2006. A multienzyme network functions in intestinal protein digestion by a platyhelminth parasite. J. Biol. Chem. 282, 39316–39329. Dillon, G.P., Feltwell, T., Skelton, J.P., Ashton, P.D., Coulson, P.S., Quail, M.A., et al., 2006. Microarray analysis identifies genes preferentially expressed in the lung schistosomulum of Schistosoma mansoni. Int. J. Parasitol. 36, 1–8. Do, C.B., Mahabhashyam, M.S., Brudno, M., Batzoglou, S., 2005. ProbCons: Probabilistic consistency-based multiple sequence alignment. Genome Res. 15, 330–340. Dolecˇkova´, K., Kasˇny´, M., Mikesˇ, L., Cartwright, J., Jedelsky´, P., Schneider, E.L., et al., 2009. The functional expression and characterisation of a cysteine peptidase from the invasive stage of the neuropathogenic schistosome Trichobilharzia regenti. Int. J. Parasitol. 39, 201–211. Dolecˇkova´, K., Kasˇny´, M., Mikesˇ, L., Mutapi, F., Stack, C., Hora´k, P., 2007. Peptidases of Trichobilharzia regenti (Schistosomatidae) and its molluscan host Radix peregra s. lat. (Lymnaeidae): Construction and screening of cDNA library from intramolluscan stages of the parasite. Folia Parasitol. 54, 94–98. Donnelly, S., Dalton, J.P., Loukas, A., 2006. Proteases in helminth- and allergen-induced inflammatory responses. Parasites Allergy 90, 45–64. Dresden, M.H., Deelder, A.M., 1979. Schistosoma mansoni: Thiol proteinase properties of adult worm ‘hemoglobinase’. Exp. Parasitol. 48, 190–197. Dunn, B.M., 2002. Structure and mechanism of the pepsin-like family of aspartic peptidases. Chem. Rev. 102, 4431–4458. Dvorˇa´k, J., Delcroix, M., Rossi, A., Vopa´lensky´, V., Pospı´sˇek, M., Sˇedinova´, M., et al., 2005. Multiple cathepsin B isoforms in schistosomula of Trichobilharzia regenti: Identification, characterization and putative role in migration and nutrition. Int. J. Parasitol. 35, 895–910. Dvorˇa´k, J., Mashiyama, S.T., Braschi, S., Sajid, M., Knudsen, G.M., Hansell, E., et al., 2008. Differential use of protease families for invasion by schistosome cercariae. Biochimie 90, 345–348. Ekici, O.D., Go¨tz, M.G., James, K.E., Li, Z.Z., Rukamp, B.J., Asgian, J.L., et al., 2004. J. Med. Chem. 47, 1889–1892. El-Meanawy, M.A., Aji, T., Phillips, N.F., Davis, R.E., Salata, R.A., Malhotra, I., et al., 1990. Definition of the complete Schistosoma mansoni hemoglobinase mRNA sequence and gene expression in developing parasites. Am. J. Trop. Med. Hyg. 43, 67–78.


285

El-Sayed, L.H., Ghoneim, H., Demian, S.R., El-Sayed, M.H., Tawfik, N.M., Sakr, I., et al., 1998. Diagnostic significance of Schistosoma mansoni proteins Sm31 and Sm32 in human schistosomiasis in an endemic area in Egypt. Trop. Med. Int. Health 9, 721–727. Emori, Y., Kawasaki, H., Imajoh, S., Imahori, K., Suzuki, K., 1987. Endogenous inhibitor for calcium-dependent cysteine protease contains four internal repeats that could be responsible for its multiple reactive sites. Proc. Natl. Acad. Sci. USA 84, 3590–3594. Fengler, A., Brandt, W., 2000. Development and validation of homology models of human cathepsins K, S, H, and F. Adv. Exp. Med. Biol. 477, 255–260. Fishelson, Z., Amiri, P., Friend, D.S., Marikovsky, M., Petitt, M., Newport, G., et al., 1992. Schistosoma mansoni: Cell-specific expression and secretion of a serine protease during development of cercariae. Exp. Parasitol. 75, 87–98. Foster, L., Hall, D.K., 1978. Location of gelatinase in furcocercous, monostome, cotylomicrocercous, and pleuolophocercous trematode cercariae. J. Parasitol. 64, 376–377. Geldhof, P., Visser, A., Clark, D., Saunders, G., Britton, C., Gilleard, J., et al., 2007. RNA interference in parasitic helminths: Current situation, potential pitfalls and future prospects. Parasitology 134, 609–619. Ghendler, Y., Parizade, M., Arnon, R., McKerrow, J.H., Fishelson, Z., 1996. Schistosoma mansoni: Evidence for a 28-kDa membrane-anchored protease on schistosomula. Exp. Parasitol. 83, 73–82. Goldlust, A., Arnon, R., Silman, I., Tarrab, H.R., 1986. Acetylcholinesterase of Schistosoma mansoni: Purification and characterization. J. Neurosci. Res. 15, 569–581. Go¨nnert, R., Andrews, P., 1977. Praziquantel, a new board-spectrum antischistosomal agent. Z. Parasitenkd. 52, 129–150. Go¨tz, B., Klinkert, M.Q., 1993. Expression and partial characterization of a cathepsin B-like enzyme (Sm31) and a proposed ‘haemoglobinase’ (Sm32) from Schistosoma mansoni. Biochem. J. 290, 801–806. Go¨tz, M.G., James, K.E., Hansell, E., Dvorˇa´k, J., Seshaadri, A., Sojka, D., et al., 2008. Azapeptidyl Michael acceptors. A new class of potent and selective inhibitors of asparaginyl endopeptidases (legumains) from evolutionarily diverse pathogens. J. Med. Chem. 51, 2816–2832. Grams, R., Vichasri, G.S., Sobhon, P., Upatham, E.S., Viyanant, V., 2001. Molecular cloning and characterization of cathepsin L encoding genes from Fasciola gigantica. Parasitol. Int. 50, 105–114. Greenbaum, D., Baruch, A., Hayrapetian, L., Darula, Z., Burlingame, A., Medzihradszky, K.F., et al., 2002. Chemical approaches for functionally probing the proteome. Mol. Chem. Proteomic 1, 60–68. Greenbaum, D., Medzihradszky, K.F., Burlingame, A., Bogyo, M., 2000. Epoxide electrophiles as activity-dependent cysteine protease profiling and discovery tools. Chem. Biol. 7, 569–581. Grogan, J., Rotmans, P., Ghoneim, H., Deelder, A., Yazdanbakhsh, M., Klinkert, M.Q., 1997. Recognition of Schistosoma mansoni cathepsins B and L by human IgG1 and IgG4 antibodies. Parasite Immunol. 19, 215–220. Guerra-Sa´, R., Castro, B.W., Evangelista, E.A., Kettelhut, I.C., Rodrigues, V., 2005. Schistosoma mansoni: Functional proteasomes are required for development in the vertebrate host. Exp. Parasitol. 109, 228–236. Guroff, G., 1964. A neutral, calcium-activated proteinase from the soluble fraction of rat brain. J. Biol. Chem. 239, 149–155. Hamajima, F., Yamamoto, M., Yamakami, K., Fujino, T., Hamajima, H., Katsura, Y., 1994. Immunosuppression by a neutral thiol protease from parasitic helminth larvae in mice. Parasite Immunol. 16, 261–273. Hansell, E., Braschi, S., Medzihradszky, K.F., Sajid, M., Debnath, M., Ingram, J., et al., 2008. Proteomic analysis of skin invasion by blood fluke larvae. PLoS Negl. Trop. Dis. 16, 1–11.

286


Hara-Nishimura, I., Takeuchi, Y., Nishimura, M., 1993. Molecular characterization of a vacuolar processing enzyme related to a putative cysteine proteinase of Schistosoma mansoni. Plant Cell 5, 1651–1659. Harmsen, M.M., Cornelissen, J.B., Buijs, H.E., Boersma, W.J., Jeurissen, S.H., Milligen, F.J., 2004. Identification of a novel Fasciola hepatica cathepsin L protease containing protective epitopes within the propeptide. Int. J. Parasitol. 34, 675–682. Harrop, R., Coulson, P.S., Wilson, R.A., 1999. Characterization, cloning and immunogenicity of antigens released by lung-stage larvae of Schistosoma mansoni. Parasitology 118, 583–594. He, Y.X., Salafsky, B., Ramaswamy, K., 2005. Comparison of skin invasion among three major species of Schistosoma. Trends Parasitol. 21, 201–203. Hedstrom, L., 2002. Serine protease mechanism and specificity. Chem. Rev. 102, 4501–4523. Heffernan, M., Smith, A., Curtain, D., McDonnell, S., Ryan, J., Dalton, J.P., 1991. Characterisation of a cathepsin-B proteinase released by Fasciola hepatica (liver fluke). Biochem. Soc. Trans. 19, 1–27. Heussler, V.T., Dobbelaere, D.A., 1994. Cloning of a protease gene family of Fasciola hepatica by the polymerase chain reaction. Mol. Biochem. Parasitol. 64, 11–23. Hola-Jamriska, L., Dalton, J.P., Aaskov, J., Brindley, P.J., 1999. Dipeptidyl peptidase I and III activities of adult schistosomes. Parasitol. 118, 275–282. Hola-Jamriska, L., King, L.T., Dalton, J.P., Mann, V.H., Aaskov, J.G., Brindley, P.J., 2000. Functional expression of dipeptidyl peptidase I (Cathepsin C) of the oriental blood fluke Schistosoma japonicum in Trichoplusia in insect cells. Protein Expr. Purif. 19, 384–392. Hola-Jamriska, L., Tort, J.F., Dalton, J.P., Day, S.R., Fan, J, Aaskov, J., et al., 1998. Cathepsin C from Schistosoma japonicum-cDNA encoding the preproenzyme and its phylogenetic relationships. Eur. J. Parasitol. 255, 527–534. Hora´k, P., Kola´rˇova´, L., 2005. Molluscan and vertebrate immune responses to bird schistosomes. Parasite Immunol. 27, 247–255. Hora´k, P., Kola´rˇova´, L., Adema, C.M., 2002. Biology of the schistosome genus Trichobilharzia. Adv. Parasitol. 52, 155–233. Hora´k, P., Kola´rˇova´, L., Dvorˇa´k, J., 1998. Trichobilharzia regenti n. sp. (Schistosomatidae, Bilharziellinae), a new nasal schistosome from Europe. Parasite 5, 349–357. Hora´k, P., Mikesˇ, L., Rudolfova´, J., Kola´rova´, L., 2008. Penetration of Trichobilharzia cercariae into mammals: Dangerous or negligible event? Parasite 15, 299–303. Horn, M., Baudysˇ, M., Voburka, Z., Kluh, I., Vondra´sˇek, J., Maresˇ, M., 2002. Free-thiol Cys331 exposed during activation process is critical for native tetramer structure of cathepsin C (dipeptidyl peptidase I). Protein Sci. 11, 933–943. Hosfield, C.M., Elce, J.S., Davies, P.L., Jia, Z., 1999. Crystal structure of calpain reveals the structural basis for Ca(2þ)-dependent protease activity and a novel mode of enzyme activation. EMBO J. 18, 6880–6889. Hota-Mitchell, S., Clarke, M.W., Podesta, R.B., Dekaban, G.A., 1999. Recombinant vaccinia viruses and gene gun vectors expressing the large subunit of Schistosoma mansoni calpain used in a murine immunization-challenge model. Vaccine 17, 1338–1354. Hotez, P.J., Molyneux, D.H., Fenwick, A., Ottesen, E., Sachs, S.E., Sachs, J.D., 2006. Incorporating a rapid-impact package for neglected tropical diseases with programs for HIV/ AIDS, tuberculosis, and malaria. PLoS Med. 3, 576–584. Howell, R.M., 1966. Collagenase activity of immature Fasciola hepatica. Nature 209, 713–714. Hu, W., Yan, Q., Shen, D.K., Liu, F., Zhu, Z.D., Song, H.D., Xu, X.R., et al., 2003. Evolutionary and biomedical implications of a Schistosoma japonicum complementary DNA resource. Nat. Genet. 35, 139–147. Idris, M.A., Ruppel, A., 1988. Diagnostic Mr31/32,000 Schistosoma mansoni proteins (Sm31/ 32): Reaction with sera from Sudanese patients infected with S. mansoni or S. haematobium. J. Helminthol. 62, 95–101.


287

Illy, Ch., Quraishi, O., Wang, J., Purisima, E., Vernet, T., Mort, J.S, 1997. Role of the occluding loop in cathepsin B activity. J. Biol. Chem. 10, 1197–1202. Iwata, M., Munoz, J.J., Ishizaka, K., 1983. Modulation of the biologic activities of IgE-binding factor IV. Identification of glycosylation-enhancing factor as a kallikrein-like enzyme. J. Immunol. 131, 1954–1960. James, K.E., Go¨tz, M.G., Caffrey, C.R., Hansell, E., Carter, W., Barrett, A.J., McKerrow, J.H., Powers, J.C., 2003. Aza-peptide epoxides: potent and selective inhibitors of Schistosoma mansoni and pig kidney legumains (asparaginyl endopeptidases). Biol. Chem. 384, 1613–1618. James, M.N.G., 2004. Catalytic pathway of aspartic peptidases. In: Barrett, Rawlings, Woessner, (Eds.) Handbook of Proteolytic Enzymes, 2nd edn. Elsevier, Amsterdam, The Netherlands, pp. 12–19. Jolly, E.R., Chin, Ch. S., Miller, S., Bahgat, M., Lim, K.C., DeRisi, J., et al., 2007. Gene expression patterns during adaptation of a helminth parasite to different environmental niches. Genome Biol. 8, R65. Jones, A.K., Bentley, G.N., Oliveros-Parra, W.G., Agnew, A., 2002. Molecular characterization of an acetylcholinesterase implicated in the regulation of glucose scavenging by the parasite Schistosoma. FASEB J. 16, 441–443. Kang, T.H., Yun, D.H., Lee, E.H., Chung, Y.B., Bae, Y.A., Chung, J.Y., Kang, I., et al., 2004. A cathepsin F of adult Clonorchis sinensis and its phylogenetic conservation in trematodes. Parasitology 128, 195–207. Karcz, S.R., Podesta, R.B., Siddiqui, A.A., Dekaban, G.A., Strejan, G.H., Clarke, M.W., 1991. Molecular cloning and sequence analysis of a calcium-activated neutral protease (calpain) from Schistosoma mansoni. Mol. Biochem. Parasitol. 49, 333–336. Karrer, K.M., Peiffer, S.L., DiTomas, M.E., 1993. Two distinct gene subfamilies within the family of cysteine protease genes. Proc. Natl. Acad. Sci. USA 90, 3063–3067. Kato, D., Boatright, K.M., Berger, A.B., Nazif, T., Blum, G., Ryan, C., Chehade, K.A., et al., 2005. Activity-based probes that target diverse cysteine protease families. Nat. Chem. Biol. 1, 33–38. Kasˇny´, M., Mikesˇ, L., Dalton, J.P., Mountford, A.P., Hora´k, P., 2007. Comparison of cysteine peptidase activities in Trichobilharzia regenti and Schistosoma mansoni cercariae. Parasitology 134, 1599–1609. Kennedy, N.J., Spithill, T.W., Tennent, J., Wood, P.R., Piedrafita, D., 2006. DNA vaccines in sheep: CTLA-4 mediated targeting and CpG motifs enhance immunogenicity in a DNA prime/protein boost strategy. Vaccine 24, 970–979. Kim, H., Lipscomb, W.N., 1993. X-ray crystallographic determination of the structure of bovine lens leucine aminopeptidase complexed with amastatin: Formulation of a catalytic mechanism featuring a gem-diolate transition state. Biochemistry 32, 8465–8478. Kim, T.S., Na, B.K., Park, P.H., Song, K.J., Hontzeas, N., Song, Ch. Y., 2000. Cloning and expression of a cysteine proteinase gene from Paragonimus westermani adult worms. J. Parasitol. 86, 333–339. King, Ch. H., 2007. Lifting the burden of Schistosomiasis-defining elements of infectionassociated disease and the benefits of antiparasite treatment. J. Infect. Dis. 196, 653–655. King, Ch. H., Dickman, K., Tisch, D.J., 2005. Reassessment of the cost of chronic helmintic infection: A meta-analysis of disability-related outcomes in endemic schistosomiasis. Lancet 365, 1561–1569. Kirschke, H., Barrett, A.J., 1987. Chemistry of lysosomal proteases. In: Glauman Ballard, (Eds.), Lysosomes: Their Role in Protein Breakdown, Academic Press, London, United Kingdom, pp. 193–238. Kisselev, A.F., Songyang, Z., Goldberg, A.L., 2000. Why does threonine, and not serine, function as the active site nucleophile in proteasomes? J. Biol. Chem. 275, 14831–14837. Kitamoto, Y., Veile, A.R., Keller, H.D., Sadler, J.E., 1995. cDNA Sequence and chromosomal localization of human enterokinase, the proteolytic activator of trypsinogen. Biochemistry 34, 4562–4568.

288


Klinkert, M.Q., Felleisen, R., Link, G., Ruppel, A., Beck, E., 1989. Primary structures of Sm31/ 32 diagnostic proteins of Schistosoma mansoni and their identification as proteases. Mol. Biochem. Parasitol. 33, 113–122. Klinkert, M.Q., Ruppel, A., Beck, E., 1987. Cloning of diagnostic 31/32 kilodalton antigens of Schistosoma mansoni. Mol. Biochem. Parasitol. 25, 247–255. Knudsen, G.M., Medzihradszky, K.F., Lim, K. Ch., Hansell, E., McKerrow, J.H., 2005. Proteomic Analysis of Schistosoma mansoni cercarial secretions. Mol. Cell. Proteomic 4, 1862–1875. Koehler, J.W., Morales, M.E., Shelby, B.D., Brindley, P.J., 2007. Aspartic protease activities of schistosomes cleave mammalian hemoglobins in a host-specific manner. Mem. Inst. Oswaldo Cruz 102, 83–85. Kola´rˇova´, L., 2007. Schistosomes causing cercarial dermatitis: A mini-review of current trends in systematics and of host specificity and pathogenicity. Folia Parasitol. 54, 81–87. Kourˇilova´, P., Hogg, K.G., Kola´rˇova´, L., Mountford, A.P., 2004. Cercarial dermatitis caused by bird schistosomes comprises both immediate and late phase cutaneous hypersensitivity reactions. J. Immunol. 172, 3766–3774. Krautz-Peterson, G., Skelly, P.J., 2008. Schistosome asparaginyl endopeptidase (legumain) is not essential for cathepsin B1 activation in vivo. Mol. Biochem. Parasitol. 159, 54–58. Krautz-Peterson, G., Radwanska, M., Ndegwa, D., Shoemaker, C.B., Skelly, P.J., 2007. Optimizing gene suppression in schistosomes using RNA interference. Mol. Biochem. Parasitol. 153, 194–202. Krem, M.M., Di Cera, E., 2002. Evolution of enzyme cascades from embryonic development to blood coagulation. Trends Biochem. Sci. 27, 67–74. Krupa, J.C., Hasnain, S., Na¨gler, D.K., Meńard, R., Mort, J.S., 2002. S2’ substrate specificity and the role of His110 and His111 in activity of human cathepsin B. Biochem. J. 361, 613–619. Kumagai, T., Maruyama, H., Hato, M., Ohmae, H., Osada, Y., Kanazawa, T., et al., 2005. Schistosoma japonicum: Localization of calpain in the penetration glands and secretions of cercariae. Exp. Parasitol. 109, 53–57. Landsperger, W.J., Stirewalt, M.A., Dresden, M.H., 1982. Purification and properties of a proteolytic enzyme from the cercariae of the human trematode parasite Schistosoma mansoni. Biochem. J. 201, 137–144. Law, R.H., Smooker, P.M., Irving, J.A, Piedrafita, D., Ponting, R., Kennedy, N.J., et al., 2003. Cloning and expression of the major secreted cathepsin B-like protein from juvenile Fasciola hepatica and analysis of immunogenicity following liver fluke infection. Infect. Immun. 71, 6921–6932. Lawrence, J.D., 1973. The ingestion of red blood cells by Schistosoma mansoni. J. Parasitol. 59, 60–63. Lecaille, F., Kaleta, J., Bro¨me, D., 2002. Human and parasitic papain-like cysteine proteases: Their role in physiology and pathology and recent developments in inhibitor design. Chem. Rev. 102, 4459–4488. Lee, C.L., Lewert, R.W., 1956. Quantitative studies of the collagenase-like enzymes of cercariae of Schistosoma mansoni and the larve of Strongyloides ratti. J. Infect. Dis. 99, 15–20. Lee, E.G., Na, B.K., Young, A.B., Kim, S.H., Je, E.Y., Ju, J.W., et al., 2006. Identification of immunodominant excretory–secretory cysteine proteases of adult Paragonimus westermani by proteome analysis. Proteomics 6, 1290–1300. Li, Y.L., Liu, S.Y., Han, J.J., Ning, C.X., Ruppel, A., 1996. Evaluation of a monoclonal antibody-based sandwich-ELISA for detection of circulating Schistosoma japonicum antigen (Sj31/32) in an endemic area of China. Trop. Med. Int. Health 1, 847–850. Lichtenbergova´, L., Kolbekova´, P., Kourˇilova´, P., Kasˇny´, M., Mikesˇ, L., Haas, H., et al., 2008. Antibody responses induced by Trichobilharzia regenti antigens in murine and human hosts exhibiting cercarial dermatitis. Parasite Immunol. 30, 585–595.


289

Lim, K.G., Sun, E., Bahgat, M., Bucks, D., Guy, R., Hinz, R.S., et al., 1999. Blockage of skin invasion by schistosome cercariae by serine protease inhibitors. Am. J. Trop. Med. Hyg. 60, 487–492. Liu, F., Lu, J., Hu, W., Wang, S.Y., Cui, S.J., Chi, M., et al., 2006. New perspectives on host– parasite interplay by comparative transcriptomic and proteomic analyses of Schistosoma japonicum. PLoS Pathogens 2, 268–281. Lockyer, A.E., Olson, P.D., Ostergaard, P., Rollinson, D., Johnston, D.A., Attwood, S.W., et al., 2003. The phylogeny of the Schistosomatidae based on three genes with emphasis on the interrelationships of Schistosoma Weinland, 1858. Parasitology 126, 203–224. Losada, S., Chacoń, N., Colmenares, C., Bermu´dez, H., Lorenzo, A., Pointier, J.P., et al., 2005. Schistosoma: Cross-reactivity and antigenic community among different species. Exp. Parasitol. 111, 182–190. Lowther, W.T., Matthews, B.W., 2002. Metalloaminopeptidases: Common functional themes in disparate structural surroundings. Chem. Rev. 102, 4581–4608. Marcilla, A., Rubia, J.E., Sotillo, J., Bernal, D., Carmona, C., Villavicencio, Z., et al., 2007. Leucine aminopeptidase is an immunodominant antigen of Fasciola hepatica excretory/ secretory products in human infection. Clin. Vaccine Immunol. 15, 95–100. Marikovsky, M., Arnon, R., Fishelson, Z., 1990. Schistosoma mansoni: Localization of the 28 kDa secreted protease in cercaria. Parasite Immunol. 12, 389–401. Mason, R.W., Green, G.D., Barrett, A.J., 1985. Human liver cathepsin L. Biochem. J. 226, 233–241. Mathieu, M.A., Bogyo, M., Caffrey, C.R., Choe, Y., Lee, J., Chapman, H., et al., 2002. Substrate specificity of schistosome versus human legumain determined by P1–P3 peptide libraries. Mol. Biochem. Parasitol. 121, 99–105. Matsumura, K., Mitsui, Y., Sato, K., Sakamoto, M., Aoki, Y., 1991. Schistosoma mansoni: Possible involvement of protein kinase C in linoleic acid-induced proteolytic enzyme release from cercariae. Exp. Parasitol. 72, 311–320. McCarthy, E., Stack, C., Donnelly, S.M., Doyle, S., Mann, V.H., Brindley, P.J., et al., 2004. Leucine aminopeptidase of the human blood flukes, Schistosoma mansoni and Schistosoma japonicum. Int. J. Parasitol. 34, 703–714. McGinty, A., Moore, M., Halton, D.W., Walker, B., 1993. Characterization of the cysteine proteinases of the common liver fluke Fasciola hepatica using novel, active-site directed affinity labels. Parasitology 106, 487–493. McGonigle, L., Mousley, A., Marks, N.J., Brennan, G.P., Dalton, J.P., Spithill, T.W., et al., 2008. The silencing of cysteine proteases in Fasciola hepatica newly excysted juveniles using RNA interference reduces gut penetration. Int. J. Parasitol. 38, 149–155. McKerrow, J.H., 1989. Molecular and biochemical studies of the cercarial proteinase of Schistosoma mansoni. Mem. Inst. Oswaldo Cruz 84, 209–210. McKerrow, J.H., 2003. Invasion of skin by schistosome cercariae: Some neglected facts— response. Trends Parasitol. 19, 66–68. McKerrow, J.H., Doenhoff, J.M., 1988. Schistosome proteinases. Parasitol. Today 4, 334–340. McKerrow, J.H., Salter, J., 2002. Invasion of skin by Schistosoma cercariae. Trends Parasitol. 18, 193–195. McKerrow, J.H., Caffrey, C., Kelly, B., Loke, P., Sajid, M., 2006. Proteases in parasitic diseases. Ann. Rev. Pathol. 1, 497–536. McKerrow, J.H., Newport, G., Fishelson, Z., 1991. Recent insights into the structure and function of a larval proteinase involved in host infection by a multicellular parasite. Proc. Soc. Exp. Biol. Med. 197, 119–124. McKerrow, J.H., Pino-Heiss, S., Linquist, R., Werb, Z., 1985. Purification and characterization of an elastinolytic proteinase secreted by cercariae of Schistosoma mansoni. J. Biol. Chem. 260, 3703–3707. McMahon, J.E., Kolstrup, N., 1979. Praziquantel: A new schistosomicide against Schistosoma haematobium. Br. Med. J. 2, 1396–1398.

