CCR7

CCR7 Hisayuki Nomiyama1,* and Osamu Yoshie2 1

Department of Biochemistry, Kumamoto University School of Medicine, 2-2-1 Honjo, Kumamoto, 860-0811, Japan 2 Department of Bacteriology, Kinki University School of Medicine, 377-2 Ohno-Higashi, Osaka-Sayama, Osaka, 589-8511, Japan * corresponding author tel: +81-96-373-5065, fax: +81-96-373-5066, e-mail: [email protected] DOI: 10.1006/rwcy.2000.22007.

SUMMARY CCR7, also known as Epstein±Barr virus-induced gene 1 (EBI1) or Burkitt's lymphoma receptor 2 (BLR2), was originally identified as an orphan G protein-coupled receptor. Later, it was found to be a receptor for the CC chemokines ELC/MIP-3 and SLC/6Ckine. CCR7 is mainly expressed on lymphocytes and dendritic cells, and is important in migration of these types of cells to secondary lymphoid tissues. CCR7 may also be involved in viral pathogenesis since the expression of CCR7 is upregulated by infection of lymphocytes and dendritic cells, and is important in migration of these types of cells to secondary lymphoid tissues. CCR7 may also be involved in viral pathogenesis since the expression of CCR7 is upregulated by infection of dendritic cells, and is important in migration of these cell types to secondary lymphoid tissues. CCR7 may also be involved in viral pathogenesis since the expression of CCR7 is upregulated by infection of cells with Epstein-Barr virus (EBV) and T cells with human herpesvirus (HHV) types 6 and 7. The human gene for CCR7 is located on human chromosome 17q12q21.2.

BACKGROUND

Discovery The human CCR7 cDNA was initially cloned as an Epstein±Barr virus (EBV)-inducible gene by subtractive hybridization between EBV-infected Burkitt's

lymphoma (BL) cells and parental EBV-negative BL cells (Birkenbach et al., 1993), and also from activated peripheral blood leukocytes (PBLs) by RT-PCR with degenerate primers based on another orphan receptor BLR1, now identified as CXCR5 (Burgstahler et al., 1995), and termed EBI1 and BLR2, respectively. Schweickart et al. (1994) reported isolation of the human and mouse EBI1 cDNAs by degenerate PCR using genomic DNA. Later, the EBI1/BLR2 was found to be a specific receptor for ELC (EBI1-ligand chemokine; Yoshida et al., 1997) and secondary lymphoid tissue chemokine (SLC; Campbell et al., 1998; Willimann et al., 1998; Yoshida et al., 1998b).

Alternative names Besides EBI1, BLR2 and the official gene symbol CCR7 for this receptor, the nomenclatures such as CMKBR7 (chemokine family receptor 7), CKR7 (chemokine (C±C motif ) receptor 7), and CC±CKR7 have been used in the literature.

Structure CCR7 contains the features common to chemokine receptors: seven hydrophobic transmembrane domains, a pair of cysteines in the second and third extracellular domains, a conserved DRY motif (A/ S)(I/V)DR(Y/F)XXXX (where X represents hydrophobic residues) at the junction of the third transmembrane domain and the second intracellular loop, and potential N-glycosylation sites in the Nterminal extracellular domain.

2088 Hisayuki Nomiyama and Osamu Yoshie

Main activities and pathophysiological roles CCR7 mediates migration of naõÈ ve lymphocytes and antigen-bearing dendritic cells to secondary lymphoid tissues where SLC/6Ckine and ELC/MIP-3 are expressed, and promotes the encounter of these cell types as a first step of immune response (Dieu et al., 1998; Gunn et al., 1998, 1999; Ngo et al., 1998; Pachynski et al., 1998; Sozzani et al., 1998; Tangemann et al., 1998; Willimann et al., 1998; Yanagihara et al., 1998; Chan et al., 1999; Kellermann et al., 1999; Saeki et al., 1999; Sallusto et al., 1999b). When naõÈ ve T cells are activated and differentiated into memory/effector cells, CCR7 expression is downregulated. The memory/effector cells then leave the lymphoid tissues and move to inflamed tissues. Antigenic or polyclonal stimulation of the memory/effector cells upregulate their CCR7 expression and they again migrate into the secondary

