Biotechnology Annual Review, Volume 3

Biotechnology Annual Review Volume 3

This Page Intentionally Left Blank

Biotechnology Annual Review Volume 3

Editor:

M. Raafat El-Gewely Department of Biotechnolgy University of Tromsra Tromsra, Norway

1997 ELSEVIER Amsterdam -Lausanne -New York - Oxford - Shannon -Tokyo

01997Elsevier ScienceB.V. All rights reserved. No part of this publicationmay be reproduced, stored in a retrievalsystem or transmittedin any form or by any means, electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher, Elsevier Science B.V., Permissions Department, PO.Box 521, 1000 AM Amsterdam,TheNetherlands. No responsibilityis assumed by the Publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from use or operation of any methods, products, instructionsor ideas containedin the material herein. Because ofrapid advancesin the medical sciences, the Publisher recommendsthat independentverificationofdiagnosesand drugdosagesshouldbe made. Special regulationsfor readers in the USA - This publication has been registeredwith the Copyright Clearance Center Inc. (CCC), 222 Rosewood Drive, Danvers, MA 01923, USA. Information can be obtained from the CCC about conditionsunder which photocopies of parts of this publication may be made in the USA. All other copyright questions, including photocopying outside the USA should be referred to the copyright owner, Elsevier ScienceBY, unless otherwise specified.

ISBN 0-444-82773-0 This book isprintedon acid-freepaper. Published by: Elsevier ScienceB.V. PO.Box211 1000AE Amsterdam The Netherlands

In order to ensure rapid publication this volume was prepared using a method ofelectronictext processing known as Optical Character Recognition (OCR). Specific accuracy and consistencyof style were handled by the author.Time did not allow for the usual extensive editingprocess ofthe Publisher. Printed inThe Netherlands

V

Preface This series, as the title implies, aims at covering the development in the field of biotechnology in the form of comprehensive, illustrated and well-referenced reviews. With the expansion in the field of biotechnology both in industry as well as in education, coupled with the increase in the number of new journals reporting new results in the field, the need for a publication that is continuously providing reviews is urgent. The goal of Biotechnology Annual Review is to fill this gap. Naturally, all aspects of biotechnology cannot be reviewed extensively in each issue every year, but each volume will have a number of reviews covering different aspects of biotechnology Reviewed topics will include biotechnology applications in medicine, agriculture, marine biology, industry, bioremediation and the environment. Fundamental problems dealing with enhancing the technical knowledge encountering biotechnology utilization, regardless of the field of application, will be emphasized. Examples of such vital topics are promoters, vectors, media, induction, genetic stabilization during heterologous gene expression, and any relevant new technique. Essential information dealing with the utilization of data banks, such as protein and nucleic acid data banks, will be reviewed. Homology studies as related to biotechnology, as well as issues dealing with the characterization of motifs and motif databases will also be dealt with. New developments in protein engineering, optimization of protein function, and protein design will be addressed. Problems dealing with protein functionality are important not only for the production of active recombinant proteins and enzymes, but also for the purpose of drug development and design based on screening using such proteins, whether by employing in vitro or in vivo assays. Newly discovered open reading frames or proteins identified by two-dimensional gel electrophoresis will be updated whenever possible*. Other issues, dealing with policy and regulation of biotechnology as well as the problems of development in developing countries, as related to biotechnology, will be included in the various issues. The “Editorial Board” of Biotechnology Annual Review encourages suggestions and contributions of articles from industry or from academic institutions that would constitute a comprehensive covering of a relevant topic in biotechnology. Please contact me or any of the editorial board members for any suggestions about chapter contributions. M. Raafat El-Gewely, PhD Professor of Biotechnology Institute of Medical Biology University of Tromss, 9037 Tromss, Norway Tel.: +47-776-44654. Fax: +47-776-45350 E-mail: [email protected] *Downstream processing, purification and scale-up operations are of great interest.

This Page Intentionally Left Blank

vii

Biotechnology Annual Review Volume 3 Editor

Dr M.R. El-Gewely Department of Biotechnology Institute of Medical Biology University of Tromse MH-Bygget 9037 Tromspl Norway Tel.: +47-77-64-46-54 Fax: +47-77-64-53-50 Associate editors

Dr Thomas M.S. Chang Artificial Cells & Organs Research Centre McGill, 3655 Drummond St. Room 1005 Montreal, Quebec Canada H3G 1Y6 Tel.: + 1-514-398-3512 Fax: + 1-514-398-4983

Dr E Felici IRBM P Angeletti Via Pontina km 30.600 00040 Pomezia, Rome, Italy Tel.: +39-672-594/319(office)/307(lab.) Fax: +39-620-23500 Dr Shigehiro Hirano Department of Agricultural Biochemistry and Biotechnology Tottori University Tottori 680, Japan Tel.: +81-857-280321 (ext. 5200) Fax: +8 1-857-315347 Dr Kuniyo Inouye Department of Food Science and Technology Faculty of Agriculture Kyoto University Sakyo-ku, Kyoto 606-01 Japan Tel.: +81-75-753-6267 Fax: +81-75-753-6265

Dr Thomas T. Chen Biotechnology Center University of Conneticut 184 Auditorium Road U-149 Storrs CT 06269-3149, USA Tel.: +1-203-486-5011/5012 Fax: +1-203-486-5005

Dr Guido Krupp Institut fur Allgemeine Mikrobiologie Christian-Albrechts-Universitat Am Botanischen Garten 9 D-24118 Kiel, Germany Tel.: +49-431-880-4330 Fax: +49-431-880-2194

Dr. Roy H. Doi Section of Biochemistry and Biophysics University of California, Davis Davis, CA 95616-8535, USA Tel.: +1-916-752-3191 Fax: + 1-916-752-3085

Dr Eric Olson Department of Biotechnology Warner-Lambert, 2800 Plymouth Road Ann Arbor MI 48105, USA Tel.: +1-3 13-998-5961 Fax: +1-313-998-5970

...

Vlll

Dr Steffen B. Petersen Department of Biotechnology Aalborg University 9000-Aalborg, Denmark Tel.: +49-459-635-8469 Fax: +49-459-814-2555

G. Kristen Rosendal The Fridtjof Nansen Institute PO. Box 326 1324 Lysaker, Norway Tel.: +47-67-53-89-12 Fax: +47-67-12-50-47

Dr Jack Preiss Department of Biochemistry Michigan State University Biochemistry Building East Lancing, MI 48824-1319 USA Tel.: +1-517-353-3137 Fax: +1-517-353-9334

Dr Shiva M. Singh Department of Zoology and Division of Medical Genetics 307 Western Science Centre The University of Western Ontario London, Ontario, Canada N6A 5B7 Tel.: +1-519-661-3135 Fax: + 1-519-661-2014

ix

List of contributors Dr J. William Anderson Plant Biotechnology Institute National Research Council of Canada 110 Gymnasium Place Saskatoon, Saskatchewan Canada S7N OW9 Tel.: +1-306-975-5248 Fax: +1-306-975-4839 Dr Marcel B. Sally Department of Advanced Therapeutics British Columbia Cancer Agency Vancouver British Columbia Canada Dr Raju Datla Plant Biotechnology Institute National Research Council of Canada 110 Gymnasium Place Saskatoon, Saskatchewan Canada S7N OW9 Rl.: +1-306-975-5248 Fax: +1-306-975-4839

Dr Marc Giband Laboratoire de biologie cellulaire INRA Centre de Versailles Versailles Cedex France Peik Haugen Department of Molecular Cell Biology Institute of Medical Biology University of Tromsnr N-9037, Norway Tel.: +47-77-64-53-67 Fax: +47-77-64-53-50 Dr Finn Haugli Department of Molecular Cell Biology Institute of Medical Biology University of Tromss N-9037, Norway Tel.: +47-77-64-47-19 Fax: +47-77-64-53-50 E-mail: [email protected]

Christer Einvik Department of Molecular Cell Biology Institute of Medical Biology University of Tromsnr N-9037, Norway Rl.: +47-77-64-47-18 Fax: +47-77-64-53-50

Dr Boglarka Kajuk Wageningen Agricultural University Department of Food Science Food and Bioprocess Engineering Group PO.Box 8129 6700 EV Wageningen The Netherlands Telefax: +3 1-317-48223

Morton Elde Department of Molecular Cell Biology Institute of Medical Biology University of Tmmsnr N-9037, Norway Rl.: +47-77-64-53-67 Fax: +47-77-64-53-50

Dr H. Kreipe Institute of Pathology University of Wiirzburg Josef-Schneider-Str.2 D-97080 Wurzburg Germany Fax: +49-931-201-3440

X

Dr Ravinder K. Jain Plant Biotechnology Institute National Research Council of Canada Saskatoon, Saskatchewan Canada S7N OW9 Tel.: +1-306-975-5495 Fax: +1-306-975-4839 E-mail: [email protected] Dr S. Johansen Department of Molecular Cell Biology Institute of Medical Biology University of Tromsra N-9037, Norway Tel.: +47-77-64-53-67 Fax: +47-77-64-53-50 E-mail: [email protected] Dr Lise Jouanin Laboratoire de biologie cellulaire INRA Centre de Versailles Versailles Cedex France Dr Tiziana Maggi Sezione di Microbiologia Dipartimento di Biologia Molecolare Universita di Siena Siena Italy Dr Riccardo Manganelli Sezione di Microbiologia Dipartimento di Biologia Molecolare Universita di Siena Siena Italy Dr Vftor A.P. Martinos dos Santos Wageningen Agricultural University Department of Food Science Food and Bioprocess Engineering Group PO.Box 8129 6700 EV Wageningen The Netherlands Tel.: +31-317-484372 Fax: +31-317-482237

Dr Marianne Mazier Station d'amklioration des plantes maraichires INRA, BP 94 84143 Montfavet Cedex France Fax: +33-90-31-63-98 Dr Donata Medaglini Microbiologia/Universitl di Siena Via Laterina 8 53100 Siena, Italy Tel.: +39-577-26-3874 Fax: +39-577-26-3870 Dr S. Muller-Deubert Institute of Pathology University of Wiirzburg Josef-Schneider-Str.2 D-97080 Wiirzburg Germany Fax: +49-931-201-3440 Dr Thomas Munder Hans-Knoll-Institut fur Naturstoff-Forschunge.K Department of Cell and Molecular Biology Beutenbergstr. 11 D-07745 Jena Germany Tel.: +49-3641-65-66-92 Fax: +49-3641-65-66-94 E-mail: [email protected] Dr Milena Ninkovic Department of Cell and Molecular Biology Hans-Knoll-Institut fur Natursoff-Forschunge.K, Jena Germany Dr Catherine Pannetier Laboratoire de biologie cellulaire INRA Centre de Versailles Versailles Cedex France

xi Dr Gianni Pozzi Sezione di Microbiologia Dipartimento di Biologia Molecolare Universiti di Siena Siena, Italy Dr Marco R. Oggioni Sezione di Microbiologia Dipartimento di Biologia Molecolare Universita di Siena Siena, Italy Dr Dorothy L. Reimer Department of Advanced Therapeutics British Columbia Cancer Agency 600 West 10th Ave.,Vancouver British Columbia, Canada V5Z 4E6 Tel.: +1-604-877-6010/3155 Fax: +1-604-877-6011 E-mail: [email protected] Dr Susanna Ricci Sezione di Microbiologia Dipartimento di Biologia Molecolare Universiti di Siena Siena, Italy Dr Vincenzo Romano-Spica Institute of Hygiene and Public Health Faculty of Medicine of the Catholic University L.E Vito 1, Rome 00168, Italy Tel.: +39-6-30154396 Fax: +39-6-3058202 E-mail: [email protected] Dr Biirbel Rudakoff Department of Cell and Molecular Biology Hans-Knoll-Institut fur Natursoff-Forschung e.V Jena, Germany Dr Catherine M. Rush Sezione di Microbiologia Dipartimento di Biologia Molecolare Universita di Siena Siena, Italy

Dr Hiroshi Sano Nara Institute of Science and Technology Ikoma, Nara 630-01 Japan Fax: +81-298-38-7044 Dr Shigemo Seo Nara Institute of Science and Technology Ikoma, Nara 630-01 Japan Fax: +81-298-38-7044 Dr Gopalan Selvaraj Plant Biotechnology Institute National Research Council of Canada Saskatoon, Saskatchewan Canada S7N OW9 Tel.: +1-306-975-5495 Fax: +1-306-975-4839 E-mail : [email protected] Dr S.M. Singh Department of Zoology and Division of Medical Genetics 307 Western Science Center University of Western Ontario London, Ontario Canada N6A 5B7 Tel.: + 1-519-661-3135 Fax: + 1-519-661-2014 E-mail: [email protected] Dr Jacques Tourneur Laboratoire de biologie cellulaire INRA, Centre de Versailles Versailles Cedex France Dr Johannes Tramper Wageningen Agricultural University Department of Food Science Food and Bioprocess Engineering Group PO. Box 8129,6700 EV Wageningen The Netherlands Fax: +31-317-48223

xii Anna Vader Department of Molecular Cell Biology Institute of Medical Biology University of Tromse N-9037, Tromse Norway Tel.: +47-77-64-47-18 Fax: +47-77-64-53-50 Dr Vikram N. Vakharia Center for Agricultural Biotechnology University of Maryland Biotechnology Institute MD 20742-37 1 1 USA Fax: + 1-301-935-6079

Dr Tatjana Vasilevska Wageningen Agricultural University Department of Food Science Food and Bioprocess Engineering Group PO. Box 8129, 6700 EV Wageningen The Netherlands Telefax: +31-317-48223 Dr Jan Vijg Division on Aging Harvard Medical School and Gerontology Division Beth Israel Hospital 330 Brookline Avenue Boston, MA 02215 USA

...

Xlll

Contents Preface Two-dimensional DNA electrophoresis: state of the art and applications K Romano-Spica and J Vijg The two-hybrid system in yeast: applications in biotechnology and basic research I: Munder, M. Ninkovic and B. Rudakoff Human gene therapy: principles and modern advances D. L. Reimer, M. B. Bally and S.M Singh Group I introns in biotechnology: prospects of application of ribozymes and rare- cutting homing endonucleases S. Johansen, C. Einvik, M. Elde, E! Haugen, A. Vader and l? Haugli Development of recombinant vaccines against infectious bursal disease KN Vakharia Molecular methods in diagnostic pathology S. Muller-Deubert and H. Kreipe Transgenic manipulation of signaling pathways of plant resistance to pathogen attack S. Seo, H Sano and X Ohashi Production and characterization of double-layer beads for coimmobilization of microbial cells Tramper VA.R Martins dos Santos, I: Vasilevska, B. Kajuk, .l and R.H. Wiyfels Molecular genetic improvement of salt tolerance in plants R.K. Jain and G. Selvaraj Plant promoters for transgene expression R. Datla, J William Anderson and G. Selvaraj Recombinant Gram-positive bacteria as vehicles of vaccine antigens D. Medaglini, S. Ricci, I: Maggi, C.M. Rush, R. Manganelli, M. R. Oggioni and G. Pozzi The expression of Bacillus thuringiensis toxin genes in plant cells M. Mazier, C. Pannetier, J Tourneur, L. Jouanin and M. Giband

V

1

31 59 111 151 169 197

227 245 269 297 313

Index of Authors

349

Keyword index

35 1

This Page Intentionally Left Blank

01997 Elsevier Science B.V. All rights reserved. Biotechnology Annual Review Volume 3 M.R. El-Gewely, editor.

1

Two-dimensional DNA electrophoresis: state of the art and applications Vincenzo Romano-Spica' and Jan Vijg2 'Institute of Hygiene and Public Health, Dir Prof: G.C. Vanini, Faculty of Medicine of the Catholic Universitj Rome, Italy; Division on Aging, Harvard Medical School and Gerontology Division, Beth Israel Hospital, Boston, USA

Abstract. Two-dimensional DNA electrophoresis allows the analysis of multiple DNA fragments based on both their size and sequence properties. The often complex gel separation patterns represent information-rich data sets that may be analyzed with dedicated image analysis systems. The introduction of a denaturing gradient in the second dimension enhances the capability of the method to identi@sequence variations, and the recent construction of automated instruments opens up new ways for the diffusion of the procedure into the laboratory routine. In this review, the state of the art of the technique, its general principles and basic methodology will be discussed together with major applications in different fields, including environmentalmicrobiology, mutation detection and human genetics. Keywords: denaturing gradient gel electrophoresis (DGGE), DNA polymorphism, DNA fingerprinting, gene mutation, gene scanning, genetic variation, genetic typing, genetic epidemiology, genetics, genome scanning, genotoxicity, heteroduplex analysis, hospital infection, linkage, microbiology, mutation detection, mutational spectroscopy, polymerase chain reaction, restriction fragment length polymorphism, tumor analysis, two-dimensional DNA electrophoresis.

Introduction The recent explosive development of molecular biology has opened original and productive lines of research in different disciplines. The possibility of investigating genetics and cell biology at a molecular level has created a growing demand of more informative and efficient methods of analysis. Genotyping has become an important approach in medical genetics, forensic medicine, microbiology, as well as in the characterization of animal and plant species. Genome projects for human, animals, plants and microorganisms, require and depend upon the availability of rapid and cost-effective methods for large-scale analysis of individual DNA sequence variation. For this purpose, nucleotide sequencing will not sufice. Indeed, even if the determination of nucleotide sequence would provide the ultimate tool, it requires dramatic improvements to become routinely applicable for genome scanning or screening purposes [1-31. More rapid methods for sequencing have been suggested, but are still under development [4- lo]. Address for correspondence: Dr Vincenzo Romano-Spica, Institute of Hygiene and Public Health, Faculty of Medicine of the Catholic University, L.F. Vito 1, Rome, 00168, Italy. Tel.: +39-630154396. Fax: +39-6-3058202. E-Mail: [email protected]

2 Sequencing methods provide much unnecessary information, since virtually all of the comparatively analyzed sequence may appear identical. The development of techniques that are able to identify deviations from a particular wild-type sequence of interest, in a sensitive and specific manner, is therefore opportune. Several approaches for mutational scanning have been adopted, such as restriction fragment length polymorphism (RFLP) analysis [11-131, hybridization analysis [14- 161, single-strand conformation polymorphism (SSCP) analysis [171 and denaturing gradient gel electrophoresis (DGGE) [18]. To date, methods to detect DNA sequence variation have been mostly based on the possibility of recognizing differences in the size of the fragments to be analyzed (RFLP) or in their nucleotide sequence by exploiting physical properties as intrastrand interactions (SSCP), melting behavior (DGGE), and ability to form an heteroduplex molecule with a labeled nucleic acid probe (hybridization). Two-dimensional DNA electrophoresis is a procedure originally described by Fischer and Lerman in a paper published in the January 1979 issue of Cell [181. It combines size separation in polyacrylamide or agarose gel (first dimension) with sequence separation of the fragments in a DGGE gel (second dimension), finally generating a panel of spots on a gel instead of a succession of bands in a lane (Fig. 1) [19,20]. Each spot is determined by the nucleotide number and the melting temperature of the fragment. Other forms of two-dimensional DNA electrophoresis, based on different separation criteria, have been described, but although they are able to reveal minute differences, they achieve only a low resolution and/or are impractical [20,21]. In general, when identical separation criteria are used in twodimensional electrophoresis the fragments would cluster along a straight diagonal (Fig. 2A). Restriction enzyme or S1 nuclease digestion have been used as a basic principle for the second dimension separation criterion [21,22]. This procedure necessitates the incubation of the first dimension gel with a solution containing the modifjling enzyme, followed by an electrophoretic run in the second dimension. This approach is still based on size separation in both dimensions and generates a pattern of spots only within a restricted area of the gel below the above-mentioned diagonal (Fig. 2B,C). Even if only half of the gel area can be used for the resolution of the fragments, several hundreds of spots can still be detected using this enzyme-digestion approach. Protocol modifications have been applied as electroblotting, endlabeling of the fragments, pulsed field gel electrophoresis or field inversion gel electrophoresis [23-291. This general approach has been used to analyse and isolate repetitive sequences in Drosophila DNA [30,31], and to estimate genome sizes of simple prokaryotic organisms [22,25,32-341. Analysis of more complex genomes has been facilitated by transferring the separation pattern onto a membrane and by subsequent hybridization analysis [23,24,35-371. As in two-dimensional protein electrophoresis the key point in determining the effectiveness of two-dimensional DNA electrophoresis is an independent separation criterion in the second dimension (Fig. 2D). Several approaches have been

Mrst dimenslon

B

I

IICB B B B I B

D

0

A

First dimension

G 0

0

F

0 0

C

-

3

.

0

E

Fig. I. Two-dimensional DNA electrophoresis, according to Fischer and Lerman [18,19]. A: Schematic depiction - first dimension is on the basis of fragment size and an agarose or polyacrylamide gel is used for separation. A denaturing gradient gel is used for the second dimension and DNA fragments are separated on the basis of sequence variation. Spots D and E represent fragments with different nucleotide sequences but identical molecular weight. B: Example of an ethidium bromide-stained gel pattern. A pool of restriction enzyme-digested fragments (HaeIII, RsaI, BglI) from phage lambda DNA was loaded. The experimental, semiautomated apparatus indicated in Fig. 4A was used. The first dimension was run on a 6% acrylamide gel, at 200 V (0.18 A) for 3 h at 60°C; and the second dimension on a 6% acrylamide gel with a 0-75% UF denaturing gradient,

proposed to combine different, independent separation criteria on the basis of conformational variation of DNA molecules under different circumstances, such as the presence of intercalating dyes [38,39], different electric field strengths, buffers, matrices [39--411. Although these methods may reveal minute differences, they maintain low resolution, ?re usually cumbersome and do not allow largescale scanning of genomic regions. The introduction of DGGE as the second dimension criterion is technically important to obtain an optimal distribution of spots across the entire area and a good resolution based on small sequence variation. DGGE involves separation in a polyacrylamide gel containing a gradient of denaturants (i.e., urea and formamide) at a fixed and elevated temperature [18,19]. The double-stranded DNA

4 first dimension

d = i e m c e O n “

8

.-.:‘., . . . .. . _ .

1;:.

m

d i 0

n

. , .. A

Fig. 2. Schematic depiction of the DNA fragment distribution after two-dimensional gel electrophoresis using identical or independent separation criteria for the first and second dimension. 1: Identical first and second separation criteria. 2: Separation criteria are identical for first and second dimensions, but fragments have been digested between the two separations. 3: Separation criteria are identical for frst and second dimension, but the gel matrices are different and fragments have been digested between separations. 4 First and second dimension separation criteria are independent. (Modified from Uitterlinden and Vijg, 1994 [20].)

fragments migrate through the gel according to their size until they encounter a specific denaturants concentration able to dissociate their double-helical state in a particular domain. Once part of the molecule is melted, the conformation change causes a reduction in its electrophoretic mobility Therefore, at a certain position in the denaturing gradient, migration of a particular fragment in the DGGE gel becomes no longer size-dependent, but is a fhction of the base-pair sequence. Melting of DNA fragments is not a gradual process, but proceeds in discrete steps, due to the presence of so-called melting domains: stretches of 50-400 base pairs that will denature at nearly identical melting temperatures. The melting behavior of a particular sequence can be calculated using a computer algorithm (MELT87, MELT95) based on thermodynamic stability values of a given base pair with its neighboring base pairs [18,42,43]. The prediction of the computer program has been shown to be reasonably accurate and comparable to the observed gel position of a specific fragment compared to its variants, even if differing only by a single point mutation [43,44-461. The ability to identi@ small mutations is improved by the attachment of a GC-rich sequence (“GCclamp”), that modifies the melting behavior of the fragment, preventing monodomain molecules from complete dissociation and guarantees that the adjacent

5

sequence is always the first melting domain [42,44,45]. Although DGGE is capable of detecting single base differences by comparing homoduplexes, its sensitivity can be enhanced by introducing base pair mismatches as they occur in heteroduplexes [42,47]. In its second dimension, two-dimensional DNA electrophoresis, takes advantage of the potential of DGGE. In principle, fragments of identical size may be resolved by two-dimensional electrophoresis as a function of their sequence diversity. Even if more complex, the final result of a two-dimensional electrophoresis is highly informative and allows the simultaneous analysis of many genes or genomic sites for sequence variations, with a resolution in the order of lo2 spots per gel area depending on the size of the gel [47-501. Once optimized for a specific study requirement, it may become the method of choice for complex gene and genome scanning. The interpretational analysis of the distribution of the spots on a two-dimensional area can be facilitated by image analysis of the digitalized pattern [51-531. Thus, different exons of genes of interest can be analyzed in parallel by two-dimensional DNA electrophoresis searching for minor differences such as, for example, point mutations [54-561. Studies have shown its capability to perform genetic typing [28,57,58], detect mutations in neoplastic tissues [59-611 and furnish information in linkage studies [62]. However, the technology available to analyse DNA fragments by two-dimensional electrophoresis is still laborious and requires particular care to obtain reproducibility and an optimal resolution of the fragment mixture [63]. The recent progress in the design of an appropriate electrophoresis apparatus and dedicated software for image analysis are the first promising steps toward the Ml automation of the procedure and its introduction in routine laboratories [64]. Even if not yet a fully automated and easily adoptable procedure in a laboratory routine, two-dimensional DNA electrophoresis, constitutes a highly informative and promising approach for gene and genome scanning. In this paper we will discuss recent developments in DNA two-dimensional methodology and the application of these procedures in gene or genome analysis of prokaryotic or eukaryotic organisms. Equipment: electrophoresis apparatus and image analysis software

The original equipment described by Fischer and Lerman was based on an acrylic frame (Fig. 3) [19]. In the cathode chamber, about 100 ml of electrolyte was constantly recirculated by means of a peristaltic pump. The negative electrode was made by highly purified graphite, while a platinum wire parallel to the trough was used as anode. The denaturing gradient gel was prepared with a digitally controlled gradient maker, in which the two solutions were linearly mixed from two 50-ml glass syringes. The gel temperature was measured using a needle-mounted thermometer. Several modified versions based on the original two-dimensional apparatus are available today from several companies (e.g., C.B.S. Scientific, Solana Beach,

6

Fig. 3. Two-dimensional DNA gel electrophoresis apparatus, as originally realized by Fischer and Lerman [18,19]. Left panel: front view. Right panel: schematic depiction of the side view. A, acrylic frame; B, trough; C, gradient gel; D, stainless-steel screws; E, screwforce spreader; F, cathodebuffer chamber; G, agarose gel strip; H,carbon cathode; I, rubber gasket; J, cathode buffer chamber inlet; K, cathode buffer chamber outlet; L, 90 mg/ml acrylamide plug; M, tabbed inner glass plate; N, outer glass plate; 0, 10 mg/ml agarose seal. (Reproduced with permission [18].)

CA, USA; Ingeny B.Y., Leiden, The Netherlands). The introduction of small improvements in the design of the apparatus made the procedure more simple and reproducible, but the general technique remains unchanged. The first and second dimensions are run separately, and after size separation of the DNA fragments the lane containing the separation pattern must be excised from the gel and placed on the denaturing gradient gel, for the second electrophoresis. A landmark toward a possible realization of an automated system is the prototype made by Ingeny B.Y. (Leiden, The Netherlands) and described by Mullaart et al. in 1993 [a]. This instrument consists of two pairs of electrodes and four separate buffer chambers. The first commercially available instrument based on this prototype is depicted in Fig. 4. This automated system is capable of running 10 gels simultaneously and consists of two pairs of platinum electrodes and four separate buffer chambers: two side reservoirs for the first dimension, and the middle and bottom reservoirs for the second dimension. A heating element equipped with thermostat helps in maintaining the set buf€er temperature during electrophoresis, and a system of valves, pumps and shunts

7

Fig. 4. Automatic two-dimensionalelectrophoresis apparatus (Ingeny BY,Leiden,The Netherlands). A: Prototype. The instrument consists of four electrodes and of a system of valves, pumps and heater able to keep the correct buffer levels and temperature during the fmt and second dimensions. One of the two cartridges, on the side of the apparatus, have been loaded with dummi gels. In this picture the buffer tank and the power supply are not shown. B: Recently commercializedautomated version. In this instrument the electrophoresisconditions can be programmed at the beginning of the experiment, avoiding any further manual intervention during the electrophoresis.

guarantees recirculation and correct levels of the buffer. Gels are cast outside the instrument within a glass-plate sandwich, then slid between silicone sealings in two cartridges capable of five gels each and inserted into the instrument.

8

Samples are loaded in aV-shaped slot and run first horizontally in an acrylamide nondenaturant portion of the gel and then vertically in a denaturing gradient (Fig. 5). This simple strategy avoids the laborious step of cutting and transferring lanes containing the size separation pattern. Another major advantage of this electrophoresis unit is the possibility to run 10 gels simultaneously under identical conditions. Although this instrument opens up new promising paths for large-scale two-dimensional electrophoretic analysis, the general procedure is still time consuming, requires skilled personnel and may therefore need further improvements in automation and consistency of the electrophoresis parameters. Depending on the specific experimental requirements, a two-dimensional polyacrylamide separation pattern can be visualized directly after staining (ethidium bromide, silver-staining) or by hybridization, after electro-blot transfer to a nylon membrane. Whatever apparatus and protocol is used, the final evaluation of the spot patterns is a complex and time-consuming process. Computerized image analysis systems may provide a helphl alternative to process information obtained from multiple gels. Several systems able to compare two-dimensional gel patterns, are commercially available, such as the Tycho system [51,52] the Quest system [53],

First dimension

Second dimension

Fig. 5. Examples of a one- and two-dimensional separation pattern of phage lambda marker fragments obtained with the automatic instrument. In order to obtain the one-dimensional pattern, the automatic two-dimensional process was interrupted and the gel stained. Then, another gel that wad allowed to run completely in two dimensionswas stained to obtain the two-dimensionalpattern..

9 the Masterscan (Scanalytics) and the IngenyVision system (Ingeny BY). The last one has been specifically developed for interpretation of spot patterns generated after a two-dimensional DNA electrophoresis. General obligatory steps in the computerized image analysis process are: 1) image acquisition, 2) spot detection, 3) calibration, 4) matching, and 5) database generation and searching [20]. Images of ethidium bromide stained gels and autoradiographs can be acquired by means of scanners or video cameras. The spots originated from radioactive hybridization filters can be detected and captured also by means of phosphor storage screens with the advantage of fast exposure times and possible quantitative determinations (Molecular Dynamics, Fuji, Biorad). Today, image acquisition is a relatively simple and accurate step which is valuable not only for computerized image analysis but also for storage of results. Once the image has been acquired, the identification of the correct spots involves the definition of their location within the gel and the recognition of possible artifacts. The increased intensity of a spot against the threshold background is the basis for spot detection, and several procedures have been adopted to improve the process [51]. The location of a spot in a two-dimensional gel can be defined along x-y coordinates, by a process called calibration (Fig. 6). In particular, the “x” value is related to the size of the fragment and the “y” to its melting temperature. The assignment of the correct coordinates is essential for the identification of the right spot and the comparison of the results. However, the relative position of an individual spot and/or groups of spots, may differ due to inter-gel variations. Even if such deviations are reduced by standardizing experimental conditions, computerized calibration is necessary and allows gel comparison for the presence or absence of a particular spot. Matching of spot patterns has the ultimate purpose of scoring the presence or absence of spots. It is based principally on spot position, but can also be done on the basis of several other criteria, such as intensity or morphology In general, computerized image analysis systems represent helphl tools for analyzing groups of two-dimensional gels, but require a consistent, correct and optimized input of the electrophoresis results. Methodological considerations: general protocols, optimization of the parameters

Two-dimensional DNA electrophoresis, as first described by Fischer and Lerman [18,193 and hrther improved by others [64], can be considered a highly informative, sensitive, but also complex methodology Not only the interpretation of the final spot patterns, but any step in the protocol requires particular care to obtain optimal, accurate and consistent results, starting from the preparation of the sample. It is important to start with good-quality DNA, avoiding single- and double-strand breaks, that may negatively influence the second and first run, respectively Frequently cutting restriction enzymes, such as “four-cutters”, are

10

Fig. 6. The automated image analysis: the calibration step. The calibration allows the assignment of the correct location of a spot along x-y coordinates and is an essential step in comparing several gels in parallel. The x value is related to the size of the fragment and the y to its melting temperature.The middle pattern shows the actual gel picture, on the left is a reference database and on the right the resulting calibrated pattern. This procedure is based on a triangle-transformation routine. This example has been obtained using the image analysis system IngenyVision (Ingeny BY, Leiden, The Netherlands). After completing the calibration step, it is possible to analyze a group of gels in parallel, an example of group analysis is shown in Fig. 8.

most suitable for analyzing genomic DNA, because after digestion they generate a pool of small fragments which can be optimally resolved by two-dimensional electrophoresis into a highly informative spot pattern. The distribution of the spots in the first dimension (x-axis), depends on the size of the fragments to be separated, and can be modified by varying the polyacrylamide (or agarose) concentration. Currently we are using 6% polyacrylamide for size-separating fragments between 100 and 900 bp and 10% polyacrylamide for fragments between 150 and 350 bp. Agarose is more suitable for fragments of 1-2 kb or larger. In the second dimension, 6% polyacrylamide is currently used and the concentration may be increased if the fragments to be analyzed are all included within a small size range (100-400 bp). Optimal resolution of the fragments of interest can be achieved by varying

11

electrophoresis parameters along the first and/or the second dimension: time, buffer concentration, polyacrylamide concentration, temperature and denaturing gradient. We found it crucial to accurately maintain the ionic strength of the buffer (TAE 0 . 5 ~pH 8.0 at 1530 pS; TAE = 0.02 M Tris; 0.01 M Na-acetate; 0.5 mM Na2EDTA, pH 8.0 by addition of acetic acid), and to use reverseosmosis purified water. Electrophoresis is generally carried out at 200 V for 1.5-4 h (0.15 A) along the first dimension and at 200 V for 4-12 h (0.5 A) along the second dimension, at 60°C. The most critical and important variable, however, is the preparation of an appropriate denaturing gradient. Several possibilities are available to modifL the distribution of the spots over a gel (Fig. 7), but the critical point is the range of denaturants concentration over which the fragments of interest would be optimally distributed. Starting from two solutions at different denaturants concentration, the gradient can be obtained using any suitable gradient mixer. Commonly used denaturing gradient gels are made with a linear gradient ranging from 10% (top) to 75% (bottom) (100% = 7 M urea, 40% v/v formamide deionized by incubation with mixed bed resin). The denaturing window can be modified to optimize the specific conditions of the experiment [54-561. The spot pattern may be directly visualized by ethidium bromide, silver staining, SYBR-Green, or by hybridization with labeled probes after transferring of the spot pattern onto a nylon membrane using electroblotting [20]. The reproducibility of this method was tested in intra/interlaboratory experiments performed in the Laboratory of Molecular Biology of the Institute of

Fig. 7. Denaturing gradient gel constellations.Several modifications of the originallydescribed twodimensional DNA separation experiments have been performed to improve resolution and avoid the condensation of spots in the upper left part of the two-dimensional pattern (fragments with high molecular weight and low denaturants concentration).To address this aim, linear denaturing gradients perpendicular to the first dimension can be modified using linear or exponentialgradients (smaller increments of denaturant at the top of the gel and larger increments at the bottom), in a diagonal orientation to the first dimension separation.The schematicrepresentation shows the predicted modifications in the shape and direction of the denaturing gradient and their influence on the separation pattern. (Modified from Uitterlinden and Vijg, 1994 [20,57].)

12 Hygiene of the Catholic University, Rome, Italy and in the Ingeny Laboratories, Leiden, The Netherlands, and it appeared sufficiently high (> 95%) to support large-scale genome and gene-scanning experiments (Fig. 8). Such reproducibility is guaranteed by maintaining identical experimental conditions. This can be achieved by following optimized protocols and by standardizing all steps: from the preparation of samples, buffers and gels to the electrophoresis conditions and the manipulation of gels. Preparation of large stocks of master solutions and minimizing manual handling are two basic points for an efficient daily routine. Applications in different fields

In principle, almost any pool of DNA fragments can be efficiently separated by two-dimensional electrophoresis, which generates a highly informative pattern of spots under optimized conditions. Genomic DNA isolated from plants, animals, bacteria or viruses can be analyzed after enzymatic digestion or amplified by polymerase chain reaction using specific or arbitrary primers [65-671. The

Fig.8. Gel analysis and reproducibility, Comparison of reproducibility has been performed in several inter- and intralaboratory experiments. A simplified example of computerized analysis of the spot patterns is shown. The gels are representative of different electrophoresisruns or of different gels within the same run (up to 10 gels). For this experiment the semiautomated prototype (Fig. 4) and the After the calibration step Ingenyvision image analysis system described in the text were used [a]. (Fig. 6), computer analysis makes it possible to compare up to 16 gels in parallel. On the upper left is a reference database containing different spots corresponding to different restriction fragments (phage lambda DNA).

13 possibility to generate a fingerprint on the basis of both the size and the sequence of the obtained fragments, represents a powerll tool for genetic typing of microorganisms, animals and plants, and can contribute to medical genetics and forensic medicine. The complex spot patterns obtained after hybridization with highly polymorphic multilocus probes represent displays for analysis of genomic instability, assessment of mutation rates and possible association studies. Variants within particular genomic regions can be identified and hrther analyzed by matching the spot patterns with a computer database or after direct isolation and characterization of the spot of interest. The observation that some spots corresponding to particular traits can segregate following a mendelian model provides new perspectives in linkage analysis, and the availability of linkage-dedicated software enhances the informativity of the approach. The possibility to analyse fragments of the same size in one gel simultaneously allows gene-scanning experiments in which all possible mutations can be visualized in parallel [24,54-561. Electrophoresis of GC-clamped fragments makes it feasible to identif) point mutations and opens up promising new ways for diagnosis and screening of susceptibility genes, in genetic epidemiology studies. Environmental and clinical microbiology

The possibility to distinguish microorganisms at the strain level is of basic importance for environmental microbiology and epidemiologic or clinical studies [68]. Several molecular methods are available based on proteins, lipid analysis, antibiogram or biochemical profiles [69]. Nucleic acid analysis and genetic typing can be performed following different approaches like ribotyping, plasmid profiling, RFLP analysis or comparison of DNA fingerprints generated by polymerase chain reactions with arbitrary primers [70,713. Also, denaturinggradient gel electrophoresis (DGGE) has been successllly used for studying genetic diversity of several microorganisms [72-741. In principle, any pool of DNA fragments already informative for typing different microbial strains could be resolved on a two-dimensional gel in a more complex and informative pattern of spots. Interestingly, in the first two-dimensional experiment, Fischer and Lerman used Eco RI digested E. coli genomic DNA and demonstrated the possibility to resolve over 250 fragments in a length-independent way (Fig. 9) [18,19]. A similar experiment was performed with the digested genome of other schizomycetes: Mycoplasma capricolum, Acholeplasma laidwaii, Haemophilus influenzae and Bacillus amyloliquefuciens [75]. In these experiments, the total number of DNA restriction fragments and their distribution as a function of the fragment size allowed the calculation of the genome size of the microorganism. Two-dimensional electrophoresis has been applied for typing the viral genome of the bacteriophage lambda and of the BHV-1 (bovine herpesvirus type-1) (Fig. 10) [64,76]. Spot differences detected after two-dimensional electrophoresis of the digested genome of different BHV-1 isolates, have been associated with

14

Fig. 9. The original experiment of Fischer and Lerman: E. coli and E. coli h DNA have been compared by two-dimensionalDNA electrophoresis.(Reproducedwith permission [181.)

the presence of different strains. A computer algorithm (Melt program, by L. Lerman) was successllly used to design a melting map of the entire genome of the bacteriophage lambda and theoretically evaluate the presence of melting domains able to determine the focusing of restriction fragments along the second dimension [20,77]. The relatively small size of viral and bacterial genomes (bacteriophage lambda, 4.8 x lo4 bp; E. coli, 4.4 x lo6 bp) allows direct detection of the restriction fragments after ethidium bromide staining (Fig. 11). The same visualization method generates an unresolvable cloud of different fragments, when analyzing digested genomic DNA isolated from lower eukaryotes such as yeast (Succhuromyces cerevisiue, 1.5 x lo7 bp). Electroblotting and hybridization analysis with

15

Strain A

Strain B

Fig. 10. Bovine herpes virus identification. Example of genetic typing by two-dimensional DNA

electrophoresis. The viral genome was digested with a restriction enzyme, analyzed by two-dimensional electrophoresis and stained with ethidium bromide. (Reproduced with permission [76].)

microsatellite core probes or probes for transposable elements have been successWly used to study two-dimensional electrophoresis gels containing Hae I11 digested genomic DNA isolated from Aspergillus niger and Saccharomyces cerevisiae [20,78,79]. DGGE analysis of amplified 16s rDNA fragments (Fig. 12) has been used to identify different microorganisms and to study the genetic diversity of microbial populations isolated from a range of different environments, such as from experimental bioreactors and intertidal sediments [72,73]. This approach provides a direct display of the sample composition in both a qualitative and a semiquantitative way, allowing studies on genetic diversity and popula-

16

I Identification of Microorganisms

k

Small k200 kb)

Lame b200 kb)

Fig. 11. Schematic representation of techniques for identification of microorganisms.

tion dynamics of mixed microbial communities.Two-dimensional electrophoresis can expand the potential of this strategy, allowing the simultaneous analysis of several DNA fragments. In conclusion, several microbial genomes have now been studied by twodimensional DNA electrophoresis, after digestion with restriction enzymes.

30% UF

50% UF Fig. 12. Example of determination of genetic diversity using DGGE analysis.The PCR-fragments of 16s rDNA were amplified from different Cundidu species.

17 While the entire field of genetic typing and in particular DGGE-based analysis is in expansion, the introduction of two-dimensional electrophoresis opens up new perspectives in acquiring data from more complex pools of fragments. Epidemiological studies of small community or hospital-acquired infections, genotyping of clinical isolates, taxonomy studies, and analysis of environmental samples may take advantage of the introduction of two-dimensional genomic fingerprinting. The capability to distinguish between different strains of the same microorganism and the possibility to associate genetic variation with specific phenotypes, is important to investigate specific properties as virulence and oncogenicity, and to identifi the source and the transmission ways of the disease. Medical genetics: linkage analysis and gene scanning

Diagnosis, genetic counseling and gene therapy prospects are strongly connected with the progress in molecular biology and with the availability of new techniques suitable for identifiing the exact molecular defect causing a disease. The complexity of the human genome, the distribution of gene exons among large intronic regions, and the genetic heterogeneity of mendelian disorders necessitate the development of rapid, sensitive, informative and economical genetic analysis tools. In recent years, positional cloning has led to the isolation of a growing number of genes from humans and other higher organisms, using the serial analysis of polymorphic marker loci such as micro- and minisatellites [80-821. Linkage analysis of cosegregation of a particular phenotype with a marker locus is of basic importance to localize traits of interest. Two-dimensional DNA electrophoresis has been shown to be suitable for linkage analysis [62]. The main advantage of this approach is its high information density per gel. High molecular weight genomic DNA isolated from white blood cells of pedigree members can be resolved on a two-dimensional gel after digestion with a restriction enzyme [24]. A complex pattern of heritable spots is generated after electroblotting and hybridization of the filter with micro- and/or minisatellite core probes. Several core probes detect 300-400 spots, corresponding to a similar number of alleles. In principle, by rehybridizing each filter with different nonoverlapping core probes, a high resolution and a very informative map can be obtained in a relatively short period of time, at relatively low costs. More realistically, the effective resolution power, even if very high (at least 40- 100 spots), is lower than the theoretical one, because not all spots detected represent alleles from polymorphic loci. Moreover, cross-hybridization between different probes can occur, as well as comigration of different fragments. The main limitation of this approach in linkage studies is due to the lack of immediate information on the detected spot: each spot in the pattern represents a single or double copy of a specific allele, or may represent unrelated alleles fortuitously comigrating in the gel. A significantly more efficient linkage analysis, based on two-dimensional DNA typing, would require single unknown alleles to be immediately specified and the presence of a spot to be correlated with a situation of heterozygosityor homo-

18 zygosity, for the corresponding allele. Nevertheless, even without this additional information, the procedure remains highly informative. The copresence of a specific spot in the patterns of the parents and its absence in a child, for example, implies that the parents share only one allele at that locus. More detailed knowledge on the different alleles represented by variant spots may be reached by several approaches, such as investigations directed towards the identification of complemeptary alleles from the same locus, and the definition of haplotypes of closely linked spots. Moreover, a spot of interest can be directly isolated from the two-dimensional typing pattern and developed into a locus-specific marker, after elution of the DNA from gel pieces excised from the area of the gel corresponding to the spot localization, cloning, rehybridization for confirmation, and fbrther characterization. Another advantageous application of two-dimensional DNA electrophoresis in medical genetics is the possibility to analyse, in one gel, single or multiple genes for the presence of all possible mutations. There are at least two ways in which this can be accomplished. The first approach is based on the hybridization of genomic DNA digested with different restriction enzymes after two-dimensional electrophoresis and electroblotting. In this case, the capability to detect mutations depends on the melting behavior of the restriction fragments in the denaturing gradient gel, because it is not possible and convenient to try to modifl it by adding GC-clamps. An alternative approach is based on the high accuracy of the denaturing gradient principle in detecting small sequence variations, such as different point mutations in DNA fragments, PCR-amplified with GC-clamped primers [MI. This approach has already been applied for diseases caused by multiple mutations distributed over several exons, such as cystic fibrosis, hereditary nonpolyposis colorectal cancer and retinoblastoma (Fig. 13) [54-561. Multiplex PCR enhances the power of this approach and reduces the labor time, allowing the coamplification of different DNA fragments under identical conditions in the same reaction. This approach has been successllly used for the retinoblastoma gene, obtaining a mixture of GC-clamped fragments from 26 exons optimally resolved over a two-dimensional gel [83]. The possibility to perform a gene scanning for diseases caused by multiple mutations distributed over several exons, is essential to identlfl the precise molecular alterations underlying the phenotypes, expecially in population-based studies (Fig. 14). A major issue is the availability of relatively simple and inexpensive technology for detecting all possible mutations. Two-dimensional DNA electrophoresis is applicable to large disease genes, and could become the first practical way to screen simultaneously several disease genes for a broad-spectrum of mutations. Indeed, it proved possible to analyse simultaneously in one gel, all the possible mutations distributed over the different exons of a gene, identifling them on the basis of position alone. Under optimized conditions, the comigration of different mutations seems a remote possibility However, more extensive studies are necessary to confirm this.

19

17

100

100

@PI

9Do

Fig. 13. Multiplex PCR products obtained after amplification of the retinoblastoma gene. On the left is shown the theoretical two-dimensional electrophoresispattern of the RBI gene, as predicted from the sizes and melting profiles of the 25 amplicons. On the right is the empirical pattern as observed on the two-dimensional gel, after ethidium bromide staining.

Genetic analysis of cancer The pathogenesis of tumors can be considered as a multistep process, in which the accumulation of mutations in time can progressively modifj the growth properties of a cell toward neoplastic transformation [84,85]. The identification of genetic lesions involving proto-oncogenes and tumor suppressor genes has been correlated with a wide range of cellular fbnctions including growth control, invasion, metastasis [86,87]. The recently acquired new insights into the mechanisms involved in such complex phenomena as cell proliferation or apoptosis, could be of clinical relevance for diagnosis, prognosis or prevention. Searching for genetic variations between neoplastic and normal cells has been implemented by the introduction of analysis with highly polymorphic markers such as microand minisatellite probes [80-821. This general approach has been utilized to detect genetic alterations occurring in human cancers by two-dimensional DNA typing [60,61]. Genomic DNA from tumor and normal cells (obtained from peripheral blood lymphocytes of the patient), was compared in parallel after two-dimensional separation of digested fragments, electroblotting and hybridization analysis with mini- and microsatellite core probes (Fig. 15). This approach allowed the identification of several variations in the tumor spot patterns as compared to the control: it was possible to identi@ deletions (absence of spot), amplifications (higher intensity) and presence of new spots [61]. The recurrence of a particular spot change in several patients suggests a correspondence with an

20

Multiplex Long PCR

J Multiplex Short PCR

\1

Automated 2-D separation under one defined set of experimental conditions JI 1-D size

Low UF

>

Gradient

1

High UF

600 bp

size

>

100 bp

Post electrophoresis Processing (e.g., staining, hybridization analysis)

' L

Diagnostic Image rocessing using Computerized Gene Mutational Database Fig. 14. Schematic depiction of two-dimensional gene scanning.

allelic imbalance at loci involved in tumorigenesis or tumor progression. Characterization of each spot can be performed after its direct isolation from the gel. It is possible, in this way, to compensate the lack of immediate information about a particular spot change [20]. The total number of differences between tumor and normal DNA can be considered as an indicator of genetic instability and can be related, in principle, to the malignancy of the neoplasm and to clinical or prognostic parameters [88,89]. The availability of information on specific mutations occurring in specific tumors, has opened up the possibility to perform specific tests for already known deletions, amplifications or point mutations. Denaturing gradient gel electrophoresis has been shown to represent a useful tool for molecular genetic analysis of oncogenes and mutations observed in a given neoplasm [90,91]. The expanding pool of information provided by DGGE analysis constitutes the basis for

21

Fig. 15. An example of amplification of a marker allele in breast cancer, as revealed by a 4 x intensity increase from a two-dimensional hybridization pattern generated from the restriction enzyme digested tumor DNA. The observed amplification was confirmed by the isolation of the spot-giving fragment from the gel and its subsequent use as a locus-specific probe on the same two-dimensional blot.

future development and applications of two-dimensional electrophoresis. Taking advantage of the previously determined melting properties, a complex mixture of fragments, carrying information on several mutations in several oncogenes, may be optimally resolved in a two-dimensional gel.

22 Studies regarding combination or modification of standardized procedures may contribute to the development of molecular oncology, and may be taken into consideration for future projects. A major target of cancer research is to develop biotechnology tools able to correlate an oncogene sequence with specific biological functions, as well as tools able to transfer cell and molecular biology information into prognostic and early diagnosis markers or into pharmaceutical therapy The possibility to investigate the genetic basis of cancer pathogenesis is of fundamental importance and requires informative technical tools for measuring predisposition and designing programs of prevention for individuals at risk. Mutation analysis Mutagenesis is a guarantee of survival of a species in our ever-changing environment, and is the basis for any detection of genetic differences in and between populations. The complex interactions between fitness, selection, heritable background and changes in the environment are critical for any living being, from viruses to humans. Great effort has been dedicated in understanding the mechanisms of spontaneous or induced mutagenesis and identify genotoxic agents. The characterization of mutations at the sequence level is considered indispensable to clarify the relationship between the mutagenic event and cellular or physiological endpoints. Several experimental models for mutagenesis in vivo have been described using micr-oorganisms, yeasts, Drosophila, cell lines or small animals such as rodents [92,93]. The time required for detection depends on the exposure conditions and the replication rate of the used species, about 5 days for bacteria to years for small mammals. Assays for gene reversion, recombination, sister chromatid exchange, chromosomal aberrations, and tests for specific mutations have been used to detect differences in the DNA of exposed compared to controls. The laboratory models simplify the complexity of variables involved in real exposure situations in which several confounding factors are present, such as mixtures of compounds at different concentrations, unpredictable physical-chemical interactions and host populations with heterogeneous genetic background. These confounding factors complicate any study on human populations exposed to a given genotoxic agent. Mutation at selectable genes, such as HPRTand MHC, has been used as a biomarker for monitoring DNA damage in human populations [94,95]. Although informative, this approach has disadvantages because it involves selection of cells in culture, and because the analysis of coding genes may constitute an insensitive indicator for permanent genetic damage, due to their inherent stability; moreover, in this kind of assay, mutations are measured at only a single site in the genome [96]. The assessment of human DNA mutation rates by two-dimensional DNA typing could offer a complementary device in addition to current detection systems. Naturally unstable (hypermutable) sequences spread over the genome, as micro- or minisatellites, may represent an ideal indidator to measure mutation rates. These sequences constitute about 1% of the human genome and display instability both in somatic

23 cells as well as in the germline [59,97-991. Genomic DNA fingerprints can be generated using micro- and minisatellite probes for Southern blot hybridization analysis [80]. This informative procedure has been extensively used for several purposes, such as identity testing in forensic medicine, linkage studies in medical genetics, and the detection of mutations during tumor development or aging [97,100]. One-dimensional DNA fingerprinting has been applied in mutagenesis studies with chemical and physical agents employing minisatellite probes for Southern analysis of treated, as well as untreated, cell lines or animals [101-1031. Two-dimensional DNA typing has been shown to have a higher resolution than Southern blot analysis, reaching 625 spots per probe against the 20-30 bands resolvable in a single dimension, allowing the generation of highly informative DNA fingerprints [24]. In principle, the same general procedure already extensively used for Southern blot analysis can be applied to two-dimensional electrophoresis, by electroblotting the DNA fragments distributed on the twodimensional gel onto a nylon membrane. This procedure has been applied to study mutation frequencies in fibroblasts from the skin of old vs. young rats, confirming previous results that indicated an average mutation rate for micro- and minisatellite loci between and 10- [1041. However, large-scale twodimensional DNA typing studies on treated cells have not yet been performed, and specific experiments on cell lines exposed to environmental carcinogens are in progress. In mutagenesis studies, an additional application field for two-dimensional DNA electrophoresis is the mutational spectra technology [105,106]. The mutational spectrum, first described by Seymour Benzer and Ernst Freese, consists of a specific and reproducible pattern of genetic changes observable when exposing a homogeneous cell population to a given mutagen at particular conditions of exposure [107]. A set of specific mutations has been described for the genome of the T4 bacteriophage as well as for bacteria, yeast, rodents and human cells. The introduction of denaturing gradient gel electrophoresis allows detection of several mutant sequences, separate from each other and from an excess of wildtype, avoiding selection of individual mutant colonies [105,108-1121. The general procedure is based on the amplification with nested primers of a target sequence with a high-fidelity polymerase. The template DNA is isolated from the mixture of exposed cells, avoiding subcloning and sequencing of several colonies. The pool of amplified fragments will include subpopulations characterized by specific point mutations detectable by DGGE. The sequencing of each band can reveal the point-mutational spectrum of the test agent. This strategy can be extended to any locus and if necessary can be implemented by the inclusion of GC-clamped primers. In principle, it can also be introduced in different studies using different hosts, from viral and bacterial to mammalian cell populations. While this procedure has a high sensitivity in detecting point mutation and small insertion/deletions within the amplified target sequence, it is not reliable in detecting chromosomal rearrangements or major deletions. The

24

combination of size separation and DGGE analysis in a two-dimensional gel can increase the informative power of the general method, allowing the analysis of several target regions in parallel, which in turn allows the establishment of a more complex mutational spectrum. Conclusion and critical evaluation Two-dimensional DNA electrophoresis can be considered an informative procedure capable of resolving a pool of fragments according to their size and sequence properties. The introduction of a denaturing gradient gel for the second dimension increases the potential of the technique, opening promising horizons for gene and genome studies. Preliminary results have demonstrated the applicability of the general procedure to different fields such as microbiology, medical genetics, molecular oncology and mutation analysis, and have proven that it is possible to optimize experimental conditions for each specific aim. The final result, represented by a pattern of spots on a surface area, is highly informative, but also complex to interpret. A computerized image analysis system may accelerate the comparison between many gels offering a suitable alternative for large scale experiments. Genomic DNA isolated from humans as well as from plants, animals, bacteria or viruses can be analyzed after restriction enzyme digestion or PCR amplification with specific or arbitrary primers. Spots of interest can be visualized directly after staining with a DNA dye, or by hybridization and autoradiography after electroblotting. So far, the major limit to this procedure is the lack of immediate information on a given spot, even if this can be supplied by its isolation from the gel, and further characterization. In general, two-dimensional DNA electrophoresis requires skilled personnel and particular care in keeping all the electrophoresis parameters constant, due to the sensitivity of the method and to the number of variables involved, such as temperature, denaturing gradient, and buffer conductance. Direct experience has shown, however, that reproducible results can be obtained using standard optimized protocols and taking care in keeping the experimental parameters constant. Designing automated devices, able to run several gels in parallel and under identical electrophoretic conditions, has been a landmark toward a possible diffusion of the method into routine laboratories. Although genotyping and gene scanning represent major applications, the versatility of the procedure suggests further applications in a wide range of situations. A currently explored example is the possibility to study mutations at cDNA level, by increasing resolution of differential display This is a technique aiming at the identification of those genes which are differentially expressed between different cell types, or in the same cell population under different conditions as, for example, after exposure to specific agents [113]. In conclusion, several biotechnological areas may take advantage of the introduction of two-diwnsional DNA electrophoresis, and especially those fields in which denaturing gradient gel electrophoresis is already being exploited. The

25 addition of a GC-clamp enhances the sensitivity of the method, allowing detection of sequence differences as small as point mutations. The high information density per gel provides new opportunities in performing complex screenings on large populations, searching for induced mutations, genetic polymorphisms or affected alleles. The recent, rapid and expanding developments in molecular and cell biology as well as the mathematical-statistical advances in genetic epidemiology open up new ways for a comprehensive understanding of the pathophysiology of multifactorial diseases such as cancer, hypertension and diabetes [114,1151. Linkage analysis on extensive pedigrees, association studies based on the inclusion of multiple DNA markers, and biotechnology tools able to hrnish comprehensive information at the molecular level, are essential to investigate complex phenotypes carried by polygenic systems. Such a multidisciplinary approach provides new contributions to studies on the interaction between environmental agents and genetic predisposition. Acknowledgements We thank everyone who supported the background work necessary for the preparation of this manuscript and in particular Revd Luigi Ferlauto and all the collaborators of the Oasi Institute of Troina, Italy; the collaborators of the research team of Prof Giancarlo Vanini at the School of Hygiene and Public Health of the Catholic University in Rome; the Mastelli srl, San Remo, Italy; and all collaborators at Ingeny B.V., Leiden, The Netherlands, and in the Molecular Genetics Section, Gerontology Division, Beth Israel Hospital, Boston, Massachusetts, USA. References 1. Maxam AM, Gilbert W. A new method of sequencing DNA. Proc Natl Acad Sci USA 1977;74 560-564. 2. Gilbert W. DNA sequencing and gene structure. Science 1981;2141305-1312. 3. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 1977;74:463-5467. 4. Mathies RA, Huang XC Capillary array electrophoresis: an approach to high-speed, highthroughput DNA sequencing. Nature 1992;359:167- 169. 5. Chetverin AB, Russel Kramer E Oligonucleotide array: new concepts and possibilities. BioTechnology 1994;12:1093- 1099. 6. Fodor SPA, Rava RP, Huang XC, Pease AC, Holmes CP, Adams CL. Multiplexed biochemical assays with biological chips. Nature 1993;364555-556. 7. Drmanac R, Labat I, Brukner I, Crkvenjakov R. Sequencing of megabase plus DNA by hybridization: theory of the method. Genomics 1989;4:114-128. 8. Strezoska Z, PauneskuT, Radosavljevic D, Labat I, Dramanac R, Crkvenjakov R. DNA sequencing by hybridization: 100 bases read by a non-gel-based method. Proc Natl Acad Sci USA 1991;88:10089-10093. 9. Drmanac R, Drmanac S,Strezoska Z, PauneskuT,Labat I, Zeremski M, Snoddy I, Funkhouser

26

10. 11.

12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30.

WK, Koop B, Hood L, Crkvenjakov R. DNA sequence determination by hybridization: a strategy for efficient large-scale sequencing. Science 1993;260: 1649- 1652. Davis LM, Fairfield FR, Harger CA, Jett JH, Keller RA, Hahn JH, Krakowski LA, Marrone BL, Martin JC, Nutter HL, Ratliff RL, Brooks Shera E, Simpson DJ, Soper SA. Rapid DNA sequencing based upon single molecule detection. Genet Anal Tech Appl 1991;8:1-7. Flavel RA, Kooter JM, De Boer E, Little PFR, Williamson R. Analysis of the beta-delta-globin gene loci in normal and Hb Lepore DNA. direct determination of gene linkage and intergene distance. Cell 1978;15:25-41. Kan YW, Dozy AM. Polymorphisms of DNA sequence adjacent to human beta-globin structural gene: Relationship to sickle mutation. Proc Natl Acad Sci USA 1978;75:5631-5635. Jeffreys AJ. DNA sequence variants in the Ggamma-, Agamma- and beta-globin genes of man. Cell 1979;18:1- 15. Southern EM. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Molec Biol 1975;98:503-517. Wallace RB, ShaKer J, Murphy RF, Bonner J, Hirose T, Itakura K. Hybridization of synthetic oligodeoxyribonucleotidesto X174 DNA: the effect of single base pair mismatch. Nucl Acid R ~ 1979;6:3543-3557. s Saiki RK, Walsh PS, Levenson CH, Erlich HA. Genetic analysis of amplified DNA with immobilized sequence-specific oligonucleotide probes. Proc Natl Acad Sci USA 1989;86:62306234. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T. Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Natl Acad Sci USA 1989;86:2766-2770. Fischer SG, Lerman LS.Length-independent separation of DNA restriction fragments in twodimensional gel electrophoresis. Cell 1979;16:191-200. Fischer SG, Lerman LS. Two-dimensional electrophoretic separation of restriction enzyme fragments of DNA. Meth Enzymol 1979;68:183-191. Uitterlinden AG, Vijg J. Two dimensional DNA typing. A parallel approach to genome analysis. Chichester: Ellis Horwood, 1994. Yee T, Inouye M. Ik.0-dimensional S1 nuclease heteroduplex mapping: detection of rearrangements in bacterial genomes. Proc Natl Acad Sci USA 1984;81:2723-2727. Poddar SK, Maniloff J. Chromosome analysis by two-dimensional fingerprinting. Gene 1986; 49:93-102. Sheppard RD, Montagutelli X,Jean WC, Tsai J-Y; Rose A, Gunet EL, Cole MD, Silver LM. Two-dimensional gel analysis of complex DNA families: methodology and apparatus. Mamm Genome 1991; 1:104- 111. Uitterlinden AG, Slagboom PE, Knook DL, Vijg J. Two-dimensional DNA fingerprinting of human individuals. Proc Natl Acad Sci USA 1989;86:2742-2746. Yi M, Au L-C, Ichikawa N, Ts’o POP. Enhanced resolution of DNA restriction fragments: a procedure by two-dimensional electrophoresis and double-labeling. Proc Natl Acad Sci USA 1990;87:3919-3923. Woolf T, Lai E, Kronenberg M, Hood L. Mapping genomic organization by field inversion and two-dimensional gel electrophoresis: application to the murine T-cell receptor gene family Nucl Acid Res 1988;16:3863-3875. Kamiura S, Nolan CM, Meruelo D. Longe-range physical map of the Ly-6 complex: mapping the Ly-6 multigene family by field-inversion and two-dimensional gel electrophoresis. Genomics 1992;12:89- 105. Walter MA, Cox DW A method for two dimensional DNA electrophoresis (2D-DE): application to the immunoglobulin heavy chain variable region. Genomics 1989;5:157- 159. BautschW Rapid physical mapping of the Mycoplasma mobile genome by two-dimensional field inversion gel electrophoresis. Nucl Acid Res 1988;16:11461--11467. GilroyTE, Thomas CA. The analysis of some new Drosopkilu repetitive DNA sequences isolated

27 and cloned from two-dimensional agarose gels. Gene 1983;23:41-51. 31. Hatada I, Hayashizaki Y; Hirotsune S,Komatsubara H, Mukai T. A genomic scanning method for higher organisms using restriction sites as landmarks. Proc Natl Acad Sci USA 1991;88: 9523-9527. 32. Potter SS, Bott KF, Newbold JE. Two dimensional restriction analysis of the Bacillus subtilis genome: gene purification and ribosomial ribonucleic acid gene organization. J Bacteriol 1977;129:492-500. 33. YeeT, Inouye M. Tko-dimensional electrophoresisapplied to the study of DNA methylation and the analysis of genome size in Myxococcus xanthus. J Molec Biol 1982;154 181-196. 34. Boehm TLJ, Drahovsky D. Two-dimensional restriction mapping by digestion with restriction endonucleases of DNA in agarose and polyacrylamide gels. J Biochem Biophys Meth 1984;9: 153-161. 35. Huvos PE, Aquiles Sanchez J, Kramer KM, Karrer KM, Wangh LJ. Two-dimensional DNA gel electrophoresis as a method for analysis of eukaryotic genome structure: evalutation using lktrahymena thermophilae DNA. Biochim Biophys Acta 1988;949:325-333. 36. Rogan PK, Lemkin PL, Klar AJS, Singh J, Strathern JN. Two-dimensional agarose gel electrophoresis of restriction-digestedgenomic DNA. Methods: Comp Meth Enzymol 1991;3:91-97. 37. Sakaki Y; KurataY; MiyakeT, Saigo K. Two-dimensional gel electophoreticanalysis of the Hind I11 1.8 kb repetitive-sequence family in the human genome. Gene 1983;24:179-190. 38. Meyer G, Hildebrandt A. Xvo-dimensional gel analysis of repetitve nuclear DNA sequences in the genome of Physarum polycephalum. Eur J Biochem 1986;157:507-512. 39. VanWye JD, Bronson EC, Anderson JN. Species-specific patterns of DNA bending and sequence. Nucl Acid Res 1991;19:5253-5261. 40. Bell L, Byers B. Separation of branched from linear DNA by two-dimensional gel electrophoresis. Anal Biochem 1983;130:527-535. 41. ShinomiyaT, Ina S.Analysis of chromosomal replicons in early embryos of Drosophila melanogarter by two-dimensional gel electophoresis. Nucl Acid Res 1991;19:3935-3941. 42. Lerman LS, Fischer SG, Hurley I, Silverstein K, Lumelsky N. Sequence-determined DNA separations. Ann Rev Biophys Bioeng 1984;13:399-423. 43. Lerman LS, Silverstein K, Grinfield E. Searching for gene defects by denaturing gradient gel electrophoresis. Cold Spring Harbor Symp Quant Biol 1986;51:285-297. 44. Myers RM, Fischer SG, Maniatis T, Lerman LS. Modification of the melting properties of duplex DNA by attachment of a GC-rich DNA sequence as determined by denaturing gradient gel electrophoresis. Nucl Acid Res 1985;13:3111-3129. I Nearly all single base substitutions in DNA 45. Myers RM, Fischer SG, Lerman LS, Maniatis ' fragments joined to a GC-clamp can be detected by denaturing gradient gel electrophoresis. Nucl Acid Res 1985;13:3131-3145. 46. Abrams ES, Murdaugh SE, Lerman LS. Comprehensive detection of single base changes in human genomic DNA using denaturing gradient gel electrophoresisand a GC clamp. Genomics 1990;7:463-475. 47. Uitterlinden AG, Vijg J. Denaturing gradient gel electrophoreticanalysis of the human cHa-ras 1 proto-oncogene. Appl Theor Electrophor 1990;1:175- 179. 48. Vijg J, Uitterlinden AG. A search for DNA alterations in the aging mammalian genome: an experimental strategy Mech Aging Dev 1987;41:47-63. 49. Uitterlinden AG, Vijg J. Two-dimensional DNA typing. TIBTECH 1989;7:336-341. 50. Uitterlinden AG, Mullaart E, Morolli B, Vijg J. Genome scanning of higher eukaryotesby twodimensional DNA typing using micro- and minisatellite core probes. Methods: Comp Meth E I U Y ~1991 O ~;3:83-90. 51. Anderson NL, Taylor J, Scandora AE, Coulter BP, Anderson NG. The Tycho system for computer analysis of two-dimensional gel electrophoresis patterns. Clin Chem 1981;27:1807-1820. 52. Anderson NL. 'Rvo-dimensional electrophoresis: operation of the ISO-DALT System. Rockville: Large Scale Biology Press, 1991.

53. Garrels JI. The QUEST system for quantitative analysis of two-dimensional gels. J Biol Chem 1989;264:5283-5299. 54. Li D, Vijg J. Multiplex co-amplification of 24 retinoblastoma gene exons after pre-amplification by long-distance PCR. Nucl Acid Res 1996;24:538-539. 55. WuY, Hofstra RMW, Scheffer H, Uitterlinden AG, Mullaart E, Buys CHCM,Vijg J. Comprehensive and accurate mutation scanning of the CFTR-gene by two-dimensional DNA electrophoresis. Hum Mutat 1996;8:160-167. 56. Nystrom-Lahti M, WuY, Moisio AL, Hofstra RMW, Osinga J, Mecklin JP, Jarvinen HJ, Leisti J, Buys CHCM, de la Chapelle A, Peltomaki P. DNA mismatch repair gene mutations in 55 kindreds with verified or putative hereditary non-polyposis colorectal cancer. Hum Molec Genet 1996;5:763-769. 57. Uitterlinden AG, Slagboom EP, Mullaart E, Meulenbelt 1,Vijg J. Genome scanning by twodimensional DNA typing: The use of repetitive DNA sequences for rapid mapping of genetic traits. Electrophoresis 1991;12:119-134. 58. Uitterlinden AG, Vijg J. Denaturing gradient gel electrophoretic analysis of minisatellite alleles. Electrophoresis 1991;12:12- 16. 59. Armour JAL, Patel I, Thein SL, Fey MF, Jeffreys AJ. Analysis of somatic mutations at human minisatellite loci in tumors and cell lines. Genomics 1989;4:328-334. 60. Hovig E, Mullaart E, Borresen AL, Uitterlinden AG, Vijg J. Genome scanning of human breast carcinomas using micro- and minisarellite core probes. Genomics 1993;17:66-75. 61. Verwest AM, de Leeuw WJF, Molijn AC, Andersen TI, Borresen AL, Mullaart E, Uitterlinden AG, Vijg J. Genome scanning of breast cancers by two-dimensional DNA typing. Br J Cancer 1994;69:84-92. 62. te Meerman GJ, Mullaart E, van der Meulen MA, den Daas JHG, Morolli B, Uitterlinden AG, Vijg J. Linkage analysis by two-dimensional DNA typing. Am J Hum Genet 1993;53:12891297. 63. Hampe J, Marczinek K, Preuss A, Nuruberg P. Marker pattern instabilities as a major cause of reproducibility problems in two-dimensional DNA fingerprinting. Electrophoresis 1996;17: 659-666. 64. Mullaart E, de Vos GJ, te Meerman GJ, Uitterlinden AG, Vijg J. Parallel genome analysis by two-dimensional DNA typing. Nature 1993;365:469-471. 65. Welsh J, McClelland M. Fingerprinting genomes using PCR with arbitrary primers. Nucl Acid Res 1990;18:7213-7218. 66. Williams JGK, Kubelik AR, Livak KJ, Rafalski JA,Tingey SV.DNA polymorphisms amplified by arbitrary primers are useful as genetic marker. Nucl Acid Res 1995;18:6531-6535. 67. Garson JA, Tedder RS, Briggs M, Tuke P, Glazebrook JA, Trutte A, Parker D, Barbara JAJ, Contreras M, Aloysius S. Detection of hepatitis C viral sequences in blood donations by ‘Nested’ polymerase chain reaction and prediction of infectivity Lancet 1990;335:1419-1422. 68. Aber RC, Mackel DC. Epidemiologic typing of nosocomial microorganisms. Am J Med 1981; 70~899-905. 69. Brokop CD, Farmer JJ. In: Doget RG (ed) Clinical Manifestation of Infection and Current Therapy 1. New York: Academy Press, 1979;89-133. 70. Schlichting C, Branger C, Fournier JM, Witte W, Boutonnier A, Wolz C, Goullet P, Doring G. Typing of Staphylococcus uureus by pulsed-field gel electrophoresis, zymotyping, capsular typing, and phage typing: resolution of clonal relationships. J Clin Microbiol 1993;31:227-232. 71. Pitt TL. State of the art: typing of Serrutiu murcescens. J Hosp Infect 1982;3:9-14. 72. Muyzer G, Teske A, Wirsen CO, Jannasch HW. Phylogenetic relationships of Thiomicrospiru species and their identification in deep-sea hydrothermal vent samples by denaturing gradient gel electrophoresis of 16s rDNA fragments. Arch Microbiol 1995;164:165-172. 73. Muyzer G, de Waal EC, Uitterlinden AG. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16s rRna. Appl Environ Microbiol 1993;59:695-700.

29 74. Wawer C, Muyzer G. Genetic diversity of Desulfovibrio spp. in environmental samples analyzed by denaturing gradient gel electrophoresis of [NiFe] hydrogenase gene fragments. Appl Environ Microbiol 1995;61:2203-22 10. 75. Poddar SK, Maniloff J. Determination of microbial genome sizes by two-dimensional denaturing gradient gel electrophoresis. Nucl Acid Res 1989;17:2889-2895. 76. Vijg J. Two-dimensionalDNA typing. Molec Biotechnol 1995;4275-295. 77. Venema I? User Manual for the Melting Program Melt 95. Leiden: Ingeny B.V., 1995. 78. Moroz-Williamson V. Transposable elements in yeast. Int Rev Cytol 1983;83:1-24. 79. Genbauffe FS, Chisholm GE, Cooper TG. Tau, sigma and delta: a family of repeated elements in yeast. J Biol Chem 1984;259:10518-10525. 80. Jeffrey AJ, Wilson V, Thein SL. Hypervariable ‘minisatellite’ regions in human DNA. Nature 1985;31467-73. 81. NakamuraY; Leppert M, OConnell P, Wolff R, HolmT, Culver M, Martin C, Fuijmoto E, Hoff M, Kumlin E, White R. Variable number of tandem repeat (VNTR) markers for human gene mapping. Science 1987;235:1616- 1622. 82. Tautz D, Trick M, Dover GA. Cryptic simplicity in DNA is a major source of genetic variation. Nature 1986;322:652-656. 83. Van Orsouw NJ, Li D, van der Vlies P, Scheffer H, Eng C, Buys CHCM, Li Fp,Vijg J. Mutational scanning of large genes by extensive PCR multiplexing and two-dimensional electrophoresis: application to the RB1 gene. Hum Molec Genet 1996;5:755-761. 84. Peto R, Roe FJC, Lee PN, Levy L, Clack J. Cancer and aging in mice and man. Br J Cancer 1975;32:411-426. 85. Weinberg RA. Oncogenes, anti-oncogenes, and the molecular bases of multistep carcinogenesis. Cancer Res 1989;49:3713-3721. 86. Bishop JM. Molecular themes in oncogenesis. Cell 1991;64.235-248. 87. Thibodeau SN, Bren G, Schaid D. Microsatellite instability in cancer of the proximal colon. Science 1993;260:816-8 19. 88. Nowell I? The clonal evolution of tumor cell populations. Science 1976;194:23-28. 89. Volpe JPG. Genetic instability of cancer: Why a metastatic tumour is instable and a benign tumour is stable. Cancer Genet Cytogenet 1988;34125-134. 90. Shirasawa S, Urabe K, Yanagawa Y; Toshitani K, Iwama T, Sasazuki T p53 gene mutations in colorectal tumors from patients with familial polyposis coli. Cancer Res 1991;51:2874-2878. 91. Cotton RGH. Current methods of mutation detection. Mutat Res 1993;285:125-144. 92. Bridges BA. Mutagenesis after exposure of bacteria to ultraviolet light and delayed photoreversal. Molec Gen Genet 1992;233:331-336. 93. Gossen JA, de Leeuw WJF, Vijg J. LacZ transgenic mouse models: their application in genetic toxicology Mutat Res 1994;307:451-459. 94. Branda RF, Sullivan LM, ONeill JP, Falta MT, Nicklas JA, Hirsch B, Vacek PM, Albertini RJ. Measurement of HPRT mutant frequencies in T-lymphocytes from healthy human populations. Mutat Res 1993;285:267-279. 95. Grist SA, McCarron M, Kutlaca A, Turner DR, Morley AA. In vivo human somatic mutation: frequency and spectrum with age. Mutat Res 1992;266:189- 196. 96. Nee1 JV, Satoh C, Myers R. Report of a workshop on the application of molecular genetics to the study of mutation in the children of atomic bomb survivors. Mutat Res 1993;291:1-20. 97. Thein SL,Jeffreys AJ, Gooi HC, Cotter F, Flint J, O’Connor NTJ, Weatherall DJ, Wainscoat JS. Detection of somatic changes in human cancer DNA by DNA fingerprint analysis. Br J Cancer 1987;55:353-356. 98. Jeffreys AJ, Royle NJ, Wilson V, Wong Z. Spontaneous mutation rates to new length alleles at tandem-repetitive hypervariable loci in human DNA. Nature 1988;332:278-28 1. 99. Nurnberg P, Roewer L, Neitzel H, Sperling K, Popper1 A, Hundrieser J, Poche H, Epplen C, Zischler H, Epplen J T DNA fingerprinting with the oligonucleotide probe (CAC)s/(GTG)s: somatic stability and germline mutations. Hum Genet 1989;84:75-78.

30 100. de Jong D, Voetdijk BMH, Klein-Nelemans JC, van Ommen GJB, Kluyn PM. Somatic changes in B-lymphoproliferative disorders (B-LPD) detected by DNA fingerprinting. Br J Cancer 1988;58:773-775. 101. Honma M, Kataoka E, Ohnishi K, Kikuno A, Hayashi M, Sohni T, Mizusawa H. Detection of recombinational mutations in cultured human cells by Southern blot analysis with minisatellite DNA probes. Mutat Res 1993;286:165-172. I Detection of 102. Kikuno T, Honma M, Kataoka E, Ohnishi K, Inoue A, Mizusawa H, Sofuni ' minisatellite DNA mutations induced by MNNG treatment with DNA fingerprint analysis. Mutat Res 1992;272:267. 103. Dubrova YE, Jeffrey AJ, Malashenko AM. Mouse minisatellite mutations induced by ionizing radiation. Nature Genet 1993;5:92-94. 104. Slagboom PE, Mullaart E, Droog S, Vijg J. Somatic mutations and cellular aging: twodimensional DNA typing of rat fibroblast clones. Mutat Res 1991;256:311-321. 105. Coller HA, Thilly WG. Development and applications of mutational spectra technology. Environ Sci Techno1 1994;28:478-487. 106. Coulondre C, Miller JH. Genetic Studies of the lac Repressor. J Molec Biol 1977;117:577-606. 107. Benzer S, Freese E. Induction of specific mutations with 5-bromouracil. Roc Natl Acad Sci USA 1958;44:112- 119. 108. Keohavong P, Liu VF, Thilly WG. Analysis of point mutations induced by ultraviolet light in human cells. Mutat Res 1991;249:147-159. 109. Keohavong P, Thilly WG. Mutational spectrometry: A general approach for hot-spot point mutations in selectable genes. Proc Natl Acad Sci USA 1992;89:4623-4627. 110. Chen J, Thilly W Mutational spectrum of chromium (VI) in human cells. Mutat Res 1994; 323:21-27. 111. Oller AR, Thilly WG. Mutational spectra in human B-cells. J Molec Biol 1992;228:813-826. 112. Cariello NF, Keohavong P, Kat AG, Thilly WG. Molecular analysis of complex human cell populations: mutational spectra of MNNG and ICR-191. Mutat Res 1990;231:165-176. 113. Liang P, Pardee AB. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 1992;257:967-971. 114. Khoury MJ, Beaty TH,Cohen BH. Fundamentals of genetic epidemiology. New York: Oxford University Press, 1993. 115. Weiss KM. Genetic variation and human disease. New York: Cambridge University Press, 1993.

01997 Elsevier Science B.V. All rights reserved. Bwtechnology Annual Review Yolume 3 M.R.El-Gewely, editor.

31

The two-hybrid system in yeast: applications in biotechnology and basic research Thomas Munder, Milena Ninkovic and Barbel Rudakoff Department of Cell and Molecular Biology, Hans-Knoll-Institut fur Naturstofl-Forschung e. K, Jena, Germany

Abstract. The two-hybrid system in Saccharomyces cerevisiae is a powerful technology for probing of protein-protein interactions in vivo. It offers several advantages compared to biochemical in vitro methods. Many applications are conceivable, both in basic and applied research. These include the screening for proteins interacting with a given target protein, characterization of protein binding sites, and the fimctional analysis of whole genomes by generating three-dimensional interaction maps. The two-hybrid system in yeast is well-suited for the development of compound screening assays. Drugs can be identified which interfere in the interaction of therapeutic relevant proteins. Keywords: P-galactosidase, Ace 1, Cdc25, combinatorial libraries, drug screening, Gal4, glycosylation, green fluorescent protein, immunoprecipitation, interaction trap, interaction matrix, metallothionein, nuclear hormone receptors, one-hybrid system, phosphorylation, posttranslational modification, protein linkage map, protein-DNA interactions, protein-linkage map, protein-protein interaction, Ras, reporter gene, Saccharomyces cerevisiae, therapeutic intervention, transactivation assay, transcription factor, tribrid system, two-hybrid system, yeast.

Introduction Protein-protein interactions are involved in many cellular processes like signal transduction pathways leading to the expression of cellular genes. Other examples are the synthesis of DNA and RNA molecules, development of cellular structures like cell membranes, spindle pole body formation and nuclear pore complexes, as well as specific enzymatic reactions. The interaction between proteins is therefore an important regulatory mechanism for the cell. The scientific community invests increasing effort elucidating these various interactions to get detailed insight into the cellular protein network. The dissolving of this network is important to understand the formation and maintenance of human disorders. Many diseases are based on genetic defects concerning specific proteins involved in the cellular metabolism. Figure 1 gives a general overview of the processes occurring in a cell when specific signals, such as growth factors or hormones, reach the cellular surface.When a signal binds to a specific receptor, the receptor is activated and stimulates a signal transduction cascade involving numerous protein-protein interactions. This casAddress for correspondence: T. Munder, Hans-Knoll-Institut fur Naturstoff-Forschung e.\, Department of Cell and Molecular Biology, Beutenbergstr. 11, D-07745 Jena, Germany Bl.: +49-364165-66-92. Fax: +49-3641-65-66-94. E-mail: [email protected]

32

Fig. 1. Signal transduction mechanisms in eukaryotic cells. Black box = mutated protein (e.g., an oncoprotein). Grey boxes = proteins regulated by the activity of the mutated protein.

cade finally leads to an induction or repression of gene transcription by activation of transcription factors. A modification of this cascade by a truncated protein results in an enhanced or reduced interaction with its target protein. This can have dramatic effects on the expression levels of certain genes. These defects can be treated, for example, with biologically active compounds interfering in this particular interaction. For the identification of such compounds, simple and efficient assays have been developed, which allow the fast screening of a large number of chemicals. These screening systems have found a broad range of applications in the field of biotechnology research and are currently used by the pharmaceutical industry for drug discovery This review will focus on the development of screening assays based on the reconstitution of protein-protein and protein-DNA interactions in vivo. In 1989 Fields and Song published a novel genetic system for the detection of proteinprotein interactions in the budding yeast Succharomyces cerevisiae, which was called the two-hybrid technology [ 11. This method offers many applications in basic and applied research. As described below, it can be used for identification of both new drugs and new protein targets for therapeutic intervention. 'ho-hybrid systems General overview

Several methods are available for the detection of protein-protein interactions in vitro (for a recent review see [2]). For special applications these techniques are

33 not sensitive enough and require purified proteins and specific reagents such as high-affinity antibodies for coimmunoprecipitation, which may not be available for a specific protein. Additionally, efficient bacterial or eukaryotic systems for expression of the proteins are necessary Some interactions render to be undetected, because these proteins may need specific cofactors for binding, which are not provided by the in vitro approach. In vitro assays can lead to the identification of artificial protein-protein interactions, which do not occur in vivo. Interactions detected by in vitro methods do not reflect the natural situation in living cells. This is of particular importance if posttranslational modifications are essential for the interaction with other proteins. The two-hybrid system allows the detection of protein-protein interactions in vivo. Thus, it offers a powerful alternative to in vitro methods. Figure 2 describes the main components of this method. The two-hybrid systems developed in yeast, bacteria and higher eukaryotes are based on the properties of a defined class of acidic transcription factors [3,4]. They have the unique feature to function in all eukaryotes tested so far [5-81. Transcription factors are composed of at least two domains, a DNA-binding and an acidic activation domain [3,9,10]. The molecular organization of these proteins has been established by combining the DNA-binding domain of one factor with the activation domain of another factor, yielding a transcription factor with novel properties. This was shown by the construction of a chimera between the DNA-binding domain of the bacterial repressor lexA and the activation domain of the yeast Gal4 protein [ 111. The DNA-binding domain of a transcription factor determines its specificity, which is given by the recognition elements located within the DNA. Binding domains were characterized intensively through X-ray diffraction analysis of single crystals or nuclear magnetic resonance spectroscopy [12]. The precise function of activation domains remains still obscure: it is not clear whether they modulate the activity of the transcriptional initiation complex composed of RNA polymerase I1 and the basic transcription factors by recruiting those factors to the promoter or by altering their activity state. Alternatively they may function in a more indirect way by modulating the chromatin structure allowing the assembly of the transcriptional machinery on the DNA [ 131. For the function of the two-hybrid system it is important that both transcription factor domains act independently. The DNA-binding domain interacts with DNA even in the absence of the transactivation part of the protein which has been demonstrated for the Gal4 DNA-binding domain [lo]. The activation domain retains its ability to activate transcription by itself. This was shown by generating hybrid proteins with both domains of transcription factors of different origin, for example, between the yeast Gal4 DNA-binding domain and the activation domain of herpes simplex virus protein Vp16 [14]. Induction of transcription only occurs if the activation domain can be recruited to a specific DNA element. This function is mediated by the DNA-binding domain. Expression of both domains separately does not activate transcription because it fails to localize the activation domain to the promoter.