290


McManus, D.P., 2005. Prospects for development of a transmission blocking vaccine against Schistosoma japonicum. Parasite Immunol. 27, 297–308. McManus, D.P., Dalton, J.P., 2006. Vaccines against the zoonotic trematodes Schistosoma japonicum, Fasciola hepatica and Fasciola gigantica. Parasitology 133, S43–S61. Meemon, K., Grams, R., Vichasri, G.S., Hofmann, A., Korge, G., Viyanant, V., et al., 2004. Molecular cloning and analysis of stage and tissue-specific expression of cathepsin B encoding genes from Fasciola gigantica. Mol. Biochem. Parasitol. 136, 1–10. Mehlhorn, H., 2001. ‘‘Encyclopedic Reference of Parasitology: Biology, Structure, Function’’. 2nd edn. Springer-Verlag, Berlin, Germany. Merckelbach, A., Hasse, S., Dell, R., Eschlbeck, A., Ruppel, A., 1994. cDNA sequences of Schistosoma japonicum coding for two cathepsin B-like proteins and Sj32. Trop. Med. Parasitol. 45, 193–198. Michel, A., Ghoneim, H., Resto, M., Klinkert, M.Q., Kunz, W., 1995. Sequence, characterization and localization of a cysteine proteinase cathepsin L in Schistosoma mansoni. Mol. Biochem. Parasitol. 73, 7–18. Mikesˇ, L., Man, P., 2003. Purification and characterization of a saccharide-binding protein from penetration glands of Diplostomum pseudospathaceum—a bifunctional molecule with cysteine protease activity. Parasitology 127, 69–77. Mikesˇ, L., Zı´dkova´, L., Kasˇny´, M., Dvorˇa´k, J., Hora´k, P., 2005. In vitro stimulation of penetration gland emptying by Trichobilharzia szidati and T. regenti (Schistosomatidae) cercariae. Quantitative collection and partial characterization of the products. Parasitol. Res. 96, 230–241. Mkwetshana, N., Naude´, R.J., Muramoto, K., 2002. The purification and characterization of mu-calpain and calpastatin from ostrich brain. Int. J. Biochem. Cell Biol. 34, 613–624. Moczon, T., 1994a. A cysteine proteinase in the cercariae of Diplostomum pseudospathaceum (Trematoda, Diplostomatidae). Parasitol. Res. 80, 680–683. Moczon, T., 1994b. Histochemistry of proteinases in the cercariae of Diplostomum pseudospathaceum (Trematoda, Diplostomatidae). Parasitol. Res. 80, 684–686. Moczon, T., 2007. A cysteine proteinase in the penetration glands of the cercariae of Tylodelphys excavata (Trematoda, Diplostomidae). Parasitol. Res. 100, 299–304. Moertel, L., Gobert, G.N., McManus, D.P., 2008. Comparative real-time PCR and enzyme analysis of selected gender-associated molecules in Schistosoma japonicum. Parasitology 135, 575–583. Molgaard, A., Arnau, J., Lauritzen, C., Larsen, S., Petersen, G., Pedersen, J., 2007. The crystal structure of human dipeptidyl peptidase I (cathepsin C) in complex with the inhibitor Gly-Phe-CHN2. Biochem. J. 401, 645–650. Molyneux, D.H., 2006. Control of human parasitic diseases: Context and overview. Adv. Parasitol. 61, 1–45. Morales, M.E., Kalinna, B.H., Heyers, O., Mann, V.H., Schulmeister, A., Copeland, C.S., et al., 2004. Genomic organization of the Schistosoma mansoni aspartic protease gene, a platyhelminth orthologue of mammalian lysosomal cathepsin D. Gene 338, 99–109. Morales, M.E., Rinaldi, G., Gobert, G.N., Kines, K.J., Tort, J.F., Brindley, P.J., 2008. RNA interference of Schistosoma mansoni cathepsin D, the apical enzyme of the hemoglobin proteolysis cascade. Mol. Biochem. Parasitol. 157, 160–168. Mort, J.S., 2004. Cathepsin B. In: Barrett, Rawlings, Woessner, (Eds.) Handbook of Proteolytic Enzymes, 2nd edn. Elsevier, Amsterdam, The Netherlands, pp. 1079–1086. Mulcahy, G., O’Connor, F., McGonigle, S., Dowd, A., Clery, D.G., Andrews, S.J., et al., 1998. Correlation of specific antibody titre and avidity with protection in cattle immunized against Fasciola hepatica. Vaccine 16, 932–939. Muller, R., 2002. ‘‘Worms and Human Diseases’’. 2nd edn. CABI Publishing, Wallingford, United Kingdom.


291

Mu¨ntz, K., Blattner, F.R., Shutov, A.D., 2002. Legumains—a family of asparagine-specific cysteine endopeptidases involved in propolypeptide processing and protein breakdown in plants. J. Plant Physiol. 159, 1281–1293. Murata, M., Miyashita, S., Yokoo, C., Tamai, M., Hanada, K., Hatayama, K., et al., 1991. Novel epoxysuccinyl peptides. Selective inhibitors of cathepsin B, in vitro. FEBS Lett. 280, 307–310. Murata, S., Yashiroda, H., Tanaka, K., 2009. Molecular mechanisms of proteasome assembly. Nat. Rev. 10, 104–115. Musil, D., Zucic, D., Turk, D., Engh, R.A., Mayr, I., Huber, R., et al., 1991. The refined 2.15 A X-ray crystal structure of human liver cathepsin B: The structural basis for its specificity. EMBO J. 10, 2321–2330. Na, B.K., Kim, S.H., Lee, E.G., Kim, T.S., Bae, Y.A., Kang, I., et al., 2006. Critical roles for excretory–secretory cysteine proteases during tissue invasion of Paragonimus westermani newly excysted metacercariae. Cell. Microbiol. 8, 1034–1046. Nabhan, J.F., El-Shehabi, F., Patocka, N., Ribeiro, P., 2007. The 26S proteasome in Schistosoma mansoni: Bioinformatics analysis, developmental expression, and RNA interference (RNAi) studies. Exp. Parasitol. 117, 337–347. Nabhan, J.F., Hamdan, F.F., Ribeiro, P., 2001. A Schistosoma mansoni Pad1 homologue stabilizes c-Jun. Mol. Biochem. Parasitol 116, 209–218. Corrected and republished. Mol. Biochem. Parasitol. 121, 163–172. Newport, G.R., McKerrow, J.H., Hedstrom, R., Petitt, M., McGarrigle, L., Barr, P.J., et al., 1988. Cloning of the proteinase that facilitates infection by schistosome parasites. J. Biol. Chem. 263, 13179–13184. Novobilsky´, A., Horaé`kova´, E., Hirtova´, L., Modry´, D., Koudela, B., 2007a. The giant liver fluke Fascioloides magna (Bassi 1875) in cervids in the Czech Republic and potential of its spreading to Germany. Parasitol. Res. 100, 549–553. Novobilsky´, A., Kasˇny´, M., Mikesˇ, L., Kovarˇe`´ık, K., Koudela, B., 2007b. Humoral immune responses during experimental infection with Fascioloides magna and Fasciola hepatica in goats. Parasitol. Res. 101, 357–364. Noya, O., Alarcoń, N.B., Losada, S., Colmenares, C., Guzmań, C., Lorenzo, M.A., et al., 2002. Laboratory diagnosis of Schistosomiasis in areas of low transmission: A review of a line of research. Mem. Inst. Oswaldo Cruz 97, 167–169. Ohta, N., Kumagai, T., Maruyama, H., Yoshida, A., He, Y., Zhang, R., 2004. Research on calpain of Schistosoma japonicum as a vaccine candidate. Parasitol. Int. 53, 175–181. Ojopi, E.P.B., Oliveira, P.S.L., Nunes, D.N., Paquola, A., DeMarco, R., Grego´rio, S.P., et al., 2007. A quantitative view of the transcriptome of Schistosoma mansoni adult-worms using SAGE. BMC Genomics 8, 186. O’Neill, S.M., Brady, M.T., Callanan, J.J., Mulcahy, G., Joyce, P., Mills, K.H., et al., 2000. Fasciola hepatica infection downregulates Th1 responses in mice. Parasite Immunol. 22, 147–155. Orwig, K.E., Bertrand, J.E., Ou, B.R., Forsberg, N.E., Stormshak, F., 1994. Involvement of protein kinase-C, calpains, and calpastatin in prostaglandin F2 alpha-induced oxytocin secretion from the bovine corpus luteum. Endocrinology 134, 78–83. Park, H., Hong, K.M., Ryu, J.S., Shin, C.H., Lee, J.B., Soh, C.T., et al., 1997. Cloning of a cysteine proteinase cDNA of adult Paragonimus westermani by polymerase chain reaction. Mol. Cell 7, 335–339. Park, H., Ko, M.Y., Soh, C.T., Paik, M.K., Seo, J.H., Im, K., 1995. Cytotoxicity of a cysteine proteinase of adult Clonorchis sinensis. Korean J. Parasitol. 33, 211–218. Park, S.Y., Lee, K.H., Hwang, Y.B., Kim, K.Y., Park, S.K., Hwang, H.A., et al., 2001. Characterization and large-scale expression of the recombinant cysteine proteinase from adult Clonorchis sinensis. J. Parasitol. 87, 1454–1458.

292


Peng, H.J., Chen, X.G., Wang, X.Z., Lun, Z.R., 2003. Analysis and gene expression profile of Schisotosoma japonicum cercariae by a strategy based on expressed sequence tags. Parasitol. Res. 90, 287–293. Piacenza, L., Acosta, D., Basmadjian, I., Dalton, J.P., Carmona, C., 1999. Vaccination with cathepsin L proteinases and with leucine aminopeptidase induces high levels of protection against fascioliasis in sheep. Infect. Immun. 67, 1954–1961. Pierrot, C., Capron, A., Khalife, J., 1995. Cloning and characterization of two genes encoding Schistosoma mansoni elastase. Mol. Biochem. Parasitol. 75, 113–117. Pierrot, C., Godin, C., Liu, J.L., Capron, A., Khalife, J., 1996. Schistosoma mansoni elastase: An immune target regulated during the parasite life-cycle. Parasitology 113, 519–526. Planchart, S., Incani, R.N., Cesari, I.M., 2007. Preliminary characterization of an adult worm ‘vomit’ preparation of Schistosoma mansoni and its potential use as antigen for diagnosis. Parasitol. Res. 101, 301–309. Pleass, R.J., Aboobaker, A.A., Schmitt, A.O., 2008. Piggybacking schistosome invasion: Similarities are only skin deep. Trends Parasitol. 24, 153–156. Pleass, R.J., Kusel, J.R., Woof, J.M., 2000. Cleavage of human IgE mediated by Schistosoma mansoni. Int. Arch. Allergy Immunol. 121, 194–204. Polga´r, L., 1987. The mechanism of action of aspartic proteases involves ‘push–pull’ catalysis. FEBS Lett. 219, 1–4. Ram, D., Ziv, E., Lantner, F., Schechter, I., 2003. Interaction of the proteasome S5a/Rpn10 multiubiquitin-binding protein and the 8 kDa calcium-binding protein of Schistosoma mansoni. Parasitology 127, 337–347. Rao, K.V., Chen, L., Gnanasekar, M., Ramaswamy, K., 2002. Cloning and characterization of a calcium-binding, histamine-releasing protein from Schistosoma mansoni. J. Biol. Chem. 277, 31207–31213. Rawlings, N.D., Barrett, A.J., 1993. Evolutionary families of peptidases. Biochem. J. 290, 205–218. Rawlings, N.D., Barrett, A.J., 2004a. Introduction: The clans and families of cysteine peptidases. In: Barrett, Rawlings, Woessner, (Eds.) Handbook of Proteolytic Enzymes, 2nd edn. Elsevier, Amsterdam, The Netherlands, pp. 1051–1071. Rawlings, N.D., Barrett, A.J., 2004b. Introduction: Serine peptidases and their clans. In: Barrett, Rawlings, Woessner, (Eds.) Handbook of Proteolytic Enzymes, 2nd edn. Elsevier, Amsterdam, The Netherlands, pp. 1417–1439. Rawlings, N.D., Barrett, A.J., 2004c. Introduction: Metallo peptidases and their clans. In: Barrett, Rawlings, Woessner, (Eds.) Handbook of Proteolytic Enzymes, 2nd edn. Elsevier, Amsterdam, The Netherlands, pp. 231–268. Rawlings, N.D., Barrett, A.J., 2004d. Introduction: Clan PB containing N-terminal nucleophile peptidases. In: Barrett, Rawlings, Woessner, (Eds.) Handbook of Proteolytic Enzymes, 2nd edn. Elsevier, Amsterdam, The Netherlands, pp. 2047–2049. Rawlings, N.D., Morton, F.R., Kok, C.Y., Kong, J., Barrett, A.J., 2008. MEROPS: The peptidase database. Nucleic Acids Res. 36, 320–325. Rege, A.A., Wang, W., Dresden, M.H., 1992. Cysteine proteinases from Schistosoma haematobium adult worms. J. Parasitol. 78, 16–23. Rinaldi, G., Morales, M.E., Cancela, M., Castillo, E., Brindley, P.J., Tort, J.F., 2008. Development of functional genomic tools in trematodes: RNA interference and luciferase reporter gene activity in Fasciola hepatica. PLoS Negl. Trop. Dis. 2, 1–10. Ring, Ch. S., Sun, E., McKerrow, J.H., Lee, G.K., Rosenthal, P.J., Kuntz, I.D., et al., 1993. Biophysics structure-based inhibitor design by using protein models for the development of antiparasitic agents. Proc. Natl. Acad. Sci. USA 90, 3583–3587. Robinson, M.W., Dalton, J.P., Donnelly, S., 2008a. Helminth pathogen cathepsin proteases: It’s a family affair. Trends Biochem. Sci. 33, 1–8. Robinson, M.W., Tort, J.F., Lowther, J., Donnelly, S.M., Wong, E., Xu, W., et al., 2008b. Proteomics and phylogenetic analysis of the cathepsin L protease family of the helminth


293

pathogen Fasciola hepatica: Expansion of a repertoire of virulence-associated factors. Mol. Cell. Proteomics 7, 1111–1123. Rollinson, D., Simpson, A.J.G., 1987. ‘‘The Biology of Schistosomes: From Genes to Latrines’’. Academic Press, San Diego. Rudolfova´, J., Hampl, V., Bayssade-Dufour, C., Lockyer, A.E., Littlewood, D.T., Hora´k, P., 2005. Validity reassessment of Trichobilharzia species using Lymnaea stagnalis as the intermediate host. Parasitol. Res. 95, 79–89. Rue, G.R., Butler, E.P., Berkhout, P.G., 1926. Studies on the trematode family Strigeidae (Holostomidae): No. IV. The eye of fishes, an important habitat for larval Strigeidae. Trans. Am. Microsc. Soc. 45, 282–288. Rupova, L., Keilova, H., 1979. Isolation and some properties of an acid protease from Fasciola hepatica. Z. Parasitenkd. 61, 83–91. Ruppel, A., Chlichlia, K., Bahgat, M., 2004. Invasion by schistosome cercariae: Neglected aspects in Schistosoma japonicum. Trends Parasitol. 20, 397–400. Ruppel, A., Diesfeld, H.J., Rother, U., 1985. Immunoblot analysis of Schistosoma mansoni antigens with sera of schistosomiasis patients: Diagnostic potential of an adult schistosome polypeptide. Clin. Exp. Immunol. 62, 499–506. Ruppel, A., Shi, Y.E., Wei, D.X., Diesfeld, H.J., 1987. Sera of Schistosoma japonicum-infected patients cross-react with diagnostic 31/32 kD proteins of S. mansoni. Clin. Exp. Immunol. 69, 291–298. Ruppel, A., Xing, Y., Dell, R., Numrich, P., Shi, Y.E., 1991. Schistosoma mansoni and S. japonicum: Decline of antibodies against diagnostic adult worm antigens (Sm31/32) following praziquantel treatment of mice. Trop. Med. Parasitol. 42, 325–331. Sajid, M., McKerrow, J.H., 2002. Cysteine proteases of parasitic organisms. Mol. Biochem. Parasitol. 120, 1–21. Sajid, M., McKerrow, J.H., Hansell, E., Mathieu, M.A., Lucas, K.D., Hsieh, I., et al., 2003. Functional expression and characterization of Schistosoma mansoni cathepsin B and its trans-activation by an endogenous asparaginyl endopeptidase. Mol. Biochem. Parasitol. 131, 65–75. Salter, J.P., Choe, Y., Albrecht, H., Franklin, C., Lim, K.C., Craik, C.S., et al., 2002. Cercarial elastase is encoded by a functionally conserved gene family across multiple species of schistosomes. J. Biol. Chem. 277, 24618–24624. Salter, J.P., Lim, K.C., Hansell, E., Hsieh, I., McKerrow, J.H., 2000. Schistosome invasion of human skin and degradation of dermal elastin are mediated by a single serine protease. J. Biol. Chem. 275, 38667–38673. Schechter, I., Berger, A., 1967. On the size of the active site in proteases. I. Papain. Biochem. Biophys. Res. Comm. 27, 157–162. Schwar, G., Brandenburg, J., Reich, M., Burster, T., Driessen, C., Kalbacher, H., 2002. Characterization of legumain. Biol. Chem. 383, 1813–1816. Scott, J.C., McManus, D.P., 2000. Characterisation and expression of a cDNA encoding the 80-kDa large subunit of Schistosoma japonicum calpain. Parasitol. Int. 48, 205–214. Shin, M.H., Kita, H., Park, H.Y., Seoh, J.Y., 2001. Cysteine protease secreted by Paragonimus westermani attenuates effector functions of human eosinophils stimulated with immunoglobulin G. Infect. Immun. 69, 1599–1604. Siddiqui, A.A., Phillips, T., Charest, H., Podesta, R.B., Quinlin, M.L., Pinkston, J.R., et al., 2003. Induction of protective immunity against Schistosoma mansoni via DNA priming and boosting with the large subunit of calpain (Sm-p80): Adjuvant effects of granulocytemacrophage colony-stimulating factor and interleukin-4. Infect. Immun. 71, 3844–3851. Siddiqui, A.A., Pinkston, J.R., Quinlin, M.L., Saeed, Q., White, G.L., Shearer, M.H., et al., 2005. Characterization of the immune response to DNA vaccination strategies for schistosomiasis candidate antigen, Sm-p80 in the baboon. Vaccine 23, 1451–1456. Siddiqui, A.A., Zhou, Y., Podesta, R.B., Karcz, S.R., Tognon, C.E., Strejan, G.H., et al., 1993. Characterization of Ca(2þ) dependent neutral protease (calpain) from human blood flukes, Schistosoma mansoni. Biochim. Biophys. Acta 1181, 37–44.

294


Silva, F.P., Jr., Ribeiro, F., Katz, N., Giovanni, S.S., 2002. Exploring the subsite specificity of Schistosoma mansoni aspartyl hemoglobinase through comparative molecular modelling. FEBS Lett. 514, 141–148. Skelly, P.J., Shoemaker, C.B., 2001. Schistosoma mansoni proteases Sm31 (cathepsin B) and Sm32 (legumain) are expressed in the cecum and protonephridia of cercariae. J. Parasitol. 87, 1218–1221. Skelly, P.J., Da’dara, A., Harn, D.A., 2003. Suppression of cathepsin B expression in Schistosoma mansoni by RNA interference. Int. J. Parasitol. 33, 363–369. Smith, A.M., Dalton, J.P., Clough, K.A., Kilbane, C.L., Harrop, S.A., Hole, N., et al., 1994. Adult Schistosoma mansoni express cathepsin L proteinase activity. Mol. Biochem. Parasitol. 67, 11–19. Smith, A.M., Dowd, A.J., Heffernan, M., Robertson, C.D., Dalton, J.P., 1993. Purification of a cathepsin L-like proteinase secreted by adult Fasciola hepatica. Mol. Biochem. Parasitol. 62, 1–8. Smith, I.J., Dodd, S.L., 2007. Calpain activation causes a proteasome-dependent increase in protein degradation and inhibits the Akt signalling pathway in rat diaphragm muscle. Exp. Physiol. 92, 561–573. Sojka, D., Franta, Z., Horn, M., Hajdusˇek, O., Caffrey, C.R., Maresˇ, M., et al., 2008. Profiling of proteolytic enzymes in the gut of the tick Ixodes ricinus reveals an evolutionarily conserved network of aspartic and cysteine peptidases. Parasit. Vectors 7, 1–14. Sojka, D., Hajdusˇek, O., Dvorˇa´k, J., Sajid, M., Franta, Z., Schneider, E.L., et al., 2007. IrAE— An asparaginyl endopeptidase (legumain) in the gut of the hard tick Ixodes ricinus. Int. J. Parasitol. 37, 713–724. Sorimachi, H., 2004. Muscle calpain p94. In: Barrett, Rawlings, Woessner, (Eds.) Handbook of Proteolytic Enzymes, 2nd edn. Elsevier, Amsterdam, The Netherlands, pp. 1213–1217. Spithill, T.W., Dalton, J.P., 1998. Progress in development of liver fluke vaccines. Parasitol. Today 14, 224–228. Spithill, T.W., Piedrafita, D., Smooker, P.M., 1999. Immunological approaches for the control of fasciolosis. Int. J. Parasitol. 27, 1221–1235. Stack, C.M., Caffrey, C.R., Donnelly, S.M., Seshaadri, A., Lowther, J., Tort, J.F., et al., 2008. Structural and functional relationships in the virulence-associated cathepsin L proteases of the parasitic liver fluke, Fasciola hepatica. J. Biol. Chem. 283, 9896–9908. Stack, C.M., Dalton, J.P., Cunneen, M., Donnelly, S., 2005. De-glycosylation of Pichia pastorisproduced Schistosoma mansoni cathepsin B eliminates non-specific reactivity with IgG in normal human serum. J. Immunol. Meth. 304, 151–157. Stamatakis, A., 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688–2690. Steenstrup, J.J.S., 1842. ‘‘Ueber den Generationswechsel, oder Fortpflanzung und Entwickelung durch Abwechselnde Generationen, eine Eigenthu¨mliche Form der Brutpflege in den Niederen Thierclassen’’. Verlag, Copenhagen, Denmark. Steinmann, P., Keiser, J., Bos, R., Tanner, M., Utzinger, J., 2006. Schistosomiasis and water resources development: Systematic review, meta-analysis, and estimates of people at risk. Lancet Inf. Diseases 6, 411–425. Stirewalt, M.A., Austin, B.E., 1973. Collection of a secreted protease from the preacetabular glands of cercariae of Schistosoma mansoni. J. Parasitol. 59, 741–743. Stirewalt, M.A., Kruidenier, F.J., 1960. Activity of the acetabular secretory apparatus of cercariae of Schistosoma mansoni under experimental conditions. Exp. Parasitol. 11, 191–211. Strauss, W., O’Neill, S.M., Parkinson, M., Angles, R., Dalton, J.P., 1999. Short report: Diagnosis of human fascioliasis: Detection of anti-cathepsin L antibodies in blood samples collected on filter paper. Am. J. Trop. Med. Hyg. 60, 746–748. Suzuki, K., Hata, S., Kawabata, Y., Sorimachi, H., 2004. Structure, activation, and biology of calpain. Diabetes 53, 12–18. Swales, W.E., 1935. The life cycle of Fascioloides magna (Bassi, 1875), the large liver fluke of ruminants in Canada with observations on the bionomics of the larval stages and the


295

intermediate hosts, pathology of fascioloidiasis magna, and control measures. Can. J. Res. 12, 177–215. Tanaka, K., 2009. The proteasome: Overview of structure and functions. Proc. Jpn. Acad. B Phys. Biol. Sci. 85, 12–36. The UniProt Consortium, 2008. The Universal Protein Resource (UniProt). Nucleic Acids Res. 36, 190–195. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTALX windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Timms, A.R., Bueding, E., 1959. Studies of a proteolytic enzyme from Schistosoma mansoni. Br. J. Pharmacol. Chemother. 14, 68–73. Tkalcevic, J., Ashman, K., Meeusen, E., 1995. Fasciola hepatica: Rapid identification of newly excysted juvenile proteins. Biochem. Biophys. Res. Comm. 213, 169–174. Tort, J., Brindley, P.J., Knox, D., Wolfe, K.H., Dalton, J.P., 1999. Proteinases and associated genes of parasitic helminths. Adv. Parasitol. 43, 161–266. Towatari, T., Nikawa, T., Murata, M., Yokoo, C., Tamai, M., Hanada, K., et al., 1991. Novel epoxysuccinyl peptides. A selective inhibitor of cathepsin B, in vivo. FEBS Lett. 280, 311–315. Trap, C., Boireau, P., 2000. Les proteáses chez les helminthes. Vet. Res. 31, 461–471. Truden, J.L., Boros, D.L., 1987. Detection of a2-Macroglobulin, aþ-Protease Inhibitor, and neutral protease-antiprotease complexes within liver granulomas of Schistosoma mansoniinfected mice. Am. J. Pathol. 130, 281–288. Turk, B., Turk, D., Turk, V., 2000. Lysosomal cysteine proteases: More than scavengers. Biochim. Biophys. Acta 147, 98–111. Turk, B., Turk, D., Dolenc, I., Turk, D., Turk, V., 2004. Dipeptidyl-peptidase I. In: Barrett, Rawlings, Woessner, (Eds.) Handbook of Proteolytic Enzymes, 2nd edn. Elsevier, Amsterdam, The Netherlands, pp. 1192–1196. Turk, D., Janjiæ, V., Stern, I., Podobnik, M., Lamba, D., Dahl, S.W., et al., 2001. Structure of human dipeptidyl peptidase I (cathepsin C): Exclusion domain added to an endopeptidase framework creates the machine for activation of granular serine proteases. EMBO J. 20, 6570–6582. Turk, V., Marks, N., 1977. Intracellular protein catabolism II. Proc. 2nd Int. Symp. Intracellular Protein Catabolism (Ljubljana, Yugoslavia). Plenum Press, New York. Valdivieso, E., Bermudez, H., Hoebeke, J., Noya, O., Cesari, I.M., 2003. Immunological similarity between Schistosoma and bovine cathepsin D. Immunol. Lett. 89, 81–88. Verity, C.K., Loukas, A., McManus, D.P., Brindley, P.J., 2001a. Schistosoma japonicum cathepsin D aspartic protease cleaves human IgG and other serum components. Parasitology 122, 415–421. Verity, C.K., McManus, D.P., Brindley, P.J., 1999. Developmental expression of cathepsin D aspartic protease in Schistosoma japonicum. Int. J. Parasitol. 29, 1819–1824. Verity, C.K., McManus, D.P., Brindley, P.J., 2001b. Vaccine efficacy of recombinant cathepsin D aspartic protease from Schistosoma japonicum. Parasite Immunol. 23, 153–162. Verjovski, A.S., Venancio, T.M., Oliveira, K.C., Almeida, G.T., DeMarco, R., 2007. Use of a 44k oligoarray to explore the transcriptome of Schistosoma mansoni adult worms. Exp. Parasitol. 117, 236–245. Verjovski-Almeida, S., DeMarco, R., Martins, E.A., Guimara˜es, P.E., Ojopi, E.P., Paquola, A.C., et al., 2003. Transcriptome analysis of the acoelomate human parasite Schistosoma mansoni. Nat. Genet. 35, 148–157. Verwaerde, C., Auriault, C., Damonneville, M., Neyrinck, J.L., Vendeville, C., Capron, A., 1986. Role of serine proteases of Schistosoma mansoni in the regulation of IgE synthesis. Scand. J. Immunol. 24, 509–516. Vieira, P., Miranda, H.P., Cerqueira, M., Delgado, M.L., Coelho, H., Antunes, D., et al., 2007. Latent schistosomiasis in Portuguese soldiers. Mil. Med. 172, 144–146.