lymphoid tissues (Sallusto et al., 1999a). It is assumed that CCR7 is also involved in trafficking of lymphoid progenitors in to the thymus and bone marrow (Kim et al., 1998, 1999; Campbell et al., 1999; Suzuki et al., 1999).

GENE

Accession numbers GenBank: Human cDNA: NM_001838 Mouse cDNA: L31580 Human gene: L31584

Sequence See Figure 1.

Figure 1 Human CCR7. The coding region is shown by upper-case letters. 1 61 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1261 1321 1381 1441 1501 1561 1621 1681 1741 1801 1861 1921 1981 2041 2101

gtgagacaggggtagtgcgaggccgggcacagccttcctgtgtggttttaccgcccagag agcgtcATGGACCTGGGGAAACCAATGAAAAGCGTGCTGGTGGTGGCTCTCCTTGTCATT TTCCAGGTATGCCTGTGTCAAGATGAGGTCACGGACGATTACATCGGAGACAACACCACA GTGGACTACACTTTGTTCGAGTCTTTGTGCTCCAAGAAGGACGTGCGGAACTTTAAAGCC TGGTTCCTCCCTATCATGTACTCCATCATTTGTTTCGTGGGCCTACTGGGCAATGGGCTG GTCGTGTTGACCTATATCTATTTCAAGAGGCTCAAGACCATGACCGATACCTACCTGCTC AACCTGGCGGTGGCAGACATCCTCTTCCTCCTGACCCTTCCCTTCTGGGCCTACAGCGCG GCCAAGTCCTGGGTCTTCGGTGTCCACTTTTGCAAGCTCATCTTTGCCATCTACAAGATG AGCTTCTTCAGTGGCATGCTCCTACTTCTTTGCATCAGCATTGACCGCTACGTGGCCATC GTCCAGGCTGTCTCAGCTCACCGCCACCGTGCCCGCGTCCTTCTCATCAGCAAGCTGTCC TGTGTGGGCATCTGGATACTAGCCACAGTGCTCTCCATCCCAGAGCTCCTGTACAGTGAC CTCCAGAGGAGCAGCAGTGAGCAAGCGATGCGATGCTCTCTCATCACAGAGCATGTGGAG GCCTTTATCACCATCCAGGTGGCCCAGATGGTGATCGGCTTTCTGGTCCCCCTGCTGGCC ATGAGCTTCTGTTACCTTGTCATCATCCGCACCCTGCTCCAGGCACGCAACTTTGAGCGC AACAAGGCCATCAAGGTGATCATCGCTGTGGTCGTGGTCTTCATAGTCTTCCAGCTGCCC TACAATGGGGTGGTCCTGGCCCAGACGGTGGCCAACTTCAACATCACCAGTAGCACCTGT GAGCTCAGTAAGCAACTCAACATCGCCTACGACGTCACCTACAGCCTGGCCTGCGTCCGC TGCTGCGTCAACCCTTTCTTGTACGCCTTCATCGGCGTCAAGTTCCGCAACGATCTCTTC AAGCTCTTCAAGGACCTGGGCTGCCTCAGCCAGGAGCAGCTCCGGCAGTGGTCTTCCTGT CGGCACATCCGGCGCTCCTCCATGAGTGTGGAGGCCGAGACCACCACCACCTTCTCCCCA taggcgactcttctgcctggactagagggacctctcccagggtccctggggtggggatag ggagcagatgcaatgactcaggacatccccccgccaaaagctgctcagggaaaagcagct ctcccctcagagtgcaagccctgctccagaagttagcttcaccccaatcccagctacctc aaccaatgccgaaaaagacagggctgataagctaacaccagacagacaacactgggaaac agaggctattgtcccctaaaccaaaaactgaaagtgaaagtccagaaactgttcccacct gctggagtgaaggggccaaggagggtgagtgcaaggggcgtgggagtggcctgaagagtc ctctgaatgaaccttctggcctcccacagactcaaatgctcagaccagctcttccgaaaa ccaggccttatctccaagaccagagatagtggggagacttcttggcttggtgaggaaaag cggacatcagctggtcaaacaaactctctgaacccctccctccatcgttttcttcactgt cctccaagccagcgggaatggcagctgccacgccgccctaaaagcacactcatcccctca cttgccgcgtcgccctcccaggctctcaacaggggagagtgtggtgtttcctgcaggcca ggccagctgcctccgcgtgatcaaagccacactctgggctccagagtggggatgacatgc actcagctcttggctccactgggatgggaggagaggacaagggaaatgtcaggggcgggg agggtgacagtggccgcccaaggccacgagcttgttctttgttctttgtcacagggactg aaaacctctcctcatgttctgctttcgattcgttaagagagcaacattttacccacacac agataaagttttcccttgaggaaacaacagctttaaaag