34

A

B

promoter

UAS

[

B-D

I

]

UAS

reporter gene

promoter

reporter gene

n

C

UAS

promoter

reporter gene

D

UAS

promoter

reporter gene

Fig. 2. The two-hybrid system. BD,AD = DNA-bindingdomain and activation domain of a transcription factor; UAS = upstream activating sequences; XXZ = proteins !%ed to the DNA-binding domain or activation domain. A: Binding of the complete transcription factor to its specific UAS leads to the expression of a reporter gene. B: The reporter gene is not activated when the transcription factor domains are expressed separately C: Generation of two hybrids composed of the interacting proteins X or Y and the DNA-binding or activation domain results in expression of the reporter. D: Fusions of two noninteracting proteins X and Z to the transcription factor domains do not stimulate reporter gene expression.

For analyzing a possible interaction of two proteins, they are fused to the DNAbinding domain and the activation domain to generate in-frame hybrid proteins. The binding of one hybrid protein to the other results in a reconstitution of an active transcription factor complex, indicated by the expression of a reporter

35 gene. A failure in transactivation is based on a missing contact between the two foreign proteins (Fig. 2). Reporter genes Several reporter genes have been described for the detection of protein-protein interactions in yeast. They are listed in Table 1. The product of the lacZ gene from Escherichiu coli, p -galactosidase, is a widely distributed reporter system [1,15- 191. The enzymatic activity is easily monitored by a direct staining of yeast colonies on 5-bromo-4-chloro-3-indolyl-~-~ -galactopyranoside containing agar plates or, alternatively, after transfer of yeast cells onto filter papers, permeabilization of cells and incubation in presence of the chromogenic substrate [20]. A quantification of p-galactosidase is possible by cultivation of yeast cells in liquid media [21]. This is important when using the two-hybrid technology as a drug screening system (see section: Drug discovery using one- and two-hybrid systems in yeast). Apart from the p-galactosidase, enzymes of the biosynthetic pathway of amino acids or nucleotides are also frequently used as reporters. These include HIS3 [15-17,221, LEU2 [18,23], and URA3 [24]. For example, in a histidin auxotrophic yeast mutant lacking the endogenous HIS3 gene product the activity of a reconstituted transcription factor can simply be monitored through growth of transformants on minimal medium lacking histidine. The URA3 gene product can be measured quantitatively and allows a negative selection scheme using 5fluoro-orotic acid [25], which is metabolized by URA3 to a toxic product. This reporter has been applied for the identification of interaction between nuclear hormone receptors and transcriptional intermediary factors [24,26]. The CUPl gene coding for the yeast metallothionein [27--291 has also been used in two-hybrid approaches [30]. Cup1 confers resistance of yeast cells to heavy metals, especially to copper ions [31,32].The CUPl gene differs from the other reporter systems in that it allows different strengths of protein-protein interactions to be monitored: a strong binding affinity can be detected by the growth of yeast cells under high copper stress conditions, whereas weak interactions result in a weak resistance to exogenously added copper [30]. Recently, a novel reporter system has been described: the green fluorescent protein (GFP) produced by the bioluminescent jellyfish Aequoreu victoria lhble 1. Reporter systems used in the yeast two-hybrid technology. Gene

Product

laCZ HIS3 LEU2 uRA3 CUPl

f3-galactosidase imidazole glycerol phosphate dehydratase f3-isopropylmalatedehydrogenase orotidine-5’-monophosphatedecarboxylase metallothionein

36 [33-361. The GFP also functions in yeast [37,38]. GFP has found many applications, including gene expression and protein localization studies in living organisms. The expression of GFP can simply be monitored by measuring the emitted fluorescence. There is no addition of exogenous cofactors or substrates required for its activity and the lysis of cells can be omitted. Thus, it is an interesting reporter for high-throughput compound screening systems (see section: Drug discovery using one- and two-hybrid systems in yeast). The use of GFP in twohybrid assays has not been demonstrated to date. A commonly used reporter system for two-hybrid studies in mammalian cells is the bacterial chloramphenicol acetyltransferase [39-411. Other reporters are gene products inducing hygromycin B resistance or the coding sequences of human CD4, which can be monitored by fluorescence-activated cell sorting using, for example, a mouse antihuman CD4 monoclonal antibody and a phycoerythrin-conjugatedgoat antimouse IgG antiserum [40]. Transcriptionfactors

The strategy to exploit transcription factors for analyzing protein-protein interactions is based on the observation of Ma and Ptashne that a fusion of the yeast Gal80 repressor to an acidic activation domain induces transcription via the Gal4 DNA-binding domain and Gal4 operator sequences indicating an interaction between Gal4 and Gal80 [42]. In the original two-hybrid assay developed by Fields and Song the Gal4 protein was selected as the transcriptional activator protein [ 11. Gal4 induces transcription of genes required for galactose catabolism in yeast through binding to specific DNA sequences located in the promoter of these genes [43]. For most two-hybrid applications this protein is split in its amino terminal located DNA-binding portion (residues 1-147) and the carboxy terminal activation function (residues 768-88 1). Fields and Song verified their system by probing for the binding of the serine-threonine-specificprotein kinase Snf 1 with its associated protein Snf4 [11. It has been shown that the two-hybrid system also works with transcription factors that differ from Ga14. The transcription factor Vp16 from the herpes simplex virus contains a strong activation domain, which functions very efficiently in yeast [14]. Vp16 together with the DNA-binding domain of the bacterial lexA repressor has been used to analyze, for example, the protein-binding activities in the yeast transcriptional corepressor complex Qc8-Tupl [44]. Gyuris et al. developed a modified version of the GalCbased two-hybrid system called the interaction trap [23], which uses the lexA DNA-binding domain and the bacterial B42 acidic activation domain [45]. Fusions of foreign proteins to a DNA-binding domain are termed bait, whereas hybrids between an activation domain and other proteins are called prey The B42 tag is not as strong as the activation sequences of Gal4 or Vp16, respectively, thus eliminating the possibility of strong semitoxic gene activation [46-481. The expression of at least one hybrid protein under control of the inducible Gall promoter allows the

37 detection of heterologous protein-protein interaction with partners which might be toxic to yeast cells. Reporter gene expression of lacZ and LEU2 in the interaction trap was driven in the presence of ColEl lexA operators [49]. The interaction trap was successhlly applied to detect interactions between the human Cdil protein phosphatase and cell cycle regulated proteins like Cdc2 and Cdk3 [23]. It has also been used to identlfl the human Mxil protein, which specifically binds to the mammalian Max protein, involved in regulation of cell growth [18]. Munder and Furst applied the characteristics of the yeast Acel transactivator for its use in the two-hybrid system [30]. Acel stimulates the transcription of the yeast CUPl gene mentioned above by binding to the CUPl promoter [50-521. Like the Gal4 protein the Acel transcription factor is composed of an aminoterminal DNA-binding and a carboxyterminal transactivation domain [49,53]. The interaction between the DNA-binding domain of Acel and the DNA strongly depends on copper. It has been postulated that copper induces a conformational change in Acel, allowing the protein to bind to DNA [49]. This unique property makes the Acel-based two-hybrid system highly usell for drug screening assays (see section: Drug discovery using one- and two-hybrid systems in yeast). Munder and Furst validated the Acel-based system showing the complex formation between a variety of proteins [30]. Thus, it was proven that the regulatory subunit of the yeast cyclic AMP-dependent protein kinase forms homodimeric complexes in vivo. Furthermore, the interaction of the murine pl 1 Ca2+-bindingEF-hand protein with the annexin I1 or p36 protein was demonstrated with the Acel -based two-hybrid system. The aminoterminal 14 residues of p36 were sufficient for the binding to pl 1 [30]. Subsequently, the Acel system was applied to detect a variety of other protein-protein interactions [54-561. More recently the DNA-binding domain of the human estrogen receptor together with the activation domain of Vp16 was used to demonstrate the ligand-dependent interaction between the retinoid acid receptor and potential cellular transcription factors [24,26]. Interaction was monitored by expression of a reporter gene via estrogen receptor response elements within a yeast promoter lacking natural upstream activating sequences (UAS). The practical aspects of the work with the yeast two-hybrid system can be read in detail in recently published articles, which describe the use of numerous vectors, different yeast strains and various yeast promoters controlling reporter gene expression [57-601. Applications

The two-hybrid technology is an attractive method to check for protein-protein interactions in vivo (Table 2). For this purpose the cDNA sequences of proteins of interest are inserted into plasmids coding for the DNA-binding and activation domain of a transcription factor to obtain in-frame fusions. This methodology has been successhlly applied to numerous proteins from different organisms, including viruses, yeasts, higher plants, flies and mammals [61].

38 Table 2. Main applications of the two-hybridtechnology.

Interactions between two proteins. Mapping of interacting protein domains. 0 Protein interaction screen. 0 Functional genome analysis. 0 Network analysis. 0 High-throughputcompound screening. 0 0

A wide-spreading approach is the probing for interaction domains of given protein partners. Tzamarias and Struhl, for example, found that the yeast proteins Cyc8 and Tupl, involved in transcriptional repression, associate in the two-hybrid assay [MI. To identifl the region of Tupl interacting with Cyc8, several derivatives of a lexA-Tupl hybrid have been constructed and probed with a Cyc8-Vp16 fusion. It turned out that the 72 aminoterminal residues of the 713 amino acids of Tupl are necessary and sufficient to mediate interaction with Cyc8. Using a similar approach Chien et al. found that 7% of the 111-length Sir4 protein of yeast are sufficient to induce homodimerization [62]. The two-hybrid system has been successfully applied to analyze specific mutations in genes, which influence the binding capacity of the target protein. Munder and Furst examined the interaction of the yeast Cdc25 protein with specific mutations of the Ras2 protein. They demonstrated that Cdc25 binds stronger to catalytically inactive Ras2, locked in its GDP-bound or nucleotidefree state, than to dominant activating mutations characterized by bound GTP [301. The application of the two-hybrid system as a protein interaction screen was first demonstrated by Chien et al. [62]. Genomic and cDNA libraries from various tissues and organisms are available for this purpose. The foreign DNA in these libraries is tagged to the activation domain of a transcription factor. It has to be considered that statistically only one-third or one-sixth (dependent on the generation of the library) of the entire library is represented as an in-frame fusion to the activation domain. To cover the complete genome of an organism more inserts must be present in the library and more clones must be screened as compared to conventional methods. Plasmids containing the bait construct and the library are transformed either successively or by cotransformation into a reporter yeast strain. Interacting proteins are usually detected by a combination of two reporter genes. Their expression is regulated by different promoters to reduce the occurrence of false positives. The HIS3 reporter allows a very efficient screening of interacting proteins. The strength of interaction can be influenced by cultivating the cells in the presence of the inhibitor of the HIS3 gene product, 3-aminotriazole (3-AZ, [63]). A low concentration of 3-AZ suppresses a large number of false positives and weak interactions between proteins. The higher the concentration of 3-AZ in the medium of growing yeast colonies the stronger the interaction

39

of the proteins to be identified [22]. In a similar way the CUP1 gene can be used as a reporter for a two-hybrid screen. Only Cupl-expressing cells can grow on mediums containing copper. As in the case of 3-AZ it is possible to vary the amount of copper in the growth medium to influence the stringency of interaction: yeast cells expressing hybrids of strong interacting proteins confer resistance to a higher copper concentration than do cells containing no or low-interacting proteins. Positive signals can be subsequently checked by determination of the P-galactosidase activity Generally, a positive cDNA clone does not contain the whole sequence information of one genuine protein. The entire protein has to be identified, for example, by screening of a phage library containing large DNA fragments by plaque hybridization using the identified sequence as a probe. A two-hybrid interaction screen can be applied to characterize proteins of unknown functions. The sequencing of the entire yeast genome led to the identification of many essential genes, which are usually analyzed with difficulty by phenotypic assays of mutant yeast strains. Identification of interacting proteins helps to clarifjr their cellular function. Related investigations can be accomplished with expressed sequence tags arising form the human genome sequencing project. Such an approach may also lead to the identification of new mammalian genes altered in disease states. The two-hybrid system can be used as a genetic tool to reveal a molecular network of interacting proteins. An initial protein serves as a bait to find interacting partner proteins which are involved in ordered cellular pathways. Such experiments have been performed to clarifjr the protein network of components of the yeast pheromone-response signal transduction pathway (reviewed in [MI). These experiments are laborious using the classical screening approaches, based on transformation of the library into yeast cells carrying the baits. To simplifjr the whole procedure, Finley and Brent developed a novel selection scheme [65]. This method relies on the fact that haploid yeast have two different mating types, MATa and MATa, which fuse to form diploid cells [66]. The bait constructs were transformed into an MATa strain, for example, and the prey constructs into a strain of opposite mating type. Cells are allowed to mate, the resulting diploids are selected on minimal media and checked for reporter gene expression. Several individual protein-protein interaction can be tested by this interaction mating procedure. The results can be displayed as two-dimensional arrays in an interaction matrix [65]. Bendixen et al. modified this approach [67]. Yeast MATa cells containing activation domain tagged libraries were spread onto agar plates, replica plated and mated with MATa cells containing the bait construct. This method eliminates the need for cotransformations and allows the search for interacting proteins to an unlimited number of bait constructions with a single transformation [67]. An interesting extension of the two-hybrid system is the identification of all possible protein-protein interactions in a cell to generate a three-dimensional interaction map of one organism. Bartel et al. constructed two libraries of the relatively small E. coli bacteriophage T7 genome, tagged with the DNA-binding

40 or the activation domain of Gal4 [68]. After excluding self-activating baits the two libraries were screened for interacting proteins against each other. Among 55 genome-encoded proteins Bartel et al. identified 25 intra- and intermolecular interactions. These initial experiments could be extended to organisms possessing a higher complexity It is particularly helpful if the genome sequence of the investigated organism is known. The respective genome size and the problems of false positives and false negatives are the limiting factors in these studies. The use of the two-hybrid technology in drug screening is discussed in the section: Drug discovery using one- and two-hybrid systems in yeast. Pros and cons

The two-hybrid assay is a fast system for determination of protein-protein interactions, usually involving only two cloning steps for the bait and prey construction. The system is highly sensitive and for some interactions it seems to be more sensitive than in vitro approaches [69,70]. For example, the cellular prion protein PrP binds to the apoptosis suppressor Bcl-2, as was shown by a yeast interaction trap. Using a monoclonal anti-Myc antibody this interaction could not be detected by immunoprecipitation of PrP and Bcl-2 tagged with an epitope derived from c-Myc [71]. Proteins involved in signal transduction pathways are usually characterized by a weak binding affinity to their target molecules. Detectable coprecipitation between yeast Ras and adenylate cyclase, for example, has never been observed [72,73], whereas the binding of mammalian h-ras to the adenylate cyclase was demonstrated with a lexA-Vp16 two-hybrid assay [171. The interaction between Ras and its guanine-nucleotide exchange protein Cdc25 can only be measured in biochemical experiments if specific Ras mutations were used, which bind more strongly to Cdc25 than do wild-type Ras [74,75]. Even cross-linking studies with h-ras binding proteins seems to be particularly ineffective [76]. Therefore one might speculate that biochemical in vitro methods may be not suitable to discover physiological relevant interactions. The minimal affinity interaction detectable in the two-hybrid system depends on several variables, including expression level of the fusion proteins, choice of the reporter gene, and the number of DNA-binding sites in the reporter promoter. The two-hybrid system may detect weak interactions with a & of less than 1 pM [77]. Estojak et al. correlated affinity data taken from two-hybrid experiments with in vitro measurements [77]. Two sets of proteins were used in their approach: mammalian Myc, Max, and Mxil, belonging to the class of helix-loop-helix proteins and the CI repressor from bacteriophage lambda. The strength of protein-protein interactions generally correlated with in vitro determinations of binding affinity High, intermediate, or low affinity interactions as determined in vitro could be similarly discriminated in yeast cells. Importantly, there was no single reporter gene for which the amount of gene expression linearly reflected the affinity measured in vitro. This suggests that it is not advisable to use differences in the reporter activity level as a direct indication of an

41 interaction afinity One has to consider these findings by evaluating interaction affinities with the yeast two-hybrid assay [77]. Compared to biochemical in vitro studies the two-hybrid system allows the discovery of protein-protein interaction in vivo. Nevertheless, in some cases it is questionable whether an interaction identified in the yeast assay is a natural interaction, reflecting the situation in the cell. It may happen that binding of two proteins was found, which are normally expressed in different cell types, localized in distinct cellular compartments, or expressed in different developmental stages [78]. To distinguish between true and false positives several methods have been developed, mainly based on the use of different bait vectors and various yeast strains. A comprehensive review about these problems was published by Bartel et al. [79]. It is therefore recommended that an in vivo interaction is confirmed by alternative methods. A fbnctional assay for a given protein-protein interaction would be additionally usefbl for the verification of cellular interactions. It may happen that an expected protein-protein interaction could not be detected due to a specific two-hybrid configuration. The candidate proteins, for example, are fbsed aminoterminal to the transcription factor domains, but the interaction may require unmasked aminotermini. Switching the protein domains to the other part of the transcription factor seems to be also critical in some instances. Mosteller et al., for example, used the yeast GalCbased two-hybrid system to analyze the interaction between yeast Cdc25 and human h-ras [80]. They found that the configuration of plasmid constructs strongly affected the results of these interaction studies. Fusions of the DNA-binding domain of Gal4 to Cdc25 and chimera between the Gal4 activation domain and h-ras did not produce a positive signal, whereas the exchange of transcription factor tags in the opposite configuration led to the detection of binding between Cdc2S and h-ras. Thus, a negative result in the two-hybrid system does not mean that the two proteins tested do not interact in principle. It indicates that they do not interact under the specific conditions examined [80]. The following parameters can be changed if an interaction is not detected: 1) the host organism; 2) another transcription factor and/or another two-hybrid approach; 3) truncated protein domains, which is of special importance if high-level expression of the protein is toxic to the cell or the protein is not stably expressed; and 4) peptide spacers located in between the transcription factor domains and the fused protein to generate a specific distance between the proteins of one hybrid, preventing the mutual influence of one domain on the activity of the other one. The two-hybrid assay is limited to proteins that can be localized to the nucleus. This does not necessarily mean that the binding of two proteins occur in this cellular compartment. An interaction can also occur immediately after protein synthesis in the cytoplasm. The whole complex is subsequently transported via nuclear pore complexes into the nucleus. However, to enhance the probability of nuclear import, vectors have been developed encoding the activation domain tagged to nuclear localization sequences of the SV40 large T antigen [62,81]. This short stretch of aminoterminally located seven amino acids is able to trans-

42 locate proteins into the yeast nucleus [82,83]. It is generally accepted that the two-hybrid system does not detect interaction between transmembrane and secreted proteins. These proteins exist in an oxidizing environment outside the cell and cannot fold properly to interact and activate reporter genes in the yeast nucleus [84]. Interestingly a recent work demonstrated that the extracellular domain of a Moloney murine leukemia virus transmembrane envelope protein is able to form dimeric complexes if analyzed by the yeast two-hybrid approach [85]. As Munder and Fiirst already reported earlier, the yeast GDP/GTP catalyst Cdc25 binds to Ras2 in vivo [30]. Both proteins are membrane associated. These studies also extended the use of the two-hybrid system to membrane localized proteins. In general, due to their activating properties, transcription factors are in many cases not suitable for a bait construction in the two-hybrid system. Additionally, there exist many proteins not involved in transcription, which can activate transcription if hsed to a DNA-binding domain. To circumvent this undesirable induction of transcription deletions at the activating parts can help. Alternatively, bacterial two-hybrid systems can be used (see section: Alternative two-hybrid systems). However, there are numerous reports demonstrating the interaction of transcription factors with other cellular proteins using transcription factors as baits, such as the viral transcription factor Tax [86,86a] and human proteins from the steroidhhyroid receptor family [87-901. Protein-protein interactions, which are dependent on specific posttranslational modifications that occur within the endoplasmic reticulum, such as glycosylation and disulfide bond formation, may not be detectable in the yeast two-hybrid system.Very little is known in yeast about the process of 0-glycosylation,whereas more information are available about N-glycosylation. Yeast as an eukaryotic organism possesses the mechanisms for protein glycosylation [91,921. These processes follow the same rules as in higher eukaryotic cells [93,94]. The protein hybrids in the two-hybrid system are generally highly expressed in yeast due to strong promoters present on multicopy plasmids, which implies that only a small portion of these proteins may be glycosylated. Therefore some protein-protein interactions remain undetected. Several proteins are posttranslationally modified by phosphorylation. S. cerevisiae expresses many serinekhreonine-specific protein kinases, but there is only limited tyrosine phosphorylation of endogenous yeast proteins [95-981. Despite the detection of interactions between autophosphorylated tyrosine kinases and other proteins [99-1011, it is difftcult to demonstrate interactions between proteins, which are dependent on tyrosine phosphorylation. To circumvent these difficulties, Osborne et al. modified the two-hybrid system to a socalled tribrid system [102]. This approach was used to examine the signal transduction mechanism induced by activation of the high affinity IgE receptor FceRI via src-homology 2 (SH2)-containing proteins leading to the release of intracellular calcium and other second messengers [1031. FcsRI contains immunoreceptor tyrosine-based activation motifs (ITAMS, [104]), which are

43 phosphorylated by the tyrosine kinases Lck and Lyn and subsequently mediate the interaction with the protein tyrosine kinase Syk, as was biochemically shown [105-1081. For the tribrid studies the cytoplasmic tail of the FceRIy subunit containing an ITAM was hsed to the DNA-binding domain of l e d and the SH2 domains of Syk were joined with the transcriptional activation region of the herpes simplex virus type I Vmw65 protein [109]. Activation of reporter gene expression occurs only in the presence of coexpressed Lck, indicating that a phosphorylation of the FceRIy ITAM by Lck was necessary for the interaction with Syk. A similar approach was described by Sun and Maurer [ 1101. They demonstrated an interaction between the transcription factor CREB and the CREB binding protein CBP using a mammalian two-hybrid system. This interaction could only be seen if cells were cotransfected with a cyclic AMP-dependent protein kinase expression vector. Thus, phosphorylation of CREB by this kinase seems to be essential for the detection of CREBKBP binding. There are several studies demonstrating that the interaction of two proteins is dependent on the presence of a third protein. The binding of yeast Ras proteins to Cdc25 has been shown to be dependent on the activation state of Ras: Cdc25 interacts predominantly with the inactive GDP-bound form of Ras, and the interaction gets lost after the conversion in the activated GTP-bound state [30]. The yeast Iral protein converts GTP-Ras to GDP-Ras [ 1111. The binding of Cde25 to Ras proteins in an iral-disrupted strain was considerably lower compared to an Iral wild-type strain [30]. This indicates that Iral participates in the interaction of Cdc25 with Ras. The serine-threonine specific protein kinase Raf is a downstream effector molecule of h-ras in mammalian signal transduction pathways. The Map kinase kinase Mek can be activated by Raf, which leads to phosphorylation of the Map protein kinase. Van Aelst et al. found in the yeast Gal4 two-hybrid system that h-ras interacts specifically with the aminoterminus of Raf, whereas Mek binds to the carboxyterminal half of Raf [112]. No direct binding of h-ras to Mek was found. Interestingly, in presence of overexpressed wild-type Raf, h-ras interacts with Mek in the two-hybrid system, indicating a heterotrimeric complex formation between h-ras, Raf and Mek. Legrain and Chapon examined the interaction between proteins of the yeast spliceosome assembly pathway [1131. They identified binding of Prp9 to Spp91 as well as Spp9l to Prpll, but they could not detect a contact between Prpl 1 and Prp9 [113,114].The latter interaction was restored by overexpression of Spp91 in yeast, indicating a ternary protein complex. Alternative two-hybrid systems Certain proteins of bacterial of mammalian origin require specific secondary modifications for their binding activity, which are not provided by the yeast cell. Some proteins are not stably expressed or degraded by the activity of specific or unspecific proteases in yeast. Additional mammalian proteins, not present in

44 yeast, may be involved in the formation of a complex between two proteins. Twohybrid systems developed in higher eukaryotes and in bacteria can be used to study interactions of proteins from these organisms [39,40,115]. The bacterial host organism is a suitable system for the detection of proteins interacting with an eukaryotic transcription factor bait, as eukaryotic activation sequences are not active in E. coli. In yeast and higher cells those sequences may stimulate transcription if they were fused to the DNA-binding domain, which interfere in the determination of protein-protein interaction with the twohybrid approach. An interesting variant of the two-hybrid approach in prokaryotes was developed recently by Gramatikoff et al. [116]. The direct interaction rescue (DIRE) relies on the minor coat protein encoded by gene 3 of a filamentous phage. This protein can be functionally separated into two parts, the Nterminal domain binds to the F’ pili allowing the infection with E. coli cells and the C-terminal domain, which is anchored to the phage. Fusion of interacting proteins to the separated gene 3 products results in reconstitution of phage infectivity The DIRE is of special importance for the interaction screening of proteins binding to a given bait, because filamentous phages allow the generation of protein domain libraries possessing a great complexity It has been applied to demonstrate the binding of the mammalian c-Jun transcription factor to the cytoskeletal tropomyosin and the ribosomal protein L18a of higher eukaryotes [117]. Recently a new variant of the two-hybrid assay has been described, the ubiquitin-based split-protein sensor technology (USPS) [1181. This system makes use of ubiquitin instead of transcription factor hsion proteins and allows the monitoring of protein-protein interaction as a hnction of time at the natural sites of this interaction in a living cell. Therefore USPS is an interesting two-hybrid alternative, especially useful for proteins, which are not able to enter the nucleus, or which contain transactivation domains. One-hybrid systems The one-hybrid system in yeast is derived from the two-hybrid assay It is used for

DNA-binding sites

prpmoter

reporter gene

Fig. 3. The one-hybrid system. BD, AD = DNA-binding domain and activation domain of a transcrip-

tion factor.

45 characterization of protein-DNA interactions. Figure 3 shows the basic principle. One-hybrid systems are composed of two basic components, a reporter construct containing cis-acting regulatory elements within an UAS-less yeast promoter and a plasmid expressing a transcription factor of interest, either alone or as a fusion to a DNA-binding domain or activation domain of another transcription factor. The concept of a one-hybrid system has been developed independently by two groups [119,120]. Li and Herskowitz used this genetic in vivo assay for isolation of novel genes encoding proteins that recognize autonomous replicating sequences in yeast (ARS). ARSs act as DNA replication origins both on chromosomes and on plasmids [121]. The reporter expression in the one-hybrid assay was controlled by multiple copies of the yeast ARS consensus sequence (ACS). To guarantee binding specificity, nonfunctional ACS has been used additionally Screening of a Gal4 activation domain tagged expression genomic yeast library led to the identification of ORC6, a component of the yeast origin recognition complex. Using a similar approach Dowel1 and co-workers found that the yeast Dbf4 gene product also interacts with ARS, either directly or through an unidentified protein [122]. Dbf4 is known to bind to the yeast protein kinase Cdc7 [123]. To determine which regions of Dbf4 are required for interaction with Cdc7 and with ARS, deletions within the Dbf4 coding regions have been made. It turned out that the Cdc7 and A R S interaction domains of Dbf4 are not coincident, implying that Dbf4 does not interact with initiation complexes through Cdc7. This study shows that one- and two-hybrid systems can be combined to characterize multiprotein complexes (Tables 2 and 3). Gstaiger et al. used a modified version of the one-hybrid assay to identif) proteins involved in tissue-specific transcriptional regulation [1241. The octamer motif, playing a central role in mediating the activity of both B-cell specific and ubiquitous promoters, was linked to promoter regions of the lacZ and HIS3 gene. Screening of a Gal4 activation domain tagged human peripheral lymphocyte library led to the identification of a novel protein named Bobl . It stimulates reporter gene transcription provided that the predominantly lymphoid-restricted octamer-binding factor Oct2 is coexpressed. It is concluded that Bobl represents a new tissue-specific transcriptional coactivator [1241. Wilson et al. have used the one-hybrid assay as an in vivo selection system for isolating DNA targets of DNA-binding proteins [125]. The feasibility of this new approach was verified by the identification of DNA fragments that contained binding sites for the well-characterized Gcn4 transcriptional activator. These cis-acting elements were pooled out of random oligonucleotides and rat genomic sequences inserted within the UAS-less GAL1 promoter upstream of the HIS3 reporter. This system was applied to identif) binding sites of the NGFI-B protein (nerve growth factor receptor-induced orphan receptor), an orphan receptor, which belongs to the steroid/thyroid hormone receptor superfamily [126,1271. To make sure that NGFI-B activates transcription in yeast, a fusion protein composed of the DNA-binding part of lexA, NGFI-B and the activation domain

46 of Gal4 was generated. This chimera still activated transcription from a lexA binding site containing reporter gene, demonstrating that the hybrid activator protein was functionally expressed in yeast. The above-mentioned approaches can be extended to any transcription factor or DNA-binding site of interest. This allows a profound characterization of transcriptional activators in vivo. Since the one-hybrid assay relies on transcriptional activation it cannot be applied to iden@ transcriptional repressors. The one-hybrid system can also be used for the characterization of the activating properties of proteins with unknown function. Such proteins can be tethered to the DNA-binding domain of Gal4 and its transcriptional activity determined by reporter gene expression through Gal4 binding sites. Since the one-hybrid assay requires only a single cloning step for each protein it presents an attractive technology for the functional characterization of a large number of proteins. Another application is envisible. The one-hybrid system should allow the identification of the whole set of acidic transcriptional activators present in an organism. For this purpose the design of DNA-binding domain tagged libraries is required. Many transcription factors are involved in the establishment of human diseases. The one-hybrid system is a tool to identifl those factors, which can be used for therapeutic intervention. Fusing E. coli genomic DNA fragments to the Gal4 DNA-binding domain Ma and Ptashne have already demonstrated in 1987 the potency of this system. They identified a variety of bacterial transcriptional activating sequences functionally active in yeast [45]. One of these sequences (B42) is commonly used as the activation domain in yeast two-hybrid assays (see section: Transcription factors). A positive response in the one-hybrid system does not necessarily indicate the activity of a transcription factor. Many studies have shown that cellular proteins not involved in transcription contain fortuitous acidic transactivation domains resulting in transcriptional stimulation. Drug discovery using one- and two-hybrid systems in yeast S. cerevisiae possess many advantages which are useful for the development of in vivo drug screening assays. Yeast cells are easy to handle and they have a short generation time. Several transformation protocols are available. Vectors for the heterologous gene expression have been developed, allowing the stable maintenance of plasmids in yeast (for recent reviews see [128,129]). S. cerevisiue is well-characterized on both genetic and cellular levels. It is the first eukaryotic Table 3. Applications of the one-hybrid system.

Identification of DNA-binding sites. Identification of transcriptional activators. 0 Mapping transactivation domains. 0D rug screening.

0 0

47 organism, for which the sequence has been determined completely [130,1311. An attractive feature for expression of many mammalian targets in yeast is that many of these proteins are completely foreign to yeast cells. Therefore yeast allows the analysis of their activities in an isolated, but in vivo system. On the other hand, the extensive homologies between basic processes in yeast and higher cells allow heterologous proteins to be functional in S.cerevisiue. This has been demonstrated, for example, with proteins belonging to the family of transcription factors. The interaction of transcriptional activators with transcription factors, adapters, and RNA polymerase I1 is a complex biochemical event that is difficult to study in cell-free systems [132,1331. These proteins are important candidates for therapeutic intervention due to three main characteristics [131. First, they have a high diversity and it is estimated that the human genome encodes for more than 3,000 gene-specific transcription factors [134]. Second, they show a high degree of specificity, which is given by their DNA-binding domains and the respective recognition sequences within the DNA. Third, many of them are involved in the establishment of human disorders, ranging from cancer, viral infections, autoimmune diseases and inflammation, for example. Detection of transcription factor activity in yeast requires two plasmids: one expresses the protein of interest and the second one carries the reporter gene fhed to a synthetic promoter containing the DNA recognition sites of the respective transcription factor. These plasmids are subsequently transformed into a yeast strain. The activity of the reporter gene product correlates directly with the activity of the transcription factor. These cells can be used to screen for biologically active drugs, which interfere in the activity of the target protein. To achieve a highly effective screening of many compounds in different concentrations this assay can be adapted to a miniaturized format, like the 96-well culture dishes, for example. Using automated equipment several thousands of compounds can be analyzed within a short period of time. Transactivation assays in yeast have been described for the detection of antiviral drugs and new ligands for nuclear hormone receptors, for example (reviewed in [133]). Screens of the latter type are highly selective for receptor agonists and can detect agonistic compounds even at low concentrations [135]. These drugs have a broad application both in medicine and agriculture. It has been demonstrated by several reports that members of the steroidhhyroid receptor family are functionally expressed in yeast [136--141a]. In some instances endogenous yeast proteins may occupy the DNA recognition sites for the foreign transcription factors or they may induce reporter gene expression by themselves. A one-hybrid assay, obtained by a fusion of the transcription factor to the Gal4 DNA-binding domain, allowing gene expression through Gal4 binding sites should avoid these problems. This could also be applied to transcription factors with unknown DNA recognition sites, e.g., orphan receptors. Fusion of a strong acidic activation domain, originating from Vp16 or Ga14, respectively, to a transcription factor supports the detection of weak transcriptional activities in yeast.

48 As a link between one- and two-hybrid drug screening assays, Dasmahapatra et al. developed an elegant genetic system for studying the activity of a proteolytic enzyme [142]. They inserted the self-cleaving 3C protease of coxsackievirus B3 [1431 between the DNA-binding and activation domain of the yeast Gal4 protein. The activity of the chimeric protease was detected by inhibition of reporter gene expression, whereas a mutated nonfunctional protease hybrid stimulated lacZ activity through Gal4 binding sites in yeast. This system can be easily adapted as a drug screening assay for identification of protease-inhibiting compounds [1331. Viral proteases induce proteolysis of the primary viral polypeptide precursors and are therefore essential for viral replication. Thus, they represent potential targets for an antiviral therapy The two-hybrid system could be used as a tool to id en ti^ specific molecules interfering in the interaction of two or more proteins. In general this sophisticated screening technique can be applied to any protein-protein interaction of therapeutic interest. As a prerequisite, the cDNA sequence of these targets has to be accessible and the interaction must be restored in the two-hybrid approach. Like in the one-hybrid assay, inhibition of protein-protein interactions by certain compounds can be detected by a miniaturized format. The problem of the GalCbased two-hybrid systems for its use in drug screening is the constitutive expression of the protein partners. This leads to an expression of the reporter during the whole fermentation process. For the two-hybrid drug screening yeast cells are grown overnight. The cultures are subsequently aliquoted into 96-well plates and the compounds to be tested are added. This implies that the effect of an inhibitory compound, resulting in reduced reporter gene expression, could hardly be detected. Therefore the Gal4-based two-hybrid system suffers from a signal-to-noise ratio. The inducibility of reporter gene expression by copper ions makes Acel very usell for development of highthroughput drug screening assays (Fig. 4). As stated above, the DNA-binding domain of Acel interacts with DNA only in the presence of copper. This implies that the transcription of the reporter in an Acel-based two-hybrid assay is only initiated by the addition of copper. The incubation of yeast cells with a drug inhibiting a given protein-protein interaction followed by the copper inducer results in a clearly distinguishable reduction of reporter gene expression compared to control cells. Two reporter systems are of interest for monitoring protein-protein interaction in drug screening assays: the green fluorescent protein and the P-galactosidase mentioned above. The activity of the latter one is usually determined by a colorimetric assay using 0-nitrophenyl-fl-D -galactopyranoside as a substrate. The detection sensitivity of j3 -galactosidase is dramatically increased through the use of the chemiluminescent 1,2-dioxetane.Dioxetane can be linked to a j3-galactosidase substrate, which becomes deglycosylated by the reporter activity under neutral pH conditions. After shifting the pH above 12 the activated intermediate becomes deprotonated and decomposes with the emission of light [144]. The chemiluminescence is measured by a luminometer or alternatively a liquid

49

Fig. 4. Comparison of the GaM-based two-hybrid system with the copper inducible Ace1 system. Explanation in the text.

scintillation counter [145,1461. This assay offers more than 1,000-fold higher sensitivity compared to the color ONPG test, which is of special interest, if weak protein-protein interactions are examined in drug screening systems. Whole cell-based systems offer significant advantages over cell-free screening assays. In vivo assays allow the identification of drugs in the cellular environment, which most closely resembles the natural conditions. Furthermore, they do not need the reconstitution of entire multiprotein complexes like in cell-free systems [133,1351. Transactivation assays using steroid hormone receptors as target proteins, for example, discriminate between agonistic and antagonistic receptor ligands, which cannot be distinguished by the classical in vitro recep-

50

tor-ligand binding assays. However, compounds, which do not penetrate the cellular membrane, are undetected in a cell-based in vivo assay It is known that yeast is relatively impermeable to many chemicals [147]. Incubation with lytic enzymes to dissolve the cell wall or the treatment with specific agents such as polymixin B leads to an enhanced permeability of yeast (reviewed in [148]). It is worthwhile to keep in mind that screening assays in S. cerevisiue have to be considered as primary screening assays, which implies that other assays have to be followed to determine the specificity of a newly identified drug. Only the combination of cell-based and in vitro assays may lead to the identification of novel lead compounds. Small-molecule lead structures are of outstanding interest for their use as therapeutic drugs. Many compounds are collected as purified products within existing libraries and can be chemically modified. Living organisms and the recently established combinatorial chemistry are important resources, since they produce new or unknown compounds. Combinatorial libraries, produced by automated synthesizers [1491, so far generate peptide sequences [1501.Work is in progress to generate nonpeptide combinatorial libraries [151-1531. Many biologically active substances are produced by a large variety of microorganisms, but also by invertebrates, algae and higher plants. Most of these natural compounds possess unknown functions and a lot of them remain undetected. Approximately 180,000 different species of microorganisms have been identified to date, but an estimated 5-10 times more species probably exist. To date, 16,500 individual microbial metabolites have been isolated and characterized. Out of this, 1%, i.e., 130-150 compounds, have found practical uses in agriculture and medicine [1541. These substances may represent a highly important pool for the treatment of mammalian disorders. The two-hybrid technology has been used to identifl small peptides interacting with given protein targets. Randomly generated peptide libraries, fused to the Gal4 activation domain are now readily available. Yang et al. identified several peptides capable of binding to the retinoblastoma protein [155]. In a similar approach peptide aptamers have been found, which recognize and inhibit the human kinase Cdk2. These aptamers bear analogies with monoclonal antibodies [156]. This approach can be applied as a screening system for the identification of peptides interfering in the interactions between pharmaceutically relevant proteins. The application could be extended to characterize the binding site of two proteins, since a peptide mimicking the interaction sites should result in a reduction of reporter gene expression.

Conc1usions The two-hybrid system in S. cerevisiue is a powerll tool for probing of proteinprotein interactions in vivo. It offers several advantages compared to biochemical in vitro methods. The possibilities of the two-hybrid technology both in basic research and for biotechnological applications are enormous. This is demon-

51

strated by accumulating data in the literature. The two-hybrid assay is used for the characterization of protein binding sites, the screening of proteins interacting with a given target protein, and the fimctional analysis of whole genomes by generating three-dimensional interaction maps. Furthermore, it is well-suited for the development of compound screening assays. Drugs can be identified interfering in the interaction of therapeutically relevant proteins. Besides the yeast system, several methods have been developed to analyze protein-protein interactions in prokaryotes as well as in higher eukaryotes. It is obvious, that the two-hybrid system leads to a better understanding of the processes that occur in living organisms.

Acknowledgements We thank Christian Zurek, Karin Adelhelm and Yvonne Berghofer-Hochheimer for many helpll comments and for critically reading the manuscript.

References 1. Fields S, Song 0-K. A novel genetic system to detect proteidprotein interactions. Nature (London) 1989;340:245-246. 2. Phizicky EM, Fields S. Protein-protein interactions: methods for detection and analysis. Microbiol Rev 1995;59:94-123. 3. Ptashne M. How eukaryotic transcriptional activators work. Nature (London) 1988;335:683689. 4. Mitchell PJ, Tjian R. Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 1989;245:371-378. 5. Fischer JA, Giniger E, Maniatis T, Ptashne M. GALA activates transcription in Drosophiia. Nature (London) 1988;332:853-856. 6. Kakidani H, Ptashne M. GALA activates gene expression in mammalian cells. Cell 1988;52 161-167. 7. Ma J, Przibilla E, Hu J, Bogorad L,F'tashne M. Yeast activators stimulate plant gene expression. Nature (London) 1988;334:631-633. 8. Webster N, Jin JR, Green S, Hollis M, Chambon €?Theyeast UASG is a transcriptional enhancer in human HeLa cells in the presence of the GAL4 trans-activator. Cell 1988;52:169-178. 9. Hope IA, Struhl K. finctional dissection of a eukaryotic transcriptional activator protein, GCN4 ofyeast. Cell 1986;46:885-894. 10. Keegan L, Gill G, Ptashne M. Separation of DNA binding from the transcription-activating function of a eukaryotic regulatory protein. Science 1986;231:699-704. 11. Brent R, Ptashne M. A eukaryotic transcriptional activator bearing the DNA specificity of a prokaryotic repressor. Cell 1985;43:729-736. 12. Harrison SC. A structural taxonomy of DNA-binding domains. Nature (London) 1991;353: 715-719. 13. Peterson MG, Baichwal VR. Transcription factor based therapeutics: drugs for the hture? 'Rends Biotech 1993;11:11-18. 14. Sadowski I, Ma J, Triezenberg S, Ptashne M. GALA-VP16 is an unusually potent transcriptional activator. Nature (London) 1988;335:563-564. 15. Hannon GJ, Demetrick D, Beach D. Isolation of the Rb-related p130 through its interaction

52 with CDK2 and cyclins. Genes Dev 1993;7:2378-2391. 16. Harper JW, Adami GR, Wei N, Keyomarsi K, Elledge SJ. The p21 Cdk-interacting protein Cipl is a potent inhibitor of G1 cyclin-dependent kinases. Cell 1993;75:805-816. 17. Vojtek AB, Hollenberg SM, Cooper JA. Mammalian Ras interacts directly with the serinel threonine kinase Raf Cell 1993;74:205-214. 18. Zervos AS, Gyuris J, Brent R. Mxil ,a protein that specifically interacts with Max to bind MycMax recognition sites. Cell 1993;72:223-232. 19. Fields S, Sternglanz R. The two-hybrid system: an assay for protein-protein interactions.Trends Genet 1994;110:286-292. 20. Breeden L, Nasmyth K. Regulation of the yeast HO gene. Cold Spring Harb Symp Quant Biol 1985;50:643-650. 21. Breeden L, Nasmyth K.Cell cycle control of the yeast HO gene: cis- and trans-acting regulators. Cell 1987;48:389-397. 22. DurfeeT, Becherer K,Chen P-L,Yeh S-H, Yang Y, Kilburn AE, Lee W-H, Elledge SJ. The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit. Genes Devel 1993;7:555-569. 23. Gyuris J, Golemis E, Chertkov H, Brent R. Cdi, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell 1993;75:791-803. 24. Le Douarin B, Pierrat B, vom Baur E, Chambon P, Losson R. A new version of the two-hybrid assay for detection of protein-protein interactions. Nucl Acid Res 1995;23:876-878. 25. Boecke JD, Lacroute F, Fink GR. A positive selection for mutants lacking orotidine-5’-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Molec Gen Genet 1984; 197:345-346. 26. vom Baur E, fiche1 C, Heery D, Heine MJ, Garnier JM, Vivat V, Le Douarin B, Gronemeyer H, Chambon P, Losson R. Differential ligand-dependent interactions between the AF-2 activating domain of nuclear receptors and the putative transcriptional intermediary factors mSUGl and TIFI. EMBO J 1996;15:110-124. 27. Butt TR, Sternberg EJ, Gorman JA, Clark P, Hamer D, Rosenberg M, Crooke SI. Copper metallothionein of yeast, structure of the gene, and regulation of expression. Proc Natl Acad Sci USA 1984;81:3332-3336. 28. Fogel S, Welch JW. Tandem gene amplification mediates copper resistance in yeast. Proc Natl Acad Sci USA 1982;79:5342-5346. 29. Karin M, Najarian R, Haslinger A,Valenzuela P, Welch J, Fogel S. Primary structure and transcription of an amplified genetic locus: the CUP1 locus of yeast. Proc Natl Acad Sci USA 1984;81:337-341. 30. Munder T, Fiirst P. The Saccharomyces cerevisiae CDC25 gene product binds specifically to catalytically inactive Ras proteins in vivo. Molec Cell Biol 1992;12:2091-2099. 31. Kagi JHR, KojimaY. Chemistry and biochemistry of metallothionein. In: Kagi JHR, Kojima Y (eds) Metallothionein 11. Basel, Birkhauser Verlag, 1997;25-61. 32. Hamer DH. Metallothionein. Ann Rev Biochem 1986;55:913-951. 33. Tanahashi H, Ito T, Inouye S, Tsuji FL, Sakaki Y. Photoprotein aequorin: use as a reporter enzyme in studying gene expression in mammalian cells. Gene 1990;96249-255. 34. Sheu Y-A, Kricka LJ, Pritchett DB. Measurementof intracellular calcium using bioluminescent aequorin expressed in human cells. Anal Biochem 1993;209:343-347. 35. Inouye S, l3uji FL. Aequorea green fluorescent protein: expression of the gene and fluorescent characteristics of the recombinant protein. FEBS Lett 1994;341:277-280. 36. Chalfie M,TuY, Euskirchen G, Ward WW, Prasher DC. Green fluorescent protein as a marker for gene expression. Science 1994;263:802-805. 37. Cubitt AB, Heim R, Adams SR, Boyd AE, Gross LA,Tsien RY. Understanding, improving and using green fluorescent proteins. Trends Biochem Sci 1995;20448-455. 38. Niedenthal RK, Riles L, Johnston M, Hegemann H. Green fluorescentprotein as a marker for gene expression and subcellular localization in budding yeast. Yeast 1996;12:773-786.

53 39. Vasavada HA, Ganguly S, Germino FJ, Wang ZX,Weissman SM! A contingent replication assay for the detection of protein-protein interactions in animal cells. Proc Natl Acad Sci USA 1991; 88:10686--10690. 40. Fearson ER, Finkel T, Gillison ML, Kennedy SP,Casella JF, Tomaselli GF, Morrow JS, Dang CV. Karyoplasmic interaction selection strategy: a general strategy to detect protein-protein interactions in mammalian cells. Proc Natl Acad Sci USA 1992;89:7958-7962. 41. Yin M-J, Paulssen Ed, Seeler J-S, Gaynor RB. Protein domains involved in both in vivo and in vitm interactions between human T-cell leukemia virus type I 'Igx and CREB. J Virol 1995;69: 3420-3432. 42. Ma J, Ptashne M. Converting a eukaryotic transcriptional inhibitor into an activator. Cell 1988; 55:443-446. 43. Johnston M. A model hngal gene regulatory mechanism: the GAL genes of Saccharomyces cerevisiae. Microbiol Rev 1987;51:458-476. 44. Tzamarias D, Struhl K. Functional dissection of the yeast Cyc8-Tupl transcriptional co-repressor complex. Nature (London) 1994;369:758-761. 45. Ma J, Ptashne M. A new class of yeast transcriptional activators. Cell 1987;51:113-119. 46. Gill G, Ptashne M. Negative effect of the transcriptional activator GALA. Nature (London) 1988;334:721-724. 47. lliezenberg SJ, LaMarco KL, McKnight SL. Evidence of DNA: protein interactions that mediate HSVl -immediate early gene activation by VPl6. Genes Devel 1988;2:730-742. 48. Berger SL, Piiia B, Silverman N, Marcus GA, Agapite J, Regier JL, Triezenberg SJ, Guarente L. Genetic isolation of ADA2: a potential transcriptional adapter required for hnction of certain acidic activation domains. Cell 1992;70251-265. 49. Ebinak; TakcharaY, Kishi F, Nakazawa A, Brent R. LexA protein is a repressor of the colicin El gene. J Biol Chem 1983;258:13258-13261. 50. Fiirst P, Hu S, Hackett R, Hamer D. Copper activates metallothionein gene transcription by altering the conformation of a specific DNA binding protein. Cell 1988;55:705-717. 51. Thiele DJ. ACEl regulates expression of the Succharomyces cerevisiae metallothionein gene. Molec Cell Biol 1988;8:2745-2752. 52. Szczypka MS, Thiele D. A cysteine-rich nuclear protein activates yeast metallothionein gene transcription. Molec Cell Biol 1989;9:421-429. 53. Cizewski-CulottaV, HsuT, Hu S, Fiirst P, Hamer D. Copper and the ACEl regulatory protein reversibly induce yeast metallothionein gene transcription in a mouse extract. Proc Natl Acad Sci USA 1989;868377-8381. 54. Chaudhuri B, Hiimmerle M, Fiirst €? The interaction between the catalytic A subunit of calcineurin and its autoinhibitory domain, in the yeast two-hybrid system, is disrupted by cyclosporin A and FK506. FEBS Lett 1995;357:221-226. 55. Chaudhuri B, Stephan C, Huijbregts RP, Martens GJ. The neuroendocrine protein 7B2 acts as a molecular chaperone in the in vitro folding of human insulin-like growth factor-1 secreted from yeast. Biochem Biophys Res Commun 1995;211:417-425. 56. Chaudhuri B, Stephan C. Only in the presence of immunophilins can cyclosporin and FK506 disrupt in vivo binding of calcineurin A to its autoinhibitory domain yet strengthen interaction between calcineurin A and B subunits. Biochem Biophys Res Commun 1995;215:781-790. 57. Ausubel FM, Brent R, Kingston R, Moore D, Seidman JJ, Smith J, Struhl K. Current protocols in molecular biology New York,Ny: John Wiley & Sons, 1993. 58. Feilotter HE, Hannon GJ, Ruddell CJ, Beach D. Construction of an improved host strain for two hybrid screening. Nucl Acid Res 1994;22:1502- 1503. 59. Legrain P, Dokhelar M-C, Transy C. Detection of protein-protein interactions using different vectors in the two-hybrid system. Nucl Acid Res 1994;22:3241-3242. 60. Bartel P, Relds S. Analyzing protein-protein interactions using two-hybrid system. Meth Enzymol 1995;254:241-263. 61. Munder T.Strategy to analyze proteinlprotein and proteinlproteinlDNA interactions in vivo.

54

62. 63.

64. 65. 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 80.

81. 82. 83. 84.

In: Saluz HP,Wiebauer K (eds) DNA and Nucleoprotein Structure In Vivo. Austin, New York, Hong Kong: R.G. Landes Company and Springer Verlag, 1995;ll-35. Chien T, Bartel PL, Sternglanz R, Fields S.The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. Proc Natl Acad Sci USA 1991; 88:9578-9582. Kishore GM, Shah DM. Amino acid biosynthesis inhibitors as herbicides. Ann Rev Biochem 1988;57:627-663. Evangelista C, Lockshorn D, Fields S.The yeast two-hybrid system: prospects for protein linkage maps. Trends Cell Biol 1996;6:196-199. Finley RL, Brent R. Interaction mating reveals binary and ternary connections between Drosophila cell cycle regulators. Proc Natl Acad Sci USA 1994;91:12980-12984. Herskowitz I. Life cycle of the budding yeast Saccharomyces cerevisiae. Microbiol Rev 1988;52 536-553. Bendixen C, Gangloff S, Rothstein R. A yeast mating-selectionscheme for detection of proteinprotein interactions. Nucl Acid Res 1994;22:1778- 1779. Bartel PL, Roecklein JA, Sengupta D, Fields S. A protein linkage map of Escherichiu coli bacteriophageT7. Natl Genet 1996;12:72-77. Koyama S,Yu H, Dalgarno C, Shin TB, Zydowsky D, Schreiber SL. Structure of the PI3K SH3 domain and analysis of the SH3 family Cell 1993;72:945-952. Li B, Fields S. Identification of mutations in p53 that affects its binding to SV40 1argeTantigen by using the yeast two-hybrid system. FASEB J 1993;7:957-963. Kurschner C, Morgan JI. The cellular prion protein (PrP) selectively binds to Bcl-2 in the yeast two-hybrid system. Molec Brain Res 1995;30165-168. TodaT, Uno I, IshikawaT, Powers S,KataokaT, Broek D, Cameron S, Broach J, Matsumoto K, Wigler M. In yeast, RAS proteins are controlling elements of adenylate cyclase. Cell 1985;40: 27-36. Field J, Nikawa J, Broek D, MacDonald B, Rodgers L, Wilson IA, Lerner RA, Wigler M. Purification of a RAS-responsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method. Molec Cell Biol 1988;8:2159-2165. Jones S, Wgnais M-L, Broach JR. The CDC25 protein of Saccharomyces cerevisiue promotes exchange of guanine nucleotides bound to ras. Molec Cell Biol1991;11:2641-2646. Lai C-C, Boguski M, Broek D, Powers S. Influence of guanine nucleotides on complex formation between Ras and Cdc25 proteins. Molec Cell Biol 1993;13:1345-1352. Ikawa S,Weinberg RA. An interaction between p2lras and heat shock protein hsp90, a chaperonin. Roc Natl Acad Sci USA 1992;89:2012-2016. Estojak J, Brent R, Golemis E. Correlation of two-hybrid affinity data with in vitro measurements. Molec Cell Biol 1995;15:5820-5829. Allan JB, Walberg MW, Edwards MC, Elledge SJ. Finding prospective partners in the library: the two-hybrid system and phage display find a match. Trends Biochem Sci 1995;20:511-516. Bartel P, Chien C-T, Sternglanz R, Fields S.Elimination of false positives that arise in using the two-hybrid system. BioTech 1993;14920-924. Mosteller RD, Park W, Broek D. Analysis of interaction between Ras and CDC25 guanine nucleotide exchange factor using yeast GAL4 two-hybrid system. Meth Enzymol 1995;255: 135-148. Kalderon D, Roberts BL, Richardson WD, Smith AE. A short amino acid sequence able to specify nuclear location. Cell 1984;39:499-509. Sternglanz R, Fisher PA. Signal-mediated import Benton BM, Eng W-K, Dunn JJ, Studier W , of bacteriophage T7 RNA polymerase into the Saccharomycescerevisiae nucleus and specific transcription of target genes. Molec Cell Biol 1990;10:353-360. Nelson M, Silver !F Context affects nuclear protein localization in Saccharomyces cerevisiae. Molec Cell Biol 1989;9:384-389. Luban J, Goff SP.The yeast two-hybrid system for studying protein-protein interactions. Curr

55 @in Biotechnol 1995;6:59-64. 85. Li X, McDermott B, Yuan B, Goff SP. Homomeric interactions between transmembrane proteins of Moloney murine leukemiavirus. J Virol 1996;70:1266-1270. 86. Rousset R, Desbois C, Bantignies F, Jalinot P. Effects on NF-KBl/p105 processing of the hteraction between the HTLV-1 transactivator lhx and the proteasome. Nature (London) 1996; 381~328-331. 86a.ShnGeva M, MunderT. The oncoproteinTaxof the humanT-cell leukemia virus type I activates transcription via interaction with cellular ATF- 1/CREB factors in Succharomyces cerevisiue. J Vim1 1996;707478-7484. 87. BurrisTP, Nawaz Z,Tsai M-J, O’Malley B. A nuclear hormone receptor-associatedprotein that inhibits transactivation by the thyroid hormone and retinoic acid receptors. Proc Natl Acad Sci USA 1995;92:9525-9529. 88. Lee JW, Choi H-S, Gyuris J, Brent R, Moore DD. Two classes of proteins dependent on either the presence or absence of thyroid hormone for interaction with the thyroid hormone receptor. Molec Endocrinol 1995;9:243-254. 89. Lee JW, Ryan F, Swafield JC, Johnston SA, Moore DA. Interaction of thyroid-hormone receptor with a conserved transcriptional mediator. Nature (London) 1995;37491-94. 90. Oiiate SA, Tsai SU, Tsai M-J, O’Malley BW Sequence and characterization of a coactivator for the steroid hormone receDtor superfamily Science 1995:270: 1354- 1357. 91. Ballou CE. Yeast cell wall and cell surface. In: Strathern JN, Jones EW, Broach JR (eds) The Molecular Biology of the Yeast Succhuromyces. Metabolism and Gene Expression. Cold Spring Harbor, NY Cold Spring Harbor Laboratory, 1982;335-360. 92. Kukuruzinska MA, Bergh MLE, Jackson BJ. Protein glycosylation in yeast. Ann Rev Biochem 1987i56915-944. 93. Lehle L, Bause E. Primary structural requirements for N- and 0-glycosylation of yeast mannoproteins. Biochem Biophys Acta 1984;799:246-251. 94. Innis MA. Glycosylation of heterologous proteins in Succhuromyces cerevisiue. In: Barr PJ, Brake AJ, Valenzuela P (eds) Yeast Genetic Engineering. Boston: Butterworth, 1989;233-246. 95. Castellanos RMP, Muon MJ. Identification of phosphotyrosine in yeast proteins and of a protein tyrosine kinase associated with the plasma membrane. J Biol Chem 1985;2608240-8242. 96. Gartner A, Nasmyth K, Ammerer G. Signal transduction in Succharomyces cerevbiue requires tyrosine and threonine phosphorylation of FUS3 and KSS1. Genes Devel 1992;61280-1292. 91. Lim M-y Dailey D, Martin GS, Thorner J. Yeast MCKl protein kinase autophosphorylatesat tyrosine and serine but phosphorylates exogenous substrates at serine and threonine. J Biol Chem 1993;268:21155-21164. 98. Navon A, SchwarzU, Hazan B, Kassir U, Nir U. Meiosis-dependent tyrosine phosphorylationof a yeast protein related to the mouse p5lfC? Molec Gen Genet 1994;244.160-167. 99. F’andey A, Lazar DF, Saltiel AR, Dixit VM. Activation of the Eck receptor protein tyrosine kinase stimulates phosphatidylinositol 3-kinase activity J Biol Chem 1994;26930154-30157. 100. Gustafson TA, He W, Craparo A, Schaub CD, ONeill TJ. Phosphotyrosine-dependentinteraction of SHC and insulin receptor substrate 1 with the NPEY motif of the insulin receptor via a novel non-SH2 domain. Molec Cell Biol 1995;15:2500-2508. 101. ONeill TJ, Craparo A, Gustafson TA. Characterization of an interaction between insulin receptor substrate 1 and the insulin receptor by using the two-hybrid system. Molec Cell Biol 1995;14:6433-6442. 102. Osborne MA, Dalton S, Kochan JP. The yeast tribrid system - genetic detection of transphosphorylated ITAM-SH2-interactions. Bio/Technol 1995;13:1474- 1478. 103. Beavan MA, Metzger H. Signal transduction by Fc receptors, the FcsRI case. Immunol Today 1993;14222-226. 104. Cambier JC. New nomenclature for the Reth motif (or ARHl /TAM/ARAM/YXXL). Immuno1 Today 1995;16:110. 105. Kihara H, Siraganian RP. Src homology 2 domains of Syk and Lyn bind to tyrosine-

56 phosphorylated subunits of the high affinity IgE receptor. J Biol Chem 1994;269:22427-22432. 106. Paolini R, Renard V, Vivier E, Ochiai K, Jowain MH, Malissen B, Kinet JP. Different roles for the Fc epsilon RI gamma chain as a hnction of the receptor context. J Exp Med 1995;181: 247-255. 107. Shiue L, Green J, Green OM, Karas JL, Morgenstern JP, Ram MK, Taylor MK, Zoller MJ, Zydowsky LD, Bolen JB, Brugge JS. Interaction of ~ 7 2 ' ~with ' the y and subunits of the high-affinity receptor for immunoglobulin E FcsRI. Molec Cell Biol 1995;15:272-281. 108. Shiue L, Zoller MJ, Brugge JS. Syk is activated by phospho-tyrosine-containing peptides representing the tyrosine-based activation motifs of the high affinity receptor for IgE. J Biol Chem 1995;270:10498- 10502. 109. Dalrymple MA, McGeoch DJ, Davison AJ, Preston CM. DNA sequence of the herpes simplex virus type I gene whose product is responsible for transcriptional activation of immediate early promoters. Nucl Acid Res 1985;13:7865-7879. 110. Sun P, Maurer RA. An inactivating point mutation demonstrates that interaction of CAMP response element binding protein (CREB) with the CREB binding protein is not sufficient for transcriptional activation. J Biol Chem 1995;270:7041-7044. 111. Tanaka K, Matsumoto K, Toh-e A. IRA1, an inhibitory regulator of the RAS-cyclic AMP pathway in Succhuromycescerevisiue. Molec Cell Biol 1989;9:757-768. 112. Van Aelst L, Barr M, Marcus S, Polverino A, Wigler hf Complex formation between RAS and RAFand other protein kinases. Proc Natl Acad Sci USA 1993;906213-6217. 113. Legrain P, Chapon C Interaction between PRPl 1 and SPP91 yeast splicing factors and characterization of a PRP9-PRPl1-SPP91 complex. Science 1993;262:108-110. 114. Legrain P, Chapon C, Galisson E Interaction between PRP9 and SPP91 splicing factors identify a protein complex required in prespliceosome assembly Genes Devel 1993;7:1390-1399. 115. Ma J. Detecting interactions between eukaryotic proteins in bacteria. Gene Expres 1992;2: 139-146. 116. Gramatikoff K, Georgiev 0,Schaffner W. Direct interaction rescue, a novel filamentous phage technique to study protein-protein interactions. Nucl Acid Res 1994;22:5761-5762. 117. Gramatikoff K, Schaffner W, Georgiev 0.The leucine zipper of c-Jun binds to ribosomal protein L18a: a role in Jun protein regulation? Biol Chem Hoppe-Seyler 1995;376:321-325. 118. Johnsson N, Varshavsky A. Split ubiquitin as a sensor of protein interactions in vivo. Proc Natl Acad Sci USA 1994;91:10340-10344. 119. Li JJ, Herskowitz I. Isolation of ORC6, a component of the yeast origin recognition complex by a one-hybrid system. Nature (London) 1993;262:1870- 1874. 120. Wang MM, Reed RR. Molecular cloning of the olfactory neuronal transcription factor Olf-1 by genetic selection in yeast. Nature (London) 1993;364121-126. 121. Fangman WL, Brewer BJ. Activation of replication origins within yeast chromosomes. Ann Rev Cell Biol 1991;7:375-402. 122. Dowel1 SJ, Romanowski P, Diffley JFX. Interaction with Dbf4, the Cdc7 protein kinase regulatory subunit, with yeast replication origins in vivo. Nature (London) 1994265:1243-1246. 123. Jackson AL, Pahl P, Harrison K, Rosamond J, Sclafani RA. Cell cycle regulation of the yeast Cdc7 protein kinase by association with the Dbf4 protein. Molec Cell Biol 1993;12:28992908. 124. Gstaiger M, Knoepfel L, Georgiev 0,Schaffner W, Hovens CM. A B-cell coactivator of octamer-binding transcription factors. Nature (London) 1995;373:360-362. 125. Wilson TE, Fahrner TJ, Johnston' M, Milbrandt J. Identification of the DNA binding site for NGFI-B by genetic selection in yeast. Science 1991;252:1296-1300. 126. Tsai M-J, O'Malley BW. Molecular mechanisms of action of steroidhhyroid receptor superfamily members. Ann Rev Biochem 1994;63:451-486. 127. Mangelsdorf DJ, Evans RM. The RXR heterodimers and orphan receptors. Cell 1995;83:841850.

128. Hadfield C, Raina KK, Shashi-Menon K, Mount RC The expression and performance of

57 cloned genes in yeast. Mycol Res 1993;897-944. 129. Hinnen A, Buxton F, Chaudhuri B, Heim J, HottigerT, Meyhack B, Fbhlig G. Gene expression in recombinant yeast. In: Smith A (ed) Gene Expression in Recombinant Microorganisms. NewYork, Basel, Hong Kong: Marcel Dekker Inc., 1995;121-193. 130. Johnston M. Genome sequencing: the complete code for a eukaryotic cell. Curr Biol 1996;6: 500-503. 131. Oliver SG. From DNA sequence to biological hnction. Nature (London) 1996379597-600. 132. Martin K. The interactions of transcription factors and their adapters, coactivators, and accessory proteins. Bioessays 1991;13:499-503. 133. Hertzberg RF? Whole cell assays in screeningfor biologically active substances. Curr Opin Biotechno1 1993;4:80-84. 134. Faisst S, Meyer S. Compilation of vertebrate-encoded transcription factors. Nucl Acid Res 199220~3-26. 135. Kirsch DR. Development of improved cell-based assays and screens in Succhuromyces through the combination of molecular and classical genetics. Curr Opin Biotechnol 1993;4:543-552. 136. Metzger C, White JH, Chambon F? The human oestrogen receptor hnctions in yeast. Nature (London) 1988;3@3 1-36. 137. Schena M, Yamamoto KR. Mammalian glucocorticoid receptor derivatives enhance transcription in yeast. Science 1988;251:965-967. 138. Mak P, McDonnell DP, Weigel NL, Schrader WT,OMalley BW Expression of functional chicken oviduct progesterone receptors in yeast (Succhuromycescerevisiue). J Biol Chem 1989; 2W.21613-21618. 139. McDonnell DP, Pike JW, Drutz DJ, Butt TR, OMalley BW Reconstitution of the vitamin Dresponsive osteocalcin transcription unit in Succhuromyces cerevisiue. Molec Cell Biol 1989;9: 3517-3523. 140. F’urvis IJ, Chotai D, Dykes CW, Lubahn DB, French FS, Wilson EM, Hobden AN. An androgen-inducible expression system for Succhuromyces cerevisiue. Gene 1991;106:35-42. 141. Lyffle C, Damian-Matsumura P, Juul H,Butt T Human estrogen receptor regulation in a yeast model system and studies on receptor agonists and antagonists. J Steroid Biochem Molec Biol 199342~677-685. 141a.Berghijfer-HochheimerY, Zurek C, Langer G, Munder T Expression of the human vitamin D and the retinoid X receptors in Saccharomyces cerevisiae: alternative in vivo models for ligand-induced transactivation. J Cell Biochem 1997;(In press), 142. Dasmahapatra B, DiDomenico B, Dywer S, Ma J, Sadowski I, Schwartz J. A genetic system for studying the activity of a proteolytic enzyme. Roc Natl Acad Sci USA 1992;89:4159-4162. 143. Dasmahapatra B, Rozhon EJ, Hart AM, Cox S,Tracy S, Schwartz J. Cell-free expression of the coxsackievirus 3C protease using the translational initiation signal of an insect virus RNA and its characterization.Virus Res 1991;20:237-249. 144. JainVK, Magrath ITA. A chemiluminescent assay for the quantification of P-galactosidase in the femtogram range: application to quantitation of P-galactosidase in lacZ-transfected cells. Anal Biochem 1991;199:119- 124. 145. Fulton R, van Ness B. Luminescent reporter gene assays for luciferase and P-galactosidase using a liquid scintillation counter. BioTechniques 1993;19762-763. 146. Nguyen W, Morange M, Bensaude 0. Firefly luciferase luminescence assays using scintillation counters for quantitation in transfected mammalian cells. Anal Biochem 1988;171:404-408. 147. Boguslawski G. Effects of polymixin B sulfate and polymixin B nonapeptide on growth and permeability on the yeast Succhuromyces cerevisiue. Molec Gen Genet 1985;199:4O1-405. 148. Mendelsohn A, Brent R. Applications of interaction trapskwo-hybrid systems to biotechnology research. Curr Opin Biotech 1994;5:482-486. 149. Zuckermann RN, Kerr JM, Siani MA, Banville SC,Santi DV. Identification of highest-afinity ligands by affinity selection from equimolar peptide mixtures generated by robotic synthesis. Proc Natl Acad Sci USA 1992;89:4505-4509.

150. Lam KS, Salmon E, Hersh EM, Hruby VJ, Kazmierski WM, Knapp RJ. A new type of synthetic peptide library for identifying ligand-binding activity Nature (London) 1991;35482-84. 151. Simon RJ, Kania RS, Zuckermann RN, Hiibner VD, Jewel1 DA, Banville S, Ng S,Wang L,

Rosenberg S,Marlowe CK, Spellmayer DC, ’Ign R, Frankel AD, Santi DV, Cohen FE, Bartlett PA. Peptoids: a modular approach to drug discovery Proc Natl Acad Sci USA 1992;89:93679371. 152. Zuckermann RN, Kerr JM, Kent SBH, Moos WH. Efficient method for the preparation of

peptoids [oligo(N-substitutedglycins)] by submonomer solid-phase synthesis. J Am Chem SOC 1992; 1 1 4 10646- 10647. 153. De Witt SH, Kiely JS, Stankovic CJ, Schroeder MC, Cody DM, Pavia MR. ‘Diversomers’: an approach to nonpeptide, nonoligomeric chemical diversity Proc Natl Acad Sci USA 1993;90: 6909-691 3. 154. Tanaka Y, Omura S. Agroactive compounds of microbial origin. Ann Rev Microbiol 1993;47: 57-87. 155. Yang M, Wu Z, Fields S. Protein-protein interactions analyzed with the yeast two-hybrid system. NucI Acid Res 1995;23:1152-1156. 156. Colas P, Cohen B, Jessen T, Grishina I, McCoy J, Brent R. Genetic selection of peptide aptamers that recognize and inhibit cyclin-dependent kinase 2. Nature. (London) 1996;380: 548-550.

01997 Elscvier Science B.V. All rights reserved. Biotechnology Annual Review Volume 3 MR. El-Gewely, editor.

59

Human gene therapy: principles and modern advances Dorothy L. Reimer', Marcel B. Bally' and Shiva M. Singh2 'Departmentof Advanced Therapeutics,British Columbia Cancer Agenq Vancouver,British Columbia; and 'Molecular Medical Genetics Program, London Health Sciences Center and Molecular Genetics

Unit,Department of Zoology and Division of Medical Genetics, Universityof Western Ontario,London, Ontario, Canada

Abstract. The treatment of human diseases by gene therapy is logical, given the fact that it is possible to introduce nucleic acids into human cells. More importantly, genetic manipulations are able to eIicit relevant biological responses. Despite the potential for gene therapy in the future, numerous technological problems still exist that limit its acceptance as a mainstream therapeutic option. Every problem, however, has a logical and practical solution. We focus this review on issues related to the hdamental problems of gene transfer. Given the progress and potential impact of this therapeutic technology on the treatment of a large number of human diseases, it is anticipated that gene therapy will revolutionize the way in which we treat disease in the next century

Keywords: AAT, adeno-associated, adenoviral, AIDS, antisense, cancer, CF, FA, FH,gene therapy, gene transfer, herpesvirus, human, lipid-based carriers, MD, microencapsulation, oligonucleotides, PKU, receptor-mediated, retroviral, KID, vectors, viral.

Introduction Human gene therapy, defined as the introduction of genetic material into mammalian somatic cells for the purpose of treating diseases, is currently viewed as an ultimate goal of research on many diseases. Although this technology has been aimed at developing a cure for severe human diseases of single gene etiology, it is now being applied to the treatment of multifactorial diseases such as cancer, as well as infectious diseases such as AIDS. This treatment strategy differs from traditional approaches which attempt to compensate for the missing gene function and subsequent metabolic consequences by treating the disease symptom rather than the cause. The possibility of correcting a defect at the level of the gene itself, has been considered for over 2 decades and has evolved with the ability to identi@genes and gene defects responsible for diseases. The number of genes identified that are involved in the causation and predisposition of diseases has been impressive. These discoveries can be attributed to a comprehensive research program that integrates genetic principles with sophisticated Mressfor Correspondence: Dr S.M. Singh, Department of Zoology and Division of Medical Genetics, 307 Western Science Center, University of Western Ontario, London, Ontario, Canada, N6A 5B7. Tel.: +1-519-661-3135. Fax: +1-519-661-2014. E-mail: [email protected]. or Dr D.L. Reimer, Department of Advanced Therapeutics, British Columbia Cancer Agency, 600 West 10th Av.,Vancouver, British Columbia, Canada,VSZ 4E6. Tel.: +1-604-877-6010-3155. Fax: +1-604877-6011. E-mail: [email protected].

60

and highly sensitive molecular technologies. Today, disease gene mutations are being identified rapidly, and shortly after the genes are discovered a battery of diagnostic, prevention and effective treatment strategies are considered. This coincides with the development of molecular assays for the detection of genes, development of efficient gene delivery systems and the technology that allows for controlled gene expression.We have come a long way in our ability to identify disease-causing mutations and to manipulate and move recombinant DNA molecules at will. However, efficient transfer of a gene to target tissues and/or specific cell types, such that spatial and temporal expression are exhibited, remains the most significant problem to overcome. Conceptually, it is logical to think of DNA as the drug of choice for the treatment of many diseases, both genetic and nongenetic. Developing a gene therapy protocol is a very lengthy process which begins with cloning the gene that causes a particular disease (comparable to identifying a potential drug or target for a drug). The gene drug must be isolated, prepared using manufacturing procedures that are reproducible and appropriate for products destined for human use and evaluated in animal models for toxicity and efficacy The latter can be used to support submissions, such as an Investigational New Drug (IND) application to regulatory bodies and are required prior to initiation of early clinical testing. Along this pathway, appropriate procedures must be developed to characterize the mechanism of activity of the gene drug as well as the pharmacokinetic behaviour of the active agent. This drug development pathway is one that is comparable to any new, clinically unproven, conventional drug. What distinguishes the gene drug from a conventional drug is their molecular size. For this reason, procedures must be developed to promote effective delivery of the gene drug and this, therefore, provides the initial focus of this review. Specifically, it will include discussions on viral and nonviral approaches to gene delivery and their effectiveness, if known, as they apply to selected genetic and nongenetic diseases. During the course of this review, we will take the liberty to speculate on the challenges for the development of improved gene delivery systems. Within this context, it is important to summarize the potential dangers as well, including inadvertently altering germ cells in cases of in utero use of somatic cell gene therapy, reinfectivity and oncogenicity of the viral vector, interruption of a normal host gene with negative consequences, bacterial contamination, and only partial correction of the genetic disease (thus converting a fatal disease to a chronic progressive one), among others. Guidelines dealing with most of these concerns are not readily available and are currently being developed by committees in a number of different countries. Some of these concerns will be addressed following a comprehensive discussion on the gene delivery systems and their applications. It is important to indicate here that we are aware of the significant ethical considerations surrounding applications of gene therapy Although the implications of somatic cell gene therapy are restricted to the individual, alterations of germ line cells will lead to the information being passed down to subsequent

61 generations. The prospect of deliberately making inherited alterations in the human genome and gene pool is historically feared both by the general public as well as the scientific community. The fear and threat associated with human germ line gene therapy is magnified because we know that the technology for germ line gene transfer is already available for experimental and domesticated mammals and the technology for instituting germ line gene therapy on humans is now a reality. This review will not concentrate on these ethical concerns, rather it will focus on the lessons learned from human gene therapy studies, dealing first with the methods used for gene transfer and some of the regulatory/safety concerns associated with these gene transfer methods, and subsequently with examples of preclinical and clinical experiences with gene therapy Finally, an overview of oligonucleotide-based therapeutic strategies will be given. Although the size of the therapeutic agent is much smaller (18-24 mers) in comparison to a gene (9-30+ kb), oligonucleotides offer an alternative gene therapy approach that is reliant on turning off the expression of a particular gene. In this context, the approach is similar to strategies involving the transfer of genes to elicit a specific therapeutic response.

Gene delivery methods

In principle, there are two general approaches for the correction of a defective gene in a tissue or cell type. First, the normal gene sequence is introduced into cells cultured ex vivo, followed by reintroduction of the corrected cells into the patient being treated. Correction of gene defects by this approach is, of course, limited to cell types that can be biopsied, cultured and manipulated in vitro and in general would involve stable integration of the gene into the cellular genome. In the second approach, the normal gene or desired sequence is introduced into specific cells or tissues of the patient in vivo. In this case, any cell type could potentially be targeted, however, the fate of the introduced DNA need not involve integration into the host genome. In this part of the review, we will discuss in vivo and ex vivo approaches for the introduction of nucleic acids to correct cells and tissues. This will provide a solid foundation for understanding the variety of methods being used in ongoing gene therapy clinical studies. More importantly, it is emphasized that other variations will emanate over time, given the variety of tissues and cell types that could be subject to such therapy strategies. A comprehensive list of delivery methods is summarized in Table 1, and is discussed in some detail in the following sections. This section has been divided into two subsets, nonviral- and viral-mediated gene delivery methods. Nonviral-mediatedgene delivery Direct injection of DNA One of the simplest approaches for introducing DNA into cultured mammalian cells which can be expressed is by mechanical injection into the nucleus [l].

Table I. Summary of gene transfer methods and associated properties.

A: Nonviral Method

Max. insert size

Wget

Eficiency transfection

Direct injection of DNA

Unlimited

Skeletal muscle

LOW

LOW

Multiple

Liposome-mediatedDNA

Unlimited

Replicating and nonreplicating cells

LOW

LOW

Multiple

Receptor-mediated DNA

Unlimited

Moderate

LOW

Multiple

Adenoviral-ligand DNA

Unlimited

Hepatocytes (e.g., ASGPr, folate) Replicating cells (e.g., transferrin) Replicating cells (e.g., transferrin) Hepatocytes (e.g., ASGPr, folate)

Moderate

Moderate

Multiple

ofExpression

No. of doses

B:Vial ~~

Method

Max. insert size(kb)

DNA/ RNA

Insertional mutagenesis

Infectivity

Integration

Expression Target

No. of doses

RetrOvirUS

9.0

RNA

High

LOW

Chrom

S

Replicating cells

Single

Adenovirus

7.5

dsDNA

LOW

High

Episomal

T

Respiratory G.I.

Multiple

Adenoassoc. virus

4.5

ssDNA

High

High

Episomal/ Chrom

S/T

Respiratory G.I.

30.0

dsDNA

?

High

Chrom

S

Neurons

Herpes virus

S = stable, T = transient, Chrom = integration into the host genome.

Single

63 Although this procedure is laborious and expensive, it has been used successhlly for the introduction of genes into embryos for the production of transgenic animals [2,3]. The DNA cloning vector containing the gene of interest and often used for direct injection is a plasmid, a double-stranded, circular DNA element of bacterial origin, which replicates extrachromosomally.The direct injection of DNA approach was modified in an attempt to introduce purified and hnctional plasmid DNA directly into the tissues in vivo. Though highly specific in location, DNA is required to be taken up into the cells from the extracellular space, making its application for human somatic gene therapy limited. Recently, however, specific tissues such as skeletal muscle have been shown to express plasmid DNA following direct injection in vivo. The expression of this DNA in myofiber cells has been reported from a variety of species including fuh [4], rats [5], mice [5-81, cats and monkeys [9]. The efficiency of this process is relatively low compared to other gene transfer approaches. This may be due to the fact that the majority of transfection is localized principally along the track of injection. Despite this caveat, partial therapeutic gain was demonstrated by Ascadi et al. [lo], following direct injection of a dystrophin minigene (in free form) into the skeletal muscle of mice with muscular dystrophy There is data suggesting that the ability to incorporate and express DNA delivered in free form may be unique to muscle cells. Although the mechanism by which myofibrils take up and express free DNA is not clearly understood, it is proposed that the DNA is taken into the cytoplasm of the cell through the transverse tubules, which are unique to muscle cells and may act as diffisory conduits for the DNA [l 13. It is also possible that the mechanics of injection of DNA causes direct damage of individual myofibers, resulting in disruption of the cell membrane, allowing DNA to enter the cell [8]. Regardless of mechanism, the fact that muscle cells are so readily transfected with free DNA has an important application in the development of vaccines as discussed elsewhere [12]. Direct injection and ultimate expression of purified plasmid DNA in other tissues has been met with limited success. One exception is the thyroid where injection of a gene into the interstitial spaces of rabbit thyroid has led to its expression in follicular cells at levels equivalent to those observed in muscle [13]. Similarly, injection of large amounts of DNA into the liver (2-5 mg) have shown detectable expression of recombinant genes [14]. In these tissues, it is likely that the DNA is taken up passively during the normal course of endocytosis. Whatever the mechanism of gene transfer, the efficiency and expression after direct administration of purified DNA is relatively low compared to other gene transfer protocols.

Liposome- and DNA particle-mediated gene transfer The use of liposomes as vehicles for the delivery of genetic information began in the early 1980s and is a natural extension of their application as drug delivery agents (for reviews see [15,16]). Typically, liposomes are spherical membrane vesicles consisting of a lipid bilayer surrounding an aqueous space. Liposomes

64 can be prepared using any lipid components or mixtures capable of adopting a bilayer structure. In 1987, Felgner et al. demonstrated that liposomes prepared with positively charged lipids can be used for gene transfer in vitro. The prototype cationic lipid for gene transfer is DOTMA ("1 -(2,3-dioleyloxy)propyl]-NNNtrimethylammonium chloride) [171, although a variety of other synthetic cationic lipids have also been used for gene transfer [18-231. The positive charges of the cationic lipid interact with the negative charges of the DNA backbone, creating a DNA-liposome aggregate where the DNA binds to the liposome through ionic interactions [24]. The resulting cationic liposome-DNA aggregates are prepared to exhibit a net positive charge, and are effective in delivering DNA to cells, since they have the propensity to interact with negatively charged cell membranes (Fig. 1). The efficiency of DNA delivery using cationic liposomes depends on several variables including lipid membrane composition [25,26]. Zwitterionic phospholipids such as DOPE (dioleoylphosphatidylethanolamine) are thought to be a necessary component, since it is known that this lipid plays an important role in mediating membrane fbsion [27]. The size and overall net charge of the liposome-DNA complex is also thought to be important in developing cationic liposomes which have a high efficiency of DNA delivery [17,28,29]. The size and

hsert+x:

+

+

+

v

Plasmid DNA

cationic iiposome

Endosome

L~~~soIYw-DNA

Nucleus

Fig. I. Proposed mechanism for cationic liposome-mediated gene transfer. Plasmid DNA containing

the desired insert gene forms aggregates with cationic liposomes through ionic interactions. These liposome-DNA aggregatesexhibit a net positive charge which can interact with the negatively charged cell membranes. These complexes are internalized by the cell, through unknown mechanisms and can enter the endosomal pathway, or migrate through the cytoplasm directly to the nucleus where the plasmid DNA is transcribed and the gene expressed.