296


Wang, K.K.W., Yuen, P., 1999. Calpain substrates, assay methods, regulation, and its inhibitory agents. In: Wang Yuen, (Eds.), Pharmacology and toxicology of calcium-dependent protease, CRC Press, London, United Kingdom, pp. 77–101. Wang, L., Li, Y.L., Fishelson, Z., Kusel, J.R., Ruppel, A., 2005. Schistosoma japonicum migration through mouse skin compared histologically and immunologically with S. mansoni. Parasitol. Res. 95, 218–223. Wasilewski, M.M., Lim, K.C., Phillips, J., McKerrow, J.H., 1996. Cysteine protease inhibitors block schistosome hemoglobin degradation in vitro and decrease worm burden and egg production in vivo. Mol. Biochem. Parasitol. 30, 179–189. Webster, B.L., Southgate, V.R., Littlewood, D.T., 2006. A revision of the interrelationships of Schistosoma including the recently described Schistosoma guineensis. Int. J. Parasitol. 36, 947–955. Wex, T., Levy, B., Wex, H., Bromme, D., 1999a. Human cathepsins F and W: A new subgroup of cathepsins. Biochem. Biophys. Res. Comm. 259, 401–407. Wex, T., Wex, H., Bro¨mme, D., 1999b. The human cathepsin F gene—a fusion product between an ancestral cathepsin and cystatin gene. Biol. Chem. 380, 1439–1442. Wijffels, G.L., Panaccio, M., Salvatore, L., Wilson, L., Walker, I.D., Spithill, T.W., 1994. The secreted cathepsin L-like proteinases of the trematode, Fasciola hepatica, contain 3-hydroxyproline residues. Biochem. J. 299, 781–790. Williams, D.L., Sayed, A.A., Bernier, J., Birkeland, S.R., Cipriano, M.J., Papa, A.R., et al., 2007. Profiling Schistosoma mansoni development using serial analysis of gene expression (SAGE). Exp. Parasitol. 117, 246–258. Williamson, A.L., Brindley, P.J., Knox, D.P., Hotez, P.J., Loukas, A., 2003. Digestive proteases of blood-feeding nematodes. Trends Parasitol. 9, 417–423. Wippersteg, V., Sajid, M., Walshe, D., Khiem, D., Salter, J.P., McKerrow, J.H., et al., 2005. Biolistic transformation of Schistosoma mansoni with 5’ flanking regions of two peptidase genes promotes tissue-specific expression. Int. J. Parasitol. 35, 583–589. Wong, J.Y., Harrop, S.A., Day, S.R., Brindley, P.J., 1997. Schistosomes express two forms of cathepsin D. Biochim. Biophys. Acta 1338, 156–160. World Health Organization Expert Committee, 2002. Prevention and control of schistosomiasis and soil-transmitted helminthiasis. World Health Organ. Tech. Rep. Ser. 912, 1–57. World Health Organization, 2001. ‘‘The World Health Report’’. World Health Organization, Geneva, Switzerland. World Health Organization, 2004. ‘‘The World Health Report’’. World Health Organization, Geneva, Switzerland. Wu, Z.D., Lu¨, Z.Y., Yu, X.B., 2005. Development of a vaccine against Schistosoma japonicum in China: A review. Acta Trop. 96, 106–116. Yamakami, K., Hamajima, F., 1990. A neutral thiol protease secreted from newly excysted metacercariae of trematode parasite Paragonimus westermani: Purification and characterization. Comp. Biochem. Physiol. 95, 755–758. Yamakami, K., Hamajima, F., Akao, S., Tadakuma, T., 1995. Purification and characterization of acid cysteine protease from metacercariae of the mammalian trematode parasite Paragonimus westermani. Eur. J. Biochem. 233, 490–497. Yamasaki, H., Mineki, R., Murayama, K., Ito, A., Aoki, T., 2002. Characterisation and expression of the Fasciola gigantova cathepsin L gene. Int. J. Parasitol. 32, 1031–1042. Zerda, K.S., Dresden, M.H., Damian, R.T., Chappell, C.L., 1987. Schistosoma mansoni: AntiSMw32 proteinase response in vaccinated and challenged baboons. Am. J. Trop. Med. Hyg. 37, 320–326. Zhang, R., Suzuki, T., Takahashi, S., Yoshida, A., Kawaguchi, H., Maruyama, H., et al., 2000. Cloning and molecular characterization of calpain, a calcium-activated neutral proteinase, from different strains of Schistosoma japonicum. Parasitol. Int. 48, 232–242.


297

Zou, Z., Lopez, D.L., Kanost, M.R., Evans, J.D., Jiang, H., 2006. Comparative analysis of serine protease-related genes in the honey bee genome: Possible involvement in embryonic development and innate immunity. Insect Mol. Biol. 15, 603–614. Zussman, R.A., Bauman, P.M., 1971. Schistosome hemoglobin protease: Search for inhibitors. J. Parasitol. 57, 233–234.

USEFUL WEBSITES Three-dimensional model of haemoglobin: www.mcat45.com BACHEM: www.bachem.com BRENDA enzyme database: http://www.brenda-enzymes.info/ Enzyme nomenclature: www.chem.qmul.ac.uk/iupac/jcbn/ GenBank (available on the National Center for Biotechnology Information (NCBI) ftp site): http://www.ncbi.nlm.nih.gov/genbank/index.html MEROPS database 8.2: http://merops.sanger.ac.uk/ Multiple alignment (ExPASy Proteomics Server, CLUSTALW alignment): http://www.expasy.org/tools/#align Photograph of elastin fibres: http://www.people.vcu.edu/glbowlin/ elastin.htm Phylogenetic peptidase tree: www.schistosomes.cz/peptidase-tree.pdf Picture of elastin and collagen: http://medinfo.ufl.edu/pa/chuck/ summer/handouts/connect.htm Predicted model of human pro-cathepsin B1: www.delphi.phys.univtours.fr/Prolysis/Images/procatbrib.jpeg Protein three-dimensional structure on-line modelling: www.cbs.dtu.dk/ services/CPHmodels-2.0 PubMed database: www.pubmed.gov S. mansoni ESTs database: http://compbio.dfci.harvard.edu/tgi/cgi-bin/ tgi/gireport.pl?gudb=s_mansoni S. mansoni GeneDB (Wellcome Trust Sanger Institute): www.schistodb. org Scheme of eukaryote proteasome structure: www.benbest.com Sigma-Aldrich: http://www.sigmaaldrich.com SwissProt database: http://www.expasy.org/sprot/ UniProtKB/TrEMBL database: http://www.uniprot.org/

CHAPTER

5 Potential Contribution of Sero-Epidemiological Analysis for Monitoring Malaria Control and Elimination: Historical and Current Perspectives Chris Drakeley and Jackie Cook

Contents

5.1. Introduction 5.2. Humoural Immunity to Malaria from a Sero-Epidemiological Point of View 5.3. Measuring Anti-Malarial Antibodies 5.3.1. Complement fixation test (CFT) 5.3.2. Indirect haemagglutination assay (IHA) 5.3.3. Immunofluorescence antibody test (IFAT) 5.3.4. Enzyme-linked immunosorbent assay (ELISA) 5.3.5. Protein micro-array 5.3.6. Source of antigen for assays 5.3.7. General methodological considerations 5.4. Application of Serological Data 5.4.1. Using serological data to assess malaria endemicity and risk 5.4.2. Serological data to monitor malaria control and elimination 5.4.3. Serological data to assess malaria eradication/elimination 5.5. Summary and Future Directions Acknowledgements References

300 301 302 303 303 303 309 309 310 312 313 314 333 338 343 345 345

Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London, United Kingdom Advances in Parasitology, Volume 69 ISSN 0065-308X, DOI: 10.1016/S0065-308X(09)69005-9

#


299

300

Abstract

Chris Drakeley and Jackie Cook

Anti-malarial antibody responses represent an individual’s history of exposure to the disease and, as age sero-conversion rates, reflect cumulative malaria exposure in a population. As such these antibody responses are an alternate measure of malaria transmission intensity and have potential in evaluating changes in exposure. This approach was used in the 1970s to evaluate malaria control and eradication attempts in a variety of different ecological settings. These historical studies provided a wealth of information on how serological data might be used to interpret control measures. However they were limited by a lack of standardized antigens and reproducible high-throughput assays. Current techniques using recombinant antigens with a range of immunogenicities, highthroughput enzyme-linked immunosorbent assays (ELISA) and statistical analysis allow a more robust examination of how serological parameters can be used to evaluate factors affecting malaria transmission. Here we present a review of the historical data and use it to assess the serological contribution to monitoring malaria elimination.

5.1. INTRODUCTION Understanding the human humoral response to malarial antigens has been a major objective in malarial research since the start of the 20th Century. Initially, this centred on the identification of protective immune responses and the classic serum replacement experiments of Cohen and Macgregor (Cohen et al., 1961; McGregor, 1964). However, antibodies not only contribute to mediating protection from disease but also represent a marker of exposure to disease that can be measured. The potential utility of this facet of antibody responses was quickly realised, as the insensitivity of conventional blood smears for malaria diagnosis meant that cases of low parasitaemia could easily be missed by this method. Sero-diagnosis became an attractive alternative and early methods for detecting malarial antibodies included the complement fixation test (CFT) and precipitin tests (Harris and Reidel, 1948; Thomson, 1918; Tobie, 1964). The role that malaria played in causing fatalities during both the World Wars and the Korean and Vietnam wars, together with confidence in vector control afforded by dichloro-diphenyl-trichloroethane (DDT), sparked new interest in eliminating malaria. In addition, the thousands of infected soldiers provided a wealth of accessible samples, offering new insights into the development of antibodies to Plasmodium infections in non-immune individuals. In the 1960s it was recognised that antibody data could be used more broadly to assess local malaria transmission, and thus the potential effect of any measures used to control and ultimately eliminate malaria. This resulted in a large number of sero-epidemiological

Malaria Seroepidemiology: Historical and Current Perspectives

301

studies assessing the potential for elimination in the late 1960s and 1970s. However, it would appear that as the funding and will to eliminate the disease decreased, so did this application of serology. In 2009, with elimination of malaria now back on the agenda, it will be important to re-evaluate the lessons learnt from these previous studies and assess how sero-epidemiology might be best studied with current technology in this context. This article will present a discussion of the pertinent aspects of a selection of these historical studies and examine what insights they may offer for current proposed malaria elimination programmes.

5.2. HUMOURAL IMMUNITY TO MALARIA FROM A SERO-EPIDEMIOLOGICAL POINT OF VIEW There are several reviews of the development of immunity to malaria and it is not the intention of this article to expand on these (Doolan et al., 2009; Marsh and Kinyanjui, 2006; Schofield and Mueller, 2006; Wykes and Good, 2006). Generally, however, these address the development of functional immunity, that is, one that prevents infection and/or disease, and the key sero-epidemiological element is the presence of antibodies as markers of exposure rather than their function in terms of protection. The interest, therefore, is in the factors that govern the acquisition and loss of antibodies and the rates at which these occur. Fundamental to this are the sensitivity of the assay used to detect antibodies and the appropriateness of the antigenic target (e.g. correct species for parasite, correct antigenic type for single antigens). Regardless of the type of assay, there appears to be broad agreement that in most cases antibodies to parasite antigens are generated relatively quickly during an infection (within 2 weeks; Baird et al., 2003; Collins et al., 1964) with some variation depending on age (Baird et al., 2003). The main area of contention is how quickly antibodies are lost, though this seems to be largely a result of these interpretational differences between protection and exposurerelated immunity. These alternative interpretations are illustrated in Fig. 5.1A&B where the rapid decline in antibodies after infection is understood as a loss of protective immunity, whereas exposure is reflected in the longer slower loss of lower antibody levels. As markers of exposure, antibodies have been shown to persist for several years without re-infection in immigrants to Europe (Bouchaud et al., 2005; Bruce-Chwatt et al., 1972). Antibodies have also been shown to appear very rapidly in individuals re-exposed to malaria during epidemics (Migot et al., 1995), as well as in populations from which malaria had been recently eliminated (Kaneko et al., 2000). These data suggest that, in adults at least, a memory antibody response exists and can persist

302


A

B

FIGURE 5.1 Hypothetical anti-malarial antibody profiles following (A) first infection and (B) persistent or recurrent infections. Notes: Solid black lines represent detectable serum antibody levels, broken dashed lines splenic plasma cells and broken dotted lines bone marrow plasma cells. The straight gray line represents an arbitrary antibody assay detection limit.

for many years. However, there is evidence that antibody responses are not as fixed in children as they are in adults, particularly in areas of seasonal malaria (Achtman et al., 2005; Akpogheneta et al., 2008; Taylor et al., 1996). This needs to be considered in the context of epidemiological surveys. The potential mechanisms for the maintenance and memory of anti-malarial immunity are described by Struik and Riley (2004) and Achtman et al. (2005).

5.3. MEASURING ANTI-MALARIAL ANTIBODIES The ideal test for detecting malarial antibodies in epidemiological studies has specific and predictable requirements. Serological surveys for detecting and estimating malaria transmission are often, by necessity, very large. Therefore, the test used would ideally be capable of assaying many samples at once (high throughput) and be simple, rapid, easily interpretable and reproducible so that results in the field can be analyzed quickly. An additional advantage is low cost, to enable widespread standardized use of the assay in the areas where it is needed. Over the


303

years, tests have evolved, meeting some or most of these criteria. These tests make use of different consequences of the antigen–antibody interaction and are described below and in Table 5.1.

5.3.1. Complement fixation test (CFT) One of the earliest tests shown to successfully detect malarial antibodies was the CFT (Thomson, 1918). The test developed as a way of detecting malaria infection in individuals and was shown to be more sensitive than using blood slides at detecting current infections (Thomson, 1918). The test is based on competition for complement between the antigen– antibody complex of interest and an indicator system of antigen–antibody complexes (typically sheep red blood cells and corresponding rabbit antibodies) and complement. Complement is used up in the presence of antigen–antibody complexes, and if there is a slight deficiency in complement, the lysis of the red blood cells in the indicator system is reduced. The reduction can be measured photospectronically and will be greater when the quantities of anti-malarial antibody in the serum are greater. This method was widely used primarily as an alternative for the diagnosis of malaria, but fell away with the evolution of the haem-agglutination test, which required much smaller amounts of antigen and was shown to be more sensitive (Wilson et al., 1975).

5.3.2. Indirect haemagglutination assay (IHA) The IHA became a common method of detecting malarial antibodies in the 1960s. It relies on cross-linking between antibodies when they bind antigen, which eventually results in clumping of blood cells. The resulting haemagglutination is measured by eye. Sera are tested by serial dilution with the highest dilution exhibiting agglutination recorded as the titre of antibody present in the serum. This simple method has the advantage of being adaptable to micro-titre plates meaning that multiple samples can be tested simultaneously. However, the result remains subjective with standardization difficult and reported reproducibility issues with the technique (Bray and el-Nahal, 1966; Lobel et al., 1973) and, therefore, cross comparison of data from different research groups is limited.

5.3.3. Immunofluorescence antibody test (IFAT) The IFAT gradually became the technique of choice from the 1960s onwards. The technique involves incubating the sera of interest on a glass slide on which the antigen of interest, typically whole parasitised red blood cells, has been fixed. A secondary antibody coupled with a fluorescent compound is then used to detect any bound antibodies from

TABLE 5.1

Advantages and disadvantages of methods used to detect anti-malarial antibodies

Method

Overview

Caveats

Use in malarial studies

References

CFT

Based on the addition of pre-

Serial dilution of serum

Studies show

1–7

determined amounts of SRBC, rabbit antibodies to SRBC and complement (generally guineapig serum) that will ensure near total lysis of the SRBC. Complement attaches (fixation) to malaria antibody–antigen complexes, resulting in lysis of SRBC. The degree of lysis can be determined spectrophotometrically by measuring the intensity of the red haemoglobin released. If the amount of antigen is constant, fixation of complement can be plotted as a function of antibody concentration.

is necessary as excess antibody or antigen affect complement. Some antigens bind complement without the addition of antibody. Some sera are anticomplementary without the presence of antigen. Labour-intensive. Large amount of antigen is required.

complement fixing antibodies for malarial antigens are only detected shortly after the appearance of parasites (not useful for early diagnosis). Was shown to be less sensitive than IHA and IFAT.7 High level of false positives.

IHA

When antibody binds with an

insoluble antigen, cross-linking occurs—this will eventually result in clumping (agglutination) of the antigen particles by antibodies. If the antigen is soluble, it can be attached to an insoluble particle (often SRBC are used). The titre can be determined by a serial dilution of the serum and determining the highest dilution in which agglutination still occurs. IPPT

Agglutination may not

occur at high concentrations of antibody, meaning serial dilution is necessary. More effective with IgM. Wide variation in techniques used. Difficulty in determining what is positive. Heterophile antibodies.

Good for large-scale

7–12

fieldwork. Often used with nonhuman Plasmodium species. Requires small amounts of antigen. Studies suggest it is less sensitive than IFAT.

When an agglutination reaction

For use with soluble

Originally used for

forms a certain size, the complex becomes insoluble. The subsequent precipitate can be weighed in order to estimate the amount of antibody present (if the amount of antigen is constant).

antigen. Serial dilutions are necessary. Variation of results obtained in different laboratories.

diagnostic purposes. Studies have shown that other tests are more sensitive.

13–15

(continued)

TABLE 5.1

(continued)

Method

Overview

Caveats

Use in malarial studies

References

IFAT

Indirect method involves using

Immunofluorescence is

Studies show

7, 16–20

a single fluorescent anti-Ig antibody which will bind to antibodies of many different specificities.

assessed by eye, therefore subjective. It is vulnerable to user error and bias, as well as differences between users, microscopes and laboratories. Time consuming. Requires skilled microscopists.

antibodies for malarial antigens are only detected shortly after the appearance of parasites (not useful for early diagnosis). Used in many seroepidemiological studies to investigate endemicity of malaria.

Currently used to

High throughput,

ELISA

Involves the use of plastics to

adsorb layers of proteins on their surface. The amount of antigen bound to corresponding antibodies may be detected by the use of anti-Ig labelled with an enzyme, which then change colour with the addition of an appropriate substrate.

detect antibodies to single antigens and can be affected by antigenic polymorphism or nonresponsiveness.

easily standardized. Regularly used to investigate humoural responses to malarial antigens. Several studies have reported its use in seroepidemiological studies looking at endemicity of malaria.

21–26

Protein microarray

A miniaturized assay system

that allows the detection of antibodies to many antigens simultaneously.

Currently an expensive

method.

Serological profiles

27

have been analyzed in order to detect correlates of protection.

Notes: CFT, complement fixation test; ELISA, enzyme-linked immuno-sorbent assay; IFAT, immunofluorescent antibody test; Ig, immunoglobulin; IHA, indirect haemagglutination assay; IPPT, immuno-precipitation; SRBC, sheep red blood cells; Heterophile antibodies–antibodies induced by external antigens that react with self antigens. References: 1, Thomson, 1918; 2, Eaton and Coggeshall, 1939; 3, Lippincott et al., 1945; 4, Harris and Reidel, 1948; 5, Schindler and Voller, 1967; 6, Voller, 1967; 7, Wilson et al., 1975; 8, Desowitz and Saave, 1965; 9, Kagan et al., 1969b; 10, Lobel et al., 1973; 11, Meuwissen, 1974; 12, Meuwissen et al., 1974; 13, Tobie, 1964; 14, Sadun, 1972; 15, Nardin et al., 1979; 16, McGregor et al., 1965; 17, Voller and O’Neill, 1971; 18, Ambroise-Thomas, 1976; 19, Manawadu and Voller, 1978; 20, Benzerroug et al., 1986; 21, Voller et al., 1980; 22, Esposito et al., 1990; 23, Sato et al., 1990; 24, Roy et al., 1994; 25, Voller et al., 1994; 26, Amerasinghe et al., 2005; 27, Bacarese-Hamilton et al., 2004.

308


the serum. The fluorescence is examined using a specialized microscope. One of the key advantages of this method is the relative ease of making IFAT slides, as whole parasites are easier to access and prepare than were the extracts of soluble antigens required for the previous techniques. Additionally, the antigenic properties of whole parasites are less variable between batches than those of soluble parasite antigens (AmbroiseThomas, 1976). Initially, simian malarias were widely used as antigen for the assay with Plasmodium fieldi being popular (Voller and Draper, 1982) despite its limited sensitivity for detecting human infections (Draper et al., 1972a). P. vivax and P. falciparum were originally isolated from infected individuals, though the latter was quickly replaced as P. falciparum culture became available as a stable source of antigen. IFAT remained in favour for many years and is still widely used in certain areas (Domarle et al., 2006; Silvie et al., 2002; Zheng et al., 2008). The method’s main advantage being its higher sensitivity and ability to detect antibodies at a lower concentration than IHA (Draper et al., 1972b). In one study, the same samples were tested with IHA and IFAT for immunoglobulin (Ig)G and IgM with the positivity of IHA falling between the IFAT antibody classes. The discrepancies between the two methods appear to be influenced by patent parasitaemia, with IHA detecting fewer positives than IFAT (80.2% with IHA vs. 94.5% with IFAT) in parasite-positive individuals, compared to 64.6% with IHA and 79.4% with IFAT in parasite-negative individuals (Meuwissen et al., 1974). This could be due to either the higher sensitivity of the IFAT (the malaria antibodies are sufficient for detection in IFAT but insufficient to form stable antibody bridges between adjacent sensitized cells in IHA), or the higher non-specific nature of the IFAT. It has been suggested that the difference between these two techniques is that they bind different classes and sub-classes of antibody (Meuwissen, 1974). This is supported by studies finding that IFAT detects antibodies earlier in the primary infection (Bidwell et al., 1973; Wilson et al., 1971), however, there are discrepancies as to whether IHA detects them for a shorter time (Bidwell et al., 1973) or for longer time (Wilson et al., 1971). It has also been suggested that antibodies detected in IFAT are more likely to recognise antigens on the exterior of the parasite (although some internal antigens may be exposed as the parasite is fixed to the microscope slide) while antibodies detected by IHA may be more likely to recognise internal antigens (Wilson et al., 1971). IFAT has also been shown to detect higher titres of antibodies than CFT especially at peak infection (Schindler and Voller, 1967). Again this is presumed to be due to the broader range of antigenic targets available in the IFAT. However, there are various drawbacks to using IFAT. Similarly to the IHA, the test is based on visual examination, thus it is subjective and difficult to standardize. Additionally it is a time-consuming process


309

meaning that large numbers of samples will take considerable lengths of time to analyze. Also, there is a wide variety of protocols and reagents in use making inter-study comparison difficult. Despite the availability of cultured antigen, reproducibility studies found results differed between lots of antigen and with different storage conditions (Manawadu and Voller, 1978).

5.3.4. Enzyme-linked immunosorbent assay (ELISA) The ELISA is now widely used for antibody detection to a variety of antigens in laboratories worldwide. The process is similar to the IFAT except that rather than using microscope slides, antigens (most often a single recombinant protein) are coated on to high-binding micro-titre plates. The serum of interest is incubated in the plate following blocking of non-specific sites. Bound antibodies are then detected with a secondary antibody that is linked with an enzyme. The final step involves the addition of an enzymatic substrate that is then converted if there is bound enzyme present in the well, resulting in colour change or fluorescence measurable by a spectrophotometer. This process leads to a highthroughput, standardisable assay that is relatively cheap and easy to perform, and that generates objective results. One of the first ELISAs used for detecting malarial antibodies was performed by Voller et al. in 1975 using antigen obtained from P. knowlesi. The ELISA was able to detect antibody in both P. falciparum and P. vivax parasite-positive individuals. The commercial availability of ELISA components and recombinant proteins enables findings to be compared from different laboratories with robust results (Esposito et al., 1990). Some protocols involve reading the results by eye (Sato et al., 1990) which, while being ideal for resourcepoorer settings, does mean the results are more subjective, although for use in diagnostic studies, where a simple positive or negative answer is required, they could play a role (Voller et al., 1974). Two commercially available ELISA kits are available to detect antibodies to plasmodium species though these have not been used to in an epidemiological context (She et al., 2007; Elghouzzi et al., 2008).

5.3.5. Protein micro-array Protein micro-arrays are the most recent addition to the antibody detection methodology. The technique is similar to the ELISA but recombinant proteins are bound to a microscope slide in nanogram quantities. Arrays can potentially screen 100s of antigens simultaneously and have a greater dynamic range of antibody level detection than ELISA. Limited data are available on their use for sero-epidemiology (Doolan et al., 2008; Gray et al., 2007) and the current cost prohibits widespread use.