CCR7 2089

Cell types and tissues expressing the receptor

PROTEIN

Accession numbers SwissProt: Human: P32248 Mouse: P47774

Sequence See Figure 2.

Description of protein The EBI1 sequence reported by Schweikart et al. (1994) is identical to the BLR2 sequence (Burgstahler et al., 1995) and to the the EBI1 contained in the recently deposited BAC sequence (GenBank accession number AC004585), but differs in three amino acids from the sequence determined by Birkenbach et al. (1993). The above sequence is the one described by Schweikart et al. (1994).

Relevant homologies and species differences CCR7 is most closely related to another CC chemokine receptor, CCR6 (42% amino acid identity). Human and mouse CCR7 are 87% identical.

Affinity for ligand(s) In stable CCR7 transfectants, both SLC and ELC show high and almost identical binding affinity (in the picomolar or nanomolar range) (Yoshida et al., 1998b; Sullivan et al., 1999). However, the binding affinity may vary depending on the cell type used (Yoshida et al., 1998b).

CCR7 mRNA is expressed in PBLs, spleen, thymus, lymph nodes, tonsil, and appendix at high levels, and in small intestine, colon, placenta, bone marrow, and fetal liver at low levels (Birkenbach et al., 1993; Schweikart et al., 1994; Yoshida et al., 1998a). As demonstrated by northern hybridization (Birkenbach et al., 1993; Schweikart et al., 1994; Yoshida et al., 1998a) and responses to ELC and SLC, the cell types expressing CCR7 in these tissues are assumed to be T cells, thymocytes, B cells, dendritic cells, NK cell subsets, and macrophage progenitor cells. It has been reported that some T cell lines (H9, HUT78, CEM, and HSB-2) (Birkenbach et al., 1993; Schweikart et al., 1994), B cell lines (Raji, HS602, and Jijoyve; Schweikart et al., 1994) and NK cell lines (NKL and YT-INDY) (Kim et al., 1999) express CCR7 mRNA. The expression of CCR7 on dendritic cells in the peripheral tissues is strongly induced upon maturation (Dieu et al., 1998; Sallusto et al., 1998b; Sozzani et al., 1998; Yanagihara et al., 1998; Saeki et al., 1999). Recently, it has been reported that there is no difference in the CCR7 expression between mature and immature dendritic cells in mice (Kellermann et al., 1999; Ogata et al., 1999; Zhang et al., 1999). In thymus, CCR7 is expressed on single-positive and positively selected double-positive thymocytes that are migrating from the cortex to the medulla (Campbell et al., 1999; Suzuki et al., 1999). Using the gene-trapping method, Steel et al. (1998) identified CCR7 expressed in the mouse hippocampus. They showed by in situ hybridization that CCR7 is expressed in neurons of the central nervous system.