65

charge of the complexes can be optimized by altering the composition of the lipids as well as the lipid-to-DNA ratio within the complex [30]. This is thought to affect the efficiency of DNA delivery and it has been suggested that larger vesicles may be more effective than smaller vesicles for in vitro gene delivery [3 11. Although cationic liposomes with various lipid combinations exhibit quantitatively different gene delivery efficiencies in different cell types, no clear patterns have emerged concerning features of liposome carriers that are necessary for optimal gene delivery The efficiency of gene transfer using cationic liposomes can be enhanced by the encapsulation of DNA within the aqueous compartment of the liposome [24]. Although the encapsulation process is largely inefficient, this approach may be more suitable for in vivo gene therapy, since it is thought that the encapsulated DNA would be protected against enzymatic degradation in systemic circulation as well as during intracellular processing. There has been extensive research into the use of liposomes as an effective nonviral approach for gene therapy, however, the mechanism of DNA transfer across the cell membrane and subsequently to the nucleus is still not wellunderstood. It is generally believed that endocytosis is the major route of cellular uptake for DNA-liposome complexes [32,33]. This event, however, may be highly dependent on the liposomal lipid composition which can specifically effect DNA movement into the cytoplasm following fusion of the liposome-DNA complex to the cell membrane [34]. Regardless of how the DNA gains access to the cell, the efficiency of expression still depends on several variables including dissociation of the lipid from the DNA, and transfer of the DNA through the cytoplasm to the nucleus. A full understanding of the mechanisms involved in these processes is necessary before an efficient nonviral gene delivery system can be achieved. Despite our lack of complete understanding of the transfection mechanisms, liposomes have many advantages as DNA delivery agents. First, they have the potential to deliver DNA of unlimited size. Second, they are relatively nontoxic and lack the ability to recombine to form an infectious agent, avoiding the problems of mutation and oncogenesis associated with viral vectors. Finally, they are also able to transfect nondividing cells, and may evoke fewer immune responses than their viral counterparts because they lack protein constituents [35]. Their use for in vivo gene therapy, however, may be hampered by the fact that the transfected DNA remains episomal within the target cells and therefore repetitive dosing will likely be required to achieve therapeutic effects. Studies on cationic liposomes have inspired the creation of a second generation of a self-assembling nonviral lipid-based DNA particle. Under controlled conditions, the ionic interactions of cationic lipids and DNA have been shown to result in the formation of a hydrophobic lipid-DNA complex that can be readily isolated in solvents [36,37]. Subsequently, this hydrophobic complex can be used in the preparation of small and well-defined particles [38]. These particles have the potential to be used for the production of novel lipid-based carrier systems for in vivo gene therapy The biological challenge in developing these systems is to

66 control their characteristics such as size, charge, interaction with serum proteins and interaction with cell surfaces such that effective delivery of the DNA to the nucleus is achieved. Synthetic cationic polymers have also been developed as a method for gene delivery [39]. An example of a particularly useful polymer is known as a dendrimer, which is a branched cation whose diameter is determined by a number of synthetic polymerization steps. Dendrimer-DNA complexes have been shown to exhibit efficient gene delivery in vitro and is thought to enter the cells by endocytosis. The efficiency of gene delivery using dendrimers has been further enhanced by the addition of peptides that release the endosomal contents into the body of the cell [39]. Furthermore, dendrimers can be designed to home in on specific target cells by attaching sugars and proteins to the dendrimer surface. These molecules, therefore, hold great promise for the future of gene therapy as super molecules for DNA delivery whose properties are easy to manipulate and can be made to order [40]. Receptor-mediated gene transfer Receptor-mediated gene transfer has emerged as a promising approach for the introduction of DNA into cells in a tissue-specific manner in vivo. Targeting of DNA to a particular cell type is usually achieved by covalently coupling the ligand to a polycationic anchor, such as polylysine, and then forming a ligandpolylysine-DNA complex through ionic interactions between the positively charged polylysine and the negatively charged DNA [41,42].The polycation binds to and condenses the plasmid DNA to a size and conformation which is thought to enhance transfer across the cell membrane [43]. The resulting complexes have ligands which are exposed on the surface of the conjugate and retain the ability to interact specifically with cognate receptors on the surface of the target cell resulting in internalization of the complex into the cell by endocytosis (Fig. 2). Upon entry, the ligand-polycation-DNA complex could enter the nucleus and undergo gene expression, usually without integration into the cellular genome. One of the first receptors to utilize this approach was the asialoglycoprotein receptor (ASGPr) whose expression is limited to the surface of hepatocytes. These cells constitute 70-80% of the liver volume, making it a good choice for liverspecific gene targeting. Asialoglycoproteins have been used as ligands to target DNA to hepatocytes via this receptor. It has been shown that 85% of asialoorosomucoid-polylysine-DNAcomplexes were specifically endocytosed by hepatocytes within 10 min of intravenous injection and transiently expressed [41,44,45]. Although ASGPr-mediated endocytosis can deliver large quantities of DNA very rapidly to hepatocytes in vivo, the majority of the DNA is rapidly degraded following entry into the cells. This is likely due to the degradable enzymes of the lysosomal pathway to which the receptor complex is directed following the process of endocytosis. Recently, Perales et al. [46] have evaluated the specific structural features on the DNA-ligand complexes which may be important for the introduction of DNA into rat livers in vivo. They demonstrated that when plasmid DNA was complexed to polylysine and thereby condensed, effec-

67

Fig. 2. Proposed mechanism for receptor-mediated gene transfer. Plasmid DNA containing the desired gene insert undergoes condensation when complexed with a polycation, such as polylysine, covalently attached to a specific ligand. The ligand is responsible for targeting this complex to a specific cell type where internalization is primarily into the endosome. By mechanisms which are not yet clearly understood, the plasmid DNA can escape the endocytic pathway and/or make their way through the cytoplasm to the nucleus where host genome machinery acts to transcribe the gene, resultingin expression.

tive and specific targeting and expression to hepatocytes was achieved. These results suggest that condensation of the DNA-ligand complexes is the key to the successful introduction of genes into tissues by receptor-mediated endocytosis. Tmsferrin receptors have also been used as ligands to target genes to cells from specific tissues [47]. Rapidly proliferating cells such as neoplastic cells or cells of the hematopoietic lineage require elevated levels of iron and therefore overexpressthe transferrin receptor on the surface of their cells [48]. Extracellular iron is complexed to the carrier protein transferrin; this complex is then endocytosed by specific cells by binding via the transferrin receptor. This property makes them particularly useful for receptor-mediated targeting. The transferrin molecule can be modified by the addition of a polycation such as polylysine that efficiently binds and condenses DNA of a wide variety of sizes. Using this approach, polylysine-transferrimDNAcomplexes have been shown to be effective in delivering genes into various types of cells in vitro [49] including hematopoietic cells [42] and pulmonary epithelium [50]. Other ligands have also been used to generate similar conjugates that are effective in delivering genes to cells in a

68 tissue-specific manner and include surfactant B [513, antithrombomodulin [52], insulin [53], epidermal growth factor [54] and lectins [55]. These approaches, like those of transferrin and asialoglycoprotein, rely on endocytosis as the mechanism of entry A common feature for the internalization of DNA using the receptor-mediated approach depends on endocytosis, a process that directs the complex into the lysosomal compartment of the cell. The efficiency of gene delivery in this system, therefore, is limited by the fact that a large amount of the DNA is rapidly degraded following internalization. Although DNA-ASGPr-polylysine conjugates, which are endocytosed by hepatocytes following intravenous injection into rats, express the CAT reporter gene only transiently, persistent, high levels of hepatic CAT activity were achieved when partial hepatectomy was performed after gene delivery [45]. This persistence may be due to failure of the endosomal vesicles to translocate to lysosomes, thereby stabilizing episomal DNA. These studies suggest that the amount of DNA delivered to hepatocytes by this mechanism is sufficient for effective gene expression, provided that intracellular degradation can be inhibited. A new generation of molecular conjugate vectors has been developed that has the ability to overcome the limitations of endosomal entrapment [47]. This approach makes use of the natural attributes of adenoviruses. Once internalized, they can effectively escape the acidic environment of the endosome compartment by causing membrane disruption allowing virions to proceed to the nucleus to complete their life cycle. It is thought that during viral internalization, endosome acidification elicits structural changes in capsid proteins that are capable of penetrating the endosomal membrane thereby releasing endosomal contents into the cytoplasm of the cell [56,57]. When adenoviral particles were mixed with receptor-mediated complexes, including transferrin-polylysine-DNA [50], asialoglycoprotein-polylysine-DNA [58] and folate-polylysine-DNA [59], and cotransfected, up to 1,000-fold increase in the efficiency of gene delivery was observed. Incorporation of the adenoviral particle into the functional design of a new vector includes covalently binding polylysine to the surface of the virus, allowing binding of the DNA to the particle by ionic interactions. This approach has led to significantly higher DNA uptake, gene transfer and expression in primary hepatocytes than that achieved by free adenovirus [60,61]. Several approaches have now been evaluated for the enhancement of endosoma1 release without the need for the adenoviral particles, but these efforts have been largely unsuccessful. One approach that has met with some success, however, is the use of hemagglutinin peptides from the influenza virus, which like the capsid protein of the adenovirus, undergoes a conformational rearrangement in acid environments resulting in a membrane agglutination activity [62]. Results from these studies where complexes containing hemagglutinin and transferrin-polylysine-DNA were transfected to cells in vitro showed enhanced gene delivery and expression over transferrin-polylysine-DNA alone. Although in its present form, molecular conjugation can mediate high trans-

69 fection efficiencies in vitro, it is unlikely that this technology will be routinely applicable for in vivo gene therapy This is mainly due to the large size of the receptor-polycation conjugates (adenoviral-DNA conjugates being even larger) prohibiting tissue penetration. In addition, the concentrations of these conjugates, particularly those that consist of adenoviral-DNA complexes, are several orders of magnitude lower in vivo than those commonly used in vitro. Furthermore, with the use of any viral components, there is always the likelihood of direct immune response to the viral proteins used to construct the complexes. It should be noted that approaches based on receptor-mediated gene delivery are applicable to the particle-based delivery system discussed above. Other approaches Other nonviral methods for gene delivery include biolistics, jet injection, electroporation, as well as microencapsulation. Electroporation is a widely used method for gene transfer in vitro in which cells are exposed to a high voltage that creates transient pores in the cell membrane. Although this method can achieve transfection rates >90% in many cell lines, it is not suitable for in vivo gene therapy Recently, it has been shown that DNA can be delivered to cells by jet injection, a method whereby liquid droplets containing DNA are projected under pressure [63]. Although the use of this method is still in its infancy, it has been used for injection of DNA into muscles, which leads to the uptake and expression of the administered gene [64,65]. Biolistics is also a relatively new method for directly injecting DNA into cells in vitro and in vivo [66]. This method of particle bombardment using the ”gene gun” involves precipitating the DNA onto microparticles that are directed into cells using explosive or ballistic-driven devises [67,68]. Once the DNA-coated particles enter the cell, the DNA is slowly released from the particle which leads to gene expression. This method has been successful in the delivery of DNA to a variety of cell types in vitro including epithelial cells, endothelial cells, fibroblasts, and lymphocytes among others [69]. It has also been used to transfer genes into various organs in vivo including the skin, liver and muscle [70,67]. Although the use of the “gene gun” has potential for gene therapy in vivo, it is limited by the fact that it is not capable of penetrating deeply into tissues, and effective gene delivery is often only achieved in the superficial layers of the injected tissue. Many gene therapy protocols require the genetic manipulation of autologous cells. A number of reports including those from Reilly et al. [71], Chang et al. [72], Liu et al. [73], Hughes et al. [74] and al-Hendy et al. [75] among others have suggested the use of microcapsules for the delivery of a gene product to a somatic tissue. Although this approach has a number of variations, they all rely on appropriate cell lines engineered to secrete the desired gene products in vivo. Encapsulating these cells within immunoprotective biocompatible devices prior to implantation is expected to prevent rejection of the nonautologous donor cells. To facilitate the secretion of the nonsecreted gene product, a signal sequence could be hsed to the amino terminus of a nonsecreted protein, directing the

70 product into the secretory pathway for release from the cells. Using this approach Hughes et al. [74] reported activity of the secreted adenosine deaminase from microcapsules where the cells remained viable for over 5 months when implanted into a mouse. The microencapsulation approach may provide a prototype for engineering nonsecreted gene products for therapy. Other modifications of this approach include the use of universal cell lines, and immunoprotective alginatepoly-r. -1ysine-alginate microcapsules [75]. The results from the modifications of the type discussed above may offer yet another strategy for the delivery of a gene product in a protocol involving the genetic manipulation of somatic cells. Only time will tell whether this approach will gain popularity and become commonplace in gene therapy protocols. Viral-mediated gene delivery

Viruses have evolved highly efficient mechanisms to transfer their genetic material to target cells [76,77]. The design of recombinant viral gene transfer vectors has capitalized on this property The strategy for designing these gene transfer vectors has involved the incorporation of heterologous sequences into the genome of the viral parent. In the process of delivering endogenous viral sequences during the infectious process, the virion can also deliver incorporated heterologous sequences. Since these viral vectors are attenuated, the virions are therefore thought of merely as helper sequences. These sequences have been derived from DNA and RNAviruses [78,79] and have been shown to be effective in mediating gene transfer in vitro and in vivo [80]. Each vector system has distinct advantages and disadvantages for gene therapy applications. These are discussed below Retrovirus Gene delivery vectors using RNA viruses have been derived from avian [81], murine [82,83] and human sources [84-861 and are the most widely studied viral vectors. Most human gene therapy clinical protocols currently in use are based on disabled murine retroviruses [87,88]. Retroviruses contain two single-stranded copies of RNA which can replicate through a DNA intermediate in the host cell. Infectious viral particles bind to and gain entry into the host cell by a receptor-mediated mechanism [89]. Once inside the cell, the genomic RNA is reverse transcribed into DNA, called a provirus, which then enters the cell nucleus where it integrates into the cellular genome (Fig. 3). The ability of this virus to integrate genetic material directly into the host chromosome is a usehl feature towards the design of a recombinant viral-based vector. The provirus is bound at each end by a long terminal repeat (LTR) which contains enhancer and I3romoter elements in addition to signals for the initiation and termination of viral transcripts. Between these LTRs are situated the coding sequences for a series of structural genes, gag, pol and env, and the sequences coding for the packaging signal necessary for encapsidation of the viral transcripts. The first step in generating a recombinant retroviral vector is the deletion

-

71

Inserted gene

0

oooo

Recombinant Retroviral Particles

Integrated Nucleus

Gene Expression

Rg.3. Mechanism of retrovirus-mediated gene transfer. The gag, pol and env sequences are deleted from the wild-type virus containing the encapsidation signal (JI) and replaced with the desired gene. This replication deficient provirus is introduced into a packaging cell line which contains an encapsidation defective retrovirus that will provide the proteins necessary to produce recombinant viral particles. The vector, with its expression cassette, can enter the cell by receptor-mediated endocytosis. In the cytoplasm, reverse transcriptase converts the vector to proviral DNA which is then integrated randomly into the host cell genome, where transcription and gene expression takes place.

of structural genes, which not only renders the virus replication defective, but also allows replacement with desired heterologous DNA sequences coding the gene to be expressed [90]. The resulting recombinant viral vector is dependent on an alternate source of viral protein production for subsequent replication and infection. These properties are restored by supplying a retroviral packaging cell line that contains the retroviral genome from which the signals for encapsidation of the viral particles have been removed or mutated [83,91]. Although the viral genome of the packaging cell line produces all proteins necessary for viral replication and assembly, the infectivity is lost. Introduction of the proviral form of the retroviral vector into this packaging cell line results in the release of

72 recombinant retroviral particles, containing only encapsidated foreign RNA, into the culture medium. These producer cell lines can then be used to transduce target cells with recombinant retroviral sequences which are subsequently integrated into the host genome leading to the production of the new protein (see [90] for review). The major advantage of retroviral vectors for use in gene therapy is the integration of the transferred genes into cellular DNA, resulting in permanently modified target cells [87,82,92], a property which is particularly advantageous for the treatment of hereditary and chronic disorders. However, the process of genomic integration with retroviruses is associated with a risk of insertional mutagenesis and tumour formation if the proviral DNA randomly inserts next to a tumoursuppressor gene or an oncogene [93]. The use of retroviruses is also limited by the fact that target cells must be actively dividing [94] which creates an obvious drawback for the treatment of neurological diseases as well as diseases such as cystic fibrosis where the target cell is often l l l y differentiated and nonreplicating. The potential for the production of replication-competent helper virus during the production of the retroviral vectors always remains a concern and these cell lines must therefore undergo extensive preclinical testing. Adenovirus Adenoviruses, which are naturally occurring human respiratory and gastrointestinal tract pathogens [95], are currently being developed for use in gene therapy [96,97]. The wild-type adenovirus genome consists of a linear double-stranded DNA of approximately 35 kb in length. The DNA contains a series of early genes (El-E4) that are required for viral replication and a series of late genes (L1-L5) that encode viral structural proteins [95,98]. Adenoviruses, which have a lytic life cycle, are taken up by the cell through receptor-mediated endocytosis [99] thus entering via endosomes.These viruses have the innate ability to escape the endosomal pathway and instead enter the cytoplasm through a fbsion process, where they lose their protein coat. The viral DNA then translocates to the nucleus. The viral DNA does not integrate into the chromosome, remaining as a linear episomal fragment. The recombinant adenovirus that has been developed for gene therapy is made by deleting the El region [loo] which regulates adenoviral transcription and is necessary for viral replication. The El region is subsequently replaced with the foreign gene of interest. The resulting replication-deficient adenovirus requires an external source of El proteins, usually supplied by growing the virus on an adenovirus-transformed human embryonic kidney cell line. Resulting viral particles do not carry the El genes and are, therefore, incapable of replication inside the target cell [97]. They are, however, still capable of infecting many cell types and can express the foreign gene under the control of its own promoter. Adenoviruses have been extensively studied as vector systems to deliver genes to the lungs, since this is a tissue which these viruses naturally infect. This makes recombinant adenoviral gene therapy particularly attractive as an option for the

73 treatment of diseases involving the respiratory system such as cystic fibrosis (CF) [101-1031. An advantage for the use of adenoviruses is their ability to infect numerous cell types including nonreplicating as well as actively replicating cells [104]. They are particularly suitable for in vivo gene therapies because they can be produced in high titers [lo41 and have the potential to carry large segments of DNA [97]. Since the transferred genetic information remains epichromosomal, there is little risk of insertional mutagenesis due to random integration. This proper@ however, often leads to instability of gene expression due to the loss of the viral vector in subsequent daughter cells making repeated dosing necessary While repetitive dosing may be feasible, the adenoviruses in current use have evoked nonspecific inflammation and antivector immunity, both humoral and cellular [105,106]. This is the major drawback in the use of adenoviral vectors for gene therapy Adeno-associated virus (AAV) AAV has proven to be a versatile alternative to the adenovirus vectors described above [107,108]. AAV is a small single-stranded DNA virus belonging to the parvovirus family and is known to infect respiratory and gastrointestinal tracts [109]. It has the potential to be widely applicable to gene transfer strategies because it can infect many cell types, is nonpathogenic and naturally defective for replication. These viruses require coinfection with a helper adenovirus or herpesvirus in order to replicate or cause a lytic infection. In the absence of a helper virus, AAV infects a cell, integrating into the host cell genome where it remains in a latent form. The AAV genome is relatively small (4.7 kb) and consists of two genes, rep and cap, flanked by inverted terminal repeats (ITRs) which are necessary for replication and nucleocapsid formation, respectively Recombinant AAV is constructed by deleting the rep and cap genes, thereby making room for about 4.5 kb for the insertion of a foreign cDNA. Packaging is accomplished by cotransfection of adenovirus-infected cells with both the recombinant AAV and a packaging plasmid which contains only the rep and cap sequences. Only the genes flanked by the ITRs will be encapsidated. The resulting AAV particles are incapable of replication once inside the target cell, but are effective at infecting and expressing the introduced gene in a wide variety of dividing and nondividing cell types. The main advantages of the use of AAV are its nonpathogenic nature, its ability to be grown to high titers and the propensity for apparently harmless targeted integration into a region of human chromosome 19 [1101. It has been suggested, however, that although the wild-type AAV integrates into specific sites, the recombinant AAV appears to integrate into multiple random sites [1113, providing a higher risk of insertional mutagenesis than once thought. The major disadvantage of the use of AAV vectors is the fact that the amount of material that can be inserted is limited to approximately 4.5 kb. Despite the size limitations of this vector, it should be u s e l l for the transfer of genes encoding enzymes or receptors that are involved in metabolic disorders. There will be significant problems under

74 conditions where repetitive administration is required, since AAV, like other viral vectors, are highly immunogenic.

Herpesvirus Effective gene transfer vectors using DNA viruses have been derived from herpesviruses and include herpes simplex virus (HSV) and Epstein Barr virus [112- 1141. Herpes viruses naturally infect neurons and have therefore become attractive as vectors for gene therapy in the treatment of neurological disorders [115,116]. HSVs are double-stranded DNA viruses whose genome consists of about 150 kb of linear DNA [1 161. The genome consists of a long DNA strand of 126 kb and a short DNA strand of 26 kb, each segment containing unique sequences bounded by inverted repeat elements, which contain sequences needed for cutting and packaging the viral DNA into capsids. In total, the HSV genome contains about 70 genes, which are subgrouped according to the time and conditions of their expression during productive infection [117]. In general, early gene products participate in replication of the viral DNA, while late genes encode structural components of the virion, including proteins that act as trans-acting factors during infections to stimulate transcription of early genes. Although large, many of the genes in the HSV genome can be deleted without the virus losing its ability to propagate [1 181. HSV, therefore, can be extensively manipulated and the resulting recombinant virus can accommodate up to 30 kb of foreign DNA [119].These recombinant viruses are capable of infecting dividing and nondividing cells, particularly neurons, without the aid of helper viruses. More recently, the HSV vector has been modified to include enhanced endogenous expression of the herpes simplex thymidine kinase gene under the control of its viral promoter [120]. This viral enzyme is capable of phosphorylating the nucleoside analogue ganciclovir to toxic analogues which leads to inhibition of DNA synthesis and cell death. Triggering these suicide genes has been successll in the treatment of glioblastomas [121] and ovarian carcinomas [122]. The main advantages of herpes viral vectors as agents for gene transfer is that they can accommodate large amounts of foreign DNA that can be particularly targeted to cells of the central nervous system by direct local administration. Unfortunately, expression is dependent on the acute replication cycle of virus. Recently, however, long-term expression of the transgene has been achieved by incorporating the promoter of the viral gene latency-associated transcript (LAT) that remains active during the latent period of infection and thus remains in the neuron for life [123,124].The main disadvantages of the HSV vector systems concerns diniculty in manipulation of the large viral genome such that the gene of interest can be inserted and subsequently expressed. In addition, the risks associated with the use of these vectors have not been fully evaluated and it is not yet clear whether these vectors will efficiently infect other cell types. They do, however, have the potential for use in long-term expression in a limited number of cells in specific structures of the brain. Although the bulk of the studies have focused on transduction of neurons in the central nervous system, this gene ther-

75

apy approach could also be extended to treat many peripheral neuropathies. Although the specific gene delivery methods discussed here represent a spectrum of approaches as they exist today, additional strategies are continuously being considered in order to resolve the current gene transfer problems. It is said that our imagination is the only limiting factor toward finding the “perfect vector” for use in all gene therapy protocols. This vector may not be universal for all protocols, rather it may exhibit cell-type specificity and may perform differently under different circumstances. The development of specific and effective vector systems remains at the forefront of investigations involving gene therapy

Realities of gene therapy potentially, all tissues and every cell type in the body could be targets for correction by gene transfer. The efficiency of gene transfer, however, is known to differ from one cell type to another and depends on the properties of the cell type, including the potential to culture and manipulate them in vitro and the type of gene-transfer system used [79]. In many cases it may be desirable to remove a given cell type from the body, culture and correct it ex vivo and reintroduce it into the body where it can hnction to supply the required gene product. In other cases, it may be desirable to introduce the normal gene in vivo in a tissue-specific manner using a variety of delivery methods as outlined above. These methods range from simply injecting “naked DNA” into specific tissues to introducing a gene using highly specific recombinant viruses. The choice of gene transfer method and the tissue to be targeted is known to influence the ultimate fate of the transferred gene. It may follow a random or site-specific integration into the host genome, or the therapeutic gene could exist extrachromosomally or extranuclearly and will therefore not be passed on to daughter cells with high efficiency In some nondividing cell types this may not be a major concern if the transferred genes could be maintained as stable and hnctional elements. Any gene therapy program must therefore consider specific properties of the tissue and cell type to be treated. This will not only determine whether the approach taken should be in vivo or ex vivo, but it will also determine whether the method used should be viral or nonviral, and eventually whether the gene will be integrated or not into the host genome. Given the involvement of different cell types in a number of diseases, most of the gene-transfer efforts to date have focused on the correction of hematopoietic stem cells, T cells, respiratory epithelium, muscles, liver and a variety of tumour types. The discussion of gene therapy methods currently in use or under development will be undertaken in the context of a suitable cell or tissue type to be corrected or treated using examples of specific human diseases. Over the past 20 years, the promising concept of gene therapy has become a reality Although the concept is simple, it is based on sophisticated molecular technology that is only now reaching a development stage that allows safe usage in human subjects [91]. Before gene therapy can be considered as a treatment

76 option, several criteria must be met. If DNA is considered to be a drug, then the first and foremost criterion that must satisfied is the safety issue surrounding its use. There must be minimal, if any, health risks or side effects resulting from treatment using a gene therapy approach. Equally as important, it must be shown that correcting a genetic defect, usually in preclinical animal models, will result in significant therapeutic benefit. Once the potential for therapy has been confirmed, the DNA drug may enter into a phase I or phase 1/11clinical trial where toxicity and efficacy are extensively investigated in humans. In order to l l l y understand the impact that this therapeutic approach will have on disease management, it is necessary to have a complete understanding of the biochemistry and cell biology of normal functioning genes in addition to the molecular pathophysiology of the disease to be treated. Gene therapy for the treatment of many disorders, including inherited (e.g., CF) and infectious disorders (e.g., AIDS), has now resulted in clinical benefit. There are over 100 clinical trials currently under way using a variety of gene therapy strategies [125] and these have been summarized in Table 2. Therapeutic strategies include the treatment of 1) inherited monogenic disorders, 2) complex multifactorial diseases such as cancer, and 3) infectious diseases such as AIDS. Although not currently used for therapeutic gain, marking studies have also been included in Table 2 since a substantial number of clinical protocols are being evaluated for their potential use in the future. The approach taken for the treatment of a particular disease is largely dependent on the target tissue and the specific cell type which needs to be genetically modified by the gene drug. In the following section, we evaluate the treatment, or potential treatment, of specific human diseases using a gene therapeutic approach, focusing on methods which are currently being used and the specific tissues and/or cell types that are being targeted. Our aim is to provide examples of current gene therapy strategies with lessons about how modifications in the current strategies could result in improved disease management in the future. Single gene diseases Severe combined immunodeficiency disease (SCID) Severe combined immunodeficiency is associated with the inherited deficiency of adenosine deaminase (ADA) [126]. This enzyme is involved in the purine salvage pathway of nucleic acid degradation and is essential for the complete development and functioning of the immune system [127]. Absence of ADA leads to accumulation of one of its substrates, deoxyadenosine, which is preferentially converted to deoxyadenosine triphosphate in T lymphocytes. This compound, which is cytotoxic to lymphocytes, results in a disabled immune system [128- 1301 leading to SCID. Untreated, affected individuals usually die from frequent, persistent viral and fungal infections, repeated bacterial infections and cancer at an early age. An additional feature of this disease are the skeletal abnormalities, including cupping and flaring of the costochondral junctions and growth delay A less severe form of SCID, resulting in late-onset immuno-

77 able 2. Summary of the RAC-approved clinical protocols (modified from [1251).

category

Therapeutic gene

Inherited single diseases - gene 1. Severe combined immunodeficiency disease 2. Cystic fibrosis 3. Gaucher disease 4. Familial hypercholesterolemia 5. Emphysema 6. Fanconi's anemia 7. Chronic granulomatous disease 8. Hunter Syndrome

Adenosine deaminase CRR Glucocerebrosidase LDL receptor u-1-antitrypsin FACC Cytochrome B (f!) Iduronate-2-sulphatase

lbtd

Complex multifactorial diseases 1. Cancer A. antisense B. chemoprotection C. immunotherapy (ex vivo) D. immunotherapy (in vivo) E. prodrug F. tumour suppressors 2. Peripheral artery disease 3. Rheumatoid arthritis

AIDS Marking studies

A11 studies (as of Dec. 1995)

1 11 3 1 1 1 1 1 20

Example K-ras, IGF-1 MDR-1 IL-2 HLA-B7 HSV-TK P53 VEGF IL-1

lbd Infectious diseases

Number of protocols

2 4

23 7 11 4

1 1 53

Example revM 10, Hy-TK, anti-5'-UTS ribozyme, HIV IIIB env/rev Neomycin

8 25 106

deficiency has also been described and affects a minority of patients [1311. The treatment of choice for children with SCID due to an ADA deficiency is allogeneic bone marrow transplantation (BMT). Obviously, this can only be achieved when an identical HLA-matched sibling bone marrow donor is available [132,133]. Unfortunately, the availability of such donors for children with SCID is only 25-30%. For these children, ADA enzyme-replacement therapy has proven to be an effective, yet costly, therapeutic alternative. Extracellular intravenous-administered ADA generates a diffusion gradient by which its substrate leaves the cell and is degraded in plasma or extracellular fluid [134]. Adagen, the ADA replacement currently used, was designed by covalently attaching polyethylene glycol (PEG) to purified bovine ADA [135]. Treatment with PEGADA is life-saving, with most patients experiencing weight gain and a decrease in opportunistic infections [1361.Weekly injections of PEG-ADA has resulted in

78 immune recovery in at least 35 children up to 6 years of age following the initiation of the treatment program [137]. Although an increase in peripheral T lymphocytes has been routinely observed in all patients, consistent immune responses to specific antigens has been observed in only a few patients. While this is a significant step forward, the major drawback is the need for continuous lifelong treatment with this modified enzyme in order to maintain a functional immune system. ADA-SCID is an attractive model for the development of gene therapy procedures based on correction of a single gene defect. The target tissue for the ADA gene is the easily accessible hematopoietic system. The observation that during allogeneic bone marrow transplantation the only donor cells that were active in eliciting functional immunity were the T lymphocytes raised the possibility that T cell-directed gene therapy may be a possible and useful treatment. Furthermore, since PEG-ADA treatment resulted in increased levels of T lymphocytes, it was thought that this would provide a source of T cells crucial to the implementation of the gene therapy protocol [138]. T cells were obtained from SCID patients, induced to proliferate in culture using interleukin 2, transduced with Moloney murine leukemia retrovirus vector containing the h11-length 1.5 kb cDNA for human ADA, culture-expanded and reinfused into the patient after 9-12 days. Current clinical trials have shown that the human ADA efficiently transduced ADA deficient T cells in two children resulting in normal amounts of ADA expression in their T cells for 4 years [136]. This rendered the T cells resistant to the toxicity and growth inhibition when challenged with deoxyadenosine [ 139,1401. In these studies, using retroviral-mediated gene transfer, the survival of reinfused ADA transduced peripheral blood T lymphocytes is prolonged in vivo, suggesting that these cells have a survival advantage over noncorrected ADA-deficient cells. It should be noted, however, that both children treated in this manner continue to receive the PEG-ADA enzyme-replacement therapy, although the dose required to sustain normal immune function has been substantially reduced [ 1361. It is therefore difficult to attribute the benefits observed solely to the gene therapy protocol. Despite these problems, the observations are consistent with the conclusion that ex vivo gene transfer of ADA to T lymphocytes and hematopoietic stem cells elicits biological responses which are relevant to the treatment of SCID. Moreover, these studies suggest that ex vivo modification of cells to be injected into patients can be a safe and effective addition to treatment for patients with this and perhaps other debilitating diseases. Ultimately, the genetic correction of SCID resulting from ADA deficiency would be achieved by insertion of the human ADA gene into hematopoietic progenitor cells that give rise to Tand B cells. If achieved, the affected individual should show normal immunity and a lifetime cure. Recent advances in isolation and in vitro growth of stem cells have allowed researchers to focus on the challenges of low transfection efficiencies and unstable expression with this cell population [138]. Stable expression of the introduced ADA gene into stem cells has been obtained by retroviral-mediated gene transfer and this vector is the one

79 of choice for entry into clinical trials [138,141]. It should be noted, however, that wen under optimal conditions, transfection efficiencies of less that 30% are typically obtained. Recently, investigations to determine whether human cord blood stem cells may be more efficiently transduced than those from bone marrow have been initiated with the view of using these cells as gene transfer targets in prenatally diagnosed ADA-deficient newborns [1421.

Cysticfibrosis CF is one of the most common autosomal recessive disorders that affects Caucasian populations with an incidence of about one in 2,000 live births [143].Though the monogenic nature of the disease has been known for over 40 years, the gene responsible was not cloned until 1989 [144]. A defect in the epithelial CAMPregulated chloride channel (Cystic Fibrosis Transmembrane conductance Regulator (CFTR)) causes a disorder of exocrine glands that affects both mucoussecreting and sweat glands throughout the body. Major clinical manifestations of this disease are limited to two sites, the airway epithelium and pancreatic excretory ducts. Obstruction of the pancreatic ducts leads to pancreatitis, pancreatic insufficiency, malabsorption and intestinal obstruction requiring affected individuals to rely on lifelong pancreatic supplements. Vicid airway secretions lead to the other serious manifestations of the disease, namely purulent mucus, recurrent infection and bronchiectasis. Most morbidity and virtually all mortality associated with CF results from progressive damage to the respiratory epithelium following chronic infection and inflammation (see [ 145- 1471 for reviews). The CF gene codes for the CFTR protein which is a glycosylated molecule composed of two membrane-spanning segments and intracytoplasmic regions including two nucleotide binding folds and one R domain [148,149]. Mutations in this gene lead to abnormal processing and trafkking of the mutant CFTR protein, and ultimately to dysfunctional apical membrane chloride conductance in epithelial cells [1501. Analysis of genotype/phenotype relationships of the 400 mutants described to date suggests that although there is an association between specific mutations in the CF gene and pancreatic function, there is no such obvious correlation for the severity of pulmonary disease [151]. This has led to the speculation that factors other than the nature of the CF gene mutation, such as the rate of CFTR-mediated chloride secretion in each organ as well as the anatomical and physiological characteristics of the affected organ (involving additional genes), may play an important role in the clinical phenotype [152]. The individual response to pulmonary pathogens, especially Pseudomonus, is another genetically determined factor that may determine severity of CF, complicating the overall understanding of the phenotype and treatment of the disease. Current treatment regimes for this disease are largely palliative and eventually ineffective. Because CF is an autosomal recessive disorder and the respiratory epithelium is accessible for topical treatment, this disease is also an attractive target for gene therapy The respiratory epithelial cell provides a well-defined target and the objective is to restore the CAMP-activated chloride channel in

80

these cells. In vitro studies have shown that intrcduction of a normal copy of the CFTR cDNA into CF epithelial cells using retroviral vectors restored the normal chloride transport function of these cells for up to 6 months [153,154]. Since the treatment of CF is not amenable to ex vivo manipulation [155], it was, therefore, necessary to develop in vivo methodologies that were capable of delivering the normal CFTR cDNA to epithelial cells of the airways of CF patients. Numerous gene transfer vectors have been evaluated in animals for the in vivo treatment of CF and include viral vectors (such as retroviruses, adenoviruses and AAVs [156]), liposomes [ 101,1571, and receptor-mediated gene transfer vectors [ 1581. By comparison, the adenoviral vectors have been the most effective in transducing lung epithelial cells in vitro [159,160] and in vivo [96,100,161] with CFTR cDNA. This is largely due to the fact that the these viral vectors naturally infect nonreplicating cells of the respiratory tract with high efficiency Moreover, adenoviruses are able to accommodate large inserts such as the CFTR cDNA (4.5 kb), with a suitable promoter to drive transcription. The first report from a clinical trial using a CF adenovirus vector for in vivo transduction of epithelial cells by Zabner et al. [161] showed that a single dose administered to the nasal epithelium of three CF patients corrected the CAMP-dependent chloride channel defect. Despite this initial success, immune response to the adenovirus vectors of the CFTR gene has resulted in a halt to the clinical trial, and, therefore, is a clearly identified limitation of this approach. Cationic liposome-DNA complexes have been adopted as an effective method of achieving gene transfer to epithelial cells in vitro and are now being developed and considered as the only viable approach for direct gene transfer to lungs in vivo [ 102,157,1621. Cationic liposome-DNA complexes can be administered to the lungs of transgenic mice with CF as an aerosol [163] or by direct tracheal instillation [1641. In either case, a CAMP-regulated chloride channel was restored to the upper airways of transgenic mice lacking the CFTR gene [164,165]. Despite differences in electrophysiological properties between murine and human airways, there are promising insights for the potential role of in vivo cationic liposome-mediated gene transfer for the treatment of CF in humans. Results from the first cationic liposome-based gene therapy clinical trial for CF show that it is possible to transfer and express recombinant CFTR in vivo in nasal epithelial cells using cationic liposome vectors [1661. Preliminary results from a phase I clinical trial show that significant changes in the basal potential difference and sodium and chloride transport were observed in all patients with no adverse side effects [167]. However, the long-term benefits have not yet been assessed. The main advantage of using cationic liposome-mediated gene transfer is its relatively low level of toxicity and reduced likelihood of evoking inflammatory or immune responses [1681. This makes repetitive administration possible, thus offering the probability of maintaining transferred gene expression above required threshold levels despite transient expression. Moreover, genes of unlimited size can be transferred using liposome-DNA complexes. Furthermore, it is thought that only a small portion of the target cells may need to be genetically

81 modified to achieve clinical benefit in the treatment of CF [loll. A better understanding of the mechanisms of cationic liposome-mediated gene transfer will undoubtedly help in developing a more effective lipid-mediated gene transfer vector with the potential for in vivo treatment of CF [169].

Gaucher disease Gaucher disease is the most common form of lysosomal storage disease and results from autosomal recessive inheritance of a lysosomal enzyme glucocerebrosidase deficiency [1701. This deficiency produces defective hydrolysis of glucocerebroside which accumulates in reticuloendothelial cells (tissue macrophages). Excessive quantities of glucocerebroside have been observed in many organs of patients with Gaucher disease, who often present with hepatosplenomegaly, anemia, pulmonary and kidney involvement as well as extensive CNS damage, neurologic deterioration and myoclonic seizures [1711. The current treatment regime is infbsion of biochemically modified enzyme into patients [172,1731. However, like ADA-replacement therapy, this is an expensive treatment option. Since glucocerebrosides accumulate in reticuloendothelial cells and the disease is caused by mutations in a single gene, the therapeutic target is well-defined. Ideally, treatment of this disease will focus on the hematopoietic stem and progenitor cells. Retroviral vectors have been used to transduce these cells ex vivo with the glucocerebrosidase cDNA with high efficiency [1741. Long-term bone marrow cultures and long-term culture initiating cells have been efficiently transduced and exhibit sustained mRNA expression and glucocerebrosidase enzyme production in their progeny cells. These preliminary studies suggest that this ex vivo approach can be used to treat patients with Gaucher disease causing physiologically relevant levels of glucocerebrosidase activity The NIH Recombinant DNA Advisory Committee has recently approved this approach for initiation of phase I clinical trials for this disease [175], although results from these trials are not yet available. Muscular dystrophy (MD) MDs make up a well-defined, yet heterogeneous, group of progressive, primary, genetically determined myopathies that are characterized by proximal muscle weakness and incapacitation that, in several cases, leads to death [176]. No effective treatment is available, although the progressive course of the disease can be slowed by administration of oral glucocorticoids [177]. Two of the dystrophies, Duchenne and Beckers, are inherited as X-linked traits and are caused by different mutations in a single gene. The cDNA, which has been cloned and sequenced [178] is 13.9 kb, contains 79 exons and codes for dystrophin. Dystrophin is a protein which makes up a membrane complex that links the normal muscle cytoskeleton to the basal lamina [179]. In Duchenne MD, the majority of gene mutations result in premature translational termination leading to severely reduced levels or absence of dystrophin. In contrast, most gene mutations in the

82

clinically more benign Beckers dystrophy lead to in-frame deleted transcripts that generate abnormal proteins which may possess some degree of normal function. It is now thought that new mutations in the dystrophin gene are very common, making up about one-third of Duchennes and Beckers MD cases [180]. Because of major advances in our understanding of the underlying defect, and cloning of the gene responsible for the disease phenotype, Duchenne MD is a prime candidate for gene-replacement therapy. There are, however, significant challenges associated with developing viable treatment strategies for testing in clinical trials. Since the full-length dystrophin gene is very large, only the cDNA can be considered for gene therapy However, even the cDNA which is 13.9 kb exceeds the capacity for adenoviruses. Furthermore, a suitable promoter, one which is small and exhibits tissue-specificity, has not yet been identified. Although a number of delivery systems have been evaluated using mouse as a model for this disease [7,181,182], there have been no significant levels of gene expression with any of these systems. As a result, no clinical trial is in place, and a number of problems still require solutions in animal studies before gene therapy for human muscle diseases such as Duchenne MD can be considered [183]. Recent success in the use of direct injection of plasmids into muscles has led to the suggestion that this simple and direct approach may be the most viable option for the management of MD. Phenylketonuria (PKU) PKU is an autosomal recessive disorder caused by a deficiency of hepatic phenylalanine hydroxylase (PAH). The PAH catalyzes the conversion of L -phenylalanine to tyrosine and is involved in the catabolism of phenylalanine to COz and water. Deficiencies of hepatic PAH activity result in accumulation of PAH and abnormal metabolites in the blood and other tissues, leading to severe, irreversible mental retardation [1841. The conventional approach for the treatment of PKU is the dietary restriction of phenylalanine, which significantly reduces serum phenylalanine levels and can largely reduce or prevent the mental impairment if initiated early in the neonatal period. Despite the success of this treatment strategy, the efficacy is frequently limited by poor compliance of adolescent patients, leading to premature termination of treatment. This invariably results in a decline in mental and neuropsychological hnction [1851. Early experiments demonstrated the potential for gene therapy for the treatment of PKU by showing that human PAH protein can be produced in PAHdeficient hepatic cells through the introduction of human PAH cDNA [186]. Since then, recombinant retroviruses [187,1881 and adenoviruses [1891 have been used to introduce PAH activity into PAH-deficient cells in vitro and in vivo. Although recombinant retroviruses can efficiently transduce PAH-deficient cells in vitro, they are limited in their use by their low transduction efficiency in vivo. Recombinant adenoviruses, on the other hand, have been shown to efficiently transduce mouse hepatocytes in vivo [1891. However, the therapeutic effect

83 was transient and readministration had no further effect, potentially a conse-

quence of acquired immune response to the initial viral injection. Furthermore,

high antiadenoviral antibody titers were observed in treated animals. Despite these caveats, these results demonstrate that PKU, and possibly other metabolic disorders caused by deficiencies of hepatic enzymes, can be completely corrected by somatic gene therapy when more persistent vector systems are developed.

Familial hypercholesterolemia (FH) FH is a well-characterized genetic disease caused by a defect in the gene coding for low-density lipoprotein (LDL) receptor, a cell surface molecule that binds LDL, the major cholesterol transport lipoprotein in human plasma [190]. FH is transmitted as an autosomal dominant trait and therefore has manifestations in heterozygotes as well as homozygotes.The LDL receptor is located on the surface of a variety of cell types, especially hepatocytes where it facilitates the removal of LDL from plasma by receptor-mediated endocytosis and delivers it to lysosomes which release the cholesterol for metabolic use [190]. An absence or functional deficiency of LDL receptors causes reduced LDL uptake resulting in high levels of serum cholesterol. FH homozygotes make up one in 1,000,000 of the general population and have severe hypercholesterolemia. These individuals have cutaneous xanthomas before 4 years of age and succumb to premature atherosclerosis, myocardial infarction and death before 20 years of age [191]. FH heterozygotes make up one in 500 of the general population and have 2-fold elevation of plasma cholesterol. Though the clinical manifestations are less severe than the homozygotes, individuals develop tendon xanthomas and coronary artery disease by their mid-30s. Traditional approaches to control hypercholesterolemia and premature coronary heart disease such as drug and surgical intervention are largely ineffective. The most significant correction of the metabolic processes by traditional medicine involves liver transplantation, aggressive plasmapheresis or LDL apheresis [192- 1941. Homozygous familial hypercholesterolemia is particularly suited for gene therapy [195], since it has high morbidity and is refractory to traditional treatments. The current gene therapy treatment for individuals with severe LDL deficiency is liver resection, ex vivo transfection of hepatocytes and reinfusion into the body [196]. Hepatocytes are harvested by partial hepatectomy and are grown in vitro, during which time they are transfected with the normal LDL receptor gene using retrovirus vector as the transfer agent. Hepatocytes, corrected for the defect are collected and autologously transplanted via the spleen from which they assimilate into the regenerating liver [197]. Results from the first human gene therapy clinical trial for hypercholesterolemia have shown a reduction in serum LDL cholesterol and in the ratio of LDL to HDL over 18 months [198,1991. This suggests that the gene-corrected hepatocytes are functioning in vivo to internalize and metabolize the LDL cholesterol appropriately at least 4 months after gene therapy

84 Like ADA deficiency, it is difficult to evaluate the effect of gene therapy in FH patients since additional therapies are simultaneously administered [79]. However, because there is a general correlation between the levels of serum cholesterol and the severity of the disease, any reduction is serum levels may be clinically beneficial. It is thought that transduction of only 15% of hepatocytes is required to fully reverse the disease [200]. For a full evaluation of this ex vivo approach, more data on the clinical response in these patients is required. Although these clinical trials are in their infancy, recent progress in the development of in vivo approaches for the treatment of FH using animal models may lead to more effective approaches for the treatment of this and other liver metabolic diseases in humans [201,202]. Alpha-1 -antitrypsin deficiency @AT) AAT is inherited as an autosomal codominant trait [203]. It is characterized by low serum levels of a-1-antitrypsin leading to the development of pulmonary emphysema and cirrhosis of the liver [204,205]. In normal individuals, AAT protects the lower respiratory tract from destruction by neutrophil elastase by inhibiting elastase activity [206]. As a result of mutations in the coding region of the AAT gene (G to A transition in the codon for a glutamate residue, [207]), hepatocytes cannot secrete sufficient amounts of AAT to protect the lungs while accumulation of mutant AAT in hepatocytes causes cirrhosis. The conventional treatment for AAT deficiency is to infuse human AAT protein derived from spent human plasma into the blood of affected patients [208,209]. It is not known whether such protein infusions effectively arrest further pulmonary degradation and deterioration of lung function. Furthermore, this treatment protocol is expensive and also carries the risks of transferring bloodborne infections. Another strategy to treat AAT deficiency is to use gene therapy to directly transfer the AAT cDNA to somatic cells of the affected individuals. This would provide a population of cells capable of synthesizing and secreting AAT into the circulatory system. The resulting protein would diffise into the alveolar space providing the necessary antielastase function. However, this form of therapy would only be effective against the pulmonary manifestations of the disease, and would not be effective against the hepatic disease resulting from excessive accumulation of the mutant protein in the liver [210]. The hepatocytes have therefore become the target cell for gene therapy with hAAT. A variety of approaches have been developed to target hepatocytes with hAAT cDNA and include ex vivo strategies with retrovirus vectors and in vivo strategies with liposomes and adenovirus vectors [211-2131. Although the potential for gene augmentation of AAT deficiency is substantial, inefficient delivery of the hAAT gene to hepatocytes in vivo and ex vivo is a rate-limiting factor for clinical application. It has been suggested that, unlike disorders such as familial hypercholesterolemia, AAT deficiency would require a substantial number of transfected hepatocytes in order to correct the disease phenotype [2141. Administration of receptor-mediated conjugates

85 intravenously are very practical, but currently require partial hepatectomy for efficient gene expression. The use of adenoviral vectors is the most encouraging approach to date. However, as indicated for other approaches that rely on adenoviral vectors, immune response to the virus limits repetitive dosing.

Fanconi’s anemia (FA) FA is a rare autosomal recessive disorder affecting approximately three in 1,000,000 live births [215]. Symptoms of this disease are pleomorphic and may include congenital malformations, abnormal skin pigmentation, renal anomalies, aplastic anemia, bone marrow failure and susceptibility to cancer. FA is commonly referred to as a cancer-prone chromosomal instability syndrome, since cultured cells from these patients exhibit increased chromosomal instability and hypersensitivity to cross-linking agents such as mitomycin C [216]. The most profound clinical hallmark of FA is the development of aplastic anemia, which results from bone marrow failure. Although the cause of bone marrow failure is unclear, the abnormal cellular characteristics in FA have been thought to be due to defects in DNA repair [217], response to oxygen [218], and cytokine production and response [219]. The extensive clinical and cellular heterogeneity of this disease has led to the investigation of genetic heterogeneity Complementation analysis using cell fusion hybrids revealed that mutations in at least four different genes can lead to this disorder (FA-A, B, C, and D) [220]. A cDNA encoding the FA complementation group C (FACC) polypeptide has been identified by cDNA complementation cloning [221]. FACC is thought to encode a novel protein that localizes to the cytoplasmic compartment of cells ruling out the role for the gene in DNA repair [222], although the function of this protein is not well-understood. Current treatment of FA involves bone marrow transplantation from HLAbone-matched donors. This treatment, however, is largely palliative and > 75% of affected patients have no suitable bone marrow available. Recent cloning of the FACC gene has made gene therapy a viable option for the treatment of FA in affected individuals. Gene replacement therapy for FA consists of insertion of the normal FA gene into hematopoietic stem cells to correct for the hnction of the defective gene. In this approach, bone marrow stem cells and lymphoid progenitor cells are collected from peripheral blood of FA patients and transduced ex vivo using a recombinant retrovirus- [223] or adenovirus-associated expression vector [224]. Preliminary studies have shown that genetically corrected cells, following transduction using the retroviral vector containing the wild-type coding sequence of FACC were normalized for their susceptibility to MMCinduced chromosomal breakage [223]. Recent animal experiments have demonstrated that transduction of FACC into hematopoietic stem cells transplanted to bone marrow and spleens of nonmyeloablated BALB/c mice has no direct haimll effects to the hematopoietic system [225]. This approach has recently been approved by the Recombinant DNA Advisory Committee for initiation of phase I clinical trials [175]. If this procedure is deemed successful for group C

86 patients, without unacceptable complications, it has the potential for the treatment of patients from other complementation groups, once the corresponding genes have been identified. Complex multifactorial diseases - cancer

Understanding the molecular events involved in the control of normal cellular growth has revealed a plethora of genetic and cellular alterations that lead to malignant transformation.The complexity and heterogeneity of these transformations is recognized by the clonal expansion of multiple genetic changes associated with tumour development. This complexity is not limited solely to multiple genetic heterogeneity but is also enhanced by influences of other factors including responses from the immune system as well as environmental interactions. Therefore, the gene alterations which lead to cancer are often much more complex than those which cause single gene hereditary diseases. For this reason, treatment strategies based on the use of gene therapy will be more challenging. It will be important to select a target tissue or cell type for gene therapy as well as selecting an approach that may involve turning off a gene that promotes proliferation, turning on a gene that stimulates programmed cell death or introducing a new gene that will result in a therapeutic response. Nonetheless, since many cancers have now been established as having a genetic basis and are now considered to be genetic diseases, gene therapy is being evaluated as a relevant treatment option. The potential for gene therapy in cancer treatment is well recognized and more than 50% of clinical gene transfer protocols currently in place involve treatment of cancer ([125,226],Table 2). As indicated above, due to the genetic heterogeneity associated with many tumours, it is often difficult to determine which cells or tissues should become the target for a gene therapy approach. The first approved clinical trial in gene transfer was not designed to be therapeutic, but was designed to track the fate of tumour-infiltrating lymphocytes (TILs) in response to tumour growth and development [227]. TILs are lymphoid cells that are isolated from solid tumours and are capable of naturally locating and killing tumour cells [228]. These cells can be expanded ex vivo by stimulation with the T cell hormone IL2 and when readministered to the patient are known to mediate tumour regression [229]. In order to distinguish the inhsed lymphocytes from other lymphocytes in the body, they were transduced ex vivo with a retroviral vector encoding the selected marker gene, neomycin phosphotransferase gene (neoR). Once inhsed into patients with malignant melanoma, these cells were evaluated for their in vivo distribution and survival. Genetically modified TILs could be detected for up to 64 days at the site of the tumour in some patients [227]. This laid the groundwork for many of the subsequent gene therapy experiments involving ex vivo manipulation of bone marrow or peripheral leukocytes. Numerous gene-marking trials have since been initiated and most have used retrovirus vectors for transfer of selective marker genes or genes that code for cytokines. The focus of these studies

87 addresses biological principles that are relevant for treating malignant disorders [79]. Therapeutic clinical trials are aimed at transferring into target cells within sites of cancer progression, expression cassettes which carry genes that will: 1) enhance immune responses to tumours, 2) alter the proliferation rate of cancer cells, or 3) sensitize a malignant population to a cytotoxic agent or radiation. The applicable delivery system used for cancer gene therapy protocols are as varied as the strategies. Most of the therapeutic trials for cancer involving enhanced immune responses consist of introducing one of several cytokine genes into either tumour cells, bone marrow cells or TILs. These genetically modified cells will produce the desired cytokine thereby enhancing immunity [230]. Once it was shown that gene-modified TILs could be safely given to patients, attempts to increase the effectiveness of the antitumour response were undertaken. A protocol was initiated in which the gene for tumour necrosis factor (TNF)was added to the vector in hope that localized secreted TNF would enhance immune recognition and destruction of tumour cells [231].This ex vivo protocol was problematic since it was shown that the bulk of administered TIL cells were trapped in the liver, spleen and lungs. This resulted in large amounts of ectopic TNF production and associated toxicity [86]. Augmenting the antigenicity of the tumour cells themselves was an alternate approach to improving immunotherapy A number of investigators have used this “tumour vaccine” approach and initiated clinical trials involving the transfer of cytokines with histocompatability genes into tumour cells. This resulted in stimulation of immune response and systemic tumour destruction [232-2351. The preclinical results obtained using this approach have been remarkable, where distant, genetically unmodified tumours regress following injection of identical tumour cells that have been transfected with an appropriate histocompatability gene. The clinical strategy [236], therefore, consists of regional transfer of a histocompatability gene, through direct injection of plasmid DNA-liposome complex in a cancerous lesion, with hopes that an immune response will effect a therapeutic response at distal sites. Another approach in cancer therapy is to specifically inhibit or block tumour cell proliferation. Much of the research consists of in vitro studies aimed at inhibiting the expression of oncogenes by the use of antisense oligonucleotides [237,238]. Genes that have been targeted include c-myc, c-myb, bcr-abZ, bcZz and fibroblast growth factor (see section: Novel advances - therapeutic oligonucleotides). The inhibition of expression of these genes is aimed at blocking the translation of mRNA into protein, although there are multiple levels that alteration of gene expression can occur. The use of this approach is still in its infancy and a considerable amount of research needs to be done before we can recognize the impact it may have on the treatment of cancer. One area of research in gene therapy of cancer that has gained an enormous amount of attention, is the modulation of the expression of the tumour suppressor gene p53. Mutations in the p53 gene are known to occur in > 50% of human tumours, including metastatic breast cancer [239], one of the leading causes of

death in women. The p53 gene product functions as a transcriptional activator of other genes, which inhibits the progression of the cell cycle from GI to S phase in normal cells. P53 protein levels are known to be elevated in response to DNA damage [240], leading to GI arrest, terminal differentiation or apoptosis [241,242]. Mutations in the p53 gene lead to loss of wild-type p53 protein hnction associated with disruption of the normal cell cycle resulting in tumour progression and uncontrolled cell growth [243]. Since this discovery, numerous studies have been launched to evaluate the role of exogenously supplied wildtype p53 gene in human tumour cells both in vitro and in vivo [244--2481. These studies have involved a number of treatment strategies including the use of adenovirus vectors [249], retroviral vectors [250], liposome-mediated transfection [2513 and ribozyme-mediated modification of p53 [252]. Although the function of p53 has been restored efficiently in tumour cells in vitro, it has been less successhl in vivo. This is largely due to problems of in vivo targeting of p53 expression vectors to the site of tumour progression. Other problems also exist, which are specific to the delivery method used and reflect the safety concerns associated with any method currently used for gene therapy Although the results evaluated to date suggest that restoration of p53 expression in aberrant cancer cells may be significant in the treatment of many human malignancies, many conceptual and technical problems must still be solved. The remaining treatment strategies involve augmenting the cytotoxicity of chemotherapeutic drugs and two examples of this approach are provided here. One approach uses retroviruses carrying the HSV thymidine kinase gene, otherwise known as a “suicide” gene [116]. Introduction of this gene directly into tumour cells and subsequent expression renders the cell susceptible to killing by the antiviral agent ganciclovir [120]. Brain tumours are amenable to this approach, since nondividing cells are refractory to retroviruses, whereas tumour cells, which are rapidly dividing are readily infected and the viral genome is integrated and expressed. Moreover, during the process of cell death directed by HSV-TK, toxic metabolites are generated that kill nearby unmodified tumour cells in what is termed a bystander effect [253].The cytotoxic effects are therefore not limited to cells that have undergone transfection. Phase I clinical trials have been initiated using this approach for the treatment of brain cancer [121], ovarian cancer [122] as well as AIDS [254], although a full evaluation of patients receiving these treatments has not been completed. Clearly, however, the use of suicide genes in the treatment of cancers is a promising and valuable approach. A second approach for augmenting cytotoxicity of chemotherapeutic drugs involves the manipulation of the drug sensitivity of cells via the multiple drug resistance gene (MDR-l), which confers resistance to certain chemotherapeutic agents. Conventional chemotherapy for the treatment of many cancers is limited by its toxicity to normal bone marrow cells. With this treatment strategy, the MDR-1 gene is inserted into the normal bone marrow progenitor cells in an ex vivo approach using retroviruses, which confers a protective effect for these cells against high doses of chemotherapy [255]. This strategy serves to increase the

89

number of patients who can potentially benefit from high-dose chemotherapy as well as increase the amount of chemotherapeutic agents administered to patients by protecting their hematopoietic system. Although clinical trials have been initiated for the use of this MDR-1 approach in the treatment of breast cancer [256], additional genes that bestow hematopoietic cells with selective resistance to chemotherapeutic agents and radiation are now being considered for future gene therapy applications. Infectious diseases: acquired immunodeficiencysyndrome (4 IDS) AIDS, described more than 12 years ago, is now a global health problem [257]. AIDS is caused by infection of the CD4+ lymphocytes by the immunodeficiency virus-1 (HIV-1). Like other members of the retroviral family, HIV-1 transcribes its RNA genome into DNA which randomly integrates into the chromosome of the host cell [258]. Once stably integrated, the provirus retains the potential for viral expression and production of viral progeny throughout the lifetime of the infected cell. Despite the progress in understanding the causative agent at the molecular level, the continuous and rapidly changing viral populations evolving within each patient make this disease difficult to manage and inevitably fatal. The most extensively studied therapeutic approach for controlling HIV infection is inhibition of reverse transcriptase, which results in cessation of replication of the retroviral genome. This approach, however, has limited efficacy due to the fact that it is only effective against new viral particles. Previously infected cells, in patients who are given this therapy, can continue to generate viral progeny and in turn continue to generate a multitude of escape mutants, propagating the disease. A diversity of gene transfer based approaches have been evaluated for the treatment of AIDS and at present two different strategies are being explored [259]. The first is an antiviral approach and is termed “intracellular immunization’’ [260]. It is designed to render cells resistant to viral replication and to limit the spread of virus in the infected individual. It involves the efficient and stable transfer of genetic elements that inhibit viral replication into those cells of a patient that are potential targets for viral infection. This should effect a reduction in the spread of virus in the body Intracellular immunization, perhaps more correctly termed intracellular interference or intracellular inhibition, can be divided into three treatment strategies: 1) those that are protein-based, 2) those that are RNA-based, and 3) those that are immunologically based. The protein-based strategy for inhibition of viral replication stems from research from McKnight and co-workers who demonstrated that cells stably expressing a truncated form of the HSV transactivator protein VP16 did not support the replication of wild-type HSV [261]. They suggested that this mutant protein interfered with the function of a cis-acting element by wild-type protein and thus viral replication. A similar strategy was devised to inhibit HIV replication and is achieved by the expression of altered HIV gene products that have a

90 transdominant (TD) mutant phenotype [262]. TD mutant proteins that have been identified, and that inhibit HIV replication, include those that are structural kug, env) as well as regulatory (tut, rev). The most extensively studied TD mutant is revMZ0, a mutant rev protein resulting from amino acid substitutions at positions 78 and 79, that acts as a TD inhibitor of wild-type rev [263]. Retroviral vector delivered revMZ0 to human T cells has shown that cells which were stably transfected with revMZ0 were resistant to viral infection. Transfection of primary human PBLs with revMZ0 vector also conferred resistance to HIV-1 [259]. The mutant gene that encodes for the revMZ0 protein is therefore an attractive candidate gene for use in hrther preclinical testing and perhaps clinical studies in the future. A second protein-based treatment strategy focuses on the host cell. Variants of CD4, which can bind and sequester virion progeny in the cell, can limit HIV replication by providing a binding site decoy for the virus. The CD4 molecule is a receptor on inducedhelper T cells and monocyte/macrophages which HIV-1 recognizes to establish infectivity [264]. It is known that expression of an exogenous recombinant secreted form of CD4 (sCD4) produced by genetically engineered cells can block HIV-1 replication in cultured T cells [265,266]. These cells act as cellular factories to secrete sCD4 into the medium where it binds to HIV virions. This approach, using genetically engineered cells to produce sCD4 that are subsequently administered to affected individuals, has been tested in a phase I clinical trial and high plasma levels of recombinant protein were achieved in patients with HIV-1 [259]. The infusion of recombinant cells into these patients, however, failed to show efficacy, and was thought to be due to marked resistance of primary clinical isolates to the neutralizing activity of this protein [267,268]. These studies demonstrate the problems that can still arise in the development of a promising strategy from the bench to use in the clinic. RNA-based strategies, unlike protein-based inhibitors, are more advantageous since they are less likely to be immunogenic, easier to express at high levels and exhibit higher levels of target specificity. RNA-based inhibitors include antisense RNA and ribozymes which use the specificity of Watson-Crick base pairing to interfere with gene expression. Antisense RNA has been used extensively to study gene expression in viral diseases (for review see [269]). More recently, Chatterjee et al. [270] have shown that an HIV-1 antisense construct, complementary to a 63 bp sequence in the LTR which includes the tat responsive element (TAR) and part of the polyadenylation signal, transduced into human T cells using recombinant AAV inhibited replication of the HIV-1. Although a significant reduction in virus production was observed, a nonspecific general antiviral effect could not be ruled out. More extensive analyses of the antisense RNA approach are needed to more accurately determine the effectiveness of this approach. An extension of the antisense approach involves the use of RNA decoys. This strategy sequesters viral nucleic acid binding regulatory proteins by overexpressing their cognate RNAs. The two key regulatory gene products that have become common targets are tat and rev which bind to nascent viral RNA sequences, termed TAR

91

and RRE, respectively. This is known to activate gene expression [271]. Expression of short RNAs corresponding to TAR and RRE sequences in cells transduced with an antisense retroviral vector will result in binding of the TAR and RRE targets. This, in turn, prevents these proteins from binding to their physiological targets and thereby inhibits HIV replication [272,273]. Although preliminary experiments show that RNA decoys are effective at inhibiting HIV replication, one caveat identified with this approach is that additional cellular factors that bind TAR and RRE were also sequestered. This phenomenon can be eliminated by designing decoys that correspond to more specific binding domains. Despite their potential, like TD mutants proteins, RNA decoys are effective only after viral integration and therefore cannot protect the cell from initial infection. Ribozymes are now on the forefront of research for use in RNA-based strategies to inhibit HIV replication. They have the advantage of being very specific and versatile, since they allow a wide range of targets to be selected. Furthermore (as noted in the section: Novel advances - therapeutic oligonucleotides), ribozymes are known to efficiently cleave RNA targets with high specificity Because of their catalytic properties, ribozymes can be effective at much lower concentrations and obviate the need for efficient expression systems that generate excess inhibitor RNA. The first ribozyme described, the hammerhead ribozyme (named for its secondary structure), has been effectively used as an anti-HIV agent [274]. Ribozymes have been designed to target gag [274], vif [275], integrase [276] and leader sequences [277], all reporting delays or reduction in viral expression. More recently,Yu et al. [278] have constructed a hairpin ribozyme which is designed to cleave HIV-1 RNA in the 5’ leader sequence and appears to be effective in blocking virus expression from pre-existing proviral DNA.This ribozyme has the potential to be a unique intervention for the treatment of HIV infection in that it can target the replication cycle during both early (prior to provirus integration) and late (subsequent to provirus integration) phases of viral infection. This ribozyme has now been approved for clinical gene therapy trial for the treatment of AIDS and awaits fbrther assessment. The third treatment strategy using a gene therapy approach for the management of HIV infection is an immunological one aimed at enhancing antiviral immunity by using genetically modified cells that express viral gene products. This approach attempts to mimic natural infections, where infective particles are presented to class I MHC molecules which are subsequently used to generate a CTL response. Warner et al. [279] attempted to express an HIV protein in vivo for prophylactic vaccination and modulation of the immune response of infected individuals. They used an MMLV-based retroviral vector to deliver a gene encoding HIV-IIIB gp160 to murine fibroblast cell lines. Mice immunized with transduced cells developed MHC-restricted, envelope-specificCTLs and were capable of eliminating established tumour cells expressing HIV- 1 envelope protein [259]. Transduction of autologous cells have recently yielded similar results in mice and nonhuman primates [280].Retroviral gene transfer of HIV-1 gp160 has now

92 advanced to a phase I clinical trial, however, the utility of these vaccines still remains unclear. An alternative method for generating CTL responses involves the direct injection of naked DNA into the muscle of experimental animals. AIDS is currently the only infectious disease for which gene therapy clinical trials have been approved. Application of gene therapy to the HIV problem will present many challenges, however, with the increasing understanding of the mechanisms of viral infection and their associated properties, research in this area will continue to escalate. Intracellular immunization as well as gene-based immunization strategies are both potentially important approaches for the treatment of AIDS, and the therapeutic benefit of these approaches awaits imminent clinical trials. Novel advances - therapeutic oligonucleotides

It has long been recognized that short nucleic sequences can effect gene transcription and translation and induce RNA cleavage [281-2841. The ability of oligonucleotides to suppress gene expression makes them excellent candidates for the treatment of conditions involving gene overexpression such as cancer [285-2871 and infectious disorders like hepatitis B or AIDS [274,288,289]. They also have the potential for treating dominant-negative disorders in which a mutant allele is capable of saturating the normal allele, yielding a negative phenotype. There are two general classes of oligonucleotides used in gene therapy, antisense oligonucleotides and ribozymes. Antisense oligonucleotides are short nucleic acid sequences complementary to DNA or mRNA. DNA containing a homopurine/homopyrimidine stretch can form a triple helix with an oligonucleotide complementary to the purine-rich strand using Hoogsteen bonds [281]. This triplex may act either to physically inhibit transcription [290] or act as a site for specific mutagenesis [291,292]. Since only a few oligonucleotide molecules are needed to affect a gene by binding to DNA, regulation of gene expression at this level is quite sensitive. Alternatively, in the case of oligonucleotides binding to mRNA, many copies are necessary such that translation is sufficiently inhibited. This may result from an inability of the message to be transported out of the nucleus, steric hindrance of translation, direct blockage of a target sequence, or cleavage by RNase H [283,293,294]. Duplexes formed between mRNA and an oligonucleotide may also result in directed mutagenesis (gene editing) [295,296], which would allow for correction of base changes at the level of mRNA. Oligonucleotides may also act as ribozymes. Ribozymes are metalloenzymes which consist of short RNAs and have the ability to catalytically cleave specific sites of other RNA molecules. Although divalent cations, such as M 2 + and Mn2+, are required for this process, no protein moiety is involved [297,298]. The hammerhead ribozyme has been studied extensively with the intent to utilize it in gene therapy protocols. This small ribozyme is about 35 nucleotides long, with the central region (stem 11) being conserved, and forming a “handle” for

93 the “hammer”.The termini (stems I and 111) form a complementary sequence to the target site of about 15 nucleotides. This target sequence requires a UH (where H is A, C or U) at the cleavage site, but the rest of the sequence can be designed specific to one mRNA. Because of their high specificity, it is possible to design ribozymes which will specifically cleave a mutant allele, leaving the normal allele intact. This provides an effective approach for treatment of dominant-negative disorders. Once an mRNA is cleaved, no protein will be produced, and the ribozymes will continue to catalyze cleavage reactions of new mRNAs as they are transcribed. Delivery of oligonucleotides The optimal delivery method for oligonucleotides is still under investigation. However, oligonucleotides can either be directly delivered to cells, or can be transcribed from a cell transiently or permanently transfected with an expression vector. A problem facing the use of oligonucleotides for gene therapy is the rapid degradation of nucleic acids by serum and intracellular nucleases. Two approaches have been used to correct this problem. First, transfection vectors that will transcribe an RNA oligonucleotide ideally allow a continuous production of the foreign RNA, making degradation not a problem. However (as indicated in the section: Gene delivery methods), understanding the regulation of foreign genes in mammalian systems is limited, and hrther research is necessary before this becomes a common clinical procedure. Second, it is preferable to use oligonucleotides (DNA and RNA) that are synthesized using modified nucleotides. The most common modifications are at the linking phosphate molecule; a sulfur (phosphorothioate) or methyl group (methylphosphonate) can be substituted for one of the nonbridging oxygen molecules. This protects the modified oligonucleotides from degradation, since they are not efficient substrates for nucleases. For example, duplex DNA made with two phosphorothioate nucleotide bases can be transfected into cells and has a transcription efficiency of 95% compared to normal phosphodiester DNA, yet has a much longer half-life in the presence of nucleases. In fact, phosphorothioate-modified oligonucleotides appear unaffected after incubation in unpurified serum and cellular nucleases after six days of incubation [299]. This increased resistance is also true of singlestranded oligonucleotides modified with phosphorothioates, especially selfstabilized ones [300]. The efficiency of uptake of oligonucleotides into cells has been enhanced by the use of synthetic delivery systems such as liposome encapsulation [301], cationic lipids [302], coupling the oligonucleotide to polylysine or lipofectin [303] and covalent linkage to cholesterol moieties [304]. Although the choice of method for oligonucleotide delivery is still in its infancy, it is important to point out that the potential for antisense technology to generate efficient clinical therapeutic results is enormous. It will, however, take a great deal of experimentation before this technology can fulfill its promise.

94

Potential gene therapy applicationsfor oligonucleotides

Besides the utility of oligonucleotides in treating disorders due to gene overexpression, they can also be used to treat dominant-negative disorders such as osteogenesis imperfecta [305].Osteogenesis imperfecta is a collagen disorder, in which an aberrant collagen polypeptide is produced and incorporated into a collagen trimer, processed normally and incorporated into a defective extracellular matrix. Gene therapy for this disorder does not rely on adding a “good” allele, but rather on neutralizing a “bad” allele. The use of antisense oligonucleotides, delivered through lipid-mediated transfection, resulted in 45% of control levels of mutant protein in fibroblast cells [305].Although this is not sufficient for complete correction of this disorder, it represents a significant start towards the treatment of osteogenesis imperfecta. Work is also being done to decrease high blood pressure in rats using antisense oligonucleotides against angiotensinogen, a regulator of blood pressure [306]. There is still a substantial amount of work to be completed before oligonucleotides are widely used for gene therapy, but there is a great deal of potential, and the obstacles are rapidly being overcome. It is now recognized that the mechanism of oligonucleotide entry may be receptor-mediated, and the proteins involved in such a process are currently being identified and characterized. Both antisense oligonucleotides and ribozymes will undoubtedly play an important role in the fiture of gene therapy Future directions Human gene therapy, as shown in this review, has tremendous potential for the treatment of many debilitating diseases including classical monogenic disorders, complex multifactorial diseases and infectious diseases. The idea of using genes as medicines is not new and has been around since the development of the recombinant DNA era. Over the past 5 years the field of gene therapy has grown logarithmically with more than 100 clinical trials now approved by the Recombinant DNA Advisory Committee at NIH. With the increase in the number of clinical trials, this young field is the subject of a significant amount of attention and scrutiny as it has been put on the forefront of molecular medicine. Although gene therapy is capable of generating biological responses that are relevant for the treatment of many diseases, this approach suffers from public criticism, which often involves the ethical concerns regarding the manipulation of the expression of human genes. In general, somatic cell gene therapy for the purpose of treating many diseases has been considered acceptable to many people, however, gene modification of the germ line is still largely unacceptable on ethical grounds. Furthermore, the use of this technology for things such as the enhancement of beauty, the enhancement of muscle mass and increase of life span remains a matter of debate concerning issues such as ethics, safety and economics. Despite the fact that there are a large number of clinical trials in progress with

95

some documented success, gene therapy still remains experimental. Criticism has been levied against some researchers who have prematurely rushed into clinical application of the technology, thereby raising false hope among the population of affected individuals. This, in turn, can jeopardize the public financial support upon which this medical research depends. It is important during the development of a gene therapy protocol that before we use genes as effective medicines that we understand some basic science including genetic recombination, replication, repair, gene transfer, intracellular trafficking and immune responses to transfected gene products. Among those listed, we must also consider the problems that arise when predicting clinical outcome from gene transfer studies using experimental animals to the results obtained in humans trials. Let us not forget, however, that the hallmark of phase I clinical trials is safety and that the primary goal of these early clinical studies is to guide events in the more specific efficacy evaluations that occur in phase I1 and phase I11 studies. We believe that understanding the more fundamental areas of gene transfer will enable researchers and clinicians to develop better clinical studies that more accurately treat the disease state using the appropriate gene therapy method targeted to the appropriate tissue or cell type in a specific organism. Although a variety of methodologies for gene delivery are now in existence, the difficulty in getting genes transferred efficiently to specific target cell@),where they can evoke a biological response, still remains an important problem for all gene therapists. Viral-based vectors have been the most efficient method for introducing genes in vitro, but have been subject to safety concerns in the clinic such as stimulating the immune system to attack and neutralize the therapeutic cells or more problematic, the induction of an immune response to the vector itself. The fhndamental need to develop the “perfect” vector has been a challenge with numerous investigations into both viral and nonviral approaches. Preliminary data from clinical trials suggests that all vectors need to be refined, but each gene therapy approach in use will likely be well-suited for the target for which they were designed. An ideal vector, therefore, will likely be different for different applications. The vector of the hture could be based on synthetic custom-designed vehicles into which specific targeting features could be included depending on the particular disease and target cell requirements. Moreover, these new vectors must be easy to purify in large quantities, and ultimately must be able to evoke the desired biological response. Most importantlx these vectors must adhere strictly to health guidelines, and demonstrate safety for the patient being treated with manageable and well-defined side effects. Lipid-based carriers and dendrimers have recently become the focus of much research which is laying down the foundation for understanding the hndamental mechanisms of gene transfer. Although this is not an easy task, designing an effective gene transfer vehicle and understanding the mechanism($ of transfer is hndamental to the progress in disease management and treatment using a gene therapy strategy Despite the inevitable implementation of gene therapy for the treatment of many diseases, we need to pay close attention to how the public is educated in order

to avoid raising false hopes. Scientists, clinicians, and scientific journalists alike have an obligation to accurately inform the public in education forums on the present status and the potential fbture of this therapeutic strategy The scope and potential impact of this technology on the fbture of gene therapy also raises a number of additional questions such as: who will pay for the services, who executes the service, and what happens if something goes wrong? While some of these issues can be considered regulatory, other issues will have a profound financial impact. This will, in turn, play a fbndamental role in determining the optimal place for gene therapy in the treatment of human diseases in the next century Acknowledgements

This review benefited from discussions with researchers from the laboratories at the British Columbia Cancer Agency, Molecular Medical Genetics Program, London Health Sciences Center, and the University of Western Ontario. In particular, the authors wish to thank Gwyn Bebb, Rebecca Ott, Nick Schisler and Jack Jung for their constructive criticism in the preparation of this manuscript. Financial support for this review was provided by grants from NSERC and the Canadian Genome Analysis and Technology Program. Dorothy Reimer is the recipient of a Medical Research Council postdoctoral fellowship. References 1. Capecchi MR. High efficiency transformation by direct microinjection of DNA into cultured mammalian cells. Cell 1980;22:479-488. 2. Gordon JW, Scangos GA, Plotkin DJ, Barbosa JA, Ruddle FH. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad Sci 1980;77:7380-7384. 3. Brinster RL, Chen HY; Tmmbauer ME, Yagle MK, Palmiter RD. Factors affecting the eficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci 1985; 82~4438-4442. 4. Hansen E, Fernandes K, Goldspink G, Butterworth P, Umeda PK, Chang KC Strong expression of foreign genes following direct injection into fish muscle. FEBS Lett 1991;290:73-76. 5. Wolff JA, Williams P, Acsadi G, Jiao S, Jani A, Chong W. Conditions affecting direct gene transfer into rodent muscle in viva Biotechniques 1991;11:474-485. 6. Wolff JA, Malone RW, Williams P, Chong W, Ascadi G, Jani A, Felgner P.Direct gene transfer into mouse muscle in viva Science 1990;247:1465-1468.

7 . Davis HL, Demeneix BA, Quantin B, Coulombe Y, Whalen RG. Plasmid DNA is superior to viral vectors for direct gene transfer into adult mouse skeletal muscle. Hum Gene Ther 1993;4: 733-740.

8. Manthorpe M, Cornefert-Jensen F, Hartikka J, Felgner J, Rundell A, Margalith M, Dwarki V. Gene therapy by intramuscular injection of plasmid DNA: studies on firefly luciferase gene expression in mice. Hum GeneTher 1993;4:419-431. 9. Jiao S, Williams P, Berg RK, Hodgeman BA, Liu L, Repetto G, Wolff JA. Direct gene transfer into nonhuman primate myofibers in viva Hum GeneTher 1992;3:21-33. 10. Ascadi G, Dickson G, Love D, Jani A, Gurusinghe A, Walsh FS, Wolff JA, Davies KE. Human dystrophin expression in mdx mice after intramuscular injection of DNA constructs. Nature 1991;352:8 15-81 8. 11. Wolff JA, Dowty ME, Jiao S, Repetto G, Berg RK, Ludtke JJ, Williams P, Slatutterbak DB.

97

12. 13. 14. 15. 16. 17.

18. 19. 20. 21. 22. 23. 24. 25. 26.

27. 28. 29. 30. 31. 32. 33.