310


5.3.6. Source of antigen for assays A major limitation for early serological methods was the difficulty in obtaining the often large amounts of suitable parasite antigen. In 1927, antigen was obtained by mincing infected ‘fresh placenta. . .in a meat chopper’, a method that could yield high numbers of parasites but was also limited by the rarity of obtaining infected placentas with localized parasitization (Young and Taliaferro, 1928). The difficulty of acquiring large quantities of infected blood in which to isolate antigen meant that in the 1940s, animal models became more commonly used, a method which rested on the assumption of cross-reactivity between species. Both P. knowlesi (Dulaney and Morrison, 1944; Eaton and Coggeshall, 1939; Giacometti and Suter-Kopp, 1973) and P. gallinaceum (Giacometti and Suter-Kopp, 1973; Lippincott et al., 1945) were used for antigen regularly. However, variation between different lots of P. gallinaceum antigens, and to some extent P. knowlesi antigens (Harris and Reidel, 1948), were quite common. The cross-reactivity between simian malarias and human malarias meant there was access to large amounts of antigen. Collins et al. (1966) concluded that patients infected with any combination of past Plasmodium infections could be detected with P. fieldi antigens and that P. brasilianum was useful in determining recent exposure to P. malariae. However, despite the perceived practical advantage of cross-reactivity between species, it also highlights the non-specificity of the reaction between species when using whole parasites. A major drawback of this non-specificity is the inability to distinguish between responses to the different human malarias. Cross-reactivity between P. vivax and P. falciparum antigens, which often overlap in geographical distribution, was shown to be broad but not complete as homologous antigen often showed a stronger response by IFAT (Diggs and Sadun, 1965) and it appeared that P. vivax was the more cross-reactive of the two. Different species cause different patterns of morbidity and respond to different treatments. It is, therefore, important to investigate transmission of each species separately. Several surveys in the 1960s investigated the dynamics between serological responses to P. vivax and P. falciparum parasites. One study found that it was very rare that the antibody response was highest to P. vivax even when an individual was infected with this species. It is possible that in the presence of mixed infections, P. falciparum induces higher responses than P. vivax (Collins et al., 1968). Additionally, a serological study in Sri Lanka noted that serological responses to P. falciparum and P. vivax differed over the year, with P. falciparum responses being high in the wet season but P. vivax responses becoming more prevalent in the dry season (Mathews and Dondero, 1982).


311

The advent of recombinant protein technology allows the identification of antibodies to specific parasite antigens. These have most commonly been used to identify protective immune responses and identify potential vaccine candidates. The caveat for sero-epidemiological studies is that single antigens reduce the broader sensitivity of the assay and antibody responses may be affected by antigenic polymorphism and differential responsiveness (Good et al., 1993; Taylor et al., 1996). An obvious step is to return to using a combination of antigens from different species in order to detect transmission in areas of very low transmission or areas where elimination needs to be confirmed. As some individuals appear to not make antibodies even to the most immunogenic antigens (e.g. apical membrane antigen (AMA), glutamate-rich protein (GLURP)) and yet do to merozoite surface protein (MSP)-119 and less immunogenic antigens (Taylor et al., 1995), a combination antigen approach would be sensitive at detecting any residual transmission. This method would be more specific than the old method of using cross-reacting simian Plasmodium or whole parasites. Further modifications could be achieved by including antigens from both the sporozoite and blood stages. In the 1960s, IFAT was used to track the development of the immune response to both P. vivax sporozoite and blood-stage parasites (Tobie et al., 1966). Antibodies were reported as appearing closely after parasites were detected by blood slide, rising abruptly to a peak, remaining at high levels for about 1 month (including the period after elimination of the parasite), and gradually declining but persisting at low levels for an extended period of time. These data suggested that IFAT was not detecting antibodies to sporozoites but to blood-stage infection. Recently, results using recombinant proteins have indicated that half lives of antibodies for sporozoite antigens such as circumsporozoite protein (CSP), differ to that from blood-stage antigens ( John et al., 2003; Modiano et al., 1996). This is probably a function of the amount of antigen and the length of time it encounters the immune system, both of which are considerably less for non-replicating sporozoites than for merozoites. Previous work indicates that antibody responses to CSP are short lived and reflect exposure rates (Webster et al., 1992) although antibodies to whole sporozoites may persist for longer (Druilhe et al., 1986). More recent studies have utilized recombinant proteins to assess endemicity and to evaluate transmission dynamics, for example P. falciparum CSP (Druilhe et al., 1986; Ramasamy et al., 1994; Webster et al., 1992), AMA-1 (Drakeley et al., 2005) and MSP antigens (Drakeley et al., 2005; Ladeia-Andrade et al., 2007) and P. vivax CSP (Lee et al., 2003; Lim et al., 2005), AMA-1 (Wickramarachchi et al., 2006) and Duffy binding protein (Ceravolo et al., 2005).

312


5.3.7. General methodological considerations Standardization is clearly a key element in the comparison and interpretation of results from sero-epidemiological studies. As described above, one of the principal sources of variability between laboratories and experiments was caused by the use of different antigens (Tobie, 1964). The source of antigen ranges from infected monkeys and humans, to parasite culture for P. falciparum and most recently recombinant antigens. However, this is merely the first point of potential variation. Van der Kaay in summarizing seven studies that used IHA noted six different sources of antigen, two different methods for the collection of blood, three methods for the removal of non-infected cells, three for isolation of parasitized cells and so on to generate a bewildering array of possibilities (Van der Kaay, 1976). This of course was during the early developmental approach when assays were being optimized, yet similar inter-laboratory variability has been described with IFAT (Manawadu and Voller, 1978). Recombinant antigen technology has gone some way to reduce this variability, though laboratories favour different expression systems and even with repeat peptide antigens different forms are used. A good example of this is the widely researched CSP of P. falciparum: the NANP tetramer of this protein has been used at between five and 50 repeats in ELISA (Gruner et al., 2007; Noland et al., 2008). Ultimately antigen choice is defined by study objectives, but for epidemiological studies, the lack of standard antigens hampers interpretation. The variation in type and concentration of antigen can be further compounded by the dilution at which sera are tested against them. This was perhaps less of an issue with IHA and IFAT but does vary with ELISA. Direct comparison of two studies investigating malaria and altitude in East Africa is problematic as sera were tested at 10-fold different dilutions (Drakeley et al., 2005; Noland et al., 2008). The subsequent developmental steps of assay procedure tend to rely on commercially available products and as such are more controlled. The one potential source of variation is the antibody sub-class that is to be detected. Different antibody sub-classes are produced to different antigens and this also varies with age, malaria transmission intensity and time during a patent infection (Aribot et al., 1996; Tongren et al., 2006; Wickramarachchi et al., 2006). Similarly important variability in the analysis and presentation of data has been reported. The two principle readouts from assays are the binary sero-prevalence (i.e. presence or absence of antibody) and the magnitude of antibody response in sero-positives. Sero-prevalence alone can be a simple descriptor of endemicity along with both slide positivity rate (SPR) and entomological inoculation rate (EIR) (Druilhe et al., 1986). When combined with age, the age-specific sero-prevalence can be calculated to provide a force of infection (Drakeley et al., 2005) and changes in this sero-


313

prevalence profile can be used to infer changes in malaria transmission (Bruce-Chwatt et al., 1973). One question is how a sero-positive is defined. The standard approach for nearly all the methods described above has been to assay sera from a group (variable in number) of individuals not exposed to malaria. The cut off is defined as above the most discriminatory titre (Lobel et al., 1973; Van der Kaay, 1976) or, for ELISA, the mean optical density (OD) plus 3 standard deviations. More mathematical approaches to this have been suggested (Irion et al., 2002) and alternatives, such as the use of mixture models widely used for other serological assays (Baughman et al., 2006; Hardelid et al., 2008; Rota et al., 2008) may be more appropriate especially at low transmission settings (Cook et al. personal communication). As individuals can remain sero-positive for many years, the magnitude of antibody response can reflect fluctuations in recent exposure in the sero-positive group. Antibody responses tend to be higher in currently infected individuals with antibody levels declining once parasites are cleared or reduced. Antibody titres are more likely to be of discriminatory use in areas where malaria transmission, and thus seroprevalence, is very high and/or where a highly sensitive assay has been used. The frequency distribution of antibody titres has been used to describe malaria endemicity (Kagan et al., 1969a; Lobel et al., 1973; Van der Kaay, 1976). An important consideration for interpretation of these data is the age composition of the samples: surveys must ideally be age cross-sectional surveys, as a survey just involving adults would skew the results as they are more likely to be positive with higher antibody titres.

5.4. APPLICATION OF SEROLOGICAL DATA The initial use for serological assays was as diagnostic tools, however, several studies observed that malarial antibodies did not appear until several days after patent parasitaemia making their diagnostic capabilities limited (Warren et al., 1976). It quickly became obvious that a primary use of the data could be to determine levels of malaria endemicity. Subsequently, serological methods have been used to screen blood donors to assess prior malaria infection (Elghouzzi et al., 2008). Additionally, a study has looked at the development of antibodies in non-immune soldiers travelling to highly endemic areas to define risk of infection. Approximately 35% sero-positivity to various pre-erythrocytic antigens was detected in French soldiers who were deployed to either Gabon or Coˆte d’Ivoire for 5 months. The study was also able to detect the protective effect of using anti-mosquito measures (Orlandi-Pradines et al., 2006). In an epidemiological context, serological data have been used to assess transmission intensity, to identify areas of focal transmission, to

314


monitor control interventions and to confirm eradication. This section will focus on several key studies that used sero-epidemiological data to assess one or more of these criteria (Table 5.2).

5.4.1. Using serological data to assess malaria endemicity and risk Different levels of transmission are reflected in the resultant age–seroprevalence curves. In an area of low transmission, development of antibody will be slow and may only be exhibited in adults. Conversely, in areas of heavy transmission, much of the population will be sero-positive, and only young children, who are less likely to have been exposed, will remain sero-negative. Serological measures are a useful additional measure of transmission intensity and in areas of low transmission, where parasite prevalence and EIR can be insensitive, they offer a way of accurately assessing endemicity and identifying focal areas of transmission.

5.4.1.1. Tanzania, 1967 A series of sero-epidemiological studies took place in Tanzania at the end of the 1960s evaluating the use of serology for monitoring malaria transmission in areas of different endemicity (Lelijveld, 1972). Surveys were conducted before and after the transmission season in areas classified as holo-endemic, meso-endemic and non-endemic, and antibody responses were measured using IFAT with P. fieldi as the antigen. Differences were observed between the mean titres in these seasonal surveys, though antibody prevalence generally remained similar over the year (Fig. 5.2A). Antibody prevalences were high in all endemic areas so the mean titre index (MTI) was deemed more sensitive for establishing differences between transmission areas and changes in exposure over time. Fig. 5.2B, D and F show that MTI plots correlate well with the different endemicities. The non-endemic area in Kilimanjaro still had prevalences of up to 40%, although these prevalences were constricted to older individuals and may have been linked to movement of this age group through more endemic areas. Interestingly parasite-positive individuals did not have higher antibody responses, which is probably linked to the upper limit of sensitivity of the IFAT and the fact that in high transmission areas there is a significant degree of sub-microscopic parasite carriage (Marques et al., 2005). The authors concluded that serological data added important information in defining endemicity that other parameters collected (i.e. parasite data and spleen data) did not provide.

5.4.1.2. Other Studies Several other studies used serology to define malaria endemicity. Prior to the landmark Garki project (see below), surveys were conducted in Kabba Province, an area of high altitude with low rainfall, and Benue Province, a

TABLE 5.2

Assorted sero-epidemiological studies and their principal findings

Continent

Country

South America

Argentina, Brazil, Columbia

Year of survey

Test and antigen

1969

IHA P. knowlesi

Purpose of study

Population studied

Principal findings

Reference

Sero-epidemiology study in army recruits from South America.

10,956 recruits aged 18 years and above.

Sero-prevalence showed

1

broad range 0–50% and was highest in Columbia as expected. Sero-prevalence correlated with altitude and geographical distribution of important vectors. Sero-prevalence in this age group did not correlate with measured P. falciparum for site of recruitment but did for site of birth or area of longest residence. Lack of correlation due to changes in transmission and that areas close to elimination were previously malarious.

(continued)

TABLE 5.2

Continent

(continued)

Country

Year of survey

Test and antigen

Tobago

1970

IHA P. knowlesi

IFAT

El Salvador

Costa Rica

1971

1972

IFAT

Purpose of study

Population studied

Principal findings

Reference

Sero1,000 individuals epidemiological of all ages. evaluation posteradication following a malaria outbreak.

Marked drop in

2

Longitudinal study in an area of low incidence.

1,200 individuals of all ages.

Sero-prevalence 5.5%

Study in an area with no active transmission.

900 samples of all ages.

Majority of sero-positive

population seroprevalence since eradication (1955–1969) from 79% to 10% in a limited set of paired sample. Lower than expected sero-prevalence in individuals with documented malaria. 3

overall though heterogeneous over small distances. Cross-sectionally collected serology data do not have the range of PCD which collects peripheral cases. samples restricted to older ages.

4

Suggest that only titres above a certain level reflect recent transmission. Also suggest comparison of titres by age may indicate necessity for action. Panama and 1972 El Salvador

IFAT

Surinam

IHA

1972

Post-epidemic serological analysis.

260 individuals.

Serological assessment of elimination programme.

2,000 individuals of all ages from five sites.

Rapid loss of antibody

5

post-epidemic perhaps due to prompt treatment and/or low levels of preexisting immunity. Difference in age groups in the rate of antibody loss.

Serology accurately

6

reflected the current epidemiological situation. Use for serology to define areas which have eliminated malaria.

(continued)

TABLE 5.2

Continent

(continued)

Country

Year of survey

Test and antigen

Purpose of study

Population studied

Principal findings

Reference

Details analysis of titres to monitor change in transmission and success of interventions. Brazil

Asia

1975

The 1963 Philippines

IFAT

IHA P. knowlesi

Sero-prevalence study of malaria endemicity in Brazil.

Around 4,000 individuals of all ages.

Evaluate 2,987 individuals seroepidemiology of all ages. as a tool for assessing malaria transmission.

Range of sero-positivity

7

noted between and within study regions reflecting climate and geography. Noted age-related increase in seroprevalence for both P. falciparum and P. vivax. Sero-prevalence used to target IRS strategies.

Mean titre increases with age in all areas. Seven of the 20 areas surveyed had no antibodies in children under the age of 7 years, suggesting no recent transmission.

2

Three of the areas showed considerably higher sero-prevalence in all age groups and were considered to have been subject to recent, local transmission. The 1991– Philippines 1992

IFAT P. falciparum P. vivax

To identify focal areas of transmission.

Malaysia

IFAT P. falciparum P. vivax P. malariae

To investigate the 1,915 individuals effect different of all ages, three ecologies have on different areas. antibody response.

1966

165 individuals of all ages 192 individuals of all ages.

Focal sero-prevalence in

8

relation to the forest. Differences in seroprevalence in dry and wet season. An increase in P. vivax parasite positivity in the dry season.

Sero-prevalence

9, 10

demonstrated heterogeneity of transmission in villages. Populations receiving anti-malarial drugs had noticeably lower antibody titres.

(continued)

TABLE 5.2 (continued)

Continent

Country

Year of survey

Test and antigen

Purpose of study

Population studied

Principal findings

Reference

Adult males had consistently higher responses in one area of the study, possibly due to behavioural risk patterns. India

1977– 1985

IHA IFAT ELISA P. knowlesi P. falciparum

A multi-centric Many thousands in different study with the studies. objective to develop and field test IHA, IFAT and ELISA for seroepidemiological studies.

ELISA results using the homologous P. falciparum antigen were deemed to be more accurate than IHA tests using P. knowlesi. Both tests distinguished between areas of differential transmission. Geometric mean reciprocal titre correlated very well with sero-prevalence in areas around Delhi.

11

Sero-positivity and parasite positivity was lowest in an area where mass drug therapy was being carried out. Infected individuals showed higher seropositivity. India

Papua New Guinea

1994

1981– 1983

To develop a simple 77 children (0–5 ELISA serological test to years) and 70 RESA check the efficacy adults (>20 MSP-1 of malaria control years) Crude P. falciparum programmes. antigen

Responses to RESA and

ELISA P. falciparum

Over 85% of the

To investigate the epidemiology of malaria in a population surrounding Madang.

3,960 in each survey

12

MSP-1 in endemic versus non-endemic areas reflect transmission levels. Adults and children showed similar levels in the high endemic area. 13

population were seropositive. The only significant change in seroprevalence between seasons was seen in 5–9-year-old children. There was an increase in ‘high positives’ in the wet season, indicating increased transmission.

(continued)

TABLE 5.2

Continent

(continued)

Country Thailand

Thailand

Sri Lanka

Year of survey

Test and antigen

1985– 1987

ELISA IFAT CSP

1989

1993

Purpose of study

Population studied

Principal findings

Reference

To demonstrate that prevalence of CSP can reflect transmission levels in an area.

There was a distinct

14

IFAT ELISA RESA

To investigate the 421 individuals humoural of all ages. immune response to P. falciparum.

Males have higher sero-

Radioimmunoassay P. falciparum CSP P. vivax CSP

Assess the use of responses to sporozoite antigens as markers of transmission.

decrease in CSP seroprevalence in adults in the dry season. The percentage of responders increased with age but did not level off in adults. CSP response in the population mirrored transmission patterns indicated by parasite rates.

220 individuals of all ages.

15

prevalence than females between the ages of 11 and 45 years.

A larger drop in seroprevalence between wet and dry seasons was seen in children (57% to 17%) than in adults (58% to 35%).

16

There appeared to be no major differences between the transmission patterns of the two species. Sri Lanka

Korea

Aged over 15 years with confirmed P. vivax positivity.

1999– 2000

ELISA P. vivax MSP-119 P. vivax MSP-142

Assess the usefulness of MSP-119 versus MSP-142 in vaccine trials in Sri Lanka.

2001

ELISA P. vivax CSP

Assess the sero1,014 individuals, prevalence of reof all ages from emerging P. vivax. five different areas

Antibodies more

17

common to MSP-142. IgG1 most common subclass to both antigens. Negative trends were seen for IgM responses to both antigens and increasing exposure. Similar levels of antibody prevalence were found in endemic and non-endemic areas—this was hypothesized to be due to travel into endemic areas.

Sero-prevalence ranged

18

from 0.9% to 9.6% across the five areas. Men consistently had higher sero-prevalence with the highest difference seen in the area with the highest incidence (13.5% vs. 1.8%).

(continued)

TABLE 5.2

Continent

Africa

(continued)

Country

Year of survey

Test and antigen

Korea

2002

Nigeria

Nigeria

Purpose of study

Population studied

Principal findings

Reference

ELISA P. vivax CSP

To investigate seroprevalence in an area of reemerging transmission.

1,176 children aged 9–13 years) plus 257 adults.

Sero-prevalence

19

1965– 1967

IFAT P. cynomolgi bastianellii

Assess the endemicity of malaria in two ecologically different areas.

1,082 crosssectional.

Prevalence between the

1971– 1975

IFAT, IHA, IPT Assess the impact of 2000 in the P. falciaprum, control measures intervention P. malariae, on the group 1000 in P. brasiliansum development of control group antimalarial antibodies

distinguished between areas of different endemicities. Sero-prevalences in adults were similar to that of children. Area closest to the demilitiarised zone had the highest prevalence, reflecting previous studies. Uneven distribution of sero-prevalences across ages. 20

two areas were similar but titres were much higher in the lower land area.

All serological tests showed age specifc increases in antibody titre. Antibody prevalence was not affected by intervention but mean titre showed a reduction across all ages in the intervention group.

21

Following cessation of intervention activities antibody responses returned to levels comparable with the control group. Ethiopia

Tanzania

Tanzania

IFAT P. falciparum, P. malariae, P. ovale, P. vivax

Assess the seroprevalence to malarial antigens in the Ethiopian highlands.

1967– 1970

IFAT P.fieldi

Around 1,500 Assess the use of serological data in cross-sectional, determining repeated in endemicity and several surveys. evaluating eradication campaigns.

1970– 1979

IFAT, Assess the effect of P. falciaprum, the cessation of P. fieldi previously successful interventions on antimalarial antibody responses

1967


1800 (1970) 625 (1979) cross sectional surveys

Very few people living

22

at an altitude above 6,000 ft (1,829 m) were antibody positive to any antigens tested. Males more likely to be sero-positive.

Serological data

23

distinguished between areas of different transmission intensity. The sero-prevalences complemented spleen and parasite rates and showed less seasonality.

A sharp increase in titres

25

at the age of 14 in the 1970 study indicated people previously exposed to high levels of transmission had retained high antibody levels.

(continued)

TABLE 5.2

Continent

(continued)

Country

Year of survey

Test and antigen

Purpose of study

Population studied

Principal findings

Reference

In the subsequent survey in 1979 antibody responses had increased reflecting the return of parasite rates to preintervention levels. Tunisia

Mauritius

1970– 1972

IFAT P. cynomolgii

To use serological measures to assess eradication.

Around 8,000 cross-sectional over six surveys.

Sero-prevalence reduced

1972

IFAT P. falciparum

To use serological measures to confirm eradication.

5,814 crosssectional but focussing on young children.

There were no antibody

26

from 20% to 3.5% in the 2 years that the surveys took place. By fifth survey, no seropositives in children under the age of 15 years. Results suggest that transmission had stopped in all but one area surveyed. positives in children under 5 years of age in an area of previously high transmission. Very few positives were found in people under the age of 20 years, born since interventions had been in place.

27

A steep increase in seroprevalence in people over the age of 25 years was evident. Madagascar

Madagascar

1989– 1991

ELISA P. falciparum (NANP)40

Four surveys 3,967 Assess the usefulness of children (aged antibodies to CSP 6–13 years) in as markers of total, crossendemicity. sectional.

Sero-prevalence was

2004

IFAT P. falciparum

Evaluate exposure to malaria in the urban population of Antananarivo.

Sero-prevalence overall


28

heterogeneous across the villages. Differences were seen between the seasonality of sero-prevalence. Strong correlation between sero-prevalence and parasite prevalence. Antibodies to CSP would be useful in assessing endemicity where malaria exposure is high and present for more than 4 months of the year. 29

was low. Travel outside of the city was associated with positive IFAT.

Notes: CSP, circumsporozoite protein; ELISA, enzyme-linked immunosorbent assay; IFAT, immunofluorescence antibody test; Ig, immunoglobulin; IHA, indirect haemagglutination assay; IRS, indoor residual spraying; MSP, merozoite surface protein; PCD, passive case detection; RESA, ring-infected erythrocyte surface antigen. 1, References: Kagan et al., 1969b; 2, Mathews et al., 1970; 3, Warren et al., 1975b; 4, Warren et al., 1975a; 5, Warren et al., 1976; 6, Sulzer et al., 1975; 7, Jeffery et al., 1975; 8, Tongol-Rivera et al., 1993; 9, Mathews and Dondero, 1982; 10, Collins et al., 1968; 11, Sharma, 1989; 12, Roy et al., 1994; 13, Cattani et al., 1986; 14, Webster et al., 1992; 15, Kamol-Ratanakul et al., 1992; 16, Ramasamy et al., 1994; 17, Wickramarachchi et al., 2006; 18, Lee et al., 2003; 19, Lim et al., 2005; 20, Voller and Bruce-Chwatt, 1968; 21, Molineaux, 1980; 22, Collins et al., 1971; 23, Lelijveld, 1972; 24, Draper et al., 1972a; 25, Matola et al., 1981; 26, Ambroise-Thomas et al., 1976; 27, Bruce-Chwatt et al., 1973; 28, Romi et al., 1994; 29, Domarle et al., 2006.

328


B

A 1 0.8 0.6 0.4 0.2 0

5 4 3 2 1 0

0 10 20 30 40 50 60 70 80

C

0

10 20 30 40 50 60 70 80

0

10 20 30 40 50 60 70 80

0

10 20 30 40 50 60 70 80

D 1

5

0.8

4

0.6

3

0.4

2

0.2

1 0

0 0

10 20 30 40 50 60 70 80

E

F 1

5

0.8

4

0.6

3

0.4

2

0.2

1

0 0

10

20

30

40

50

60

70

80

0

FIGURE 5.2 Age–anti-malarial antibody prevalence (A, C and E) and titre curves (B, D and F) for areas of different malaria transmission intensity in Tanzania. Notes: Broken dotted lines represent data from peak transmission season and the solid black lines the low transmission season data. Plots A and B are from the high transmission village of Muheza, C and D from the meso-endemic Amani hills and E and F from the villages on the slopes of Kilimanjaro, a low transmission area. Plots A, C and E are proportion antibody positive by age and plots B, D and F are mean antibody titre by age (Lelijveld., 1972).

lowland area with high levels of rainfall, in Nigeria (Voller and BruceChwatt, 1968). A total of 1,082 people were surveyed and antibodies to P. cynomolgi bastianellii were detected by IFAT. Parasite prevalence was high in both areas, although parasite densities were noticeably higher in Benue Province, where spleen rates were also higher. The serological data


329

reflected these findings with children under 5 years of age in Benue Province having a similar mean titre as adults in Kabba Province. However, the authors concluded that these differences were due to the timing of the surveys, which took place at peak transmission in Benue Province and in the dry season in Kabba Province. A similar study in Ethiopia in 1967 contrasted two populations in the highlands (Collins et al., 1971). Antibodies to all four human malaria parasites were detected by IFAT in 1,141 people. They found 37% overall sero-prevalence in people living at altitudes less than 6,000 feet (1,829 m) but only 4% sero-prevalence in people living higher than 6,300 feet (1,920 m). Positive antibody responses at the higher altitudes appeared to be clustered in one area. The authors suggested that the reason for higher antibody prevalence in this area was due to the presence of a large market drawing people from more malarious areas, compounded by the large population of resident immigrants from endemic areas, and was not due to local transmission. In 1969 in South America, a large-scale evaluation of anti-malarial antibody responses was carried out by the group of Kagan et al. (1969b), early forerunners of the malaria sero-epidemiology approach. They used blood samples from enrolment of army recruits and tested these for antibodies using IHA with P. knowlesi antigen. At the country level, the overall sero-prevalence followed a predictable pattern with prevalences highest in Columbia (range 15–49%), then Brazil (range 10–40%), followed by Argentina (0–30%) and the United States (0–15%). Within the South American countries, regional recruitment site sero-prevalence values showed little correlation with malaria prevalence values collected from the public health authorities. The authors explain this in part as being due to the short-comings of sampling army recruits as sample numbers reflected demographic distribution rather than geographical distribution with a heavy sample from urban areas and less so from more remote areas such as the Amazon. However, they did observe a much stronger agreement between sero-prevalence and parasite rate when they used the individual’s place of birth or place of longest residence rather than their recruitment site. Acknowledging that sero-prevalence in this group reflects ‘lifelong exposure to malaria’ they note that discordance between sero-prevalence and parasite rate reflects fluctuations in transmission and exposure. While the majority of discordances reflect a reduction in transmission, they caution that there was evidence of transmission in areas thought close to elimination. Two other of large-scale surveys where sero-prevalence has been used to define transmission were conducted in India in the 1980s (Sharma, 1989) and more recently in West Africa (Gardella et al., 2008). One example of the Indian work is a survey of more than 17,000 people surveyed in and around Delhi. In this scenario, serology is a very real alternative to

330


conventional parasite surveys given the size of the population and the subtle variations in transmission season. Sero-positivity by IHA in the 56 villages ranged from 2% to 43% and information was used to focus control efforts better (Sharma, 1989). In the West African study, antibody levels to CSP were used to characterize transmission intensity and relate this to the levels of anti-malarial drug consumption (Gardella et al., 2008).