Regulation of receptor expression Epstein±Barr virus infection of B cells strongly induces CCR7, and this upregulation was shown to be due to transactivation by EBV nuclear antigen 2 (Burgstahler et al., 1995). The CCR7 mRNA was also

Figure 2 Human CCR7. The possible signal peptide sequence is underlined. 1 61 121 181 241 301 361

MDLGKPMKSV LPIMYSIICF SWVFGVHFCK GIWILATVLS FCYLVIIRTL SKQLNIAYDV IRRSSMSVEA

LVVALLVIFQ VGLLGNGLVV LIFAIYKMSF IPELLYSDLQ LQARNFERNK TYSLACVRCC ETTTTFSP

VCLCQDEVTD LTYIYFKRLK FSGMLLLLCI RSSSEQAMRC AIKVIIAVVV VNPFLYAFIG

DYIGDNTTVD TMTDTYLLNL SIDRYVAIVQ SLITEHVEAF VFIVFQLPYN VKFRNDLFKL

YTLFESLCSK AVADILFLLT AVSAHRHRAR ITIQVAQMVI GVVLAQTVAN FKDLGCLSQE

KDVRNFKAWF LPFWAYSAAK VLLISKLSCV GFLVPLLAMS FNITSSTCEL QLRQWSSCRH

2090 Hisayuki Nomiyama and Osamu Yoshie shown to be induced in CD4+ T cells by human herpesvirus 6 or 7 infection (Hasegawa et al., 1994). CCR7 expression is also upregulated by stimulation with IL-2 or PHA or both (Willimann et al., 1998; Yoshida et al., 1998a) and by treatment with TGF (Sallusto et al., 1998a).

SIGNAL TRANSDUCTION

Cytoplasmic signaling cascades The signaling from CCR7 is mediated by a pertussis toxin-sensitive heterotrimeric GTP-binding protein pathway. Recently, Sullivan et al. (1999) demonstrated that activation of MAP kinase enzyme is involved in the signal transduction cascade.

BIOLOGICAL CONSEQUENCES OF ACTIVATING OR INHIBITING RECEPTOR AND PATHOPHYSIOLOGY

Unique biological effects of activating the receptors The in vivo and in vitro analyses of CCR7 and its ligands have demonstrated that CCR7 plays a major role in the homing of lymphocytes and dendritic cells.

References Birkenbach, M., Josefsen, K., Yalamanchili, R., Lenoir, G., and Kieff, E. (1993). Epstein±Barr virus-induced genes: first lymphocyte-specific G protein-coupled peptide receptors. J. Virol. 67, 2209±2220. Burgstahler, R., Kempkes, B., Steube, K., and Lipp, M. (1995). Expression of the chemokine receptor BLR2/EBI1 is specifically transactivated by Epstein±Barr virus nuclear antigen 2. Biochem. Biophys. Res. Commun. 215, 737±743. Campbell, J. J., Bowman, E. P., Murphy, K., Youngman, K. R., Siani, M. A., Thompson, D. A., Wu, L., Zlotnik, A., and Butcher, E. C. (1998). 6-C-kine (SLC), a lymphocyte adhesion-triggering chemokine expressed by high endothelium, is an agonist for the MIP-3 receptor CCR7. J. Cell Biol. 141, 1053±1059. Campbell, J. J., Pan, J., and Butcher, E. C. (1999). Developmental switches in chemokine responses during T cell maturation. J. Immunol. 163, 2353±2357. Chan, V. W., Kothakota, S., Rohan, M. C., PanganibanLustan, L., Gardner, J. P., Wachowicz, M. S., Winter, J. A., and Williams, L. T. (1999). Secondary lymphoid-tissue chemokine (SLC) is chemotactic for mature dendritic cells. Blood 93, 3610±3616.