Expression of naked plasmids by cultured myotubes and entry of plasmids into T tubules and caveolae of mammalian skeletal muscle. J Cell Sci 1992;103:1249- 1259. Ulmer JB, Donnelly JJ, Parker SE, Rhodes GH, Felgner PL, Dwarki VJ, Gromkowski SH, Deck RR, DeWitt CM, Friedman A. Heterologous protection against influenza by injection of DNA encoding a Viral protein. Science 1993;259:1745-1749. Sikes M, O'Malley BW Jr, Finegold MJ, Ledley FD. In vivo gene transfer into rabbit thyroid follicular cells by direct DNA injection. Hum GeneTher 1994;5:837-844. Hickman MA, Malone RW, Lehmann K, SihTR, Knoell D, Szoka FC Jr, Walzem R, Carlson DM, Powell JS. Gene expression following direct injection of DNA into liver. Hum Gene Ther 1994;5:1477- 1483. Fraley R, PapahadjopoulosD. New generation liposomes:The engineeringof an efficient vehicle for intracellular delivery of nucleic acids. Trends Biochem Sci 1981;6:77-80. Straubinger RM, Papahadjopoulos D. Liposomes as carriers for intracellular delivery of nucleic acids. Meth Enzymol 1983;101:512-527. Felgner PL, GadekTR, Holm M, Roman R, Chan HW, Wenz M, Northrop JP, Ringold GM, Danielsen M. Lipofection: A highly efficient, lipid-mediated DNA-transfection procedure. Proc Natl Acad Sci 1987;84:7413-7417. Pinnaduwage R, Schmitt L, Huang L. Use of a quaternary ammonium detergent in liposome mediated DNA transfection of mouse L-cells. Biochim Biophys Acta 1989;985:33-37. Gao XA, Huang L. A novel cationic liposome reagent for efficient transfection of mammalian cells. Biochem Biophys Res Commun 1991;179280-285. Zhou XH, Klibanov AL, Huang L. Lipophilic polylysines mediate efficient DNA transfections in mammalian cells. Biochim Biophys Acta 1991;1065:8-14. Farhood H, Bottega R, Epand RM, Huang L. Effect of cationic cholesterol derivatives on gene transfer and protein kinase C activity. Biochim Biophys Acta 1992;1111:239-246. Barthel F, Remy JS, LoeEler JP, Behr JP. Gene transfer optimization with lipospermine-coated DNA. DNACell Biol 1993;12:553-560. Zhou X, Huang L. DNA transfection mediated by cationic liposomes containing lipopolylysine: Characterization and mechanism of action. Biochim Biophys Acta 1994;1189:195-203. Smith JG, Walzem RL, German JB. Liposomes as agents of DNA transfer. Biochim Biophys Acta 1993;1154:327-340. Gould-Fogerite S, Mazurkiewicz JE, Raska K, Voelkerding K, Lehman JM, Mannino RJ. Chimerasome-mediatedgene transfer in vitro and in vivo. Gene 1989;84429-438. Liu D, Huang L, Moore MA, Anantharamaiah GM, Segrest JP. Interactions of serum proteins with small unilamellar liposomes composed of dioleoylphosphatidylethanolamine and oleic acid: high density lipoprotein, apolipoprotein A 1 and amphipathic peptides stabilize liposomes. Biochemistry 1990;29:3637-3643. Cullis PR, Hope MJ, Tilcock CP. Lipid polymorphism and the roles of lipids in membranes. Chem Phys Lipid 1986;40:127-144. Rose JK, Buonocore L, Whitt MA. A new cationic liposome reagent mediating nearly quantitative transfection of animal cells. Biotechniques 1991;10:520-525. Stewart MJ, Plautz GE, Buono LD, Yang ZY, Xu L, Gao X, Huang L, Nabel EG, Nable GJ. Gene transfer in vivo with DNA-liposome complexes: Safety and acute toxicity in mice. Hum Gene Ther 1992;3:267-275. Wasan EK, Reimer DL, Bally MB. Plasmid DNA is protected against ultrasonic cavitationinduced damage when complexed to cationic liposomes. J Pharm Sci 1996;85:427-433. Felgner JH, Kumar R, Sridhar CN, Wheeler CJ, Tsai YJ, Border R, Ramsey P, Martin M, Felgner PL. Enhanced gene delivery and mechanism studies with a novel series of cationic lipid formulations. J Biol Chem 1994;269:2550-2561. Legendre JY, Szoka FC Jr. Delivery of plasmid DNA into mammalian cell lines using pHsensitive liposomes: comparison with cationic liposomes. Pharmacol Res 1992;9:1235- 1242. Debs R, Pian M, Gaensler K, Clements J, Friend DS, Dobbs L. Prolonged transgene expression

98 in rodent lung cells. Am J Respir Cell Molec Biol 1992;7:406-413. 34. Nicolau C, Cudd A. Liposomes as carriers of DNA. Crit Rev Ther Drug Carrier Sys 1989;6: 239-271. 35. Farhood H, Gao X,Son K,Yang YY, Lazo JS, Huang L, Barsoum J, Bottega R, Epand RM. Cationic liposomes for direct gene transfer in therapy of cancer and other diseases. Ann NY Acad Sci 1994;716:23-34. 36. Reimer DL, ZhangY, Kong S, Wheeler JJ, Graham RW, Bally MB. Formation of a hydrophobic complexes between cationic lipids and plasmids. Biochemistry 1995;34:12877- 12883. 37. Wong FMP, Reimer DL, Bally MB. Cationic lipid binding to DNA: characterization of complex formation. Biochemistry 1996;35:5756-5763. 38. Zhang Y-P, Reimer DL, Zhang G, Lee PH, Bally MB. Self-assembling DNA-lipid particles for gene transfer. J Pharm Sci 1996;1 4190- 196. 39. Haensler J, Szoka FC Jr. Polyamidoamine cascade polymers mediate efficient transfection of cells in culture. Bioconjug Chem 1993;4372-379. 40. Tomalia DA. Dendrimer molecules. Sci Am 1995;272:62-66. 41. Wu GX Wu CH. Receptor-mediated gene delivery and expression in vivo. J Biol Chem 1988;263: 14261-14264. 42. Zenke M, Steinlein P, Wagner E, Cotten M, Beug H, Birnstiel ML. Receptor-mediated endocytosis of transferrin-polycation conjugates: an efficient way to introduce DNA into hematopoetic cells. Proc Natl Acad Sci 1990;87:3655-3659. 43. Wagner E, Cotten M, Foisner R, Bernsteil ML. Transferrin-polycation-DNA complexes: the effect of polycations on the structure of the complex and DNA delivery to cells. Proc Natl Acad Sci 1991;88:4255-4259. 44. Wu GY, Wilson JM, Wu CH. Targeting genes: delivery and persistent expression of a foreign gene driven by mammalian regulatory elements in viva J Biol Chem 1989;264:16985--16987. 45. Chowdhury NR, Wu CH, Wu GY, Yerneni PC, Bommineni VR, Chowdhury JR.Fate of DNA targeted to the liver by asialoglycoprotein receptor-mediated endocytosis in vivo. Prolonged persistence in cytoplasmid vesicles after partial hepatectomy J Biol Chem 1993;268:1126511271. 46. Perales JC, Ferkol T, Beegen H, Ratnoff OD, Hanson RW. Gene transfer in vivo: Sustained expression and regulation of genes introduced into the liver by receptor-targeted uptake. Proc Natl Acad Sci 1994;91:4086-4090. 47. Michael SI, Curiel DT. Strategies to achieve targeted gene delivery via the receptor-mediated endocytosis pathway Gene Ther 1994;1:223-232. 48. Huebers HA, Finch CA.The physiology of transferrin and transferrin receptors. Physiol Rev 1987;67:520-582. 49. Wagner E, Zenke M, Cotten M, Beug H, Birnsteil ML. 'Ifansferrin-polycation-conjugatesas carriers for DNA uptake into cells. Proc Natl Acad Sci 1990;87:3410-3414. 50. Harris CE, Agarwal S,Hu P, Wagner E, Curiel DT. Receptor-mediated gene transfer to airway epithelial cells in primary culture. Am J Respir Cell Molec Biol 1993;9:441-447. 51. Baatz JE, Bruno MD, Ciraolo PJ, Glasser SW, Stripp BR, Smyth KL,KorfhagenTR. Utilization of modified surfactant-associatedprotein B for delivery of DNA to airway cells in culture. Proc Natl Acad Sci 1994;91:2547-2551. 52. Trubetskoy VS, Torchilin VP, Kennel SJ, Huang L. Use of N-terminal modified poly(r.-1ysine)antibody conjugates as a carrier for targeted gene delivery in mouse lung endothelial cells. Bioconjug Chem 1992;3:323-327. 53. Rosenkrantz AA,Yachmenev W, Jans DA, Serebryakova NV, Marav'ev VI, Peters R, Sobolev AS. Receptor-mediated endocytosis and nuclear transport of a transfecting DNA construct. Exp Cell Res 1992;199:323-329. 54. Chen J, Gamou S,lkkayanagi A, Shimizu N. A novel gene delivery system using EGF receptormediated endocytosis. FEBS Lett 1994;338:167-169. 55. Barra RK, Wang-Johanning F, Wagner E, Garver RI, Curiel DT Receptor-mediated gene

99 delivery employing lectin-binding specificity Gene Ther 1994;1:255-260. 56. Seth F? Adenovirus dependent release of choline from plasma membrane vesicles at an acidic pH is mediated by the penton base protein. J Virol 1994;68:1204-1206. 57. Garoff H, Wilschut J, Liljestrom P, Wahyberg JM, Bron R, Suomalainen M, Smyth J, Salminen A, Barth BU, Zhao H. Assembly and entry mechanism of Simliki Forest Virus. Arch Virol 1994;9(S~ppl):329-338. 58. Cristiano RJ, Smith LC, Woo SL. Hepatic gene therapy: adenovirus enhancement of receptormediated gene delivery and expression in primary hepatocytes. Proc Natl Acad Sci 1993;90: 2122-2126. 59. Gottschalk S, Cristiano RJ, Smith LC, Woo SLC Folate receptor-mediated DNA delivery into tumor cells: protosomal disruption results in enhanced gene expression. Gene Ther 1993;l: 185-191. 60. Wagner E, Zatloukal K, Cotten M, Kirlappos H, Mechtler K, Curie1 DT, Birnsteil ML. Coupling of adenovirus to transferrin-polylysine-DNA complexes greatly enhances receptormediated gene delivery and expression of transfected genes. Proc Natl Acad Sci 1992;89: 6099-6103. 61. Cristiano RJ, Smith LC, Kay MA, Brinkley BR, Woo SL. Hepatic gene therapy: efficient gene deliver and expression in primary hepatocytes utilizing a conjugated adenovirus-DNA complex. Proc Natl Acad Sci 1993;90:11548-11552. 62. Wagner E, Plank C, Zatloukal K, Cotten M, Birnsteil ML. Influenzavirus hemagglutinin HA-2 N-terminal hsogenic peptides augment gene transfer by transferrin-polylysine-DNA complexes: Toward a synthetic virus-like gene-transfer vehicle. Proc Natl Acad Sci 199289:79347938. 63. Furth PA, Shamay A,Wall RJ, Hennighausen L. Gene transfer into somatic tissues by jet injection. Anal Biochem 1992;20:365-368. 64. Davis HL, Michel ML, Mancini M, Schleef M,Whalen RG. Direct gene transfer in skeletal muscle: plasmid DNA-based immunization against the hepatitis B virus surface antigen. Vaccine 1994;12:1503- 1509. 65. Vahsing HL,Yankauckas MA, Sawdey M, Gromkowsky SH, Manthorpe M.Immunization with plasmid DNA using a pneumatic gun. J Immunol Meth 1994;175: 11-22. 66. Yang NS, Burkholder J, Roberts B, Martinell B, McCabe D. In vivo and in vitro gene transfer to mammalian somatic cells by particle bombardment. Proc Natl Acad Sci 1990;87:9568-9572. 67. Cheng L, Ziegelhoffer PR,Yang NS. In vivo promoter activity and transgene expression in mammalian somatic tissues evaluated by using particle bombardment. Proc Natl Acad Sci 1993;90:4455-4459. 68. ThompsonTA, Gould MN, Burkholder JK,Yang NS. Transient promoter activity in primary rat mammary epithelial cells evaluated using particle bombardment gene transfer. In Vitro Cell Dev Biol 1993;29A165-170. 69. Burkholder JK, Decker J, Yang NS. Rapid transgene expression in lymphocyte and macrophage primary cultures after particle bombardment-mediated gene transfer. J Immunol Meth 1993; 165:149-1 56. 70. Williams RS, Johnston SA,Reidy M, Devit MJ, Mclligot SG, Sanford JC. Introduction of foreign genes into tissues of living mice by DNA-coated microprojectiles. Proc Natl Acad Sci 1991;88:2726-2730. 71. Redly EB, Antognetti G, Weslowski JS Jr, Sakorafas F? The use of microcapsules for high density growth of human tumour infiltrating lymphocytes and other immune reactive T cells J Immuno1 Meth 1990;126:273-279. 72. Chang PL, Shen N, Westcott AJ. Delivery of recombinant gene products with microencapsulated cells in vivo. Hum GeneTher 1993;4:433-40. 73. Liu Hw,Ofosu FA, Chang PL. Expression of human factor IX by microencapsulatedrecombinant fibroblasts. Hum GeneTher 1993;4291-301. 74. Hughes M,Vassilakos A, Andrews DW, Hortelamo G, Belmont JW, Chang PL. Delivery of a

100 secretable adenosine deaminase through microcapsules - a novel approach to somatic gene therapy Hum GeneTher 1994;5:1445-1455. 75. al-Hendy A, Hortelano G, Tannenbaum GS, Chang PL. Correction of growth defect in dwarf mice with nonautologous microencapsulated myoblasts - an alternate approach to somatic gene therapy Hum GeneTher 1995;6:165-175. 76. Choppin PW, Scheid A. The role of viral glycoproteins in adsorption, penetration, and pathogenicity of viruses. Rev Infect Dis 1980;240-61. 77. Kielian M, Jungerwirth S. Mechanisms of enveloped virus entry into cells. Molec Biol Med 1990;7:17-31. 78. Miller N, Vile R. Targeted vectors for gene therapy FASEB J 1995;9:190-199. 79. Baichwal VR, Sugden B. Vectors for gene transfer derived from animal DNA viruses: Transient and stable expression of transferred genes. In: Kucherlapati R (ed) Gene Transfer. New York: Plenum Press, 1986;117. 80. Crystal R. Transfer of genes to human: Early lessons and obstacles to success. Science 1995;270: 404-410. 81. Miller AD. Retroviral vectors. Curr Top Micro Immunol 1992;158:1-24. 82. Bandyopadhyay PK, Temin HM. Expression of complete chicken thymidine kinase gene inserted in a retrovirus vector. Molec Cell Biol 1984;4:749-754. 83. Mann R, Baltimore D. Varying the position of a retrovirus packaging sequence results in the encapsidation of both unspliced and spliced RNAs. J Virol1985;54401-407. 84. Page KA, Landau NR, Littman DR. Construction and use of a human immunodeficiency virus vector for analysis of virus infectivity J Virol 1990;64:5270-5276. 85. Shimada T, Fuji H, Mitsuya H, Nienhuis AW Targeted and highly efficient gene transfer into CD4+ cells by a recombinant human immunodeficiency virus retroviral vector. J Clin Invest 1991;88:1043-1047. 86. Buchschacher GL Jr, Panganiban AT. Human immunodeficiency virus vectors for inducible expression of foreign genes. J Virol 1992;66:2731-2739. 87. Anderson WE Human gene therapy Science 1992;256:808-813. 88. Miller AD. Human gene therapy comes of age. Nature 1992;357:455-460. 90. Miller AD, Rosman GJ. Improved retroviral vectors for gene transfer and expression. Biotechniques 1989;7:980-990. 91. McLauchlin JR, Cornetta K, Eglitis MA, Anderson WE Retroviral-mediated gene transfer. Prog Nucl Acid Res 1990;38:91-135. 92. Mulligan RC. The basic science of gene therapy Science 1993;260:926-932. 93. Temin HM. Safety considerations in somatic gene therapy of human diseases with retroviral vectors. Hum Gene Ther 1990;1:1 1 1-123. 94. Miller DG, Adam MA, Miller AD. Gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection. Molec Cell Biol 1990;10:4239-4242. 95. Horwitz MS. Adenoviruses. In: Fields BN, Knipe DM (eds) FieldsVirology, 2nd edn. NewYork: Raven Press, 1990;1723-1740. 96. Berkner KL. Development of adenovirus vectors for the expression of heterologous genes. Biotechniques 1988;6:616-629. 97.Kozarsky KF, Wilson JM. Gene therapy: adenovirus vectors. Curr Opin Genet Devel 1993;3:499-503. 98. Ginsberg HS, Moldawar LL, Sehgal PB, Redington M, Kilian PL, Chanock RM, Prince GP. A mouse model for investigating the molecular pathogenesis of adenovirus pneumonia. Proc Natl Acad Sci 1991;88:1651-1655. 99. Wickham TJ, Mathias P, Cheresh DA, Nemerow GR. Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment. Cell 1993;73:309-3 19. 100. Berkner KL. Expression of heterologous sequences in adenoviral vectors. Curr Top Microbiol Immunol 1992;158:39-66. 101. Rosenfeld MA, Yoshimura K, Trapnell BC, Yoneyama K, Rosenthal ER, Dalemans W, Fukaya-

101 ma M, Bargon J, Stier LE, Stratford-Perricaudet L. I n vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airway epithelium. Cell 1992;68:143- 155. 102.Yoshimura K, Rosenfeld MA, Nakamura H, Scherer EM, Pavirani A, Lecocq J-P, Crystal RG. Expression of the human cystic transmembrane conductance regulator gene in the mouse lung after in vivo intratracheal plasmid-mediated gene transfer. Nucl Acid Res 1992;20:3233-3240. 103. Welsh MJ. RAC Report 9212-036, 1995. 104. Rosenfeld MA, Siegfried W, Yoshimura K, Yoneyama K, Fukayama M, Stier LE, Paakko PK, Gilardi P, Stratford-Perricaudet L, Perricaudet M. Adenovirus-mediatedtransfer of a recombinant a-1 antitrypsin gene to the lung epithelium in vivo. Science 1991;252:431-434. 105. Yang Y, Nunes FA, Berencsi K, Furth EE, Gonczol E, Wilson JM. Cellular immunity to viral antigens limits E l deleted adenoviruses for gene therapy Proc Natl Acad Sci 1994;91:44074411. 106.Yang Y, Li Q, Erte HCJ, Wilson JM. Cellular and humoral responses to viral antigens create barriers to lung-directed gene therapy with recombinant adenoviruses. J Virol 1995;69:2OO42015. 107. Samulski RJ, Zhu X, Xiao X, Brook JD, Housman DE, Epstein N, Hunter LA. Targeted integration of adeno-associated virus (AAV) into human chromosome 19. EMBO J 1991;10:39413950. 108. Flotte TR, Afione SA, Conrad C, McGrath SA, Solow R, Oka H, Zeitlin PL, Guggino WB, Carter BJ. Stable in vivo expression of the cystic fibrosis transmembrane conductance regulator with an adeno-associated virus vector. Proc Natl Acad Sci 1993;90:10613--10617. 109.Carter BJ. The growth cycle of adenoassociated virus. In: Tjissen P (ed) Handbook of Pawoviruses, vol 1. Boca Raton, Florida: CRC Press, 1990;155-168. 110. Samulski RJ. Adeno-associated virus: integration at a specific chromosomal locus. Curr Opin Genet Devel 1993;3:74-80. 111. Kearns W, Afione S, Cutting G. AAV-CFTR vectors integrate at multiple chromosomal sites in a CF bronchial epithelial cell line. Pediatr hlmonol 1993;9S:242. 112. Freese A, Geller AI, Neve R. HSV- 1 vector mediated neuronal gene delivery Strategies for molecular neuroscience and neurology Biochem Pharmacol 1990;40:2189-2199. 113. Fink DJ, Sternberg LR, Weber PC, Mata M, Goins WF, Glorioso JC. In vivo expression of betagalactosidase in hippocampal neurons by HSV-mediated gene transfer. Hum Gene "her 1992; 3~11-19. 114. Margolskee RF. Epstein-Barr virus based expression vectors. Curr Top Microbiol Immunol 1992;158:67-95. 115. Suhr ST,Gage FH. Gene therapy for neurologic disease. Neurol Rev 1993;50:1252-1268. 116. Breakefield XO, DeLuca NA. Herpes simplex virus for gene delivery to neurons. New Biol 1991;3:203-218. 117.Roizman B, Sears AE. Herpes viruses and their replication. In: Fields BN, Knipe DM (eds) Virology, 2nd edn. New York: Raven Press, 1990;1795- 1842. 118. Barker DE, Roizman B. Identification of three genes nonessential for growth in cell culture near the right terminus of the unique sequences of long component of herpes simplex virus I. J Virol 1990;177:684-691. 119.Longnecker R, Roizman B, Meignier B. Herpes simplex viruses as vectors: Properties of a prototype vaccine strain suitable for use as a vector. In: Gluzman Y, Hughes SH (eds) Viral Vectors. Cold Spring Harbor: Cold Spring Harbor Lab. Press, 1988;68. 120. Tiberghien P. Use of suicide genes in gene therapy J Leuk Biol1994;56:203-209. 121. Oldfield EH, Ram Z, Culver KW, Blaese RM, DeVroom HL. Gene therapy for the treatment of brain tumors using intra-tumoral transduction with the thymidine kinase gene and intravenous ganciclovir. Hum GeneTher 1993;4:39-69. 122. Freeman SM, McCune C, Angel C, Abraham GN, Abboud CN. Treatment of ovarian cancer using HSV-TK gene modified vaccine - regulatory issues. Hum Gene Ther 1992;3:342-349. 123.Dobson AT, Margolis Tp,Sedarati F, Stevens JG, Feldman LT. A latent nonpathogenic HSV-1-

102 derived vector stably expresses f3-galactosidase in mouse neurons. Neuron 1990;5:353-360. 124. Wolfe JH, Deshmane SL, Fraser NW Herpesvirus vector gene transfer and expression of Bglucouronidase in the CNS of MPS VII mice. Nature Genet 1992;1:379-384. 125. Orkin SH, Motulsky AG. Report and recommendations of the panel to assess the NIH investment in research on gene therapy 1995;http:/ /wwwnih.gov/news/panelrep.html. 126. Giblett ER, Anderson JE, Cohen F, Pollara B, Meuwissen HJ. Adenosine deaminase deficiency in two patients with severely impaired cellular immunity. Lancet 1972;2:1067- 1069. 127. Thompson LF, Seegmiller JE. Adenosine deaminase deficiency and severe combined immunodeficiency disease. In: Meister A (ed) Advances in Enzymology, vol 51. New York: Academic Press, l980;156-210. 128. Cohen A, Hirschhorn R, Horowitz SD, Rubinstein A, Polmar SH, Hong R, Martin DW Jr. Deoxyadenosine triphosphate as a potentially toxic metabolite in adenosine deaminase deficiency Proc Natl Acad Sci 1978;75:472-476. 129. Hirschhorn R, Martiniuk F, Roegner-Maniscalco V, Ellenbogen A, Perignon JL, Jenkins T. Genetic heterogeneity in partial adenosine deaminase deficiency J Clin Invest 1983;71:18871892. 130. Akeson AL, Wiginton DA, Hutton JJ. Normal and mutant adenosine deaminase genes. J Cell Biochem 1989;39:217-228. 131. Santisteban I, Arredonto-Vega FX, Kelly S, Mary A, Fischer A, Hummell DS, Lawton A, Sorenson RU, Steihm ER, Uribe L. Novel splicing, missence and deletion mutations in seven adenosine deaminase deficient patients with late/delayed onset combined immunodeficiency disease. J Clin Invest 1993;922291-2302. 132. Reisner Y, Kapoor N, Kirkpatrick D, Pollack MS, Cunningham-Rundles S, Dupont B, Hoder MZ, Good R4,O'Reilly RJ. Transplantation for severe combined immunodeficiency with HLA-A, B, D, DR incompatible parental marrow cells fractionated by soybean agglutinin and sheep red blood cells. Blood 1983;61:341-348. 133. OReilly RJ, Keever CA, Small TN,Brochstein J. The use of HLA non-identical T-cell-depleted marrow transplants for correction of severe combined immunodeficiency disease. Immunodef Rev 1989;1:273-309. 134. Hershfield MS, Buckley RH, Greenberg ML, Melton AL, Schiff R, Hatem C, Kurtzberg J, Markert ML, Kobayashi RH, Kobayashi AL. Treatment of adenosine deaminase deficiency with polyethylene glycol-modified adenosine deaminase. N Engl J Med 1987;316:589-596. 135. Levy Y, Hershfield M, Fernandez-Mejia C, Polmar S, Scudiery D, Berger M, Sorensen RU. Adenosine deaminase deficiency with late onset of recurrent infections: Response to treatment with polyethylene glycol-modified adenosine deaminase. J Pediatr 1988;113:312-3 17. 136. Blaese MR, Culver KW, Miller DA, Carter CS, Fleisher T, Clerici M,Shearer G, Chang L, Chiang Y, Tolstoshev P, Greenblatt JJ, Rosenberg SA, Klein H, Berger M, Mullen CA, Ramsey WJ, Muul L, Morgan RA, Anderson WE T lymphocyte-directed gene therapy for ADASCID: Initial trial results after 4 years. Science 1995;270:475-480. 137. Hershfield MS. The role of polyethylene glycol adenosine deaminase in the evolution of therapy for adenosine deaminase deficiency In: Gupta S, Griscelli C (eds) New Concepts in Immunodeficiency Diseases. Chichester: Wiley, 1993;417-426. 138. Bordignon C, Notarangelo LD, Nobili N, Ferrari G, Casorati G, Panina P, Mazzolari E, Maggioni D, Rossi C, Servida P, Ugazio AG, Mavilio F. Gene therapy in peripheral blood lymphocytes and bone marrow for ADA- immunodeficient patients. Science 1995;270:470474. 139.Kohn DB, Anderson WF, Blease RM. Gene therapy for genetic diseases. Cancer Invest 1989;7:179-192. 140. Kohn DB, Mitsuya A, Ballow M, Selegue JE, Barankiewicz J, Cohen A, Gelfand E, Anderson WF, Blaese RM. Establishment and characterization of adenosine deaminase deficient human T cells. J Immunol 1989;142:3971-3979. 141. Kaptein LCM, Einerhand MPW, Braakman E,Valerio D, von BeusechemVW Bone marrow

103 gene therapy for adenosine deaminase deficiency. Immunodeficiency 1993;4:335-345. 142. Moritz T, Keller DC, Williams DA. Human cord blood cells as targets for gene transfer: Potential use in genetic therapies of severe combined immunodeficiency disease. J Exp Med 1993;178:529-536. 143. Boat TF, Welsh MJ, Beaudet AL. Cystic fibrosis. In: Scriver CR, Beaudet AL, Sly WS,Valle D (eds) The Metabolic Basis of Inherited Disease. New York: McGraw Hill, 1989;2649-2680. 144. Rommens JM, Iannuzzi MC, Kerem B, Drumm ML, Melmer G, Dean M, Rozmahel R, Cole JL, Kennedy D, Hidaka N. Identification of cystic fibrosis gene: chromosome walking and jumping. Science 1989;245:1059-1065. 145. Riordan JR. The cystic fibrosis transmembrane conductance regulator. Ann Rev Physiol 1993; 55:609-630. 146. Welsh MJ, Smith AE. Molecular mechanisms of CFTR chloride channel dyshnction in cystic fibrosis. Cell 1993;73:1251-1254. 147. Colledge WH, Evans MJ. Cystic fibrosis gene therapy. Br Med Bull 1995;51:82-90. 148. Riordan JR, Rommens JM, Kerem B, Alon N, Rozmahel R, Gnelczak Z, Zielenski J, Lok S, Plavsic N, Chou J-L, Drumm ML, Iannuzzi MC, Collins FS, Tsui L-C. Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science 1989;245: 1066- 1073. 149. Gregory RJ, Cheng SH, Rich DP, Marshall J, Paul S, Hehir K, Ostedgaard L, Klinger KW, Welsh MJ, Smith AE. Expression and characterization of the cystic fibrosis transmembrane conductance regulator. Nature 1990;347:382-386. 150. Cheng SH, Gregory RJ, Marshall J, Paul S, Souza DW, White GA, O'Riordan CR, Smith AE. Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis. Cell 1990;63:827-834. 151. Dean M, Santis G. Heterogeneity in the severity of cystic fibrosis and the role of CFTR gene mutations. Hum Genet 1994;93:364-368. 152. Tizzano EF, Buchwald M.CFTR expression and organ damage in cystic fibrosis. Ann Int Med 1995;123:305-308. 153. Rich DP, Anderson MP, Gregory RJ, Cheng SH, Paul S,Jefferson DM, Smith AE, McCann JD, Klinger KW, Smith AE, Welsh MJ. Expression of the cystic fibrosis transmembrane conductance regulator corrects defective chloride channel regulation in cystic fibrosis airway epithelial cells. Nature 1990;347:358-363. 154. Olsen JC, Johnson LG, Stutts MJ, Sarkadi B, Vankaskas JR, Swanstrum R, Boucher RC. Correction of the apical membrane chloride permeability defect in polarized cystic fibrosis airway epithelia following retroviral-mediatedgene transfer. Hum Gene Ther 1992;3:253-266. 155. Weibel ER. Design of airways and blood vessels considered as b k c h i n g trees. In: Crystal RG, West JB (eds) The Lung Scientific Foundations. The Lung Scientific Foundation. New York: Raven Press, 1991;711-720. 156. Mastrangeli A, Dane1 C, Rosenfeld MA, Stratford-Perricaudet L, Perricaudet M, Paviriani A, Lecocq JP, Crystal RG. Diversity of airway epithelial cell targets for in vivo recombinant adenovirus-mediated gene transfer. J Clin Invest 1993;91:225-234. 157. McLachlin G, Davidson DJ, Stevenson BJ, Dickinson P, Davidson-Smith H, Dorin JR, Porteous DJ. Evaluation in vifro and in vivo of cationic liposome-expression construct complexes for cystic fibrosis gene therapy. Gene Ther 1995;2:614-622. 158.Curiel DT, Agarwal S, Romer MU, Wagner E, Cotten M, Birnstiel ML, Boucher RC. Gene transfer to respiratory epithelial cells via the receptor-mediated endocytosis pathway. Am J Resp Cell Molec Biol 1992;6:247-252. 159. Rich DP, Couture LA, Cardoza LM, Guiggio VM, Amentano D, Espino PC,Hehir K, Welsh MJ, Smith AE, Gregory RJ. Development and analysis of recombinant adenoviruses for gene therapy of cystic fibrosis. Hum Gene Ther 1993;4461-476. 160. FlotteTR, Solow R, Owens RA, Afione S,Zeitlin PL, Carter BJ. Gene expression from adenoassociated virus vectors in airway epithelial cells. Am J Respir Cell Molec Biol 1992;7:349-356.

104 161. Zabner J, Couture LA, Gregory RJ, Graham SM, Smith AE,Welsh MJ. Adenovirus-mediated gene transfer transiently corrects the chloride transport defect in nasal epithelia of patients with cystic fibrosis. Cell 1993;75:207-216. 162. Brigham KL, Meyrick B, Christman B, Magnuson M, King G, Berry LC Jr. In vivo transfection of murine lung with a hnctioning prokaryotic gene using a liposome vehicle. Am J Med Sci 1989;298:278-281. 163. Stribling R, Brunette E, Liggitt D, Gaensler K, Debs R. Aerosol gene delivery in vivo. Proc Natl Acad Sci 1992;89:11277-11281. 164. Alton EW, Middleton PG, Caplen NJ, Smith SN, Steel DM, Munkonge FM, Jeffrey PK, Geddes DM, Hart SL, Williamson R. Non-invasive liposome mediated gene delivery can correct the ion transport defect in the cystic fibrosis mutant mice. Nature Genet 1993;5:135-142. 165. Hyde SC, Gill DR, Higgins CETrezise AE, MacVinish LJ, Cuthbert AW, Ratcliff R, Evans MJ, Colledge WH. Correction of the ion transport defect in cystic fibrosis transgenic mice by gene therapy Nature 1993;362:250-255. 166. Caplen NJ, Alton EW, Middleton PG, Dorin JR, Stevenson BJ, Gao X,Durham SR, Jeffrey PK, Hodson ME, Coutelle C. Liposome-mediated CFTR gene transfer to the nasal epithelium of patients with cystic fibrosis. Nature Med 1995;1:39-46. 167. Middleton PG, Caplen NJ, Gao X, Huang L, Dorin JR, Porteous DJ, Williamson R, Geddes DM, Alton EWW. The electrophysiological effects of in vivo liposome mediated CFTR delivery to the nasal epithelium. Pediatr Pulmonol 1994;(Suppl10):229-230. 168. Farhood H, Gao X,Son K,Yang W, Lazo JS, Huang L, Barsoum J, Bottega R,Epand RM. Cationic liposomes for direct gene transfer in therapy of cancer and other diseases. Ann NY Acad Sci 1994;716:23-35. 169. Meyer KB, Thompson MM, Levy MY, Barron LG, Szoka FC Jr. Intratracheal gene delivery to the mouse airway: characterization of plasmid DNA expression and pharmacokinetics. Gene Ther 1995;2:450-460. 170. Frenkel EP. Gaucher disease; a heterogeneous clinical complex for which effective enzyme replacement has come of age. Am J Med Sci 1993;305:331-344. 171. Brady RO, Barton NW, Grabowski GA. The role of neurogenetics in Gaucher disease. Arch N e w 1 1993;50:1212- 1224. 172. Barton NW, Furbish FS, Murray GJ, Garfield M, Brady RO. Therapeutic response to intravenous infusions of glucocerebrosidasein a patient with Gaucher disease. Proc Natl Acad Sci 1990;87:1913-1916. 173. Beutler E, Kay A, Saven A, Garver P, Thurston D, Dawson A, Rosenbloom B. Enzyme replacement therapy for Gaucher disease. Blood 1991;78:1183-1189. 174. Xu L, Stahl SK, Dave HP, Schiffmann R, Correll PH, Kessler S, Karlsson S.Correction of the enzyme deficiency in hematopoetic cells of Gaucher patients using a clinically acceptable retroviral supernatant transduction protocol. Exp Hematol 1994;22:223-230. 175. Kerr WG, Mule JJ. Gene therapy: current status and hture prospects. J Leuk Biol 1994;56: 211-214. 176. Emery AEH. Duchenne Muscular Dystrophy, 2nd edn. New York: University Press, 1988;l317. 177. Griggs CR, Moxley RT, Mendell JR, Fenichel GM, Brooke MH, Rstronk A. Prednisone in Duchenne dystrophy A randomized controlled trial defining the time course and dose response. Arch Neurol 1991;48:383-388. 178. Koenig M, Hoffman EP, Bertelson CJ, Monaco AP, Feener C, Kunkel LM. Complete cloning of the DMD cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell 1987;50:509-517. 179. Ahn AH, Kunkel LM. The structural and functional diversity of dystrophin. Nature Genet 1993; 3:283-291. 180. Oldfors A, Eriksson BO, Kyllerman M, Martinsson R, Wahlstrom J. Dilated cardiomyopathy and the dystrophin gene. Br Heart J 1994;72:344-348.

105 181. Quantin B, Perricaudet LD, Tajbakakhsh S, Mandel JL. Adenovirus as an expression vector in muscle cells in vivo. Proc Natl Acad Sci 1990;87:439-443. 182. Ragot T, Vincent N, Chafey V, Vigne E, Gildenkrantz H, Couton D, Cartaud J, Briand P, Kaplan J-C, Perricaudet M, Kahn A. Efficient adenovirus-mediated transfer of human minidystrophin gene to skeletal muscle of mdx mice. Nature 1993;361:647-650. 183. Karpati G, Acsadi G. The principles of gene therapy in Duchenne Muscular Dystrophy. Clin Invest Med 1994;17:499-509. 184. Scriver CR, Kaufman S,Woo SLC. The hyperphenylalaninemias. In: Scriver CR, Beaudet AL, Sly WS, Valle D (eds) The Metabolic Basis of Inherited Disease, vol 1, 6th edn. New York: McGraw Hill, 1989;495-534. 185. Smith I, Lobascher ME, Stevenson JR,Woolf OH, Schmidt H, Grubel-Kaiser S,Bickel H. Effect of stopping low-phenylalaninediet on intellectual progress of children with phenylketonuria. Br Med J 1978;2:723-726. 186. Ledley FD, Grenett HE, DiLella AG, Kwok SCM, Woo SLC. Gene transfer and expression of human phenylalanine hydroxylase. Science 1985;228:77-79. 187. Peng H, Armentano D, Mackenzie-Graham L, Shen R-F, Darlington G, Ledley FD, Woo SL. Retroviral-mediated gene transfer and expression of human phenylalanine hydroxylase in primary mouse hepatocytes. Proc Natl Acad Sci 1988;85:8146-8150. 188. LiuT-J, Kay MA, Darlington GJ, Woo SLC. Reconstitution ofenzymatic activity in hepatocytes of phenylalanine hydroxylase-deficientmice. Somat Cell Molec Genet 1992;18239-96. 189. Fang B, Eisensmith RC, Li XHC, Finegold MJ, Shedlovsky A, Dove W, Woo SLC. Gene therapy for phenylketonuria: phenotypic correction in a genetically deficient mouse model by adenovirus-mediated hepatic gene transfer. Gene Ther 1994;1:247-254. 190. Brown MS,Goldstein JL. A receptor-mediated pathway for cholesterol homeostasis. Science 1986;232:34-37. 191. Goldstein JL, Brown MS. Familial hypercholesterolemia. Lipoprotein and lipid metabolism disorders. In: Scriver CR, Beaudet At, Sly WS,Valle D (eds) Metabolic Basis of Inherited Disease, 6th edn. New York: McGraw Hill, 1989;1215-1250. 192.Bilheimer DW, Goldstein JL, Grundy SM, Starzl TE. Liver transplantation to provide low density lipoprotein receptors and lower plasma cholesterol in a child with homozygous familial hypercholesterolemia.N Engl J Med 1984;311:1658- 1664. 193.Thompson GR, Barbir M, Okabayshi K, Trayner I, Larkin S. Plasmapharesis in familial hypercholesterolemia.Arteriosclerosis 1989;9(Suppl):I152-1157. 194. Gordon BR, Kelsey SF, Bilheimer DW, Brown DC, Dau PC, Gotto AM Jr, Illingworth DR, Jones PH, Leitman SF, Prihoda JS. Treatment of refractory familial hypercholesterolemia by low-density lipoprotein apheresis using an automated dextran sulfate cellulose absorption system. Am J Cardiol 1992;70:1010-1016. 195. Weatherall D. Heroic gene therapy. Nature Genet 1994;6:325-326. 196. Grossman M, Raper SE, Kozarsky K, Stein EA, Engelhardt JF, Muller D, Lupien PJ, Wilson JM. Successful ex vivo gene therapy directed to liver in a patient with familial hypercholesterolemia. Nature Genet 1994;6:335-341. 197. Chowdhury JR, Grossman M, Gupta S, Chowdhury NR, Baker JR, Wilson JM. Long term improvement of hypercholesterolemia after ex vivo therapy in LDLR-deficient rabbits. Science 1991;254:1802- 1805. 198. Grossman M, Rader DJ, Muller DWM, Kolansky DM, Kozarsky K, Clark BJ 111, Stein EA, Lupien PJ, Brewer HB, Raper SE,Wilson JM. A pilot study of ex vivo gene therapy for homozygous familial hypercholesterolemia. Nature Med 1995;l:1148- 1154. 199. Raper SE, Grossman M, Rader DJ, Thoene JG, Clark BJ 111, Kolansky DM, Muller DW, Wilson JM. Safety and feasibility of liver-directed ex vivo gene therapy for homozygous familial hypercholesterolemia.Ann Surg 1996;223:116-126. 200. Wilson MA. Medical news and perspectives. J Am Med Assoc 1993;269;837-838. 201. Ishibashi S, Brown MS, Goldstein JL, Gerard RD, Hammer RE, Herz J. Hypercholesterolemia

106 in low density lipoprotein receptor knockout mice and its reversal by adenovirus-mediated gene delivery. J Clin Invest 1993;92:883-893. 202. Kozarsky KF, McKinley DR, Austin LL, Raper SE, Stratford-Perricaudet LD, Wilson JM. In vivo correction of low density lipoprotein receptor deficiency in the Watanabe heritable hyperlipidemic rabbit with recombinant adenoviruses. J Biol Chem 1994;269:13695--13702. 203. Fagerhol MK, Laurel1 C-B. The Pi system-inherited variants of serum a1 antitrypsin. In: Steinberg AG, Bearn AG (eds) Progress in Medical Genetics, vol3. New York: Grune and Stratton, 197Q96-111. 204. Crystal RG. The al-antitrypsin gene and its deficiency states. Trends Genet 1989;5:411-417. 205. Crystal RG. a 1-antitrypsin deficiency, emphysema and liver disease: genetic basis and strategies for therapy J Clin Invest 1990;85:1343-1352. 206. Brantly M, Nukiwa T, Crystal RG. Molecular basis of al-antitrypsin deficiency. Am J Med 1988;84:13-3 1. 207. Kidd VJ, Wallace RB, Itakura K, Woo SLC. al-antitrypsin deficiency detection by direct analysis of the mutation in the gene. Nature 1983;304230-234. 208. Hubbard RC, Sellers D, Czerski L,Stephens L, Crystal RG. Biochemical efficacy and safety of monthly augmentation therapy for al-antitrypsin deficiency J Am Med Assoc 1988;260: 1259-1264. 209. Kay MA, Ponder Kp,Woo SLC Human gene therapy: present and future. Breast Cancer Res Treat 1992;21:83-93. 210. Carlson J, Rogers BB, Sifers RN, Finegold MJ, Clift SM, DeMayo FJ, Bullick DW, Woo SLC The accumulation of Piz crl-antitrypsin causes liver damage in transgenic mice. J Clin Invest 1989;83:1183-1190. 21 1. Jaffe HA, Dane1 C, Longenecker G, Metzger M, Setoguchi Y; Rosenfeld MA, Gant W , Thorgeirsson SS, Stratford-Perricaudet LS,Perricaudet M, Pavirani A, Lecocq J-P, Crystal RG. Adenoviral-mediated in vivo gene transfer and expression in normal rat liver. Nature Genet 1992;1:368-371. 212. Kay MA, Baley P, Rothenberg S, Leland F, Fleming L, Ponder KP, Liu T-J, Finegold M, Darlington G, Pokorny W, Woo SLC Expression of human u-1-antitrypsin in dogs after autologous transplantation of retroviral transduced hepatocytes. Proc Natl Acad Sci 199&89:8993. 213. Alino SF, Bobadilla M, Garcia-Sanz M, Lejarreta M, Unda F, Hilario E. I n vivo delivery of human alpha-1-antitrypsin gene to mouse hepatocytes by liposomes. Biochem Biophys Res Commun 1993;192:174-181. 214. Knoell DL, Wewers MD. Clinical implications of gene therapy for alpha-1-antitrypsin deficiency Chest 1995;107:535-545. 215. Joenje H, Mathew C, Gluckman E. Fanconi anemia research: current status and prospects. Eur J Cancer 1995;31A:268-272. 216. Cervenka J, Arthur D, Yasis C. Mitomycin C test for diagnostic differentiation of idiopathic aplastic anemia and Fanconi anemia. Pediatrics 1981;67:119-127. 217. Hoeijmakers JHJ, Bootsma D. DNA Repair - 2 pieces of the puzzle. Nature Genet 1992;l: 313-314. 218. Joenje H, Gille JJP. Oxygen metabolism and chromosomal breakage in Fanconi anemia. In: Schroeder R, Obe G, Auerbach AD (eds) Clinical, Cytogenetic and Experimental Aspects of Fanconi Anemia. Berlin: SpringerVerlag, 1989;174-1 82. 219. Roselli F, Sanceau J, Gluckman E,Wietzerbin J, Moustacchi E. Abnormal lymphokine production - a novel feature of the genetic disease Fanconi anemia. 11. Spontaneous overproduction of tumor necrosis factor alpha. A possible tool in detecting heterozygous individuals. Blood 1994;83:1216- 1225. 220. Joenje H, LoTen Foe JR, Arwert F, ten Kate LP. Complementation testing and genetic classification of Fanconi's anemia. Lancet 1994;343:862. 221. Strathdee CA, Gavish H, Shannon WR, Buchwald M. Cloning of cDNAs for Fanconi's anemia

107 by functional complementation.Nature 1992;356:763-767. 222. Auerbach AD. Fanconi anemia. Dermatol Clin 1995;13:41-49. 223. Walsh CE, Grompe M,Vanin E, Buchwald M, Young NS, Nienhuis AW, Lui JM. A hnctionally active retrovirus vector for gene therapy in Fanconi anemia group C. Blood 1994;84453-459. 224. Walsh CE, Nienhuis AW, Samulski RJ, Brown MG, Miller JL,Young NS, Liu JM. Phenotypic correction of Fanconi anemia in human hematopoetic cells with a recombinant adenoassociated virus vector. J Clin Invest 1994b941440-1448. 225. Liu JM, Kim S, Walsh CE. Retroviral-mediated transduction of the Fanconi anemia C complementing (FACC) gene in two murine transplantation models. Blood Cell Molec Dis 1995; 2156-63. 226. Marshall E. Gene therapy’s growing pains. Science 1995;269:1050-1055. 227. Rosenberg SA, Aeversold PM, Cornetta K, Kasid A, Morgan RA,Moen R, Karson EM, Lotze MT, Yang HC, Topalian SL, Merino MJ, Culver K, Miller AD, Blaese RM, Anderson WE Gene transfer into humans - immunotherapy of patients with advanced melanoma using tumor-infiltrating lymphocytes modified by retroviral gene transduction. N Engl J Med 1990; 323:570-578. 228. Kradin RL, Kurnick JT, Lazarus DS, Preffer RI, Dubinett SM, Pinto C, Gifford J, Davidson E, Grove B, Callahan RJ, Strauss HW. n m o r infiltrating lymphocytes and interleukin-2 in the treatment of advanced cancer. Lancet 1989;1:577-580. 229. Rosenberg SA. The immunotherapy and gene therapy of cancer. J Clin Oncol 1992;10:180199. 230. Tepper R, Mule JJ. Experimental and clinical studies of cytokine gene modified tumor cells. Hum GeneTher 1994;5:153-164. 231. Hwu P, Yannelli J, Kriegler M, Anderson WF, Perez C, Chiang Y, Schwartz S, Cowherd R, Delgad0 C, Mule J, Rosenberg SA. Functional and molecular characterization of tumor-infiltrating lymphocytes transduced with tumor necrosis factor-alpha cDNA for the gene therapy of cancers in humans. J Immunol 1993;150:4104-4115. 232. Nabel G. Immunotherapy of malignancy by in vivo gene transfer into tumors. Hum Gene Ther 1992;3:399-410. 233. Rosenberg SA,Anderson WF, Asher AL, Blaese MR, Ettinghausen SE, Hwu P, Kasid A, Mule JJ, Parkinson DR, Schwartzentruber DJ, Topalian SL,Weber JSYannelli JR,Yang JC, Linehan WM.Immunization of cancer patients using autologous cancer cells modified by insertion of the gene for tumor necrosis factor. Hum GeneTher 1992;3:57-73. 234. Osanto S, Brouwenstyn N, Vaessen N, Figdor CG, Melief CJM, Schrier PI. Immunization with interleukin-2 transfected melanoma cells. A phase 1-11 study in patients with metastatic melanoma. Hum Gene Ther 1993;4:323-330. 235. Plautz GE, Nabel EG, Fox B,Yang Z-Y, JaEe M, Gordon D, Chang A, Nabel GJ. Direct gene transfer for the understanding and treatment of human disease. Ann NY Acad Sci 1994;716: 144-153. 236. Silver HKB, Klasa RJ, Bally MB. Genetic allogenization of malignant melanoma. Transhs Sci 1996;17:169-1 74. 237. Tonkinson JL, Stein CA. Antisense oligodeoxynucleotidesas clinical therapeutic agents. Canc Invest 1996;1454-65. 238. Maher LJ.Prospects for the therapeutic use of antigene oligonucleotides. Canc Invest 1996;14 66-82. 239. Vogelstein B. Cancer. A deadly inheritance. Nature 1990;348:68 1-682. 240. Selivanova G, Wilman KG. p53: a cell cycle regulator activated by DNA damage. Adv Cancer R ~ 1995;66:143-180. s 241. Keurbitz SJ, Plunkett BS, Walsh W, Kastan MB. Wild-type p53 in a cell cycle checkpoint determinant following irradation. Proc Natl Acad Sci 1992;89:7491-7495. 242. Lane DI? p53, guardian of the genome. Nature 1992;358:15-16. 243. Chang F, Syrjanen S, Syrjanen K. Implications of p53 tumor-suppressorgene in clinical oncol-

ogy J Clin Oncol 1995;13:1009-1022. 244. Casey G, Lo-Hsueh M, Lopez ME,Vogelstein B, Stanbridge EJ. Growth suppression of human breast cancer cells by the introduction of a wild-type p53 gene. Oncogene 1991;6:1791-1797. 245. Ozturk M, Ponchel F, Puisieux A. p53 as a potential target in cancer therapy Bone Marrow Transpl 1992;9(S):164-170. 246. Fujiwara T, Grimm EA, Roth JA. Gene therapeutics and gene therapy for cancer. Curr Opin Oncol 1994;6:96-105. 247. Eastham JA, Hall SJ, Sehgal I, Wang J, Timme TL, Yang G, Connell-Crowley L, Elledge SJ, Zhang WW, Harper JW In vivo gene therapy with p53 or p21 adenovirus for prostate cancer. Cancer Res 1995;55:5151-5155. 248. Workman P.To pop or not to pop: p53 as a critical modulator of tumour responsiveness to therapy in vivo? Hum Exper Tox 1995;14:222-225. 249. Wills KN, Maneval C, Menzel P, Harris MP, Sutjipto S, Vaillancourt M-T, Huang W-M, Johnson DE, Anderson SC,Wen SF, Bookstein R, Shepard HM, Gregory RJ. Development and characterization of recombinant adenoviruses encoding human p53 for gene therapy of cancer. Hum Gene Ther 1994;5: 1079- 1088. 250. FujiwaraT, Cai DW, Georges R, Mukhapakhyat T, Grimm EA, Roth JA. Therapeutic effect of a retroviral wild-type p53 expression vector in an orthotopic lung cancer model. J Natl Cancer Inst 1994336:1458- 1462. 25 1. Lesoon-Wood LA, Kim WH, Kleinman HK, Weintraub BD, Mixson AJ. Systemic gene therapy with p53 reduces growth and metastases of a malignant human breast cancer in nude mice. Hum GeneTher 1995;6:395-405. 252. Cai DW, Mukhopadhyay T, Roth JA. Suppression of lung cancer cell growth by ribozymemediated modification of p53 pre-mRNA. Cancer Gene Ther 1995;2:199-205. 253. Freeman SM, Abboud CN, Whartenby KA, Packman CH, Koeplin DS, Moolten FL, Abraham GN. The “bystander effect” tumor regression when a fraction of the tumor mass is genetically modified. Cancer Res 1993;53:5274-5283. 254. Riddell SR, Greenberg PD, Overell RW, Loughran Tp, Gilbert MJ, Lupton SD, Agosti J, Scheeler S, Coombs RW, Corey L. Phase I study of cellular adoptive immunotherapy using genetically modified CD8+ HIV-specific T cells for HIV seropositive patients undergoing allogeneic bone marrow transplant. Hum GeneTher 1992;3:319-328. 255. Sorrentino BP, Brandt SJ, Bodine D, Gottesman M, Pastan I, Cline A, Nienhuis AW Selection of drug-resistant bone marrow cells in vivo after retroviral transfer of human MDR-1. Science 1992;257:99- 103. 256. Deisseroth AB. RAC Report 9406-077, 1995;June. 257. Merson MH. Slowing the spread of HIV: agenda for the 1990s. Science 1993;260:1266-1268. 258. Wong-Staal E Human immunodeficiency virus and their replication. In: Fields BN, Knipe DM (eds) Fundamental Virology New York: Raven Press Ltd., 1991;709-723. 259. Yu M, Poeschla E, Wong-Staal E Progress towards gene therapy for HIV infection. GeneTher 1995;l:13-26. 260. Baltimore D. Gene therapy: intracellular immunization. Nature 1988;355:395-396. 261. Friedman AD, Triezenberg SJ, McKnight SL. Expression of truncated viral transactivator selectively impedes lytic infection by its cognate virus. Nature 1988;355:452-454. 262. Herskowitz I. Function inactivation of genes by dominant negative mutations. Nature 1987;329: 2 19-222. 263. Malim MH, Cullen BR. HIV-1 structural gene expression requires the binding of multiple Rev monomers to the viral RRE: implications for HIV-1 latency. Cell 1991;65:241-248. 264. Dalgleish AG, Beverley PC, Clapham PR, Crawford DH, Greaves MF, Weiss RA. The CD4 (T4) antigen is an essential component of the receptor for the AIDS retrovirus. Nature 1984;312: 763-767. 265. Deen KC, McDougal JS, Inacker R, Folena-WassermanG, Anthos J, Rosenberg J, Maddon PJ, Axel R, Sweet RW. A soluble form of CD4 (T4) inhibits AIDS virus infection. Nature 1988;

109 331:82-84. 266. Morgan RA, Looney DJ, Muenchau DD, Wong-Staal F, Gallo RC, Anderson WR. Retroviral vectors expressing soluble CD4: a potential gene therapy for AIDS. AIDS Res Hum Retrovir 1990;6:183- 191. 267.Daar ES, Ho DD. Relative resistance of primary HIV-1 isolates to neutralization by soluble CD4. Am J Med 1991;90:223-268. 268. Orloff SL, Kennedy MS, Belperron AA, Maddon PJ, McDougal JS. Two mechanisms of soluble CD4 (sCD4)-mediated inhibition of human immunodeficiency virus type 1 (HIV-1) infectivity and their relation to primary HIV-1 isolates with reduced sensitivity to sCD4. J Virol 1993;67: 1461-1471. 269. Stein CA, Cheng YC Antisense oligonucleotides as therapeutic agents - is the bullet really magical? Science 1993;261:1004- 1012. 270. Chatterjee S,Johnson PR, Wong KK Jr. Dual-target inhibition of HIV-1 in vitro my means of an adenoassociatedvirus antisense vector. Science 1992;258:1485- 1488. 271. Gilboa E, Smith C. Gene therapy for infectious diseases: the AIDS model. Trends Genet 1994; 10:139- 144. 272. Sullenger BA, Gallardo HF, Ungers GE, Gilboa E. Overexpression of TAR sequences renders cells resistant to human immunodeficiency virus replication. Cell 1990;63:601-608. 273. Lee TC, Sullenger BA, Gallardo HF, Ungers GE, Gilboa E. Overexpression of RRE-derived sequences inhibits HIV-1 replication in CEM cells. New Biol 1992;466-74. 274. Sarver N, Cantin EM, Chang PS, Zaia JA, Ladne PA, Stephens DA, Rossi JJ. Ribozymes as potential anti-HIV-1 therapeutic agents. Science 1990;247:1222- 1225. 275. Lorentzen EU, Wieland U, Kuhn JE, Braun RW In vitro cleavage of HIV-1 vif RNA by synthetic ribozyme.Virus Genes 1991;5:17-23. 276. Sioud M, Drlica K. Prevention of human immunodeficiencyvirus type 1 integrase expression in Bcherichiu coli by a ribozyme. Proc Natl Acad Sci 1991;88:7303-7307. 277. Weerasinghe M, Liem SE, Asad S, Read SE, Joshi S. Resistance to human immunodeficiency virus type 1 (HIV-1) infection in human CD4' lymphocyte-derivedcell lines conferred by using retroviral vectors expressing an HIV-1 RNA-specific ribozyme. J Virol 1991;65:5531-5534. 278. Yu M, Ojwang J,Yamada 0, Hampel A, Rapapport J, Looney D, Wong-Staal E A hairpin ribozyme inhibits expression of diverse strains of human immunodeficiency virus type 1. Proc Natl Acad Sci 1993;906340-6344. 279. Warner JF, Anderson CG, Laube L, Jolly DJ, Townsend K, Chada S,St. Louis D. Induction of HIV-specific CTL and antibody responses in mice using retroviral vector-transduced cells. AIDS Res Hum Retrovir 1991;7:645-655. 280. Jolly D. Retroviral vectors expressing HIV env as immunotherapeutics for HIV infection. UCLA/UCI AIDS Symposium: Gene Therapy Approaches to Treatment of HIV Infection. 1993;12. 281. Morgan AR, Wells RD. Specificity of the three-strand complex formation between doublestrand DNA and single-strand RNA containing repeating nucleotide sequences. J Molec Biol 1968;37:63-80. 282. Zamecnik PC, Stephenson ML. Inhibition of Rous sarcoma virus replication and cell transformation by a specific oligodeoxynucleotide. Proc Natl Acad Sci 1978;75:280-284. 283.Walder RY, Walder JA. Role of RNase H in hybrid-arrested translation by antisense oligonucleotides. Proc Natl Acad Sci 1988;85:5011-5015. 284. Scanlon KJ, OhtaY, Ishida H, Kijima H, OhkawaT, Kaminski A,Tsai J, Horng G, Kashanisabet M. Oligonucleotide-mediated modulation of mammalian gene expression. FASEB J 1995;9: 1288-1296. 285. Janicek MF, Sevin BU, Nguyen HN, Averette HE. Combination anti-gene therapy targeting cmyc and p53 in ovarian cancer cell lines. Gynecol Oncol 1995;59:87-92. 286. Normanno N, Selvam MP, Bianco C, Damiano V, Deangelis E, Grassi M, Magliulo G, Tortora G, Salomon DS, Ciardiello E Amphiregulin anti-sense oligodeoxynucleotides inhibit growth

110 and transformation of a human colon carcinoma cell line. Int J Cancer 1995;62:762-766. 287. Hall WA, Flores EP, Low WC. Antisense oligonucleotides for central nervous system tumors. Neurosurgery 1996;38:376-383. 288. Matsukura M, Koike K, Zon G. Antisense phosphorothioates as antivirals against human immunodeficiency virus (HIV) and hepatitis B virus (HBV). Toxic01 Lett 1995;82-83:435-438. 289. Sczakiel G. Antisense strategies in the treatment of hematological malignancies. Stem Cells 1995;13(Suppl3):88-92. 290. Maher LJ 111, Wold B, Dervan PB. Inhibition of DNA binding proteins by oligonucleotidedirected triple helix formation. Science 1989;245:725-730. 29 1. Havre PA, Gunther EJ, Gasparro FP, Glazer PM. Targeted mutagenesis of DNA using triple helix-forming oligonucleotides linked to psoralen. Proc Natl Acad Sci 1993;90:7879-7883. 292. Sandor Z, Bredberg A, Repair of triple helix directed psoralen adducts in human cells. Nucl Acid Res 1994;22:2051-2056. 293. Neckers L, Whitesell L, Rosolen A, Geselowitz DA. Antisense inhibition of oncogene expression. Crit Rev Oncogen 1992;3:175-231. 294. Leonetti JP, Degols G, Clarenc JP, Mechti N, Lebleu B. Cell delivery and mechanisms of action of antisense oligonucleotides. Prog Nucl Acid Res Molec Biol 1993;W.143-166. 295. Sullenger BA, Cech TR. Ribozyme-mediated repair of defective mRNA by targeted transsplicing. Nature 1994;371:619-622. 296.Woolf TM, Chase JM, Stinchcomb DT. Toward the therapeutic editing of mutated RNA sequences. Proc Natl Acad Sci 1995;92:8298-8302. 297. Sullivan SM. Development of ribozymes for gene therapy J Invest Dermatol 1994;103:85S89s. 298. Thompson JD, Macejak D, Couture L, Stinchcomb DT Ribozymes in gene therapy Nature Med 1995;1:277-278. 299. Ciafrk SA, Rinaldi M, Gasparini P, Seripa D, Bisceglia L, Zelante L, Farace MG, Fazio VM. Stability and functional effectiveness of phosphorothioate modified duplex DNA and synthetic ‘mini-genes’. Nucl Acid Res 1995;23:4134-4142. 300. Zhang RW, Lu ZH,Zhang XS,Zhao H, Diasio RB, LiuTp, Jiang ZW,Agrawal S. In vivo stability and disposition of a self-stabilized oligodeoxynucleotide phosphorothioate in rats. Clin Chem 1995;41:836--843. 30 1. Thiery AR, Dritschilo A. Intracellular availability of unmodified, phosphorothioated and liposomally encapsulated oligodeoxynucleotides for antisense activity. Nucl Acid Res 1992;20: 5691-5698. 302. Capaccioli S, DiPasquale G, Mini E, Mazzei T, Quattrone A. Cationic lipids improve antisense oligonucleotide uptake and prevent degradation in cultured cells in human serum. Biochem Biophys Res Commun 1993;197:818-825. 303. Clarenc J, Degols G, Leonetti J, Milhaud P, Lebleu B. Delivery of antisense oligonucleotides by poly(~-1ysine) conjugation and liposome encapsulation. Anti-Cancer Drug Design 1993;8:8194. 304. Krieg AM, Tonkinson J, Matson S, Zhao Q, Saxon M, Zhang LM, Bhanja U, Yakubov L, Stein CA. Modification of antisense phosphodiester oligodeoxynucleotides by a 5’ cholesteryl moiety increases cellular association and improves efficacy. Proc Natl Acad Sci 1993;901048- 1052. 305. Wang Q, M a d JC. Antisense oligodeoxynucleotides selectively suppress expression of the mutant a2(I) collagen allele in type IV osteogenesis imperfecta fibroblasts - a molecular approach to therapeutics of dominant negative disorders. J Clin Invest 1996;97:448-454. 306. Tomita N, Morishita R, Higaki J, Aoki M, NakamuraY, Mikami H, Fukamizu A, Murakami K, KanedaY, Ogihara T. Transient decrease in high blood pressure by in vivo transfer of antisense oligodeoxynucleotides against rat angiotensinogen. Hypertension 1995;26:131-136.

01997 Elsevier Science B.V. All rights reserved Bwtechnology Annual Review Volume 3

111

M.R.El-Gewely, editor.

Group I introns in biotechnology: prospects of application of ribozymes and rare-cutting homing endonucleases Steinar Johansen, Christer Einvik, Morten Elde, Peik Haugen, Anna Vader and Finn Haugli Department of Molecular Cell Biology, Institute of Medical Biology, University of Poms0, Thoms0, Norway

Abstract. Group I introns are sporadically, but universally distributed among different genes and genomes. They are distinguished from other classes of introns by a characteristic RNA structure and splicing mechanism. Group I introns may encode two different gene products with relevance to biotechnology: group I ribozymes and rare-cutting homing endonucleases. General aspects on molecular and biological features of naturally occurring group I introns are briefly discussed in the first part of the chapter. The second part focuses on group I ribozymes and their potential as tools in molecular biology and therapy, including both gene therapy and chemotherapy Finally, rare-cutthg homing endonucleases are reviewed and considered as molecular tools in genome mapping and genome engineering.

Keywords: antibiotics, gene repair, gene inactivation, gene therapy, genome engineering, genome mapping, group I ribozyme, group I intron, homing endonucleases, homologous recombination, in vitro selection, in vitro evolution, intron, rare-cutting endonucleases, ribozyme, ribozyme-directed chemotherapy, RNA splicing, RNA processing, RNA, trans-splicing.

Introduction The coding sequences sequences of many genes are interrupted by introns, and in some cases these introns contain additional genes encoding different proteins or RNAs. First, the spliceosomal introns, which are widely distributed among eukaryotic chromosomal genes, sometimes code for small nucleolar RNAs. These structural RNAs accumulate in the nucleolus and probably function in ribosomal RNA (rRNA) processing and maturation [1,2]. Second, the related group I1 introns are found in organelle genomes in some eukaryotes as well as in a few bacterial genomes [3,4], where they encode self-splicing group I1 ribozymes. Furthermore, most group I1 introns harbor large open reading frames (ORFs) corresponding to reverse transcriptase (RT) like proteins, or sometimes multifunctional enzymes with both RT endonuclease and maturase activities. Such enzymes have been shown to be involved in both splicing and retrohoming of group I1 introns [3,5,6].Third, both archea introns and inteins harbor functional ORFs. When tested they all appear to encode rare-cutting homing endonuAddressfor correspondence: S. Johansen, Department of Molecular Cell Biology, Institute of Medical Biology, University of Tromsnr, N-9037Tromsnr, Norway Tel.: +47-77-64-53-67. Fax:+47-77-64-5350.E-mail: [email protected]

112 cleases; enzymes involved in intron mobility by the homing mechanism [7-lo]. Finally, the universally distributed self-splicing group I introns contain ribozymes responsible for self-splicing [l 13 and several harbor ORFs [12]. Three different categories of function have been assigned to the group I intron ORF-proteins: structural proteins, RNA maturases or DNA endonucleases. This chapter concentrates on some of the gene products encoded by group I introns: group I ribozymes and rare-cutting homing endonucleases. We first summarize basic features of intron splicing as well as the distribution of group I introns in nature. Group I introns are widespread with examples known from most genome categories, however, their distribution is sporadic. At the RNAlevel these introns fold into well-defined structures and become catalytic RNAs (group I ribozymes) responsible for intron excision as well as exon ligation of the precursor RNA [l 11. Some group I introns are mobile genetic elements at the DNA-level. Mobility is dependent on the intron-encoded rare-cutting homing endonuclease, and is proceeded by a double-strand break repair (DSBR) pathway called intron homing [131. Next we will discuss how group I ribozymes have been engineered to become tools in biotechnology Possible applications include gene-inactivation and generepair strategies, both at the RNA-level, mediated by trans-cleaving and transsplicing group I ribozymes, respectively [14]. The latter may be a novel method of human gene therapy However, a number of basic. problems are still to be solved before this strategy can become applied technology Group I ribozymes are also being applied in in vitro selection experiments in order to create RNA with new functions, including novel catalytic activities [15]. In a different approach, group I ribozymes may be viewed as targets in chemotherapy By using antibiotics to inhibit the splicing of naturally occurring group I introns in pathogenic organisms, it may be possible to treat infectious diseases [16]. The last part of the chapter focuses on the proteins encoded by some of the group I introns. The rare-cutting homing endonucleases have large and specific recognition sites in double-stranded DNA, and cleave very infrequently [171. These endonucleases are being applied in physical mapping of large genomes in both prokaryotes and eukaryotes. Furthermore, rare-cutting homing endonucleases have been successhlly used to study homologous recombination and DNA repair in eukaryotes, including mammalian cells [ 181. Distribution of group I introns The distribution of group I introns in nature is widespread, but scattered. They interrupt both structural RNA and protein-coding genes in both prokaryotes and eukaryotes. There is strong phylogenetic evidence to support horizontal gene transfer of group I intron elements during evolution [19-211, which in part may explain the distribution pattern of group I introns. Recently, artificial horizontal intron transfer was demonstrated in vivo. The two self-splicing group I introns PpLSU3 and TtLSUl from the myxomycete Physurum and the ciliate

113 Etruhymena, respectively, were successfidly integrated into all genome copies of ribosomal DNA (rDNA) in the yeast Sacchuromyces ([22], J. Lin and YM. Vogt, personal communication). In nature, intimate physical contact between donor and recipient organisms (e.g., symbiotic relationship or even phagocytosis) might easily allow horizontal transfer [ 19,231. Group I introns in prokaryotes

Prokaryotic genes may be interrupted by introns. Examples of inteins, archaeal introns, group I and group I1 introns, and even spliceosomal introns are known [24].The group I introns are most common and have been found in both bacterial chromosomal genes and phage genes. The phage T4 and related E. coli phages [25] as well as several Bacillus phages [26,27] contain group I introns in various protein coding genes. Some bacterial tRNA genes are also interrupted by group I introns. These include the genes coding for tRNAUe,tRNAMet,tRNAArg,and tRNALe"of cyanobacteria and proteobacteria [28-3 11. The majority of bacterial group I introns are small, and the 205 base pair thermostable Azourcus tRNAne-intron is the smallest self-splicing group I intron known [30,32,33]. One of the bacterial introns harbor an ORF corresponding to a putative protein of 150 amino acids [31]. Group I introns in eukaryotes

The majority of group I introns are found in eukaryotes. They interrupt genes in both chloroplast, mitochondrial, nuclear, and viral genomes. Close relationships between the bacterial group I introns and those in chloroplast tRNA genes of plants and some algae have been suggested [34,35].This may reflect the proposed eubacterial evolutionary origin of the cytoplasmic organelles [36]. Furthermore, a number of introns have been reported in chloroplast genes of various species of green algea, especially the rRNA genes [21,37,38]. In many different fungi, and in particular among the ascomycetes [39-411, numbers of group I introns occur in the mitochondrial DNA (mtDNA). The complete mtDNA sequences of the chytridiomycete Allomyces macrogyrus [42] and the ascomycete Podosporu anserina [39] revealed 26 and 33 group I introns, respectively, most of them harboring large ORFs. In contrast, only few protists [38], plants [20,43], and animals [44] have group I introns in their mtDNAs. A number of protists and fungi contain group I introns in their nuclear rRNA genes [38,45,46]. Both the small subunit (SSU) and large subunit (LSU) rRNA genes may be interrupted by introns. These introns are always located at highly conserved regions of the nuclear rRNA genes, and more than 20 different locations are known [38]. Most are small (ca. 300-400 base pairs), encoding only the group I ribozyme part responsible for the characteristic structure and splicing mechanism of group I introns [111. However, a few of the introns are larger and contain functional ORFs, and these seem to have a preference for genera with

114 extrachromosomal rDNA such as Nuegleriu, Physururn, or Didyrniurn [38]. Group I introns have so far only been observed in a single eukaryotic virus [47]. Self-splicing and processing of naturally occurring group I introns

Group I introns can be folded at the RNA level into a well-defined structure of about 10 base-paired segments (P1 to P10) and several tertiary interactions [48-501. A schematic structure of a group I intron RNA is presented in Fig. 1. The catalytic core includes about 200 nucleotides of the P3, P4 and P7 segments, the proximal regions of P6 and P8, and single-stranded regions between these. The catalytic core structure is highly conserved among the 11 defined subclasses of group I introns [48] and include the catalytically important guanosine binding site in P7. Structural aspects of group I introns have been extensively reviewed [11,49,511. Some group I introns have large internal insertion-like extensions located in peripheral loop regions (Pl, P2, P6, P8, and p9; see Fig. 1) without perturbing RNA folding or ribozyme fhnction. Such insertions may be a repetitive sequence element [45], a fragmented ORF [43], a hnctional ORF [17], or a second group I ribozyme [52].

1

I

P9

P5

I

P1 ..........

I

5'

P7

P4

...................... P6

i

LJ

.................. P3

P2

.............

I

1

f

Fig. I. Schematic presentation of the group I intron secondary RNA structure according to [49]. P1 to P10,base paired elements of the intron structure. Bold lines represent the Sand 3'exon regions.

115 Many group I introns self-splice in vitro as naked RNA only in the presence of salts and a guanosine cofactor [l 11. A recent compilation of known rDNA group I intron showed that one out of three tested did not self-splice under in vitro conditions [38]. In this section we focus on three different selfisplicing group I introns: TtLSUl from the ciliate Tetruhymenu, PpLSU3 from the myxomycete Physurum, and DiSSUl from the myxomycete Didymium. Self-splicing of group I introns

The Tetruhymenu intron TtLSUl was the first self-splicing group I intron to be discovered and characterized [53,54]. This 413 base pair intron is located within a conserved domain of the nuclear LSU rRNA gene, corresponding to position 1925 in the Escherichiu coli reference sequence [38]. TtLSUl splices from prerRNA in vivo in the range of seconds, and the free intron is rapidly degraded [55]. All group I introns are generally believed to follow the same catalytic splicing pathway, and the intensively studied Tetruhymenu intron has become the prototype of all these introns [11,51,56,57]. Group I intron splicing is accomplished by a series of transesterification reactions that are initiated by nucleo5'

3'

3'

U

G

+

Ligated exon

Excised exon

Rg. 2. Guanosine-dependentself-splicing mechanism of group I introns.

116 philic attack of the 3' hydroxyl group of a guanosine (G) residue at the upstream exon-intron junction (see Fig. 2). The G cofactor is specifically associated to P7 in the catalytic core, and becomes covalently bound to the released 5' end of the intron. In the second transesterification reaction, the free 3' hydroxyl group of the 5' exon attacks the 3' splice site. Subsequently, the exon sequences are ligated and the linear intron is liberated. TtLSUl and PpLSU3 are cognate introns. They are located at the exact same site in the LSU rRNA genes of Tetruhyrnenu and Physururn, respectively TtLSUl and PpLSU3 share approximately 71% overall sequence identity and 90% in the catalytic core [58]. The main structural difference is that PpLSU3 harbors an ORF in P1, which encodes a DNA endonuclease that is responsible for intron homing [59]. The 943 base pair PpLSU3 self-splices in vitro by the same mechanism asTtLSU1 [58]. However, Rocheleau and Woodson [60] found that PpLSU3 is 1,500-fold less reactive compared to the Tetruhyrnenu intron. Surprisingly, deletion of the ORF region in P1 gave only a slight increase in splicing rate. In fact, the PpLSU3 splicing rate is stimulated 10- to 25-fold by a second group I intron (PpLSU2 [19]) located 24 nucleotides downstream in Physururn rDNA [61]. The complex DiSSU1 intron interrupts the nuclear SSU rRNA gene in Didymium at position 956 (numbering according to the E. coli reference sequence [38]). DiSSU1 is an optional and mobile group I intron of 1,436 base pairs ([62], S. Johansen et al., submitted). At the RNA-level it has a twin-ribozyme organization composed of two group I ribozymes with different functions in RNA processing, separated by an endonuclease-encoding ORF (Fig. 3) [52]. One of the ribozymes (DiGIR1) is small, has a novel structure, and is not involved in intron splicing, while DiGIR2 appears to be a regular self-splicing group I ribozyme. DiSSU1 self-splice under in vitro conditions, but at high temperatures and in salt conditions (5OOC; 1 M KCl; 25 mM Mg2+)[62]. In contrast, Decatur et al. [52] showed that a DiGIR2 construct of DiSSU1 (deleted DiGIR1 and ORF sequences) splice as well as naked RNA at conditions more similar to those inside cells. Processing of excised group I introns

In contrast to intron splicing, which results in exon ligation and thus is in the interest of the host, processing of excised intron RNA may be a selfish feature of the intron element. The excised Tetruhyrnenu intron RNA form circles in a transesterification reaction where the 3' hydroxyl group of the terminal G-residue attacks the bond between nucleotide 15 and 16, leading to a release of a short linear RNA fragment corresponding to the 5' end of the intron [63]. The circle can be reopened at the same site by hydrolysis, resulting in the linear ribozyme called linear minus 15 (L- 15) [64]. Furthermore, L- 15 RNA may perform a second round of circularization usually at a site four nucleotides downstream of the 5' end, and then reopen again yielding the L- 19 RNA. L- 19 RNA is a very active RNA enzyme that has been applied in a number of ribozyme studies

117

3'ss

z

7 G exonl (GIRl) (GIRZ) exon2

=k 0

v

I

I

D 0

z

I Ligated exons

I-DifI ORF I

GI,"

- pGIRZ Go"

GIR1 hydrolysis

0 k5E z W (GIR1)

0 0

I

m

1

I I-DirI ORF I

Gl

v) v)

zc)

ssn* (GIR1)

I-DkI ORF

I

GI

Rg.3. Splicing and processing pathway of the group I intron DiSSUl from Didymium rDNA. See text for more details.

(see below). The linear PpLSU3 intron RNA is processed by G-addition at an internal processing site leading to separation of the two intron halves: the ribozyme and the ORF [58]. The ORF fragment may represent the messenger RNA for the I-Ppo I endonuclease in vivo in Physururn [58]. In contrast to the excised Tefruhyrnenuintron, which is degraded rapidly in vivo, PpLSU3 RNAs appear to be quite stable in the cell [61,65]. As summarized in Fig. 3, processing of the DiSSUl RNA is proposed to follow a complicated pathway The excised linear intron RNA, generated in the self-

118 splicing reaction (step l), circularizes in a G-exchange transesterification reaction [62]. The circle formation (step 2) is catalyzed by the DiGIR2 ribozyme in a reaction where the 3’-terminal G-residue attacks the 5‘-terminal of the intron RNA, resulting in a full-length intron circle and the release of the noncoded G cofactor. In step 3 the circle reopens by a DiGIRZmediated hydrolysis reaction [52,62], generating a linear intron RNA that lacks the noncoded G-residue at the 5‘ end, thus preventing a second round of G-exchange circularization.The linear intron RNA is then cleaved at an internal processing site (IPS) by DiGIRl-catalyzed hydrolysis (step 4), yielding one small RNA that contains the DiGIR1 ribozyme as well as a larger RNA harboring the ORE Alternatively, excised intron RNA may be cleaved directly at IPS, resulting in almost the same two RNA species (step 5). What could be the biological significance of excised intron processing? First, in Tetruhymena it may be as simple as preventing the reverse splicing reaction by deleting a short oligonucleotide from the 5’ end of the intron. Second, intron processing in Physurum and Didymium may lead to functional messengers for the intron-encoded proteins I-Ppo I and I-Dir I, respectively Thus, these endonucleases seem to be rare examples of proteins encoded by ribozyme-processed RNA polymerase I transcripts. Finally, the full-length intron RNA circle in Didymium could be involved in horizontal transfer between species since it contains all the genetic information in the intron [62]. Trans-reactions of group I ribozymes Group I ribozymes act in many ways as true enzymes. However, all naturally occurring self-splicing group I ribozymes work in cis; the catalytic core and substrate are present in the same RNA molecule. Thus, in order to get a true RNA enzyme with a turnover, these ribozymes have to be engineered for trunsreactions between the substrate and ribozyme. Currently, several different reactions are known to be catalyzed by group I ribozymes in addition to splicing. These RNA enzyme activities include sequence-specific endonuclease, templatedependent ligation, nucleotidyl transferase, and aminoacyl esterase [66]. The first truns-reaction with a group I ribozyme was reported more than a decade ago, when dinucleotides (CU) and oligonucleotides (CUCUCU) resembling the 5’ exon were added in truns to the Tetruhymena group I ribozyme [67]. Zaug and Cech [68] then reported that the L- 19 RNA of the Tetruhymenu group I ribozyme was able to cleave and rejoin oligonucleotide substrates (pC,) when added in trans, resulting in products of six to nine nucleotides. Different truns-reaction strategies have now been reported, and some of them will be discussed below. li.uns-reuction strategies Different truns-reactions have been developed to study a particular reaction or structure within a group I ribozyme. One strategy depends on non-base-pairing

119 interactions between ribozyme domains or structures. This includes single paired segments such as P1 [69,70], the P5 subdomain [71], simple structures such as ligated exons [72,73] and complex pseudoknots structures [74], all added in trans. In the work of Van der Horst et al. [71], an RNA consisting of the P5abc subdomain was added in trans to a splice-deficient Tetrahyrnena ribozyme lacking this P5 structure (AP5abc). The interaction between P5abc-RNA and AP5abcRNA is based on a non-base-pairing RNA-RNA recognition. They found that under normal self-splicing conditions, the two-component ribozyme was able to self-splice efficiently The second trans-reaction ribozyme strategy is based on one or several basepaired regions. The best characterized are the shortened linear versions, L- 19 and L-21, of the Tetrahyrnena ribozyme [75,76]. These ribozymes lack the first 19 and 21 nucleotides, respectively, resulting in a single-stranded internal guide sequence (IGS) which functions as an antisense sequence in trans-reactions. The deleted 5’ exon sequence, including the 5’ splice site, is added in trans to make a six base pair interaction with IGS and to recreate the cleavage site. The cleavage reaction is analogous to the first step of group I intron splicing (Fig. 2). The Tetrahyrnena ribozyme L-21 ScaI, which lack five additional nucleotides upstream from the 3‘ splice site, has been successfblly applied in a number of trans-cleavage experiments [76]. Variant forms of the L-21 ScaI ribozyme have been designed to cleave different substrates [77]. Other paired segments of group I ribozymes have been used in trans-reactions in addition to the P1-approach described above. Decatur et al. [52] used the P2 segment in order to get supporting evidence that DiGIR2 was the splicing ribozyme within the DiSSUl group I intron. Here, the P2 interaction involved about 30 base pairs. Efficient splicing was observed when the 5‘ exonPl-P2(5’) substrate RNA was added in trans to the DiGIR2 ribozyme core. More complex multi-trans-reactions that involve two or three single-stranded regions to bring the molecules together have also been reported [78,79]. Applications of group I ribozymes as tools

Group I ribozymes represent only one of at least eight main classes of naturally occurring ribozymes which can be divided into two categories: the “small” and the “large” ribozymes [51,80,81]. The hairpin, hepatitis delta virus (HDV), and the hammerhead catalytic RNAs are all members of the small ribozymes. The hammerhead ribozyme is the simplest of the ribozymes, both in structure and cleavage mechanism. This RNA has been intensively studied over the last decade, and the three-dimensional crystal structure was recently determined [82,83]. Three classes of catalytic RNAs belong to the large ribozyme category, namely, group I and group I1 ribozymes, and the ribonuclease P ribozyme. Basic biological, structural and fbnctional properties of the different ribozyme classes have been extensively reviewed [51,80,84-871. In order to be used as tools in biotechnological approaches, ribozymes have to be artificially engineered. Changes

120

include reduced size, altered target specificity, improved catalysis and increased nuclease resistance [88]. The Tetrahymena group I ribozyme (L-21) is commercially available from the United States Biochemical Corporation as a sequencespecific ribonuclease with the target sequence CUCU. Below we discuss three different potential applications of group I ribozymes as tools in biotechnology: RNA-directed gene therapy both by inactivation and by repair, and in vitro RNA selection methods to produce RNAs with new functions. Gene-inactivationmediated by self-cleavinggroup I ribozymes Antisense molecules may be designed to hybridize to DNA or RNA sequences, and thereby blocking the synthesis of a specific gene product. There are three major classes of gene-inactivation strategies based on antisense sequences: antisense sequences that bind at the DNA-level, antisense sequences that block specific gene transcripts at the RNA-level, and ribozymes that combine features of antisense sequences and RNA cleavage [89]. The potential of therapeutic applications of ribozymes include treatment of various disorders such as cancer and viral infections (e.g., HIV infection) [go-951. The hammerhead ribozymes have been proven to be successful in several gene-inactivation studies. Other ribozyme classes such as ribonuclease P [96], HDV [97], and group I ribozymes [98] may also have potential as tools. Three features in particular make group I ribozymes interesting as tools for gene-inactivation in vivo. First, in contrast to small ribozymes like the hammerhead, the large group I ribozyme folds into stable RNA structures independent of substrate binding. More stable ribozymes might have longer half-lives in vivo and should therefore be more effective. Second, most trans-cleaving strategies are based on antisense interactions at the IGS. This approach does not depend on additional structural requirements from the substrate. Finally, naturally occurring group I ribozymes exist that work well in in-vivo-like conditions (e.g., the DiGIR2 ribozyme), and which function normally in eukaryotic nuclei. A schematic presentation of a possible gene-inactivation strategy, based on transcleaving group I ribozymes, is presented in Fig. 4. Here, an engineered ribozyme binds a specific messenger RNA at the IGS. The ribozyme cuts the messenger at a predetermined cleavage site, resulting in degradation of the RNA and release of the ribozyme part, which can then bind to and cleave a second target. The messenger is degraded and cannot be translated into a specific protein. Recently, Campell and Cech [99] reported a designed Tetrahymena ribozyme that cleaved an HIV-specific RNA in vitro. Studies of hammerhead trans-cleaving have shown that local structures at the RNA-target may inhibit binding to the ribozyme [93]. Thus, Campell and Cech developed a method to identifl group I ribozymes within a ribozyme library (randomized antisense sequences in P1) that were able to cleave the RNA. In a G-addition labelling assay, they were able to identi@ several cleavage sites within the HIV-specific RNA. This strategy may be applied to group I ribozyme mediated cleavage of practically

121

'ila \...[I .... ......I ...

. .... .. ......

Fig. 4. Gene-inactivation based on trans-cleaving group I ribozymes. A ribozyme recognizes and binds to the messenger RNA and catalyses cleavage. After dissociation, the ribozyme may participate in a second round of cleavage.

any RNA transcript. A different approach was reported by Tasiouka and Burke [79]. They developed a system where a Tetrahymena ribozyme, followed by a 5' exon, is able to react in trans with a substrate-analogof the 3' splice site. During the in vitro reaction, the 3' exon becomes ligated to the 5' exon to produce an intron-Sexon-3'exon product. This trans-reaction is based on a 17 base pair interaction, and may be a new powerll inactivation strategy of cellular RNA transcripts [79]. In vivo application of ribozymes depends on several additional factors such as a delivery system to the cell, colocalization of the ribozyme and

122 target RNA within the cell, in vivo stability of ribozymes or intracellular interactions with cellular proteins [1001. Despite all these potential problems, Sullenger and co-workers [loll reported that the Tetruhymena ribozyme works in trans within mammalian cells. Gene-repair mediated by self-splicinggroup I ribozymes Recently, a novel method in gene therapy, based on splicing ribozymes, has received public attention [98,102]. A group I ribozyme, engineered to perform trans-splicing, can be used to repair defective RNA transcripts in mammalian cells. Similar to group I ribozyme-mediated trans-cleavage, the first step in trans-splicing involves the antisense IGS sequence at the 5’ end of the ribozyme core. However, the trans-splicing ribozyme contains a tag-sequence at the 3‘ end that replaces a mutant homolog in the target RNA, resulting in a repaired functional messenger RNA. A schematic presentation of group I ribozymemediated repair is presented in Fig. 5. The corrected messenger can then be translated into a functional protein. The first in vitro trans-splicing experiment between the Tetrahymena ribozyme and oligonucleotides was reported by Inoue et al. in 1985 [67]. By changing nucleotides within the IGS antisense region, it became possible to direct transsplicing into new targets [103]. At the same time, self-splicing of the Tetrahymena intron was reported in vivo in E. coli [104,105]. Here, the intron was inserted into the lacZ-coding region and splicing resulted in a functional messenger of the a-complement of p-galactosidase. In a similar approach, the phage T4 tdintron was found to successfully self-splice in E. coli from the chloramphenicol acetyltransferase gene-transcript [1061. More recently, Sullenger and Cech [1071 reported trans-splicing in E. coli using the Tetrahymena L-21 ribozyme and the lacZ transcript. However, in their experimental setting the 5’ exon RNA was a short truncated version of the lacZ gene that included a ribosomal binding site, the first 21 coding nucleotides, the 5’ splice site, and two additional adenosine residues at the 3’ end. The second RNA molecule contained the Tetrahymena ribozyme core tagged at the 3‘ end with the downstream 3‘ lacZ exon. Zhznssplicing in this artificial situation was detected by reverse-transcription polymerase chain reaction (RT-PCR). Recently, Jones at al. [1011 reported group I ribozyme-mediated trans-splicing within mammalian cells. Two different model systems were used: a T7 expression plasmid system similar to that of the E. coli experiments [107], and a system dependent on a retrovirus expression vector. Both vectors were transfected into mouse fibroblast cells (OST7-l), and trans-spliced lacZ gene transcripts were detected either by RT-PCR or 5‘-RACE (rapid amplification of cDNA ends) PCR of isolated total RNA. Sequencing analysis of RT-PCR products revealed that the precision of trans-splicing was perfect. 5’-RACE-PCR was used to study the specificity of the in vivo reaction. Sequence analysis of the amplification products showed that most of the products originated from targets other than

123

clp

I Fig. 5. Gene-repairbased on trans-splicing group I ribozymes. A 3'-tagged ribozyme recognizes and binds to a mutant messenger RNA 5' of the mutation (M). Mutant 3'-regions of the messenger are exchanged by a homologous wild-type (wt) sequence, resulting in a corrected functional transcript.

the lacZ transcript. The low target specificity is probably due to the short six base pairs 5' exon binding site. However, trans-splicing ribozymes are novel tools in the therapy of genetic diseases like sickle-cell anemia [102,108]. One major advantage of this method is that the endogenous expression pattern of the corrected gene is maintained

124 [141. In addition to the repair approach described above, designed trans-splicing group I ribozymes may act as antiviral agents [107].