5.4.1.2. Detecting epidemics and focal areas of transmission Malaria transmission is notoriously heterogeneous and within single villages some households experience high levels of infection while others appear to be infection and exposure free. There are a variety of factors that influence this heterogeneity leading to foci of infection. Detecting these foci has long been recognised as vital in the struggle to eliminate malaria. Malaysia is characterized by huge heterogeneity of transmission owing to three regions of very different topography. Consequently, different interventions have been implemented, resulting in different levels of exposure across the country. Collins et al. in 1968, sampled villages at different altitudes and at different distances from the Pahang River in Malaysia (Collins et al., 1968). The villages also differed in their ecology, demographics and malaria prevention activities. Not surprisingly antibody prevalences varied widely, ranging from 3% in an area where a successful anti-malarial scheme had been in place to 42% in an area surrounding a health centre that may have influenced the high seroprevalence. However, in two areas there were no positive reactions in children under 5 years of age, indicating a lack of recent local transmission. A study in Peru used a range of plasmodial targets to identify a focus of non-falciparum malaria (Sulzer et al., 1975). Initial Reports were from a local priest indicated high levels of malaria infections. Microscopy subsequently revealed a high prevalence of P. malariae compared to P. vivax with an almost complete absence of P. falciparum. IFAT assays using P. falciparum, P. vivax and P. brasilianum were carried out on sera after the transmission season in 1972 and again 15 months later in 1973. Seroprevalence was high with only 11 negative samples. The authors had previously detailed these species-specific IFAT as highly sensitive using control sera, however, they observed reactivity of sera to all the plasmodial species by IFAT. They argued that the strongest reaction (i.e. with the highest titre) is likely to reflect the most recent infection and high titres can be interpreted as recent or indeed current infections with the different species. However, a true interpretation is difficult given the crossreactivity observed with the IFAT. Prior to this, IHA had been used to investigate an outbreak of malaria on the island of Tobago that occurred after a malaria-free period of more than 10 years (Mathews et al., 1970). Since the 1940s, combined larvicide and DDT spraying had led to the elimination with no malaria reported


331

between 1954 and 1966, when there was a small focal outbreak of malaria. In 1969, samples were obtained from residents in the community, some of whom had had a sample taken 12 years previously, and also from people who were sampled during the outbreak. The community prevalence was low with only 1.5% of individuals being sero-positive, which is noteworthy as the persistence of antibodies in individuals exposed before elimination would be expected. Similarly low prevalences were observed in a small group of individuals who were sampled 12 years apart with prevalences dropping from an initial 79% to 10% over this period. In individuals who were malaria cases at the time of the outbreak only five of 27 had any demonstrable antibodies. The explanation given for these latter results was the rapid response in terms of treatment at the individual level and surveillance, spraying and mass drug treatment at the village level. The conclusion being that elimination had reduced immunity to very low levels and that the almost immediate treatment had meant insufficient stimulus for antibodies to be regenerated. The community data support this and the authors postulate on the relatively short antibody half life they observed. While these data may have some credence given that endemicity is low, these finding are at odds with more recent data on antibody responses post-epidemic from Madagascar (Deloron and Chougnet, 1992) and on antibody longevity in general (Drakeley et al., 2005). The most likely explanation is that the IHA assay used P. knowlesi and when subsequently evaluated against the IFAT (Draper et al., 1972b) was insufficiently sensitive to detect low levels of antibody. Additionally, there may be issues with preservation of the blood spots that the authors specifically noted were sent by air mail for assay in the United States as there may have been loss of antibody during transportation (Corran et al., 2008). IFAT was used to investigate localized epidemics in Escobal, Panama and Jocomontique, El Salvador (Warren et al., 1976). The epidemic in Panama was attributed to emerging resistance of the vector An. albuminus to DDT and P. falciparum to chloroquine, and was brought under control by prompt effective treatment of cases. In El Salvador, the cause of the epidemic was inferred to be an imported index case with local spread ultimately stopped by the intense dry season limiting vector densities to abrogate further transmission. Comparison of samples from children known to be infected (and sero-positive) in the epidemics and 6 months later showed a complete loss of antibody over this short period. This suggests rapid clearance of the infection with prompt effective treatment in individuals with no pre-existing immunity. Thus, accurate interpretation of serological data not only requires knowledge of the current epidemiological situation but knowledge of treatment history too.

332


5.4.1.3. Spatial mapping of responses One of the most recent additional applications of serological data is in mapping transmission areas. While this has been done extensively for parasite rate data (Hay et al., 2009), the extra sensitivity serology offers is likely to be particularly informative about the focality of transmission in areas of low or markedly seasonal transmission. This approach was used in Korea to establish the likely cause of recent epidemics of P. vivax that had resulted in increasing numbers of cases during the preceding 4 years (Kho et al., 1999). P. vivax IFAT slides were prepared using parasites from the blood of a patient infected with P. vivax in the local area. Although overall titres were relatively low, they were highest close to the de-militarized zone. Coupled with mapping of reported cases, the authors concluded the source of the epidemics was likely to be mosquitoes flying from the de-militarized zone where malaria control is problematic. In the 1960s, Mathews et al. (1970) undertook a sero-epidemiological study to evaluate the use of IHA in assessing malaria transmission across The Philippines. They were able to determine several areas where transmission had not occurred recently, defined by a lack of antibodies in children under 7 years of age. They also were able to highlight three areas that appeared to be experiencing higher transmission than nearby clusters, indicated by both higher prevalence and titre of antibodies. A more specific malaria risk area was identified in a sero-prevalence study on Palawan Island in The Philippines. Here higher antibody levels were found with IFAT to both P. falciparum and P. vivax in individuals who lived closest to the forest (Tongol-Rivera et al., 1993). This is a common finding in Asia, due to malaria transmission by sylvan anopheline species (Dysoley et al., 2008). In contrast, more recently, whole P. falciparum-parasite ELISA has been used to show variation in exposure over very small distances in children in Kenya (Wilson et al., 2007). The assay in this case may not have been optimal but this study does highlight the potential for integrating modern geographical information systems (GIS) and serological techniques.

5.4.1.4. Behavioural differences Behaviour is potentially an important determinant of exposure to malaria. Where malaria risk is associated with forests, it is often adult males who travel to the forest for labour and who are more likely to be outside at times when infected vector mosquitoes are biting. Several studies reflect this unequal exposure between sexes in their antibody data. In the Malaysian study discussed earlier, males were shown to have both higher parasite prevalence and a higher magnitude of response to all antigens tested (Collins et al., 1968). A similar difference was seen in CSP responses detected by ELISA in Korea (Lee et al., 2003)


333

and in responses to P. falciparum ring-infected erythrocyte surface antigen (RESA) antibodies in Thailand (Kamol-Ratanakul et al., 1992), all suggesting behaviour-related increased risk in exposure.

5.4.2. Serological data to monitor malaria control and elimination From the previous section it is clear that both antibody prevalence and titre reflect cumulative exposure to the parasite and any change in malaria transmission might be reflected in these serological parameters. Individuals born after successful interruption of transmission will be seronegative (apart from declining maternal antibody in the first year of life), while their older counterparts will remain sero-positive for a time due to their previous exposure. This was elegantly shown in seroprevalence studies by Bruce-Chwatt and colleagues (1973; 1975) several years after malaria elimination campaigns in Mauritius and Greece. The effects of malaria control have also been shown in the shorter term by measuring changes in antibody titres (Cornille-Brogger et al., 1978).

5.4.2.1. The Garki Project, Nigeria, 1970 The Garki study conducted in Nigeria in the early 1970s remains a landmark assessment of the effect of malaria control on a variety of malariometric, entomological and serological indicators (Molineaux, 1980). The serological survey covered one control village cluster and the two clusters receiving the most intense control approach: indoor residual spraying (IRS) and mass drug administration. There were approximately 1,000 people in the control cluster and 2,000 in the intervention clusters with samples taken at regular intervals over a 5-year period including baseline, intervention and post-intervention periods. Sera were tested for total IgG and IgM and for parasite-specific responses to P. falciparum by precipitin, IHA and IFAT and to P. malariae by IFAT. These rich results are described by Cornille-Brogger et al. (1978). All serological tests showed age-specific increases in both antibody prevalence and titre, consistent with exposure-acquired immunity (Fig. 5.3). The prevalence of antibodies was 100% by the age of 5 years, much quicker than in another rural West African site in The Gambia (McGregor et al., 1965) indicating a much higher rate of exposure in the Garki area. Antibody prevalence was not affected by the intervention but mean titre by age appeared to be sensitive to changes in transmission; both the initial reduction caused by the intervention and the gradual return of transmission to baseline levels after the control programme was stopped. Fig. 5.3A shows the reduction in titres for P. falciparum IFAT over surveys 3, 4 and 5 (5, 12 and 16 months after intervention, respectively) and Fig. 5.3B the return to preintervention titres in surveys 5, 6, 7 and 8 (16, 21, 36 and 48 months after

334


A

IFAT-PF Geom mean titre

1620

3 4 5

180

20

Unprotected 3, 4, 5 Serological surveys after 20, 50, 70 weeks of protection 0

B

44+

Years IFAT-PF Geom mean titre

7

1620 8 5 6 180

20

Unprotected 5, 6, 7, 8 serologic survey protected population 1:80). These, they suggest, may represent chronic asymptomatic or imported cases with transmission potential and hightitre individuals might usefully be the target of presumptive treatment to prevent onward transmission.

5.4.3. Serological data to assess malaria eradication/elimination The inherent longevity of antibody responses makes them the optimal tool to chronicle exposure history in a population. It was reasoned by Bruce-Chwatt and others that individuals born after the start of successful elimination programmes should be antibody negative and this was tested in a variety of different elimination scenarios.

5.4.3.1. Mauritius, 1968 This classic study was the first to use serology to confirm malaria elimination and details a survey undertaken in 1968 in Mauritius (BruceChwatt et al., 1973). The island had suffered many devastating epidemics since the introduction of malaria to the area in the late 1800s. In 1949, an eradication scheme based on DDT spraying was established with a dramatic reduction in cases and parasite rates from 9.5% to 0.5% in just 2 years. However, transmission continued in focal areas, particularly in an area around the port, presumably due to the arrival of migrants from malarious areas. The last case of P. falciparum in the country was noted in 1968. In 1972 Bruce-Chwatt and colleagues took nearly 6,000 blood samples from people living in the Black River district in the south-west of the island, where malaria had been the most persistent. Antibodies were detected by IFAT using P. falciparum from Aotus monkeys. Younger children were over-sampled in an attempt to confirm elimination by the absence of antibodies in this age group. The age sero-prevalence curve is shown in Fig. 5.4A. The low proportion of sero-positive individuals under 20 years of age reflected that these people had been born since initiation of intensive malaria control (post-1949). Sero-positivity in individuals over 35 years of age was much higher as this age group would


339

A 1 0.8 0.6 0.4 0.2 0 0

10

20

30

40

50

60

70

B 1 0.8 0.6 0.4 0.2 0 0

10

20

30

40

50

60

70

80

FIGURE 5.4 Age sero-prevalence curves 5 years post-malaria elimination in Mauritius (A) and 15 years post-elimination in Greece (B). Note: Solid black lines represent the proportion of antibody positives by age assessed by P. falciparum immunofluorescent antibody test (IFAT) (Bruce-Chwatt et al., 1973, 1975).

have experienced high malaria transmission prior to 1949. In children under 5 years of age, there were 16 IFAT positive samples (from 1,081 tested) all showing very low titres of antibody. As none of the children showed a history of malaria, the authors concluded that this was a nonspecific reaction. By fitting simple linear regression curves to the seropositivity data the authors estimated older adults had been exposed to roughly five times higher transmission intensity than individuals under 20 years of age. In this study sero-epidemiology was able to gauge past transmission patterns from a single survey and at the same time confirm the virtual absence of recent transmission.

5.4.3.2. Greece, 1974 Another area where an elimination programme was assessed using serology was Greece (Bruce-Chwatt et al., 1975). The country experienced its most famous malaria epidemic during the First World War, when nearly 250,000 cases were reported in British and French armies on the Macedonian border. A successful spraying campaign began in 1946 (Livadas and

340


Belios, 1948) with the number of cases falling from 20,000 in 1949 to 5,000 in 1951 (Belios, 1955). Prior to the survey in 1974, only 174 indigenous malaria cases had been reported during the previous 10 years. The survey focussed on an area where the most recent cases had been found, the nomos (region) of Hemathia. Antibodies were detected by IFAT using P. falciparum from an infected chimpanzee and the positives were also screened and titrated against P. vivax and P. malariae. Again, children were over-sampled in the survey and no sero-positives were found in any of the 2,965 individuals under 20 years of age. The sero-prevalence curve (Fig. 5.4B) showed evidence of higher exposure in those aged over 40 years. While the authors state that there appears to have been very little or no transmission in recent years, they do say this is not absolute as only 35% of those aged less than 20 years in the area were sampled and antibodies resulting from recent infections may have already been lost.

5.4.3.3. Surinam, 1973–1974 An impressive attempt to use sero-epidemiology to study malaria elimination was the work of Van der Kaay (1976) in Surinam. Surinam was neatly divided into three ecological zones: coastal, savannah and jungle, which were in different stages of the malaria elimination process of maintenance, control and attack, respectively (Fig. 5.5). Historically, the coastal areas had always had lower transmission and the jungle interior was notorious for high spleen rates with malaria as a major source of mortality during the construction of a cross-jungle railway. The principal reason for this appears to have been the difference in transmission capacity of the vectors with An. darlingii inland and An. aquasalis on the coast. The issue was further compounded by the higher prevalence of P. falciparum in the interior linked to a higher numbers of workers of African origin. An elimination programme was started in 1957 based on combinations of IRS, larviciding and medicated salt. By the early 1970s, malaria was all but absent in the coastal belt, had very low prevalence in the savannah belt but remained a major problem in the jungle interior where drug resistance (to chloroquine given in the salt), incomplete IRS and lack of co-operation of villages led to large epidemics in 1972. Surveys were conducted in five areas in 1973 and 1974 to describe the epidemiology in the coastal and savannah areas and assess the effect of targeted control in the high transmission jungle area. IHA was used to measure antibody prevalence and titre (Fig. 5.6). It is clear from the serological profiles that there is no evidence of recent transmission in Totness and Friendship in the coastal area (Fig. 5.6A and B). Similarly, in Bigeston while seropositives were observed, these were very low titres indicative of no recent transmission and suggesting that recent epidemics had not affected this area. In both these cases, the serological data are an extremely useful adjunct to parasitological data for assigning a phase of elimination.


341

FIGURE 5.5 Map of Surinam highlighting the areas under different phases of elimination and the study villages. Note: M denotes the maintenance phase and the two villages Totness and Friendship. C denotes consolidation phase and the village of Bigaston. The attack phase is denoted by A, the survey villages in this area were Dang and Kambaloea, Stoelmans Island and Alalaparoe (van der Kaay, 1976).

The sero-prevalence profiles also neatly describe the higher transmission areas and show the potential of the serological approach to assess the effect of interventions. This was most apparent when examining the effect of control on the titre of antibody response rather than the prevalence (see Fig. 5.6F, H and 5.6J). An analysis of antibody titres in approximately 300 individuals sampled in both surveys (Alalaparoe, Fig. 5.6J) showed, not

342


A

B 1 0.8 0.6 0.4 0.2 0

10 8 6 4 2 0

0 10 20 30 40 50 60 70 80

C

0

10

20

30

40

0

10

20

30

40

50

60

70

80

D 1 0.8 0.6 0.4 0.2 0 0 10 20 30 40 50 60 70 80

E

10 8 6 4 2 0 50

60

70

80

F 1 0.8 0.6 0.4 0.2 0

10 8 6 4 2 0 0

0

10 20 30 40 50 60 70 80

G

10

20

30

40

50

60

70

80

H 1

10 8 6 4 2 0

0.8 0.6 0.4 0.2 0

0

10 20 30 40 50 60 70 80

I

0

10

20

0

10

20

30

40

50

60

70

80

J 10

1 0.8 0.6 0.4 0.2 0

8 6 4 2 0

10 20 30 40 50 60 70 80

0 30

40

50

60

70

80

FIGURE 5.6 Age–anti-malarial antibody prevalence (A, C, E, G and I) and titre curves (B, D, F, H and J) for areas in different phases of elimination in Surinam. Notes: Black line represents data from the surveys in 1972 and broken dotted line surveys in 1973. Peak transmission season and the solid black lines the low transmission season data. Plots A and B are from the villages of Totness and Friendship and plots C and D the village of Bigaston. The attack phase villages of Dang and Kambaloea (plots E and F), Stoelmans island (G and H) and Alalaparoe (I and J) had malaria control programmes in between the two surveys. Plots A, C, E, G and I are proportion antibody positive by age and plots B, D, F, H and J are mean antibody titre by age (van der Kaay, 1976).


343

surprisingly, that the greatest reductions in titres were seen in those with the highest initial titres, predominantly in adults and a combination of zero sero-prevalence in youngest age groups together with reductions in antibody titre in older age groups may be taken as a strong indication of effective transmission reduction.

5.4.3.4. Other studies Tunisia initiated an eradication programme in 1968 using a mixture of DDT IRS and rapid case detection and treatment (Ambroise-Thomas et al., 1976). Following these interventions slide positivity fell dramatically and by the time the sero-epidemiological surveys took place in 1970 only one person was found to be slide positive out of 2,171 individuals. Subsequent surveys took place every 6 months for the next 3 years, and no more parasites were found in nearly 11,000 blood films. Sero-prevalence to P. cynomolgi using IFAT fell from 20% in the first survey in 1970 to 3.5% in the final survey in 1972. Mean titres also fell, and in the final survey there was only one individual with titres above 1:160. By the fifth survey, sero-positivity in children under 15 years of age was non-existent and the authors confirmed the elimination scheme successful with the interruption of transmission in many areas of Tunisia. Additionally a study undertaken in Bangladesh, where an eradication campaign had been underway, was able to confirm no recent local exposure by demonstrating that no children under the age of 8 years were antibody positive by IHA (Lobel et al., 1973).

5.5. SUMMARY AND FUTURE DIRECTIONS There seems to be a general agreement from the studies described above that sero-epidemiology can provide vital information in addition to routinely collected malariometric indices. Indeed at low transmission levels, serology is perhaps the test of choice to assess exposure levels as parasite rates will be extremely low and numbers of infected mosquitoes lower still (Corran et al., 2007). In certain settings the additional sensitivity of an antibody-based assay over malaria blood films has identified, or confirmed, epidemiological phenomena relating to travel and behaviour. Additionally, exploiting antibody longevity to assess cumulative exposure over an individual’s life time, as Bruce-Chwatt and colleagues (1973; 1975) did, allows reconstruction of transmission history with a precision dependent on the number of samples collected and the age range of the study population. Given the re-newed scientific and financial focus on malaria elimination (Grabowsky, 2008; Roberts and Enserink, 2007) there is an absolute requirement to have the most appropriate and sensitive tools in place to both measure and monitor transmission (Greenwood,

344


2008; Hay et al., 2008). What then, are the requirements for a serological assay in this current elimination context? As has been discussed, the early assays were plagued by a lack of standardization in the source of antigen and a variety of other steps in the assay procedure. This had an effect on both sensitivity and specificity. The cross-genus reactivity rationale for using simian malarias in place of those species that infect humans seems to have been conveniently forgotten in many studies once human malarias were sourced and needed to be compared. It is unclear in some of these studies why, for example, antibody responses to P. fieldi can represent exposure to any malaria but an antibody response to P. vivax is assumed to be specific to that parasite. Even the widely used IFAT assay, which fixes parasites to a glass slide, will expose some internal potentially cross-reactive antigens. The reverse of this is a highly specific assay to a single antigen unique to a parasite species, as is commonplace with the ELISA. This is too specific for epidemiological studies where the requirement will be to detect any exposure (within reason). The ideal assay is a combination of the two: a multi-target species-specific assay. This could be achieved by assaying samples against a variety of targets simultaneously or by combining antigens in a single assay, for example, a combination of MSPs in one ELISA (She et al., 2007; Elghouzzi et al., 2008). This latter approach would almost certainly be a cheaper option. The varying sensitivity of CFT, IHA and IFAT makes inter-study comparison difficult but it does hint at the possibility of tailoring assays to add a further temporal element. This might be achieved by using antigens of differing immunogenic properties meaning antibody responses would be expected to be lost (or gained) differentially to each antigen as transmission decreases. Measurement of antigen-specific responses could then identify the rate at which transmission was decreasing. The analogy here is the assertion by some authors that antibody titres reflect more recent exposure (Warren et al., 1976). We have previously suggested that antigen choice is influenced by transmission intensity (Corran et al., 2007). This could be further extended to try and detail the various components of exposure by including antigens from the blood stage, sporozoite stage (Elghouzzi et al., 2008) and from mosquito saliva (Poinsignon et al., 2008a,b). The evidence for exposure related acquisition of antibodies is consistent across many of the studies with the rate of acquisition strongly linked to malaria transmission intensity. However, there are fewer data on the rate at which antibodies are lost, with current models assuming a standard rate across age groups (Drakeley et al., 2005). The observations from epidemic studies in central America where children known to have been parasitaemic were found never to have sero-converted or to have lost antibodies over a very short time period (Warren et al., 1975a, 1976)


345

suggests that rates of antibody loss may not be consistent. Identifying the factors that influence antibody loss is likely to require mathematical analysis of longitudinal antibody studies from a range of epidemiological settings. There is considerable potential for the integration of serological data with more recently available epidemiological tools such as mapping and the malaria indicator surveys (MIS). The definition of the recently published maps of global distribution of malaria (Hay et al., 2009) might be significantly enhanced by a serological component particularly in low transmission areas where parasite prevalences are low or undetectable. Furthermore, serological samples are most likely to be collected in the context of large malariometric surveys developed as part of an MIS or demographic and health-survey network. Aggregating serological data with known and potential risk factors such as net use and travel is likely to be highly beneficial. One final consideration is how serology might set a benchmark to define whether an area is malaria free. Several studies showed how serology might do this (Ambroise-Thomas et al., 1976; Bruce-Chwatt et al., 1973, 1975) but there was no consistent and standardized sampling frame other than ‘as many children as possible’. Even having sampled these younger age groups selectively, Bruce-Chwatt et al. (1973, 1975) were careful not to make absolute statements about malaria elimination. Current statistical sampling techniques such as lot quality assurance may prove crucial. With the likely advances described above, malaria seroepidemiology might finally come of age.

ACKNOWLEDGEMENTS We are very grateful for the support of our colleagues at the London School of Hygiene and Tropical Medicine: Eleanor Riley, Patrick Corran, Lucy Okell and Teun Bousema and those at Imperial College: Azra Ghani and Jamie Griffin. We would particularly like to thank Dr. Jan Peter Verhave at the University of Nijmegen for his help with identifying and providing copies of the two Dutch theses, which were very illuminating and our thanks are extended to the authors of those theses (Drs. Lelijveld and Van der Kaay). We are supported by a grant from the Wellcome Trust (078925).

REFERENCES Achtman, A.H., Bull, P.C., Stephens, R., Langhorne, J., 2005. Longevity of the immune response and memory to blood-stage malaria infection. Curr. Top. Microbiol. Immunol. 297, 71–102. Akpogheneta, O.J., Duah, N.O., Tetteh, K.K., Dunyo, S., Lanar, D.E., Pinder, M., et al., 2008. Duration of naturally acquired antibody responses to blood-stage Plasmodium falciparum is age dependent and antigen specific. Infect. Immun. 76, 1748–1755.

346


Ambroise-Thomas, P., 1976. Immunofluorescence in the diagnosis, therapeutic follow-up and sero-epidemiological studies of some parasitic diseases. Trans. R. Soc. Trop. Med. Hyg. 70, 107–112. Ambroise-Thomas, P., Wernsdorfer, W.H., Grab, B., Cullen, J., Bertagna, P., 1976. Etude seroepidemiologique longitudinale sur la paludisme en Tunisie. Bull. Organ. Mond. Sante 54, 355–367. Amerasinghe, P.H., Alifrangis, M., van der Hoek, W., Wirtz, R.A., Amerasinghe, F.P., Konradsen, F., 2005. Optimizing malarial epidemiological studies in areas of low transmission. Southeast Asian J. Trop. Med. Public Health 36, 1079–1084. Aribot, G., Rogier, C., Sarthou, J.L., Trape, J.F., Balde, A.T., Druilhe, P., et al., 1996. Pattern of immunoglobulin isotype response to Plasmodium falciparum blood-stage antigens in individuals living in a holoendemic area of Senegal (Dielmo, West Africa). Am. J. Trop. Med. Hyg. 54, 449–457. Bacarese-Hamilton, T., Mezzasoma, L., Ardizzoni, A., Bistoni, F., Crisanti, A., 2004. Serodiagnosis of infectious diseases with antigen microarrays. J. Appl. Microbiol. 96, 10–17. Baird, J.K., Barcus, M.J., Elyazar, I.R., Bangs, M.J., Maguire, J.D., Fryauff, D.J., et al., 2003. Onset of clinical immunity to Plasmodium falciparum among Javanese migrants to Indonesian Papua. Ann. Trop. Med. Parasitol. 97, 557–564. Baughman, A.L., Bisgard, K.M., Lynn, F., Meade, B.D., 2006. Mixture model analysis for establishing a diagnostic cut-off point for pertussis antibody levels. Stat. Med. 25, 2994–3010. Belios, G.D., 1955. Recent course and current pattern of malaria in relation with its control in Greece. Riv. Malariol. 34, 1–24. Benzerroug, E.H., Demedts, P., Wery, M., 1986. Detection of antibodies to Plasmodium vivax by indirect immunofluorescence: Influence of the geographic origin of antigens and serum samples. Am. J. Trop. Med. Hyg. 35, 255–258. Bhattarai, A., Ali, A.S., Kachur, S.P., Martensson, A., Abbas, A.K., Khatib, R., et al., 2007. Impact of artemisinin-based combination therapy and insecticide-treated nets on malaria burden in Zanzibar. PLoS Med. 4, e309. Bidwell, D., Voller, A., Meuwissen, J.H., Leeuwenberg, A.D., 1973. Comparison of indirect haemagglutination and immunofluorescence tests for malaria antibody in Aotus monkeys infected with Plasmodium falciparum. Application of indirect haemagglutination tests for malaria. Bull. World Health Organ. 49, 313–316. Bouchaud, O., Cot, M., Kony, S., Durand, R., Schiemann, R., Ralaimazava, P., et al., 2005. Do African immigrants living in France have long-term malarial immunity? Am. J. Trop. Med. Hyg. 72, 21–25. Bray, R.S., el-Nahal, H.M., 1966. Indirect haemagglutination test for malarial antibody. Nature 212, 83. Bruce-Chwatt, L.J., Dodge, J.S., Draper, C.C., Topley, E., Voller, A., 1972. Sero-epidemiological studies on population groups previously exposed to malaria. Lancet 1, 512–515. Bruce-Chwatt, L.J., Draper, C.C., Konfortion, P., 1973. Seroepidemiological evidence of eradication of malaria from Mauritius. Lancet 2, 547–551. Bruce-Chwatt, L.J., Draper, C.C., Avramidis, D., Kazandzoglou, O., 1975. Sero-epidemiological surveillance of disappearing malaria in Greece. J. Trop. Med. Hyg. 78, 194–200. Cattani, J.A., Tulloch, J.L., Vrbova, H., Jolley, D., Gibson, F.D., Moir, J.S., et al., 1986. The epidemiology of malaria in a population surrounding Madang, Papua New Guinea. Am. J. Trop. Med. Hyg. 35, 3–15. Ceravolo, I.P., Bruna-Romero, O., Braga, E.M., Fontes, C.J., Brito, C.F., Souza, J.M., et al., 2005. Anti-Plasmodium vivax duffy binding protein antibodies measure exposure to malaria in the Brazilian Amazon. Am. J. Trop. Med. Hyg. 72, 675–681. Cohen, S., McGregor, A.I., Carrington, S., 1961. Gamma-globulin and acquired immunity to human malaria. Nature 192, 733–737.