Dieu, M. C., Vanbervliet, B., Vicari, A., Bridon, J. M., Oldham, E., Ait-Yahia, S., Briere, F., Zlotnik, A., Lebecque, S., and Caux, C. (1998). Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites. J. Exp. Med. 188, 373±386. Hasegawa, H., Utsunomiya, Y., Yasukawa, M., Yanagisawa, K., and Fujita, S. (1994). Induction of G protein-coupled peptide receptor EBI1 by human herpesvirus 6 and 7 infection in CD4+ T cells. J. Virol. 68, 5326±5329. Kellermann, S. A., Hudak, S., Oldham, E. R., Liu, Y. J., and McEvoy, L. M. (1999). The CC chemokine receptor-7 ligands 6Ckine and macrophage inflammatory protein-3 are potent chemoattractants for in vitro- and in vivo-derived dendritic cells. J. Immunol. 162, 3859±3864. Kim, C. H., Pelus, L. M., White, J. R., and Broxmeyer, H. E. (1998). Macrophage-inflammatory protein-3 /EBI1-ligand chemokine/CK -11, a CC chemokine, is a chemoattractant with a specificity for macrophage progenitors among myeloid progenitor cells. J. Immunol. 161, 2580±2585. Kim, C. H., Pelus, L. M., Appelbaum, E., Johanson, K., Anzai, N., and Broxmeyer, H. E. (1999). CCR7 ligands, SLC/ 6Ckine/Exodus2/TCA4 and CK -11/MIP-3 /ELC, are chemoattractants for CD56(+)CD16(ÿ) NK cells and late stage lymphoid progenitors. Cell. Immunol. 193, 226±235. Ogata, M., Zhang, Y., Wang, Y., Itakura, M., Zhang, Y. Y., Harada, A., Hashimoto, S., and Matsushima, K. (1999). Chemotactic response toward chemokines and its regulation by transforming growth factor- 1 of murine bone marrow hematopoietic progenitor cell-derived different subset of dendritic cells. Blood 93, 3225±3232. Pachynski, R. K., Wu, S. W., Gunn, M. D., and Erle, D. J. (1998). Secondary lymphoid-tissue chemokine (SLC) stimulates integrin 4 7-mediated adhesion of lymphocytes to mucosal addressin cell adhesion molecule-1 (MAdCAM-1) under flow. J. Immunol. 161, 952±956. Saeki, H., Moore, A. M., Brown, M. J., and Hwang, S. T. (1999). Secondary lymphoid-tissue chemokine (SLC) and CC chemokine receptor 7 (CCR7) participate in the emigration pathway of mature dendritic cells from the skin to regional lymph nodes. J. Immunol. 162, 2472±2475. Sallusto, F., Lenig, D., Mackay, C. R., and Lanzavecchia, A. (1998a). Flexible programs of chemokine receptor expression on human polarized T helper 1 and 2 lymphocytes. J. Exp. Med. 187, 875±883. Sallusto, F., Schaerli, P., Loetscher, P., Schaniel, C., Lenig, D., Mackay, C. R., Qin, S., and Lanzavecchia, A. (1998b). Rapid and coordinated switch in chemokine receptor expression during dendritic cell maturation. Eur. J. Immunol. 28, 2760± 2769. Sallusto, F., Palermo, B., Lenig, D., Miettinen, M., Matikainen, S., Julkunen, I., Forster, R., Burgstahler, R., Lipp, M., and Lanzavecchia, A. (1999b). Distinct patterns and kinetics of chemokine production regulate dendritic cell function. Eur. J. Immunol. 29, 1617±1625. Schweickart, V. L., Raport, C. J., Godiska, R., Byers, M. G., Eddy, R.L. Jr., Shows, T. B., and Gray, P. W. (1994). Cloning of human and mouse EBI1, a lymphoid-specific Gprotein-coupled receptor encoded on human chromosome 17q12-q21.2. Genomics 23, 643±650. Sozzani, S., Allavena, P., D'Amico, G., Luini, W., Bianchi, G., Kitaura, M., Imai, T., Yoshie, O., Bonecchi, R., and Mantovani, A. (1998). Differential regulation of chemokine receptors during dendritic cell maturation: a model for their trafficking properties. J. Immunol. 161, 1083±1086.