In vitro selection and in vitro evolution strategies applied on group I ribozymes In vitro selection and in vitro evolution strategies have been used to artificially alter natural group I ribozymes into new functional structures or catalytic abilities. These engineered ribozymes are becoming interesting new tools in biotechnology A number of recent reviews have focused on in vitro selection [ 109- 1111 and in vitro evolution [ 15,112- 1141 of different RNAs. Both in vitro strategies start with a large pool of randomized sequences, usually 10l2 to 10l8 molecules, representing all possible sequence variants [ 151. Then, the appropriate molecule is selected for by specific binding or catalytic abilities. If amplification steps are included in the selection process, then the term SELEX (systematic evolution of ligands by exponential enrichment) is commonly used [1151. In vitro selection has been further developed into in vitro evolution by including a mutagenesis step during amplification in each cycle (or generation) [ 151. Two different categories of information are obtained from group I ribozymes by in vitro selection and in vitro evolution strategies. First, information about RNA structure and basic conditions for catalysis. Second, new knowledge about substrate specificity in catalysis and binding. Phylogenetic analysis of homologous molecules has been proven to be a very powerful approach to study secondary and tertiary structural features of group I introns [48]. In vitro analysis may be a way to extend phylogenetic sequence information. Green et al. [116] used in vitro selection to study two particular regions (J3/4 and J7/3) in the catalytic core of the Tetruhymena ribozyme where phylogenetic data suggest covariations. Nine positions from those regions were randomized. A library of 10" to 10" molecules representing all sequence variants (about 250,000) was made, and transcribed from the T7 promoter. In a reaction scheme that included three rounds of selection (reaction, reverse transcription, PCR amplification and transcription), active variants were isolated and sequenced [1161. The results confirmed most of the sequence covariation previously suggested from the phylogenetic data. The most common sequence variant selected was the wild-type sequence. In a related study on the Tetruhymena intron, Lehman and Joyce [117] selected variants of the ribozyme with an altered metal ion specificity They used the in vitro evolution strategy, since their reaction scheme had included a mutagenesis step during PCR amplification.With a starting pool of more than 1013molecules, and eight generations of mutagenesis, amplification and selection, they were able to isolate group I ribozymes that work with Ca2+ as the cationic cofactor. More recently, other regions of the Tetrahymena ribozyme have been analysed. Williams et al. [78] have described in vitro selection experiments to evaluate functions of the P5 domain. In addition to the Tetruhymena ribozyme, structures of the T4 sunY ribozyme have been investigated by in vitro selection and in vitro evolution strategies [118,1191.

125 The second category of analysis develops novel catalysts by altering the substrate specificity of group I ribozymes. Joyce and co-workers started with derivatives of the Tetrahymena ribozyme that consisted of a constant scaffold (mainly PlyP2, P5,P6, and P9) and randomized positions in the central regions by 5% mutagenesis in each generation [120]. Starting with a population pool of lOI3 molecules they selected, by in vitro evolution over 10 generations, a ribozyme variant that cleaved a single-stranded DNA substrate with a 100-fold increase compared to the wild-type ribozyme activity [121,1221. The DNA cleaving ribozyme was further improved by Tsang and Joyce [1231. After 27 successive generations of in vitro evolution, a group I ribozyme was isolated with a 105-foldoverall improvement in activity. This was done by varying conditions such as substrate concentration and reaction time. Other catalytic activities such as RNA ligation and amide bond formation, in addition to RNA and DNA cleavages, may be obtainable by the in vitro evolution approach [124]. Chemotherapy based on group I ribozymes as targets

Any chemotherapeutic strategy requires a differential response between host and target cells. In principle, any parasitic cell or organism may be the target of chemotherapy as long as a compound, such as an antibiotic, with suficiently specific activity can be found. With the increase in antibiotic resistance among pathogenic bacteria, it is important to search for new ways of designing chemotherapeutic strategies. The targeting of RNA and ribozyme function has now become a possibility, based on increasing information in the following two areas: 1. Some real or potential pathogens are now known to contain self-splicing group I introns. 2. The equally striking finding that these group I ribozymes are directly affected by antibiotics make these molecules realistic targets for inhibition of function. This section will discuss some of the information available in this field. Antibiotics and group I ribozymes

The finding that antibiotics interact with ribozymes has influenced the thinking about the origin of life and has contributed to the concept of the RNA-world as the originator of life on earth. On the other hand, this new knowledge raises the possibility that the inhibitory activity which many antibiotics have on prokaryotic translation, traditionally ascribed to interaction with protein factors of the ribosome, is in fact due to direct interaction between RNA and the antibiotic. Thus, the possibility of new strategies in the development and use of antibiotics must be considered. Furthermore, the observations that interaction between antibiotics and RNA extends to the self-splicing group I ribozymes, opens up a completely new potential for chemotherapeutic strategies. Here we will briefly review some of the data pertaining to ribozymes and their interaction with antibiotics. Next we will discuss two examples where antibiotic inhibition of ribozymes already appears to allow new chemotherapeutic strategies to be considered.

126 One of the first reports on antiribozymal activity by an antibiotic was published by von Ahsen and Schroeder [125] and showed that streptomycin inhibits the splicing of the group I intron of the thymidylate synthase gene (td-intron) of phage T4. Here the inhibition occurred by competition with the guanosine (G) cofactor in binding to the G-binding site in P7 via the guanidino group of streptomycin. Considerably more interest was attached to the findings that several compounds such as aminoglycoside and peptide antibiotics, also interfere with ribozyme activity via a noncompetitive mechanism related to the structure of the RNA molecules [126-1281. Not only do several antibiotics interfere with the regular splicing mechanism in these in vitro experiments, some of them also induce novel reactions such as oligomerization of the intron [129]. This information adds up to a picture where one can envisage that secondary metabolites, such as antibiotics, have always played a part as modulators of RNA function, and that this manifests itself today in the fact that many antibiotics have been shown to interfere with ribozyme fbnction [16]. These observations may be summarized in the following conclusions, all referring to studies on the td-intron of phageT4: gentamycins, acting mostly on the second step of splicing, but with members such as sisomycin and 5-epi-sisomycin having marked inhibitory effect on both steps in the splicing process, are potent inhibitors of these reactions. However, other members of the gentamycins, such as the widely used G418, have no effect on either step, giving evidence for the narrow range of specificity encountered among these antibiotics in their inhibitory action on ribozymes. Among the neomycins most members have an effect on the second step of splicing, while some also inhibit the first step. Among the kanamycins some inhibit the second step of splicing, but none appear to have an effect on the first step. Finally, among the peptide antibiotics interesting effects on group I ribozyme activities may be found: viomycin inhibit both steps at relatively high concentrations and tuberactinomycin inhibits the first step, also at relatively high concentrations. The latter antibiotic has also been found to have the peculiar effect of causing oligomerization of the intron. The data referred to above all concern the td-intron of phage T4. The exact effects which a certain antibiotic will have on a given ribozyme varies from one intron to another. Thus, to evaluate a certain therapeutic potential one shall have to screen the available antibiotics for their activity in order to reach any conclusions applicable to that particular situation. This is exactly what has been done, and is being done, in a few cases to which therapeutic potential is being tied. It is also a promising fact that the interaction between ribozymes and antibiotics shows such a degree of specificity, since this suggests that it might be possible to accurately design antibiotics for highly specific inhibitory activity Examples of parasitic organisms suitablefor ribozyme-directed chemotherapy

The potential for a chemotherapeutic strategy alluded to above has not been given broad attention. Nor are there many examples at the present time where

127

this possibility is obviously available. However, the fact that group I introns have been observed in fungi, protists and bacteria, but not in higher eukaryotes such as mammals, immediately suggests that specific inhibitors of group I introns might provide a principally new way of treating some infectious diseases. A scheme for splicing inhibition by antibiotics is presented in Fig. 6. Failure to splice introns from the preribosomal RNAs may produce dysfbnctional ribosomes with a subsequent loss of viability We will discuss two possible cases of chemotherapy based on ribozymes as targets. Pneumocystis carinii By far the most important and potent case would seem to be the fbngus Pneumocystis carinii [130], a single-celled eukaryotic pathogen known to cause pneumonia (PCP)in immunosuppressed individuals. PCP is responsible for much of the mortality associated with AIDS. Studies of the rDNA of this organism first showed that the SSU rRNA gene contained a self-splicing group I intron [131,1321. Suggestion was made that this intron would be a potential chemotherapeutic target. Further studies by Leibowitz and co-workers revealed that I! carinii rDNA showed a variety of group I introns, all of which could be regarded as potential targets for a chemotherapeutic strategy [133]. The conclusion from this latter work was that one isolate from rat contained introns in both SSU and WmNA

5'--T

/ Exclad Introwligatedexons

1 FunctionalrRNAMbooomw

Y

ANTIBIOTIC RIBOZYME INHIBITORS

No intron splicing

1 No functional rlbo8omw

1

1

I Viability I

I No vlabiiity I

Rg.6. Antibiotic-mediated chemotherapy based on group I intron splicing as the target. Excision of introns and ligation of exons of intron-containing pre-rRNA is essential for host viability (left). Splicing inhibition by antibiotics (right) results in unspliced pre-rRNA and dysfunctional ribosomes, with a subsequent loss of host viability

128 LSU rRNA genes, while another rat isolate and a human isolate only contained an intron in the LSU rRNA gene. These four introns all catalyzed their own excision from the pre-rRNA transcripts, hlfilling the criteria of self-splicing group I introns. Furthermore, the antipneumocystis drug pentamidine, a linear peptide antibiotic, and several analogues of this drug, inhibited the ribozymemediated self-splicing reactions in vitro. The existence of these group I introns in the nuclear rRNA genes of Pneumocystis, as well as in mitochondrial genes of many hngi, distinguish these organisms from mammals. Thus it is clear that, provided that the drugs which are active in vitro can be made available to the cells in vivo, it should be possible to develop chemotherapeutic strategies against this and similar organisms based on the inhibition of intron splicing. Extending these studies, it was found that various pentamidine analogues varied considerably in their ability to inhibit the splicing reactions [134,1351. These results, where some modifications completely abolished the inhibitory activity, while other potentiated the inhibition, points to the considerable potential of work aimed at developing new drugs with narrow specificities directed against relevant ribozymes. The screening of such design-inhibitors could be done in vitro using the intron self-splicing reactions, before testing in vivo using cells. In summary, work on P carinii has shown that group I introns provides a new and potentially very useful target for novel chemotherapeutic strategies. Here the antibiotic pentamidine, currently much in use in fighting Pneumocystis infections in immunodepressed individuals, has been shown to be an efficient inhibitor of the essential splicing reactions of the group I introns found in the ribosomal RNA genes of this pathogen. While it has not yet been conclusively shown that pentamidine is effective because it inhibits these ribozymes, the potential for this kind of chemotherapy is clearly demonstrated. Human hepatitis delta virus Human hepatitis delta virus (HDV) is a single-stranded satellite RNA virus of the human hepatitis B virus. HDV may pose a health threat in populations where chronic hepatitis B is occurring. Both genomic and antigenomic sequences contain ribozymes which are essential for viral replication. Structural and hnctional features of HDV ribozymes have been discussed in recent reviews [80,92,95,97]. In a study by Rogers and co-workers [136], the activity of several antibiotics against viral self-cleavage was tested. It was found that some antibiotics of the aminoglycoside, tetracycline and peptide classes inhibit HDV cleavage in vitro at micromolar concentration. Gentamicine, neomycin and 5-epi-sisomycin were the most effective aminoglycoside inhibitors of self-cleavage. Simple pseudodisaccharides such as T-de-N-L - p-1ysyllysinomicin also inhibited HDV selfcleavage. Finally, peptide antibiotics of the tuberactinomycin class inhibited the ribozyme reactions of HDV, with viomycin, tuberactinomycin A,B and di-P -1ysyl capreomycin IIA being most active. This study [136] concludes that the interaction of the antibiotic with the ribozyme is likely to be specific. First, kanamycin A and tuberactinomycin N were very poor inhibitors, while the structurally

129 related neomycin and viomycin antibiotics, respectively, were active. Neomycin, differing from paromomycin at only one position, inhibits at 35 pM, while paromomycin had little effect at 500 pM. In general, among the more than 200 antibiotics tested for effects on catalytic RNA hnction, only a few inhibit ribozymes, indicating that antibiotic inhibition of ribozyme activity is specific, giving h t h e r credence to the suggestion that this has chemotherapeutic potential. Now, the HDV ribozyme is neither a group I ribozyme, nor a hammerhead ribozyme, which can also be inhibited by certain antibiotics. However, since an antibiotic such as viomycin, well-known to be active against group I ribozymes as reviewed above, was a quite efficient inhibitor of the HDV ribozymes, one might speculate that certain antibiotic binding sites have been preserved between ribozymes of different kinds as a relic of ancient molecular history If so, one might hope and expect that it could be possible to develop antiribozymal antibiotics which showed general activity against ribozymes of viral pathogens, of a fairly wide range, while the putative human host cells would be spared. A model system of ribozyme-directed chemotherapy The new chemotherapeutic strategy deserves continued interest and may lead to valuable new possibilities for treatment. One model system to approach the question of developing ribozyme-directed chemotherapy might be the Didymium DiSSU1 intron which consists of two distinct group I ribozymes of different fbnctions [52,62]. As discussed in the “self-splicing” section of this chapter, one of the ribozymes (DiGIR2) is responsible for intron splicing whereas the other (DiGIR1) is suggested to regulate the expression of the intron coded homing endonuclease I-Dir I. Recently, we have explored the differential inhibition of the two ribozymes DiGIRl and DiGIR2 in this optional and mobile intron. A number of antibiotics within the groups alluded to above were explored for their in vitro inhibition activities, and a differential effect was indicated with some of these (unpublished results). These antibiotics include the cyclic peptide viomycin, the aminoglycoside 5-epi-sisomycin, and chelocardin, the latter being a member of the tetracyclinegroup antibiotics. If the same differential effects could be obtained from in vivo experiments where Didymium amoebae were exposed to the same antibiotics in appropriate concentrations, then the ribozyme-dependent expression of the intron protein I-Dir I could be studied in a novel approach. However, similar to problems associated with the use of ribozyme tools in cells, the in vivo inhibitions of naturally occurring group I ribozymes by antibiotics are difficult to control in an experimental cellular setting. Problems related to uptake of antibiotics into the living cell and endogenous effects other than on target introns, need to be solved before actually applying such inhibitors to pathogens.

130 Group I intron-encoded proteins

At least 130 different examples of proteins (or putative proteins) encoded by group I introns have been described in the literature. These include about onethird of all reported group I introns. ORF-containing introns are found in eubacteria and phages, in chloroplast and mitochondrial genomes, and in the nuclear rDNA of a few protists. However, most intron-ORFs are found in mitochondrial genomes, and more than 70 reported cases are known only in fungi. The distribution of ORF-containing and ORF-lacking group I introns differs dramatically between genetic compartments.Whereas a great majority of group I introns in fungi mitochondria and phage genomes contain ORFs, only a small fraction (ca. 5%) of the nuclear rDNA do. Here, large ORF-containing group I introns appear only to be associated with extrachromosomal nuclear rDNAs [38]. The intron-proteins vary greatly in size, ranging from 89 to 700 amino acids. ORFs are always located in peripherical domains of the RNA structure with P8 as the most frequent location. Group I intron ORF proteins seem to fall into three categories based on function (Table 1).

Structural proteins, RNA maturases, and DNA endonucleases The first category, only found among the mitochondrial group I introns, is the structural proteins. Two different proteins are found in Podospora, the ribosomal protein S5 in the rDNA intron PaLSU2 [137] and the NADH dehydrogenase 4L (ND4L) subunit in the PaND4Li1 [138], which in fact interrupts a second copy of the ND4L gene [1391. The S5-protein has also been identified in a homologous mitochondrial rDNA intron of Neurospora [1391. Recently, group I introns were reported in the mitochondrial genomes of primitive animals [44].Three different species of sea anemones contain two group I introns each. One of the introns (the ND5 intron) contains two NADH dehydrogenase genes (ND1 and ND3). Unlike the Podospora ND4L, NDl and ND3 are single-copy genes. The second category of intron-proteins is the maturases, proteins that are required for RNA splicing of its own intron, or in a few cases, other group I introns present in the same genome [140]. All known group I intron maturases are from yeast mtDNA (Table 1). These activities have only been demonstrated genetically since no biochemical assays for maturases are available [66]. However, based on sequence similarities additional maturases are likely to be present among the unassigned group I intron ORF fimctions, especially those from mtDNA of different yeast species [141]. The majority of group I intron proteins are DNA endonucleases, and about 20 confirmed cases are known (Table 1). As will be discussed below, these enzymes are usually involved in group I intron mobility at the DNA-level. Intron endonucleases (or homing endonucleases) have recently been reviewed [9,12,13,17,38] and will only be briefly discussed here. Sequence similarities between confirmed endonucleases and functional unknown ORF-proteins

131 liable 1. Group I intron proteins with known functions.

Name"

Functionb

I-EvI I-2v I 1 I-RvIII] I-HmuI I-HmuII

Ho-ENw Ho-ENase ENase ENase ENase

245 258 269 174 185

I-C*e I I-CeuI I-ChuI I-CpaI I-Cpa I1

Ho-ENase Ho-ENase ENase ENase ENase

163 218 218 152 234

I-Csm I

Ho-ENase

237

Size"

Motif'

Intron'

Organism

Reference

phage T4 phage T4 phage RB phage SPO phage SP8

t17l

(Eubacteria; phages) GIY HNH HNH HNH

T4td T4sunY T4nrdB SpoPol SP8pol

r171 71 126,1601 126,1601

(Chloroplasts;protists) LAG LAG LAG LAG LAG

CrLSUl CeLSU5 ChLSUl CpLSU2 CpSSUl

Chlamydomonasreinhardii C. eugametos C. humicola C. pallidostigmatica C. pallidostigmatica

(Mitochondria;protists) LAG

CsCOBil

Chlamydomonassmithii

(Mitochondria; fungi) I-See I I-See I1

Ho-ENase Ho-ENasel Maturase I-Sce III Ho-ENase I-Sce IV Ho-ENase Maturase Maturase Maturase Maturase N W L Structural rpS5 Structural rpS5 structural

235 316

LAG LAG

ScLSUl ScOXli4

Saccharomyces cerevisiae S.cerevisiae

334 306 89 463 426

LAG LAG

ScOXli3a ScOXli5a ScCOBi3 ScCOBi4 ScCOBi5 SpOXlil PaND4Lil PaLSu2 NcLSUl

S. cerevbiae

NDl ND3 NDl ND3 ND1 ND3

Structural Structural Structural structural structural structural

334 118 -

I-Dir I P -I' I I-NjaI Wan1 I-Nit1

Ho-ENase Ho-ENase ENase ENase ENase

-

-

LAG LAG -

I1 7,1531 [171

S.cerevisiae S.cerevisiae S.cerevisiae S.cerevisiae

[166,221J [166,221] [166,221] Schizosaccharomyces pombee [222] [1381 P anserina [1371 E! anserina (1 391 Neurospom crassa

(Mitochondria; animals)

-

-

-

MsND5il MsND5il AeND5il AeND5il TspND5il TspND5il

[441

Metridium senile M. senile Anthopleura elegantissima A. elegantissima Ealia sp. Ralia sp.

W1 1441 1441 [441 [441

(Nuclear; protists) 261 163 238 238 238

HC HC HC HC HC

DiSSUl PpLSU3 NjSSUl NaSSUl NiSSUl -~

Didymium iridis Physarum polycephalum Naegleriajamiesoni N andersoni N italica

UP 159,1731

UP UP ~~~

up up

~

"htmn endonucleases are named according to [223]. NDl, ND3, ND4L are subunits of the mitochondrial NADH dehydmgenseprotein complex. rpS5 is the ribosomal protein S5. bENase, endonuclease;Ho-ENase, mdonuclease known to initiate intron homing. Endonuclease and maturase activities have been demonstrated by biochemical and genetical methods, respectively Structural proteins have been identified by sequence homology. 'Size in amino acids. dSequence motifs present in proteins. See text for more information. =GroupI introns are named according to [48,224]. UP = unpublished.

132 suggest that many of the cloned and sequenced group I intron ORFs are DNA endonucleases. In fact, the ORFl and ORF2 proteins of the Podospora mitochondrial group I introns PaND 1i4 and PaOX 1i7, respectively, have recently been shown to be directly involved in intron homing. It is very likely that these proteins are new members of the homing endonucleases [ 1421. The intron endonucleases can be grouped into several families based on the presence or absence of specific sequence motifs: LAGLI-DADG (LAG), GIYYIG (GIY), His-Cys Box vlc>, and HNH [9,17,143]. These sequence motifs may not all represent distinct evolutionary histories of the endonuclease proteins. However, endonucleases with different motifs seem to prefer distinct genetic compartments. Whereas the motifs HNH and HC are almost exclusively found within intron proteins from phage and nuclear genomes, respectively, LAG and GIY motifs are more widespread and most frequently observed in chloroplast and mitochondrial intron proteins. No certain hnction has been associated with the different sequence motifs, except the LAG-motif. Most “LAG”-proteins have two copies of the motif, P1 and P2 [9]. Recently, Gimble and Stephens [144] reported that both the LAG-motif copies of the intein endonuclease PI-Sce I were directly involved in DNA cleavage. Furthermore, the LAG-motif has been shown to participate in binding and positioning of metal ions important for DNA cleavage by the archea endonuclease I-Por I (J. Lykke-Andersen and R.A. Garrett, personal communication). Thus, it appears that the LAG-motifs are directly involved in the catalytic center of the endonucleases. Biological properties of group I intron endonucleases

The intron endonucleases are small proteins, usually between 150 and 300 amino acids (Table 1). Most group I intron endonucleases are homing endonucleases, and features of these enzymes have been extensively reviewed [9,17]. Two different biological processes are associated with group I intron endonucleases: intron homing and marker exclusion. Zntron homing and marker exclusion Two distinct versions of group I intron mobility have been observed; intron transposition and intron homing, resulting in transfer into nonallelic and allelic sites, respectively [9]. Transposition of group I introns during cellular evolution has been suggested from DNA sequencing studies, but has so far not been demonstrated directly in living cells. However, transposition experiments by reversesplicing in vitro have been reported [73,145]. About 10% of the ORF-containing group I introns have been demonstrated to be mobile in vivo by homing. These mobile introns include the two phage T4 introns td and sunY [146,147], the Chlamydomonas chloroplast introns CrLSUl and CeLSU5 [148,149], the Chlamydomonas mitochondrial intron CsCOBi 1 [ 1501, the yeast mitochondrial introns ScLSU1, ScOXli4, ScOXli3a and ScOXli5a [151-1541, the Podospora

133 mitochondrial introns PaNDli4 and PaOXli7 [142], and the nuclear introns PpLSU3 and DiSSU1 from the myxomycete Physarum and Didymium, respectively ([59], S. Johansen et al., submitted). The experimental approach used to demonstrate group I intron mobility is genetic crossing of intron-lacking and intron-containing strains [12,131. Intron homing is explained by the double-strand break repair (DSBR) pathway; a DNA repair mechanism first described for mating type switching in yeast [155] and later shown to be universally distributed [156-1581. The first step in intron homing is cleavage of the intron-lacking target allele (homing site) by the intron-encoded homing endonuclease. This double-strand break is subsequently repaired by a gene conversion event using the intron-containing allele as a template resulting in a unidirectional transfer of intron sequences and co-conversion of flanking homologous sequences. In addition to DSBR, alternative pathways of intron homing have been described in the E. coli phage T4 [9,159]. More recently, Shub and co-workers reported a second biological process associated with group I introns and intron-encoded endonucleases [1601. Several ORF-containing group I introns in Bacillus bacteriophage genomes were identified and characterized [24,161]. The two related phages SPOl and SP82 contain similar group I introns at identical positions in their DNA polymerase genes. Both introns encode site-specific DNA endonucleases: I-Hmu I and I-Hmu I1 (see Table 1). However, the protein sequences are only weakly conserved (43.8% identity). This is in contrast to the group I ribozyme parts of the introns which are almost identical. I-Hmu I and I-Hmu I1 are highly unusual in that they only nick the template strand of the target DNA. Furthermore, each nuclease prefers DNA of the heterologous phages, regardless of whether the intron is present or not. During mixed infection with SPOl and SP82 in Bacillus, the SP82-encoded I-Hmu I1 endonuclease performed an efficient exclusion of the corresponding SPOl markers [ 1601. Thus, marker exclusion confers selective advantages to group I introns. Examples of rare- cutting homing endonucleases of biotechnological relevance Among the approximately 20 rare-cutting endonucleases encoded by group I introns (Table l), three enzymes are of special importance in relation to history, properties, and application as tools in biotechnology (see below). These are the I-See I from mitochondria of the yeast Saccharomyces cerevisiae, the I-Ceu I from chloroplast of the algae Chlamydomonas eugametos, and the I-Ppo I from nucleus of the myxomycete Physarum polycephalum. I-Sce I was the first homing endonuclease to be characterized [162-1651. Several aspects of its biology and biochemistry have been reviewed [12,17,166]. The 235 amino acid I-Sce I protein is encoded by the intron ScLSU1, located within the mitochondrial LSU rRNA gene in yeast. Its minimal recognition sequence is approximately 18 base pairs spanning the intron insertion site, it is highly sequence specific, [1671, and creates a four nucleotide 3’ overhang during

134

cleavage (Fig. 7). Physical analysis [168] suggest that I-Sce I initially binds strongly to sequences downstream from the intron insertion site, and then to upstream sequences by major groove interactions. These interactions bring the catalytic site of the enzyme into the right position for DNA cleavage. The turnEUKARYOTIC Chloroplast

5 ' -CTGGGTT

I-Cre I

I-ceu I

I-Chu I

5 I-ATAAGATCCI'AAGGT 3 '-TATTCTAGGATTCCA

I-Cpa I

'-ATAAGATCCI'AAGGT 55'-GAATAAGCCCCGGCT 33' -CTTATTCGGGGCCGA '-TATTCTAGGATTCCA

I-Cpa I1

5 ' -GAATAAGCCCCGGCT Mitochondri a1 3 ' -CTTATTCGGGGCCGA

I-Sce I Mitochondri a1 I-Sce I1

I-Sce I11

I-Sce IV

.

5 '-GI'ACTAGCATGGGGT CAAATGTC"TCTGG-3 3 '-CATGATCGTACCCCA GTTTACAGNVGACC-5

I-csm I

Fig. 7. Target sites of rare-cutting homing endonucleases. Cleavage sites are presented as staggered lines, and gaps in sequences indicate intron insertion sites. Cleavage sites of I-CsmI, I-DirI, and PITZiII have not been determined. Minimal recognition sequences are boxed. References are: I-ChuI, I-SceIII, I-SceIV, I-Csm I, I-Tev 11, I-Tev 111, I-Dmo I, PI-TZi I, and PI-Tli I1 (see [17]);I-Cre I, [213]; I-Ceu I, [170-1721; I-Cpu I and I-Cpu 11, [21,37];I-Sce I, [17,163,164];I-Sce 11, [214,215];I-Ppo I, [173,174];I-Nju I, (M. Elde et al. unpublished results); I-Dir I, (S. Johansen et al. submitted); PI-Sce I, [144,216];I-Tev I, [217,218];I-Por I, [219];PI-Psp I, [17,220].(Figure continued on next page.)

135 Nuclear I-Ppo I

I-Nja

I

5 '-GTGGAACCTGAGGCT TAATTTGACI'CAACA-3' 3 '-C4CC'ITGGACTCCGAATTMCTGAGTTGT-5 '

I-Dir I

5 '-ATpcTATGTCGGGTGCIGGAGAAFGAGGTAAT-3 ' 3 '-TAGATACAGCCCTCTTTCTCCATTA-5 '

PI-Sce I

Eubacterial I-Tev I

GCTCAGTAGATGT'ITTCTTGGGT

CGAGTCATCTACAAAAGAACCCA 5 ' -TCCAAGCITATGAGT 3 ' -AGGITCGAATACTCA GTACCI'TTAACTTCC-3' C A T 5 '

I - T e v I11

Archaebacterial

I-Dmo

I

I-Por I

PI-Tli

I

5 '-AAAITGCl'TGcAAAC AGCTATTACGGCTAT-3 ' 3 ' -TTTAACGAACGTTTG TCGATAATGCCGATA-5'

PI-Tli

I1

5 ' -AAAATCCCGGCAAAC AGCTATTA%GTAT-3 3 ' -TTTIAGGACCGTTTG 5-ATACCCA'AGCT

PI-Psp I

' '

Fig. 7.Continued.

over rate for I-Sce I is low, only 0.058 min-' [165]. The chloroplast intron CeLSU5, which encodes I-Ceu I, is mobile during interspecific crosses between the intron-containing C. eugumetos and the intronlacking C. moewusii [149]. I-Ceu I is a 218 amino acids protein [169]. Similar to I-Sce I, it is coded by an intron in the LSU rRNA gene, has an 18 base pair recognition sequence, and creates a four nucleotide 3' overhang during cleavage (Fig. 7) [170- 1721. In contrast to I-Sce I, I-Ceu I preferentially cleaves the coding

136 strand five nucleotides upstream from the intron insertion site of an intronless rDNA. Thus, the rate-limiting step in the reaction is the bottom strand cleavage [172]. Furthermore, I-Ceu I is much more stable than I-Sce I , probably because its stability is not dependent on the presence of substrate DNA [169]. I-Ppo I is encoded by the third group I intron (PpLSU3) in the nuclear LSU rRNA gene of Z? polycephalum (Carolina isolate) 159,1731. I-Ppo I is a small protein of 163 amino acids (not 138 amino acids as previously reported) which binds its recognition sequence as a homodimer [174]. The minimal DNA target sequence (homing site) is 13-15 base pairs, spanning the intron insertion site, and creating a four nucleotide 3’ overhang during cleavage (Fig. 7) [174]. I-Ppo I binds DNA tightly and bends DNA upon binding [175]. This endonuclease is very active, with a turnover rate of 2.6 min-’, about 50 times higher than I-Sce I [176]. This is in the same order as the type I1 restriction enzyme EcoRI (3.4 min- ’). Relationships between rare-cutting homing endonucleases and type 11 restriction enzymes?

With the exception of a restriction enzyme from a eukaryotic Chlorella virus [1771, all of the approximately 2,400 known restriction enzymes are of prokaryotic origins [ 1781. In contrast, rare-cutting homing endonucleases have so far mainly been found in eukaryotic compartments [171, with a few examples in prokaryotes (Table 1). Their biological functions seem to be different. Whereas type I1 restriction enzymes are components in the restriction-modification system involved in bacterial defense, homing endonucleases perform self-propagation of their own genes. Despite these apparent differences in the biology, several common features are seen in the mechanism of DNA cleavage and specificity/organization of the recognition sequence. First, both categories of endonucleases cleave the double-stranded DNA target in a Mg2+-dependent and highly sequence-specific manner close to, or at, their DNA recognition sequences [17,1791. Second, whereas most type I 1 restriction enzymes recognize a short palindromic sequence of four to six base pairs, some have asymmetrical target sequences and others have large recognition sequences similar to the rare-cutting homing endonucleases. Examples of the latter are Sfi I and Xcm I with recognition sequences of 13 and 15 base pairs, respectively [178]. This is the same size as for the I-Ppo I homing endonuclease [174]. However, the Sfi I and Xcm I recognition sequences contain five and nine base pairs, respectively, that are completely degenerate in specificity Finally, type I 1 enzymes show a variety of cleavage patterns which include 5’ and 3’ overhangs of one to five nucleotides, as well as blunt ends. The majority of homing endonucleases create four nucleotide 3’ overhang at, or very close to, the intron insertion site (Fig. 7). Exceptions are the phage enzymes I-Tev I , 11, and 111, which all cleave at short distances (13 to 23 nucleotides) from the intron

137 insertion sites. These enzymes generate two nucleotide overhangs at the 3' (I-Tev I and 11) or 5' (I-Tev 111) ends [17]. Recently, we discovered an additional exception. The Naegleria homing endonuclease I-Nja I creates a five nucleotide 3' overhang with a degenerate central nucleotide (unpublished results). This resembles the subclass IIW of the restriction enzymes, which all create similar odd-number nucleotide overhangs [1801. The common features of the type I 1 enzymes and the rare-cutting homing endonucleases appear to be restricted to certain subclasses. Recently, Wittmayer and Raines [175] noted a common putative active site motif among I-Ppo I and 10 different restriction enzymes (including EcoRI). Perhaps this could reflect an evolutionary relationship between some of the prokaryotic and eukaryotic enzymes. Interestingly, recent observations suggest that the genes encoding both categories of endonucleases are likely to be involved in horizontal transfers [181,182]. Applications of rare-cutting homing endonucleases

The large and complex recognition sites of rare-cutting homing endonucleases from inteins, archea introns and group I introns (Fig. 7) make these enzymes useM tools in molecular biology when large segments of DNA are analyzed or engineered [ 17,1831. Type I 1 restriction enzymes usually recognize four to eight base pairs of double-stranded DNA, corresponding to approximately one cleavage site per 102-105 bp of random sequence. However, these enzymes may be converted into rare cutters by the Achilles' cleavage strategy [184], or in the PNA-assisted rare cleavage approach [ 185,1861. Rare-cutting endonucleases from introns, however, have natural recognition sites between 15 to 20 base pairs [17], and cleave as infrequently as once per 109-10'2 bp (see Fig. 7). To date only three rare cutters from group I introns are commercially available; I-Sce I from Boehringer Mannheim Biochemica, I-Ceu I from New England Biolabs, and I-Ppo I from both Promega and New England Biolabs. Physical genome mapping

Two main approaches using rare-cutting homing endonucleases as tools in physical genome mapping have been reported: endonuclease-digestion of isolated chromosomal DNA and chromosome fragmentation after artificially inserted recognition sites. The yeast enzyme I-Sce I has no cleavage site in the entire yeast genome, except in mitochondrial DNA of strains lacking the original ScLSUl intron [163,164]. No naturally occurring sites are found in a variety of bacterial and phage genomes, except one site in phage T7 [167]. Thus, this mitochondrial enzyme may not be very informative in mapping studies of isolated genomic DNAs from prokaryotes or eukaryotes. In contrast, I-Ceu I from a Chlamydomonas chloroplast and I-Ppo I from the myxomycete protist Physarum cleave bacterial

138 and eukaryotic LSU rRNA genes, respectively, at one site each. The number of genome mapping studies using rare-cutting homing endonucleases is increasing. I-Ceu I cleaves bacterial rDNA, and has been applied for comparing genome structure of related bacteria species. The genomes of E. coli and Salmonella typhimurium were each found to contain seven copies of the rDNA interspersed in a conserved pattern within the genome. This was revealed in an approach based on I-Ceu I digestion followed by pulsed-field gel electrophoresis [187]. I-Ceu I digestion of the related S. typhi genome detected major rearrangements due to inversion and transposition of genome fragments [1881. Similarly, at least three rDNA loci were found in Rhizobium meliloti, and in combination with Southern blotting the orientation of each locus was determined [189]. A detailed physical map of Bacillus subtilis is of particular interest due to the progressive European B. subtilis genome sequencing project [1901. Based on I-Ceu I digestion, the B. subtilis chromosome was found to contain 10 interspersed rDNA copies [191]. The recognition site of I-Ppo I is not present in the E. coli [173] nor probably in other bacterial genomes. All eukaryotes appear to contain one I-Ppo I cleavage site in each of the rDNA repeats. It has been shown experimentally that yeast only contains I-Ppo I cleavage sites at chromosome XI1 where the approximately 130 copies of the tandem rDNA repeats are located [22]. Recently, I-Ppo I was used in a mapping study of a plant genome (Arabidopsis thaliana) [192]. Here, the two rDNA clusters were mapped at telomeric regions of different chromosomes. The second version of genome mapping based on rare-cutting endonucleases is chromosomal insertion of artificially I-Sce I recognition sites, followed by cleavage. This approach has been demonstrated in yeast [167,193]. Here, nested chromosomal fragmentation was performed by I-Sce I cleavage at single sites, either specifically inserted by homologous recombination or by random insertion using transposons. The method has been used to sort genomic clone libraries and to construct a physical map of yeast chromosomes [194,195]. Furthermore, it can be used to map flanking regions of an artificial I-Sce I site by partial digestion of type I 1 restriction endonucleases in combination with I-Sce I [193]. I-Sce I based mapping has been used in the European yeast sequencing program to facilitate mapping and cloning [193,196]. Also, genes within the genome of Candida albicans were mapped by the same strategy [197]. Induction of homologous recombination in eukaryotic genomes

Genome engineering has recently been developed as an approach for analysing hnctional rearrangement in complex genomes in order to study aspects of DNA repair, gene targeting, or new potential prospects for gene therapy [18,198,1991. Double-strand breaks are introduced in chromosomal DNA either by site-specific recombinases or rare-cutting endonucleases, and these lesions are most frequently repaired by nonhomologous or homologous recombination mechanisms, respectively.

139 The first experimental system that involved rare-cutting endonucleases was developed in the yeast nucleus [200]. Homologous chromosomal recombination was artificially introduced in yeast by expressing the HO-endonuclease from an inducible synthetic HO-gene along with its DNA target site (MATa) on a cotransfected plasmid [200]. The HO-endonuclease normally initiates a mating-type switch in yeast by the same DSBR-pathway as group I intron homing [12,13,155]. The approach was fhther developed to include I-Sce I [201], which promoted a recombinogenic activity similar to that previously described for the HO-endonuclease. Experiments on cells from multicellular organisms such as plants, Xenopus, and mammals have been reported [202-2041. Here, recombination was assayed on extrachromosomal target substrates such as cotransfected plasmids. Successfully induced homologous recombination was reported in tobacco protoplasts after expression of the I-Sce I gene along with its target site on a cotransfected plasmid [202]. Similarly, I- Sce I dependent homologous recombination was observed and analysed in Xenopus oocytes after microinjecting the enzyme [203]. An inducible site-specific homologous recombination system in mammalian cells, dependent on rare-cutting endonuclease, is a new and interesting approach for gene targeting in complex genomes [18]. However, to express the mitochondrial I-Sce I endonuclease in mammalian cells several modifications have to be performed at the gene level, including the universal code equivalent. A modified I-Sce I gene was expressed in different murine cell lines [204] and found to be nontoxic after constitutive expression. Furthermore, double-strand breaks and subsequent enhanced recombination of the extrachromosomal substrate target was observed. Artificial I-Sce I sites inserted into mouse chromosomal DNA allowed studies on chromosomal double-strand breaks directly in vivo [205-2081. Here, efficient cleavage and recombination at the genomic I-Sce I sites was reported. In contrast to the yeast experiments, both nonhomologous and homologous recombination were observed. A different application of rare-cutting homing endonucleases has been reported by Vogt and co-workers [22]. Constitutive expression of I-Ppo I is toxic in yeast cells due to cleavage of the rDNA repeats at chromosome XII. However, resistant cells can be obtained by cotransfecting an I-Ppo I expression plasmid with a plasmid that contains the Physarurn intron PpLSU3 and flanking exon sequences. Some I-Ppo I resistant cells gained PpLSU3 into all 130 rDNA repeats in yeast by homologous recombination between cleaved yeast rDNA and intron plasmid DNA [22]. Thus, a group I intron can artificially be introduced into heterologous organisms in a process that simulates intron homing in vivo. More recently, similar experiments have successfully introduced both the Tetruhymenu intron TtLSUl and mutant versions of PpLSU3 into yeast rDNA (J. Lin and YM.Vogt, personal communication).This approach may be useful for functional in vivo analysis of mobile nuclear introns in order to test how the intron ORFs apparently transcribed by RNA polymerase I [52,58] can be expressed from rDNA.

140

+LINK PI-SceI

I-Ppol

I-CeuI

PI - T l i I

uu

Eco RI Bgl 11

S m aI

Hpa I

Fig. 8. Schematic presentation of the multifbnctionsal polylinker PI-LINK [211]. Rare-cutting homing endonuclease sites are presented above and restriction enzyme sites below the line.

Specializedgene-cloningand expression systems Target sites of rare-cutting homing endonucleases have been incorporated in cloning and expression vectors since internal sites within random inserts are highly unlikely. Vectors containing I-Sce I have been designed for mapping and sequencing analysis [209,2lo]. More recently, a multifunctional polylinker containing the recognition sites of four commercially available homing endonucleases interspersed with 12 different type I1 restriction sites was designed for the cloning of large DNA fragments [211]. Two of the homing endonucleases, IPpo I and I-Ceu I, are of group I intron origin, whereas PI-Sce I and PI-Tli I are intein-encoded endonucleases (Fig. 8). The mammalian expression vector pCI-neo from Promega Corporation contains the target site of I-Ppo I [212]. This vector was designed for high, constitutive protein expression from cloned DNA inserts in mammalian cells. It carries the human cytomegalovirus immediate-early enhancer/promoter region that controls the expression of the insert. This promoter can be replaced with different promoter elements by cleavage of I-Ppo I and SgfI at incorporated sites flanking the promoter element. Acknowledgements Thanks to Jue Lin,Volker M. Vogt, Jens Lykke-Andersen, Roger A. Garrett and Jeff Rogers for communicating unpublished results, and to Kari Haugli and Truls Moum for making the MCB-lab complete. This work was supported by grants from the Norwegian Research Council, the Norwegian Cancer Society, the Erna and Olav Aakre Foundation for Cancer Research, the Odd Fellow Foundation for Medical Research, and the University of Tromsnr. References 1. Maxwell ES, Fournier MJ. The small nucleolar RNAs. Ann Rev Biochem 1995;35:897-934. 2. Tycowski KT, Shu M-D, Steitz JA. A mammalian gene with introns instead of exons generating

141 stable RNA products. Nature 1996;379:464-466. 3. Michel F, Ferat J. Structure and activities of group I1 introns. Ann Rev Biochem 1995;M435461. 4. Mills DA, McKay LL, Dunny GM. Splicing of a group I1 intron involved in the conjugative transfer of pRSOl in lactococci. J Bacteriol 1996;178:3531-3538. 5. Grivell LA. Mobile introns get into line. Curr Biol 1996;6:48-51. 6. Curcio MJ, Belfort M. Retrohoming: cDNA-mediated mobility of group I1 introns requires a catalytic RNA. Cell 1996;84:9-12. 7. Garrett RA, Aagaard C, Andersen M, Dalgaard JZ, Lykke-AndersenJ, Phan HTN, Trevisanato S, Ostergaard L, Larsen N, Leffers H. Archeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny. System Appl Microbiol 1994;16: 680-691. 8. Aagaard C, Dalgaard JZ, Garrett R. Intercellular mobility and homing of an archaeal rDNA intron confers a selective advantage over intron - cells of Sulflobus acidocaldurius. Proc Natl Acad Sci USA 1995;92:12285-12289. 9. Belfort M, Perlman PS.Mechanisms of intron mobility. J Biol Chem 1995;270:30237-30240. 10. Cooper AA, Stevens TH. Protein splicing: self splicing of genetically mobile elements at the protein level. Trends Genet 1995;20:351-356. 11. CechTR. Self-splicing of group I introns. Ann Rev Biochem 1990;59:543-568. 12. Dujon B. Group I introns as mobile genetic elements: facts and mechanistic speculations. Gene 1989;82:91-114. 13. Lambowitz AM, Belfort M. Introns as mobile genetic elements. Ann Rev Biochem 1993;62: 587-622. 14. CechTR. Group I introns: New molecular mechanisms for mRNA repair. BioTechnolohy 1995; 13:323-326. 15. Joyce GE In vitro evolution of nucleic acids. Curr Opin Struct Biol 1994;4331-336. 16. Davies J, von Ahsen U, Schroeder R. Antibiotics and RNA world: a role for low-molecularweight effectors in biochemical evolution. In: Gesteland RF, Atkins JF (eds) The RNA World. New York: CSHL Press, 1993;185-204. 17. Mueller JE, Bryk M, Loizos N, Belfort M. Homing endonucleases. In: Linn SM, Lloyd RS, Roberts RJ (eds) Nucleases, 2nd edn. New York: CSHL Press, 1993;lll-143. 18. Jasin M. Genetic manipulation of genomes with rare-cutting endonucleases.Trends Genet 1996; 12~224-228. 19. Johansen S, Johansen T, Haugli E Structure and evolution of myxomycete nuclear group I introns: a model for horizontal transfer by intron homing. Curr Genet 1992;22:297-304. 20. Vaughn JC, Mason MT, Sper-Whitis GL, Kuhlman P, Palmer JD. Fungal origin by horizontal transfer of a plant mitochondria1group I intron in the chimeric cox1gene of Peperomiu. J Molec E d 1995;41:563-572. 21. lbrmel M, CbtkV, Otis C, Mercier J-P, Gray MW, Lonergan KM, Lemieux C. Evolutionary transfer of ORF-containing group I introns between different subcellularcompartments (chloroplast and mitochondria). Molec Biol Evol 1995;12:533-545. 22. Muscarella DE, Vogt VM. A mobile group I intron from Physarum polycephalum can insert itself and induce point mutations in the nuclear ribosomal DNA of Saccharomyes cerevisiue. Molec Cell Biol 1993;13:1023-1033. 23. Kidwell MG. Lateral transfer in natural populations of eukaryotes. Ann Rev Genet 1993;27: 235-256. 24. Belfort M, Reaban ME, Coetzee T, Dalgaard JZ. Prokaryotic introns and inteins: a panoply of form and function. J Bacteriol 1995;177:3897-3903. 25. Maley F, Chu FK, Maley GE Intron-associated splicing reactions in bacteriophageT4. Molec Microbiol 1990;4:867-871. 26. Goodrich-Blair H, Shub DA. The DNA polymerase genes of several HMU-bacteriophageshave similar group I introns with highly divergent open reading frames. Nucl Acid Res 1994;22:

142 3715-3721. 27. Mikkonen M, AltossaveT A group I intron in the terminase gene of Lactobacillus delbrueckii subsp. luctis phage LL-H. Microbiology 1996;141:2183-2190. 28. Kuhsel MG, Strickland R, Palmer JD. An ancient group I intron shared by eubacteria and chloroplasts. Science 1990;250 1570-1 573. 29. Xu M-Q, Kathe SD, Goodrich-Blair H, Nierzwicki-Bauer SA, Shub DA. Bacterial origin of a chloroplast intron: conserved self-splicing group I introns in cyanobacteria. Science 1990;250 1566- 1570. 30. Reinhold-Hurek B, Shub DA. Self-splicingintrons in tRNA genes of widely divergent bacteria. Nature 1992;357:173- 176. 31. Biniszkiewicz D, Cesnaviciene E, Shub DA. Self-splicinggroup I intron in cyanobacterialinitiator methionine tRNA: evidence for lateral transfer of introns in bacteria. EMBO J 1994;13: 4629-4635 32. Chowrira BM, Berzal-Herranz A, Burke JM. Novel RNA polymerization reaction catalyzed by a group I ribozyme. EMBO J 1993;12:3599-3605. 33. Tanner MA, Cech TR. Activity and thermostability of the small self-splicing group I intron in the pre-tRNA"' of the purple bacterium Azoarcus. RNA 1996;2:74-83. 34. Evrard J-L, Kuntz M, Straw NA, Weil J-H. A class-I intron in a cyanelle tRNA gene from Cyunophoru purudoxu: phylogenetic relationship between cyanells and plant chloroplasts. Gene 1988;71:115-122. 35. Hiratsuka J, Shimada H, Whittier R, Ishibashi T, Sakamoto M, Mori M, Kondo C, Honji Y, Sun C-R-, Meng B-Y, Li Y-Q, Kanno A, NishizawaY, Hirai A, Shinozaki K, Sugiura M. The complete sequence of the rice (Oryza sutivu) chloroplast genome: intermolecular recombination between distinct tRNA genes accounts for a major plastid DNA inversion during the evolution of the cereals. Molec Gen Genet 1989;217:185-194. 36. Gray MW. The endosymbiont hypothesis revisited. Int Rev Cytol 1992;141:233-357. 37. Turmel M, Mercier JP, CMV, Otis C, Lemieux C. The site-specific DNA endonucleaseencoded by a group I intron in the Chlumydomonus pallidostigmuticu chloroplast small subunit rRNA gene introduces a single-strand break at low concentrations of M e . Nucl Acid Res 1995;23: 2519-2525. 38. Johansen S,Muscarella DE, Vogt VM. Insertion elements in ribosomal DNA. In: Zimmermann RA, Dahlberg AE (eds) Ribosomal RNA: Structure, Evolution, Processing, and Function in Protein Biosynthesis. New York, London: CRC Press, 1996;89-108. 39. Cummings DJ, McNally KL, Domenico JM, Matsuura ET.The complete DNA sequence of the mitochondrial genome of Podospora unserinu. Curr Genet 1990;17:375-402. 40. Skelly PJ, Maleszka R. Distribution of mitochondrial intron sequences among 21 yeast species. Curr Genet 1991;19:89-94. 41. Wilson C, Fukuhara H. Distribution of mitochondrial rl-type introns and the associated open reading frame in the yeast genus Kluyveromyces. Curr Genet 1991;19:163-167. 42. Paquin B, Lang BE The mitochondrial DNA of Allomyces mucrogynus: the complete genomic sequence from an ancestral fungus. J Molec Biol 1996;255:688-701. 43. Ohta E, Oda K,Yamato K, NakamuraY, 'Iiikemura M, Nozato N, Akashi K, Ohyama K, Michel E Group I introns in the liverwort mitochondrial genome: the gene coding for subunit 1 of cytochrome oxidase shares five intron positions with its fungal counterparts. Nucl Acid Res 1993;21:1297-1 305. 44. Beagley CT, Okada NA, Wolstenholme DR. Two mitochondrial group I introns in a metazoan, the sea anemone Metridium senile: one intron contains genes for subunits 1 and 3 of NADH dehydrogenase.Proc Natl Acad Sci USA 1996;93:5619-5623. 45. Vader A, Nress J, Haugh K, Haugli F, Johansen S.Nucleolar introns from Physurumflavicomum contain insertion elements that may explain how mobile group I introns gained their open reading frames. Nucl Acid Res 1994;22:4553-4559. 46. Bhattacharya D, Surek B, Riising M, Damberger S,Melkonian M. Group I introns are inherited

143 through common ancestry in the nuclear-encoded rRNA of Zygnemutules (Churophyceue).Roc Natl Acad Sci USA 1994;91:9916-9920. 47. Yamada T, Tamura K, Aimi T, Songrosi P. Self-splicing group I introns in eukaryotic viruses. Nucl Acid Res 1994;22:2532-2537. 48. Michel F,Westhof E. Modelling of the three-dimensional architecture of group I catalytic introns based on comparative sequence analysis. J Molec Biol 1990;216:585-610. 49. CechTR, Damberger SH, Gutell RR. Representation of the secondary and tertiary structure of group I introns. Nature Struct Biol 1994;1:273-280. 50. Costa M, Michel E Frequent use of the same tertiary motif by self-folding RNAs. EMBO J 1995;14:1276- 1285. 51. CechTR. Structure and mechanism of the large catalytic RNAs: group I and group I1 introns and ribonuclease F? In: Gesteland RF, Atkins JF (eds) The RNA World. New York: CSHL Press, 1993;239-269. 52. Decatur WA, Einvik C, Johansen S,Vogt VM. Two group I ribozymes with different functions in a nuclear rDNA intron. EMBO J 1995;14:4558-4568. 53. Wild MA, Sommer R. Sequence of a ribosomal RNA gene intron from Etruhymenu. Nature 1980;283:693-694. 54. CechTR, Zaug AJ, Grabowski PJ. In vitro splicing of the ribosomal RNA precursor of Tetruhymenu: involvement of a guanosine nucleotide in the excision of the intervening sequence. Cell 1981;27:487-496. 55. Brehm SL,Cech TR. Fate of an intervening sequence ribonucleic acid: excision and cyclization of the Tetruhymenu ribosomal ribonucleic acid intervening sequence in vivo. Biochemistry 1983;222390-2397. 56. CechTR, Herschlag D, Piccirilli JA, Pyle AM. RNA catalysis by a group I ribozyme: developing a model for transition state stabilization. J Biol Chem 1992;267:17479--17482. 57. SteitzTA, Steitz JA. A general two-metal-ion mechanism for catalytic RNA. Proc Natl Acad Sci USA 1994;90:6498-6502. 58. Ruoff B, Johansen S,Vogt VM. Characterization of the self-splicingproducts of a mobile intron from the nuclear rDNA of Physurum polycephulum. Nucl Acid Res 1992;20:5899-5906. 59. Muscarella DE,Vogt VM. A mobile group I intron in the nuclear rDNA of Physarumpolycephulum. Cell 1989;56:443-454. 60. Rocheleau GA,Woodson SA. Requirements for self-splicingof a group I intron from Physarum polycephulum. Nucl Acid Res 1994;22:4315-4320. 61. Rocheleau GA, Woodson SA. Enhanced self-splicing of Physarum polycephalum intron 3 by a second group I intron. RNA 1995;1:183-193. 62. Johansen S,Vogt VM. An intron in the nuclear ribosomal DNA of Didymium iridis codes for a group I ribozyme and a novel ribozyme that cooperate in self-splicing. Cell 1994;76:725-734. 63. Zaug AJ, Grabowski PJ, Cech TR. Autocatalytic cyclization of an excised intervening sequence RNA is a cleavage-ligationreaction. Nature 1983;301:578-583. 64. Zaug AJ, Kent JR, CechTR. A labile phosphodiester bond at the ligation junction in a circular intervening sequence RNA. Science 1984;224:574-578. 65. Ellison EL. Characterization of the intron-encoded endonuclease I-Ppo I from Physurum polycephalum. PhD Thesis, Cornell University. 66. Saldanha R, Mohr G, Belfort M, Lambowitz AM. Group I and group I1 introns. FASEB J 1993;7:15-24. 67. Inoue T, Sullivan FX,CechTR. Intermolecular exon ligation of the rRNA precursor of Tetruhymenu: oligonucleotidescan function as 5’ exons. Cell 1985;43:431-437. 68. Zaug AJ, Cech TR. The intervening sequence RNA of Tetruhymenu is an enzyme. Science 1986;231:470-475. 69. Doudna JA, Couture S, Szostak JW A multisubunit ribozyme that is a catalyst of and template for complementarystrand RNA synthesis. Science 1991;251:1605-1608. 70. Winter AJ, Groot Koerkamp MJA, Tabak HE The mechanism of group I self-splicing: an inter-

nal guide sequence can be provided in trans. EMBO J !990;9: 1923- 1928. 71. Van der Horst G, Christian A, Inoue T Reconstitution of a group I intron self-splicing reaction with an activator RNA. Proc Natl Acad Sci USA 1991;88:184-188. 72. Chowrira BM, Berzal-Herranz A, Burke JM. Novel system for analysis of group I 3’ splice site reactions based on functional trans-interaction of the P1 /P10 reaction helix with the ribozyme’s catalytic core. Nucl Acid Res 1995;23:849-855. 73. Woodson SA, Cech TR. Reverse self-splicingof the Tetruhymenugroup I intron: implication for the directionality of splicing and for intron transposition. Cell 1989;57:335-345. 74. Sargueil B, Tanner NK. A shortened form of the Dtruhymenu thermophilu group I intron can catalyze the complete splicing reaction in trans. J Molec Biol 1993;233:629-643. 75. Zaug AJ, Been MD, Cech TR. The Tetruhymenuribozyme acts like an restriction endonuclease. Nature 1986;324:429-433. 76. Zaug AJ, Grosshans CA, Cech TR. Sequence-specific endoribonucleaseactivity of the Tetruhymenu ribozyme: Enhanced cleavage of certain oligonucleotide substrates that form mismatched ribozyme-substrate complexes. Biochemistry 1988;27:8924-893 1. 77. Murphy FL, CechTR. Alteration of substrate specificity for the endoribonucleolyticcleavage of RNA by the Tetruhymenu ribozyme. Proc Natl Acad Sci USA 1989;86:9218-9222. 78. Williams Kp, Imahori H, Fujimoto DN, Inoue T. Selection of novel forms of a functional domain within the Etruhymenu ribozyme. Nucl Acid Res 1994;22:2003-2009. 79. Tasiouka KI,Burke JM. A modified group I intron can function as both a ribozyme and a 5’ exon in a trans-exon ligation reaction. Gene 1994;144:1-7. 80. Symon RH. Small catalytic RNAs. Ann Rev Biochem 1992;61:641-671. 8 1. Scott WG, Klug A. Ribozymes: structure and mechanism in RNA catalysis. Trends Biochem Sci 1996;21:220-224. 82. Pley HW, Flaherty KM, McKay DB. Three-dimensional structure of a hammerhead ribozyme. Nature 1994;372:68-74. 83. Scott WG, Finch JT, Klug A. The crystal structure of an all-RNA hammerhead ribozyme: a proposed mechanism for RNA catalysis. Cell 1995;81:99 1-1002. 84. Symon RH. Ribozymes. Crit Rev Plant Sci 1991;10:189-234. 85. Castanotto D, Rossi JJ, Deshler JO. Biological and functional aspects of catalytic RNAs. Crit Rev Euk Gene Exp 1992;2:331-357. 86. Been MD. Nucleases that are RNA. In: Gesteland RF, Atkins JF (eds) The RNA World. New York: CSHL Press, 1993;407-437. 87. Symons RH. Ribozymes. Curr Opin Struct Biol 1994;4:322-330. 88. CechTR. Ribozyme engineering. Curr Opin Struct Biol 1992;2:605-609. 89. Putnam DA. Antisense strategies and therapeutic application. Am J Health-Syst Pharm 1996; 53:151-160. 90. Altman S. RNA enzyme-directed gene therapy Proc Natl Acad Sci USA 1993;90:1089810900. 91. Sullivan SM. Development of ribozymes for gene therepy J Invest Dermatol 1994;103:85S89s. 92. Kijima H, Ishida H, Ohkawa T, Kashani-Sabet M, Scanlon KJ. Therapeutic applications of ribozymes. Pharmac Ther 1995;68:247-267. 93. Sczakiel G, Nedbal W The potential of ribozymes as antiviral agents. Trends Microbiol 1995;3: 213-217. 94. Altman S. RNase P in research and therapy BioTechnolohy 1995;13:327-329. 95. Christoffersen RE, Marr JJ. Ribozymes as human therapeutic agents. J Med Chem 1995;38: 2023-2037. 96. Hartmann RK, Krupp G, Hart W-D. Towards a new concept of gene inactivation: specificRNA cleavage by endogenous ribonuclease P.Biotechn Ann Rev 1995;1:215-265. 97. Been MD. Cis- and trans-acting ribozymes from a human pathogen, hepatitis deltavirus. Trends Biochem Sci 1994;19:251-256.

145 98. Sarver N, Cairns S. Ribozyme trans-splicing and RNA tagging: Following the messenger. Nature Med 1996;2:641-642. 99. Campell TB, Cech TR. Identification of ribozymes within a ribozyme library that efficiently cleave a long substrate RNA. RNA 1995;1:598-609. 100. Rossi JJ. Making ribozymes work in cells. Curr Biol 1994;4469-471. 101. Jones JT, Lee S-W, Sullenger BA. Tagging ribozyme reaction sites to follow trans-splicing in mammalian cells. Nature Med 1996;2:643-648. 102. Hart S.RNA’s revising machinery. BioScience 1996;46:318-321. 103. Been MD, Cech TR. One binding site determines sequence specificity of Tetrahymena prerRNA self-splicing, trans-splicing, and RNA enzyme activity. Cell 1986;47:207-216. 104. Waring RB, Ray JA, Edwards SW, Scazzocchio C, Davies RW The Rtrahymena rRNA intron self-splices in E. coli: in vivo evidence for the importance of key base-paired regions of RNA for RNA enzyme function. Cell 1985;40:371-380. 105. Price JV, Cech TR. Coupling of Tetrahymena ribosomal RNA splicing to 0-galactosidase expression in Escherichia coli. Science 1985;228:719-722. 106. ChanWKY, Belfort G, Belfort M. Stability of the group I intron RNA in Escherichia coli and its potential application in a novel expression vector. Gene 1988;73:295-304. 107. Sullenger BA, Cech TR. Ribozyme-mediated repair of defective mRNA by targeted transsplicing. Nature 1994;371:619-622. 108. Sullenger BA. Ribozyme-mediated repair of defective mRNAs by targeted trans-splicing: RNA based molecular surgery J Cell Biochem 1995;19A206. 109.Klug SJ, Famulok M. All you wanted to know about SELEX. Molec7 Biol Rep 1994;20: 97- 107. 110. Ellington AD, Conrad R. Aptamers as potential nucleic acid pharmaceuticals. Biotech Ann Rev 1995;1:185-214. 111. Uphoff KW, Bell SD, Ellington AD. In vitro selection of aptamers: the dearth of pure reason. Curr @in Struct Biol 1996;6:281-288. 112. Szostak Jw.In vitro genetics. Trends Biochem Sci 1992;17:89-93. 113. Kumar PKR, Ellington AD. Artificial evolution and natural ribozymes. FASEB J 1995;9:11831195. 114.Bang J, Joyce GE In vitro evolution of randomized ribozymes. Meth Enzymol 1996;267:410416. 115. Tuerk C, Gold L. Systematic evolution of ligands by exponential enrichment. Science 1990;249: 505-5 10. 116. Green R, Ellington AD, Szostak JW In vitro genetic analysis of the Tetrahymena self-splicing intron. Nature 1990;347:406-408. 117. Lehman N, Joyce GE Evolution in vitm of an RNA enzyme with altered metal dependence. Nature 1993;361:182- 185. 118. Green R, Szostak JW. Selection of a ribozyme that functions as a superior template in a selfcopying reaction. Science 1992;258:1910- 1915. 119. Green R, Szostak JW. In vitro genetic analysis of the hinge region between helical elements P5P4-P6 and W-P3-P8 in the sunY group I self-splicing intron. J Molec Biol 1994;235:140-155. 120. Beaudry AA, Joyce GF. Directed evolution of an RNA enzyme. Science 1992;257:635-641. 121.Herschlag D, Cech TR. DNA cleavage catalysed by the ribozyme from Rtruhymena. Nature 1990;344:405-409. 122. Robertson DL, Joyce GE Selection in Vitro of an RNA enzyme that specifically cleaves singlestranded DNA. Nature 1990;344:467-468. 123. Tsang J, Joyce GE Evolutionary optimization of the catalytic properties of a DNA-cleaving ribozyme. Biochemistry 1994;33:5966-5973. 124. Wright MC, Jaeger L, Joyce GE A new class of molecules for exploring the catalytic potential of RNA. J Cell Biochem 1995319A228. 125.von Ahsen U, Schroeder R. Streptomycin inhibits splicing of group I introns by competitionwith

146 the guanosine substrate. Nucl Acid Res 1991;19:2261-2265. 126. von Ahsen U, Davies J, Schroeder R. Antibiotic inhibition of group I ribozyme function. Nature 1991;353:368-370. 127. von Ahsen U, Davies J, Schroeder R. Non-competitive inhibition of group I intron RNA selfsplicing by aminoglycoside antibiotics. J Molec Biol 1992;226:935-941. 128. Wank H, Rogers J, Davies J, Schroeder R. Peptide antibiotics of the tuberactinomycin family as inhibitors of group I intron RNA splicing. J Molec Biol 1994;236:1001-1010. 129. Wank H, Schroeder R. Antibiotic induced oligomerizationofgroup I intron RNA. J Molec Biol 1996;258:53-61. 130. Edman JC, Kovacs JA, Masur H, Santi DV, Elwood HJ, Sognin ML. Ribosomal RNA sequences shows Pneumocystis carinii to be a member of the fungi. Nature 1988;334519-522. 131. Sogin ML, Edman JC. A self-splicingintron in the small subunit rRNA gene of Pneumocystis carinii. Nucl Acid Res 1989;17:5349-5359. 132. Lin H, Niu MT, Yoganathan T, Buck GA. Characterization of the rRNA-encoding genes and transcripts, and a group I self-splicingintron in Pneumocystis carinii. Gene 1992;119:163-173. 133. Liu Y, Leibowitz MJ. Variation and in vitro splicing of group I introns in rRNA genes of Pneumocystis carinii. Nucl Acid Res 1993;21:2415-2421. 134. Liu Y, Tidwell RR, Leibowitz MJ. Inhibition of in vitro splicing of a group I intron of Pneumocystis carinii. J Euk Microbiol 1994;41:31-38. 135. Leibowitz MJ, LiuY. Chemotherapy with a group I intron target. J Cell Biochem 1995;19A:211. 136. Rogers J, Chang AH, von Ahsen U, Schroeder R, Davies J. Inhibition of the self-cleavage reaction of the human hepatitis delta virus ribozyme by antibiotics. J Molec Biol 1996;259: 916-925. 137. Cummings DJ, Domenico JM, Nelson J. DNA sequence and secondary structure of the large subunit rRNA coding regions and its two class I introns of mitochondrial DNA from Podospora. J Molec Evol 1989;28:242-255. 138. Cummings DJ, Michel F, Domenico JM, McNally KL. DNA sequence analysis of the mitochondrial ND4L-ND5 gene complex from Podosporu anserinu. J Molec Biol 1990;212:269286. 139. Burke JM, RajBhandary UL. Intron within the large rRNA gene of N crassa mitochondria: a long open reading frame and a consensus sequence possibly important in splicing. Cell 1982; 31~509-520. 140. Tabak HF, Grivell LA. RNA catalysis in the excision of yeast mitochondrial introns. Trends Genet 1986;2:51-55. 141. Matsuoka M, Matsubam M, Kakehi M, Imanaka T Homologous maturase-like proteins are encoded within the group I introns in different mitochondria1 genes specifying Yarrowia lipolytica cytochrome c oxidase subunit 3 and Saccharomyces cerevisiue apocytochrome b. Curr Genet 1994;26:377-381. 142. Sellem CH, d’ Aubenton-CarafaY, Rossignol M, Belcour L. Mitochondria1intronic open reading frames in Podosporu: mobility and consecutive exonic sequence variations. Genetics 1996; 143~777-788. 143. Johansen S, Embley TM, Willassen NF! A family of nuclear homing endonucleases. Nucl Acid Res 1993;21:4405. 144. Gimble FS, Stephens BW Substitutions in conserved dodecapeptide motifs that uncouple the DNA binding and DNA cleavage activities of PI-Sce I endonuclease. J Biol Chem 1995;270: 5849-5856. 145. Lambowitz AM. Infectious introns. Cell 1989;56:323-326. 146. Bell-Pedersen D, Quirk SM, Aubrey M, Belfort M. A site-specificendonucleaseand co-conversion of flanking exons associated with the mobile td intron ofphageT4. Gene 1989;82:119-26. 147. Quirk SM, Bell-Pedersen D, Belfort M. Intron mobility in the T-even phages: high frequency inheritance of group I introns promoted by intron open reading frames. Cell 1989;56:455-456. 148. Durrenberger F, Rochaii J-D. Chloroplast ribosomal intron of Chlumydomonus reinhardtii: in

147 vitro splicing, DNA endonuclease activity and in vivo mobility EMBO J 1991;10:3495-3501. 149. Lemieux C, Lee RW Non-reciprocal recombination beetween allels of the chloroplast 23s rRNA gene in interspecific Chlamydomonascrosses. Proc Natl Acad Sci USA 1987;8441664170. 150.Colleaux L, Michel Wolwertz MR, Matagne RF, Dujon B. The apocytochromeb gene of Chlamydomonas smithii contains a mobile intron related to both Saccharomyces and Neurospora introns. Molec Gen Genet 1990;223:288-296. 151. Jacquier A, Dujon B. An intron-encoded protein is active in a gene conversion process that spreads an intron into a mitochondrial gene. Cell 1985;41:383-94. 152. Macreadie IG, Scott RM, Zinn AR, Butow RA. Transposition of an intron in yeast mitochondria requires a protein encoded by that intron. Cell 1985;41:395-402. 153. Guo W-W, Moran JV, Hoffman PW, Henke RM, Butow RA, Perlman PS. The mobile group I intron 3a of the yeast mitochondrial COX1 gene encodes a 35-kDa processed protein that is an endonuclease but not a maturase. J Biol Chem 1995;270:15563-15570. 154. Seraphin B, Faye G, Hatat D, Jacq C. The yeast mitochondrial intron aI5u: associated endonuclease activity and in vivo mobility Gene 1992;113:1--8. 155. Szostak Jw,Orr-Weaver TL, Rothstein RJ, Stahl FW The double-strand-break repair model for recombination. Cell 1983;3 3:25 -35. 156.Jackson SP,Jeggo PA. DNA double-strand break repair and V(D)J recombination: involvement of DNA-PK. llends Biochem 1995;20:412-415. I Homologous recombination and the roles of double-strand breaks. 157. Shinohara A, Ogawa ' 'Rends Biochem 1995;20:387-391. 158. Weaver DT. What to do at an end: DNA double-strand-break repair. Trends Genet 1995;ll: 388-392. 159. Mueller JE, Clyman J, Huang Y-J, Parker MM, Belfort M. Intron mobility in phageT4 occurs in the context of recombination-dependent DNA replication by way of multiple pathways. Genes Devel 1996;10:351-364. 160. Goodrich-Blair H, Shub DA. Beyond homing: competition between intron endonucleases confers a selective advantage on flanking genetic markers. Cell 1996;84211-221. 161. Goodrich-Blair H, ScarlatoV, Gott JM, Xu M-Q, Shub DA. A self-splicing group I intron in the DNA polymerase gene of Bacillus subtilis bacteriophage SPOl. Cell 1990;63:417-424. 162. Dujon B. Sequence of the intron and flanking exons of the mitochondrial 21s rRNA gene of yeast strains having different alleles at the o and rib-Z loci. Cell 1980;20185-197. 163. Colleaux L, d'Auriol L, Betermier M, Cottarel G, Jacquier A, Galibert F, Dujon B. Universal code equivalent of a yeast mitochondrial intron reading frame is expressed into E. coli as a specific double strand endonuclease. Cell 1986;44521-33. 164. Colleaux L, d' Auriol L, Galibert F, Dujon B. Recognition and cleavage site of the intronencoded omega transposase. Proc Natl Acad Sci USA 1988;85:6022-6026. 165. Monteilhet C, Perrin A, Thierry A, Colleaux L, Dujon B. Purification and characterization of the in vitro activity of I-Sce I, a novel and highly specific endonuclease encoded by a group I intron. Nucl Acid Res 1990;18:1407-1413. 166.Grivell LA. Nucleo-mitochondrial interactions in mitochondrial gene expression. Crit Rev Biochem Molec Biol 1995;30121-164. 167. Thierry A, Perrin A, Boyer J, Fairhead C, Dujon B, Frey B, Schmitz G. Cleavage of yeast and bacteriophage T7 genomes at a single site using the rare cutter endonuclease I-SceI. Nucl Acid Res 1991;19:189- 190. 168. Perrin A, Buckle M, Dujon B. Asymmetrical recognition and activity of the I-SceI endonuclease on its site and on intron-exonjunctions. EMBO J 1993;12:2939-2947. 169. Marshall P, Davies TB, Lemieux C. The I-Ceu I endonuclease: purification and potential role in the evolution of Chlamydomonasgroup I introns. Eur J Biochem 1994220855-859. 170. Gauthier A,Turmel M, Lemieux C. A group I intron in the chloroplast large subunit rRNA gene of Chlamydomonas eugametos encodes a double-strand endonuclease that cleaves the homing

148 site of this intron. Curr Genet 1991;19:43-47. 171. Marshall P, Lemieux C. Cleavage pattern of the homing endonuclease encoded by the fifth intron in the chloroplast large subunit rRNA-encoding gene of Chlamydomonas eugametos. Gene 1991;104241-245. 172. Marshall P, Lemieux C. The I-Ceu I endonuclease recognizes a sequence of 19 base pairs and preferentially cleaves the coding strand of the Chlamydomonas moewusii chloroplast large subunit rRNA gene. Nucl Acid Res 1992;20:6401-6407. 173. Muscarella DE, Ellison EL, Ruoff BM,Vogt VM. Characterization of I-Ppo, an intron-encoded endonuclease that mediates homing of a group I intron in the ribosomal DNA of Physarum polycephalurn. Molec Cell Biol 1990;10:3386-3396. 174. Ellison EL, Vogt VM. Interaction of the intron-encoded mobility endonuclease I-PpoI with its target site. Molec Cell Biol 1993;13:7531-7539. 175. Wittmayer PK, Raines RT Substratebinding and turnover by the highly specific I-PpoI endonuclease. Biochem 1996;35:1076-1083. 176.Lowery R, Hung L, Knoche K, Bandziulis R. Properties of I-PpoI: a rare-cutting intronencoded endonuclease. Promega Notes 1992;38:8-12. 177. Swaminathan N, Mead DA, McMaster K, George D,Van Etten JL, Skowron PM. Molecular cloning of the three base restriction endonuclease R.CniJ1 from eukaryotic Chlorella virus IL3A. Nucl Acid Res 1996;242463-2469. 178. Roberts RJ, Halford SE. Type I1 restriction endonucleases. In: Linn SM, Lloyd RS, Roberts RJ (eds) Nucleases, 2nd edn. New York: CSHL Press, 1993;35-88. 179. Heitman J. On the origins, structure and function of restriction-modification enzymes. Genet Eng 1993;15:57- 108. 180. Kessler C, Manta V. Specificity of restriction endonucleases and DNA modification methyltransferases. Gene 1990;92:1-248. 18 1. Doolittle RE The comings and goings of homing endonucleases and mobile introns. Proc Natl Acad Sci USA 1993;90:5379-5383. 182. Jeltsch A, Pingoud A. Horizontal gene transfer contributes to the wide distribution and evolution of type I1 restriction-modification systems. J Molec Evol 1996;42:91-96. 183. Perlman PS, Butow RA. Mobile introns and intron-encoded proteins. Science 1989;246:11061109. 184. Koob M. Conferring new cleavage specificities of restriction endonucleases. Meth Enzymol 1992;216:321-329. 185. Veselkov AV, Demidov VV, Frank-Kamenetskii MD, Nielsen PE. PNA as a rare genome-cutter. Nature 1996;379:214. 186. Veselkov AV, Demidov VV, Nielsen PE, Frank-Kamenetskii MD. A new class of genome rare cutters. Nucl Acid Res 1996;24:2483-2487. 187. Liu S-L, Hessel A, Sanderson KE. Genomic mapping with I-Ceu I, an intron-encoded endonuclease specific for genes for ribosomal RNAs in Salmonella spp., Escherichia coli, and other bacteria. Proc Natl Acad Sci USA 1993;90:6874-6878. 188. Liu S-L, Sanderson KE. Rearrangementsin the genome of the bacterium Salmonella typhi. Proc Natl Acad Sci USA 1995;92:1018-1022. 189. Honeycutt RJ, McClelland M, Sobral BWS. Physical map of the genome of Rhizobium melilori 1021. J Bacteriol 1993;175:6945-6952. 190. Kunst F, Vassarotti A, Danchin A. Organization of the European Bacillus subtilis genome sequence project. Microbiol 1995;141:249-255. 191. TodaT, Itaya M. I-CeuI recognition sites in the rrn operons ofthe Bacillussubtilis 168 chromosome: inherent landmarks for genome analysis. Microbiol 1995;141:1937-1945. 192. Copenhaver GP, Pikaard CS. RFLP and physical mapping with an rDNA-specific endonuclease reveals that nucleolus organizer regions of Arabidopsis thafina adjoin the telomers on chromosoms 2 and 4. Plant J 1996;9:259-272. 193. Thierry A, Dujon B. Nested chromosomal fragmentation in yeast using the meganuclease I-

149 SceI: a new method for physical mapping of eukaryotic genomes. Nucl Acid Res 1992;20: 5625-563 1. 194. Colleaux L., Rougeulle C., Avner P.Dujon B. Rapid physical mapping of YAC inserts by random integration of I-Sce I sites. Hum Molec Genet 1993;2:265-271. 195.Thierry A, Gaillon L, Galibert F, Dujon B. Construction of a complete genomic library of Succhuromyces cerevisiae and physical mapping of chromosome XI at 3.7 kb resolution. Yeast 1995;11:121-135. 196. Dujon B. The yeast genome project: what did we learn? Trends Genet 1996;12:263-270. 197. Fonzi WA, Irwin MY. Isogenic strain construction and gene mapping in Candida albicans. Genetics 1993;134:717-728. 198. Haber J. Exploring the pathways of homologous recombination. Curr Opin Cell Biol 1992;4 401-412. 199. Kilby NJ, Snaith MR, Murray JAH. Site-specific recombinases: tools for genome engineering. Trends Genet 1993;9:413-421. 200. Rudin N, Sugarman E, Haber JE. Genetic and physical analysis of double-strand break repair and recombination in Saccharomyces cerevisiae. Genetics 1989;122519-534. 201.Plessis A, Perrin A, Haber JE, Dujon B. Site-specific reconbination determined by I-Sce I, a mitochondria1 group I intron-encoded endonuclease expressed in the yeast nucleus. Genetics 1992;130:451-460. 202. Puchta H, Dujon B. Hohn B. Homologous recombination in plant cells is enhanced by in vivo induction of double strand breaks into DNA by a site-specific endonuclease. Nucl Acid Res 1993;21:5034-5040. 203. Segal DJ, Carroll D. Endonuclease-induced, targeted homologous extrachromosomal recombination in Xenopus oocytes. Proc Natl Acad Sci USA 1995;92:806-810. 204. Rouet P, Smith F, Jasin M. Expression of a site-specific endonuclease stimulates homologous recombination in mammalian cells. Proc Natl Acad Sci USA 1994;91:6064-6068. 205. Rouet P, Smith F, Jasin M. Introduction of double-strand breaks into the genome of mouse cells by expression of a rare-cutting endonuclease. Molec Cell Biol 1994;148096-8106. 206. LukacsovichT, Yang D, Waldman AS. Repair of a specific double-strand break generated within a mammalian chromosome by yeast endonuclease I-Sce I. Nucl Acid Res 1994;22:5649-5657. 207. Choulika A, Perrin A, Dujon B, Nicolas J-E Induction of homologous recombination in mammalian chromosomes by using the I-Sce I system of Saccharomyces cerevisiae. Molec Cell Biol 1995;15:1968- 1973. 208. Smith F, Rouet P, Romanienko PJ, Jasin M. Double-strand breaks at the target locus stimulate gene targeting in embryonic stem cells. Nucl Acid Res 1995;23:5012-5019. 209. Thierry A, Fairhead C, Dujon B. The complete sequence of the 8.2 kb segment left of MATon chromosome I11 reveals five ORFs, including a gene for a yeast ribokinase. Yeast 1990;6:521534. 210. Colleaux L, Rougeulle C, Avner P, Dujon B. Rapid physical mapping of YAC inserts by random integration of I-Sce I sites. Hum Molec Genet 1993;2:265-271. 211. Asselbergs FAM, Rivas S. Creation of a novel, versatile multiple cloning site cut by four rarecutting homing endonucleases. BioTechniques 1996;20:558- 560. 212. Brondyk WH. The pCI-neo mammalian expressionvector. Promega Notes 1995;Sl:lO-14. 213. Durrenberger F, Rochaix JD. Characterization of the cleavage site and the recognition sequence of the I-CreI DNA endonuclease encoded by the chloroplast ribosomal intron of Chlumydomonas reinhardtii. Molec Gen Genet 1993;236:409-414. 214.Delahodde A, Goguel V, Becam AM, Creusot F, Perea J, Banroques J, Jacq C. Site-specific DNA endonuclease and RNA maturase activities of two homologous intron-encoded proteins from yeast mitochondria. Cell 1989;56:431-442. 215. Wenzlau JM, Saldanha RJ, Butow RA, Perlman PS.A latent intron-encoded maturase is also an endonuclease needed for intron mobility Cell 1989;56:421-430. 216. Bremer MC, Gimble FS, Thorner J, Smith CL.VDE endonucleasecleaves Sacchuromyces cerevi-

150 siue genomic DNA at a single site: physical mapping of the VMAl gene. Nucl Acid Res 1992; 205484. 217. Bryk M, Quirk SM, Mueller JE, Loizos N, Lawrence C, Belfort M. The td intron endonuclease

I-TevI makes extensive sequence-tolerant contacts across the minor groove of its DNA target. EMBO J 1993;12:4040-4041. 218. Mueller JE, Smith D, Bryk M, Belfort M. Intron-encoded endonucleaseI-EvI binds as a monomer to effect sequential cleavage via conformational changes in the td homing site. EMBO J 1995;145724-5735. 219. Lykke-Andersen J, Thi Ngoc

HP,Garrett RA. DNA substrate specificity and cleavage kinetics of an archaeal homing-type endonuclease from Pyrobuculum orgunotrophum. Nucl Acid Res

1994;22:4583-4590, 220. Xu MQ, Southworth MW, Mersha FB, Hornstra LJ, Perler FB. In Vitro protein splicing of purified precursor and the identification of a branched intermediate. Cell 1993;75: 1371-1377. 22 1. Burke JM. Molecular genetics of group I introns: RNA structures and protein factors required for splicing - a review Gene 1988;73:273-294. 222. Schafer B, Wilde B, Massardo DR, Manna F, Del Giudice L, Wolf K. A mitochondrial group-I intron in fission yeast encodes a maturase and is mobile in crosses. Curr Genet 1994;25:336441. 223. Dujon B, Belfort M, Butow RA, Jacq C, Lemieux C, Perlman PS,Vogt VM. Mobile introns: definition of terms and recommended nomenclature. Gene 1989;82:115--118. 224. CechTR. Conserved sequences and structures ofgroup I introns:buildingan active site for RNA catalysis. Gene 1988;73:259-271.

01997 Elsevier Science B.V. All rights reserved. Biotechnology Annual Review Volume 3

151

M.R. El-Gewly, editor.

Development of recombinant vaccines against infectious bursal disease Vikram N. Vakharia Centerfor Agricultural Biotechnology of University Maryland Biotechnology Institute, and VA-MDRegional college of Veterinary Medicine, University of Maryland, College Park, Maryland, USA

Abstract. Infectious bursal disease virus (IBDV) is responsible for a highly immunosuppressive disease in young chickens that causes significant losses to the poultry industry worldwide. Until the late 1980s, the disease was well-controlled by the use of a range of live attenuated or killed vaccines but in recent years, “very virulent” strains of IBDV have emerged in Europe and Asia. To combat this disease, several investigators have sought the use of recombinant DNA technology to develop new cost-effective vaccines. In this review, the different approaches used for the development of recombinant IBDV vaccines are described.

Keywords: active and passive protection, baculovirus expression, birnavirus, Gumboro disease, infectious bursal disease virus (IBDV), live virus-vectored vaccine, recombinant fowlpox virus, recombinant herpesvirus of turkeys (HVT),recombinant vaccine, recombinant IBDV (rIBDV), reverse genetics, virus-like particles, yeast expression.