347

Collins, W.E., Jeffery, G.M., Skinner, J.C., 1964. Fluorescent antibody studies in human malaria. I. Development of antibodies to Plasmodium malariae. Am. J. Trop. Med. Hyg. 13, 1–5. Collins, W.E., Jeffery, G.M., Guinn, E., Skinner, J.C., 1966. Fluorescent antibody studies in human malaria. IV. Cross-reactions between human and simian malaria. Am. J. Trop. Med. Hyg. 15, 11–15. Collins, W.E., Warren, M., Skinner, J.C., 1971. Serological malaria survey in the Ethiopian highlands. Am. J. Trop. Med. Hyg. 20, 199–205. Collins, W.E., Warren, M., Skinner, J.C., Fredericks, H.J., 1968. Studies on the relationship between fluorescent antibody response and ecology of malaria in Malaysia. Bull. World Health Organ. 39, 451–463. Cornille-Brogger, R., Mathews, H.M., Storey, J., Ashkar, T.S., Brogger, S., Molineaux, L., 1978. Changing patterns in the humoral immune response to malaria before, during, and after the application of control measures: A longitudinal study in the West African savanna. Bull. World Health Organ. 56, 579–600. Corran, P., Coleman, P., Riley, E., Drakeley, C., 2007. Serology: A robust indicator of malaria transmission intensity? Trends Parasitol. 23, 575–582. Corran, P.H., Cook, J., Lynch, C., Leendertse, H., Manjurano, A., Griffin, J., et al., 2008. Dried blood spots as a source of anti-malarial antibodies for epidemiological studies. Malar. J. 7, 195. Deloron, P., Chougnet, C., 1992. Is immunity to malaria really short-lived? Parasitol Today. 8, 375–378. Desowitz, R.S., Saave, J.J., 1965. The application of the haemagglutination test to a study of the immunity to malaria in protected and unprotected population groups in Australian New Guinea. Bull. World Health Organ. 32, 149–159. Diggs, C.L., Sadun, E.H., 1965. Serological cross reactivity between Plasmodium vivax and Plasmodium falciparum as determined by a modified fluorescent antibody test. Exp. Parasitol. 16, 217–223. Domarle, O., Razakandrainibe, R., Rakotomalala, E., Jolivet, L., Randremanana, R.V., Rakotomanana, F., et al., 2006. Seroprevalence of malaria in inhabitants of the urban zone of Antananarivo, Madagascar. Malar. J. 5, 106. Doolan, D.L., Dobano, C., Baird, J.K., 2009. Acquired immunity to malaria. Clin. Microbiol. Rev. 22, 13–36. Doolan, D.L., Mu, Y., Unal, B., Sundaresh, S., Hirst, S., Valdez, C., et al., 2008. Profiling humoral immune responses to P. Falciparum infection with protein microarrays. Proteomics 8, 4680–4694. Drakeley, C.J., Corran, P.H., Coleman, P.G., Tongren, J.E., McDonald, S.L., Carneiro, I., et al., 2005. Estimating medium- and long-term trends in malaria transmission by using serological markers of malaria exposure. Proc. Natl. Acad. Sci. USA 102, 5108–5113. Draper, C.C., Smith, A., 1957. Malaria in the Pare area of N. E. Tanganyika. I. Epidemiology. Trans. R. Soc. Trop. Med. Hyg. 51, 137–151. Draper, C.C., Smith, A., 1960. Malaria in the Pare area of Tanganyika. Part II. Effects of three years’ spraying of huts with dieldrin. Trans. R. Soc. Trop. Med. Hyg. 54, 342–357. Draper, C.C., Lelijveld, J.L., Matola, Y.G., White, G.B., 1972a. Malaria in the Pare area of Tanzania. IV. Malaria in the human population 11 years after the suspension of residual insecticide spraying, with special reference to the serological findings. Trans. R. Soc. Trop. Med. Hyg. 66, 905–912. Draper, C.C., Voller, A., Carpenter, R.G., 1972b. The epidemiologic interpretation of serologic data in malaria. Am. J. Trop. Med. Hyg. 21, 696–703. Druilhe, P., Pradier, O., Marc, J.P., Miltgen, F., Mazier, D., Parent, G., 1986. Levels of antibodies to Plasmodium falciparum sporozoite surface antigens reflect malaria transmission rates and are persistent in the absence of reinfection. Infect. Immun. 53, 393–397.

348


Dulaney, A.D., Morrison, D.B., 1944. On preparation and properties of antigens from Plasmodium knowlesi. Am. J. Trop. Med. Hyg. 24, 323–326. Dysoley, L., Kaneko, A., Eto, H., Mita, T., Socheat, D., Borkman, A., et al., 2008. Changing patterns of forest malaria among the mobile adult male population in Chumkiri District, Cambodia. Acta Trop. 106, 207–212. Eaton, M., Coggeshall, L., 1939. Complement fixation in human malaria with an antigen prepared from the monkey parasite Plasmodium knowlesi. J. Exp. Med. 69, 379–398. Elghouzzi, M.H., Senegas, A., Steinmetz, T., Guntz, P., Barlet, V., Assal, A., et al., 2008. Multicentric evaluation of the DiaMed enzyme-linked immunosorbent assay malaria antibody test for screening of blood donors for malaria. Vox Sang 94, 33–40. Esposito, F., Fabrizi, P., Provvedi, A., Tarli, P., Habluetzel, A., Lombardi, S., 1990. Evaluation of an ELISA kit for epidemiological detection of antibodies to Plasmodium falciparum sporozoites in human sera and bloodspot eluates. Acta Trop. 47, 1–10. Gardella, F., Assi, S., Simon, F., Bogreau, H., Eggelte, T., Ba, F., et al., 2008. Antimalarial drug use in general populations of tropical Africa. Malar. J. 7, 124. Giacometti, P.L., Suter-Kopp, V., 1973. Detection of malarial antibodies in man by fluorescent antibody test using Plasmodium gallinaceum as antigen. Acta Trop. 30, 269–274. Good, M.F., Zevering, Y., Currier, J., Bilsborough, J., 1993. ‘Original antigenic sin’, T cell memory, and malaria sporozoite immunity: An hypothesis for immune evasion. Parasite Immunol. 15, 187–193. Grabowsky, M., 2008. The billion-dollar malaria moment. Nature 451, 1051–1052. Gray, J.C., Corran, P.H., Mangia, E., Gaunt, M.W., Li, Q., Tetteh, K.K., et al., 2007. Profiling the antibody immune response against blood stage malaria vaccine candidates. Clin. Chem. 53, 1244–1253. Greenwood, B.M., 2008. Control to elimination: Implications for malaria research. Trends Parasitol. 24, 449–454. Gruner, A.C., Mauduit, M., Tewari, R., Romero, J.F., Depinay, N., Kayibanda, M., et al., 2007. Sterile protection against malaria is independent of immune responses to the circumsporozoite protein. PLoS ONE 2, e1371. Hardelid, P., Williams, D., Dezateux, C., Tookey, P.A., Peckham, C.S., Cubitt, W.D., et al., 2008. Analysis of rubella antibody distribution from newborn dried blood spots using finite mixture models. Epidemiol. Infect. 136, 1698–1706. Harris, A., Reidel, L.M., 1948. Evaluation of the complement fixation test for malaria. Am. J. Trop. Med. Hyg. 28, 787–795. Hay, S.I., Guerra, C.A., Gething, P.W., Patil, A.P., Tatem, A.J., Noor, A.M., et al., 2009. A world malaria map: Plasmodium falciparum endemicity in 2007. PLoS Med 6, e48. Hay, S.I., Smith, D.L., Snow, R.W., 2008. Measuring malaria endemicity from intense to interrupted transmission. Lancet Infect. Dis. 8, 369–378. Irion, A., Beck, H.P., Smith, T., 2002. Assessment of positivity in immuno-assays with variability in background measurements: A new approach applied to the antibody response to Plasmodium falciparum MSP2. J. Immunol. Methods 259, 111–118. Jeffery, G.M., McWilson, W., Collins, W.E., Lobel, H., 1975. Application of the indirect fluorescent antibody method in a study of malaria endemicity in Mato Grosso, Brazil. Am. J. Trop. Med. Hyg. 24, 402–411. John, C.C., Zickafoose, J.S., Sumba, P.O., King, C.L., Kazura, J.W., 2003. Antibodies to the Plasmodium falciparum antigens circumsporozoite protein, thrombospondin-related adhesive protein, and liver-stage antigen 1 vary by ages of subjects and by season in a highland area of Kenya. Infect. Immun. 71, 4320–4325. Kagan, I.G., Mathews, H., Sulzer, A.J., 1969a. The serology of malaria: Recent applications. Bull. N. Y. Acad. Med. 45, 1027–1042.


349

Kagan, I.G., Mathews, H.M., Rogers, W.A., Jr., Fried, J., 1969b. Seroepidemiological studies by indirect haemagglutination tests for malaria. Military recruit collections from Argentina, Brazil, Colombia, and the United States of America. Bull. World Health Organ. 41, 825–841. Kamol-Ratanakul, P., Chirakalwasarn, N., Lertmaharit, S., Dhanamun, B., Seublinwong, T., Udomsangpetch, R., et al., 1992. Seroepidemiologic studies of humoral immune response to the Plasmodium falciparum antigens in Thailand. Am. J. Trop. Med. Hyg. 47, 554–561. Kaneko, A., Taleo, G., Kalkoa, M., Yamar, S., Kobayakawa, T., Bjorkman, A., 2000. Malaria eradication on islands. Lancet 356, 1560–1564. Kho, W.G., Jang, J.Y., Hong, S.T., Lee, H.W., Lee, W.J., Lee, J.S., 1999. Border malaria characters of reemerging vivax malaria in the Republic of Korea. Korean J. Parasitol. 37, 71–76. Ladeia-Andrade, S., Ferreira, M.U., Scopel, K.K., Braga, E.M., Bastos Mda, S., Wunderlich, G., et al., 2007. Naturally acquired antibodies to merozoite surface protein (MSP)-1(19) and cumulative exposure to Plasmodium falciparum and Plasmodium vivax in remote populations of the Amazon Basin of Brazil. Mem. Inst. Oswaldo Cruz. 102, 943–951. Lee, K.N., Suh, I.B., Chang, E.A., Kim, S.D., Cho, N.S., Park, P.W., et al., 2003. Prevalence of antibodies to the circumsporozite protein of Plasmodium vivax in five different regions of Korea. Trop. Med. Int. Health 8, 1062–1067. Lelijveld, J.L., 1972. Sero-Epidemiological Studies of Malaria in Tanzania [doctoral thesis]. University of Nijmegen, The Netherlands. Lim, C.S., Yoon, J.K., Chang, E.A., Suh, I.B., An, S.S., Lee, K.H., et al., 2005. Seroprevalence to the circumsporozoite protein peptide antigen of Plasmodium vivax in Korean children. Microbiol. Immunol. 49, 521–527. Lippincott, S.W., Gordon, H.H., Hesselbrock, W.B., Marble, A., 1945. Complement fixation in human malaria using an antigen prepared from the chicken parasite Plasmodium gallinaceum. J. Clin. Invest. 24, 362–371. Livadas, G., Belios, G., 1948. Postwar malaria control in Greece on basis of epidemiological data. Abstr. Int. Congr. Trop. Med. Malar. 56, 68. Lobel, H.O., Mathews, H.M., Kagan, I.G., 1973. Interpretation of IHA titres for the study of malaria epidemiology. Bull. World Health Organ. 49, 485–492. Manawadu, B.R., Voller, A., 1978. Standardization of the indirect fluorescent antibody test for malaria. Trans. R. Soc. Trop. Med. Hyg. 72, 456–462. Marsh, K., Kinyanjui, S., 2006. Immune effector mechanisms in malaria. Parasite Immunol. 28, 51–60. Marques, P.X., Sau´te, F., Pinto, V.V., Cardoso, S., Pinto, J., Alonso, P.L., Rosa´rio, V.E., Arez, A.P. 2005. Plasmodium species mixed infections in two areas of Manhiça District, Mozambique. Int. J. Biol. Sci. 1, 96–102. Mathews, H.M., Dondero, T.J., Jr., 1982. A longitudinal study of malaria antibodies in a Malaysian population. I. Group responses. Am. J. Trop. Med. Hyg. 31, 14–18. Mathews, H.M., Fisher, G.U., Kagan, I.G., 1970. Persistence of malaria antibody in Tobago, West Indies, following eradication, as measured by the indirect hemagglutination test. Am. J. Trop. Med. Hyg. 19, 581–585. Matola, Y.G., Magayuka, S.A., 1981. Malaria in the Pare area of Tanzania. V. Malaria 20 years after the end of residual insecticide spraying. Trans. R. Soc. Trop. Med. Hyg. 75, 811–813. Mattews, H.M., Fried, J.A., Kagan, I.G., 1970. A seroepidemiologic study of malaria in the Republic of the Philippines by the indirect hemagglutination test. Am. J. Epidemiol. 92, 376–381. McGregor, I.A., 1964. The passive transfer of human malarial immunity. Am. J. Trop. Med. Hyg. 13, 237–239.

350


McGregor, I.A., Williams, K., Voller, A., Billewicz, W.Z., 1965. Immunofluorescence and the measurement of immune response to hyperendemic malaria. Trans. R. Soc. Trop. Med. Hyg. 59, 395–414. Meuwissen, J.H., 1974. The indirect haemagglutination test for malaria and its application to epidemiological surveillance. Bull. World Health Organ. 50, 277–286. Meuwissen, J.H., Leeuwenberg, A.D., Voller, A., Matola, Y., 1974. Specificity of the indirect haemagglutination test with Plasmodium falciparum test cells. Comparison of indirect haemagglutination and fluorescent antibody tests on African sera. Bull. World Health Organ. 50, 513–519. Migot, F., Chougnet, C., Henzel, D., Dubois, B., Jambou, R., Fievet, N., et al., 1995. Anti-malaria antibody-producing B cell frequencies in adults after a Plasmodium falciparum outbreak in Madagascar. Clin. Exp. Immunol. 102, 529–534. Modiano, D., Petrarca, V., Sirima, B.S., Nebie, I., Diallo, D., Esposito, F., et al., 1996. Different response to Plasmodium falciparum malaria in west African sympatric ethnic groups. Proc. Natl. Acad. Sci. USA 93, 13206–13211. Molineaux, L., 1980. The Garki project research on the epidemiology and control of malaria in the Sudan savanna of West Africa. World Health Organization (WHO), Geneva, Switzerland. Nardin, E.H., Nussenzweig, R.S., McGregor, I.A., Bryan, J.H., 1979. Antibodies to sporozoites: Their frequent occurrence in individuals living in an area of hyperendemic malaria. Science 206, 597–599. Noland, G.S., Hendel-Paterson, B., Min, X.M., Moormann, A.M., Vulule, J.M., Narum, D.L., et al., 2008. Low prevalence of antibodies to preerythrocytic but not blood-stage Plasmodium falciparum antigens in an area of unstable malaria transmission compared to prevalence in an area of stable malaria transmission. Infect. Immun. 76, 5721–5728. Orlandi-Pradines, E., Penhoat, K., Durand, C., Pons, C., Bay, C., Pradines, B., et al., 2006. Antibody responses to several malaria pre-erythrocytic antigens as a marker of malaria exposure among travelers. Am. J. Trop. Med. Hyg. 74, 979–985. Poinsignon, A., Cornelie, S., Mestres-Simon, M., Lanfrancotti, A., Rossignol, M., Boulanger, D., et al., 2008a. Novel peptide marker corresponding to salivary protein gSG6 potentially identifies exposure to Anopheles bites. PLoS ONE 3, e2472. Poinsignon, A., Remoue, F., Rossignol, M., Cornelie, S., Courtin, D., Grebaut, P., et al., 2008b. Human igG antibody response to Glossina saliva: An epidemiologic marker of exposure to Glossina bites. Am. J. Trop. Med. Hyg. 78, 750–753. Pringle, G., 1967. Malaria in the Pare area of Tanzania. 3. The course of malaria transmission since the suspension of an experimental programme of residual insecticide spraying. Trans. R. Soc. Trop. Med. Hyg. 61, 69–79. Ramasamy, R., Nagendran, K., Ramasamy, M.S., 1994. Antibodies to epitopes on merozoite and sporozoite surface antigens as serologic markers of malaria transmission: Studies at a site in the dry zone of Sri Lanka. Am. J. Trop. Med. Hyg. 50, 537–547. Roberts, L., Enserink, M., 2007. Malaria. Did they really say. . . eradication? Science 318, 1544–1545. Romi, R., Sabatinelli, G., Majori, G., Ralamboranto, L., Raveloarifera, F., Ranaivoharimina, H., 1994. Plasmodium falciparum circumsporozoite antibody prevalence in Madagascar: A longitudinal study in three different epidemiologic areas. Am. J. Trop. Med. Hyg. 51, 856–863. Rota, M.C., Massari, M., Gabutti, G., Guido, M., De Donno, A., Atti, M.L., 2008. Measles serological survey in the Italian population: Interpretation of results using mixture model. Vaccine 26, 4403–4409. Roy, A., Sharma, P., Chauhan, S., 1994. The use of peptide ELISA in determining malaria endemicity. J. Immunol. Methods 167, 139–143. Sadun, E.H., 1972. The research and development of serologic tests for malaria. Am. J. Trop. Med. Hyg. 21, 677–682.


351

Sato, K., Kano, S., Yamaguchi, H., Omer, F.M., el Safi, S.H., el Gaddal, A.A., et al., 1990. An ABC-ELISA for malaria serology in the field. Am. J. Trop. Med. Hyg. 42, 24–27. Schindler, R., Voller, A., 1967. A comparison of complement-fixation and fluorescent antibody methods in a longitudinal study of simian malaria infection. Bull. World Health Organ. 37, 669–674. Schofield, L., Mueller, I., 2006. Clinical immunity to malaria. Curr. Mol. Med. 6, 205–221. Sharma, V.P., 1989. ‘‘Seroepidemiology of Human Malaria a Multicentric Study’’. Malaria Research Centre (ICMR), Delhi, India. She, R.C., Rawlins, M.L., Mohl, R., Perkins, S.L., Hill, H.R., Litwin, C.M., 2007. Comparison of immunofluorescence antibody testing and two enzyme immunoassays in the serologic diagnosis of malaria. J. Travel Med. 14, 105–111. Silvie, O., Thellier, M., Rosenheim, M., Datry, A., Lavigne, P., Danis, M., et al., 2002. Potential value of Plasmodium falciparum-associated antigen and antibody detection for screening of blood donors to prevent transfusion-transmitted malaria. Transfusion 42, 357–362. Struik, S.S., Riley, E.M., 2004. Does malaria suffer from lack of memory? Immunol. Rev. 201, 268–290. Sulzer, A.J., Cantella, R., Colichon, A., Gleason, N.N., Walls, K.W., 1975. A focus of hyperendemic Plasmodium malariae–P. Vivax with no P. Falciparum in a primitive population in the Peruvian Amazon jungle. Bull. World Health Organ. 52, 273–278. Taylor, R.R., Egan, A., McGuinness, D., Jepson, A., Adair, R., Drakely, C., et al., 1996. Selective recognition of malaria antigens by human serum antibodies is not genetically determined but demonstrates some features of clonal imprinting. Int. Immunol. 8, 905–915. Taylor, R.R., Smith, D.B., Robinson, V.J., McBride, J.S., Riley, E.M., 1995. Human antibody response to Plasmodium falciparum merozoite surface protein 2 is serogroup specific and predominantly of the immunoglobulin G3 subclass. Infect. Immun. 63, 4382–4388. Thomson, J., 1918. The complement deviation in cases of malaria: A new aid to diagnosis. Br. Med. J. 2, 628–629. Tobie, J.E., 1964. Detection of malaria antibodies—immunodiagnosis. Am. J. Trop. Med. Hyg. 13, 195–203. Tobie, J.E., Abele, D.C., Hill, G.J., 2nd., Contacos, P.G., Evans, C.B., 1966. Fluorescent antibody studies on the immune response in sporozoite-induced and blood-induced vivax malaria and the relationship of antibody production to parasitemia. Am. J. Trop. Med. Hyg. 15, 676–683. Tongol-Rivera, P., Kano, S., Miguel, E., Tongol, P., Suzuki, M., 1993. Application of seroepidemiology in identification of local foci in a malarious community in Palawan, The Philippines. Am. J. Trop. Med. Hyg. 49, 608–612. Tongren, J.E., Drakeley, C.J., McDonald, S.L., Reyburn, H.G., Manjurano, A., Nkya, W.M., et al., 2006. Target antigen, age, and duration of antigen exposure independently regulate immunoglobulin G subclass switching in malaria. Infect. Immun. 74, 257–264. van der Kaay, H.J., 1976. Malaria in Surinam, a sero-epidemiological study. Acta Leiden. 43, 7–91. Voller, A., 1967. An evaluation of complement-fixation and immunofluorescent tests with a simian malaria parasite antigen, in a study of malarial antibody levels in a population in a malaria endemic area. Bull. World Health Organ. 37, 675–678. Voller, A., Bruce-Chwatt, L.J., 1968. Serological malaria surveys in Nigeria. Bull. World Health Organ. 39, 883–897. Voller, A., Draper, C.C., 1982. Immunodiagnosis and sero-epidemiology of malaria. Br. Med. Bull. 38, 173–177. Voller, A., O’Neill, P., 1971. Immunofluorescence method suitable for large-scale application to malaria. Bull. World Health Organ. 45, 524–529.

352


Voller, A., Bidwell, D., Huldt, G., Engvall, E., 1974. A microplate method of enzyme-linked immunosorbent assay and its application to malaria. Bull. World Health Organ. 51, 209–211. Voller, A., Cornille-Brogger, R., Storey, J., Molineaux, L., 1980. A longitudinal study of Plasmodium falciparum malaria in the West African savannah using the ELISA technique. Bull. World Health Organ. 58, 429–438. Voller, A., Huldt, G., Thors, C., Engvall, E., 1975. New serological test for malaria antibodies. Br. Med. J. 1, 659–661. Warren, M., Collins, W.E., Cedillos, R., Jeffery, G.M., 1976. The seroepidemiology of malaria in Middle America. III. Serologic assessment of localized Plasmodium falciparum epidemics. Am. J. Trop. Med. Hyg. 25, 20–25. Warren, M., Collins, W.E., Jeffery, G.M., Skinner, J.C., 1975a. The seroepidemiology of malaria in Middle America. II. Studies on the Pacific coast of Costa Rica. Am. J. Trop. Med. Hyg. 24, 749–754. Warren, M., Collins, W.E., Skinner, J.C., Larin, A.J., 1975b. The seroepidemiology of malaria in Middle America. I. Longitudinal studies on populations in a low incidence area of El Salvador. Am. J. Trop. Med. Hyg. 24, 740–748. Webster, H.K., Gingrich, J.B., Wongsrichanalai, C., Tulyayon, S., Suvarnamani, A., Sookto, P., et al., 1992. Circumsporozoite antibody as a serologic marker of Plasmodium falciparum transmission. Am. J. Trop. Med. Hyg. 47, 489–497. Wickramarachchi, T., Premaratne, P.H., Perera, K.L., Bandara, S., Kocken, C.H., Thomas, A.W., et al., 2006. Natural human antibody responses to Plasmodium vivax apical membrane antigen 1 under low transmission and unstable malaria conditions in Sri Lanka. Infect. Immun. 74, 798–801. Wilson, M., Fife, E.H., Jr., Mathews, H.M., Sulzer, A.J., 1975. Comparison of the complement fixation, indirect immunofluorescence, and indirect hemagglutination tests for malaria. Am. J. Trop. Med. Hyg. 24, 755–759. Wilson, M., Sulzer, A.J., Rogers, W.A., Jr., Fried, J.A., Mathews, H.M., 1971. Comparison of the indirect-fluorescent antibody and indirect-hemagglutination tests for malarial antibody. Am. J. Trop. Med. Hyg. 20, 6–9. Wilson, S., Booth, M., Jones, F.M., Mwatha, J.K., Kimani, G., Kariuki, H.C., et al., 2007. Ageadjusted Plasmodium falciparum antibody levels in school-aged children are a stable marker of microgeographical variations in exposure to Plasmodium infection. BMC Infect. Dis. 7, 67. Wykes, M., Good, M.F., 2006. Memory B cell responses and malaria. Parasite Immunol. 28, 31–34. Young, C.C., Taliaferro, W.H., 1928. Laboratory: Some serological studies in malaria. Am. J. Public Health Nations Health 18, 793–795. Zheng, X., Fang, W., Huang, F., Shen, Y.Z., Su, Y.P., Huang, G.Q., et al., 2008. Evaluation on malaria situation in areas along Yellow River and Huaihe River by indirect fluorescent antibody test. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi 26, 417–421 (In Chinese).