CCR7 2091 Steel, M., Moss, J., Clark, K. A., Kearns, I. R., Davies, C. H., Morris, R. G., Skarnes, W. C., and Lathe, R. (1998). Gene-trapping to identify and analyze genes expressed in the mouse hippocampus. Hippocampus. 8, 444±457. Sullivan, S. K., McGrath, D. A., Grigoriadis, D., and Bacon, K. B. (1999). Pharmacological and signaling analysis of human chemokine receptor CCR-7 stably expressed in HEK-293 cells: high-affinity binding of recombinant ligands MIP-3beta and SLC stimulates multiple signaling cascades. Biochem. Biophys. Res. Commun. 263, 685±690. Suzuki, G., Sawa, H., Kobayashi, Y., Nakata, Y., Nakagawa, K., Uzawa, A., Sakiyama, H., Kakinuma, S., Iwabuchi, K., and Nagashima, K. (1999). Pertussis toxin-sensitive signal controls the trafficking of thymocytes across the corticomedullary junction in the thymus. J. Immunol. 162, 5981±5985. Tangemann, K., Gunn, M. D., Giblin, P., and Rosen, S. D. (1998). A high endothelial cell-derived chemokine induces rapid, efficient, and subset-selective arrest of rolling T lymphocytes on a reconstituted endothelial substrate. J. Immunol. 161, 6330±6337. Willimann, K., Legler, D. F., Loetscher, M., Roos, R. S., Delgado, M. B., Clark-Lewis, I., Baggiolini, M., and Moser, B. (1998). The chemokine SLC is expressed in T cell areas of lymph nodes and mucosal lymphoid tissues and attracts activated T cells via CCR7. Eur. J. Immunol. 28, 2025±2034.

Yanagihara, S., Komura, E., Nagafune, J., Watarai, H., and Yamaguchi, Y. (1998). EBI1/CCR7 is a new member of dendritic cell chemokine receptor that is up-regulated upon maturation. J. Immunol. 161, 3096±3102. Yoshida, R., Imai, T., Hieshima, K., Kusuda, J., Baba, M., Kitaura, M., Nishimura, M., Kakizaki, M., Nomiyama, H., and Yoshie, O. (1997). Molecular cloning of a novel human CC chemokine EBI1-ligand chemokine that is a specific functional ligand for EBI1, CCR7. J. Biol. Chem. 272, 13803±13809. Yoshida, R., Nagira, M., Imai, T., Baba, M., Takagi, S., Tabira, Y., Akagi, J., Nomiyama, H., and Yoshie, O. (1998a). EBI1-ligand chemokine (ELC) attracts a broad spectrum of lymphocytes: activated T cells strongly up-regulate CCR7 and efficiently migrate toward ELC. Int. Immunol. 10, 901±910. Yoshida, R., Nagira, M., Kitaura, M., Imagawa, N., Imai, T., and Yoshie, O. (1998b). Secondary lymphoid-tissue chemokine is a functional ligand for the CC chemokine receptor CCR7. J. Biol. Chem. 273, 7118±7122. Zhang, Y., Zhang, Y. Y., Ogata, M., Chen, P., Harada, A., Hashimoto, S., and Matsushima, K. (1999). Transforming growth factor- 1 polarizes murine hematopoietic progenitor cells to generate Langerhans cell-like dendritic cells through a monocyte/macrophage differentiation pathway. Blood 93, 1208±1220.