Introduction Infectious bursal disease (IBD) or Gumboro disease, initially described in the 1960s by Cosgrove [l], is a highly contagious disease of young chickens caused by an infectious bursal disease virus (IBDV) [2]. The virus causes severe immunodeficiency in young chickens by destroying the precursors of antibody-producing B cells in the bursa of Fabricius [3]. In a fully susceptible flock, between 3 and 6 weeks of age, the clinical disease causes severe immunosuppression and is responsible for losses due to impaired growth, decreased feed efficiency, and death [4]. Susceptible chickens less than 3 weeks of age do not outwardly exhibit clinical signs [5], but have a marked infection characterized by gross and microscopic lesions in the bursa of Fabricius (subclinical infection) [6]. Damage to the bursa ultimately causes immunodeficiency, which then leads to an increased susceptibility to other diseases, and interferes with effective vaccination against Newcastle disease, Marek‘s disease, and infectious bronchitis [7,8]. IBDV is a stable virus and therefore, control through sanitation and isolation is not practical for commercial poultry production [9,10]. The principal method of control is therefore by vaccination. There are two known serotypes of IBDV [l 11. Serotype I contains viruses that are pathogenic to chickens and differ markedly in their virulence [12], whereas serotype I1 viruses, isolated from turkeys, are avirulent for chickens [131. Since serotype I and its variants cause naturally occurring disease, current vaccines are derived from these strains.

152 Protection against different field strains of IBDV has long been a problem associated with the high-density rearing of commercial chickens worldwide. Primary control of IBDV is normally achieved through the administration of either live or killed vaccines to hens. As a result, the hens provide high levels of maternal antibodies to their progeny during the critical first few weeks of life. Since the mid-l980s, antigenic variants of IBDV (Delaware and GLS) have been isolated from vaccinated flocks on the Delmarva peninsula in the USA [14,15]. Although a degree of cross-protection against variant IBDV infection is obtained when socalled “classic” IBDV strains are used as immunogens, these variant strains of IBDV are able to overcome the maternal antibody induced by classic IBDV strains at an earlier age [ 161. Similarly, “very virulent” strains of IBDV have been isolated in Europe and Asia that cause 2 70% flock mortalities [17- 191. These pathotypic variants are antigenically very similar to the classic IBDV strains and can break through the maternal antibody induced by “intermediate” live vaccine strains [20]. Substantial economic losses have been sustained as a result of the emergence of these antigenic and pathotypic variant viruses. Therefore, in the USA it has become necessary to incorporate both classic and variant IBDV immunogens into commercial vaccines to enhance the antigenic spectrum [161. Biochemistry of IBDV

IBDV belongs to a group of viruses classified as Birnaviridae, which includes other similar bisegmented RNA viruses, e.g., infectious pancreatic necrosis virus of fish, tellina virus and oyster virus of bivalve molluscs, and Drosophilu X virus of the fruit fly [2]. These viruses are nonenveloped, have icosahedral symmetry, and contain high molecular weight (MW) double-stranded RNA genomes. The capsid of the IBDV virion consists of at least four structural proteins [21]. As many as nine structural proteins have been reported, but there is evidence that some of these may have a precursor product relationship [22]. The designation and MWs of the four viral proteins (VP) are: VP1 (90 kDa),VP2 (41 kDa),VP3 (32 kDa) and VP4 (28 kDa). An additional protein,VPX (47 kDa), is a precursor of VP2 [22]. The two segments of the double-stranded RNA genome of IBDV are 3,261 base pairs (MW, 2.06 x lo6) and 2827 base pairs (MW, 1.76 x lo6) in length [23,24]. In vitro translation of denatured genomic RNA has demonstrated that the large RNA segment encodes three structural proteins (VP2,VP3 and VP4). The small RNA segment encodes only one protein,VPl [23]. Both the genomic segments of an Australian strain of IBDV were the first to be cloned and sequenced [25,26]. On the basis of the nucleotide sequence data of the large segment A and other studies, it has been shown that these structural proteins are encoded in the order VP2,VP4, and VP3, and are contained in one open reading frame [25]. Recently, it was shown that a second open reading frame, preceding and partially overlapping the polyprotein gene, encodes a protein (VP5) of unknown hnction that is present in IBDV-infected cells [27]. Again, from the

153 nucleotide sequence data of the small segment B, it was shown that this segment encodes only one protein (VPl) of 90 kDa [26]. This protein is a minor component of the virion and it possesses both the RNA-dependent RNA polymerase and capping enzyme activities [28,29]. In IBDV, this VPl is tightly bound to both ends of the two genomic segments and effectively circularizes the molecules 1291. VP2 and VP3 are the major structural proteins of the virion. It has been demonstrated that VP2 is the major host-protective immunogen of IBDV. VP2 also contains the antigenic region responsible for the induction of neutralizing antibodies that determine serotype and strain specificity [30,31]. The region, which contains the neutralization site, has been proven to be highly conformational [31]. VP3 is considered to be a group-specific antigen because it is recognized by monoclonal antibodies (MAbs) directed against VP3 from strains of both serotype I and I1 [30]. VP4 appears to be a virus-coded protease, and it is involved in the processing of precursor polyproteins of VP2, VP3 and VP4 [32,33]. However, the precise way in which these proteolytic events takes place has not been determined. Antigenic variation in IBDV Antigenic variation among the IBDV isolates has been reported by several laboratories, especially in the USA [14,15,34]. To examine the antigenicity of over 1,300 wild-type field isolates collected from different poultry flocks, Snyder et al. [16] prepared a panel of seven neutralizing and two nonneutralizing MAbs, shown in Table 1. lhble I. A panel of IBDV-specific monoclonal antibodies (MAbs) used to differentiate classic and other variant viruses by AC-ELISA.a

MAbs

Eliciting IBDV strain

VN testsb

Antigen Capture-ELISAa IBDV Classic

B29 B69 R63 8 10 179 51

61 BK9

D78 (Classic) D78 (Classic) D78 (Classic) GLS

GLS GLS GLS E/Del E/Del

E/Del

GLS

+

+

-

+ +

-

+

-

+ +

DS326

-

+ + + +

-

'MAbs were evaluated in capture assays against 1:40 dilutions of IBDV containing bursa1 homogenates. The classic IBDV tested was STC. bA positive result indicates that the MAbs neutralized IBDV in virus neutralization (VN) tests.

154 Four antigenically distinct groups of serotype I IBDV could be separated on the basis of their reactivities with various MAbs in antigen capture-ELISA (AC-ELISA): classic, E/Del, GLS and DS326 [35]. All classic viruses, isolated prior to 1985, reacted with neutralizing MAbs B69, R63, 8, 10 and 179. In comparison, all the variant viruses lacked the major classic IBDV neutralization site defined by MAb B69. In addition, GLS and DS326 variants lacked an R63 epitope, but shared a common epitope defined by MAb 57. None of the variant specific epitopes (57, 67 and BK9) were present in the European field isolates when tested with this panel of MAbs [36]. To study the molecular basis of antigenic variation in IBDV, and the role of VP2 and other viral proteins (VP3,VP4,VP5 and VP1) in immunogenicity and pathogenicity, a number of investigators have cloned the structural and nonstructural protein genes of IBDV serotype I. The complete nucleotide sequences (mostly coding) of the large segment A of 12 IBDV strains have been determined: 002-73 [25] (Australia), Cu-1, Cu-lM, P2 [24] (Germany), PBG98, 52/70 [37], UK661 [38] (UK), GLS, DS326, E/Del, D78 [39], STC [40] (USA); and segment B of five strains: 002-73 [26] (Australia), Cu-1, Cu-lM, P2 [24] (Germany), UK661 [38] (UK). In addition, the VP2 gene of virulent European [7] and Japanese [41] IBDV strains, and Delaware variants A [42] and E [43,44] has been sequenced. A high level of amino acid sequence homology (>97%) has been found between the strains studied, except in the hypervariable region of VP2 [37,39]. Comparison of the deduced amino acid sequences of the US variants with other IBDV strains has shown that most of the amino acid substitutions occur in the central region between residues 212 and 332, especially in the two hydrophilic regions between residues 212 and 223 and between residues 314 and 324 of VP2 protein [39]. Figure 1 shows the alignment of the amino acid sequences of the VP2 variable region (between central AccI-SpeI sites) of various IBDV strains. The putative amino acids responsible for the formation of virus-neutralizing epitopes and antigenic variation were identified by comparison of the amino acid sequences of the US variant viruses and their reactivities with IBDV-specific MAbs. Comparison of the D78 vs. PBG98 sequence showed that Gln at position 249 (Gln249) appears to be critical in binding with MAb B69. Similarly, comparison of the US variant sequences with other serotype I sequences showed unique substitutions at residue Glu321 in GLS strain; residues Ile286, Asp318, Glu323 in Delaware strain; and residues Glu311 and Gln320 in DS326 strain, which could be potential residues involved in the recognition of MAb57, MAb67, and MAb179 epitopes, respectively [39]. In later studies, these MAbs proved to be quite usehl in mapping the major antigenic sites of IBDV. Expression vectors used for production of recombinant IBDV immunogens

To develop recombinant IBDV (rIBDV) vaccines against IBD, a number of investigators have cloned and expressed the structural protein genes, especially VP2,

155 GLS DS326 E/Del D78 PBG98 cu-1 52/70 UK661 STC

GLS DS326 WDel D78 PBG98 cu-1 52/70 UK661 STC

GLS DS326 E/Del D78 PBG98 cu-1 52/70 UK661 STC fig. I. Comparison of the deduced amino acid sequences of theVP2 variable region (Accl-SpeI sites) of selected serotype I IBDV strains. GLS, DS326 and ElDel = USAvariants; D78 and PBG98 =vaccine strains; Cu-1 = German isolate; 52/70 = British field isolate; UK661 = “very virulent” strain from UK, STC = standard challenge virus from USA. The two hydrophilic peaks are overlined and the dashes (-) indicate amino acid identity

in various expression systems.Vectors used for the expression of IBDV genes can be divided into two types. The first are those that make subunit protein antigens in vim, e.g., Escherichia coli [45], yeast [46] and baculovirus [47-491. The second type are live virus-vectors, such as fowlpox [50-521 and herpesvirus of turkey [53]. With recent development in the generation of rIBDV from cloned cDNA [54], it has become theoretically possible to make genetically engineered, live attenuated vaccines. These engineered or mutant viruses can be considered as a third type of recombinant vaccine vector. E. coli and yeast expression vectors Most of the early work on IBDV gene expression was done with various E. colivectors [32,45].When viral genes were expressed as fbsions with bacterial genes, large quantities of proteins were made that formed inclusion bodies. However, VP2

156 molecules with the smallest N-terminal fusions tended to form the least amount of inclusion bodies and had higher affinity for the conformation-dependent virusneutralizing antibodies. Expression of VP2 as an unfused protein gave very poor yields. Unfortunately, none of these proteins induced antibodies capable of neutralizing the virus or providing passive protection against IBDV infection [45]. This is presumed to be due to the inability of bacteria to correctly process IBDV antigens; events such as glycosylation, proteolytic cleavage, and folding can generate proteins that are in immunogenic conformation. Nevertheless, recombinant IBDV antigens made in E. coli have proven useful for mapping neutralizing epitopes on VP2 antigen [32], and studying proteolytic processing events [33]. Yeast vectors have been widely used for the expression of viral genes. For example, recombinant hepatitis B vaccine was one of the first commercially available recombinant subunit vaccines synthesized in yeast [55]. To circumvent the problems associated with E. coli expression mentioned above, Macreadie et al. [46] expressed the structural protein genes of IBDV in yeast. Western blots of the expression products, probed with the anti-VP2 MAb 9/6, and anti-VP3 MAb 17/80, showed that expression of the large genomic segment cDNA of IBDV in yeast yielded correctly processed VP2 and VP3 products from the precursor polyprotein. In addition, different constructs were made that only expressed VP2 protein. These antigens were then used to inoculate specific pathogen-free chickens for antisera production. The ELISA and VN titres of resultant antisera did not differ significantly from that obtained from native viral VP2, but were 20fold less than expected from the whole virus. Unfortunately, chickens injected with this antisera gave only passive protection against IBDV infection [46]. Baculovirus expression vectors

The baculovirus expression system developed by Summers and Smith [56] has been successfully used for the expression of a wide variety of foreign genes in insect cells [57]. In this system, a shuttle vector is used to insert genes under the control of Autographa culifornica nuclear polyhedrosis virus (AcNPV) polyhedrin promoter, which allows the expression of fused or nonhsed recombinant proteins. Recombinant baculoviruses are obtained by cotransfecting Spodoptera frugiperda (Sf9) cells with the transfer vector and linear AcNPV DNA. After homologous recombination, the recombinants are identified by their occlusionnegative phenotype and/or as blue plaques if the transfer vector also contained the P-galactosidase gene marker. Recombinant proteins are then obtained from cultures of infected Sf9 cells. One of the major advantages of this system over other expression systems is the abundant production of recombinant proteins that result from the use of a strong polyhedrin promoter. Moreover, it is a safe system because it does not utilize a virus that is pathogenic for vertebrates. The recombinant proteins are biologically active, immunogenic, and undergo a variety of posttranslational modifications, including N-glycosylation [57].

157

Synthesis of “virus-1ike”particlesand analysis of antigenic sites

An attractive feature of the baculovirus expression system has been its potential for vaccine development due to its high expression level, posttranslational processing, and nonpathogenicity Recent reports have shown that expression of viral capsid proteins often results in self-assembled “virus-like” particles (VLPs) that are essentially empty virions lacking nucleic acid. Of these VLP-producing systems, for example, vaccines have been proposed for HIV [58], human papillomavirus [59], poliovirus [60],bluetongue virus [61], and IBDV [62]. The advantage of VLPs is that they are highly immunogenic and noninfectious, and therefore do not have to be inactivated; a process which otherwise could alter its immunogenicity To synthesize VLPs of IBDV, we have cloned and expressed all the structural protein genes encoded in the large genomic segment using a baculovirus/insect cell system. Our recent findings show that the baculovirus-expressed IBDV structural proteins self-assemble to form empty capsids or VLPs [62] that resemble native IBDV particles (see Fig. 2). As expected, the expressed IBDV proteins reacted with all conformation-dependent neutralizing MAbs of IBDV in ACELISA test (Table 1). Since VLPs were structurally very similar to the native virus particles, they proved to be quite useful in mapping the antigenic sites of IBDV. Earlier work done in this laboratory [39] led to the identification of amino acid residues involved in the formation of virus-neutralizing epitopes and antigenic variation. To incorporate some of these epitopes in the VLPs of the GLS strain, two chimeric cDNA clones of IBDV were constructed, using the GLS plasmid as a backbone. In addition, a fill-length cDNA clone of the E/Del strain was also constructed, as shown in Fig. 3.

Fig. 2. Electron micrograph of purifed IBDV VLPs ( x 250,000) derived from vIBD-7 infected SB cells. Bar length denotes 100 nm.

158 I kb

5’r

2 kb

3’

3kb

vP5

L VP2 VP3 pCLSB.cI

1

I

pB69GLSBacH tttttt

pR63CLSBwJJ

I

I

~

Fig. 3. Schematic presentation of the plasmids encoding IBDV-specific polyprotein. A map of the IBDV genome, with its coding region, is shown at the top of the figure. GLS sequences are depicted

by an open box. The filled box represents the D78 sequences and the shaded box represents the E/ Del sequences. Amino acid substitutions are denoted by a diamond. All plasmids contain the polyhedrin promoter at their 5’-end.

Two chimeric plasmids, pB69GLSBacII and pR63GLSBacI1, were constructed by substituting the NdeI-NarI fragment from plasmid pD78 and NarI-SpeI fragment from plasmid pEDEL22. As a result of these substitutions, only three or six amino acids were substituted in the GLS VP2 protein, respectively These plasmids, shown in Fig. 3, were utilized to generate various recombinant baculoviruses. Expression of these constructs in a baculovirus/insect cell system yielded VLPs that were either GLS specific, E/Del specific, or chimeric in nature. These recombinant IBDV antigens were antigenically characterized by AC-ELISA using a panel of IBDV-specific MAbs, as shown in Table 2. Our results indicate that there are at least two antigenic sites present on the surTable 2. Characterization of recombinant baculoviruses expressing IBDV antigens and various IBDV strains by AC-ELISA using a panel of neutralizing MAbs.

Viruses

vIBD-7 vI-7 vII-5 vc12 AcNPV ElDel GLS DS326 D78

Constructs or types pGLSBacI pB69GLSBacII pR63GLSBacII pEDEL22BacII Wild Variant Variant Variant Classic

Reactivities with MAbs B69

R63

179

8

10

57

61

-

-

+ + + +

+ + + +

+ +

+ +

-

-

-

+

-

+ +

-

+ +

159 face of IBDV, one resides between amino acid residues 222 and 249, and the other between residues 269 and 323. Amino acid substitutions Ser222Pr0, Lys249Gln, and Ser254Gly in the GLS VP2 protein generated the B69 epitope, which was not present in the variant virus. Similarly, substitutions Ser269Thr, Thr284Ala, Thr286Ile, Gly318Asp, Glu321Ala, and Asp323Glu in the GLS VP2 protein, generated all the E/Del-specific epitopes recognized by MAbs 67 and R63, but deleted the GLS-specific epitopes recognized by MAbs 57 and 10.Thus, by mapping the antigenic sites of IBDV, and introducing specific amino acid mutations in a single construct, it is possible to synthesize antigens with multiple neutralizing epitopes. These chimeric recombinant antigens can then provide protection against various IBDV strains. Immunogenicity of baculovirus-expressed rIBDVantigens

During initial studies in the development of a subunit vaccine against IBD, our laboratory [47] cloned the large genomic segment of GLS-IBDVand constructed a recombinant baculovirus vIBD-7. Our studies demonstrated that Sf9 cells, infected with this recombinant virus, produced IBDV precursor proteins that were correctly processed to yield VP2, VP4 and VP3. The rIBDV antigens were characterized by immunoprecipitation with monoclonal and polyclonal antibodies to IBDV, and by AC-ELISA that utilized a panel of IBDV-specific MAbs. The rIBDVantigens closely resembled the native IBDV proteins, and these antigens reacted with all GLS virus-specific neutralizing MAbs that recognize only conformational epitopes of IBDV (see Table 2). For active protection studies, when susceptible chickens were inoculated with two doses of vIBD-7-derived GLS antigens, the vaccines induced virus-neutralizing antibodies that conferred 79% protection against IBDV infection after challenge with the homologous GLS virus. From this study, it was inferred that the concentration of IBDV antigens (antigenic mass) used for immunization was insufficient [47]. In a subsequent study carried out in this laboratory [48], the antigenic mass of the original vIBD-7-derived GLS vaccine was increased 4-fold, and used for one- and two-dose vaccination trials. In those trials, two doses of the vaccine yielded complete cross-protection against virulent STC,E/Del, and GLS challenge. In the one-dose trial, however, only 44% protection was achieved against challenge with STC virus, while complete protection was attained with E/Del and GLS virus. Results of this study imply that better cross-protection can be obtained by increasing the antigenic mass and/or doses of the vaccine. It was also evident that lower levels of antibody titres (log2 12.0 f 2.1), induced by one dose of the vIBD-7-derived GLS vaccine (compared to 14.2 f 1.4 for two doses), are not sufficiently cross-protective against classic IBDV challenge [48]. The results of the latter trials are shown in Table 3. In another single-dosevaccination cross-challengestudy, we evaluated the vI-7derived chimeric GLS vaccine that incorporated the classic B69 neutralization

160 Table 3. Active cross-protectionof SPFchickensinduced by one dose of monovalent or multivalent inactivated virus vaccines in comparison to baculovirus-expressed IBDV antigens.

Protection Number of chickens protecteda (“YO)

Group Vaccination

MeanVN titer (logz)

Challenge virus(es)

2

-

c4.0f 0.0

GLS E/Del STC

0115 0115 0115

3

GLS

15.9 f 0.5

GLS E/Del STC

818 818 818

100 100 100

GLS 4

BreederVac

16.0 f 0.0

515 515 515

100 100 100

5

vIBD-7

12.0 f 2.1

818 8/8

100 100

419

44

15/15 15/15

100 100 100 100

6

vI-7

10.9 f 1.5

E/Del STC GLS E/Del STC GLS E/Del STC IM

15/15 15/15

0 0 0

aProtection was defined as the absence of any microscopic evidence of virus-induced lesions in the bursa of Fabricius (number of bursa without lesionslnumberof bursa examined).

epitope [49]. The results of this vaccine trial show that a single-dose of vI-7derived vaccine afforded complete protection against challenge with GLS, E/ Del, STC and lethal classic IM strain (Table 3). Since the antigenic mass of the GLS-specific epitope on vIBD-7- and vI-7-derived vaccines was carefully equilibrated and equal, it was inferred that the comparative increase in efficacy of vI7-derived vaccine was solely due to the incorporation of the classic B69 epitope. For passive protection studies, when chicks were inoculated with a single dose of vIBD-7-derived GLS antigens, it induced virus-neutralizing antibodies that conferred complete protection against IBDV infection after challenge with the homologous GLS, but only 57% were protected with the heterologous E/Del strain [48]. The results of the passive protection are shown in Table 4. Our studies [48,49] have demonstrated that recombinant baculovirus-expressed IBDV antigens can assemble to form VLPs that are highly immunogenic and capable of actively and passively protecting chickens against IBDV infection. Although we did not use the chimeric vI-7-derived antigen for passive protection studies, we expect that this antigen would also confer passive protection against classic and variant viruses.

161 %ble 4. Passive protection of progeny induced by vaccination of SPF hens with a single dose of inactivated vaccine compared to baculovirus-expressed IBDV antigens. Hen vaccination

Mean VN titer (log2)

Challenge virus(es)

No. of chicks protecteda

Protection

1

-

-

-

14/14

-

2

-

~ 4 . f0 0.0

GLS E/Del

0115 0115

0 0

3

GLS

11.3 f 1.9

GLS E/Del

14/14 1/14

100

GLS E/Del

13/13 8/14

100 57

Group

4

vIBD-7

10.1 f 1.0

("/.I

50

'Protection was evaluated as no detectable IBDVantigen in the bursa of Fabricius, as assayed by ACELISA (number of bursa without IBDVantigenInumber of bursa examined).

Fowlpox virus vector

In recent years, the avipox virus fowlpox virus (FPV) has been used as a live viral vector for the delivery of specific poultry disease antigens. The technology used in the development of fowlpox vectors is very similar to that used in vaccinia virus vectors. A number of nonessential regions of the FPV genome have been identified and used for the insertion of foreign genes [63,64]. The efficacy of recombinant FPVs (rFPVs) as vaccines has been demonstrated for recombinants that express the fusion and haemagglutinin-neuraminidase genes of Newcastle disease virus [65,66] and the glycoprotein B gene of Marek's disease virus [67]. Attenuated FPV vaccines are already used and accepted in the poultry industry The advantages of using FPV as vectors include: 1) induction of a strong cell-mediated immune response; 2) alleviation of the problems of antigen processing and purification encountered with subunit protein vaccines; 3) a host range limited to avian species; and 4) up to 15-20 kb of foreign DNA can be inserted into the FPV genome. However, the main drawback is that immunity against the FPV vector may limit its usefulness for subsequent immunizations. In an initial study by Bayliss et al. [50], when chickens were vaccinated with a rFPV that contained the IBDV VP2 antigen fused to the P-galactosidase gene, it provided partial protection against mortality, but it did not protect against damage to the bursa of Fabricius. One explanation could be that the VP2 antigen was not present in the correct conformation, which is possible if VP2 is expressed as a fusion protein with P-galactosidase. In subsequent studies, Heine and Boyle [51] constructed rFPVs that expressed VP2 under the control of the fowlpox early/late promoter, and VP2-VP4-VP3 protein expression under the control of vaccinia virus late promoter. The expression level of VP2 from rFPV-VP2 was 5-fold higher than that obtained from

162 rFPV-VP2,4,3. Vaccination of 1-day-old or 3-week-old chickens with rFPV-VP2 elicited protective immune responses against bursal damage and infection with the homologous IBDV challenge strain. However, the levels of protection obtained with the rFPV-VP2 vaccine, which were localized in the cytoplasm of infected cells, were lower than that of inactivated whole IBDV vaccine [51]. The rFPV-VP2,4,3 vaccine did not protect chickens from infection and failed to induce an antibody response to IBDV This could be due to low levels of VP2 expression and reduction in the virulent character of the recombinant construct. In a recent study, Heine et al. [52] constructed another rFPV to achieve cell surface expression of VP2 with the aim of increasing immunogenicity The VP2 gene was hsed to the membrane signal/anchor sequences of influenza virus haemagglutinin and neuraminidase. Unfortunately, cell surface localization of VP2 reduced immunogenicity (antibody induction) and eliminated protection in chickens. In fact, vaccination of chickens with rFPV expressing VP2 alone provided good protection against IBDV infection [52]. Herpesvirus of turkeys vector

Herpesvirus of turkeys (HVT) has been used extensively as a vaccine against Marek’s disease since 1971. Because of its widespread use, HVT has greater potential than FPV as a live virus vector for the delivery of specific poultry disease antigens. The techniques of introducing foreign genes into the HVT genome are very similar to those of pseudorabies virus vectors. In recent studies, Morgan et al. [68,69] have demonstrated the efficacy of recombinant HVT (rHVT) vaccines by expression of the hsion gene of Newcastle disease virus. The advantages of using HVTas a vector are very similar to those described for FPV vectors. Recently, Darteil et al. [53] have constructed rHVTs that express theVP2 gene of virulent IBDV. In one construct, the VP2 gene was inserted at the locus of the small subunit of ribonucleotide reductase gene (HSV-1 UL40 homolog) without any exogenous promoter, and in another construct at the locus of gI gene (HSV-1 US7 homolog) under the control of the human cytomegalovirusimmediate/early promoter. When 1-day-old chickens were vaccinated with the latter construct, good protection against mortality and bursal damage was obtained after IBDV challenge. In contrast, only a weak level of protection was achieved after vaccination with the former construct. Unfortunately, the protection levels obtained with these two constructs after challenge against Marek’s disease virus were very low (around 10%) when compared to that induced by the parental HVT (84%). In spite of the low protection level against Marek’s disease virus, the results of this study are quite encouraging, since complete protection against IBDV was obtained with a single inoculation of a recombinant virus. Genetically engineered rIBDV vaccine vector

In recent years, a number of infectious animal RNA viruses have been generated

163 from cloned cDNA. For example, poliovirus (a plus-stranded RNA virus) [70], influenza virus (a segmented negative-stranded RNA virus) [71], and rabies virus (a nonsegmented negative-stranded RNA virus) [72] were recovered from cloned cDNAs of their respective genomes. To date, no-one had reported the recovery of an infectious virus with a segmented double-stranded RNA genome from synthetic RNAs only As this review was being written, we were developing such a system for generating live rIBDV using synthetic transcripts derived from cloned DNA [54]. In this system, full-length cDNA clones of IBDV were constructed that contained the entire coding and noncoding regions of RNA segments A and B. Segment A encoded all of the structural (VP2,VP4 and VP3) and nonstructural (VP5) proteins of D78 strain, whereas segment B encoded the RNA-dependent RNA polymerase (VP1) of P2 strain. Synthetic RNAs of both segments were produced by in vitro transcription of linearized plasmids with T7 RNA polymerase. Transfection of Vero cells with combined plus-sense transcripts of both segments generated an infectious virus. In addition, transfectant viruses were generated that contained genetically “tagged” sequences in either segments A or B to confirm the feasibility of this “reverse genetics” system. Figure 4 shows the scheme for generating rIBDV from genomic cDNA clones. Although the recovered rIBDV has not been tested as a vaccine, this system of generating live recombinant viruses has great potential for the development of genetically engineered attenuated IBDV vaccines.With this technology, it is possible to: 1) determine the nucleotide residue@) responsible for attenuation; 2) develop attenuated vaccine stocks with increased genetic stability; and 3) manipulate the viral gene@) so as to produce nonpathogenic yet highly immunogenic candidate vaccines.

Conclusion This brief review has attempted to summarize the progress in the development of recombinant IBD vaccine candidates. New information about the molecular biology of IBDVs, coupled with utilization of improved systems for gene expression, has led to the synthesis of several recombinant products which have been tested in chickens with promising results. A new strategy, which has not been addressed here, is the induction of an immune response following direct injection of DNA encoding a viral antigen. Recently, Robinson et al. [73] have demonstrated partial protection of chickens against virulent influenza virus challenge following injection of DNA encoding the HA7 hemagglutinin. Although no-one has reported the use of a DNA-based vaccine for IBDY it is conceivable that this approach could be used in the future. Presently, the three approaches which hold the most promise are the baculovirus-derived antigens, rHVT vectored vaccines, and rIBDV vaccines. As a submit vaccine, the baculovirus-derived product could be quite effective since large quantities of IBDVantigens are produced in insect cells. These antigens are struc-

164

1

genomic cDNA clones

1 transfection of Vero cells

1

Fig. 4. Scheme for the recovery of genetically engineered rIBDV using synthetic transcripts derived from cloned cDNA. T7 promoter sequences at the 5’-end of the genomic cDNA clones are indicated by filled boxes. The “tagged” sequences in the recombinant virus are denoted by filled triangles.

turally similar to native virus particles, and assemble to form VLPs. Noninfectious VLPs are highly immunogenic and induce virus-neutralizing antibodies that confer active and passive protection. In order to make this vaccine cost-effective, one can infect insect larvae with the recombinant virus and harvest the desired protein. As a live virus-vectored vaccine, rHVT offers several advantages over rFPV for delivery of foreign antigens to the chickens. Unlike FPV, HVT is routinely used as a vaccine for 1-day-old chickens. HVT is nonpathogenic to chickens, and therefore, it is considered a safe virus to use as a vector. In addition, HVT establishes a persistent infection in chickens following vaccination that facilitates the presentation of foreign antigens to the immune system over

165

an extended period of time. However, additional studies on rHVTare needed to identify the site@)for insertion of foreign genes and the promoter@)required to drive the expression. Ultimately, the potential for generating live attenuated vaccine candidates with the use of a newly developed reverse genetics system seems limitless. Acknowledgements I wish to thank my collaborators: the late Dr David B. Synder for the vaccination trials and preparation of the MAbs; Dr Dieter Lutticken for passive protection studies; Dr Mark A. Goodwin for histopathology; Dr Egbert Mundt for the reverse genetics system; my associates: Gerard H. Edwards for VLPs purification and electron microscopy; Stephanie A. Mengel-Whereat for animal work; Peter K. Savage for ELISA; and Kris Fredericks for art work. This research was supported in part by grants from the US Department of Agriculture (No. 90-341165399) Maryland Agricultural Experiment Station, and Intervet International B.V., Boxmeer, The Netherlands. References 1. Cosgrove AS. An apparently new disease of chickens - avian nephrosis. Avian Dis 1962;6: 385-389. 2. Dobos P, Hill BJ, Hallet R, Kells DTC, Becht H,Teninges D. Biophysical and biochemical characterization of five animal viruses with bisegmented double-stranded genomes. J Virol 1979; 32:593-605. 3. Cheville NF. Studies on the pathogenesis of Gumboro disease in the bursa of Fabricius, spleen and thymus of the chicken. Am J Path01 1967;51:527-551. 4. Lulcert PD, Hitchner SB. In: Hofstad MS, Barnes HJ, Calnek BW, Reid WM,Yoder HW (eds) Diseases of Poultry, 8th edn. Ames: Iowa State University Press, 1984;566-576. 5. Hitchner SB. Persistence of parental infectious bursal disease antibody and its effects on susceptibility of young chickens. Avian Dis 1971;15:894-900. 6. Winterfield RW, Fadly AM, Bickford A. Infectivity and distribution of infectious bursal disease virus in the chicken. Persistence of the virus and lesions. Avian Dis 1972;16:622-632. 7. Allan WH,Faragher JT, Cullen GA. Immunosuppression by the infectious bursal agent in chickens immunized against Newcastle disease.Vet Rec 1972;90:511-512. 8. Kibenge FSB, Dhillon AS, Russell RG. Biochemistry and immunology of infectious bursal disease virus. J GenVirol 1988;69:1757-1775. 9. Baton WJ, Cover MS, Rosenberger JK. Studies on the transmission of the infectious bursal agent (IBA) of chickens. Avian Dis 1967;11:430-438. 10. Parkhurst RT. On-the-farm studies of Gumboro disease in broilers. Avian Dis 1964;8:584-596. 11. McFerran JB, McNulty MS, McKilhop ER, Connor TJ, McCracken RM, Collins DS, Allan GN. Isolation and serological studies with infectious bursal disease viruses from fowl, turkeys and ducks: demonstration of a second serotype. Avian Path 1980;9:395--404. 12. Winterfield RW, Thacker HL. Immune response and pathogenicity of different strains of infectious bursal disease virus applied as vaccines. Avian Dis 1978;5:253-260. 13. Ismail NM, Saif YM, Moorhead PD. Lack of pathogenicity of five serotype 2 infectious bursal disease viruses. Avian Dis 1988;32:757-759.

166 14. Rosenberger JK, Cloud SS. Isolation and characterization of variant infectious bursal disease viruses. Proc. 123rd Ann. Meeting of the AVMA, 1986, Abstract 181. 15. Snyder DB, Lana DP, Savage PK,Yancey FS, Mengel SA, Marquardt W W Differentiation of infectious bursal disease viruses directly from infected tissues with neutralizing monoclonal antibodies: evidence of a major antigenic shift in recent field isolates. Avian Dis 1988;32 535-539. 16. Snyder DB, Vakharia VN, Savage PK. Naturally occurring-neutralizing monoclonal antibody escape variants define the epidemiology of infectious bursal disease virus in the United States. Arch Virol 1992;127239- 101. 17. Chettle N, Stuart JC, Wyeth PJ. Outbreak of virulent infectious bursal disease in East Anglia. Vet Rec 1989;125:271-272. 18. Van den BergTP, Gonze M, Meulemans G. Acute infectious bursal disease in poultry: isolation and characterization of a highly virulent strain. Avian Path 1991;20:133-143. 19. NunoyaT, Otaki YTajima M, Hiraga M, Saito T. Occurrence of acute infectious bursal disease with high mortality in Japan and pathogenicity of field isolates in specific-pathogen-free chickens. Avian Dis 1992;36:597-609. 20. Brown MD, Green P, Skinner MA. VP2 sequences of recent European very virulent isolates of infectious bursal disease virus are closely related to each other but are distinct from those of classical strains. J Gen Virol 1994;75:675-680. 21. Dobos I? Peptide map comparison of the proteins of infectious bursal disease virus (IBDV). J Virol 1979;32:1046-1050. 22. Miiller H, Becht H. Biosynthesisofvirus-specific proteins in cells infected with infectious bursal disease virus and their significance as structural elements for infectious virus and incomplete particles. J Virol 1982;44:384-392. 23. Azad AA, Barrett SA, Fahey KJ. The characterization and molecular cloning of the doublestranded RNA genome of an Australian strain of infectious bursal disease virus. Virology 1985; 143~35-44. 24. Mundt E, Miiller H. Complete nucleotide sequences of 5’- and 3’-noncoding regions of both genome segments of different strains of infectious bursal disease virus. Virology 1995;209: 10-18. 25. Hudson PJ, McKern NM, Power BE, h a d AA. Genomic structure of the large RNA segment of infectious bursal disease virus. Nucl Acid Res 1986;14:5001-5012. 26. Morgan MM, Macreadie IG, Harley VR, Hudson PJ, Azad AA. Sequence of the small doublestranded RNA genomic segment of infectious bursal disease virus and its deduced 90-kDa product. Virology 1988;163:240-242. 27. Mundt E, Beyer J, Miiller H. Identification of a novel viral protein in infectious bursal disease virus-infected cells. J Gen Virol 1995;76:437-443. 28. Spies U, Miiller H, Becht H. Properties of RNA polymerase activity associated with infectious bursal disease virus and characterization of its reaction products. Virus Res 1987;8:127-140. 29. Spies U, Miiller H. Demonstration of enzyme activities required for the cap structure formation in infectious bursal disease virus, a member of the birnavirus group. J Gen Virol 1990;17: 977-981. 30. Becht H, Miiller H, Miiller HK. Comparative studies on structural and antigenic properties of two serotypes of infectious bursal disease virus. J Gen Virol 1988;69:631-640. 3 1. Fahey KJ, Erny KM, Crooks J. A conformational immunogen on VP2 of infectious bursal disease virus that passively protect chickens. J Gen Virol 1989;70:1473-1481. 32. Azad AA, Jagadish MN, Brown MA, Hudson PJ. Deletion mapping in Escherichia coli of the large genomic segment of a birnavirus.Virology 1987;161:145-152. 33. Jagadish MN, StatonVJ, Hudson PJ, Azad AA. Birnavirus precursor polyprotein is processed in Escherichia coli by its own virus-encoded polypeptide. J Virol 1988;62:1084-1087. 34. Jackwood DJ, Saif YM. Antigenic diversity of infectious bursal disease viruses. Avian Dis 1987; 31~766-770.

167 35. Snyder DB, Lana DP, Cho BR, Marquardt WW Group and strain-specific neutralization sites of IBDV defined with monoclonal antibodies. Avian Dis 1988;32:527-534. 36. Van der Mare1 P, Snyder D, Liitticken D. Antigenic characterization of IBDV field isolates by their reactivity with a panel of monoclonal antibodies. Dtsch Tierarztl Wschr 1990;97:81-83. 37. Bayliss CD, Spies U, Shaw K, Peters RW, Papageorgiou A, Miiller H, Boursnell MEG. A comparison of the sequences of segment A of four infectious bursal disease virus strains and identification of avariable region inVP2. J GenVirol 1990;71:1303-1312. 38. Brown MD, Skinner MA. Coding sequences of both genome segments of a European ‘very virulent’ infectious bursal disease virus. Virus Res 1996;40:1-15. 39. VakhariaVN, He J, Ahamed B, Snyder DB. Molecular basis of antigenic variation in infectious bursal disease virus. Virus Res 1994;31:265-273. 40. Kibenge FSB, Jackwood DJ, Mercado CC. Nucleotide sequence analysis of genome segment A of infectious bursal disease virus. J Gen Virol 1990;71:569-577. 41. Lin Z, Kato A, Otaki Y, Nakamura T, Sasmaz E, Ueda S. Sequence comparisons of a highly virulent bursal disease virus prevalent in Japan. Avian Dis 1993;37:315-323. 42. Lana DP, Beisel CE, Silva RE Genetic mechanisms of antigenic variation in infectious bursal disease virus: analysis of a naturally occurring variant virus. Virus Genes 1992;6:247-259. 43. Heine HG, Haritou M, Failla P, Fahey K, Azad A. Sequence analysis and expression of the hostprotective immunogen VP2 of a variant strain of infectious bursal disease virus which can circumvent vaccination with standard type I strains. J GenVirol 1991;22:1835-1843. 44. VakhariaVN, Ahamed B, He J. Use of polymerase chain reaction for efficient cloning of dsRNA segments of infectious bursal disease virus. Avian Dis 1992;36:736-742. 45. h a d AA, McKern NM, Macreadie IG, Failla P, Heine HG, Chapman A,Ward CW, Fahey KJ. Physicochemical and immunological characterization of recombinant host-protective antigen (VP2) of infectious bursal disease virus. Vaccine 1991;9:715-722. 46. Macreadie IG, Vaughan PR, Chapman AJ, McKern NM, Jagadish MN, Heine HG, Ward CW, Fahey KJ, Azad AA. Passive protection against infectious bursal disease virus by viral VP2 expressed in yeast. Vaccine 1990;8:549-552. 47. VakhariaVN, Snyder DB, He J, Edwards GH, Savage PK, Mengel-Whereat SA.Infectious bursal disease virus structural proteins expressed in a baculovirus recombinant confer protection in chickens. J GenVirol 1993;741201-1206. 48. VakhariaVN, Snyder DB, Liitticken D, Mengel-Whereat SA, Savage PK, Edwards GH, Goodwin MA. Active and passive protection against variant and classic infectious bursal disease virus induced by baculovirus expressed structural proteins. Vaccine 1994;12:452-456. 49. Snyder DB,VakhariaVN, Mengel-Whereat SA, Edwards GH, Savage PK, Liitticken D, Goodwin MA. Active cross-protection induced by a chimeric infectious bursal disease virus structural protein gene expressed by a baculovirus recombinant. Avian Dis 1994;38:701-707. 50. Bayliss CD, Peters RW, Cook JKA, Reece RL, Howes K, Binns MM, Boursnell MEG. A recombinant fowlpox virus that expresses the VP2 antigen of infectious bursal disease virus induces protection against mortality caused by the virus. ArchVirol 1991;120193-205. 51. Heine HG, Boyle DB. Infectious bursal disease virus structural protein VP2 expressed by a fowlpox virus recombinant confers protection against disease in chickens. Arch Virol 1993;131: 277-292. 52. Heine HG, Hyatt AD, Boyle DB. Modification of infectious bursal disease virus antigenVP2 for cell surface location fails to enhance immunogenicityVirus Res 1994;32:313-328. 53. Darted R, Bublot M, Laplace E, Bouquet J-F, Audonnet J-C, Riviere M. Herpesvirus of turkey recombinant viruses expressing infectious bursal disease virus (IBDV) VP2 immunogen induce protection against an IBDV virulent challenge in chickens. Virology 1995;211:481-490. 54. Mundt E, Vakharia VN. Synthetic transcripts of double-stranded birnavirus genome are infectious. Proc Natl Acad Sci USA 1996;93:11131-11136. 55. McAleer WJ, Buynak EB, Maigetter RZ,Wampler DE, Miller WJ, Hilleman MR. Human hepatitis B vaccine from recombinant yeast. Nature 1984;307:178-180.

56. Summers MD, Smith GE. A manual of methods for baculovirus vectors and insect cell culture procedures. Texas Agricultural Experiment Station Bulletin No. 1555, 1987. 57. OReilly DR, Miller LK, Luckow VA. Baculovirus expression vectors: a laboratory manual. New York: WH. Freeman and Co., 1992. 58. Gheysen D, Yancey R, Petrovskis E, Timmins J, Post L. Assembly and release of HIV-1 precursor Pr55gagvirus-like particles from recombinant baculovirus-infected insect cells. Cell 1989; 59: 103- 112. 59. Nonnenmacher B, Hubbert N, Schiller J. Serologic response to human papillomavirus type 16 (HPV-16) virus-like particles in HPV-16 DNA-positive invasive cervical cancer and cervical intraepithelial neoplasia grade 111 patients and controls from Columbia and Spain. J Infect Dis 1995;172:19. 60. Urakawa T, Ferguson M, Minor PD, Cooper J, Sullivan M, Almond Jw,Bishop DL. Synthesis of immunogenic, but non-infectious, poliovirus particles in insect cells by a baculovirus expression vector. J GenVirol 1989;70:1453- 1463. 61. Belyaev AS, Roy F? Development of baculovirus triple and quadruple expression vectors: coexpression of three or four bluetongue virus proteins and the synthesis of bluetongue virus-like particles in insect cells. Nucl Acid Res 1993;21:1219-1223. 62. Bentley WE, Wang MY, VakhariaV. Development of an efficient bioprocess for poultry vaccines using high density insect cell culture. Ann NYAcad Sci 1994;745:336-356. 63. Boyle DB, Coupar BEH. Construction of recombinant fowlpox viruses as vectors for poultry vaccines. Virus Res 1988;10:343-356. 64. Boursnell MEG. Avipox vectors. In: Binns MM, Smith GL (eds) Recombinant poxviruses. Boca Raton: CRC Press, 1992;269-283. 65. Ogawa R, Yanagida N, Saeki S, Saito S, Ohkawa S, Gotoh H, Kodama K, Kamogawa K, Sawaguchi K, Iritani Y Recombinant fowlpox viruses inducing protective immunity against Newcastle disease and fowlpox viruses.Vaccine 1990;8:486-490. 66. Taylor J, Edbauer C, Rey-Senelonge A, Bouquet J-F, Norton E, Goebel S, Desmettre P, Paoletti E. Newcastle disease virus fusion protein expressed in a fowlpox virus recombinant confers protection in chickens. J Virol 1990;64:1441- 1450. 67. Nazerian K, Lee LF, Yanagida N, Ogawa R. Protection against Marek's disease by a fowlpox virus recombinant expressing the glycoprotein B of Marek's disease virus. J Vim1 1992;66: 1409- 1413. 68. Morgan RW, Gelb J, Schreurs CS, Lutticken D, Rosenberger JK, Sondermeijer PJ. Protection of chickens from Newcastle and Marek's diseases with a recombinant herpesvirus of turkeys vaccine expressing the Newcastle disease virus fusion protein. Avian Dis 1992;36:858-870. 69. Morgan RW, Gelb J, Pope CR, Sondermeijer PJ. Efficacy in chickens of a herpesvirus of turkeys recombinant vaccine containing the fusion gene of Newcastle disease virus: Onset of protection and effect of maternal antibodies. Avian Dis 1993;37:1032-1040. 70. Racaniello VR, Baltimore D. Cloned poliovirus cDNA is infectious in mammalian cells. Science 1981;214:916-919. 71. Enami M, Luytjes W, Krystal M, Palese P.Introduction of site-specific mutations into the genome of influenza virus. Proc Natl Acad Sci USA 1990;87:3802-3805. 72. Schnell MJ, Mebatsion T, Conzelmann KK. Infectious rabies viruses from cloned cDNA. EMBO J 1994;13:4195-4205. 73. Robinson HL, Hunt LA, Webster RG. Protection against a lethal influenza virus challenge by immunization with a hemagglutinin-expressing plasmid DNA. Vaccine 1993;11:957-960.

01997 Elsevier Science B.V. All rights reserved. Biotechnology Annual Review Volume 3 M.R. El-Gewely, editor.

169

Molecular methods in diagnostic pathology S. Muller-Deubert and H. Kreipe Institute of Pathology, University of Wurzburg,Wurzburg, Germany

Abstract. During recent years the traditional methods of pathology to analyze tissue specimens, morphology and immunohistochemistry have been increasingly enriched by molecular DNA-based techniques. Standard methods such as nucleic acid hybridization and polymerase chain reaction (PCR)have been adapted to the particular requirements of processed and stored tissues available in surgical pathology. Molecular biology provides relevant diagnostic support in: 1) the detection and identification of infectious agents; 2) the delineation of clonality in tumor-suspicious lesions; 3) the detection of clonal aberrations in cancer; and 4) the tracing of minimal tumor infiltrates. There are types of molecular analysis that already serve as routine instruments and others have at least the potential to become a standard procedure in diagnostic surgical pathology

Keywords: clonal aberrations, clonality, minimal residual disease, molecular pathology

Molecular biotechnology, in particular DNA-based techniques, has facilitated enormous progress in biomedical science over the last decade. It has brought about new insights into the pathogenesis of diseases and has provided methods enabling the analysis of very small samples and even single cells. Surgical pathology, whose task it is to render histological diagnoses from biopsies and surgical specimens, has also benefited from this development and molecular methods emerge as promising tools where pure morphology comes up against its limits. There are types of molecular analyses that have already been incorporated into everyday practice of surgical pathology and others have at least the potential to become a standard procedure in diagnostic pathology This review will summarize these methods and applications with particular emphasis on the diagnostic utility It should be kept in mind that DNA analysis is not able to substitute for a morphological diagnosis and has to be interpreted within the context of a histological classification of diseases. Molecular techniques commonly applied in diagnostic pathology

There is a limited number of laboratory procedures that are used in diverse diagnostic applications in diagnostic molecular pathology The most important of these procedures are described below.

Addressfor correspondence:S. Miiller-Deubert, Institute of Pathology, University of Wiirzburg, JosefSchneider-Str. 2, D-97080 Wiirzburg, Germany

170

Isolation of nucleic acidsfrom tissues Many probe-based methods of detection require the extraction of DNA or, in some cases, RNA from a clinical sample (body fluid, peripheral white cells, aspirate or scraping, or fresh tissue) or from microbial culture. DNA exists within cells enmeshed in protein and must be freed of the attached molecules to be an effective substrate for the many enzymes used in molecular analysis. This is accomplished by sequential steps of cell lysis, protein dissolution with proteinase, and removal of peptides from the lysate by organic extraction. Nucleic acids are then recovered by precipitation with ethanol and sodium chloride. DNA can easily be isolated from fresh or frozen tissue by mechanical disruption, proteinase digestion and extraction, as described [l-31. But in routine surgical pathology tissue in most instances is exclusively available as formalin-fixed and paraffin-embedded specimens. Therefore, procedures for extracting DNA from fresh tissues have been successfblly adapted to paraffin-embedded tissues, which must be deparaffinized before performing the above steps [3-61. Early studies focused on the isolation of high-molecular DNA (fragments > 20 kb) from paraffin-embedded tissue for conventional analysis of gene rearrangements [7-lo]. DNA in vivo is a long, linear molecule closely associated with histones and other proteins. Formalin, the general-purpose fixative used in most pathology laboratories, cross-links DNA to protein. This makes the DNA molecule rigid and susceptible to mechanical shearing. Breakage can be minimized by thin-sectioning of tissue and gentle handling of DNA-containing aqueous solutions. It is also advantageous to analyze a larger quantity of DNA derived from a fixed specimen to compensate for shearing losses. Degradation of DNA isolated from paraffin-embedded tissues therefore frequently precludes accurate analysis of gene structure and copy number using conventional Southern blot analysis for which high molecular weight DNA is required [lo]. In contrast, partially degraded, low molecular weight DNA has proven to be an excellent substrate for in vitro amplification with the polymerase chain reaction; nearly all recent studies using paraffin-embedded tissues have used this technology Sufficient DNA can be extracted in a 1.5 ml microcentrifuge tube from a 5- 10 pM thin section of paraffin-embedded tissue. After deparaffinization the tissue is washed with 95% alcohol, dried, and then incubated for 24-48 h with proteinase K in a buffer containing a detergent, usually sodium dodecyl sulfate. Subsequent boiling inactivates the proteinase, and centrifbgation leaves a supernatant that contains DNA suitable for amplification [11,121. Organic extraction with phenol and chloroform to clear the supernatant of proteins may be performed but is not always required. Alternatively, deparaffinized, dissected tissue sections can be boiled for 30 min in distilled water containing Chelex-100, a polyvalent chelating agent [13,141. The crude lysate is then passed through a 1.0 ml Sephadex G-50minicolumn before use as a substrate for the polymerase chain reaction (PCR) [13,151. Some

171 investigators have further pared down the process by omitting both proteolysis and the chelating agent and simply using the crude lysate obtained from boiling deparaffinized tissue sections [ 16- 181. The success rate of this simplified procedure is approximately 85%; the rate can be increased to nearly 100% with repeated isolation or efforts to clear the lysate of protein [17]. Primer strategies that target small areas of DNA for amplification are more successful when analyzing paraffin-embedded tissue [5,19]. Amplified DNA can be cloned or hrther characterized by hybridization with complementary nucleic acid probes, restriction endonuclease digestion, or direct sequencing. Fixative type has a direct bearing on the quality of extracted DNA. Ethanol fixation, although not routinely used in most laboratories, is an especially good preservative of DNA [6,20]. Mercuric chloride containing fixatives such as B5 have a deleterious effect on DNA integrity not reflected in histomorphology, and attempts to analyze such fixed tissues using conventional Southern blot analysis have been unsuccessful [6,9]. Tissue fixed in Bouin’s solution or B5 is sometimes at best adequate for use with the PCR [6,21]. Duration of formalin fixation also appears to be important; however, most studies of archival tissue will use routinely processed specimens fixed for less than 24 h. In contrast to DNA, the isolation of RNA from tissue specimens meets greater difficulties due to the existence of RNases. RNases are ubiquitous enzymes that degrade RNA. Isolation of intact RNA from cultured cells, fresh tissue, or blood requires special precautions to eliminate RNases from laboratory ware and reagents. Tissues processed for pathological analysis are subjected to hydration, fixation, and parafin embedding under conditions that are neither sterile nor RNase-free. These processes, however, also inactivate the enzymes that degrade nucleic acids. Hence, RNA that survives tissue fixation remains in a relatively stable state in the paraffin block. RNA has been successfully isolated from parafin-embedded tissues for quantitative dot-blot analysis of mRNA [22]. Reverse transcription of RNA with subsequent in vitro amplification of the resulting cDNA to produce double-stranded DNA is a simpler procedure that has been adapted for use with parafinembedded tissue. This technique’s (termed RT-PCR) greatest utility is in detecting RNA viruses, but can also be used to examine oncogene expression [14,23-281. Sufficient RNA for some purposes can be isolated from PETusing a standard DNA extraction protocol or the acid guanidinium thiocyanate-phenol technique customarily used to extract RNA from fresh tissues [24,26,27]. As is true for DNA, strategies targeting small segments of RNA are more successful when paraffin-embedded tissue is analyzed. Methods to analyze nucleic acids derivedpom pathological specimens

Extracted DNA or RNA from pathological tissue samples can be further studied by using standard procedures such as Southern blotting, single-strand conformational polymorphism (SSCP) and DNA sequencing. The following techniques

172 are of particular importance and require in most cases a special adaptation to the needs of diagnostic pathology. Southern blotting This approach uses genomic DNA digestion with restriction endonucleasesbefore size fractionation in agarose gels and transfer to a solid matrix (Southern blot, [S-lo]). The positions of the DNA fragments in the gel are preserved on the matrix, where they can be hybridized with a labeled single-stranded DNA probe. Autoradiography then reveals the position of the restriction fragment with a sequence complementary to that of the probe. Southern blotting can be used to follow the inheritance of selected genes. Mutations within restriction sites change the sizes of restriction fragments and hence the positions of bands in Southern blot analyses. The existence of genetic diversity in a population is termed polymorphism. The detected mutation may itself cause disease or may be closely linked to one that does. This restriction fragment length polymorphism (RFLP) can detect genetic diseases such as cystic fibrosis and Huntington’s chorea. Gene amplification has been studied in paraffin-embedded neoplasms by applying isolated DNA directly to nylon or nitrocellulose blots without prior size fractionalization, probing it with radioisotope-labeled complementary nucleic acid probes, and quantitating the bound radioactive signal density [29,30].

PCR PCR is a technique to amplify a specific DNA segment in a simple automated reaction theoretically yielding an unlimited quantity of DNA. Therefore, PGR is a sensitive technique for the detection of specific DNA sequences [1,3]. The first diagnostic application of PCR was the prenatal diagnosis of sickle-cell anemia, which is caused by a single base pair change in the sequence of the P-globin gene [31]. For PCR reaction a small amount of DNA is added to specific primers, desoxyribonucleotidesand a DNA-dependent DNA polymerase. Each reaction cycle consists of three steps: DNA denaturation, primer annealing and DNA synthesis. The reaction is started with double-stranded DNA molecules, which are denaturated by high temperatures (92-95°C). During cooling to an annealing temperature the primers hybridize to their complementary DNA sequences. The annealing temperature, which lies between 40 and 60°C has to be determined empirically to optimize PCR; it depends on primer length and sequence as well as on homology between primer and target sequence.The third step of PCR raises the temperature to the optimal reaction temperature of the DNA polymerase. It is essential to understand the limitations and problems created by PCR and to acknowledge that these difficulties must be overcome before PCR will become a standard tool of diagnostic pathology and replaces current testing methods. The extreme sensitivity of PCR paradoxically leads to one of its major drawbacks, the occurrence of false positive results. Very small amounts of the amplified target sequence, of which up to lo9 copies can be present in a single PCR solution,

173

can contaminate laboratory equipment or reagents. The PCR product can even spread as airborne droplets in areas of sample or reagent preparation. This contaminating DNA can serve as a template for hrther amplification, resulting in false positive results in subsequent samples. A precaution against this type of error is the routine use of chemical and enzymatic methods for inactivating PCR products [32].

Analysis of PCR products PCR products are routinely visualized by gel electrophoresis followed by ethidium bromide staining and UV light illumination. To increase sensitivity and confirm specificity, the products can be transferred from the gel to filters by Southern blotting and hybridized with radioactive probes [1,331. A simple and rapid method for detection of point mutations is the SSCl? This technique is based on variation of electrophoretic mobility resulting from conformational differences of single-stranded DNA molecules [34]. The conformation of single-stranded DNA is determined by its sequence. Therefore, mutant and wild-type single-strands differ in the gel. The PCR products are denatured and separated on a nondenaturing polyacrylamide gel. Mutated sequences are identified by their altered mobility with reference to the normal allele. However, carehl comparison should be made between test and control samples, as complex patterns appear. SSCP is usell as a screening method which can be followed by direct sequencing for precise characterization of mutations. Another method to detect mutations takes advantage of differential melting of DNA-duplexes in a denaturing gradient. The electrophoresis of double-stranded DNA molecules through increasing concentrations of chemical denaturants, such as formamide or urea, is known as denaturing gradient gel electrophoresis (DGGE, [35,36]). The position along the gradient gel where the DNA fragment undergoes partial denaturation and retardation of its electrophoretic mobility is strictly sequence-dependent, allowing the resolution of two identical doublestranded DNA fragments differing by a single nucleotide substitution. Modifications of DGGE include the use of a physical denaturant, such as temperature (temperature gradient electrophoresis (TGGE)), resulting in the gel-retardation of mutated heteroduplexes compared with the more stable homoduplex [37-391. The direct sequencing of PCR products has been applied widely for analysis of mutations and sequence confirmation. Two different approaches are commonly used [40]. One is based on generation of single-stranded DNA templates by PCR followed by a standard Sanger sequencing reaction. The other features a simultaneous sequencing and PCR reaction (cycle sequencing). These methods have replaced the time-consuming and complex cloning that is required to generate template DNA in standard sequencing procedures. In situ hybridization (ISH) As with Southern- (or Northern-) blotting, ISH is also based on the fact that probes consisting of labeled single-stranded sequences of DNA or RNA can

174 combine with target DNA or RNA under appropriate conditions to form stable hybrids which can then be visualized with a detection system. Particularly from the point of view of the pathologist, the blotting and subsequent hybridization procedures have the disadvantage that they provide no morphologic information. In contrast, ISH is able to localize specific DNA or RNA sequences either within cells or on chromosomes. Optimal hybridization conditions for gel and in vitro hybridization have been extensively studied and are now well-described. Hybridization conditions for ISH are complicated by the fact that in tissue sections or cell preparations there are several factors which can lead to nonspecific binding of probes, resulting in high background and a reduced signal-to-noise ratio. These factors can be considered in terms of the following variables: - the effect of tissue fixation on retention and accessibility of the target; - the type of probe, including efficiency of labelling and sensitivity of the method used for signal detection; and - the effect of hybridization conditions on the efficiency of hybridization. An optimal fixative for ISH must preserve a maximal level of target DNA or RNA while at the same time maintaining morphologic detail and allowing access of the probe to its target. Optimal tissue preparation is particularly important for ISH directed against RNA, since RNA is more sensitive to enzymatic degradation than the relatively stable DNA. For this reason it is particularly important that tissue intended for use in RNA localization should be fixed or frozen as soon as possible after surgical excision. Correspondingly, the results of ISH for RNA are much more dependent on the type, time and concentration of the fixative employed. A typical protocol for ISH tissue preparation begins with fixation in buffered 4% paraformaldehyde for 1-2 h followed by sucrose immersion to decrease freeze artifacts. The tissue is then stored in liquid nitrogen until cutting in a cryostat shortly before use. As an alternative, the tissue can be snap frozen immediately and stored in liquid nitrogen unfixed. Cryostat sections are then briefly (10 min) fixed in 4% paraformaldehyde, air-dried and stored at -70°C prior to hybridization. Although by this second method morphology is not as well maintained, an advantage is that the tissue can be used either for ISH or DNA and RNA extraction. However, in cases in which a high copy number of DNA or mRNA was originally present, ISH can be successllly performed on formalin-fixed, paraffinembedded tissue. In order to increase accessibility of the target to the probe, particularly with paraffin sections, almost all published ISH protocols include a digestion step using a detergent and proteinase. Most commonly Triton X-100 and Proteinase K are used [41]. Generally, probes with lengths ranging from 50 to 300 bp provide the best combination of access to target and high hybridization efficiency Longer probes in the range of 1.5 kb are used for chromosomal studies or for “networking” for signal enhancement [42] while probes shorter than 50 bp are usefkl when closely related gene sequences must be distinguished from one another [43].

175 The following can be used as probes for ISH: DNA: - double-stranded DNA, vector or PCR-derived; - synthetic oligonucleotides, single or multiple; and - single-stranded DNA. RNA: - single-stranded antisense RNA; and - synthetic oligonucleotides. The stringency of hybridization in ISH is dependent on several factors including the length of the probe, temperature, pH, concentration of a denaturant (e.g., formamid), concentration of salt in the hybridization buffer, and the degree of homology of the probe to its target. The concept of “stringency” is derived from the fact that the specificity of hybridization can be varied according to any of these factors. For example, under conditions of low stringency (low temperature, low denaturant concentration and high salt concentration) probes with several mismatches can still hybridize to a given target resulting in low specificity but a relatively high sensitivity Conversely, under conditions of high stringency (high temperature, high denaturant concentration and low salt concentration) only probes without mismatches can hybridize, resulting in high specificity but a relatively low sensitivity. An important difference from immunohistochemistry lies in the fact that the sensitivity and specificity of the ISH can be adjusted by carefully varying the reaction conditions in this way Detailed studies concerning influences of buffers, probe concentration, time and temperature on hybridization efliciency for DNA [42] and RNA probes [44,45] have been published. ISH is used for a variety of applications in pathology These can be divided into those which have DNA or RNA as the target nucleic acid. DNA detection is primarily important in two areas. The first of these is detection of viral or bacterial DNA, including differentiation between closely related sequences. On the other hand, ISH is able to detect gene alterations (e.g., deletion, amplification and rearrangement). ISH directed against RNA has several applications in pathology By detecting mRNA, ISH localizes the site of peptide synthesis independent of secretion or internal degradation. When used in combination with immunohistochemistry, ISH can readily determine whether a protein is actually synthesized within the cell or was absorbed or phagocytosed from the extracellular environment. Studies using ISH directed against small nuclear RNA (snRNA) can help demonstrate the rate of protein synthesis within a given cell. Finally, when immunohistochemistry is not available, either due to lack of antibody, or when available antibodies have poor sensitivity or specificity, ISH is the only technique for morphological localization of the expression products. Applications Detection of infectious agents

The traditional method of identifling a pathogen is to culture it. However, many

176

kinds of infectious agents, including mycobacteria, fungi, and viruses, are either pretentious and grow slowly or cannot be cultured at all. In these instances, serologic or histologic methods may identify the infectious agent. Nevertheless, these methods usually yield only circumstantial evidence of infection. Using special stainings for microorganisms it is frequently very tedious and sometimes impossible to identify bacteria such as tuberculosis bacilli in tissue sections. Pathologists now have highly sensitive, rapid, and specific molecular methods of identifying infectious agents by the direct detection of DNA or RNA sequences unique to a particular organism. These advances in diagnostic molecular microbiology have shortened the time necessary to identify microorganisms, expanded the number of identifiable human pathogens, and improved the accuracy of subtyping of pathogens in epidemiologic studies [46-481. The two principal molecular techniques used in the detection of microorganisms are nucleic acid hybridization with a specific DNA or RNA probe, and DNA amplification by the PCR [32,49]. These techniques are useful for the direct detection of organisms in clinical samples or for confirmation of the results of microbial cultures. Since the oligonucleotide probes identi@microbial genetic sequences rather than microbial gene products, molecular hybridization has greater sensitivity and specificity than conventional immunologic tests, which identifL antibodies and antigens related to microbial pathogens. For subtyping analysis (e.g., identification of virulent clones among isolates of bacterial species), molecular methods are reproducible and can readily discriminate between clones, thus eliminating the need for organism-specific monoclonal antibodies directed against cell-surface antigens. Hybridization on nylon membranes identifies the target microbial gene sequence within the mixture of DNA derived from the variety of host cells and organisms in the sample. It can reveal the presence of a particular organism in the tissue, but it does not necessarily implicate the microbe in active or latent infection. The histologic technique of in situ hybridization, which weds molecular biology and morphology, can make a more convincing connection between the microbe and the disease. In situ hybridization can detect a specific microbial genome within a particular cell. Moreover, it allows the pathologist to observe the relation of the infected cells to any host-tissue response. The method is suitable for formalin-fixed, paraffin-embedded tissue sections and some cytologic preparations. The detection of genetic material indicating the presence of a specific pathogen in a lesion confirms the diagnosis and eliminates the need to obtain further samples. When applied to routine histopathological specimens, in situ hybridization can identify specific types of human papillomavirus in lesions of the female genital tract [50], localize Epstein-Barr virus in lymphoproliferative disorders and nasopharyngeal carcinoma [33,5 11, and detect cytomegalovirus and herpesvirus in biopsy specimens from immunocompromised patients [18,52,53]. PCR has a substantial impact on the diagnosis of infectious disease. The ability of this method to amplify minute amounts of specific microbial DNA sequences

177 in a background mixture of host DNA makes it a powerfhl diagnostic tool. PCR produces sufficient copies of a specific sequence of DNA for molecular characterization, usually with oligonucleotide probes. A major advantage of PCR is that it is far more sensitive than direct hybridization and thus requires extremely small amounts of target DNA as a template. In terms of sensitivity, membranebased hybridization has a limit of detection of approximately 10,000 copies of target DNA, whereas PCR-based methods can detect as few as 10-100 copies in clinical samples. In addition, the sample used, which can be obtained from any tissue or body fluid, does not have to be highly purified. As long as the sequence to be amplified (usually 100-1,000 bp) is intact, the starting DNA can be partially degraded. This feature of the method makes it possible to use DNA from archival paraffin-embedded tissues to detect infectious organisms retrospectively PCR can also be used to detect RNA viruses (e.g., hepatitis C virus, [14,54]) or a specific messenger RNA transcribed by a microorganism. This application requires reverse transcription of the RNA isolated from the sample into DNA; the product of this reaction, termed complementary DNA (cDNA), then serves as a template for amplification by PCR. Caution must be exercised in these cases, since RNA is a labile molecule and its degradation could lead to false negative results. The rapidity of PCR makes it possible to generate detectable amounts of amplified target DNA within hours, as compared with several days for probe hybridization procedures and often weeks for the identification of many organisms by culture [55]. PCR is already being applied in the clinical laboratory to identify some slowgrowing organisms. One example is the identification of mycobacteria [47]. This diverse group of organisms includes a variety of pathogenic atypical and drugresistant forms whose identification is a prerequisite for proper therapy Rapid identification of specific mycobacterial species results in fewer diagnostic procedures and may eliminate long periods of precautionary isolation of the patient while the results of cultures are awaited. Another promising application of PCR is the diagnosis of infectious conditions in which there are often too few organisms present for detection by other means. An example is the use of PCR for the detection of Borrelia burgdorferi [56], the causative agent of Lyme disease, in which the range of symptoms and the limited diagnostic methods available frequently delay the diagnosis. Nearly 100 kinds of organisms have thus far been detected by PCR. The clinical relevance of a positive PCR result may be questioned when only small numbers of pathogenic organisms are present in samples from clinically unaffected persons. Another source of error is the detection of nonviable organisms by PCR, since it amplifies only a portion of the microbe’s genome. In such instances, detection of cDNA by reverse transcriptase PCR of messenger RNA encoded by the pathogenic organism could be used as evidence of active infection. This method will soon be applicable at the cellular level; recent investigations have shown the capacity of PCR to amplify and detect DNA and RNA sequences from pathogens in fixed cells and tissue sections (in situ PCR, [3]).

178 Another point of uncertainty is the rate of false negative and false positive results of PCR analysis. Also the predictive value of these tests often remains unclear. Cases are known, where patients received unnecessary medications although there was no other evidence for infectious disease except positive PCR analysis, which has been shown later to be false positive. Especially the detection of Mycobacterium tuberculosis is very diEcult under these conditions and should be handled with care [57]. Analysis of clonality

Neoplasms, by definition, are monoclonal proliferations of transformed cells. Therefore, the demonstration of monoclonality is of great benefit in distinguishing neoplasms from other proliferative conditions [58]. The assessment of clonality by Southern blot analysis has proved itself useful in lymphoma pathology However, this technique has significant disadvantages, namely, it is very time consuming and requires fresh tissue samples. PCR methods have overcome these problems, allowing rapid, routine evaluation of paraffin-embedded lymphoid tissue samples. Due to clone-specific rearrangements of immunoglobulin or Tcell receptor genes clonal proliferations of lymphoid cells can be identified. Bcell clonality is assessed by amplification of the Ig heavy chain gene and T-cell clonality by amplification of one of the T-cell receptor genes. PCR analysis of clonality in B-cell lymphoproliferative disorders is carried out by amplification and size analysis of rearranged Ig heavy chain genes. Rearrangement of the Ig heavy chain gene V, D and J segments occurs in all B-cells and yields rearranged genes which are variable in size due to the addition of N regions at the junctions. As B-cells from one clone have the same rearrangement and hence the same size of rearranged fragment, PCR products from monoclonal populations appear as a discrete band (or two bands if both alleles are rearranged), whereas polyclonal populations appear as smears of many different product sizes. Primers are designed which span the junctional regions by binding to sequences in the V and J segments. The most popular method uses a primer directed to the FR3 part of theV segment [59,60]. Because amplification products are small (80-120 bp) highly degraded samples can be used, and good resolution can be achieved on 10% polyacrylamide gels. However, this primer does not bind to all rearranged sequences due to germline variability, somatic mutation or deletion [61]. The use of additional primers directed to other regions can increase the detection rate. Using this method, monoclonality can be shown in up to 80% of low-grade Bcell lymphomas [61]. However, in high-grade B-cell lymphomas [62,63] and in some types of low-grade lymphoma such as immunoproliferative small intestinal disease [64] the detection rates are significantly lower. Despite these limitations the analysis of clonality has become an important diagnostic tool in questionable lymphoproliferationswith uncertain dignity Clonal rearrangement of an Ig heavy

179 chain gene cannot be used to distinguish B-cell from T-cell disease, because some lymphomas have rearranged Ig and T-cell receptor genes. Clone-specific Nregion sequences can be used to design disease-specific PCR primers which are of much improved sensitivity for use in the detection of minimal residual disease [65,66]. PCR amplification of Ig genes can also yield templates for sequencing reactions, provide probes for hybridization experiments, and allow identification of clones at different sites and times within the disease course [67]. According to B-cell neoplasms, clonality of T-cell populations can be assessed by amplification of T-cell receptor genes which rearrange in T-cells in the same manner as the Ig genes in B-cells. There are several possible approaches, but most exploit the P- or y-chain TCR genes because the 01 gene is complex and the 6 gene is frequently deleted in mature T-cells. A protocol involving amplification of TCR P variable regions which uses six consensus primers to cover most possible rearrangements has been invented [68]. This yields small products and is therefore suitable for paraffin-embedded samples. However, false negative rates of up to 55% occur and the technique is rather complex, requiring the use of five separate reactions. Amplification of the TCR y chain gene can be achieved using two primer mixes [69]. This has the advantage that the primers are exactly homologous to their targets rather than consensus sequences, and it has been shown to work well on parafin-embedded tissue-derived extracts and detect around 70% of T-cell lymphomas [69]. It is therefore the best method currently available for clonality assessment in T-cell lymphopkoliferations. It allows evaluation of T-cell proliferative diseases, such as those of the skin, in which diagnosis on morphological grounds is particularly difficult. In diseases of immature T-cells, such as T-ALL, amplification of TCR 6 chain is also feasible [70].

Nonlymphoid tumors More recent techniques which exploit X-linked allele inactivation patterns have made it possible to assess clonality in a variety of tumors in female patients [71]. X-linked allele inactivation analysis can be used in females to investigate clonality of any tumor type. It relies on the fact that in female tumors all the cells of a neoplasm will carry the same inactivated X-chromosome, whereas in polyclonal populations there is about 50% inactivation of each. Activated and inactivated alleles can be distinguished as the latter have different patterns of gene methylation. For the discrimination of both alleles an RFLP is required, and individuals who are heterozygous for this RFLP can exclusively be analyzed. Most studies performed to date have used Southern Blot analysis of the phosphoglycerate kinase gene and the hypoxanthine-phosphoribosyl transferase gene that in the European population show heterozygosity for defined RFLPs in 30 and lo%, respectively [72,73]. The M27P probe at X cen-pll.22 has a heterozygosity rate of over 90% [74] but the methylation of the inactive X-chromosome varies from tissue to tissue requiring sufficient controls and skewed inactivation patterns occur in blood cells [75]. Clonal analysis using RFLP in conjunction with methy-

180

lation-sensitivedigestion can also be done by PCR. Suitable loci for PCR analysis must have highly polymorphic regions (e.g., simple tandem repeats (STR)) close to methylation sites. Digestion with a methylation-sensitive restriction enzyme followed by PCR amplification of the STR region yields a single band in a clonal population, rather than the two seen in nonneoplastic tissue. Suitable alleles include the androgen receptor [76,77] and phosphoglycerate kinase [78,79]. Unfortunately, normal cells within the tumor sample may complicate the pattern seen; tumor cells must constitute at least half of total cell numbers, or precise quantitation of PCR products is required. In some individuals, however, a skewed X-inactivation pattern has been observed in some cell types necessitating carell examination of appropriate normal cell populations from each patient in order to exclude a constitutive skewed pattern [80]. The methodology has been successhlly applied to paraffin-embedded tissue extracts [77], but there may be problems with restriction digestion and in amplifjling relatively long fragments caused by alterations to, or degradation of, DNA by fixation.When the practical dificulties have been overcome this technique promises to be of great benefit to diagnostic tumor pathology Detection of clonal aberrations in cancer

The cumulative effect of several permanent genetic alterations, or mutations, represents the central event in the pathogenesis of human cancer. Mutations relevant to carcinogenesis preferentially involve growth regulatory genes, protooncogenes, and tumor-suppressor genes. The precise definition of a mutation at the molecular level can be a very valuable adjunct to the diagnosis and classification of malignancies as well as to their prognostic assessment. Point mutations The study of point mutations becomes strikingly important for the analysis of tumor diseases [81-841. Point mutations of oncogenes like the ras gene family have already been described and the mechanism, by which ras point mutations contribute to malignant transformation, has partly been clarified [84,85]. Investigations on premalignant tumors, such as papillomas of the urinary bladder or adenomas of the colon for ras mutations could be of diagnostic and prognostic value. Ki-ras point mutations have been found frequently in pancreatic carcinomas and can be used to analyze cytological specimens for atypical cells [86]. The current methods of choice for the detection and characterization of point mutations are single-strand conformational polymorphism (SSCP, [34]) and direct sequencing [40,87,88]. However, other methods such as hybridization of dot blots with allele-specific oligonucleotides [89,90], mismatch cleavage [9 1,921, DGGE [37] and TGGE [93] are also used frequently Translocations In addition to activation by point mutation, oncogenes may be activated by chro-

181 mosomal rearrangement. Examples include: the t(8; 14) translocation in Burkitt’s lymphoma resulting in c-myc activation [94,95]; translocations with the 1lq23 locus that activate the Mll/ALL-1 oncogene in acute lymphoblastic and myeloid leukemias [96]; and overexpression of PRAD-1, a cyclin associated with the bcl-1 locus in mantle cell lymphomas [97]. Translocations can be detected by Southern blot analysis and restriction mapping, but PCR allows for a much greater sensitivity If primers of a PCR analysis are designed to amplifjr a sequence flanking the crossover site of a chromosomal translocation, an amplification product will be obtained only from tumor cells that carry such translocation. This principle has been applied to distinguish the different categories of hematopoietic malignancies characterized by specific translocations [98] as well as to the detection of minimal residual disease (see below, [99]) or in the marrow before autologous transplantation [loo]. The typical translocation of chronic myelogenous leukemia (CML), t(9;22), results in the formation of a chimeric oncoprotein termed bcr/abl. The breakpoint site, however, is variable, and may include large introns not accessible to PCR amplification. To circumvent this problem a cDNA is generated by reverse transcription with subsequent amplification of the region encompassing most of the predicted breakpoint sites [101,102]. Deletions of whole exons and those encompassing restriction sites may be detected by Southern blot most advantageously Intraexonic losses of only a few base pairs [lo31 and equally short insertions are directly detectable by gel electrophoresis of fragments amplified by PCR [104- 1061.

Loss of heterozygosity Loss of heterozygosity (LOH) is an important phenomenon in tumor development, with diagnostic and prognostic relevance. LOH of polymorphic DNA markers in tumors compared with normal tissue is a sign of somatic deletion. One major phenomenon underlying somatic deletion is the loss of tumor-suppressor genes; consequently, the recurrent observation of LOH in the same chromosomal region in a given tumor type may signal the presence, in the deleted segment, of a tumor-suppressor gene specific for the tumor in question. In this wax genome-wide searches for LOH have been performed successllly to localize tumor suppressor gene loci [107- 1111. The observation that LOH may have prognostic implications has created a situation in which the study of LOH contributes information significant enough to suggest that for clinical purposes, tumors of certain types should be typed routinely for LOH at specific loci. For instance, it has been shown that loss of the chromosomal region containing the gene locus DCC has potential prognostic value. In Dukes’ B colorectal tumors, LOH in this region signifies a prognosis not different from Dukes’ C tumors, whereas retention of heterozygosity carries a better prognosis [112]. Similarly, LOH of the gene locus TP53 has prognostic implications [ 1131. Moreover, recent studies show that detection of LOH is a simple, inexpensive,

182 and reliable tool for early diagnosis of tumors [ 1141. The recent developments have turned the determination of LOH into desirable screening tests on tumor material. Most procedures to detect LOH are based on comparing alleles in tumor and normal tissue after PCR amplification of microsatellite loci followed by gel electrophoresis and allele detection by radioactivity, silver staining, or similar methods. These procedures are more labor intensive and time consuming than would be desirable of a routine procedure. Moreover, in the absence of established criteria, the interpretations should be handled with care. Recent technological developments have raised hopes regarding automation. The use of flourescently labeled primers of four different colors to amplify polymorphic markers allows high resolution to be achieved in automatic gel electrophoresis apparatuses designed for DNA sequencing [1151. Computer programs have been written to resolve the alleles of multiple markers run in the same electrophoretic lane. Gene amplijkation Increase of the dosage of cellular oncogenes by DNA amplification is a frequent genetic alteration of cancer cells. The presence of amplified cellular oncogenes is usually signalled by striking chromosomal abnormalities, “double minutes” (DMs) or “homogeneously staining chromosomal regions” (HSRs). Some human cancers carry a specific amplified oncogene at a high copy number. In neuroblastomas the amplification of N-myc has been found associated with aggressively growing cancers and is an indicator for poor prognosis. N-myc amplification is of predictive value for identifying neuroblastoma patients who require specific therapeutic regimens and for identifying patients who do not benefit from chemotherapy [1161. Amplification was the first oncogene alteration that turned out to be of practical clinical use. In metaphase spreads, DMs appear as small, spherical, usually paired chromosome-like structures that lack a centromere and may contain circular DNA in chromatin form. HSRs stain with intermediate intensity throughout their length rather than with the normal pattern of alternating dark and light bands in trypsin-Giemsa-stained preparations. Both kinds of abnormalities contain amplified DNA and are found in metaphases of freshly isolated cancer cells, but not of normal cells. DMs and HSRs have been described in most types of in vitro cultured malignant cells. The first instance of oncogene amplification concerned the cellular oncogene myc [117,118]. Now the list of amplified oncogenes includes ABLY KRAS1, KRAS2, MYC, MYCN, MYCL, MDM2, NRAS, MYB, EGFR, GLI, and HST, with copy numbers ranging from 5 to 700 [1191. N-myc amplification was originally identified when human neuroblastoma cells showing DMs or HSRs were analyzed with various oncogene probes. Later it turned out that N-myc amplification can also be seen in small cell lung cancer, retinoblastoma, malignant gliomas, and peripheral neuroectodermal tumors (PNETs), although at a much lower incidence. As a common feature, all these

183 tumors have neural qualities [120,121]. N-myc amplification is often seen in an otherwise virtually diploid chromosomal environment [1221. Amplification is a frequent genetic alteration in solid tumors, while hemopoietic malignancies exhibit amplification at a much lower frequency Interphase cytogenetic The ability to correlate chromosomal aberrations with phenotypic features in tissue lesions may allow better understanding of early and late submicroscopic alterations in the pathogenesis of neoplasms. Furthermore, chromosomal aberrations can be used to identifl and classifl tumors, in particular of the hematopoietic system. Because of the requirement of living cells, classical chromosomal analysis has been limited to a few selected cases. This limitation can now be overcome by fluorescent in situ hybridization (FISH). In contrast to karyotyping, FISH renders information on selected defects that can be detected by the hybridization probe in use. FISH permits microscopic identification and localization of aberrations in interphase and metaphase preparations.This technique also allows the analysis of many cells, thus enabling detection of minor cell populations and estimation of intratumoral clonal heterogeneity of chromosome number [123-1261. On the other hand FISH is more sensitive than conventional cytogenetics and LOH analysis, permitting the detection of chromosomal changes even in a limited population of cancer cells. Using the method of fluorescence-immunophenotyping and interphase cytogenetics as a tool for investigation of neoplasms (FICTION) [127-1291 it is possible to combine immunophenotyping and interphase cytogenetics on cytospins, smears and cryostat sections. Cytogenetically defined tumor cells can be identified with regard to numerical chromosome aberrations and simultaneously characterized by immunophenotype and morphological features [ 130,1311. The technique of interphase cytogenetic analysis enables the detection of tumor cells with numerical chromosome aberrations in sections by in situ hybridization using centromere-specific probes. In this way, individual tumor cells can be identified in their tissue context. Immunophenotyping of these individual cells could be of great interest, but these techniques are restricted because extensive enzymatic digestion is required prior to ISH. With FICTION, sections are first fixed in acetone and immunostained with monoclonal antibodies. After immunophenotyping, the slides are fixed in paraformaldehyde, and subsequently, ISH is performed [128,129]. Comparativegenomic hybridization Comparative genomic hybridization is based on a combination of fluorescence microscopy and digital image analysis [132]. The molecular genetic basis is the simultaneous hybridization of a mixture of differentially labeled test-DNA and normal reference-DNA on normal metaphase chromosomes. The hybridization is detected with two different fluorochromes. CGH produces a map of DNA sequence copy number as a function of chromosomal location throughout the

184 entire genome. It allows the identification of all unbalanced chromosomal alterations of the test DNA in a single experimental step. Regions of gain or loss of DNA sequences, such as deletions, duplications, or amplifications are seen as changes in the ratio of the intensities of the two fluorochromes along the target chromosomes. As CGH can be performed with genomic DNA derived from formalin-fixed, parafin-embedded and fresh-frozen tissue or cells, this method is an effective tool in the extended genomic screening of tumors and genetically altered tissues. CGH is based on the principles of FISH. The genomic DNA which has to be analyzed (the test-DNA) is extracted and mixed with reference-DNA (extracted from normal tissue) in a ratio of 1:1 and hybridized to chromosomes of a normal metaphase. Both probes compete for their specific chromosomal locus. The relative amounts of tumor and reference DNA bound at a given chromosomal locus are dependent on the relative abundance of those sequences in the two DNA samples and can be quantitated by the ratio of the two fluorochromes. The reference DNA serves as a control for local variations in the ability to hybridize to target chromosomes. Thus, gene amplification or chromosomal duplication in the tumor DNA produces an elevated ratio of the fluorochromes, whereas deletions or chromosomal loss cause a reduced ratio. One potential use of CGH in human pathology lies in the analysis of miscarriages. In histologic examination of abortion there is often suspect of chromosomal aberration. Generally the material cannot be analyzed with conventional cytogenetic methods because of prior fixation or autolysis. For subsequent genetic consultation the diagnosis of chromosomal alterations is an important basis for estimating the risks of repetition [133]. In analogy, CGH is able to give hints for classification of the tumor, as was shown for bladder carcinoma [134]. Together with cytogenetic and other molecular biology results known and unknown chromosomal aberrations can be found. Another important employment of CGH is in the decision of therapy strategies for neuroblastoma, a malignant tumor of childhood. The postoperative therapy relies on risk factors such as N-myc amplification, DNA ploidy or l p deletion.With CGH all prognostically relevant chromosomal aberrations can be demonstrated [1351. Microsatellite instability The human genome contains an accumulation of distinct classes of repetitive DNA. These classes of DNA are dispersed throughout the genome, and are conserved in primates and other mammals. Except for the a satellite DNA that organizes the centromere, no repeat element possesses a clearly defined function. These elements have been implicated in the pathogenesis of human genetic disease. As passive participants in genetic damage, repeat sequences serve as sites of homologous recombination, resulting in the interstitial deletion and translocation of chromosomes. As active participants, certain repeat elements can transpose themselves to new sites in the genome. Such movement has caused new mutations leading to factor VIII deficiency [136,1371.The expansion of trinucleo-

185 tide repeats is the basis of Huntington’s disease [138] and myotonic dystrophy [1391, and variation of dinucleotide repeats is observed in hereditary nonpolyposh colon cancer [1401. One family of DNA repeat elements, the microsatellites (also called simple sequence length polymorphisms (SSLPs) and short tandem repeat polymorphisms (STRPs)) can be defined as tandem arrays of short stretches of nucleotide sequences, usually repeated between 15 and 30 times [141- 1451. They belong to the family of repetitive noncoding DNA sequences. They have a repeat size of 2-6 bp, highly variable in size but ranging around a mean of 100 bp. Microsatellites are found in the euchromatin and allele sizes in populations characteristically exhibit multiple size classes distributed about the population mean [1461. In myotonic dystrophy and the fragile X syndrome, expansion of repeats in carriers has been described [147,148]. This expansion is linked to parental copy number, which is at the high end of the normal range. It is now believed that the repeat itself predisposes to mutation - a cis process called “dynamic mutation” [149] - by virtue of a relationship between repeat copy number and instability In fact with parental copy numbers of more than 80, massive expansion of repeats is seen in affected children. Tkuns-acting factors (proteins) also affect microsatellite stability Unlike the cis effects, trans factors affect microsatellites across the genome and tandem repeat instability is not causal in disease. These factors were elucidated during the search for causal mutations in hereditary nonpolyposis colorectal cancer (HNPCC), an autosomal dominant syndrome with a predisposition to colorectal and endometrial cancers and other epithelial tumors [ 1501. In HNPCC relatives, linkage to the marker D2S123 on chromosome 2p was reported and it was simultaneously noted that instability of microsatellite repeat number was present in microsatellites scattered throughout the genome [105,1511. It is estimated that the total number of mutations at microsatellite loci in replication error positive (RER+) tumor cells could be up to 100-fold that in RER-cells, suggesting a mutation affecting DNA replication or repair predisposing to replication errors [1521. Studies in mutants of Succharomyces cerevisiae and Escherichia coli showed that mutations in the mismatch repair genes PMS1, MLH1, or MLH2 produced such a phenotype [153,1541. For HNPCC it was shown that the human forms of these genes were involved in its pathogenesis [155- 1591. The proposed mechanism involved slippage of DNA polymerases on the repeat motif during normal replication and subsequent correction of the frame shifts by the mismatch repair complex, dyshnction of this repair complex predisposing to the RER+ phenotype in a recessive manner [160]. Analysis of sporadic tumors belonging to the HNPCC spectrum (colorectal cancer, endometrial cancer, and gastric cancer) revealed a significant proportion of cases with multiple replication errors, as in the HNPCC cases 11611. In contrast, other sporadic tumors (lung, breast, testes, CNS tumors, and soft tissue sarcomas) showed MSI as a rare event, usually only affecting a single microsatellite locus among several loci under investigation [161,162]. Recent reports show that subsets of lung cancer (small cell cancer),

186 cases with multiple primary tumors, and late stages of CML may be significantly associated with RER+ [163- 1651. The microsatellite instability described in sporadic tumors is thought to differ in aetiology from that seen in the HNPCC spectrum [166]. What is still unclear is whether these mutations target sequence repeats specifically or whether the genomic instability has general effects, nonspecifically activating oncogenes and/or inactivating tumor-suppressor genes. Recent reports indicate a specific inactivation of the TGF-P receptor gene in RER+ colon cancer cell lines, favoring the former possibility [1671.The detection of microsatellite instability in colon cancer specimens could contribute to the identification of gene carriers and families bearing a risk for HNPCC. Tracing of minimal tumor cell infitrates Micrometastasis The extent of metastasis is important for the decision about the intensity of therapy of malignant tumors. However, by conventional histological examination only a relatively small amount of tissue can be investigated and minimal tumor spread may be missed. For that reason the dimensions of the malignant infiltration may be underestimated. This problem can be overcome if whole RNA of the lymph node is prepared and tested by PCR for the existence of nonlymphoid mRNA, e.g., cytokeratines or tumor-associated antigens. To achieve high security, it is necessary to use several primer pairs for nonlymphoid mRNAs. One example is the estrogen receptor-positive mammacarcinom, for which primer pairs for the amplification of the cDNA of cytokeratines and the estrogen receptor are used. With the prostate carcinoma, primers for cytokeratines and the prostate-specific antigen are used, respectively [168]. It remains to be shown whether the increased sensitivity of tumor cell detection has clinical implications. It is not clear that every single tumor cell found in a lymph node or distant organ is really capable of giving rise to metastasis. The same problems have to be considered when resection margins are studied by PCR for tumor cell infiltration. Minimal residual disease Methods of detecting minimal residual disease include chromosome analysis, Southern blotting, PCR and FISH techniques. Mononuclear cell from bone marrow and peripheral blood samples are tested for the specific markers or mutations of the initial neoplasm. In chronic myeloid leukemia (CML), for example, the reciprocal translocation between chromosomes 9 and 22, which leads to the formation of the Philadelphia chromosome, allows the proto-oncogene abl to move to the breakpoint cluster region (M-BCR) of chromosome 22. Consequently, a hybrid bcr/abl transcription unit is created. The resultant mRNA is translated into a hybrid protein. The presence of a cytogenetic and molecular marker in the leukemic clone allows a correct diagnosis of the disease and a follow-up of the residual leukemic clone after ablative treatment, such as bone

187 marrow transplantation or interferon-a treatment [1691. However, the biological and prognostic implications of positive PCR results when clinical and histomorphological remission have been achieved have to be found out in the different types of neoplastic disease. A few residual tumor cells detected by PCR do not necessarily require fbrther therapy when clinically there is no sign of relapse.