INDEX A AA sequential diversity, of trematode peptidases, 226 Adult worms of echinostomes, characteristics, 159–162 Aerobic metabolism, S. mansoni, 31. See also Zygocotyle lunata Africa, Fasciola sp., 73–77. See also Fasciola sp. origin and evolution and the Near East, northwards spread, 82–83 westwards and southwards spread, 80–82 Afro-Mediterranean lowlands, F. hepatica transmission, 50. See also Fasciola sp. origin and evolution Alcelaphus buselaphus, 57 America, F. hepatica, 77–80. See also Fasciola sp. origin and evolution Amphibians, echinostomes pathology in, 173–174 Anas impercutiri, 5 Anas melanotus, 5 Anas platyrhynchos, 14 Andean countries, F. hepatica transmission, 50. See also Fasciola sp. origin and evolution Anti-malarial antibodies, measurement of, 302 advantages and disadvantages of methods for, 304–307 antigen source for assays, 310–311 complement fixation test, 303 ELISA and protein micro-arrays, 309 IHA and IFAT, 303, 308–309 methodological considerations, 312–313 Anurans, echinostome infections, 175 Aphistomum lunatum, 5 Artificial spring water, 28 Asia, Fasciola sp., 71–73. See also Fasciola sp. origin and evolution

Asparaginyl endopeptidase (AE), 259–261. See also Asparaginyl-like peptidases Asparaginyl-like peptidases, 258–261. See also Peptidases, of trematodes Aspartic peptidases (APs) of trematodes, 261–265. See also Peptidases, of trematodes pepsin A-like peptidases, 265–267 ASW. See Artificial spring water Atrazine toxicity, echinostome, 177 Avian hosts, Z. lunata, 9–11. See also Zygocotyle lunata B Balanced salt solution, 29 Benue Provinces, sero-epidemiological studies, 314, 328–329 Biochemistry, Z. lunata, 32–34. See also Zygocotyle lunata Biomphalaria alexandrina, 83, 121 Biomphalaria glabrata, 13, 152 Biomphalaria oligoza, 13 Biomphalaria orbignyi, 13 Biomphalaria peregrina, 8, 13 Biomphalaria straminea, 13 Biomphalaria tenagophila tenagophila, 13 Bos bubalus, F. indica, 56 Boselaphus tragocamelus, 54 Bos indicus, F. indica, 56 Bos primigenius, 72 Bos taurus, 6 Bos taurus tryptase, 225 BSS. See Balanced salt solution C Caecal trematode. See Zygocotyle lunata Calpain (CaNp)-like peptidases, 256–258. See also Peptidases, of trematodes Capra hircus, F. indica, 56

353

354

Carboxypeptidase Y-like peptidases, 228 Caribbean, cattle domestication, 79 Caribbean insular, F. hepatica transmission, 50 Carica papaya, 238 Cathepsin B (CB) gene, 240–246. See also Papain-like peptidases expression of, 242 identification of, 241–242 phylogenetic analysis of, 245 role of, 245 Cathepsin C (CC) gene, 254–256. See also Papain-like peptidases Cathepsin D (CD) gene, 265–267 Cathepsin F (CF) gene, 246, 252–254. See also Papain-like peptidases Cathepsin L (CL) gene, 246–252. See also Papain-like peptidases Cattle domestication and Fasciola sp. origin distributional overlap of F. hepatica and F. gigantica, 84–85 livestock transportation, transhumance and trade in, 85–87 areas of one Fasciola species, 87–90 both Fasciola species co-existing areas, 90–92 molecular characterization of, 92–96 fasciolid-lymnaeid specificity, 120–123 F. hepatica and F. gigantica, intraspecific and interspecific variation of, 96–108 gene expression and hybrid problems of, 108–111 liver fluke phenotypes, 111–118 species question in, 118–120 worldwide lymnaeid molecular characterization, 123–126 origin of, 71 in post-domestication period, 67 in Africa, 73–77 in Asia, 71–73 eastwards spread in Asia and the Pacific, 83–84 in Europe, 69–71 Fasciola gigantica, spread of, 80 in Near and Middle East, 68–69 northwards spread between Africa and the Near East, 82–83 in Oceania and the Americas, 77–80 recent spread of Fasciola hepatica, 68

Index

westwards and southwards spread in Africa, 80–82 in pre-domestication times, 56–67 standardization proposal for, 126–130 CB1 function of, 243 in IgG digestion, 244 cDNA. See Complementary deoxyribonucleic acid Cenozoic era, ruminants emergence in, 62 Central America, malaria control and elimination monitoring, 337 Cercarial elastase (CE) gene biochemical properties and specificity of, 220–223 identification, localization and function of, 223–224 inhibition of, 223 phylogeny of, 225 Cercarial transmission and metacercarial cyst formation, environmental conditions affecting, 176–178 Cercaria poconensis, 6 Cervus dichotomius, 5 CFT. See Complement fixation test Chaetogaster limnaei, 22, 35 Chick chorioallantois and Z. lunata, 31–32. See also Zygocotyle lunata Chymotrypsin-like activity, for SmCE, 223 Chymotrypsin-like peptidases cercarial elastase (CE) gene, 220–225 enterokinase-like peptidase, 227 kallikrein-like peptidase, 225–226 CIAS. See Computer image analysis system Circumsporozoite protein, 311 Cladocoelium elephantis, F. jacksoni, 55 Clinical signs, of Zygocotyle lunata, 18 Clonorchis sinensis, 241, 253. See also Papain-like peptidases CO-1. See Cytochrome oxidase 1 37-Collar spined species of Echinostoma, characteristic features of, 165–166 Complementary deoxyribonucleic acid, 224 Complement fixation test, 303 Composite haplotype (CH) nomenclature, for lymnaeids, 129

355

Index

Computer image analysis system, 112 Connochaetes taurinus, 57 Copper sulphate toxicity, on echinostome, 176–177 Cricket frogs (Acris crepitans), 175 CsCF gene, 253 CSP. See Circumsporozoite protein Cyclocheilichthys armatus, 177 Cysteine peptidases (CPs) of trematodes, 228–238 asparaginyl-like peptidases, 258–261 calpain-like peptidases, 256–258 papain-like peptidases, 238–256 Cysts, formation in ASW, 28–29. See also Zygocotyle lunata Cytochrome oxidase 1, 167 D Damaliscus korrigum, 57 DDT. See Dichloro-diphenyl-trichloroethane Dendrocygna autumnalis, 18 DGG. See Digestive gland gonad Dichloro-diphenyl-trichloroethane, 300 Digenean family Fasciolidae, 53–56 Digestive gland gonad, 32–33 Dipeptidyl peptidase, 228 Dipeptidyl peptidase III-like peptidases, 272 Diplostomum pseudospathaceum, 248, 251 Diplostomum pseudospathaceum CL, 246 DpCL. See Diplostomum pseudospathaceum CL DPP. See Dipeptidyl peptidase Drosophila melanogaster, 225 E Echinoparyphium megacirrus, 156 Echinoparyphium recurvatum, 157, 176 Echinostoma and B. glabrata, relationship of, 168 immunobiological interactions, 169–171 proteomic approaches, 172–173 Echinostoma caproni, 33. See also Echinostomes cercarial tail of, 157 miracidia of, 151, 153 pre-ovigerous echinostomes development study in, 178–179 and S. mansoni, proteome profile of, 172 sporocyst development, 154 Echinostoma friedi. See also Echinostomes cercarial infectivity of, 157 metacercariae of, 158

miracidial infectivity of, 153 ovigerous adults development, 178–179 Echinostoma jurini, 151. See also Echinostomes Echinostoma paraensei. See also Echinostomes miracidia of, 151 sporocyst development, 155 Echinostomatidae species, geographical distribution of, 164 Echinostoma trivolvis, 31, 33, 151. See also Echinostomes miracidia of, 152 ovigerous adults development in, 178–179 rediae production of, 155 Echinostome adult worms, proteomics of, 189–192 Echinostome metacercariae and second intermediate host, interaction of pathology of, 173–175 as re-emerging disease, 175–176 toxins effect on, 176–178 Echinostome metacercariae, toxins effect on, 176–178 Echinostome mother rediae, 154–155 Echinostomes host–parasite relationships study in in definitive host, 178–192 in first intermediate host level, 168–173 in second intermediate host, 173–178 lifecycle and development, 149–151 adults, 159–162 cercariae, 156–157 eggs and miracidia, 151–153 metacercariae, 157–159 sporocysts and rediae, 153–156 in parasitology, 148 taxonomy, 162 biodiversity, 163–164 biogeography and phylogeny, 164, 167–168 Echinostomiasis, in amphibians, 176 Ecology, of Z. lunata, 34–35. See also Zygocotyle lunata EDTA. See Ethylenediaminetetraacetic acid EIR. See Entomological inoculation rate Elastatinal inhibitor, role of, 243 Eleocharis acicularis, 27 Elephas indicus, F. jacksoni in, 55 Elephas maximus, F. jacksoni in, 55 ELH. See Energy limitation hypothesis

356

Index

ELISA technique. See Enzyme-linked immunosorbent assay technique El Salvador, malaria control and elimination monitoring, 337 Energy limitation hypothesis, 34 Enolase in ESPs of E. caproni, importance of, 191 Enterokinase-like peptidase, 227. See also Chymotrypsin-like peptidases Entomological inoculation rate, 312 Enzyme-linked immunosorbent assay technique, 189, 309 Eosinophilic infiltration, in Echinostoma rodents infection, 185 E-64, role of, 239 ESPs. See Excretory/secretory products Ethiopia cattle domestication in, 76 sero-epidemiological studies in, 329 Ethylenediaminetetraacetic acid, 272 Euparyphium albuferensis, 157 Europe, Fasciola sp. in, 69–71. See also Fasciola sp. origin and evolution Excretory/secretory products, 214 F Fasciola gigantica, 31, 241. See also Cattle domestication and Fasciola sp. origin AE in, 260 allometric analyses of, 114 in Asia, 71–73 eggs and fasciolids in overlap areas, phenotypic characterization of, 115–117 fasciolid eggs shed by humans, phenotypic characterization of, 117–118 and F. hepatica distributional overlap of, 84–85 divergence of, 61 haemoglobin degradation by, 243 intraspecific and interspecific variation of, 96–108 in Near East and Asia, 82–83 origin of, 57–58, 63 phenotypic characterization of adults, 111–115 in post-domestication period, 64 spread of, 80 westwards and southwards spread in Africa, 80–82

Fasciola hepatica, 241. See also Cattle domestication and Fasciola sp. origin in Asia, 71–73 cathepsins L, usage of, 246 diagnosis of, 251 eggs and fasciolids in overlap areas, phenotypic characterization of, 115–117 endemics, in human population, 49–50 fasciolid eggs shed by humans, phenotypic characterization of, 117–118 and F. gigantica distributional overlap of, 84–85 divergence of, 61 genetic heterogeneity detection, RAPD markers in, 93 genetic studies on northern and southern European populations of, 69–70 haemoglobin degradation by, 243 intraspecific and interspecific variation of, 96–108 in Near East and Asia, 82–83 in Oceania and the Americas, 77–80 origin of, 57, 63, 65 phenotypic characterization of adults, 111–115 in post-domestication period, 66 recent spread of, 68 Fasciola magna, 250. See also Cattle domestication and Fasciola sp. origin ESP of, 249 origin of, 56 Fasciola nyanzae, 58 Fasciola sp. origin and evolution distributional overlap of F. hepatica and F. gigantica, 84–85 livestock transportation, transhumance and trade in, 85–87 areas of one Fasciola species, 87–90 both Fasciola species co-existing areas, 90–92 molecular characterization of, 92–96 fasciolid-lymnaeid specificity, 120–123 F. hepatica and F. gigantica, intraspecific and interspecific variation of, 96–108 gene expression and hybrid problems of, 108–111

357

Index

liver fluke phenotypes, 111–118 species question in, 118–120 worldwide lymnaeid molecular characterization, 123–126 in post-domestication period, 67 in Africa, 73–77 in Asia, 71–73 eastwards spread in Asia and the Pacific, 83–84 Fasciola gigantica, spread of, 80 northwards spread between Africa and the Near East, 82–83 in Oceania and the Americas, 77–80 westwards and southwards spread in Africa, 80–82 Fasciolidae, infection by, 207 Fasciolid characterization genetic markers for, 127–128 phenotypic markers for, 128 Fasciolid-lymnaeid specificity, 120–123. See also Fasciola sp. origin and evolution Fasciolinae Stiles et Hassall, 1898, genera of, 54–56 Fasciolopsinae Odhner, 1910, genera of, 53–54 Fasciolopsis buski, 53 G Galba truncatula, 50, 65 Garki Project, malaria control and elimination monitoring in, 333–334 Gene expression and hybrid problems, of Fasciola sp., 108–111. See also Cattle domestication and Fasciola sp. origin Genetic characterization, of fasciolids, 93 Genetic markers for fasciolid characterization, 127–128 lymnaeid characterization, 128–129 Geographical information systems, 53, 332 Giraffa camelopardalis, F. gigantica in, 54–55 Giraffids, distribution of, 58 GIS. See Geographical information systems Global positioning systems, 127 Glutathione S-transferase, 190–191 GPS. See Global positioning systems Greece, malaria eradication and elimination assessment in, 339–340 Green frogs (Rana clamitans), 174–175 GST. See Glutathione S-transferase

H Haplotype code nomenclature, 129–130 H-DFP. See [3H]diisopropylphosphofluoridate [3H]diisopropyl-phosphofluoridate, 223 Helisoma anceps, 15 Helisoma antrosum, 5 Helisoma spp., 8 Helisoma trivolvis, 15–16 Herbicides metolachlor toxicity, on echinostome, 177 High-performance thin-layer chromatography, 33 Hippopotamus amphibius, 58 Hippopotamus amphibius, F. nyanzae in, 55 Host-parasite relationships study, in Echinostomes in definitive host, 178–192 in first intermediate host level, 168–173 in second intermediate host, 173–178 HPTLC. See High-performance thin-layer chromatography Human echinostomiasis, prevalence of, 148 Human enterokinase, physiological function of, 227 Human fascioliasis. See also Fasciola sp. origin and evolution control measures, problems of, 51–53 distribution of, 44–45 epidemiology of, 45–47 evolutionary genetics and molecular epidemiology, 53–56 heterogeneity of epidemiology of, 48–50 transmission patterns of, 50–51 neglected disease, problem of, 47–48 Human-forced overlap, of F. hepatica and F. gigantica, 84–85 Human humoral response to malarial antigens, study of, 300 Human infection by fasciolids. See also Cattle domestication and Fasciola sp. origin endemic/non-endemic situation, types of outbreaks in, 49–50 prevalence, coprological diagnosis of, 48–49 rarity of, 47 transmission patterns of, 50–51 Humans infection, by echinostomes, 178 Hypoderaeum conoideum, miracidia of, 153

358

Index

I Iberian cattle, haplotypes of, 79 IFAT. See Immunofluorescence antibody test IgG, CB1 role in, 244 IHA. See Indirect haemagglutination assay Immune proteomic approach, usage of, 187 Immunofluorescence antibody test, 303, 309 Immunology. See also Echinostomes; Zygocotyle lunata of echinostome infections, 184–189 of Z. lunata, 19–21 India, Fasciola sp. in, 71–72. See also Fasciola sp. origin and evolution Indirect haemagglutination assay, 303 Indoor residual spraying, 333 Intestinal helminth-vertebrate host relationships analysis, echinostomes in. See also Echinostomes adult worms, proteomics of, 189–192 development of, 178–179 immunology of, 184–189 reproduction and fecundity, 179–184 Invertebrate hosts, Z. lunata in, 16–17. See also Zygocotyle lunata IRS. See Indoor residual spraying ITS sequences, in Echinostoma species identification, 167 Ixodes ricinus, 242 K Kabba Provinces, sero-epidemiological studies in, 314, 328–329 Kallikrein-like peptidase, 225–226. See also Chymotrypsin-like peptidases Kobus defassa, 57 Kobus kob, 57 Kobus varondi, 57 K11777, role of, 239 L LAP. See Leucyl aminopeptidase Lectin labelling patterns study, in Echinostoma mice infection, 185 Leopard frogs (Rana pipiens), 174 Leucyl aminopeptidase, 271–272 Leucyl aminopeptidase-like peptidases, 271–272

Livestock transportation and trade, in Fasciola sp. spread, 85–87 areas of one Fasciola species, 87–90 both Fasciola species co-existing areas, 90–92 Loxodonta africana, 53 Lymnaea acuminata, 56 Lymnaea columnella, 153 Lymnaea peregra, 159 Lymnaeid F. californica and F. halli in, 56 molecular characterization, studies on, 123–126 (see also Fasciola sp. origin and evolution) vector species characteristics of, 51 in fasciolid species transmission, 51–52 Lymnaeidae, origin of, 61 Lytic enzymes in trematodes lifecycle, role of, 209, 212 M Major histocompatibility complex, 259 Malaria eradication and elimination assessment, serological data future perspectives of, 343–345 in Greece, 339–340 in Mauritius, 338–339 in Surinam, 340–343 in Tunisia, 343 Malaria, humoural immunity in, 301–302 Malaria indicator surveys, 345 Malarial antibodies detection malaria control and elimination monitoring, serological data for central and South America, 337 central El Salvador, 337 Garki Project, Nigeria, 333–334 pacific coast of Costa Rica, 338 Papua New Guinea, 336–337 Pare-Taveta Malaria Scheme, Tanzania, 335 Tanzania, 335–336 serological assays, for malaria endemicity and risk assessment, 313–314 behavioural differences, 332–333 epidemics detection, 330–331 in Ethiopia and South America, 329 in Kabba and Benue Provinces, 314, 328–329

359

Index

spatial mapping of responses, 332 studies and findings of, 315–327 in Tanzania, 314 in West Africa, 329–330 tests, 302–303 advantages and disadvantages of methods in, 304–307 CFT, 303 ELISA, 309 IFAT, 303, 309 IHA, 303 methodological concerns in, 312–313 protein micro-arrays in, 309 source of antigen for assays, 310–311 Malathion toxicity effects, on echinostome, 177 Mammalian hosts, of Z. lunata, 12. See also Zygocotyle lunata Mauritius, malaria eradication and elimination assessment in, 338–339 Mean titre index, 314 Meleagris gallopavo, 18 MEROPS database 214 AA in, 227 for cysteine peptidases, 229–237 kallikrein-like peptidase in, 225 serine peptidases in, 216–219 for trematode carboxypeptidase A, 228 MEROPS 8.2 database of aspartic peptidases, 262–264 calpains in, 256 cathepsin C in, 254 (see also Papain-like peptidases) cathepsin D in, 265 cathepsins F in, 246 metallopeptidase sequences in, 268–270 threonine peptidases in, 274–275 Merozoite surface protein, 311 Messenger ribonucleic acid, 189, 224 Metacercariae, of echinostomes, 157–159 Metacercarial cysts in Z. lunata, infectivity of, 14. See also Zygocotyle lunata Metagonimus yokogawai, 252 Metallopeptidases (MPs) of trematodes, 267–272. See also Peptidases, of trematodes MHC. See Major histocompatibility complex Microsatellite markers, in F. hepatica genetic heterogeneity detection, 94 Miracidia and Z. lunata biology, 6. See also Zygocotyle lunata

Miracidium–host encounter, importance of, 155 Miracidium, of echinostomes, 151–153 MIS. See Malaria indicator surveys Mitochondrial molecules, 167 mRNA. See Messenger ribonucleic acid MSP. See Merozoite surface protein mtDNA. See Mitochondrial molecules MTI. See Mean titre index Mus musculus, 228 N NADH. See Nicotinamide adenine dinucleotide dehydrogenase Near and Middle East, F. hepatica in, 68–69. See also Fasciola sp. origin and evolution NEJ. See Newly excysted juvenile Newly excysted juvenile, 241 Nicotinamide adenine dinucleotide dehydrogenase, 167 Nippostrongylus braziliensis, 186 O Oceania, Fasciola hepatica in, 77–80. See also Cattle domestication and Fasciola sp. origin Oil red O, 25–26 Oligocene/Miocene transition, bovids origin in, 62 Oligo-peptide substrate and cysteine peptidase, interaction of, 221 Ondatra zibetica, 5 ORO. See Oil red O P Pacific coast of Costa Rica, malaria control and elimination monitoring, 338 Pancreatic proteolytic pro-enzymes, activation of, 227 Papain-like peptidases, 238–240. See also Cysteine peptidases (CPs) of trematodes catalytic triad of, 238 cathepsin B, 240–246 cathepsin C, 254–256 cathepsin F, 252–254 cathepsin L, 246–252 three-dimensional structure of, 239 Papua New Guinea, malaria control and elimination monitoring, 336–337

360

Paragonimus ohirai, 31 Paragonimus westermani, 241, 244, 250, 259–260 Paramphistomum ichikawai, 20 Paramphistomum microbothrium, 20 Parasite geographic range, 16 Parasite infective geographic range, 16 Parasitic diseases, peptidases in, 208–209 Pare-Taveta Malaria Scheme, malaria control and elimination monitoring, 335 PAS. See Periodic acid and Schiff’s reagent Passive case detection, 337 PCD. See Passive case detection PCR-restriction fragment length polymorphism assay, 94 PCR-RFLP assay. See PCR-restriction fragment length polymorphism assay P. cynomolgi bastianellii, 328 Pecora, origin of, 62 Pepsin A-like peptidases, 265–267. See also Aspartic peptidases (APs) of trematodes Peptidases APs of trematodes, 261–267 catalysis, chemical mechanisms of, 211 classification of, 208 CPs of trematodes, 228–238 asparaginyl-like peptidases, 258–261 calpain-like peptidases, 256–258 papain-like peptidases, 238–256 MPs of trematodes, 267–272 phylogeny remarks, 277 as potential targets, for chemotherapy, 214 research of, 208–215 SPs of trematodes, 215–220 carboxypeptidase Y-like peptidases, 228 chymotrypsin-like peptidases, 220–228 prolyl-like peptidases, 228 TPs of trematodes, 273–277 Periodic acid and Schiff’s reagent, 25 PGR. See Parasite geographic range Phenotypic markers, for fasciolid characterization, 128 Phenylmethylsulphonyl fluoride, 225 Physa frontinalis, 176 Physa marmorata, 153 Pichia pastoris, 242 PIGR. See Parasite infective geographic range Planorbarius corneus, 53

Index

Plasmodium brasilianum, 310 Plasmodium falciparum, 308 Plasmodium fieldi, 308 Plasmodium gallinaceum, 310 Plasmodium knowlesi, 310 Plasmodium malariae, 310 Plasmodium vivax, 308 PMSF. See Phenylmethylsulphonyl fluoride Polyclonal anti-ESPs, immunohistochemical study by, 188 Polymerase chain reaction (PCR)-based method, 93–94 Polyvinylidene fluoride, 245 Post-domestication period, Fasciola sp. origin, 67 in Africa, 73–77 in Asia, 71–73 eastwards spread in Asia and the Pacific, 83–84 in Europe, 69–71 Fasciola gigantica, spread of, 80 in Near and Middle East, 68–69 northwards spread between Africa and the Near East, 82–83 in Oceania and the Americas, 77–80 recent spread of Fasciola hepatica, 68 westwards and southwards spread in Africa, 80–82 Pre-domestication times, fasciola sp. origin and evolution in, 56–58, 61–67 Pre-ovigerous echinostomes, growth and development of, 178 Prolyl-like peptidases, 228. See also Serine peptidases (SPs) Protein micro-arrays, in anti-malarial antibodies measurment, 302 Protofasciolinae Skrjabin, 1948, genus of, 53 Pseudosuccinea columella, 74 Pseudosuccionea columella, 57 PVDF. See Polyvinylidene fluoride Q Quantitative analysis, fascioliasis, 50 R Radix auricularia, 73 Radix natalensis, 55, 73 Rana clamitans tadpole, echinostomatid metacercariae distribution, 159

361

Index

Rana sylvatica tadpoles echinostomatid metacercariae distribution, 159 echinostome infections, 174 RAPD markers, F. hepatica genetic heterogeneity detection, 93 Recombinant protein technology, 311 RESA. See Ring-infected erythrocyte surface antigen Reverse transcription polymerase chain reaction, 189 Ribeiroia ondatra, 33 Ring-infected erythrocyte surface antigen, 333 RNA interference (RNAi), 240 Rodents infection, Echinostoma spp. in, 184–185 RT-PCR. See Reverse transcription polymerase chain reaction Ruminantia, infra-orders of, 61–62 S Schistosoma bovis, 228 Schistosoma douthitti, 223 Schistosoma flukes, importance of, 206 Schistosoma haematobium, 220, 228 Schistosoma japonicum, 223 DPP III gene of, 272 enterokinaselike peptidase, 227 haemoglobin degradation by, 243 Schistosoma mansoni, 31, 212, 220 analysis of, 249 blast analysis of, 227 cercarial elastase isolation, 222–223 digestion of blood by, 240 DPP III sequences, 272 haemoglobin degradation by, 243 pH in gut content of, 244 postacetabular penetration glands of, 250 pro-cathepsin B1 processing in vitro, 213 sporocyst stage, SmCE in, 224 trans-processing function for, 242 Z-Arg-Arg-AMC substrate in, 243 Schistosomatium douthitti, 220 Schistosome CE biological property and specificity of, 220–222 properties of, 220–221 Schistosomiasis causes of, 206 marker of, 261

SDS-PAGE. See Sodium dodecyl sulphate polyacrylamide gel electrophoresis Serine peptidases (SPs) in MEROPS database, clans and families of, 216–219 of trematodes, 215–220 carboxypeptidase Y-like peptidases, 228 chymotrypsin-like peptidases, 220–228 prolyl-like peptidases, 228 Serological assays, 313–314 malaria control and elimination monitoring central and south America, 337 central El Salvador, 337 Garki Project, Nigeria, 333–334 pacific coast of Costa Rica, 338 Papua New Guinea, 336–337 Pare-Taveta Malaria Scheme, Tanzania, 335 Tanzania, 335–336 malaria endemicity and risk assessment behavioural differences, 332–333 epidemics detection, 330–331 in Ethiopia and South America, 329 in Kabba and Benue Provinces, 314, 328–329 spatial mapping of responses, 332 in Tanzania, 314 in West Africa, 329–330 in malaria eradication and elimination assessment future perspectives of, 343–345 in Greece, 339–340 in Mauritius, 338–339 in Surinam, 340–343 in Tunisia, 343 studies and findings of, 315–327 S1 family of peptidases, activity of, 215, 220 Slide positivity rate, 312 SmCB1 and SmCB2 enzyme, role of, 241 SmCE chymotrypsin-like activity for, 223 pH optimum for, 253 selectivity, AA role in, 223 in S. mansoni sporocyst stage, 224 SmCL2. See also Schistosoma mansoni in S. mansoni cercariae, 250 three-dimensional model of, 247 Sodium dodecyl sulphate polyacrylamide gel electrophoresis, 180