Resection margins Surgical resection is the principal treatment for the majority of advanced-stage carcinomas and is also a frequent choice in treating early lesions. The complete surgical removal of the neoplasm is of great importance, because it is generally believed that failure to eradicate the primary tumor leads to local recurrence and the survival rate decreases [170]. Surgical oncologists rely heavily on the histopathological assessment of these resection margins to ensure total excision of the tumor. However, current techniques may not detect small numbers of cancer cells at the margins of resection or in cervical lymph nodes. Using in situ hybridization or PCR-based assays that have the capacity to detect one mutant cancer cell among 10,000 normal cells it is possible to detect microscopically occult neoplastic cells. Among specimens initially believed to be negative, a substantial percentage of the surgical margins and lymph nodes contain mutations specific for the primary tumor. However, this mutation (if traceable at all) of the primary tumor has to be identified for constructing the appropriate assay. This renders these methods labor intensive. Nevertheless, molecular analysis of surgical margins and lymph nodes can augment standard histopathological assessment and may improve the prediction of local tumor recurrence [170].

References 1. Sambrook J, Fritsch EF, Maniatis T Molecular Cloning. A Laboratory Manual, 2nd edn, vol 1-3. NewYork: Cold Spring Harbor Laboratory Press, 1989. 2. Jackson DP, Lewis FA, Taylor GR, Boylston AW, Quirke F? Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction. J Clin Path01 1990,43:499-504. 3. Dieffenbach CW, Dveksler GS (eds) PCR-Primer: A Laboratory Manual. New York: Cold Spring Harbor Press, 1995. 4. Park JS, h a k e JF, Sharma BK, Toki T, Kessis TD, Ambros TD, Shah W.Variability in betaglobin and HPV DNA amplification by PCR from fixed tissues. Mod Pathol 1991;4667-670. 5. Honma M,OharaY; Murayama H. Effects of fixation and varying target length on the sensitivity of polymerase chain reaction for the detection of human T-cell leukemia virus type I proviral DNA in formalin-fixed tissue sections. J Clin Microbiol 1993;31:1799- 1803. 6. Bramwell NH, Burns BE The effects of fixative type and fixation time on the quantity and quality of extractable DNA for hybridization studies on lymphoid tissue. Exp Hematol 1988;16: 730-732. 7. Mies C. Molecular biological analysis of parafin embedded tissues. Hum Pathol 199+25:555560. 8. Goelz SE, Hamilton SR,Vogelstein B. Purification of DNA from formaldehyde futed and paraf-

fin embedded human tissue. Biochem Biophys Res Commun 1985;130:118-126. 9. Dubeau L, Chandler LA, Gralow JR, Nichols PW, Jones PA. Southern blot analysis of DNA extracted from formalin-fixed, paraffin-embedded pathology specimens. Cancer Res 198646:

2964-2969. 10. Mies C, Houldsworth J, Chaganti RSK. Extraction of DNA from parafin blocks for Southern blot analysis. Am J Surg Pathol 1991;15:169- 174. 11. Shibata D, Brynes RK, Nathwani B, Kwok S, Sninsky J, Arnheim N. Human immunodeficiency viral DNA is readily found in lymph node biopsies from seropositive individuals. Am J Pathol 1989;135:697-702. 12. Shibata D, Klatt ED. Analysis of human immunodeficiency virus and cytomegalovirus infection by polymerase chain reaction in the acquired immunodeficiency syndrome. Arch Path01 Lab Med 1989;113:1239-1244. 13. Chen ML, ShiehYSC, Shim KS, Gerber MA. Comparative studies on the detection of hepatitis B virus DNA in frozen and parafin sections by the polymerase chain reaction. Mod Pathol 1991;4:555-558. 14. Akyol G, Dash S, Shieh YS, Malter JS, Gerber MA. Detection of hepatitis C virus RNA sequences by polymerase chain reaction in fixed liver tissue. Mod Path01 1992;5:501-504. 15. Lampertico P, Malter JS, Colombo M, Gerber MA. Detection of hepatitis B virus DNA in formalin-fixed, parafin-embedded liver tissue by the polymerase chain reaction. Am J Path01 1990;137~253-258. 16. Shibata DK, Arnheim N, Martin WJ. Detection of human papilloma virus in parafiinembedded tissue using the polymerase chain reaction. J Exp Med 1988;167:225-230. 17. Frank TS, Cook SM, Del Buono EA. A simplified method for detecting cytomegalovirus by polymerase chain reaction from histologic sections of small biopsies. Mod Path01 1991;5:49454. 18. Chehab FF, Xiao X,YenTS. Detection of cytomegalovirus infection in parafin-embedded tissue specimens with the polymerase chain reaction. Mod Path01 1989;2:75-78. 19. Park JS, Leake JF, Sharma BK, Toki T, Kessis TD, Ambros RA, Shah KV. Variability in betaglobin and HPV DNA amplification by PCR from fixed tissues. Mod Pathol 1991;4:667-670. 20. Wu AM, Ben-Ezra J, Winberg C, Colombero AM, Rappaport H. Analysis of antigen receptor gene rearrangements in ethanol and formaldehyde-fixed, parafin-embedded specimens. Lab Invest 1990;63:107--1l'4. 21. Greer CE, Peterson SL, Kiviat NB, Manos MM. PCR amplification from parafin embedded tissues. Effects of fixative and fixation time. Am J Clin Pathol 1991;95:117- 124. 22. Rupp GM, Locker J. Purification and analysis of RNA from parafin embedded tissues. Biotechniques 1988;6:56-60. 23. Jackson DP, Quirke P, Lewis F, Boyston AW, Sloan JM, Robertson D, Taylor GR. Detection of measles virus RNA in paraffin-embedded tissue. Lancet 1989;l:1391. 24. Stanta G, Schneider C. RNA extracted from parafin-embedded human tissue is amenable to analysis by PCR amplification. Biotechniques 1991;11:304-308. 25. Redline RW, Genest D, Tycko B. Detection of enteroviral infection in paraffin-embeddedtissue by the RNA polymerase chain reaction technique. Am J Clin Pathol 1991;96:568-571. 26. Woodall CJ, Watt NJ, Clements GB. Simple technique for detecting RNA viruses by PCR in single sections of wax embedded tissue. J Clin Pathol 1993;46:276-277. 27. Hilton DA, Variend S, Pringle JH. Demonstration of coxsackie virus RNA in formalin-fixed tissue sections from childhood myocarditis cases by in situ hybridization and the polymerase chain reaction. J Pathol 1993;170:45-51. 28. Navas S, Castillo I, Carreno V. Detection of plus and minus HCV RNA in normal liver of antiHCV-positive patients. Lancet 1993;341:904-905. 29. Wong AJ, Ruppert JM, Eggleston J, Hamilton SR, Baylin SB,Vogelstein B. Gene amplification of c-myc and N-myc in small cell carcinoma of the lung. Science 1986;233:461-464. 30. Tsuda H, ShimosatoY,Upton MP,Yokota J,Terade M, Ohira M, SugimuraT, Hirohashi S. Retrospective study on amplification of N-myc and c-myc genes in pediatric solid tumors and its association with prognosis and tumor differentiation. Lab Invest 1988;59:321-327. 31. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N. Enzymatic ampli-

189 fication of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 1985;230:1350-1354. 32. Naber SI? Molecular pathology-diagnosisof infectious disease. N Engl J Med 1994;331:12121215. 33. Brocksmith D, Angle CA, Pringle JH, Lauder I. Epstein-Barr Viral DNA in Hodgkin's disease: amplification and detection using the polymerase chain reaction. J Pathol 1991;165:11- 15. 34. Orita M, Suzuki Y; SekiyaT, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-879. 35. Myers RM, Maniatis T, Lerman LS. Detection and localization of single base changes by denaturing gradient gel electrophoresis. Meth Enzymol 1987;155:501-527. 36. Myers RM, Lumelsky N, Lerman LS, Maniatis T Detection of single base substitutions in total genomic DNA. Nature 1985;313:495-498. 37. Wartell RM, Hosseini SH, Moran Cl? Detecting base pair substitutions in DNA fragments by temperature-gradientgel electrophoresis. Nucl Acid Res 1990;18:2699-2705. 38. Meyer CG,Tbnnich E, Harders J, Henco K, Horstmann RD. Direct sequencing ofvariable HLA gene segments after in vitro amplification and allele separation by temperature-gradient gel electrophoresis. J Immunol Meth 1991;142:251-256. 39. Loda M, Stork PJ, Capodieci l? Gsp mutation in medullary thyroid carcinoma by non-isotopic temperature-gradientgel shift analysis. Lab Invest 1993;68:39. 40. Rao VB. Direct sequencing of polymerase chain reaction-amplified DNA. Anal Biochem 1994; 216:l-14. 41. Brigati DJ, Myerson D, Leary JJ, Spalholz B, Travis SZ, Fong SZ, Hsiung GD,Ward DC. Detection of viral genomes in cultured cells and parafin-embedded tissue sections using biotinlabeled hybridization probes. Virology 1983;126:32-50. 42. Lawrence JB,Singer RH. Quantitative analysis of in situ hybridization methods for the detection of actin gene expression. Nucl Acid Res 1985;13: 1777- 1799. 43. Long AA, Miiller JD, Andre-Schwartz J, Barrett KJ, Schwartz R,Wolfe HJ. High specificity in situ hybridization. Diagn Molec Path01 1992;1:45-57. 44. Cox KH, DeLeon DY Angerer LM, Angerer RC. Detection of mRNA's in sea urchin embryos by in situ hybridization using asymmetric RNA probes. Cell Biol 1984;101:485-502. 45. Hiifler H, Childers H, Montminy MR, Lechan RM, Goodman RH,Wolfe HJ. In situ hybridization methods for the detection of somatostatin mRNA in tissue sections using antisense RNA probes. Histochem J 1986;18:597-604. 46. Tompkins LS. The use of molecular methods in infectious diseases. N Engl J Med 1992;327: 1290- 1297. 47. Ghossein RA, Ross DG, Salomon RN, Rabson AR. Rapid detection and species identification of mycobacteria in parafin-embedded tissues by polymerase chain reaction. Diagn Molec Pathol 1992;1:185- 191. 48. Richter E, Schliiter C, Duchrow M, Hahn M, Rusch-Gerdes S, Galle J, Flad H, Gerdes J. An improved method for the species-specific assessment of mycobacteria in routinely formalinfixed and parafin-embedded tissues. J Pathol 1995;175:85-92. 49. Persing DH, Smith TF, Tenover FC, White TJ (eds). Diagnostic Molecular Microbiology: Principles and Applications. Washington, DC:American Society for Microbiology, 1993. 50. Schiffman MH, Bauer HM, Hoover RN. Epidemiologic evidence showing that human papillomavirus infection causes most cervical intraepithelial neoplasia. J Natl Cancer Inst 1993;85: 958-964. 51. Lin JC, Lin SC, De BK, Chan WP, Evatt BL. Precision of genotyping of Epstein-Barr virus by polymerase chain reaction using three gene loci: predominance of type A virus associated with Hodgkin's disease. Blood 1993;81:3372-3381. 52. Aurelius E, Johansson B, Skoldenberg B, Staland A, Forsgren M. Rapid diagnosis of herpes simplex encephalitis by nested polymerase chain reaction assay of cerebrospinal fluid. Lancet 1991;337:189-192.

190 53. Cao M, Xiao X,Egbert B, DarraghTM,Yen TS. Rapid detection of cutaneous herpes simplex virus infection with the polymerase chain reaction J Invest Dermatol 1989;92:391-392. 54. Shieh YS,Shim KS, Lampertico F? Detection of hepatitis C virus sequences in liver tissue by the polymerase chain reaction. Lab Invest 1991;65:408-411. 55. Pan LX,Diss TC, Isaacson PG. The polymerase chain reaction in histopathologp HistopatholO ~ Y 1995;26:201-217. 56. Liebling MR, Nishio MJ, Rodriguez A, Sugal LH, Jin T, Louie JS. The polymerase chain reaction for the detection of Borrelia burgdorferi in human body fluids. Arthritis Rheum 1993;36: 665-675. 57. Noordhock GT, van Embden JDA, Kolk AHJ. Questionable reliability of the polymerase chain reaction in the detection of Mycobacterium tuberculosis. N Engl J Med 1993;329:2036. 58. Willem CL, Grifith BB,Whittaker M. Molecular genetic approaches for the diagnosis of clonality in lymphoid neoplasms. Clin Lab Med 1990;10:119-149. 59. Wan JH,Trainor KJ, Brisco MJ, Morley AA. Monoclonality in B cell lymphoma detected in paraffin wax embedded sections using the polymerase chain reaction. J Clin Pathol 1990;43:888890. 60. McCarthy KL, Sloane JP, Wiedemann LM. Rapid method for distinguishing clonal from polyclonal B cell populations in surgical biopsy specimens J Clin Pathol 1990;43:429-432. 61. Diss TC, Peng HZ, Wotherspoon AC, Isaacson PG, Pan L. Detection of monoclonality in lowgrade B-cell lymphomas using the polymerase chain reaction is dependant on primer selection and lymphoma type. J Path01 1993;169:291-295. 62. Diss TC, Pan LX, Peng HZ, Wotherspoon AC, Isaacson PG. PCR analysis of clonality in high grade B cell lymphomas. J Clin Path01 1994;47:493-496. 63. Ben Ezra J. Variable rate of detection of immunoglobulin heavy chain V-D-J rearrangement by PCR: a systematic study of 41 B-cell non-Hodgkin’s lymphomas and leukemias. Leuk. Lymphoma 1992;7:289-295. 64. Peng HZ, Isaacson PG, Diss TC, Pan LX. Multiple PCR analyses on trace amounts of DNA extracted from fresh and parafin wax embedded tissues after random hexamer primer PCR amplification. J Clin Path01 1994;47:605-608. 65. Cotter FE, Price C, Young BD, Lister TA. Minimal residual disease in leukaemia and lymphoma. Ann Oncol1990;1:167-170. 66. Billadeau D, Blackstadt M, Greipp P, Kyle RA, Oken MM, Kay N,Van Ness B. Analysis of Blymphoid malignancies using allele-specificpolymerase chain reaction: a technique for sequential quantitation of residual disease. Blood 1991;78:3021-3029. 67. Diss TC, Peng HZ, Wotherspoon AC, Pan L, Speight PM, Isaacson PG. Brief report: a single neoplastic clone in sequential biopsy specimens from a patient with primary gastric-mucosaassociated lymphoid-tissue lymphoma and Sjogren’s syndrome. N Engl J Med 1993;329:172175. 68. McCarthy KP, Sloane JP, Kabarowski JH, Matutes E, Wiedemann LM. The rapid detection of clonal T-cell proliferationsin patients with lymphoid disorders. Am J Pathol 1991;138:821-828. 69. McCarthy Kp, Sloane JP, Kabarowski JH, Matutes E, Wiedemann LM. A simplified method of detection of clonal rearrangements of the T-cell receptor-gamma chain gene. Diagn Molec Pathol 1992;1:173- 179. 70. Hansen Hagge TE,Yokota S, Bartram CR. Detection of minimal residual disease in acute lymphoblastic leukemia by in vitro amplification of rearranged T-cell receptor delta chain sequences. Blood 1989;74:1762-1767. 71. Vogelstein B, Fearon ER, Hamilton SR, Feinberg AP. Use of restriction fragment length polymorphisms to determine the clonal origin of human tumors. Science 1985;227:642-645. 72. Kreipe H, Jaquet K, Felgner J, Radzun H, Parwaresch MR. Clonal granulocytes and bone marrow cells in the cellular phase of agnogenic myeloid metaplasia. Blood 1991;78:1814-1817. 73. Kreipe H, Jaquet K, Felgner J, Parwaresch MR. Clonal analysis of agnogenic myeloid metaplasia. Leuk Lymphoma 1992;8:459-464.

191 74. Fraser NJ, Boyd Y, Craig I. Isolation and characterization of a human variable copy number tandem repeat at Xcen-pll.22. Genomics 1989;5:144. 75. Fey MF, Liechti-Gallati S, von Rohr A, Borisch B, Theilkas L, Schneider V, Oestreicher M, Nagel S, Ziemiecki A, Tobler A. Clonality and X-inactivation patterns in hematopoietic cell populations detected by the highly informative M27 beta DNA probe. Blood 1994;83:931-938. 76. Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation.Am J Hum Genet 1992;51:1229-1239. 77. Mashal RD, Lester SC, Sklar J. Clonal analysis by study of X chromosome inactivation in formalin-fixed parafin-embedded tissue. Cancer Res 1993;53:4676-4679. 78. Noguchi S, Motomura K, Inaji H, Imaoka S, Koyama H. Clonal analysis of human breast cancer by means of the polymerase chain reaction. Cancer Res 1992;52:6594-6597. 79. Gilliland DG, Blanchard KL, Levy J, Perrin S, Bunn HE Clonality in myeloproliferative disorders: analysis by means of the polymerase chain reaction. Proc Natl Acad Sci USA 1991;88: 6848-6852. 80. Gale RE,Wheadon H, Goldstone AH, Burnett AK, Linch DC Frequency of clonal remission in acute myeloid leukemia. Lancet 1993;341:138-142. 81. Weise B, Ghebremedhin E, Zschunke F, Radzun HJ. Optimization of restriction length polymorphism and single-strand conformation polymorphism analysis for the detection of point mutations of ras oncogenes in pdin-embedded tissues. Gen Diagn Pathol 1996142: 45-52. 82. Cotton RGH. Current methods of mutation detection. Mutat Res 1993;285:125-144. 83. Daus H, Triimper L, Burger B, Jacobs G, Kriener S, von Blohn G, Zeitz M, Pfreundschuh M. Ki-ras mutation as a molecular marker for carcinoma of the pancreas. Dtsch Med Wschr 1995;120:821-825. 84. Vogelstein B, Fearon ER, Stanley RH, Kern SE,Preisinger AC, Leppert M, NakamuraY, White R, Smits AMM, Bos JL. Genetic alterations during colorectal tumor development. N Engl J Med 1988;319:525-532. 85. Sidransky D, Frost PF, von Eschenbach A, Oyasu R, Preisinger AC, Vogelstein B. Identification of ras oncogene mutations in the stool of patients with curable colorectal tumors. Science 1992i256102- 105. 86. Ihalainen J, Taavitsainen M, SalmivaaraT, Palotie A. Diagnosis of pancreatic lesions using fine needle aspiration cytology Detection of K-ras point mutations using solid phase minisequencing. J Clin Pathol 1994;47:1082-1084. 87. Gyllenstein UB, Erlich HA. Generation of single-stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus. Proc Natl Acad Sci USA 1988;85:7652-7656. 88. HultmanT, Stahl S,Hornes E, Uhlen M.Direct solid phase sequencing ofgenomic and plasmid DNA using magnetic beads as solid support. Nucl Acid Res 1989;17:4937-4946. 89. DiLella AG, Huang WM,Woo SL. Screening for phenylketonuria mutations by DNA amplification with the polymerase chain reaction. Lancet 1988;1:497-499. 90. Saiki RK, Walsh PS, Levenson CH, Erlich HA. Genetic analysis of amplified DNA with immobilized sequence-specific oligonucleotide probes. Proc Natl Acad Sci USA 1989;8662306234. 91. Myers RM, Larin Z, ManiatisT Detection of single base substitutions by ribonuclease cleavage at mismatches in RNADNA duplexes. Science 1989;230:1242- 1246. 92. Grompe M, Muzny DM, Caskey CT Scanning detection of mutations in human ornithine trumcarbamoylase by chemical mismatch cleavage. Proc Natl Acad Sci USA 1989;86:58885892. 93. Riesner D, Steger G, Zimmat R, Owens RA, Wagenhofer M, Hillen W, Vollbach S, Henco K. Temperature-gradient gel electrophoresisof nucleic acids: analysis of conformational transitions, sequence variations, and protein-nucleic acid interactions. Electrophoresis 1989;10377-389.

192 94. Dalla-Favera R, Martinotti S, Gallo RG. Human c-myc oncogene is located on the region of chromosome 8 that is translocated in Burkitt lymphoma cells. Proc Natl Acad Sci USA 1982; 79~7824-7827. 95. Lombardi L, Newcomb EW, Dalla-Favera R. Pathogenesis of Burkitt lymphoma: Expression of an activated c-myc oncogene causes the tumorigenic conversion of EBV-infected human B lymphoblasts. Cell 1987;49:161-170. 96. Thirman MJ, Gill HJ, Burnett RC. Rearrangement of the MLL gene in acute lymphoblastic and acute myeloid leukemias with llq23 chromosomal translocations. N Engl J Med 1993;329: 909-914. 97. Williams ME, Meeker TC, Swerdlow SH. Rearrangement of the chromosome 11 bcll locus in centrocytic lymphoma: Analysis with multiple breakpoint probes. Blood 1991;78:493-498. 98. Gaidano G, Dalla-Favera R. Proto-oncogenes and tumor suppressor genes. In: Knowles DM (ed) Neoplastic Hematopathology. Baltimore, MD: Williams and Wilkins, 1992245-261. 99. Yamada M, Wasserman R, Lange B. Minimal residual disease in childhood B-lineage lymphoblastic leukemia. Persistance of leukemic cells during the first months of treatment. N Engl J Med 1990;323:448-455. 100. Gribben J, Friedman A, Neuberg D. Immunologic purging of marrow assessed by PCR before autologous bone marrow transplantation for B-cell lymphoma. N Engl J Med 1991;325:15251533. 101. Kawasaki ES, Clark SS, Coyne MY Diagnosis of chronic myelogenous leukemia and acute lymphocytic leukemia by detection of leukemia-specific mRNA sequences amplified in vitro. Proc Natl Acad Sci USA 1988;85:5698-5702. 102. Kreipe H, Felgner J, Jaquet K, Heidorn K, Radzun HJ, Parwaresch MR. DNA analysis to aid in the diagnosis of chronic myeloproliferative disorders. Am J Clin Pathol 1992;98:46-54. 103. Sidransky D, von Eschenbach A, Tsai YC. Identification of p53 gene mutations in bladder cancers and urine samples. Science 1991;252:706-709. 104. Huntington’s Disease Collaborative Research Group. Cell 1993;72:971-983. 105. Aaltonen LA, Peltomaki P, Leach FS. Clues to the pathogenesis of familial colorectal cancer. Science 1993;260:812-816. 106. Saad FA,Vitiello L, Oliviero S. Detection ofunknown gene mutations by multiplex single-strand conformation polymorphism (MSSCP). PCR Meth Appl 1993;3:60-62. 107. Canzian F, Salovaara R, Hemminki A, Kristo P, Chadwick RB, Aaltonen LA, de la Chapelle A. Semiautomated assessment of loss of heterozygosity and replication error in tumors. Cancer Res 1996;56:3331-3337. 108. Winqvist R, Hampton GM, Mannermaa A, Blanco G, Alavaikko M, Kiviniemi H,Taskinen PJ, Evans GA, Wright FA, Newsham I, Cavenee WK. Loss of heterozygosity for chromosome 11 in primary human breast tumors is associated with poor survival after metastasis. Cancer Res 1995;55:2660-2664. 109. Carter SL, Negrini M, Baffa R, Gillum DR, Rosenberg AL, Schwartz GF, Croce CM. Loss of heterozygosity at 11q22-23 in breast cancer. Cancer Res 1994;54:6270-6274. 110. Rasio D, Negrini M, Manenti G, Dragani TA, Croce CM. Loss of heterozygosity at chromosome 1l q in lung adenocarcinoma: identification of three independent regions. Cancer Res 1995;55:3988-3991. 111. Gabra H, Warson JEV, Taylor KJ, Mackay J, Leonard RCF, Steel M, Porteuos DJ, Smyth JE Definition and refinement of a region of loss of heterozygosity at 1lq23,3-24,3 in epithelial ovarian cancer associated with poor prognosis. Cancer Res 1996;56:950-954. 112. Foulkes WD, Campbell IG, Stamp GWH,Trowsdale J. Loss of heterozygosity and amplification on chromosome 1l q human ovarian cancer. Br J Cancer 1993;67:268-273. 113. Champeme MR, Bieche I, Lizard S, Lidereau R. 1lq13 amplification in local recurrence of human primary breast cancer. Genes Chromosomes Cancer 1995;12:128-133. 114. Hampton GM, Penny LA, Baergen RN, Larson A, Brewer C, Liao S, Busby-Earle RMC, Williams AWR, Steel CM, Bird CC, Stanbridge EJ, Evans GA. Loss of heterozygosity in

193 cervical carcinoma: subchromosomal localization of a putative tumor-suppressor gene to chromosome 11q22-24. Proc Natl Acad Sci USA 1994;91:6953-6957. 115. Shaw ME, Knowles MA. Deletion mapping of chromosome 11 in carcinoma of the bladder. Genes Chromosomes Cancer 1995;13:1-8. 116. Schwab M. In: Bartram CR, Munk K, Schwab M (eds) Oncogenes in Cancer Diagnosis, vol39. Contrib Oncol, 1990;180-192. 117. Collins S, Groudine M. Amplification of endogenous myc related DNA sequences in a human myeloid leukemia cell line. Nature 1982;298:670. 118. Dalla-Favera R, Wong-Staal F, Gallo R C Onc gene amplification in promyelotic leukaemia cell line HL-60 and primary cells of the same patient. Nature 1982;299:63. 119. Schwab M, Amler L. Amplification of cellular oncogenes: a predictor of clinical outcome in human cancer. Genes Chromosomes Cancer 1990;1:180-193. 120. Schwab M. Amplification of N-myc in human neuroblastomas. TIG 1985;1:271-275. 121. Schwab M. Oncogene amplification in neoplastic development and progression of human cancers. Crit Rev Oncogen 1990;2:35-51. 122. Schwab M. Where pathology meets molecular pathology: N-myc amplification in human neuroblastoma as a paradigm for the clinical use of an oncogene alteration. Verh Dtsch Ges Path 1994;78:26-33. 123. Sneige N, Sahin A, Dinh M, El-Naggar A. Interphase cytogenetics in mammographically detected breast lesions. Hum Path01 1996;27:330-335. 124. Wolman SR. Fluorescence in situ hybridization: a new tool for the pathologist. Hum Pathol 1994;25:586-590. 125. Poddighe PJ, Ramaekers FC, Hopman AH. Interphase cytogenetics of tumors. J Path01 1992; 166:215-224. 126. Ramaekers FC, Hopman A,Vooijs P.Advances in the detection of ploidy differences in cancer by in situ hybridization. Anal Cell Path01 1992;4:337-344. 127. Weber-Matthiesen K, Winkemann M, Miiller-Hermelink A, Schlegelberger B, Grote W Simultaneous fluorescence immunophenotyping and interphase cytogenetics: contribution to the characterization of tumor cells. J Histochem Cytochem 1992;40:171-1 75. 128. Weber-Matthiesen K, Press1 S, Schlegelberger B, Grote W Combined immunophenotyping and interphase cytogenetics on the cryostat sections by the new FICTION method. Leukemia 1993;7:646-649. 129.Weber-Matthiesen K, Deerberg J, Miiller-Hermelink A, Schlegelberger B, Grote W. Rapid immunophenotypic characterization of chromosomally aberrant cells by the new FICTION method. Cytogenet Cell Genet 1993;63:123-125. 130. Zhang Y, Poetsch M, Weber-Matthiesen K, Rohde K,Winkemann M, HaferlachT, Gassmann W, Ludwig WD, Grote W, Loffler H, Schlegelberger B. Secondary acute leukaemias with 1lq23 rearrangement: clinical, cytogenetic FISH and FICTION studies. Br J Haematol 1996;92: 673-680. 131. Weber-Matthiesen K, Winkemann M, Grote W, Schlegelberger B. Kappa- and lambda-positive cells in centroblastic-centrocytic lymphoma may share a secondary chromosome aberration: reflections on early lymphoma development. Genes Chromosomes Cancer 1995;14:22-27. 132. Kallioniemi A, Kallioniemi OP, Sudar D, Rutovitz D, Gray JW, Waldman F, Pinkel D. Comparative genomic hybridization for molecular cytogenetic analysis of solid tumors. Science 1992;258:818-821. 133. Bryndorf T, Kirchhoff M, Rose H, Maahr J, GerdesT, Karhu R, Kallioniemi A, Christensen B, Lungsteen C, Philip J. Comparative genomic hybridization in clinical cytogenetics. Am J Hum Genet 1995;57:1211-1220. 134. SandbergAA, Berger CS. Review of chromosome studies in urological tumors. J Urol1994;151: 545-560. 135. Storkel S, Simon R, Brinkschmidt C, Gronwald J, Bocker W. Comparative genomic hybridization in pathology Pathologe 1996;17:189-194.

194 136. Krontiris TG, Devlin B, Karp DD, Robert NJ, Risch N. An association between the risk of cancer and mutations in the HRASl minisatellite locus. N Engl J Med 1993;329:517-523. 137. Dombroski BA, Mathias SL, Nanthakumar E, Scott AF, Kazazian HH. Isolation of an active human transposable element. Science 1991;254:1805- 1808. 138. Macdonald ME, Ambrose CM, Duyao MP. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell 1993;72:971-983. 139. Buxton J, Shelbourne P, Davies J, Jones C, Van Tongeren T, Aslanidis C, deJong P, Jansen G, Anvret M, Rilley B. Detection of an unstable fragment of DNA specific to individuals with myotonic dystrophy Nature 1992;355:547-548. 140. Aaltonen LA, Peltomaki P, Leach FS, Sistonen P, Pylkkanen L, Mecklin JP, Jarvinen H, Powell SM, Jen J, Hamilton SR. Clues to the pathogenesis of familial colorectal cancer. Science 1993; 260:8 12-8 16. 141. Koreth J, O'Leary J, McGee JO. Microsatellites and PCR genomic analysis. J Pathol 1996;178: 239-248. 142. Litt M, Luty JA. A hypervariable microsatelliterevealed by in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene. Am J Hum Genet 1989;44:397-401. 143.Biutz D. Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucl Acid Res 1989;17:6436-6471. 144. Edwards A, Civitello A, Hammond HA, Caskey CT. DNA typing and genetic mapping with trimeric and tetrameric tandem repeats. Am J Hum Genet 1991;49746-756. 145. Braaten DC, Thomas JR, Little RD. Locations and contexts of sequences that hybridize to poly(dG-dT).(dC-dA) in mammalian ribosomal DNAs and two X linked genes. Nucl Acid Res 1988i16865-881. 146. Biutz D, Renz M. Simple sequences are ubiquitous repetitive components of eukaryotic genome. Nucl Acid Res 1984;12:4127-4138. 147. Brook JD, McCurrach ME, Harley HG. Molecular basis of myotonic dystrophy: expansion of a trinucleotide (CTG) repeat at the 3' end of a transcript encoding a protein kinase family member. Cell 1992;68:799-808. 148. Yu S,Pritchard M, Kremer E.Fragile X genotype characterized by an unstable region of DNA. Science 1991;2521179- 1181. 149. Richards RI, Sutherland GR. Dynamic mutations: a new class of mutations causing human disease. Cell 1992;70709-712. 150. Lynch HT, Lanspa S, Smyrk T, Boman B, Warson P, Lynch P. Hereditary non-polyposis colorectal cancer. Genetics, pathology, natural history, and cancer control. Cancer Genet Cytogenet 1991;53:143-160. 151. Peltomaki P, Aaltonen LA, Sistonen P. Genetic mapping of a locus predisposing to human colorectal cancer. Science 1993;260810-812. 152. Parsons R, Li GM, Longley MJ. Hypermutability and mismatch repair deficiency in RER+ tumor cells. Cell 1993;75:1227- 1236. 153. Strand M, ProllaTA, Liskay RM, PetesTD. Destabilisation of tracts of simple repetitive DNA in yeast by mutations affecting mismatch repair. Nature 1993;365:274-276. 154. Levinson G, Gutman GA. High frequencies of short frameshiftsin poly CA/TG tandem repeats borne by bacteriophage M13 in E.coli K-12. Nucl Acid Res 1987;15:5323-5338. 155. Bronner CE, Baker SM, Morrison PT.Mutation in the DNA mismatch repair gene homologue hMLHl is associated with hereditary non-polyposis colon cancer. Nature 1994;368:258-261. 156. Nicolaides NC, Papadopoulos N, Liu B. Mutations at two PMS homologues in hereditary nonpolyposis colon cancer. Nature 1994;371:75-80. 157. Leach FS, Nicolaides NC, Papadopoulos N. Mutations of a mutS homolog in hereditary nonpolyposis colorectal cancer. Cell 1993;75:1215-1225. 158. Fishel R, Lescoe MK, Rao MR. The human mutator gene homolog MSH2 and its association with hereditary nonpolyposis colon cancer. Cell 1993;75:1027- 1038. 159. Jiricny J. Colon cancer and DNA repair: have mismatches met their match? TIG 1994;lO:

195 164-168. 160. Kunkel TA. Nucleotide repeats. Slippery DNA and diseases. Nature 1993;365:207-208. 161. F’eltomaki P, Lothe R, Aaltonen LA. Microsatellite instability is associated with tumors that characterize the hereditary non-polyposis carcinoma syndrome. Cancer Res 1993;53:58535855. 162. Wooster R, Cleton-JansenAM, Collins N. Instabilityof short tandem repeats (microsatellites) in human cancer. Nature Genet 1993;6:152-156. 163. Merlo A, Mabry M, Gabrielson E,Vollmer R, Baylin SB, Sidransky D. Frequent microsatellite instability in primary small cell lung cancer. Cancer Res 1994;54:2098-2101. 164. Horii A, Han HJ, Shimada M. Frequent replication errors at microsatellite loci in tumors of patients with multiple primary cancers. Cancer Res 1994;54:3373-3375. 165. Wada C, Shionoya S, FujinoY. Genomic instability of microsatellite repeats and its association with the evolution of chronic myelogenous leukemia. Blood 1994;83:3449-3456. 166. Liu B, Nicolaides NC, Markowitz S. Mismatch repair gene defects in sporadic colorectal cancers with microsatelliteinstability. Nature Genet 1994;9:48-55. 167. Markowitz S,Wang J, Myeroff L. Inactivation of the type I1 TGF-beta receptor in colon cancer cells with microsatellite instability. Science 1995;268: 1336- 1338. 168. Deguchi T, Doi T, Ehara H, It0 S,Takahashi Y; NishinoY; Fujihiro S,KawamuraT, Komeda H, Horie M, Kaji H, Shimokawa K, Tanaka T, Kawada Y. Detection of micrometastatic prostate

cancer cells in lymph nodes by reverse transcriptase-polymerase chain reaction. Cancer Res 1993;53:5350-5354. 169. Testoni N, Martinelli G, Farabegoli P, Zaccaria A, Amabile M, Raspadori D, F‘elliconi S, ZuRa

E, Carboni C, Tura S. A new method of “in cell reverse transcriptase-polymerase chain reaction” for the detection of bcr/abl transcript in chronic myeloid leukemia patients. Blood 1996; 87~3822-3827. 170. Brennan JA, Mao L, Hruban RH, Boyle 50, Eby YJ, Koch WM, Goodman SN, Sidransky D.

Molecular assessment of histopathological staging in squamous-cell carcinoma of the head and neck. N Engl J Med 1995;332429-435.

This Page Intentionally Left Blank

0 1 9 9 7 Elsevier Science B.V. All rights reserved. Biotechnology Annual Review Volume 3 M.R.El-Gewely, editor.

197

Transgenic manipulation of signaling pathways of plant resistance to pathogen attack Shigemi Seo', Hiroshi Sano2 and Yuko Ohashi' 'National Institute of Agrobiological Resources, Bukuba. Ibaraki; and 'Nara Institute of Science and Technology, Ikoma. Nara, Japan

Abstract. A powerful technique of transgenic manipulation has provided details of how external signals transduce the pathways leading to a broad spectrum of physiological responses in plants. This will allow us to help in elucidating complicated mechanisms of plant defense responses. Recently, progress has been made in the understanding of the regulation of pathogen- and woundinduced signal transduction pathways through cross-talk among several regulatory factors such as small GTP-binding proteins, mitogen-activated protein kinases, cytokinin, salicylic acid, and jasmonic acid. These evidences are summarized in this chapter.

Keywords: cytokinin, hypertensive response (HR), jasmonic acid (JA), u linolenic acid (LA), MAP kinases, oligouronides, pathogenesis-related (PR) proteindgenes, plant disease resistance, salicylic acid (SA), signal transduction, small GTP-bindingproteins, systemic acquired resistance (SAR), systemin, transgenic plants.

Introduction

In contrast to animals, plants are unable to move their location, and they have evolved various mechanisms which allow them to quickly respond to pathogen attack and wound stress to cure damaged parts. For defense responses, the external stimuli need to be quickly and precisely transmitted into cells or from cells to cells. In general, the response consists of signal transduction pathways in which the external signals that are converted to chemical signals in cells are transmitted through a cascade of activation of various proteins, and finally induce the defense-related gene expression in plant cells. Despite the accumulation of biological and biochemical data concerning defense responses to pathogen attack and wound stress [l-91, information on the specific molecules that function in signal transduction pathways in these responses is less. Yet, the recent development of molecular biology provides us with new knowledge on signal molecules of plant defense responses. In particular, the gene manipulation technique has been adapted to plant science, and transgenic plants have become essential tools in elucidating the function of signal molecules. An experimental approach of transgenic manipulation of signaling pathways by pathogen attack and wound stress provides several advantages over the classical Address for correspondence: Yuko Ohashi, National Institute of Agrobiological Resources, 'Ibukuba, Ibaraki 305, Japan.

198 biochemical techniques. Firstly, it is possible to examine the function of the introduced gene for a signal molecule that may play a role in signaling pathways of plant defense responses. The role of the gene can be determined from the altered pathways. Secondly, the action of such signal molecules can be controlled by the use of the appropriate transcriptional promoters. For example, the use of cauliflower mosaic virus (CaMV) 35s promoter with a gene which is a member of the signaling pathway may allow the constitutive expression of activated signaling pathways [lo]. Finally, studying the response of transgenic plants to some environmental stresses to give us new ideas on the signalling the understanding of the role of the signal molecules in a whole defense response. In this chapter, recent studies of transgenic manipulation of signal transduction pathways in self-defense responses of plants are described. Background A defense response to pathogen attack

Hypersensitive response and systemic acquired resistance As a typical resistance system against infection of pathogens, hypersensitive response (HR) has been well studied in incompatible interactions between specific plant cultivars and defined physiological races of potential pathogens. HR involves localized tissue necrosis, containing a rapid death of infected cells for restriction of the systemic spread of pathogens, cross-linking of cell wall proteins, lignification [3], and the production of antimicrobial compounds [1 11. In addition to local defense responses, uninfected parts of the same plant acquire resistance to further infections by bacterial, fungal, or viral pathogens. This resistance has been termed systemic acquired resistance (SAR) [12]. Although SAR is an important response for plant defense against pathogen attack, little is known about the mechanism of signal transduction that leads to the induction of SAR at the molecular level. Recently, plant disease resistance genes have been isolated in several plant species. Predicted structures of these genes gave us an indication of the functions required in signal transduction pathway products for the establishment of resistance reaction [13]. Products of plant disease-resistant genes may be the key molecular compounds in HR. However, these defense responses against pathogen attack consist of many biochemical processes, which contain general concepts such as: recognition of pathogen infection; production of second messengers; sequential reactions in the signal transduction, including protein phosphorylation triggered by the second messengers; production of signal compounds that activate defense-related genes such as pathogenesis-related (PR) protein genes; and a broad range of physiological responses caused by expression of these genes. Thus, it is obvious that approaches using various experimental methods at individual steps are necessary for understanding the self-defense response mechanisms of plants to pathogen attack.

199 Pathogenesis-relatedproteins SAR is correlated with the systemic and new synthesis of so-called PR proteins after HR [14,15]. In tobacco, they have been grouped into 11 families (PR-1 to PR-11) on the basis of amino acid and nucleotide sequences, serological relationship, and/or enzymatic or biological activity [16]. At least five families of tobacco PR proteins have been grouped into both acidic and basic isoforms that have similar amino acid sequences but quite different localization. Acidic PR proteins are secreted extracellularly, whereas basic PR proteins accumulate in the vacuole and are constitutively present in roots [16-201. Acidic PR proteins are induced by salicylic acid (SA) [15], which are synthesized in the tissue around local lesions [21-241. Basic types of PR proteins are induced by treatment with ethephon [25,26], a chemical that releases ethylene from plant cells in vivo, jasmonic acid (JA) and wounding [25-271. Two types, acidic and basic, of PR proteins are differentially induced during SAR [15,22,26,28]. Salicylic acid as an inducer of PR proteins SA has been proposed to play an important signal molecule in signal transduction that leads to the expression of acidic PR protein genes [29,30]. SA accumulates to high levels following infection of tobacco plants with tobacco mosaic virus (TMV) [21] and cucumber with either tobacco necrosis virus or Phytophthra parasitica [22]. In addition, enhanced levels of endogenous SA could be detected in both inoculated and uninoculated leaves of TMV-infected tobacco [23], and treatment of tobacco [15,311 and Arabidopsis [32] with SA could induce both PR gene expression and resistance to pathogens. These results indicate that SA is a powerful inducer of the expression of acidic PR protein genes. A correlation between the production of SA in TMV-infected tobacco plants and the induction of HR has been shown. In tobacco carrying the N gene, a resistance gene to TMV, local lesions form after infection at the site of TMV replication. The HR phenotype is temperature-sensitive; at a permissive temperature (> 28°C) the virus replicates and spreads systemically, but at a nonpermissive temperature (85% of mice were colonised. The concentration of S. gordonii in positive samples was always high (lo3- lo6 CFU/ml), suggesting that colonisation was very efficient. Colonising bacteria turned out to adhere to the superficial epithelial cells of the vagina, and to be trapped in mucous strands (Fig. 1). E7-specific antibodies were detected in serum and vaginal fluids of colonised animals (Figs. 2 and 3) [45]. This immune response was independent from the inoculum dose, but dependent upon effective colonisation [45]. Vaginal delivery of recombinant S. gordonii in Cynomologous monkeys (Macaca fascicularis) did not result in colonisation of the animals, however, bacteria persisted for 3 days in the monkey vagina and after three repeated inocula an antigen-specific immune response was obtained. Using strains expressing the E7 protein of HPV-16 and theV3 domain of HIV gp120, serum IgG, vaginal IgA, and T cells specific for E7 and V3 were detected in the immunised animals (Table 3) [57]. In collaboration with Dr Ricciardi-Castagnoli's group (CNR, Milano, Italy), we have recently evaluated the ability of S. gordonii to activate the dendritic cells (DC) which represent the most efficient antigen-presenting cells responsible for generating primaryT cell responses [60]. DC have a privileged distribution in tissues interfacing the external environment, thus acting as efficient sentinels for recognition of invading microorganisms. Preliminary results suggest that S. gordonii is phagocytated and induces the maturation of DC [61]. Staphylococci Staph. xylosus and Staph. carnosus were shown to be nonpathogenic both in immunocompetent and in immunocompromised mice when administered by the oral or by the subcutaneous route. They do not colonise the host, but can persist for up to 3 days in the gastrointestinal tract [56]. Their efficacy as vaccine delivery vehicles depends on the amount of recombinant antigen expressed and

307 on repeated inocula. Oral immunisation of mice with recombinant Staph. xylosus expressing the G3 epitope from the attachment glycoprotein (G protein) of human respiratory syncytial virus (RSV)induced antigen-specific serum IgG [29]. Surface expression of the recombinant vaccine antigen turned out to be essential for induction of the immune response [55]. Antigen-specific IgG were also obtained by subcutaneous and oral inocula of mice with recombinant staphylococci expressing a model antigen (the albumin binding domain of streptococcal protein G) on their surface [30,56]; higher antibody levels were obtained using Steph. camosus as a vector compared to the Steph. xylosus one [56]. Lactococcus lactis Lc. lactis is a nonpathogenic Gram-positive bacterium widely used in the food industry. Lc. lactis does not colonise the digestive tract but in humans it survives the passage through the gut and can be isolated from faeces up to 4 days [62]. As for the staphylococcal vaccine vehicles (see above) also in this system, highlevel expression of the recombinant vaccine antigen is required for effective induction of an immune response. In immunisation studies performed using the tetanus toxin fragment C (TTFC) as a model antigen expressed by Lc. lactis, mucosal (nasal and oral) delivery of recombinant bacteria was shown to induce local and systemic antibodies (Table 3), as well as the protection of animals from a lethal challenge with the tetanus toxin [32,58]. The effect of the bacterial doses and of the cellular location of the recombinant antigen was also investigated in some detail [lo]. TTFC expressed on the surface was more immunogenic than the intracellular form of the protein, however, higher doses of inoculum were needed because of the lower level of the surface expression [101. By determining the subclasses of the TTFC-specific serum IgG, evidence of both Thl and Th2 types of immune responses was found [321. Recent studies were performed using a recombinant strain of Lc. lactis expressing P28, the 28 kDa glutathione S-transferase from Schistosoma mansonii. Subcutaneous, nasal, and oral immunisation induced significant levels of antigen-specific serum antibodies and IgA in the faeces. Higher P28-specific serum antibody levels were obtained using bacteria expressing a P28-TTFC h i o n protein [10,32]. Lactobacilli

Lactobacilli are part of the normal microflora of humans and animals. They have been isolated from the oral cavity, oesophagus, intestine, vagina and urethra of humans. Their presence is considered essential for the maintenance of a balance between the normal flora and the invading pathogen, and play an important role as the first line of defence for body protection from invading microorgan-

308

isms. For this reason, live lactobacilli are often administered for intestinal disorders, vaginitis and urinary tract infections. Furthermore, strains of lactobacilli are commonly used for production of cheese, fermented milk, yoghurt and probiotic preparations. Their harmlessness and the potential benefits make these strains an ideal choice as live vaccine vectors [34]. There are two main approaches: 1) the use of strains of lactobacilli capable of colonising mucosal surfaces such as the intestinal or vaginal mucosa; or 2) the use of noncolonising strains, which are employed for food fermentation processes. The first approach aims at implanting a colonising recombinant bacterium in the normal microflora and expose the host to a long-lasting antigen delivery, as proposed for S.gordonii. In the second, lactobacilli act as microparticles that deliver large amounts of antigen, as for Lc. lactis or staphylococci. Only a limited number of studies have been performed to evaluate the immunogenicty of recombinant strains of lactobacilli (Table 3), however, their safety and their capacity to colonise very different habitats make them very attractive candidate vaccine vehicles. Listeria monocytogenes

L. monocytogenes is an intracellular facultative Gram-positive pathogen that enters the host cells, multiplies in the cytoplasm and spreads from cell to cell escaping from the extracellular environment. This ability of entering into the cytoplasm of the host cell allows the proteins released from the bacterium to be efficiently processed and presented by the class I-restricted pathway. Recent studies propose the use of L. monocytogenes as a live vaccine vehicle to induce an MHC class I restricted cytotoxic immune response. The knowledge about listerial pathogenesis and the availability of genetic tools allow the generation of genetically defined attenuated mutants [63,64]. Isogenic mutants with inframe deletions that reduce (eliminate) the ability to move intracellularly or spread from cell to cell have been recently developed. These mutants turned out to be attenuated in the mouse infection model and can be considered as candidates for vaccine vehicles to deliver heterologous antigens to the immune system. Oral and intraperitoneal immunisation with a variety of recombinant strains of L. monocytogenes induced an antigen-specific CTL response (Table 3), protection against viral challenge in a mouse model [41,42], and regression of established mouse tumours 151,521.

Concluding remarks The work reviewed here on the development of Gram-positive bacteria as vehicles of recombinant vaccine antigens clearly indicates that this approach is feasible and valuable. The expression systems for streptococci, staphylococci and lactococci are very well-developed, but there is still room for optimisation of the Lactobacillus systems. The immunogenicty of the recombinant antigens by

309 mucosal delivery has been shown using colonising 6. gordonii) and noncolonising (Lc. luctis) bacterial vehicles, whereas protection from challenge was shown with Lc. luctis. There is also great potential in the cellular responses induced by recombinant Listeriu. Targeting the bacterial vehicle to the DC of the mucosae, coexpression of vaccine antigens and cytokines, and starting human trials represent some of the main areas of hture research in this field. Acknowledgements The work described in this chapter was possible thanks to the help and advice of Prof A.M. Molina and Prof RE. Valensin, who encouraged the establishment of our research group at the Department of Molecular Biology of the University of Siena. The generous support of Istituto Superiore di Saniti (Progetto AIDS) and the Commission of the European Union (BIOTECH) is gratefully acknowledged. References 1. McGhee JR, Mesteclq J. In defence of mucosal surfaces: development of novel vaccines for IgA responses protective at the portals of entry of microbial pathogens. Infect Dis Clinics North Am 1990;4:315-341. 2. Gregoriadis G. Engineering liposomes for drug delivery: progress and problems. Trends Biotechno1 1995;13:527-537. 3. Alving CR,Koulchin V, Glenn GM, Rao M. Liposomes as carriers of peptide antigens: induction of antibodies and cytotoxic T lymphocytes to conjugated and unconjugated peptides. Immunol Rev 1995;145:5-31. 4. Sjolander A, Lovgren-Bengtsson K, Johansson M, Morein B. Kinetics, localisation and isotype profile of antibody responses to immune stimulating complexes (ISCOMS) containing human influenza virus envelope glycoproteins. Scand J Immunol1996;43:164- 172. 5. Maloy KJ, Donachie AM, Mowat AM. Induction of Thl and Th2 CD4+ T cell responses by oral or parenteral immunisation with ISCOMS. Eur J Immunol199$25:2835-2841. 6. Jenkins PG, Coombes AG, Yeh MK, Thomas NW, Davis SS.Aspects of the design and delivery of microparticles for vaccine applications. J Druglkrget 1995;3:79-81. 7. Russell-Jones GJ. Oral vaccination with lectin and lectin-like molecules. In: O'Hagan DT (ed) Novel Delivery Systems for Oral Vaccine. New York: CRC Press, 1994. 8. Lintermans P, De Greve H. Live bacterial vectors for mucosal immunisatioa Adv Drug Deliver Rev 1995;18:73-89. 9. Oggioni MR, Manganelli R, Contorni M, Tommasino M, Pozzi G. Immunisation of mice by oral colonization with live recombinant commensal streptococci.Vaccine 1995;13:775-780. 10. Wells JM, Robinson K, Chamberlain LM, Schofield KM, Le Page RWE Lactic acid bacteria as vaccine delivery vehicles. Antonie van Leeuwenhoek 1996;70:317-330. 11. Graheam FL, Prevec L. Adenovirus-based expression vectors and recombinant vaccines. Biotechnology 1992;20363-390. 12. Alexander L, Lu H-H, Gromeier M, Wimmer E.Dicistronic polioviruses expression vectors for foreign genes. AIDS Res Hum Retrovirus 1994;lO(Suppl2):S57-S60. 13. Cox DS, Taubman MA. Oral induction of the secretory antibody response by soluble and particulate antigens. Int Arch Allergy Appl Immunol 1984;74249.

310 14. Dahlgren UIH, Wold AE, Hanson LA, Midtvedt T.Expression of a dietary protein in E. coli renders it strongly antigenic to gut lymphoid tissue. Immunology 1991;73:394-397. 15. Yasutomi Y, Koenig S, Haun SS. Immunisation with recombinant BCG-SIVelicits SIV-specific cytotoxicT lymphocytes in rhesus monkeys. J Immunol 1993;150:3101-3107. 16. Roberts M, Chatfield SN, Dougan G. Salmonella as carriers of heterologous antigens. In: 0' Hagan (ed) Novel Delivery Systems for Oral Vaccines. New York: CRC Press, 1994;27-58. 17. Gicquel B. BCG as a vector for the construction of multivalent recombinant vaccines. Biologicals 1995;23:113- 118. 18. Mekalanos JJ. Live bacterial vaccines: environmental aspects. Curr Opin Biotechnol 1994;5: 312-3 19. 19. Pozzi G. Streptococci as live vectors of recombinant vaccines. XI Lancefield International Symposium on Streptococci and Streptococcal Diseases, Siena, 1990;33(AbstractL34). 20. Pozzi G, Contorni M, Oggioni MR, Manganelli R, Tommasino M, Cavalieri F, Fischetti VA. Delivery and expression of a heterologous antigen on the surface of streptococci. Infect Immun 1992;60:1902-1907. 21. Hansson M, Stihl S, Nguyen TN, Bachi T, Robert A, Binz H, Sjolander A, Uhl6n M. Expression of recombinant proteins on the surface of the coagulase-negativebacterium Stuphylococcus xylosus. J Bacteriol 1992;174:4239-4245. 22. Iwaki M, Okahashi N, Takahashi I, Kanamoto T, Sugita-Konishi Y, Aibara K, Koga T. Oral immunization with recombinant Streptococcus Iuctis carrying the Streptococcus mutuns surface protein antigen gene. Infect Immun 1990;58:2929-2934. 23. Wells JM, Wilson PW, Norton PM, Gasson MJ, Le Page RWE Lactococcus Zuctis high level expression of tetanus toxin fragment C and protection against lethal challenge. Molec Microbiol 1993;8:1155- 1162. 24. Pozzi G, Oggioni MR, Manganelli R, Fischetti VA. Surface expression of M6 protein in Streptococcus gordonii Challis after transcriptional fusion with chromosomal promoters. Res Microbiol 1992;143:449-459. 25. Pozzi G, Oggioni MR, Manganelli R, Medaglini D, Fischetti VA, Fenoglio D,Valle MT, Kunkl A, Manca E Recognition by human T helper cells of an immunodominant epitope of HIV-1 gpl20 expressed on the surface of Streptococcus gordonii. Vaccine 1994;12:1071- 1076. 26. Oggioni MR, Medaglini D, Contorni M, Cavalieri F, Pozzi G. Expression of fusion proteins in the naturally transformable Streptococcus gordonii @treptococcus sunguis) Challis. In: D Balla E, Berencsi G, Szentirmai A (eds) DNA Transfer and Gene Expression in Microorganisms. Andover: Intercept Ltd., 1993;235-240. 27. Medaglini D, Oggioni MR, Contorni M, Cavalieri F, Pozzi G. Secretion of heterologous proteins in Streptococcus gordonii (Streptococcus sunguis) Challis. In: D Balla E, Berencsi G, Szentirmai A (ed) DNA Transfer and Gene Expression in Microorganisms. Andover: Intercept Ltd., 1993;263-268. 28. Oggioni MR, Pozzi G. A host-vector system for heterologous gene expression in Streptococcus gordonii. Gene 1996;169:85-90. 29. Nguyen TN, Hansson M, Stihl S, Bachi T, Robert A, Domzig W, Binz H, Uhl6n M. Cell-surface display of heterologous epitopes on StaphyZococcus xylosus as a potential delivery system for oral vaccination. Gene 1993;128:89-94. 30. Samuelson P, Hansson M, Ahlborg N, Andreoni C, Gotz F, Bachi T, Nguyen TN, Binz H, Uhltn M, Stihl S. Cell surface display of recombinant proteins on Staphylococcus curnosus. J Bacteriol 1995;177:1470-1476. 31. Wells JM, Norton PM, Le Page RWE Progress in development of mucosal vaccines based on Lactococcus Zuctis. Int Diary J 1995;5:1071- 1079. 32. Chamberlain LM, Wells JM, Robinson K, Schofield KM, Le Page RWE Mucosal immunization with recombinant Lactococcus luctis. In: Pozzi G, Wells JM (eds) Gram-Positive Bacteria as Vaccine Vehicles for Mucosal Immunization. Biotechnology Intelligence Unit. Landes, Austin: RG, 1997;83-106.

31 1 33. Powels PH, Leer RJ. Genetic of Lactobacilli: plasmid and gene expression. Antonie van Leeuwenhoek 1993;64:85- 107. 34. Rush CM. Antigen delivery to the female reproductive tract using recombinant Luctobucillus. PhD thesis. Qeensland University of Technology, Brisbane, Australia, 1994. 35. Mercenier A, Dutot P, Kleinpeter P, Aguirre M, Pris P, Rejmund J, Slos I? Developmentof lactic acid bacteria as live vectors for oral and local vaccines. Adv Food Sci (In press). 36. Hols P, Slos P, Reymund J, Ferain T, Delplace B, Mercenier A, Delcour J. Evaluation of genetic expression and secretion cartridges suitable for topical delivery of mucosal antigens by LuctobaciZ2us sp. European Commission Conference on Lactic Acid Bacteria, Cork, Ireland, 1995; (Abstract No. PA-7). 37. Dutot I? Evaluation des lactobacilles comme vecteurs de vaccination. PhD thesis, Universite Louis Pasteur, Strasbourg, France, 1996. 38. Rush CM, Mercenier A, Pozzi G. Expression of vaccine antigens in Lactobacillus. In: Pozzi G, Wells JM (eds) Gram-Positive Bacteria as Vaccine Vehicles for Mucosal Immunization. Biotechnology Intelligence Unit. Landes, Austin: RG, 1997;107-144. 39. Shafer R, Portnoy DA, Brassel SA, Paterson Y. Induction of a cellular immune response to a foreign antigen by a recombinant Listeriu monocytogenes vaccine. J Immunol 1992;14953-59. 40. Ikonomidis G, Paterson Y, Kos FJ, Portnoy DA. Delivery of a viral antigen to the class I processing and presentation pathway by Listeria monocytogenes. J Exp Med 1994;1802209-2218. 41. Goossens PL, Milon G, Cossart P, Saron ME Attenuated Listeria monocytogenes as live vector for induction of CD8+ T cells in vivo: a study with the nucleoprotein of the lymphocytic choriomeningitis virus. Int Immunol 1995;7:797-805. 42. Shen H, Slifka MK, Matloubian M, Jansen ER, Ahmed R, Miller JF. Recombinant Listeria monocytogenes as live vaccine vehicle for the induction of protective anti-viral cell-mediated immunity. Proc Natl Acad Sci USA 1995;92:3987-3991. 43. Guzman C, Weiss S, Chakraborty T. Listeriu monocytogenes a promising vaccine carrier to evoke cellular imune responses. In: Pozzi G, Wells JM (eds) Gram-Positive Bacteria as Vaccine Vehicles for Mucosal Immunisation. Biotechnology Intelligence Unit. Landes, Austin: RG, 1997;145- 174. 44. Pozzi G, Musmanno RA, Lievens PMJ, Oggioni MR, Plevani P, Manganelli R. Method and parameters for genetic transformation of Streptococcus sunguis. Res Microbiol 1990;141:659670. 45. Medaglini D, Rush CM, Sestini P, Pozzi G. Commensal bacteria as vehicles for mucosavaccines against sexually transmitted diseases vaginal colonisation with recombinant streptococci induces local and systemic antibodies in mice. Vaccine 1997;(In press). 46. Pozzi G, Oggioni MR, Medaglini D. Recombinant Streptococcus gordonii as live vehicle for vaccine antigens. In: Pozzi G, Wells JM (eds) Gram-Positive Bacteria as Vaccine Vehicles for Mucosal Immunisation. Biotechnology Intelligence Unit. Landes, Austin: RG, 1997;35-60. 47. Pozzi G, Oggioni MR, Manganelli R, Plevani F! Genetic manipulation of streptococci by chromosomal integration of recombinant DNA. In: Dunny GM, Cleary PP, McKay LL (eds) Genetics and Molecular Biology of Streptococci, Lactococci, and Enterococci. Washington DC: American Society for Microbiology, 1991;59-61. 48. Ricci S, Rush CM, Medaglini D, Marcello A, Palu G, Pozzi G. Expression of the Escherichiu coli heat labile toxin subunit B in Streptococcus gordonii. XI1 European Meeting on Bacterial Gene Transfer and Expression, Siena, Italy, 1996;(AbstractP88). 49. Medaglini D, Pozzi G, King TP, Fischetti VA. Mucosal and systemic immune responses to a recombinant protein expressed on the surface of the oral commensal bacterium Streptococcus gordonii after oral colonisation. Proc Natl Acad Sci USA 1995;92:6868-6872. 50. Robert A, Samuelson P, Andreoni C, Bachi T, Uhlin M, Binz H, Nguyen TN, Stihl S. Surface display on staphylococci: a comparative study. FEBS Lett 1996;390:327-333. 51. Pan ZK, Ikonomidism G, Pardoll D, Paterson Y. Regression of established tumors in mice mediated by the oral administration of a recombinant Listeriu monocytogenes vaccine. Cancer

Res 1995;55:4776-4779. 52. Pan ZK, Ikonomidis G, Lazenby A, Pardoll D, Paterson Y. A recombinant Listeria monocytogenes vaccine expressing a model tumor antigen protects mice against lethal tumor cell challenge and causes regression of established tumors. Nature Med 1995;1:471-477. 53. Frankel FR, Hedge S,Lieberman J, PatersonY. Induction of cell-mediatedimmune responses to human immunodeficiency virus type 1 Gag protein by using Listeria monocytogenes as live vaccine vector. J Immunol 1995;155:4775-4782. 54. Wells JM, Wilson PW, Norton PM, Le Page RW A model system for the investigation of heterologous protein secretion pathways in Lactococcus lactis. Appl Environ Mimbiol 1993;59: 3954-3959. 55. Nguyen TN, Gourdon M-H, Hansson MA, Robert P, Samuelson C, Libon C, Andreoni PA, Nygren H, Binz M, UhlCn M, Stihl S. Hydrophobicity engineering to facilitate surface display of heterologous gene products on Staphylococcus xylosus. J Biotechnol 1995;47:207-219. 56. Stihl S, Samuelson P, Hansson M, Andrboni C, Goetsch L, Libon C, Liljequist S, Guinneriusson E, Binz H, Nguyen TN, UhlCn M. Development of non-pathogenic staphylococci as delivery vehicles. In: Pozzi G,Wells JM (eds) Gram-Positive Bacteria as Vaccinevehicles for Mucosal Immunization. Biotechnology Intelligence Unit. Landes, Austin: RG, 1997;61-81. 57. Di Fabio S,Medaglini D, Rush C, Corrias F, Panzini GL, Pace M, Monardo F, Pozzi G, Titti F, Verani €? Recombinant Gram-positive bacteria as delivery system for mucosal vaccines against sexually transmitted diseases (STD) in the primate model. First European Conference on Experimental AIDS Research. Cannes, France, 1996. 58. Robinson K, Chamberlain LM, Schofield KM, Wells JM, Le Page RWE Oral vaccination of mice with recombinant Lactococcus lactis expressing tetanus toxin fragment C elicits both s e a tory and protective high-level systemic immune responses. European Commission Conference on Lactic Acid Bacteria, Cork, Ireland, 1995;(Abstract No. PA-6). 59. Pouwels PH, Leer RJ, Boersma WJA. The potential of Lactobacillus as a carrier for oral immunisation: development and preliminary characterisation of vector systems for targeted delivery of antigens. J Biotechnol 1996;44:183-192. 60. Steinman RM. The dendritic cell system and its role in immunogenicity. Ann Rev Immunol 1991;9:271-296. 6 1. Winzler C, Rovere P, Rescigno M, Granucci F, Penna G, Adorini L, Zimmerman VS, Davoust J, Ricciardi-Castagnoli P. Maturation stages of mouse dendritic cells in grow-factor dependent long-term cultures. J Exp Med 1997;185:1-12. 62. Klijn N, Weerkamp AH, De Vos WM. Genetic marking of Lactococcus lactis shows survival in the human gastrointestinal tract. Appl Environ Microbiol 1995;61:2771-2774. 63. Guzman CA, Rohde M, ChakrabortyT,Domann E, Hudel M,Wehland J,Timmis KN. Interaction of Listeria monocytogenes with mouse dendritic cells. Infect Immun 1995;63:3665-3673. 64. Goossen PL, Milon G. Induction of protective CD8+ lymphocytes by an attenuated Listeria monocytogenesactA mutant. Int Immunol 1992;4:1415- 1421.

01997 Elsevier Science B.V. All rights reserved. Bwtechnology Annual Review Volume 3 M R El-Gewely, editor.

313

The expression of Bacillus thuringiensis toxin genes in plant cells Marianne Mazier', Catherine Pannetier2, Jacques Tourneur', Lise Jouanin2 and Marc Giband2 'Station dbmilioration des plantes maraichdres. INRA, Montfavet Cedex; and 2Laboratoirede biologie cellulaire, INRA, Centre de 'versailles,route'versaillesCedex, France

Abstract. Plants expressing genes encoding &-endotoxinsfrom Bacillus thuringiensis (Bt) have triggered interest for the control of insect pests. Numerous plant species have been transformed with genes encoding various toxins. The first transformation experiments conducted with bacterial genes showed that their level of expression in plants is too low to confer adequate protection.To circumvent these problems, Bt toxin genes have been modified or resynthesized, dramatically improving their level of expression and the protection afforded. Despite these improvements, problems remain: the control of less susceptible insects and the durable deployment of transgenic plants have yet to be fully addressed

Keywords: Bacillus thuringiensis, codon-optimized genes, cry genes, CRY toxins, &-endotoxins, entomopathogenic, insect resistance, transgenic plants.

Introduction The use of chemical insecticides causes increasing problems for human health and to the environment. Their lack of biodegradability favors the accumulation and concentration of toxic residues in the environment, and their absence of specificity leads to ecological imbalances in the entomofauna in treated areas. Insects have developed resistance to all known insecticides, and the loss of effectiveness of these pesticides has led to an increase in the number of treatments and doses that are sprayed. As a consequence, great interest has been given to biological insecticides that are capable of controlling insect pests and that could be used as substitutes for chemical insecticides. At present, 90% of the bioinsecticides that are used take advantage of the entomopathogenic properties of the bacterium Bacillus rhuringiensis (Bt) [l], representing, in 1992, 2% of the global world pesticide market [2]. Bt formulations have a narrow host spectrum and are harmless to humans, mammals, and nontarget insects. Furthermore, their remanence in the field is low. Recent progress in plant biotechnology has made it possible to envisage new alternatives to protect cultures. One of these is the use of transgenic plants that Address for correspondence: M. Mazier, Station d'amtlioration des plantes maraichkres, INRA,BP 94,84143 Montfavet Cedex, France.

314 are resistant to insects. Resistance can be achieved through the incorporation and expression of chimeric genes encoding proteins that are toxic to insect pests. Among the genes that are valuable candidates for such experiments, genes encoding Bt toxins have retained the most attention. At a time when the commercial introduction of the first transgenic resistant varieties is being achieved, our purpose here is to review the work in progress in this area. Bacillus thuringiensis Delta-endotoxins

First discovered in 1902 in a silkworm-rearing unit in Japan, the bacterium Bt was reisolated from a population of flour moths and identified in Thuringen in 191 1 by Berliner. Bt is a gram-positive bacterium which has the particularity of synthesizing insecticidal crystal proteins (ICPs) upon sporulation. The structure of the ICPs results from the assembly of one or more types of protein subunits, the protoxins or &endotoxins. A number of different &endotoxins have been characterized, each having a relatively narrow insecticidal spectrum. Since the first cloning of a gene encoding a 130 kDa &endotoxin [3], close to 100 protoxin-coding genes from various Bt isolates have been cloned and sequenced. The analysis and comparison of these gene sequences has allowed a classification based on structural homologies and toxin specificity [4]. The genes have been grouped into five major classes, each of these being divided into subclasses (Table 1). New toxins are continuously being identified, and classes and subclasses have to be added to this classification. In view of this, and due to a growing number of exceptions, a new classification based solely on nucleic acid sequence identities has recently been proposed [5]. In order to exert their entomopathogenic activity, the &endotoxins have to be dissolved in the insect gut, then activated by gut proteases which specifically cleave the C-terminal half of the high molecular weight (1 30 kDa) protoxin as well as a few N-terminal amino acids, releasing smaller 60-70 kDa polypeptides which are the active toxins [4,6,7].These smaller polypeptides comprise a toxic motif as well as the determinants responsible for specificity [7-111, and show blocks of sequences that are remarkably well conserved among the different toxins [lo,121. Tnble 1. Simplified classification of the Bt toxin genes, based on the nomenclature of Hofte and Whiteley [4]. Toxin gene

Molecular weight (kDa)

Insecticidal activity

cryIA (4 (4 (cl, B,C, D, E, R G cryIIA,B, C cryIIIA. B,B(b) cryIVA, B, C, D cry V-cryX

130- 138 69-11 13-14 12- 134 35-129

Lepidoptera Lepidoptera and diptera Coleoptera Diptera various

315 It has been demonstrated that the toxins specifically bind to the apical part of the brush border membranes of susceptible insects’ midgut 113,141. Binding involves a two-stage process, with a reversible step and an irreversible one [15]. The latter step requires binding of the toxin to a receptor. Due to their ability to specifically bind Bt toxins, a number of proteins are being characterized as putative receptors. The exact nature of these proteins, probably glycoproteins [16- 181 aad/or proteins having a high content in acidic (Asp, Glu) or hydrophobic (Ala,Val, Leu, Ile) amino acids [19], has not been precisely defined. Knight et al. [20] and Lee et al. [21] have identified and purified an aminopeptidase N from Munducu sextu (tobacco hornworm) and Lymuntriu dispar (gypsy moth) as a receptor for the CRYIA(c) toxin. Different models have been described to explain the possible role of these receptors (reviewed in Knowles and Dow [22]): the receptor itself could be a transmembrane channel which would be blocked in an open position by the toxin; the toxin and the receptor together could form a pore; or the receptor could catalyze the insertion of the toxin in the membrane, but would have no other role in pore formation. The subsequent steps in the intoxication process include the insertion of the toxin in the apical membrane of the epithelial columnar cells, inducing the formation of ionic channels or nonspecific pores in the target membrane. As a consequence of pore formation, a series of events leads to lesions in the plasma membrane, and finally to the destruction of the integrity of the midgut. Histological observations suggest that osmotic lysis is a common phenomenon in intoxicated insects. The insects then stop feeding and die (reviewed in [22] and [23]). Use of the entomoputhogenicproperties of Bt

For more than 30 years, Bt formulations have been sprayed as bioinsecticides to protect crops against more than 300 insect species. Despite great interest in biological control agents, the use of these sprays is still limited, due to their high cost and low field remanence. Indeed, the toxins are rapidly degraded by solar UV [24], conferring short-term protection and requiring frequent spraying. Nevertheless, this characteristic can, in some cases, be an advantage since it lessens the probability of selection of resistant insects. Different solutions have been developed to solve these problems: Biological encapsulation which affords a certain protection against degradation due to environmental factors [25]. Production of the toxin in nonsporulating bacteria (such as Pseudomonus) followed by chemical treatment to kill the bacteria. In addition to producing formulations that are free of living bacteria, this process allows the stabilization of the toxin by the biological coating provided by the Pseudornonus [26,27]. Broadening of the host range by addition of different toxins in the same Bt strain [28] or by recombinations between toxins to obtain new toxin hybrids ~91. Production of toxins in endophytic bacteria that colonize plant tissues [30,31]

316

-

or that live in the same ecological niches as the target insects which will then ingest the bacteria [27,32,33]. Production of the toxin by the plants themselves. This strategy consists of inserting in the plant genome chimeric genes coding for &endotoxins. It is this latter strategy that will be addressed in this review

The development of insect-resistant transgenic plants through the expression of Bt toxin genes

Benefits of the strategy Plants expressing toxin genes (which could as such be considered as “plant pesticides”) have several advantages over classical chemical means used in plant protection. Borers, for example, are difficult to reach by conventional means once they have penetrated plant tissues. Since toxin expression can be achieved throughout the whole plant during the entire life-cycle, the deployment of transgenic plants would allow the control of major insect pests such as the European corn borer (Ostriniu nubilulis) or the striped stem borer (Chilo suppressulis). Furthermore, pests are exposed to the toxins at their most sensitive stages (the early larval instars), and conversely, the plants can be protected when they are most sensitive to insect attack. Such transgenic plants represent a novel means to control insects that have developed resistance to chemical insecticides, such as the Colorado potato beetle (Leptinotursudecemlineutu), the most destructive pest in potato crops. The system allows the active compound to be maintained in the plant tissues, and has the potential of lowering costs by reducing the number of necessary chemical treatments. Finally, due to the relatively narrow host range of the Bt toxins which are active on target pests and not on beneficial insects, and to the particular mode of delivery of the toxin (the plant tissues), transgenic plants expressing Bt toxin genes can easily be integrated in an integrated pest management (IPM) scheme. The very first transgenic plants were obtained in 1983, followed in 1987 by plants transformed with genes encoding Bt toxins [34-361. These plants showed a significant tolerance to M. sextu, Heliothis virescens (tobacco budworm), and to a lesser extent, to Helicoverpu zeu (cotton bollworm/corn earworm), thus pointing out the benefits of such a strategy Tobacco and tomato, two plants for which Agrobucterium tumefuciens mediated transformation techniques were mastered, were the first plant species that were used to validate the strategy These model plant species are still frequently used for preliminary and hndamental studies, in particular when constructs are to be transferred into plant species whose transformation is more difficult and time consuming. Bt toxin genes have since been introduced into various agronomically important plant species (Table 2), either by A. tumefuciens transformation techniques, by protoplast electroporation, or by microprojectile bombardment.

317 lhble 2. Transgenic plants expressing Bt toxins.

Plants

Genesa

Nicotiana tabacum cryIA(a) (‘I (tobacco) cryIA (b) cryIA (b) cryIA(b) (’) cryIA (b) cryIA (c) (3) cryIA (b) cryIA(c) (3) cryIA (b) cryIA (c) cryIA (c) cryIA (c) cryIA (b) cryIC cryIIIA cryIA (b)

Coding sequenceb

Target insect

Reference

WT WT WT WT WT S or PM

Manduca sexta M. sexta Heliothis virescens

WI

M. sexta M. sexta

WI

S WT&DL

M. sexta

[771

WT WT

M. sexta [lo81 H virescens; Helicoverpa zea; [37] Spodoptera exigua S. exigua; H. virescens;M. sexta [41]

PM

S

[361 [991 1541 [561

1721 [35] [481

cryIA(c) (3) cryIA (b) cryIA (b) cryIC

S or PM

Leptinotarsa decemlineata M. sexta; H virescens;H zea M. sexta; H. zea; Keifera Iycopersicella M. sexta

PM

S. exigua; H virescens;M. sexta [41]

cryIA(a) (‘I

WT

[421

cryIA(a) (4) cryIA (c)

PM WT

Lymantria dispar; Malacosoma disstria L. dispar; M. disstria Apochemia cineraius; L. dispar

Vaccinium macrocarpon (cranberrv)

cryIA(a) (4)

PM

Rhopobota naevana

[1101

Liquidambar styracijiura (sweetgum)

cryIA(b) ()’

WT

Dendranthema grandijlora (chrysanthemum)

cryIA (b)

WT

H. virescens

WI

Oryza sativa (rice)

cryIA (b)

S

[701

cryIA(b) (’)

S

Chilo suppressalis; Cnaphalocrosismedinalis C. suppressalis; C. medinalis; Scirpophaga incertulas; Marasmia patnalis

cryl?