362

Index

Somalia, cattle domestication, 76 South America malaria control and elimination monitoring in, 337 sero-epidemiological studies in, 329 Spirorchis sp., 33 SPR. See Slide positivity rate Surinam, malaria eradication and elimination assessment in, 340–343 Sus cristatus, F. indica in, 56 Syncerus caffer, 57 T Tanzania malaria control and elimination monitoring, 335–336 sero-epidemiological studies, 314 Taurine cattle, origin of, 75 TBC. See Trypsin-bile salts-cysteine TBTO. See Tributyltin Temnocephala chilensis, 156 Thin-layer chromatography (TLC), 32 Thiol-dependent peptidases. See Papain-like peptidases Threonine peptidases (TPs) of trematodes, 273–277. See also Peptidases, of trematodes Th1/Th2 cytokines production, 189 TNF. See Tumour necrosis factor Transmission electron microscopy (TEM), 26 Trematode carboxypeptidase A, MEROPS database, 228 Trematode CLs role of, 251 Z-Phe-Phe-CHN2, 249 Trematode peptidases, AA sequential diversity of, 226 Trematode-snail specificity, 120 Trematodes, peptidases of APs of trematodes, 261–267 CPs of trematodes, 228–238 asparaginyl-like peptidases, 258–261 calpain-like peptidases, 256–258 papain-like peptidases, 238–256 MPs of trematodes, 267–272 phylogeny remarks, 277 research of, 208–215 SPs of trematodes, 215–220 carboxypeptidase Y-like peptidases, 228

chymotrypsin-like peptidases, 220–228 prolyl-like peptidases, 228 TPs of trematodes, 273–277 Tributyltin, 176 Trichobilharzia regenti, 223, 242, 244 CB1, 243 putative CL, 249 Trichobilharzia szidati, 223, 249 Trypsin-bile salts-cysteine, 28 Tumour necrosis factor, 189 Tunisia, malaria eradication and elimination assessment, 343 U UniProtKB database, for S. mansoni enterokinase-like peptidase, 227 V Vertebrate hosts, Z. lunata, 17–19. See also Zygocotyle lunata Vietnam, human fascioliasis, 51. See also Cattle domestication and Fasciola sp. origin W Wardius zibethicus, 3 West Africa, sero-epidemiological studies in, 329–330 World Health Organization (WHO), 44 Z Z-Arg-Arg-AMC peptide substrate, 242–243 Zebra mussels (Dreissena polymorpha), echinostome infections, 173 Zebu Y-chromosome haplotype, in Brazil cattle, 79 Z-Phe-Ala-CHN2, role of, 249 Z-Phe-Arg-AMC peptide substrate, role of, 242 Z-Phe-Phe-CHN2, role of, 249 Zygocotyle ceratosa, 6 Zygocotyle lunata, 2–3 behaviour of, 32 biochemistry of, 32–34 biology of, 6–8 cercarial encystment on, 13–14 and chick chorioallantois, 31–32 diagnosis of, 21

363

Index

ecology of, 34–35 encystment and excystment of, 22–30 epizootiology of, 14–16 future prospectives of, 36 immunology of, 19–21 intermediate hosts of, 8–13 mammalian hosts of, 12 metacercarial cysts, infectivity of, 14

pathology of invertebrate hosts, 16–17 vertebrate hosts, 17–19 taxonomic hierarchy for, 4 treatment and control of, 22 ultra-structure of, 30–31 Zygocotyle, taxonomic survey of, 3–6 Zygocotylidae, taxonomic survey of, 3–6

CONTENTS OF VOLUMES IN THIS SERIES Volume 41 Drug Resistance in Malaria Parasites of Animals and Man W. Peters Molecular Pathobiology and Antigenic Variation of Pneumocystis carinii Y. Nakamura and M. Wada Ascariasis in China P. Weidono, Z. Xianmin and D.W.T. Crompton The Generation and Expression of Immunity to Trichinella spiralis in Laboratory Rodents R.G. Bell Population Biology of Parasitic Nematodes: Application of Genetic Markers T.J.C. Anderson, M.S. Blouin and R.M. Brech Schistosomiasis in Cattle J. De Bont and J. Vercruysse

Volume 42 The Southern Cone Initiative Against Chagas Disease C.J. Schofield and J.C.P. Dias Phytomonas and Other Trypanosomatid Parasites of Plants and Fruit E.P. Camargo Paragonimiasis and the Genus Paragonimus D. Blair, Z.-B. Xu, and T. Agatsuma Immunology and Biochemistry of Hymenolepis diminuta J. Anreassen, E.M. Bennet-Jenkins, and C. Bryant Control Strategies for Human Intestinal Nematode Infections

M. Albonico, D.W.T. Cromption, and L. Savioli DNA Vaocines: Technology and Applications as Anti-parasite and Anti-microbial Agents J.B. Alarcon, G.W. Wainem and D.P. McManus

Volume 43 Genetic Exchange in the Trypanosomatidae W. Gibson and J. Stevens The Host-Parasite Relationship in Neosporosis A. Hemphill Proteases of Protozoan Parasites P.J. Rosenthal Proteinases and Associated Genes of Parasitic Helminths J. Tort, P.J. Brindley, D. Knox, K.H. Wolfe, and J.P. Dalton Parasitic Fungi and their Interaction with the Insect Immune System A. Vilcinskas and P. Go¨tz

Volume 44 Cell Biology of Leishmania B. Handman Immunity and Vaccine Development in the Bovine Theilerioses N. Boulter and R. Hall The Distribution of Schistosoma bovis Sonaino, 1876 in Relation to Intermediate Host Mollusc-Parasite Relationships H. Mone´, G. Mouahid, and S. Morand

365

366

Contents of Volumes in This Series

The Larvae of Monogenea (Platyhelminthes) I.D. Whittington, L.A. Chisholm, and K. Rohde Sealice on Salmonids: Their Biology and Control A.W. Pike and S.L. Wadsworth

Volume 45 The Biology of some Intraerythrocytic Parasites of Fishes, Amphibia and Reptiles A.J. Davies and M.R.L. Johnston The Range and Biological Activity of FMR Famide-related Peptides and Classical Neurotransmitters in Nematodes D. Brownlee, L. Holden-Dye, and R. Walker The Immunobiology of Gastrointestinal Nematode Infections in Ruminants A. Balic, V.M. Bowles, and E.N.T. Meeusen

Volume 46 Host-Parasite Interactions in Acanthocephala: A Morphological Approach H. Taraschewski Eicosanoids in Parasites and Parasitic Infections A. Daugschies and A. Joachim

Volume 47 An Overview of Remote Sensing and Geodesy for Epidemiology and Public Health Application S.I. Hay Linking Remote Sensing, Land Cover and Disease P.J. Curran, P.M. Atkinson, G.M. Foody, and E.J. Milton Spatial Statistics and Geographic Information Systems in Epidemiology and Public Health T.P. Robinson

Satellites, Space, Time and the African Trypanosomiases D.J. Rogers Earth Observation, Geographic Information Systems and Plasmodium falciparum Malaria in Sub-Saharan Africa S.I. Hay, J. Omumbo, M. Craig, and R.W. Snow Ticks and Tick-borne Disease Systems in Space and from Space S.E. Randolph The Potential of Geographical Information Systems (GIS) and Remote Sensing in the Epidemiology and Control of Human Helminth Infections S. Brooker and E. Michael Advances in Satellite Remote Sensing of Environmental Variables for Epidemiological Applications S.J. Goetz, S.D. Prince, and J. Small Forecasting Diseases Risk for Increased Epidemic Preparedness in Public Health M.F. Myers, D.J. Rogers, J. Cox, A. Flauhalt, and S.I. Hay Education, Outreach and the Future of Remote Sensing in Human Health B.L. Woods, L.R. Beck, B.M. Lobitz, and M.R. Bobo

Volume 48 The Molecular Evolution of Trypanosomatidae J.R. Stevens, H.A. Noyes, C.J. Schofield, and W. Gibson Transovarial Transmission in the Microsporidia A.M. Dunn, R.S. Terry, and J.E. Smith Adhesive Secretions in the Platyhelminthes I.D. Whittington and B.W. Cribb The Use of Ultrasound in Schistosomiasis C.F.R. Hatz Ascaris and Ascariasis D.W.T. Crompton


Volume 49

Volume 52

Antigenic Variation in Trypanosomes: Enhanced Phenotypic Variation in a Eukaryotic Parasite H.D. Barry and R. McCulloch

The Ecology of Fish Parasites with Particular Reference to Helminth Parasites and their Salmonid Fish Hosts in Welsh Rivers: A Review of Some of the Central Questions J.D. Thomas

The Epidemiology and Control of Human African Trypanosomiasis J. Pe´pin and H.A. Me´da Apoptosis and Parasitism: from the Parasite to the Host Immune Response G.A. DosReis and M.A. Barcinski Biology of Echinostomes Except Echinostoma B. Fried

367

Biology of the Schistosome Genus Trichobilharzia P. Hora´k, L. Kola´rova´, and C.M. Adema The Consequences of Reducing Transmission of Plasmodium falciparum in Africa R.W. Snow and K. Marsh

The Malaria-Infected Red Blood Cell: Structural and Functional Changes B.M. Cooke, N. Mohandas, and R.L. Coppel

Cytokine-Mediated Host Responses during Schistosome Infections: Walking the Fine Line Between Immunological Control and Immunopathology K.F. Hoffmann, T.A. Wynn, and D.W. Dunne

Schistosomiasis in the Mekong Region: Epidemiology and Phytogeography S.W. Attwood

Volume 53

Volume 50

Molecular Aspects of Sexual Development and Reproduction in Nematodes and Schistosomes P.R. Boag, S.E. Newton, and R.B. Gasser Antiparasitic Properties of Medicinal Plants and Other Naturally Occurring Products S. Tagboto and S. Townson

Volume 51 Aspects of Human Parasites in which Surgical Intervention May Be Important D.A. Meyer and B. Fried Electron-transfer Complexes in Ascaris Mitochondria K. Kita and S. Takamiya Cestode Parasites: Application of In Vivo and In Vitro Models for Studies of the Host-Parasite Relationship M. Siles-Lucas and A. Hemphill

Interactions between Tsetse and Trypanosomes with Implications for the Control of Trypanosomiasis S. Aksoy, W.C. Gibson, and M.J. Lehane Enzymes Involved in the Biogenesis of the Nematode Cuticle A.P. Page and A.D. Winter Diagnosis of Human Filariases (Except Onchocerciasis) M. Walther and R. Muller

Volume 54 Introduction – Phylogenies, Phylogenetics, Parasites and the Evolution of Parasitism D.T.J. Littlewood Cryptic Organelles in Parasitic Protists and Fungi B.A.P. Williams and P.J. Keeling

368


Phylogenetic Insights into the Evolution of Parasitism in Hymenoptera J.B. Whitfield Nematoda: Genes, Genomes and the Evolution of Parasitism M.L. Blaxter Life Cycle Evolution in the Digenea: A New Perspective from Phylogeny T.H. Cribb, R.A. Bray, P.D. Olson, and D.T.J. Littlewood Progress in Malaria Research: The Case for Phylogenetics S.M. Rich and F.J. Ayala Phylogenies, the Comparative Method and Parasite Evolutionary Ecology S. Morand and R. Poulin Recent Results in Cophylogeny Mapping M.A. Charleston Inference of Viral Evolutionary Rates from Molecular Sequences A. Drummond, O.G. Pybus, and A. Rambaut Detecting Adaptive Molecular Evolution: Additional Tools for the Parasitologist J.O. McInerney, D.T.J. Littlewood, and C.J. Creevey

Volume 55

The Mitochondrial Genomics of Parasitic Nematodes of Socio-Economic Importance: Recent Progress, and Implications for Population Genetics and Systematics M. Hu, N.B. Chilton, and R.B. Gasser The Cytoskeleton and Motility in Apicomplexan Invasion R.E. Fowler, G. Margos, and G.H. Mitchell

Volume 57 Canine Leishmaniasis J. Alvar, C. Canãvate, R. Molina, J. Moreno, and J. Nieto Sexual Biology of Schistosomes H. Mone´ and J. Boissier Review of the Trematode Genus Ribeiroia (Psilostomidae): Ecology, Life History, and Pathogenesis with Special Emphasis on the Amphibian Malformation Problem P.T.J. Johnson, D.R. Sutherland, J.M. Kinsella and K.B. Lunde The Trichuris muris System: A Paradigm of Resistance and Susceptibility to Intestinal Nematode Infection L.J. Cliffe and R.K. Grencis Scabies: New Future for a Neglected Disease S.F. Walton, D.C. Holt, B.J. Currie, and D.J. Kemp

Contents of Volumes 28–52 Cumulative Subject Indexes for Volumes 28–52 Contributors to Volumes 28–52

Volume 58

Volume 56

Leishmania spp.: On the Interactions they Establish with Antigen-Presenting Cells of their Mammalian Hosts J.-C. Antoine, E. Prina, N. Courret, and T. Lang

Glycoinositolphospholipid from Trypanosoma cruzi: Structure, Biosynthesis and Immunobiology J.O. Previato, R. Wait, C. Jones, G.A. DosReis, A.R. Todeschini, N. Heise and L.M. Previata Biodiversity and Evolution of the Myxozoa E.U. Canning and B. Okamura

Variation in Giardia: Implications for Taxonomy and Epidemiology R.C.A. Thompson and P.T. Monis Recent Advances in the Biology of Echinostoma species in the ‘‘revolutum’’ Group B. Fried and T.K. Graczyk


Human Hookworm Infection in the 21st Century S. Brooker, J. Bethony, and P.J. Hotez The Curious Life-Style of the Parasitic Stages of Gnathiid Isopods N.J. Smit and A.J. Davies

Volume 59 Genes and Susceptibility to Leishmaniasis Emanuela Handman, Colleen Elso, and Simon Foote Cryptosporidium and Cryptosporidiosis R.C.A. Thompson, M.E. Olson, G. Zhu, S. Enomoto, Mitchell S. Abrahamsen and N.S. Hijjawi Ichthyophthirius multifiliis Fouquet and Ichthyophthiriosis in Freshwater Teleosts R.A. Matthews Biology of the Phylum Nematomorpha B. Hanelt, F. Thomas, and A. SchmidtRhaesa

Volume 60 Sulfur-Containing Amino Acid Metabolism in Parasitic Protozoa Tomoyoshi Nozaki, Vahab Ali, and Masaharu Tokoro The Use and Implications of Ribosomal DNA Sequencing for the Discrimination of Digenean Species Matthew J. Nolan and Thomas H. Cribb Advances and Trends in the Molecular Systematics of the Parasitic Platyhelminthes Peter D. Olson and Vasyl V. Tkach

369

Volume 61 Control of Human Parasitic Diseases: Context and Overview David H. Molyneux Malaria Chemotherapy Peter Winstanley and Stephen Ward Insecticide-Treated Nets Jenny Hill, Jo Lines, and Mark Rowland Control of Chagas Disease Yoichi Yamagata and Jun Nakagawa Human African Trypanosomiasis: Epidemiology and Control E.M. Fe`vre, K. Picozzi, J. Jannin, S.C. Welburn and I. Maudlin Chemotherapy in the Treatment and Control of Leishmaniasis Jorge Alvar, Simon Croft, and Piero Olliaro Dracunculiasis (Guinea Worm Disease) Eradication Ernesto Ruiz-Tiben and Donald R. Hopkins Intervention for the Control of SoilTransmitted Helminthiasis in the Community Marco Albonico, Antonio Montresor, D.W. T. Crompton, and Lorenzo Savioli Control of Onchocerciasis Boakye A. Boatin and Frank O. Richards, Jr. Lymphatic Filariasis: Treatment, Control and Elimination Eric A. Ottesen Control of Cystic Echinococcosis/ Hydatidosis: 1863–2002 P.S. Craig and E. Larrieu

Wolbachia Bacterial Endosymbionts of Filarial Nematodes Mark J. Taylor, Claudio Bandi, and Achim Hoerauf

Control of Taenia solium Cysticercosis/ Taeniosis Arve Lee Willingham III and Dirk Engels

The Biology of Avian Eimeria with an Emphasis on their Control by Vaccination Martin W. Shirley, Adrian L. Smith, and Fiona M. Tomley

Implementation of Human Schistosomiasis Control: Challenges and Prospects Alan Fenwick, David Rollinson, and Vaughan Southgate

370


Volume 62 Models for Vectors and Vector-Borne Diseases D.J. Rogers Global Environmental Data for Mapping Infectious Disease Distribution S.I. Hay, A.J. Tatem, A.J. Graham, S.J. Goetz, and D.J. Rogers Issues of Scale and Uncertainty in the Global Remote Sensing of Disease P.M. Atkinson and A.J. Graham Determining Global Population Distribution: Methods, Applications and Data D.L. Balk, U. Deichmann, G. Yetman, F. Pozzi, S.I. Hay, and A. Nelson Defining the Global Spatial Limits of Malaria Transmission in 2005 C.A. Guerra, R.W. Snow and S.I. Hay The Global Distribution of Yellow Fever and Dengue D.J. Rogers, A.J. Wilson, S.I. Hay, and A.J. Graham

Targeting of Toxic Compounds to the Trypanosome’s Interior Michael P. Barrett and Ian H. Gilbert Making Sense of the Schistosome Surface Patrick J. Skelly and R. Alan Wilson Immunology and Pathology of Intestinal Trematodes in Their Definitive Hosts Rafael Toledo, Jose´-Guillermo Esteban, and Bernard Fried Systematics and Epidemiology of Trichinella Edoardo Pozio and K. Darwin Murrell

Volume 64 Leishmania and the Leishmaniases: A Parasite Genetic Update and Advances in Taxonomy, Epidemiology and Pathogenicity in Humans Anne-Laure Ban˜uls, Mallorie Hide and Franck Prugnolle Human Waterborne Trematode and Protozoan Infections Thaddeus K. Graczyk and Bernard Fried

Global Epidemiology, Ecology and Control of Soil-Transmitted Helminth Infections S. Brooker, A.C.A. Clements and D.A.P. Bundy

The Biology of Gyrodctylid Monogeneans: The ‘‘Russian-Doll Killers’’ T.A. Bakke, J. Cable, and P.D. Harris

Tick-borne Disease Systems: Mapping Geographic and Phylogenetic Space S.E. Randolph and D.J. Rogers

Human Genetic Diversity and the Epidemiology of Parasitic and Other Transmissible Diseases Michel Tibayrenc

Global Transport Networks and Infectious Disease Spread A.J. Tatem, D.J. Rogers and S.I. Hay Climate Change and Vector-Borne Diseases D.J. Rogers and S.E. Randolph

Volume 63 Phylogenetic Analyses of Parasites in the New Millennium David A. Morrison

Volume 65 ABO Blood Group Phenotypes and Plasmodium falciparum Malaria: Unlocking a Pivotal Mechanism Marıá-Paz Loscertales, Stephen Owens, James O’Donnell, James Bunn, Xavier Bosch-Capblanch, and Bernard J. Brabin Structure and Content of the Entamoeba histolytica Genome C. G. Clark, U. C. M. Alsmark, M. Tazreiter, Y. Saito-Nakano, V. Ali,


S. Marion, C. Weber, C. Mukherjee, I. Bruchhaus, E. Tannich, M. Leippe, T. Sicheritz-Ponten, P. G. Foster, J. Samuelson, C. J. Noe¨l, R. P. Hirt, T. M. Embley, C. A. Gilchrist, B. J. Mann, U. Singh, J. P. Ackers, S. Bhattacharya, A. Bhattacharya, A. Lohia, N. Guilleń, M. Ducheˆne, T. Nozaki, and N. Hall Epidemiological Modelling for Monitoring and Evaluation of Lymphatic Filariasis Control Edwin Michael, Mwele N. MalecelaLazaro, and James W. Kazura The Role of Helminth Infections in Carcinogenesis David A. Mayer and Bernard Fried A Review of the Biology of the Parasitic Copepod Lernaeocera branchialis (L., 1767)(Copepoda: Pennellidae Adam J. Brooker, Andrew P. Shinn, and James E. Bron

371

Volume 67 Introduction Irwin W. Sherman An Introduction to Malaria Parasites Irwin W. Sherman The Early Years Irwin W. Sherman Show Me the Money Irwin W. Sherman In Vivo and In Vitro Models Irwin W. Sherman Malaria Pigment Irwin W. Sherman Chloroquine and Hemozoin Irwin W. Sherman Isoenzymes Irwin W. Sherman The Road to the Plasmodium falciparum Genome Irwin W. Sherman Carbohydrate Metabolism Irwin W. Sherman

Volume 66 Strain Theory of Malaria: The First 50 Years F. Ellis McKenzie,* David L. Smith, Wendy P. O’Meara, and Eleanor M. Riley Advances and Trends in the Molecular Systematics of Anisakid Nematodes, with Implications for their Evolutionary Ecology and Host–Parasite Co-evolutionary Processes Simonetta Mattiucci and Giuseppe Nascetti Atopic Disorders and Parasitic Infections Aditya Reddy and Bernard Fried Heartworm Disease in Animals and Humans John W. McCall, Claudio Genchi, Laura H. Kramer, Jorge Guerrero, and Luigi Venco

Pyrimidines and the Mitochondrion Irwin W. Sherman The Road to Atovaquone Irwin W. Sherman The Ring Road to the Apicoplast Irwin W. Sherman Ribosomes and Ribosomal Ribonucleic Acid Synthesis Irwin W. Sherman De Novo Synthesis of Pyrimidines and Folates Irwin W. Sherman Salvage of Purines Irwin W. Sherman Polyamines Irwin W. Sherman New Permeability Pathways and Transport Irwin W. Sherman

372


Hemoglobinases Irwin W. Sherman Erythrocyte Surface Membrane Proteins Irwin W. Sherman Trafficking Irwin W. Sherman Erythrocyte Membrane Lipids Irwin W. Sherman Invasion of Erythrocytes Irwin W. Sherman Vitamins and Anti-Oxidant Defenses Irwin W. Sherman Shocks and Clocks Irwin W. Sherman Transcriptomes, Proteomes and Data Mining Irwin W. Sherman Mosquito Interactions Irwin W. Sherman

Volume 68 HLA-Mediated Control of HIV and HIV Adaptation to HLA Rebecca P. Payne, Philippa C. Matthews, Julia G. Prado, and Philip J. R. Goulder An Evolutionary Perspective on Parasitism as a Cause of Cancer Paul W. Ewald Invasion of the Body Snatchers: The Diversity and Evolution of Manipulative Strategies in Host–Parasite Interactions Thierry Lefe´vre, Shelley A. Adamo, David G. Biron, Dorotheé Misse´, David Hughes, and Fre´de´ric Thomas

Evolutionary Drivers of Parasite-Induced Changes in Insect Life-History Traits: From Theory to Underlying Mechanisms Hilary Hurd Ecological Immunology of a Tapeworms’ Interaction with its Two Consecutive Hosts Katrin Hammerschmidt and Joachim Kurtz Tracking Transmission of the Zoonosis Toxoplasma gondii Judith E. Smith Parasites and Biological Invasions Alison M. Dunn Zoonoses in Wildlife: Integrating Ecology into Management Fiona Mathews Understanding the Interaction Between an Obligate Hyperparasitic Bacterium, Pasteuria penetrans and its Obligate Plant-Parasitic Nematode Host, Meloidogyne spp. Keith G. Davies Host–Parasite Relations and Implications for Control Alan Fenwick Onchocerca–Simulium Interactions and the Population and Evolutionary Biology of Onchocerca volvulus Marıá-Gloria Basań˜ez, Thomas S. Churcher, and Marıá-Eugenia Grillet Microsporidians as Evolution-Proof Agents of Malaria Control? Jacob C. Koella, Lena Lorenz, and Irka Bargielowski

Advances in Parasitology Volume 69

Advances in Parasitology Volume 18

Advances in Parasitology Volume 29

Advances in Parasitology Volume 25

Advances in Parasitology Volume 42

Advances in Parasitology Volume 12

Advances in Parasitology Volume 27

Advances in Parasitology Volume 58

Advances in Parasitology Volume 51

Advances in Parasitology Volume 24

Advances in Parasitology Volume 15

Advances in Parasitology Volume 01

Advances in Parasitology Volume 16

Advances in Parasitology Volume 26

Advances in Parasitology Volume 36

Advances in Parasitology Volume 06

Advances in Parasitology Volume 64

Advances in Parasitology Volume 07

Advances in Parasitology Volume 60

Advances in Parasitology Volume 05

Advances in Parasitology Volume 03

Advances in Parasitology Volume 25

Advances in Parasitology Volume 21

Advances in Parasitology Volume 41

Advances in Parasitology Volume 41

Advances in Parasitology Volume 66

Advances in Parasitology Volume 37

Advances in Parasitology Volume 59

Advances in Parasitology Volume 03

Advances in Parasitology Volume 15

Advances in Parasitology, Volume 71

Advances in Parasitology Volume 69

Advances in Parasitology Volume 18

Advances in Parasitology Volume 29

Advances in Parasitology Volume 25

Advances in Parasitology Volume 42

Advances in Parasitology Volume 12

Advances in Parasitology Volume 27

Advances in Parasitology Volume 58

Advances in Parasitology Volume 51

Advances in Parasitology Volume 24

Advances in Parasitology Volume 15

Advances in Parasitology Volume 01

Advances in Parasitology Volume 16

Advances in Parasitology Volume 26

Advances in Parasitology Volume 36

Advances in Parasitology Volume 06

Advances in Parasitology Volume 64

Advances in Parasitology Volume 07

Advances in Parasitology Volume 60

Advances in Parasitology Volume 05

Advances in Parasitology Volume 03

Advances in Parasitology Volume 25

Advances in Parasitology Volume 21

Advances in Parasitology Volume 41

Advances in Parasitology Volume 41

Advances in Parasitology Volume 66

Advances in Parasitology Volume 37

Advances in Parasitology Volume 59

Advances in Parasitology Volume 03

Advances in Parasitology Volume 15

Advances in Parasitology, Volume 71

Recommend Documents