WT

Lycopersicum esculentum (tomato)

Populus spp. (poplar)

WT

[561

1631 [1091

P111

[80]

[1121 (Continued)

318 Table 2. Continued.

Plants

Genesa

Coding sequenceb

Target insect

Reference

Zea mars (corn)

cryIA(b) ( 5 ) cryIA (b) cryIA(b) (3)

S

Ostrinia nubilalis M. sexta; 0. nubilalis

[@I

cryIA(b) (3) cryIA(c) (3)

S

cryIA(c) (3)

S

[1131 Pectinophora gossypiella; Buccula- [1 141 trix thurberiella; Estigmene acrea; S. exigua Trichoplusia ni; S. exigua; H. zea [53] H. virescens [781 t511 H. virescens; H. zea; E ni [521 H. virescens ~ 5 H zea; H. virescens 1791

Brassica oleracea (broccoli)

cryIA(c)

S

Plutella xylostella

P41

Brassica oleracea var capitata (cabbage)

cryIA (c) (6)

WT

R xylostella

11 161

Brassica napobrassica (rutabaga)

cryIA (c) (6)

WT

Pieris rapae

11 171

Brassica napus (rapeseed)

cryIA(c) (7)

S

R xylostella; E ni; H. zea; S. exigua

[1181

GIycine max (soybean)

cryIA (b) cryIA(c) (7)

WT

Anticarsia gemnalis H. zea; Pseudoplusia includens; H. virescens; Anticarsia gemmatalis

[1191 [1201

Juglans regia (walnut)

cryIA (c)

WT

PIodia interpunctella; Cydia pomonella; Amvelois transitella

[461

Picea glauca (white spruce)

cryIA(a) ( 2 )

WT

Chorisoneurafumifrana

[441

WT

M. sexta Phthorimea operculella; 0.nubilalis L. decemlineata

1401

Gossypium hirsutum (cotton)

Solanum tuberosum cryIA (c) (potato)

cryIIIA

(3)

S

S

S

S

L. decemlineata

1

WI [501 [I211 [I221 [711

Solanum cryIIIB WT L. decemlineata ~231 melongena (eggplant) The number in brackets refers to the origin of the gene: the same number indicates the same origins. bNatureof the coding sequence:WT:wild-type; S: synthetic or codon-optimized;M: modified; DL:

I

i1

319 Development of transgenicplants harboring native toxin genes

Five different types of Bt toxin genes have been introduced into plants: crylA(a), crylA(b), cryZA (c), cryZC, and cryZZZA (Table 2). The transgenes were transmitted as Mendelian characters, except in the case where the gene was specifically targeted to the chloroplast genome and exclusively inherited from the female parent [37] (see below). Gene constructs In the first transformation experiments, the constructs used harbored either the entire protoxin coding sequence, or the sequence coding only for the toxic moiety (the N-terminal part of the molecule) of the &endotoxins (referred to as “truncated genes”) [35,36]. The results of these two studies were similar: transgenic plants produced a higher level of toxin when truncated versions of the genes were used. In typical experiments, the &endotoxin coding sequences, terminated at the truncation site, are placed under the control of a strong constitutive promoter. Most constructs use the cauliflower mosaic virus (CaMV) 35s RNA promoter, or derivatives thereof. In some cases, additional sequences, such as the Alfalfa mosaic virus (AMV) RNA untranslated region [34], have been placed upstream of the coding sequence in order to enhance gene expression. Indeed, it has been shown [38,39] that the addition of such leader sequences can, in some cases, enhance the expression of the coding sequence placed downstream. Various polyadenylation signals, most often that of the CaMV 35s RNA or of the nopaline synthase gene have been used. Assessment of the insecticidal properties of the transgenic plants Dijferent types of assays. Various types of bioassays have been conducted in order to assess the toxicity of the transgenic plants expressing endotoxins. Each of these have their advantages and pitfalls. The most straightforward and simplest to implement consists of using isolated plant tissues (leaf disks) placed in Petri dishes on moistened filter paper, or whole detached leaves whose petiole is placed in water [34-36,40-431. A number of larvae of defined stage are placed on the leaf material, and toxicity is recorded after a determined period of time. This type of assay has the advantage of allowing multiple repetitions of leaf material from the same plant to be tested, while requiring limited space. Furthermore, larvae can easily be collected for counting and weighing, and the amount of ingested plant material can be estimated. Such bioassays can be conducted not only on leaf or fruit material, but also on callus fragments [44,45] or on embryos [46]. Larvae can also be placed on whole plants placed in isolation chambers [34-36,471. Although this system has the advantage of assessing damage to whole plants, recovery of the insects for hrther analysis may be more difficult than in the previous type of bioassay

320

Finally, field tests, in which plants are exposed to natural or artificial infestations, allow assessment of the efficacy of the transgenic plants in conditions close to that of commercial release by visual observations of damage, and/or by counting insect populations [48]. Furthermore, such tests also allow assessment of the agronomical properties of the transformed plants [49- 521. Plants expressing Bt toxins show tolerance to certain insects. The first studies with transgenic plants harboring the cryL4-type of toxin genes were conducted with the tobacco hornworm sextu), an insect that is very sensitive to these toxins. Results from these bioassays showed that certain plants exhibited a high level of toxicity to this insect [34,36,40,47]. The protection afforded by the transgene towards insect species whose control is of economical importance was also evaluated; Fischhoff et al. [35] conducted bioassays on CRYIA(b)-expressing plants with three insect species. Whereas high levels of mortality (90 to 100%) were rapidly obtained with M. sextu larvae on a relatively high number of plants, only a few plants exhibited 100% mortality when H. virescens (tobacco budworm) larvae were tested. Bioassays conducted with H zeu (cotton bollworm) larvae on those plants that showed the best results with the two other insect species did not result in satisfactory pr6tection. Field tests, conducted with natural or artificial infestations of M. sextu, H.zeu, and Keiferiu lycopersicellu (tomato pinworm), showed different levels of protection of the transgenic tomato plants towards M. sextu [48]. T h e percentage of fruits damaged by H. zeu, an insect that is 100-fold less sensitive to the C T I toxins than M. sextu, was significantly lower compared to control plants; nevertheless, protection was not as effectivein dry and hot weather conditions. A certain level of leaf protection against K. lycopersicellu was obtained, but damage to fruits remained important. This study, aimed at evaluating the protection afforded by transgenic plants under conditions close to that of commercial release, showed not only that higher levels of toxin must be produced by the plants to obtain efficient control, but also that the level of protection depends on the insect species tested.

w.

Problems in assessing the toxicity of transgenic plants. In testing toxin-expressing plants, various levels of protection have been achieved. Results vary with the insects tested, the plants used, and the method of assessing the entomopathogenic effect of the plants. A certain number of parameters must be taken into account before an objective assessment can be made. The larval stage of the insects used can determine the outcome of the test; first instar larvae are often the most sensitive, and only plants displaying the highest level of expression of the transgene are protected against later larval instars [34]. The use of insects at later stages is therefore usell to further discriminate between the levels of protection afforded by plants showing 100% mortality towards first instars. Similarly, insect species display different levels of susceptibility towards a given

321 toxin. M. sexta is one of the most sensitive species to the CRYI-type toxins, and is therefore often used in bioassays. Insect pests of agronomic importance are usually less sensitive to endotoxins than M. sexta, as determined by diet incorporation assays. It is therefore most relevant to test the target insect species before concluding on the efficacy of the transgenic plants. Larval mortality is not always the most relevant indicator when testing the entomopathogenic effect of plants. Significant differences in larval growth (as measured by larval weight) or in leaf consumption can be observed between transgenic and control plants. Partial protection will be evidenced by a more or less high level of mortality together with a significant reduction in larval growth and/or in leaf area consumed [34,36,40,47]. According to the insects’ susceptibility to a given toxin and the larval instar used, the type and duration of the bioassay, and the number of plants tested, results can be more or less spectacular. Due to the differences in assay design, it is often difficult to compare results reported from one experiment to the other. Even though in certain cases intermediate levels of protection may be usell this will have to be judged on a case-by-case basis, depending on the target insect’s biology and the host plant considered - a high level of insect mortality (if not 100%) under field conditions is usually sought. In fact, the assessment of Bt toxin-producing plants is a stepwise evaluation, starting from laboratory bioassays conducted on leaf disks or fragments, and ending with the evaluation of the most promising plants in field trials. Few transgenic lines produced may be worth testing in the field under high insect pressure. Native toxin-encoding genes are poorly expressed in plants The lack of protection of transgenic plants harboring native toxin genes observed in many cases has been linked to the poor expression of the transgene. In many instances, toxin could not be detected using immunoenzymaticmethods. The level of expression of &endotoxins is typically around 0.001% or less of the total leaf soluble proteins [34,47,48,53]. Vaeck et al. [36] were able to achieve a level of 0.004% for the highest expressing plants. Only in one instance was a relatively high level (0.01% of the total leaf soluble proteins) achieved using a native toxin gene. This high level was observed in certain tobacco lines at the time of flowering [54]. Nevertheless, in this same experiment, most transgenic lines showed undetectable amounts of toxin. In the cases where toxin was detected, the development of extremely sensitive immunoenzymatic techniques was necessary, while in most transformation experiments no protein could be detected. As in the case of toxin proteins, the detection of cry transcripts in transgenic plants is difficult; toxin mRNAs are often present in amounts below the level of detection in Northern blots when total cellular RNA is used [36,40,41,45,46]. More sensitive methods, such as RNAse protection assays [36], RT-PCR [40,45], or the isolation of polyadenylated RNAs [35] are needed in order to visualize the transcripts. When detectable, the mRNAs are present in very low amounts (when compared to those of other cointegrated transgenes), and are often shorter

322 than expected, due to degradation or premature termination [35,47]. Various hypotheses, including transcript instability [34-36,45,47] and the inefficiency of posttranscriptional events [34] or of translation [36] have been put forward to explain the lack of mRNA accumulation. Whereas native Bt toxin-encoding genes are highly expressed in their natural host, in Escherichia coli, or in Pseudomonas, the low level of expression of these genes in plants is now well-documented. Native toxin gene expression in plants is abnormally low in comparison to that of other transgenes (reporter or marker genes for example). The transfer of truncated genes has allowed a slight improvement, but the use of various promoters, polyadenylation signals, or leader sequences has not substantially improved the production of toxin proteins in plants. Nevertheless, the expression of Bt toxin genes, even at low levels, has allowed the development of transgenic plants showing protection against various species of insects. Improving Bt toxin gene expression in plants Toxin gene expression: observations and hypotheses

Although the low level of expression of Bt toxin genes in plants is well-documented, the reasons have not been determined clearly Few studies have been undertaken to identi@the mechanisms responsible for the lack of transcript accumulation. By electroporating constructs harboring a crylA (b) gene in carrot protoplasts, Murray et al. [55] have observed a correlation between the low level of expression of the gene and mRNA instability This particular instability was due to the 5’ to 3’ degradation of the transcripts. Northern blots conducted on polyadenylated transcripts at various time-points after DNA electroporation demonstrate the presence, in low amounts, of fill-length transcripts 1 to 2 h postelectroporation. These fill-length mRNAs then disappeared as intermediate degradation products, to give, 18 h after electroporation, signals corresponding to totally degraded RNA. In control experiments, transcripts corresponding to a reporter gene were more stable and visualized at all time-points. In transgenic plants transformed with the same constructs, only low levels of truncated toxin polyA+ transcripts were detected. According to Perlak et al. [50,56], the main problem with transgene expression was defective translation of the mRNAs rather than transcript instability Based on nuclear run-off experiments, others [57,58] have suggested that Bt gene expression is hindered at the transcriptional level. This hypothesis stems from the fact that pausing of the RNA polymerase I1 during the elongation process was observed. The sometimes contradictory nature of the various hypotheses can be explained by the difficulty in dissociating the numerous steps finally leading to protein synthesis. Indeed, defective translation can result in the destabilization and

323

degradation of the mRNAs in the cytoplasm. A low level of cytoplasmic transcript accumulation may reflect RNA instability (due to various phenomena), but also the inefficiency of downstream processes (messenger maturation or transport etc.). Upon inspection of the &endotoxin coding sequences, a number of motifs rarely present in plant genes can be found repeatedly throughout the toxin nucleotide sequence. Not only is the overall (G+C) content of the cry genes much lower than that of plant genes, but particular sequences present in the toxin coding sequences may play a role in the low level of expression of these genes. These include: - Numerous (A+T)-rich stretches; such sequences are normally only found in nontranslated regions of plant genes, in particular in introns [59]. - A m A motifs; the role of these motifs as messenger destabilization elements has been demonstrated for various unstable transcripts in eukaryotic cells [60,61].

Numerous potential polyadenylation sites (such as AATAAA/T), which are normally found in the 3’ untranslated region of plant genes [62]. Furthermore, the codon usage in the cry genes is very different from that found in plant genes. This difference is even greater if one considers the codon usage in genes that are highly expressed in plants. These observations have led to the hypothesis that the low level of expression of Bt toxin genes in plants is due to the prokaryotic nature of the coding sequence, which would be unfit for expression in plant cells. Thus, modifications in the coding sequence (without modiwng the amino acid sequence), with the aim of rendering the sequence more “plant-like”,could potentially lead to a higher level of expression. -

Modification of the coding sequence of Bt toxin genes can improve their expression in plant cells

In order to identifl the features of native toxin genes that are responsible for their poor expression in plants, various experiments have been designed. The results of these experiments show that certain parts of the coding sequence (and maybe certain particular motifs present in the sequence) are indeed implicated in the low level of expression. By comparing the stability of mRNAs derived from a series of deletions of the cryZA (c) gene in electroporated protoplasts and transgenic plants, Murray et al. [55] were able to localize elements within the coding sequence that are responsible for the particular instability of the transcripts. These elements are situated in the 570 first base pairs of the coding sequence. Likewise, by introducing changes in the native coding sequence by site-directed mutagenesis (without changing the amino acid sequence), Perlak et al. [56] identified elements within the corresponding region of the crylA (b) gene which played a role in the attenuation of gene expression. Within this region corresponding to

324 the first 1/ 3 of the gene, a particular block of 37 nucleotides was shown to have a dramatic effect on gene expression. This block does not show any particular secondary structure, nor any significant difference with the rest of the coding sequence. Three motifs, corresponding to potential plant polyadenylation signals (two AACCAA and a A A T T " tract), are present within the block. Modifications of this 37-nucleotide block aimed at removing plant potential polyadenylation signals, increasing the overall (G+C) content, and increasing the number of plant-preferred codons, led to an increase in toxin protein synthesis which reached 0.016% of the total proteins. This level of protein synthesis represents close to a 10-fold increase in protein production compared to that of unmodified versions of the same gene. Other experiments point to the same 5' region of the Bt toxin coding sequence as responsible for the poor expression of such genes; by replacing the 141 first codons of a crylA(a) gene by plant-preferred codons, McCown et al. [63] were able to achieve levels of toxin transcripts detectable by Northern blots in transgenic plants. In a different approach,Van der Salm et al. [41] have introduced point mutations in the crylA(b) and crylC genes. Areas targeted for mutagenesis included regions with major (AATAAA or AATAAT) or two overlapping or adjacent minor (AACCAA) polyadenylation signals, tandem repeats of the ATTTA instability motif, or tracts of eight or more A/T residues. Furthermore, if rare plant codons were present, they were exchanged for plant-like codons. In total, 21 nucleotides in five regions of the cryZA(b) gene, and 45 nucleotides in nine regions of the cryZC gene were changed. Studies on the expression of these modified genes in transgenic tobacco and/or tomato plants showed that satisfactory levels of protection could be achieved. Whereas no tobacco plants (out of 55 plants tested) harboring a native cryZA(b) gene showed protection against M sexta, 80% of those transformed with the modified gene showed efficient protection. Of these, 50% were also protected against less sensitive H. virescens larvae. Similarly, none of the 47 plants transformed with an unmodified crylC gene showed protection against M. sexta, while 11 out of 19 plants harboring the modified version of the gene were protected against this insect, out of which four showed effective control of H. virescens and Spodoptera exigua (beet armyworm) larvae. In our laboratory, we have conducted experiments to determine which features in the cryZC coding sequence were responsible for the low level of expression of this gene in plant cells. A series of 5' deletions of the toxin coding sequence were translationally fbsed to the gus reporter gene and electroporated in tobacco protoplasts. Results (GUS activity measurements) showed that the 335 first nucleotides of the toxin gene contained elements that hindered the expression of the reporter gene placed downstream. Interestingly, this region contains a sequence which shows remarkable homologies with the 37-nucleotide block identified by Perlak et al. [56] as having a major effect on gene expression. In preliminary experiments, the replacement of this particular 335-nucleotidefragment

325 by one using plant-preferred codons and devoid of potential polyadenylation or instability sequences led to the regeneration of tobacco plants showing added protection (when compared to plants harboring a bacterial gene) against Spodopteru littoralis (Egyptian cotton leafkorm) larvae in a detached leaf bioassay (M. Mazier, J. Tourneur and M. Giband, unpublished). Although particular blocks of nucleotides seem to have a major effect on toxin gene expression, punctual or more extensive modifications in other parts of the coding sequence also lead to an enhanced level of expression of the gene. These results therefore suggest that different regions of the toxin coding sequence are involved in the attenuation of gene expression, and that interactions between various sequences are responsible for the overall low level of expression of the native toxin-encoding genes. Despite the various attempts to localize motifs or sequences responsible for the low level of expression of the toxin genes, it is difficult to point out specific sequences or the mechanisms involved. Motifs that are rarely found in plant genes are usually eliminated, and the modifications often encompass more than a single feature. Indeed, the replacement of rare codons by those preferentially used in plants (which have a strong bias for G and C) generally results in the elimination of A/T-rich tracts, and therefore of potential polyadenylation signals and instability sequences. Conversely, changes aimed at replacing A/T-rich regions result in the elimination of rare plant codons. Nevertheless, experimental evidence gathered from various systems demonstrates the detrimental effect of such features in gene expression. Rare codons or strong secondary structures have been shown to cause ribosome pausing during translation and hence messenger instability and inefficient translation [64,65]. Similarly, polyadenylation signals present within the coding sequence or in a nonoptimal context can lead to the synthesis of prematurely terminated and nonpolyadenylated unstable transcripts [66]. A/T-rich sequences could be recognized as regulatory signals and lead to internal transcription in a sense or antisense orientation [67], or as introns, causing missplicing and degradation of the corresponding mRNA [68]. Finally, the role of the ATTTA motif in transcript instability has been well-documented in various systems. Such sequences are recognized by proteins that bind specifically, causing transcript degradation [69]. Development of synthetic Bt toxin genes

Although encouraging results have been obtained with partially modified genes, the level of expression of such genes is still too low to confer a high level of protection to plants, especially against the less sensitive agronomically important insect species. Thus, more extensive modifications of the coding sequence have been brought about, resulting in “synthetic”or “codon-optimized”genes. Design of synthetic genes The modifications brought about in Bt toxin genes consist essentially of the

326 replacement of the codons rarely used in plant genes by those preferentially utilized [49,63], or in the systematic replacement of A or T bases present in the third position of a triplet by G or C bases whenever the genetic code allows it [70]. GC and AT dinucleotides in positions 2 and 3 of a triplet have in certain cases also been avoided [71]. Stretches rich in (A+T), strong secondary structures, potential polyadenylation signals, and the ATTTA destabilization sequences were methodically eliminated as codons were modified [50,53,56,71,72]. Compared to the content in (G+C) of the bacterial genes (around 37%), the synthetic genes thus designed have an increased global (G+C) content of approximately 49%, or even more (up to 60-65%) when the new gene is designed to be expressed in monocots. The building of these synthetic genes, which retain between 44 and 78% homology with their native or bacterial counterparts, usually require the complete resynthesis of the coding sequence. To date, the design and synthesis of three toxin-encoding genes (cryZA(b), cryZA (c), and cryZZZA) has been reported in the literature (Table 3). Synthesis of codon-optimizedgenes The building of these synthetic genes has been made possible by progress achieved in the techniques of oligonucleotide synthesis and assembly (oligonucleotides of more than 100 bases can now be synthesized with reasonable yields). The gene to be synthesized is decomposed into a number of single-stranded oligonucleotides (representing the top and bottom strands), then assembled. The difficulty in assembling the oligonucleotides is generally proportional to their number. As the techniques in chemical synthesis evolve, the synthesis of longer oligonucleotides has become possible, thus diminishing the number of steps required to build the 111-length sequence. Improvements that are sought in the process of building synthetic gene sequences are the reduction in the number of necessary steps and in the cost of the synthesis. The most critical point in gene assembly remains the building of mutation- or error-free sequences. The frequency of point mutations (and/or deletions or additions) is usually proportional to the length of the DNA to be synthesized, and is dependant on the technique used to assemble the oligonucleotides. The recourse to site-directed mutagenesis to correct errors is sometimes required, and makes the synthesis more difficult and time-consuming. The design of the sequence to be synthesized, avoiding strong secondary structures and sequence repeats, and a judicious choice of the oligonucleotides to be assembled are determining factors in the less problematic synthesis of DNA sequences. Gene assembly techniques based on PCR have recently been developed. In contrast to the ligation-mediated approaches sometimes used [72], these PCRbased techniques do not require ligation steps (except for the final assembly of the complete sequence), necessitate partially overlapping oligonucleotides, and allow the recovery of large quantities of material. The use of thermostable poly-

Toble 3. Results of experiments conducted with transgenic plants expressing a synthetic toxin gene.

Gene

Plant

Brget insect(s)

Protection afforded Level of protection

cryIA(b) Tobacco Tomato Corn

M. sexta M.sexta 0.nubilalis

M.sexta 0.nubilalis

Cotton

Rice

Z ni S. exigua

H. zea EI gossypiella B. thuberiella E. acrae S. exigua H. virescens (Pgossypiella) H. virescens I-1: zea Z ni H. virescens

cryIA (c)

Inhibition of larvalgrowth

++++ ++++ ++++ ++

+++

++++ ++++ +++ +++ ++++ ++++ +++ +++ +++ +++ +++

C. suppressah C. medinalis S.incertulans C. suppressah C. medinalis M. patnalis

+++ +++ +++ +++

Tobacco

M.sexta M.sexta

++++

Tomato

M. sexta

+++

m e of testkonditions

Reference

Detached leaf Detached leaf Detached leaf and field test (artificial infestation) Preliminary test on calli, leaf disk and field test (artificial infestation) Detached leaf and whole plant

[56l

Insect mortality

+++ ++++ ++++ ++++

++++

+++

++++

++++

++ +++

++ +++ +++ +++ +++ +++ ++++ ++++

[561

WI

[1131 [531

Field test (natural infestation) Detached organs Field test: evaluation of agronomical characteristics field evaluation (natural infestation): assessementof injury and yield Assessement of toxin levels in raw and processed seeds (artificial diet incorporation) Seedling Detached leaf and whole plant

Detached leaf Detached leaf Detached leaf

[561 1771 [56l w (Continued) h,

4

Table 3. Continued.

Gene

Plant

Target insect($

Protection afforded Level of protection

cryIA (c)

Broccoli Cotton

I! xylostella Z ni S. exigua H.zea H. virescens (E! gossypiella) H. virescens H. zea Z ni

++++ +++ +++

Soybean

Rapeseed

cryIIIA

Tobacco

L. decemlineata

Potato

L. decemlineata L. decemlineata

Reference

++++ +++ ++++

Whole plant Detached leaf and whole plant

1941

+++

Detached organs Field test: evaluation of agronomical characteristics Field evaluation (natural infestation): assessementof injury and yield Assessement of toxin levels in raw and processed seeds (artificial diet incorporation) Flower buds from field-grown plants Detached leaf

1781 [5 11

Inhibition of lar- Insect mortality val growth

+++ ++++

+++ +++ +++ ++++ +++

H . virescens H. zea H. virescens H . zea I! includens H.virescens A. gemmatalis I! xylostella Z ni H. zea S. exigua

Type of testlconditions

+++ ++ +++ +++ +++

++++ ++++

+++ ++

++ ++

+++ +++ ++++ ++++ ++++

,

++++ ++++ ++++ +++ . ++ +++ ++++ ++++ +++ +++ +++ +++ +++

L. decemlineata

P I

[521 11151 [791 [I201

Detached leaf

11181

Detached potato leaf painted with tobacco leaf extracts Whole plant Detached leaf, whole plant, and field test (natural infestation): assessement of agronomical characteristics Detached leaf: behavioural response of larvae Field test: assessement of abundance and variety of fungi, bacteria and plant pathogens

[721 [711 [50] w11 [1221

Insect species in brackets were not tested but present as field populations. Plant protection and mortality were assessed as low (++), medium (+++), high (+++) or 111 (++++).

329 merases less prone to errors than the Taq polymerase allows the synthesis of fragments that are close to error-free [73,74]. Recently, a novel oligonucleotide assembly method, “dual-asymmetric PCR” [75] or “recursive PCR” [76], has been described. The principle of the method is based on the use of an asymmetric proportion of oligonucleotides overlapping each other over the last 15 to 20 bases. This technique is of particular interest since the number of steps required to assemble a sequence is reduced, and has been successfblly applied to the synthesis of cry genes [74]. Gene constructs harboring synthetic cry genes In order to achieve the high level of expression of the transgene needed for good insect control, the synthetic genes have usually been placed under the control of strong constitutive promoters. As for the constructs containing native toxin genes, the CaMV 35s promoter or derivatives thereof are generally used. In order to further enhance gene expression, Wong et al. [77] have hsed a synthetic crylA (c) gene to the Arabidopsis thaliana ribulose-1,5-biphosphate carboxylase (Rubisco) small subunit (SSU) AtslA promoter (including the untranslated leader sequence) with its associated transit peptide. With the aim of enhancing translation, viral leader sequences have also been added [72]. In the specific case of constructs to be transferred into monocots, the use of introns inserted in the 5’ untranslated sequence, which have been shown to increase gene expression, has also been reported. In their construct, Fujimoto et al. [70] placed the first intron of the bean catalase I gene upstream of a codon-optimized crylA(b) coding sequence. Codon-optimized genes show enhanced expression in plant cells The expression of synthetic (codon-optimized) genes in transgenic plants allows the production of toxin protein ranging from 0.02 to 0.5% of the leaf total soluble proteins, which can easily be detected by immunoenzymaticmethods. By placing a synthetic crylA (c) gene under the control of the Rubisco SSU AtslA promoter (see above),Wong et al. [77] were able to achieve toxin expression levels representing close to 1% of the leaf proteins in some transgenic tobacco lines. Due to the presence of the transit peptide, the toxin was in this case targeted to the chloroplasts. This example shows that even though high levels of expression can be achieved through the use of synthetic genes, improvements in gene constructs can lead to even higher levels of expression, and probably to better protection. Not only does the expression of codon-optimized genes lead to higher levels of expression of the transgene, but the frequency of plants showing full protection in insect tests is also increased [56,77]. Thus, fewer plant lines have to be screened to isolate one that shows interesting levels of protection, compared to transgenic plants harboring a native gene. Concomitantly with the increase in protein production, an increase in transcript synthesis is achieved when synthetic genes are used. This increase in transcript accumulation is more or less drastic depending on the authors. Perlak et

330

al. [56] have observed a 50-fold increase in CRYIA(b) protein production through the use of a codon-optimized gene, while only a 5-fold increase in transcript accumulation was seen. The same results were obtained with another gene (a synthetic cryIZI gene), which under its native form did not lead to detectable amounts of toxin (evaluated at less than 0.001%) [50]. In contrast, others have observed a good correlation between the increase in protein production and in transcript accumulation: using a synthetic cryIIL4 construct, Sutton et al. [72] estimated that toxin production represented 0.6% of the leaf soluble proteins, while specific transcripts accumulated to 0.5% of the total RNA. Insect bioussuys The improvement in gene expression due to the use of synthetic genes has made it possible to obtain numerous transgenic plants showing a high level of resistance to less sensitive and economically important insect pests (Table 3). Thus, transgenic cotton plants were regenerated, which showed 111 protection against the cabbage looper (Ztichoplusiu ni) and 100% mortality in 5 days in bioassays conducted with beet armyworm larvae. These plants also showed 70-75% boll protection in greenhouse tests with bollworm (H zeu) pressure 100-fold greater than the recommended threshold for field application of chemical insecticides [53]. Bioassays conducted on various plant parts (cotyledons, seedling stems, leaves, squares, petals etc.) of some of these lines grown in the field exhibited good protection against tobacco budworm virescens) larvae; larval survival was very low, and those that survived showed a dramatic decrease in growth rate. Furthermore, none of the larvae placed on transgenic plant parts reached pupation [78]. Field evaluations were conducted over two growing seasons with some of the best lines. The season mean percent injury to flower buds and bolls was 10-fold lower for these lines than for the untransformed control, and never above the injury threshold recommended for chemical control [52]. Nevertheless, although the plants showed a high level of toxicity towards the first four larval instars of H. zeu and H . virescens, fifth instar larvae were not as well controlled, and a significant percentage survived, pupated and became adults [79]. Field studies conducted with nine transgenic lines harboring either a cryIA(b) or a cryIA(c) synthetic gene and showing high levels of insect control demonstrated that the integration and expression of the transgenes did not result in deleterious effects on the agronomical properties of the plants. On the contrary, certain transgenic lines surpassed the controls (which had not gone through the in vitro culture process) in lint yield and fibre properties [51]. Field studies conducted with transgenic maize plants expressing the CRYIA(b) toxin showed that the protection afforded lasts throughout the entire growing season. Despite repeated heavy artificial infestations, foliar and tunnelling damage due respectively to first and second generation European corn borer (0.nubiZuZi4 larvae, was minimized [49]. The level of protection conferred by the expression of the transgene is much better than that offered by the most tolerant nontransgenic lines.

33 1

Similarly, a commercial variety of potato (Russet Burbank) harboring a codonoptimized cryl1.A gene was protected against defoliation by Colorado potato beetles (L. decemlineata) during the course of the growing season. It is important that protection was afforded not only against larvae at different stages, but also against adults which can cause crop damage. Although exposed adults did not die as quickly as larvae, damage was negligible on plants expressing toxin levels of more than 0.005%, since feeding ceased within 24 h. Oviposition was dramatically decreased on transgenic plants as a result of the destruction of the ovaries. Finally, the agronomical and morphological properties of the plants and tubers were analyzed and found to be within the limits for the variety [50]. The two main types of cultivated rice varieties (Japonica and Indica) have been transformed with two different synthetic versions of the same crylA(b) gene, and in both cases, adequate control of important rice pests (striped stem borer, C. suppressalis, and leaffolder, Cnaphalocrosis medinalis) was achieved [70,80]. Although direct comparison of the two experiments is difficult, some interesting differences can be noted. Both experiments involved highly modified genes optimized for expression in monocots, with an overall (G+C) content of 59.2%[70] and 65% [80]. Nevertheless, protein quantification data differed significantly, the amount of toxin produced ranged from 0.05% [70] to 0.009% [80] of the total soluble proteins, even though similar constructs were used (the CaMV 35s promoter was used to drive the expression of the toxin gene in both cases). Surprisingly, higher rates of mortality were observed for both insect species in the experiments where toxin accumulation was not the greatest. This discrepancy could be explained by the experimental design (detached leaf vs. whole plant bioassay), the susceptibility of the particular laboratory insect strains to the CRYIA(b) toxin, or the fact that in the striped stem borer - but not in the leaffolder - assays different larval instars (neonate vs. second instar) were used. Alternatively, the size of the toxin encoded by the two different truncated genes could also play a role in these contradictory results. In order to exert their entomopathogenic effect, CRY toxins must undergo processing in the larval midgut, and it is possible that a longer version (724 amino acids [70]) of the truncated protein is not as efficiently processed as a shorter one (648 amino acids [49], cited in [SO]), thus rendering the toxin less active. The examples given above clearly show that, while maintaining the favorable agronomical properties of the transgenic plants, the transfer and expression of codon-optimized toxin genes can confer to some of the most important crop plants a high level of protection against their major insect pests. These encouraging results have prompted the development of numerous field trials aimed at evaluating the usellness of the technology, and finally to the approval for precommercial release of Bt toxin-expressing potato, cotton and corn varieties. The expression of native toxin genes in chloroplasts

Recently, McBride et al. [37] achieved CRYIA(c) toxin expression levels repre-

332

senting 3-5% of the leaf soluble proteins in tobacco without modifllng the coding sequence. This level of expression of a toxin gene in plants is the highest achieved to date. Bt toxins have been highly expressed in heterologous prokaryotic hosts such as E. coli or Pseudomonas, and it was speculated that the insertion of a native toxin gene into the chloroplast genome would lead to high levels of expression. Indeed, like native toxin genes, the chloroplast genome is rich in (A+T), and the transcriptional and translational machinery is of prokaryotic origin. Furthermore, cells can contain up to 50,000 copies of the chloroplastic genome, enabling the transgene to be similarly amplified. A native crylA(c) gene was placed under the control of plastid expression signals (a strong constitutive ribosomal RNA operon promoter, the Rubisco large subunit ribosome binding site, and the 3’ untranslated region of the rpsl6 ribosomal protein gene), and tobacco plastid DNA homology regions present on the vector allowed targeted insertion of the construct through homologous recombination.This type of homologous insertion has the additional benefit of eliminating plant-to-plant variations in expression levels which are due to chromosomal position effects. The insecticidal activity of the plants was tested against three important insect pests (H. virescens, H zea, and S. exigua) and mortality rates of 100% where obtained when first instar larvae were used. When third instars were tested, the same mortality was obtained with H. virescens and H. zea (although slightly more leaf area was consumed by the latter insect) while close to 90% mortality was recorded for S. exigua. The differences in mortality rates and leaf area consumed reflect the differential sensitivity of the insects to the CRYIA(c) toxin (S. exigua and H. zea are respectively 44 and 10 times less sensitive to the CRYIA(c) toxin than H. virescens). Despite the unprecedented level of toxin accumulation and the advantages of such a system (gene synthesis is not required, and the transgene is exclusively maternally inherited), this technology is not widespread, since chloroplast transformation is far from being routinely achieved, and until now is restricted to tobacco. Efforts to transfer this technique to agronomically important plant species should result in the development of highly resistant varieties. Obtaining a durable protection Emergence of Bt toxin-resistant insect populations

To safeguard the long-term use of Bt toxins as an effective biological pesticide, it is important to evaluate the risks of the emergence of toxin-resistant insect populations. The intensive use of formulations and the widespread deployment of toxinproducing plants could lead to such a phenomenon, and knowledge concerning the development, mechanisms, and genetics involved in insect resistance is essential in order to conceive strategies aimed at avoiding the emergence of such insects. The first report describing the development of resistance to Bt toxins in an

333

insect population is relatively recent [81]. Several laboratory strains of Indianmeal moths Cprodiu interpunctelkz) resistant to a formulation of Bt crystals (Dipel) were obtained by rearing these insects for several generations on artificial diets containing the toxin. Since this first report, high levels of resistance have been obtained for several other insect species through laboratory selection experiments (for a review, see [82]). Natural populations of diamondback moths (PZuteZZu xyZosteZZu) having developed a resistance to the CRY toxins due the intensive use of commercial Bt formulations have been isolated in Hawaii, on the American continent, and in Asia [83-851 (for a review see [82]). It is now well recognized that the emergence of insect populations resistant to Bt toxins is the greatest menace to the development and success of these transgenic plants. It is foreseeable that with the increasing use of such plants the potential for the emergence of resistant insect populations will also increase; care must be taken to define deployment strategies that will minimize this risk. The first studies concerning the mechanisms of resistance tended to show that the resistance is specific to the toxin used for the selection. Thus, strains of l? xyZosteZZu selected for resistance to the CRYIA(b) toxin remained sensitive to the CRYIB and CRYIC toxins [84]. Furthermore,Van Rie et al. [86] showed that, in a strain of l? interpunctella, the resistance to crystals containing the CRYIA and CRYIIA toxins was associated with an increased sensitivity to the CRYIC toxin. These studies have also shown that this type of resistance is due to alterations in the toxin binding sites of the insects’ midgut. Other studies have shown that the mode of resistance can be more complex. Thus, selection of a population of H. virescens for resistance to one type of toxin (CRYIA(c)) can lead to resistance to a broad range of unrelated toxins [87]. These insects had developed resistance not only to the CRYIA(c) and closely related CRYIA(a) and CRYIA(b) toxins, but also to more distant toxins such as CRYIIA, CRYIB and CRYIC. Tabashnik et al. [88] obtained a population of l? xylosteZZu resistant to a large spectrum of toxins (CRYIA(a), CRYIA(b), CRYIA(c) and CRYIIA). Although this population still seemed to be sensitive to the CRYIC toxin, experiments showed that there was a slight (3-fold) but significant cross-resistance to formulations of Bt subsp. aiiuwui, a mix of CRYIA and CRYIC crystals. The mode of resistance has not been characterized, but does not seem to involve changes in the midgut binding sites. At present, it is impossible to generalize and predict the mechanisms by which insects may evolve (single or cross-) resistance to the various toxins. Insects have the capacity to develop different modes of resistance, some of which have yet to be characterized (for a review see [ 11). In the case where it can be attributed to a modification in the binding sites, resistance seems to be inherited as a major recessive or partially recessive gene, and the level of resistance is generally high. In this case, cross-resistance is limited and only involves toxins that share the same binding site as the toxin used for selection. On the contrary, in the case where it is due to other unknown mod-

334

ifications, resistance seems to be inherited in an additive way, the level of resistance is moderate, and in at least one case, a broader cross-resistance has been observed (for a review, see [ 13). Strategies for the long-term deployment of toxin-expressing transgenic plants

The commercialization of transgenic Bt toxin expressing-plants will probably increase the selection pressure on insect populations. Due to the prolonged persistence and the broader coverage afforded by the particular mode of delivery of the toxin, the selection pressure will probably be higher with transgenic plants than with classical sprays. Some of the transgenic crops approved for commercial release, such as cotton and maize, are cultivated as monocultures on large areas, and the risk of the emergence of toxin-resistant insects is not negligible in such conditions. To guarantee the long-term success of these transgenic plants, resistance management practices will have to be implemented. Transgenic plants should be included in an IPM scheme, and appropriate agricultural practices will have to be developed. Different strategies aimed at reducing the selection pressure have been proposed, to delay the emergence of insect populations that are resistant to Bt toxins [89-921. These include, among others, the use of tissue-specific or inducible promoters, rehgia, toxin pyramiding, or the expression of the toxin at high doses. At present, the lack of experience under field conditions makes it difficult to determine which of these strategies will be the most effective in preserving the viability of the protection afforded by transgenic plants. It is probable that the advantage of one tactic over the others will depend largely on the environment in which the plants are released, the nature of the crop plant, the target pest, as well as the nature of the interaction between a particular plant species and its pest. The knowledge of the target pest’s biology is particularly precious; in order to implement the best strategy and obtain the optimal efficacy, it is necessary to know such features as the amplitude of the plant-to-plant movement of the larvae and their feeding habits (the preference for one type of plant tissue over the other, for example), the adults’ capacity to disperse and their mating habits (choice of the partner, oviposition, etc.), and, if possible, the frequency and type of heredity of the resistance allele in a natural population. Due to the novelty of the technology and therefore the lack of experimental data and experience, the strategies put forward are based on computer simulations. Such simulations can hardly take into account all the different parameters, and are necessarily simplified. Much discussion has focused on the subject, which remains controversial. For a discussion on the different tactics proposed, see a recent review by Roush [93]. Among the various deployment strategies that have been proposed to delay insect resistance, some have received more attention than others.

335 High dose strategy The principle of the high dose strategy is that resistance can be avoided or at least delayed if plants express enough toxin to kill insects that are heterozygous for the resistance trait, as well as most of the homozygous resistant insects. The resistance trait would, in this case, be functionally recessive, and the most common carriers of this trait, the heterozygous insects, would not be able to survive on such plants. The development of codon-optimized genes which confer high levels of expression of the toxin in plants and the mode of delivery of the toxin which allows the most sensitive early instars to be exposed represent advantages in view of this strategy Experiments conducted with transgenic broccoli expressing a synthetic cryIA(c) gene demonstrated the feasibility of this approach; selected plants showing 100% mortality with susceptible diamondback moth larvae allowed the survival of a resistant strain of insects which had developed a 300-fold resistance to Javelin (a Bt subsp. kurstaki formulation).When tested on these plants, F1 hybrids between the two strains were not able to survive [94]. Models suggest that transgenic plants expressing Bt toxins to high levels can be superior to sprays in delaying the emergence of resistant insects, since the latter do not always allow the control of heterozygous resistant insects [93]. Nevertheless, this approach will only be valid as long as the resistance trait is functionally recessive and not dominant or additive, and thus afford little fitness advantage to F1 hybrids. Furthermore, plants on which susceptible insects can develop must be available so that a continuous supply of susceptible alleles will maintain the resistance trait in a heterozygous state (see below). The notion of “high dose” is relative and will depend on the susceptibility of a given insect to a toxin. Thus, transgenic plants developed to control one species of insect will not necessarily qualifjl as “high dose” relative to a species showing a lower sensitivity to the toxin that is expressed in that particular plant. Care must be taken to avoid deploying transgenic plants in areas where the predominant pest (or even one species in a complex pest population) is such that the plants do not qualifjl as “high dose expressors” if resistance problems are to be avoided. Use of refugia The development and maintenance of refugia seems to be one of the most appropriate tactics to prevent the emergence of resistant insects, especially if the transgene is expressed at high levels. By allowing a population of unselected toxin-sensitive insects to survive on nontransformed plants and to mate with the few individuals that could have developed resistance, this system has the potential of maintaining the homozygous resistant insect population to a low level by diluting the resistance allele. The particular mode of delivery of the toxin by transgenic plants allows the refugia to be organized differently according to the target insect’s biology. Seed mixes (transgenic and nontransgenic), in-stand blocks of untransformed plants, or separate blocks of untransformed and toxin-expressing plants can be envisaged. The refugia should be close enough to the toxin-expres-

336

sing plants for the sensitive insects to be able to mate with those having developed resistance. Results from simulation models [95] show that under certain conditions, the use of mixed seeds together with separate rehgia can lead to the more rapid build-up of insect resistance than if separate rehgia are used alone. The negative effect of seed mixes could be due to decreased mortality of insects heterozygous for the resistance trait. Nevertheless, results from simulations conducted by Roush [93] with the diamondback moth as a model suggest that seed mixes can be effective as long as less than 20% of larvae move from plant to plant. The same type of computer simulation conducted with the Colorado potato beetle as a model indicates that, due to the feeding-inhibition and lethal effect of transgenic potatoes on adult beetles, mixed plants would be an essential component of a resistance management strategy [93]. Most computer simulations rely on the assumption that mating between resistant and sensitive insects will occur randomly, that oviposition will occur equally on transgenic and nontransgenic plants, and that insects will feed equally on both types of plants. In fact, it is conceivable that this will not be the case. For instance, if larvae feeding on transgenic leaves show retarded growth rather than death, it is possible that random mating will not occur due to the asynchronous emergence of adults. Research has been conducted to determine whether insects would modify their feeding behavior according to the nature (transgenic or not) of the explants. Preference tests were conducted with two different populations of gypsy moths (L. dispar) and forest tent caterpillars (Malacosoma disstria) feeding on poplar leaves expressing and not expressing the CRYIA(a) toxin. With one strain of each insect, a strong aversion for transgenic leaves was noted [42]. Similar two-way choice tests performed with European corn borer (0. nubilalis) larvae on CRYIA(c)-expressing potato leaves showed that third instar larvae avoided transgenic foliage in a 24-h test, but did not show any preference after prolonged exposure [43]. First instar larvae of the same insect were also able to sense whether they were on transgenic or control (corn) leaves, and 90% of them left the Bt-expressing leaves within 36 h of hatching (compared to 50% of those deposited on control leaves) [96]. It was also noted that in the case of H virescens, a Bt-resistant strain was less prone to move away from toxin-expressing tobacco leaves than a sensitive one, and that insects dispersing from transgenic corn had lower survival rates than those dispersing from normal corn [96]. It is not clear what kind of implication these observations could have on the effectiveness of rehgia. More experimental data need to be collected for the proper design of rehgia which are an important component in the management of transgenic plants expressing cry toxins. Use of tissue-specific or induciblepromoters The majority of transgenic plants that have been regenerated to date express the toxin continuously throughout the plant’s life-cycle. One approach to decrease the selection pressure is the use of promoters that are either inducible by various stimuli or activated at critical phases of plant development, specific of a certain

337

organ or tissue. By using such promoters, important stages or tissues would be protected through the targeted expression of the toxin genes, while leaving other less sensitive tissueshtages free of toxin. The main problem in such a case is the isolation of promoters that show the desired specificity while displaying a level of expression high enough to confer protection against later and less sensitive larval instars moving in from nonprotected tissues. Koziel et al. [49] have transformed maize with a construct associating a pollen-specific promoter and a green tissue-specific promoter (the maize PEPC promoter), both driving the expression of the same synthetic cryljl(b) gene. The combination of these two promoters produces a pattern of expression of the toxin that is effective in controlling European corn borer infestations while maintaining kernels and nongreen tissues nearly toxin free. Field evaluations of these plants showed that the protection afforded by this combination of promoters is as effective, if not more so, than that afforded by the CaMV 35s promoter. Chemically or stress-inducible promoters have also been used in various constructs to drive the expression of toxin genes. Williams et al. [47] have used the promoter of the pathogenesis-related PR- 1a gene, which is inducible by various chemical stimuli and by the inoculation with various pathogens, while Vaeck et al. [36] and van Wordragen et al. [45] used the wound-inducible Ti plasmid mannopine synthase promoter. In all cases, insect-resistant plants (or calli) were obtained. The efficacy of these promoters in affording protection under field conditions, and the in planta distribution of the toxin under various conditions were not reported. Nevertheless, the use of such promoters to create insect-resistant plants could potentially be an advantage by saving the plant resources while inducing toxin synthesis whenever and wherever needed. Toxin pyramiding This strategy is based on the assumption that if the development of resistance to a toxin is a rare event, the emergence of insects resistant to two or more toxins will be much rarer and even improbable. In the case of transgenic plants, it has been suggested that the simultaneous expression of several genes coding for different toxins could prevent or delay the emergence of resistant insects. A translational fusion between the genes coding for the CRYIC and CRYIA(b) toxins, which have been shown to have different midgut binding sites, was introduced into tobacco [41]. Some of the regenerated plants showed protection against S. exigua, H. virescens, and M. sexta, thus demonstrating the feasibility of such a strategy This system could prove beneficial as long as the toxins expressed in the plants do not share the same midgut binding sites and the mode of resistance involves modifications in these receptors. Nevertheless, since broad-spectrum resistance, which does not seem to involve mutations in the receptors, has already been observed in some cases (see above), this strategy may not be as effective as first thought. A better system would consist of expressing simultaneously a gene encoding a Bt toxin and one coding for another entomopathogenic protein possessing a different mode of action. Genes encoding proteins displaying entomo-

338 pathogenic activities, such as those coding for protease inhibitors, lectins, or chitinases have been isolated and transgenic plants expressing these proteins showed added protection against insect attack [97,98]. Besides delaying the emergence of resistant insect populations, the expression of a second gene together with one encoding a Bt toxin would have the added advantage of broadening the insect host spectrum and in some cases increasing toxicity Indeed, MacIntosh et al. [99] have observed a synergy between Bt toxins and protease inhibitors in artificial diet assays as well as in transgenic plants expressing a translational fusion between a CRY1 toxin and a protease inhibitor. Gene pyramiding is the most promising avenue for the durable deployment of transgenic plants. Genes that could constitute a second source of resistance have already been characterized, but the search for novel sources is an ongoing effort which has already yielded results; Purcell et al. [loo] have isolated a cholesterol oxidase from Streptomyces cultures which shows entomopathogenic properties against some of the important cotton lepidoperan pests, but also against the American boll weevil (4nthonornus grandis), a destructive coleopteran pest for which no active Bt toxin has yet been isolated. Similarly, proteins produced during the vegetative phase of Bt growth (Vip proteins) have been shown to possess insecticidal activities on a range of insect pests, and the corresponding genes have been cloned [loll. With the ongoing search for novel insecticidal molecules, new sources of resistance will be discovered and find their place in transformation programs aimed at creating insect-resistant plants. The possibility of introducing one or more transgenes into plants to achieve insect resistance does not mean that other more conventional sources of resistance should be overlooked. Host-plant resistance has been exploited widely in breeding programs and represents a valuable tool. Some of the important crop plants for which transformation programs have been undertaken also possess host-plant resistance traits that could be useful, such as DIMBOA in corn or glandular trichomes in potato. In cotton, the association of Bt with several hostplant resistance traits (high gossypol, glabrousness) was studied [1021 and showed to offer increased control when both toxin-resistant and sensitive strains of tobacco budworm larvae were tested. Resistance management strategies, taking into account the biological characteristics of particular insects and crop plants, have been proposed for various insect/transgenic plant couples [103-1051. They are usually based on the implementation of several of the strategies mentioned above, each adapted to the particular biological system encountered. Nevertheless, due to the lack of experience under field conditions and to the differing parameters that have been taken into account to develop them, the models are sometimes prone to debate and can lead to different conclusions [106,107]. At present, the association of a high dose with the implementation of refbgia is the strategy that has received the most attention, and that is currently being recommended for the release of transgenic plants expressing Bt toxins.

339 Conclusions and prospects

The creation of transgenic plants that express Bt toxins will not replace the other existing methods of insect control, such as the use of plant genetic resources or of beneficial insects. On the contrary, this novel plant material should be carefully managed and find its place in a broader IPM scheme which takes into account all the means that are presently available. This, not only to optimize the efficacy of the transgenic plants, but also to assure the durability of the protection afforded. Transgenic cry plants constitute a novel and powerfid tool for a more environment-friendly agriculture that would rely less on chemical inputs. If the deployment of such plants is not managed carefidly, the loss of efficacy of such a tool due to the emergence of toxin-resistant insect populations could be rapid and have severe consequences. One of the characteristics of transgenic plants expressing a Bt toxin is the monogenic nature of the dominant trait, which can be assimilated to a vertical resistance. Such resistance has the advantage of being easily integrated in a breeding program, but also has the disadvantage of potentially lacking durability Another characteristic is the relative specificity of the protection afforded by the transgene. Although this specificity is an advantage in that it allows the development of a beneficial entomofauna that broad-spectrum chemical insecticides tend to suppress, it can represent a problem for crops that are subject to attacks by a complex population of pests. The danger in this situation is that of a secondary pest becoming predominant and difficult to control. Future research should focus on broadening the protection obtained with transgenic plants, and searches for novel sources of insect resistance should be undertaken. The combination of multiple transgenes in the same plant is a very promising strategy, and the plants that are presently offered on the market should represent only the first generation. Future generations of transgenic plants will possibly express two or more different transgenes. Studies aimed at evaluating the synergistic or antagonistic effects of multiple toxins are of prime interest in this regard. The control of insect pests is one of the most costly aspects of plant production, estimated at approximately US $3-5 billion annually It seems that our society is becoming more and more aware of the fragility of the environment and of the irreparable damages that have been made. It is foreseeable that the use of biopesticides will increase in the coming years under consumer pressure, if not under legislative pressure. Certain companies have anticipated this trend and invested heavily in the development of insect-resistant plants. In March 1995, there were no less than 440 patents related to Bt either granted or pending, reflecting the battle that is being fought for the control of Bt technology The public sector, with only 12Y0 of the patents issued, is nearly absent from the scene (source: World Patent Index). In May 1995, potato plants expressing a crylllA gene developed by Monsanto (NewLeafTMpotatoes) were the first insect-resistant transgenic plants to receive the official authorization for commercial release in the USA. By the end

340 of 1995, beginning of 1996, the same company received the authorization to launch transgenic cotton, known as BollgardTMcotton. During the same period, Ciba Seeds and Mycogen Plant Sciences were granted the go-ahead for the commercialization of hybrid corn expressing a cryL4 (b) gene (MaximizerTMhybrid corn). Recently, Mycogen received approval to sell their own hybrid corn combining both Bt and natural resistance genes in the same plant under the name of NatureGardTM(source: ISB News Report, December 1995). During the first campaign of Bollgardm cotton, close to 2 million acres (representing close to 13% of the US cotton crop) were planted throughout the USA cotton belt. Although the plants were supposed to deliver high doses of toxin, cotton growers were obliged to spray chemical pesticides to control an outbreak of bollworms in at least five states. This relative “failure” - nontransgenic cotton can require up to six chemical treatments - of the transgenic plants was attributed to an unusually high bollworm pressure (reaching in some areas 20 to 50 times the threshold for chemical insecticide application) due to unusually hot weather conditions in some areas and to the fact that many farmers in the southern states planted corn, a plant on which the bollworm develops well, in the vicinity of the cotton fields. Although the emergence of resistant insect populations seems not to be the cause of this particular outbreak, the question is whether these types of problems will not increase the likelihood of insects developing resistance to toxins. This first experience shows that we have a lot to learn from the large-scale release of transgenic insect-resistant material. If the resistance management strategies that are currently being implemented do not prove effective, they should be modified for future releases. Knowing that within the coming years surfaces planted with BollgardTMcotton will double, and that transgenic corn and potatoes will also reach the field, one can wonder what will happen in the exposed insect populations. The monitoring of the insect population present in transgenic crops will be more difficult and costly than previously thought, and the personnel involved (farmers, extension workers, etc.) in the cultivation of these new plants will have to be given special education. At present, it seems more prudent not to increase the areas under cultivation with Bt crops too much, and maintain the state of “precommercial” release for a few more years until enough data can be collected to design proper resistance management strategies tailored to this new type of material. Only then will enlightened decisions be made, and the full potential of toxin-expressing plants be achieved. Acknowledgements

We would like to thank Drs K. Raffa, M. Sticklen, and E. Earle for communicating results prior to publication. We are grateful to Dr M. Tepfer for critical reading of the manuscript.

34 1 References 1. Ferri J, Escriche B, Be1 XVan Rie J. Biochemistry and genetics of insect resistance to Bacillus thuringiensis insecticidal crystal proteins. FEMS Microbiol Lett 1995;132:1-7. 2. Lambert B, Peferoen M. Insecticidal promise of Bacillus thuringiensis. Facts and mysteries about a successful biopesticide. BioScience 1992;42:112- 122. 3. Schnepf HE, Whiteley HR. Cloning and expression of the Bacillus thuringiensis crystal protein gene in Escherichia coli. Proc Natl Acad Sci USA 1981;78:2893-2897. 4. Hofte H, Whiteley HR. Insecticidal crystal proteins of Bacillus thuringiensis. Microbiol Rev 1989;53:242-255. 5. Crickmore N, Zeigler DR, Feitelson J, Schnepf E, Lambert B, Lereclus D, Gawron-Burke C, Dean DH. Revision of the nomenclature for Bacillus thuringiensis cry genes. Program and Abstracts of the 28th Annual Meeting of the Society for Invertebrate Pathology, 1995;14. 6. Aronson AI, Beckman W, Dunn P. Bacillus thuringiensis and related insect pathogens. Microbiol Rev 1986;50:1-24. 7. Hofte H, De Greve H, Seurinck J, Jansens S, Mahillon J, Ampe C,Vandekerckhove J, Vanderbruggen H,Van Montagu M, Zabeau M,Vaeck M. Structural and functional analysis of a cloned delta-endotoxin of Bacillus thuringiensis berliner 1715. Eur J Biochem 1986;161:273-280. 8. Adang MJ, Staver MJ, RocheleauTA, Leighton J, Barker RF,Thompson DV. Characterized fulllength and truncated plasmid clones of the crystal protein of Bacillus thuringiensis subsp. kurstaki HD-73 and their toxicity to Manduca sexta. Gene 1985;36:289-300. 9. Schnepf HE, Whiteley HR. Delineation of a toxin-encoding segment of a Bacillus thuringiensis crystal protein gene. J Biol Chem 1985;260:6273-6280. 10. Sanchis Lereclus D, Menou G, Chaufaux J, Guo S, Lecadet M-M. Nucleotide sequence and analysis of the N-terminal coding region of the Spodoptera-active&endotoxin gene of Bacillus thuringiensis aizawai 7.29. Molec Microbiol 1989;3:229-238. 11. Raymond KC, John TR, Bulla JLA. Larvicidal activity of chimeric Bacillus thuringiensis protoxins. Molec Microbiol 1990;4:1967-1973. 12. Hodgman TC, Ellar DJ. Models for the structure and function of the Bacillus thuringiensis 6endotoxins determined by compilational analysis. J DNA Sequence 1990;1:97- 106. 13. Ravoahangimalala 0, Charles J-F, Schoeller-RaccaudJ. Immunological localization of Bacillus thuringiensis serovar israelensis toxins in midgut cells of intoxicated Anopheles gambiae larvae (Diptera: Culicidae). Res Microbiol 1993;144:271-278. 14. Denolf P, Jansens S,Peferoen M, Degheele D,Van Rie J. Two different Bacillus thuringiensis delta-endotoxin receptors in the midgut brush border membrane of the european corn borer, Ostriniu nubilalis (Hiibner) (Lepidoptera: Pyralidae). Appl Environ Microbiol 1993;59:1828- 1837. 15. Hofmann C, Vanderbruggen H, Hofte H, Van Rie J, Jansens S,Van Mellaert H. Specificity of Bacillus thuringiensis &endotoxins is correlated with the presence of high-affinity binding sites in the brush border membrane of target insect midguts. Proc Natl Acad Sci USA 1988;85: 7844-7848. 16. Hofmann C, Luthy P, Hutter R, PliskaV. Binding of the delta-endotoxin from Bacillus thuringiensis to brush-border membrane vesicles of the cabbage butterfly (Pieris brassicae). Eur J Biochem 1988;173:85-91. 17. Oddou P, Hartmann H, Geiser M. Identification and characterisation of Heliothis virescens midgut membrane proteins binding Bacillus thuringiensis delta-endotoxins. Eur J Biochem 1991; 202:673-680. 18. Indrasith LS,Hori H. Isolation and partial characterization of binding proteins for immobilized delta-endotoxin from solubilized brush border membrane vesicles of the silkworm, Bombix mori, and the common cutworm, Spodoptera litura. Comp Biochem Physiol 1992;102B: 605-610. 19. Vadlamudi RK, Ji TH, Bulla LAJ. A specific binding protein from Manduca sexta for the insecticidal toxin of Bacillus thuringiensis. J Biol Chem 1993;268:12334-12340.

342 20. Knight PJK, Crickmore N, Ellar DJ. The receptor for Bacillus thuringiensis CryIA(c) deltaendotoxin in the brush border membrane of the lepidopteran Manduca sexta is an aminopeptidase N. Molec Microbiol 1994;11:429-436. 2 1. Lee MK, You TH, Young BA, Cotrill JA, Valaitis AP, Dean DH. Aminopeptidase N purified from gypsy moth brush border membrane vesicles is a specific receptor for Bacillus thuringiensis CryIA(c) toxin. Appl Environ Microbiol 1996;62:2845-2849. 22. Knowles BH, Dow JAT The crystal &endotoxins of Bacillus thuringiensis: models for their mechanism of action on the insect gut. Bioessays 1993;15:469-476. 23. Gill SS,Cowles EA, Pietrantonio PV. The mode of action of Bacillus thuringiensis endotoxins. Ann Rev Entomol 1992;37:615-636. 24. Pusztai M, Fast P, Gringorten L, Kaplan H, Lessard T, Carey PR. The mechanism of sunlightmediated inactivation of Bacillus thuringiensis crystals. Biochem J 1991;273:43-47. 25. Gaertner GH, Quick TC, Thompson MA. CellCap: an encapsulation system for insecticidal biotoxin proteins. In: Kim L (ed) Advanced Engineered Pesticides. New York: Marcel Dekker Inc., 1993;73-83. 26. Obukowicz MG, Perlak FJ, Bolten SL, Kusano-Kretzmer K, Mayer EJ, Watrud LS. ISSOL as a non-self-transposable vector used to integrate the Bacillus thuringiensis delta-endotoxin gene into the chromosome of root-colonizing pseudomonas. Gene 1987;51:91-96. 27. Lampel JS, Canter GL, Dimock MB, Kelly JL, Anderson JJ, Uratani BB, Foulke JSJ,Turner JT Integrative cloning, expression, and stability of the cryIA (c) gene from Bacillus thuringiensis subsp. kurstaki in a recombinant strain of Clavibacter xyli subsp. cynodontis. Appl Environ Microbiol 1994;60:501-508. 28. Lereclus D,Vallade M, Chaufaux J, Arantes 0, Rambaud S.Expansion of insecticidal host range of Bacillus thuringiensis by in vivo genetic recombination. Bio/Technology 1992;10:418-421. 29. Bosch D, Schipper B, van der Kleij H, de Maagd RA, StiekemaWJ. Recombinant Bacillus thuringiensis crystal proteins with new properties: possibilities for resistance management. Biol Technology 1994;12:915-918. 30. Stock CA, McLoughlin TJ, Klein JA, Adang MJ. Expression of a Bacillus thuringiensis crystal protein gene in Pseudomonas cepacia 526. Can J Microbiol 1990;36:879-884. 31. Turner JT, Lampel JS, Stearman RS, Sundin GW, Gunyuzlu P, Anderson JJ. Stability of the 6endotoxin gene from Bacillus thuringiensis subsp. kurstaki in a recombinant strain of Clavibacter xyli subsp. cynodontis. Appl Environ Microbiol 1991;57:3522-3528. 32. Soltes-Rak E, Kushner DJ,Williams DD, Coleman JR. Effect of promoter modification on mosquitocidal cryIVB gene expression in Synechococcus sp. strain PCC 7942. Appl Environ Microbiol 1993;59:2404-2410. 33. Bora RS, Murty MG, Shenbagarathai R, Sekar V. Introduction of lepidopteran-specificinsecticidal crystal protein gene of Bacillus thuringiensis subsp. kurstaki by conjugal transfer into a Bacillus megaterium strain that persists in the cotton phyllosphere. Appl Environ Microbiol 1994;60:214-222. 34. Barton KA, Whiteley HR, Yang N-S. Bacillus thuringiensis delta-endotoxin expressed in transgenic Nicotiana tabacum provides resistance to lepidopteran insects. Plant Physiol 1987;85: 1103- 1109. 35. Fischhoff DA, Bowdish KS, Perlak FJ, Marrone PG, McCormick SM, Niedermeyer JG, Dean DA, Kusano-Kretzmer K, Mayer EJ, Rochester DE, Rogers SG, Fraley RT. Insect tolerant transgenic tomato plants. Bio/Technology 1987;5:807-8 13. 36. Vaeck M, Reynaerts A, Hofie H, Jansens S,De Beuckeleer M, Dean C, Zabeau M,Van Montagu M, Leemans J. Transgenic plants protected from insect attack. Nature 1987;327:33-37. 37. McBride KE, Svab Z, Schaaf DJ, Hogan PS,Stalker DM, Maliga P.Amplification of a chimeric Bacillus gene in chloroplastsleads to an extraordinary level of an insecticidal protein in tobacco. Bio/Technology 1995;13:362-365. 38. Gallie DR, Sleat DE,Watts JW,Turner PC,Wilson TR. The 5’-leader of the tobacco mosaic virus RNA enhances the expression of foreign gene transcripts in vitro and in vivo. Nucl Acid Res

343 1987;15:3257-3273. 39. Jobling SA, Gehrke L. Enhanced translation of chimaeric messenger RNAs containing a plant viral untranslated leader sequence. Nature 1987;325:622-625. 40. Cheng J, Bolyard MG, Saxena RC, Sticklen MB. Production of insect resistant potato by genetic transformation with a delta-endotoxin gene from Bacillus thuringiensis var. kurstaki. Plant Sci 1992;81:83-91. 41. van der Salm T, Bosch D, Hon6e G, Feng L, Munsterman E, Bakker P, Stiekema WJ,Visser B. Insect resistance of transgenic plants that express modified Bacillus thuringiensis cryIA (b) and c r y K genes: a resistance management strategy Plant Mol Biol 1994;26:51-59. 42. Robison DJ, McCown BH, Raffa KE Responses of gypsy moth (Lepidoptera: Lymantriidae) and forest tent caterpillar (Lepidoptera: Lasiocampidae) to transgenic poplar, Populus spp., containing a Bacillus thuringiensis &endotoxin gene. Environ Entomol 1994;23:1030-1041. 43. Ebora RV, Ebora MM, Sticklen MB. Transgenic potato expressing the Bacillus thuringiensis cryIA(c) gene effects on the survival and food consumption of Phthorimea operculella (Lepidoptera: Gelechiidae) and Ostrinia nubilalis (Lepidoptera: Noctuidae). J Econ Entomol 1994;87: 1122- 1127. 44. Ellis DD, McCabe DE, McInnis S, Ramachandran R, Russell DR, Wallace KM, Martinelli BJ, Roberts DR, Raffa KF, McCown BH. Stable transformation of Picea glauca by particle acceleration. Bio/Technology 1993;11:84-89. 45. van Wordragen MF, Honee G, Dons HJM. Insect-resistant chrysanthemum calluses by introduction of a Bacillus thuringiensis crystal protein gene. Transgenic Res 1993;2:170- 180. 46. Dandekar AM, McGranahan GH,Vail PV, Uratsu SL, Leslie C,TebbetsJS. Low levels of expression of wild type Bacillus thuringiensis var. kurstaki cryIA (c) sequences in transgenic walnut somatic embryos. Plant Sci 1994;96:151-162. 47. Williams S,Friedrich L, Dincher S,Carozzi N, Kessmann H,Ward E, Ryals J. Chemical regulation of Bacillus thuringiensis delta-endotoxin expression in transgenic plants. Bio/Technology 1992;10:540-543. 48. Delannay X,LaVallee BJ, Proksch RK, Fuchs RL, Sims SR, Greenplate JT,Marrone PG, Dodson RB, Augustine JJ, Layton LG,Fischhoff DA. Field performance of transgenic tomato plants expressing the Bacillus thuringiensis var. kurstaki insect control protein. BiolTechnology 1989; 7: 1265- 1269. 49. Koziel MG et al. Field performance of elite transgenic maize plants expressing an insecticidal protein derived from Bacillus thuringiensis. Bio/Technology 1993;11:194-200. 50. Perlak FJ, StoneTB, Muskopf YM, Petersen LJ, Parker GB, McPherson SA,Wyman J, Love S, Reed G, Biever D, Fischhoff DA. Genetically improved potatoes: protection from damage by Colorado potato beetles. Plant Mol Biol 1993;22:3 13-321. 51. Wilson FD, Flint HM, Deaton WR, Buehler RE. Yield, yield components, and fiber properties of insect-resistant cotton lines containing a Bacillus thuringiensis toxin gene. Crop Sci 1994; 34~38-41. 52. Benedict JH, Sachs ES, Altman DW, Deaton WR, Kohel RJ, Ring DR, Berberich SA. Field performance of cottons expressingtransgenic CryIA insecticidal proteins for resistance to Heliothis virescens and Helicoverpa zea (Lepidoptera: Noctuidae). J Econ Entomol 1996;89:230-238. 53. Perlak FJ, Deaton RW, Armstrong TA, Fuchs RL, Sims SR, Greenplate JT, Fischhoff DA. Insect-resistantcotton plants. Bio/Technology 1990;8:939-943. 54. Carozzi NB, Warren GW, Desai N, Jayne SM, Lotstein R, Rice DA, Evola S, Koziel MG. Expression of a chimeric CaMV 35s Bacillus thuringiensis insecticidal protein gene in transgenic tobacco. Plant Mol Biol 1992;20:539-548. 55. Murray EE, Rocheleau T, Eberle M, Stock C, Sekar V, Adang M. Analysis of unstable RNA transcripts of insecticidal crystal protein genes of Bacillus thuringiensis in transgenic plants and electroporated protoplasts. Plant Mol Biol 1991;16:1035-1050. 56. Perlak FJ, Fuchs RL, Dean DA, McPherson SL, Fischhoff DA. Modification of the coding sequence enhances plant expression of insect control protein genes. Proc Natl Acad Sci USA

344 1991;88:3324-3328. 57. Cornelissen M. Modified Bacillus thuringiensis insecticidal crystal protein genes and their expression in plant cells. International Application Published under the Patent Cooperation TreatyWO 91/16432 1991. 58. Cornelissen M. Modified genes and their expression in plant cells. International application published under the Patent Cooperation Treaty.WO 93/09218 1993. 59. Goodall GJ, Filipowicz W The AU-rich sequences present in the introns of plant nuclear premRNAs are required for splicing. Cell 1989;58:473-483. 60. Shaw G, Kamen R. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 1986;46:659-667. 61. Laird-Offringa IA. What determines the instability of c-myc proto-oncogene mRNA? Bioessays 1992;14:119- 124. 62. Dean C,Tamaki S, Dunsmuir P, Favreau M, Katayama C, Dooner H, Bedbrook J. mRNA transcripts of several plant genes are polyadenylated at multiple sites in vivo. Nucl Acid Res 1986; 14:2229-2240. 63. McCown BH, McCabe DE, Russel DR, Robison DJ, Barton KA, Raffa KE Stable transformation of populus and incorporation of pest resistance by electric discharge particle acceleration. Plant Cell Rep 1991;9:590-594. 64. Kurland CG. Codon bias and gene expression. FEBS Lett 1991;285:165- 169. 65. Gallie DR. Posttranscriptional regulation of gene expression in plants. Ann Rev Plant Physiol Plant Mol Biol 1993;44:77-105. 66. Mogen BD, MacDonald MH, Graybosch R, Hunt AG. Upstream sequences other than AAUAAA are required for efficient messenger RNA 3'-end formation in plants. Plant Cell 1990;2:1261-1272. 67. Yenofsky RL, Fine M, Ragan TS. Multiple stable antisense Bacillus thuringiensis transcripts are produced by intergenic splicing in an orientation dependant processing of Bt gene sequences. J Cell Biochem 1994;(Suppl18A):112. 68. van Aarssen R, Soetaert P, Stam M, Dockx J, Gosselh V, Seurinck J, Reynaerts A, Cornelissen M. cryZA(b) transcript formation in tobacco is inefficient. Plant Mol Biol 1995;28:513-524. 69. Savant-Bhonsale S, Cleveland DW Evidence for instability of mRNAs containing AUUUA motifs mediated through translation-dependent assembly of a )20S degradation complex. Genes Devel 1992;6:1927-1939. 70. Fujimoto H, Itoh K,Yamamoto M, Kyozuka J, Shimamoto K. Insect-resistantrice generated by introduction of a modified &endotoxin gene of Bacillus thuringiensis. Bio/Technology 1993; 11:1151- 1155. 7 1. Adang MJ, Brody MS, Cardineau G, Eagan N, Roush RT, Shewmaker CK, Jones A, Oakes JV, McBride KE. The reconstruction and expression of a Bacillus thuringiensis cryZZZA gene in protoplasts and potato plants. Plant Mol Biol 1993;21:1131-1145. 72. Sutton DW, Havstad PK, Kemp JD. Synthetic cryZZZA gene from Bacillus thuringiensis improved for high expression in plants. Transgenic Res 1992;1:228-236. 73. Foguet M, Liibbert H. Precise and efficient construction of synthetic genes. BioTechniques 1992;13:674-675. 74. Sardana R, Dukiandjiev S, Giband M, Cheng X, Cowan K, Sauder C, Altosaar I. Construction and rapid testing of synthetic and modified toxin gene sequences CryIA (b&c) by expression in maize endosperm culture. Plant Cell Rep 1996;15:677-681. 75. Sandhu GS, Aleff RA, Kline BC. Dual asymmetric PCR: one-step construction of synthetic genes. BioTechniques 1992;12:14- 16. 76. Prodromou C, Pearl LH. Recursive PCR: a novel technique for total gene synthesis. Protein Eng 1992;5:827-829. 77. Wong EY, Hironaka CM, Fischhoff A. Arabidopsis thaliana small subunit leader and transit peptide enhance the expression of Bacillus thuringiensis proteins in transgenic plants. Plant Mol Biol 1992;20:81-93.

345 78. Jenkins JN, Parrott WL, McCarty JC, Callahan FE, Berberich SA, Deaton WR. Growth and survival of Heliothis virescens (Lepidoptera: Noctuidae) on transgenic cotton containing a truncated form of the delta-endotoxin gene from Bacillus thuringiensis. J Econ Entomol 1993;86: 181-185. 79. Halcomb JL, Benedict JH, Cook B, Ring DR. Survival and growth of bollworm and tobacco budworm on nontransgenic and transgenic cotton expressing a CryIA insecticidal protein (Lepidoptera: Noctuidae). Environ Entomol 1996;25:250-255. 80. Wunn J, Kloti A, Burkhardt PK, Biswas GCG, Launis K, Iglesias VA, Potrykus I. Transgenic indica rice breeding line IR58 expressing a synthetic cryZA (b) gene from Bacillus thuringiensis provides effective insect pest control. Bio/Technology 1996;14:171- 176. 8 1. McGaughey WH. Insect resistance to the biological insecticide Bacillus thuringiensis. Science 1985;229:193-195. 82. Tabashnik BE. Evolution of resistance to Bacillus thuringiensis. Ann Rev Entomol 1994;39: 47-79. 83. Tabashnik BE, Cushing NL, Finson N, Johnson MW Field development of resistance to Bacillus thuringiensis in diamondback moth (Lepidoptera: Plutellidae). J Econ Entomol 1990;83: 1671-1676. 84. Ferre J, Real MD, Van Rie J, Jansens S, Peferoen M. Resistance to the Bacillus thuringiensis bioinsecticide in a field population of Plutella xylostelIa is due to a change in a midgut membrane receptor. Proc Natl Acad Sci USA 1991;88:5119-5123. 85. Tanaka H, KimuraY Resistance to Bt formulation in diamondback moth Plutella xylostella L. on watercress. Jpn J Appl Entomol Zoo1 1991;35:253-255. 86. Van Rie J, McGaughey WC, Johnson DE, Barnett BD,Van Mellaert H. Mechanism of insect resistance to the microbial insecticide Bacillus thuringiensis. Science 1990;247:12-74. 87. Gould F, Martinez-Ramirez A, Anderson A, Ferrb J, Silva FJ, Moar WJ. Broad-spectrum resistance to Bacillus thuringiensis toxins in Heliothis virescens. Proc Natl Acad Sci USA 1992; 89:7986-7990. 88. Tabashnik BE, Finson N, Johnson MW, Moar WJ. Resistance to toxins from Bacillus thuringiensis subsp. kurstaki causes minimal cross-resistance to B. thuringiensis subsp. aizawai in the diamondback moth (Lepidoptera: Plutellidae). Appl Environ Microbiol 1993;59:1332- 1335. 89. Van Rie J. Insect control with transgenic plants: resistance proof? Tibtech 1991;9:177-179. 90. McGaughey WH, Whalon ME. Managing insect resistance to Bacillus thuringiensis toxins. Science 1992;258:1451-1455. 91. Fischhoff DA. Management of lepidopteran pests with insect resistant cotton: recommended approaches. Beltwide: Cotton Insect Research and Control Conference 1992;751-753. 92. Tabashnik BE. Delaying insect adaptation to transgenic plants: seed mixtures and refugia reconsidered. Proc R SOCLond 1994;255B:7--12. 93. Roush RT. Can we slow adaptation by pests to insect transgenic crops? In: Persley GJ (ed) Biotechnology and Integrated Pest Management. Wallingford: CAB International, 1996;242-263. 94. Metz TD, Roush RT Tang JD, Shelton AM, Earle ED. Transgenic broccoli expressing a Bacillus thuringiensis insecticidalcrystal protein: implicationsfor pest resistance management strategies. Molec Breeding 1995;1:309-317. 95. Mallet J, Porter P. Preventing insect adaptation to insect-resistant crops: are seed mixtures or rehgia the best strategy? Proc R SOCLond 1992;B250:165-169. 96. Gould E Potential and problems with high-dose strategies for pesticidal engineered crops. Biocontrol Sci Techno1 1994;4:451-461. 97. Gatehouse AMR, Boulter D, Hilder VA. Potential of plant-derived genes in the genetic manipulation of crops for insect resistance. In: Gatehouse AMR, Hilder VA, Boulter D (eds) Biotechnology in Agriculture No 7: Plant Genetic Manipulation for Crop Protection. Wallingford: CAB International, 1992155-181. 98. Boulter D. Insect pest control by copying nature using genetically engineered crops. Phytochemistry 1993;34:1453- 1466.

346 99. MacIntosh SC, Kishore GM, Perlak FJ, Marrone PG, Stone TB, Sims SR, Fuchs RL. Potentiation of Bacillus thuringiensis insecticidal activity by serine protease inhibitors. J Agric Food Chem 1990;38:1145-1152. 100. Purcell JP, Greenplate JT, Jennings MG, Ryerse JS, Pershing JC, Sims SR, Prinsen MJ, Corbin DR, Tran M, Sammons RD, Stonard RJ. Cholesterol oxydase: a potent insecticidal protein active against boll weevil larvae. Biochem Biophys Res Commun 1993;196:1406-1413. 101. Estruch JJ, Warren GW, Mullins MA, Nye GJ, Craig JA, Koziel MG. Vip3A, a novel Bacillus thuringiensis vegetative insecticidal protein with a wide spectrum of activities against lepidopteran insects. Proc Natl Acad Sci USA 1996;93:5389-5394. 102. Altman DW, Benedict JH, Sachs ES. Transgenic plants for the development of durable insect resistance: case study for cotton and Bacillus thuringiensis genes. Ann NY Acad Sci 1996;792: 106-1 14. 103. Hokkanen HMT,Wearing CH. Assessing the risk of pest resistance evolution to Bacillus thuringiensis engineered into crop plants: a case study of oilseed rape. Field Crop Res 1995;45: 171-179. 104. Bottrell DG, Aguda RM, Gould FL, Theunis W, Demayo CG, Magalit VE Potential strategies for prolonging the usefulness of Bacillus thuringiensis in engineered rice. Korean J Appl Entomol 1992;31:247-255. 105. Fischhoff DA. Insect-resistant crop plants. In: Persley GJ (ed) Biotechnology and Integrated Pest Management.Wallingford: CAB International, 1996214-227. 106. Ives AR. Evolution of insect resistance to Bacillus thuringiensis-transformed plants. Science 1996;273:1412- 1413. 107. Alstad DN, Andow DA. Evolution of insect resistance to Bacillus thuringiensis-transformed plants. Science 1996;273:1413. 108. Adang MJ, Firoozabady E, Klein J, De Boer D, Sekar V, Kemp JD, Murray E, Rocheleau TA, Rashka K, StaEeld G, Stock C, Sutton D, Merlo DJ. Expression of a Bacillus thuringiensis insecticidal crystal protein gene in tobacco plants. In: Liss AR (ed) Molecular Strategies for Crop Protection. Proceeding of a DuPony-UCLA Symposium on Molecular Strategies for Crop Protection. Steamboat Springs, CO: Liss AR, 1987;345-353. 109. Wang G, Castiglione S, Chen Y, Li L, Han Y, Tian Y, Gabriel DW, Han Y, Mang K, Salla E Poplar (Populus nigra L.) plants transformed with a Bacillus thuringiensis toxin gene: insecticidal activity and genomic analysis. Transgenic Res 1996;5:289-301. 110. Serres R, Stang E, McCabe D, Russell D, Mahr D, McCown B. Gene transfer using electric discharge particle bombardment and recovery of transformed cranberry plants. J Am SOCHort Sci 1992;117:174- 180. 111. Sullivan J, Lagrimini LM. Transformation of Liquidambur styracij7a using Agrobacterium fumefaciens. Plant Cell Rep 1993;12:303-306. 112. Hong Y, Jiaxin L, Sandui G, Xuenjun C, Yunliu E Transgenic rice plants produces by direct uptake of &endotoxin gene from Bacillus thuringiensis into rice protoplasts. Sciencia Agricultura Sinica 1989;22:1-5. 113. Armstrong CL, Parker GB, Pershing JC, Brown SM, Sanders PR, Duncan DR, Stone T, Dean DA, DeBoer DL, Hart J, Howe AR, Morrish FM, Pajeau ME, Petersen WL, Reich BJ, Rodriguez R, Santino CG, Sat0 SJ, Schuler W, Sims SR, Stehling S, Tarochione LJ, Fromm ME. Field evaluation of European corn borer control in progeny of 173 transgenic corn events expressing an insecticidal protein from Bacillus thuringiensis. Crop Sci 1995;35:550-557. 114. Wilson FD, Flint HM, Deaton WR, Fischoff DA, Perlak FJ, Armstrong DA, Fuchs RL, Berberich SA, Parks NJ, Stapp BR. Resistance of cotton lines containing a Bacillus thuringiensis toxin to pink bollworm (Lepidoptera: Gelechiidae) and other insects. J Econ Entomol 1992;85: 1516- 1521. 115. Sims SR, Berberich SA. Bacillus thuringiensis CryIA protein levels in raw and processed seeds of transgenic cotton: determination using insect bioassay and ELISA. J Econ Entomol 1996; 89:247-251.

347 116. Bai YY; Mao HZ, Cao XL, Tang T, Wu D, Chen DD, Li WG, Fu WJ. Transgenic cabbage plants with insect tolerance. Biotechnology in agriculture: Proceedings of the first Asia-Pacific conference on agricultural biotechnology 1993;15:156- 159. 117. Li XB, Ma0 HZ, Bai YY Transgenic plants of rutabaga (Brassica napobrassica) tolerant to insect pests. Plant Cell Rep 1995;15:97-101. 118. Stewart CN Jr, Adang MJ, All JN, Raymer PL, Ramachandran S, Parrot WA. Insect control and dosage effect in transgenic canola containing a synthetic Bacillus thuringiensis cryIA (c) gene. Plant Physiol1996;112115-120. 119. Parrot WA, All JN, Adang MJ, Bailey MA, Boerma HR, Stewart CN Jr. Recovery and evaluation of soybean plants transgenic for a Bacillus thuringiensis var. kurstaki insecticidal gene. In Vitro Cell Devel Biol 1994;30P:144-149. 120. Stewart CN Jr, Adang MJ, All JN,Boerma HR, Cardineau G, Tucker D, Parrot WA. Genetic transformation, recovery, and characterization of fertile soybean transgenic for a synthetic Bacillus thuringiensis cryIA(c) gene. Plant Physiol 1996;112:121-129. 121. Hoy CW, Head G. Correlation between behavioral and physiological responses to transgenic potatoes containing Bacillus thuringiensis &endotoxin in Leptinotarsa decemlineata (Coleoptera: Chrysomelidae). J Econ Entomol 1995;88:480-486. 122. Donegan KK,Schaller DL, Stone JK,Ganio LM, Reed G, Hamm PB, Seidler RJ. Microbial population, fungal species diversity and plant pathogen levels in field plots of potato plants expressing the Bacillus thuringiensis var. tenebrionis endotoxin. Transgenic Res 1996;5:25-35. 123. Chen Q, Jelenkovic G, Chin CK, Billings S, Eberhart J, Goffreda JC. Transfer and transcriptional expression of coleopteran cryZZZB endotoxin gene of Bacillus thuringiensis in eggplant. J Am SOCHort Sci 1995;120:921-927.

This Page Intentionally Left Blank

349

Index of authors Bally, M.B. 59 Datla, R. 269 Einvik, C. 111 Elde, M. 111 Giband, M. 313 Haugen, I? 111 Haugli, E 111 Jain, R.K. 245 Johansen, S. 111 Jouanin, L. 313 Kajuk, B. 227 Kreipe, H. 169 Maggi,T 297 Manganelli, R. 297 Martins dos Santos,V.A.P. 227 Mazier, M. 313 Medaglini, D. 297 Miiller-Deubert, S. 169 Munder,T 31

Oggioni, M.R. 297 Ohashi,Y. 197 Pannetier, C. 3 13 Pozzi, G. 297 Reimer, D.L. 59 Ricci, S. 297 Romano-Spica,V 1 Rush, C.M. 297 Sano, H. 197 Selvaraj, G. 245, 269 Seo, S. 197 Singh, S.M. 59 Tourneur, J. 313 Tramper, J. 227 Vader, A. 111 Vakharia, VN. 15 1 Vasilevska, T 227 Vijg, J. 1 Wijffels, R.H. 227 William Anderson, J. 269

This Page Intentionally Left Blank

351

Keyword index AAT 59 abiotic stress 245 Ace1 31 active and passive protection 151 adaptation 245 adeno-associated 59 adenoviral 59 agriculture 245 Agrobacterium 269 AIDS 59 antibiotics 111 antisense 59 Bacillus thuringiensis 3 13 baculovirus expression 151 birnavirus 151

cancer 59 Cdc25 31 cell-specific 269 CF 59 clonal aberrations 169 clonality 169 coating 227 codon-optimized genes 313 (co)immobilization 227 combinatorial libraries 3 1 constitutive 269 crop improvement 245 cry genes 313 CRY toxins 313 cytokinin 197 denaturing gradient gel electrophoresis (DGGE) 1 developmental stage-specific 269 DNA fingerprinting 1 polymorphism 1 double-layer beads 227 double-needle 227 drought 245 drug screening 3 1

encapsulation 227 A-endotoxins 3 13 enhancers 269 entornopathogenic 313 FA 59 FH 59 Gal4 31 P-galactosidase 3 1 gene inactivation 111 mutation 1 regulation 269 repair 111 scanning 1 therapy 59, 111 transfer 59 genetic engineering 245, 269 epidemiology 1 typing 1 variation 1 genetics 1 genome engineering 111 mapping 111 scanning 1 genotoxicity 1 -glucuronidase 269 glycosylation 3 1 Gram-positive bacteria 297 green fluorescent protein 31 group I intron 111 ribozyme 111 Gumboro disease 151 herpesvirus 59 heteroduplex analysis 1 homing endonucleases 111 homologous recombination 111 hospital infection 1

352 human 59 hypersensitive response (HR) 197 immunoprecipitation 3 1 in vitro evolution 111 selection 111 infectious bursa1 disease virus (IBDV) 151 insect resistance 313 interaction matrix 31 trap 31 intron 1 1 1 irrigation 245 jasmonic acid (JA) 197 linkage 1 u linolenic acid (LA) 197 lipid-based carriers 59 live virus-vectored vaccine 151 MAP kinases 197 MD 59 metabolic engineering 245 response 245 metallothionein 31 microbiology 1 microencapsulation 59 minimal residual disease 169 molecular pathology 169 mucosal vaccine delivery 297 mutation detection 1 mutational spectroscopy 1 npt-ZI 269 nuclear hormone receptors 3 1

oligonucleotides 59 oligouronides 197 one-hybrid system 3 1 osmolyte 245 osmotic stress 245 pathogenesis related (PR) proteidgenes 197 phosphorylation 31 PKU 59 plant disease resistance 197 promoters 269

polymerase chain reaction 1 posttranslational modification 3 1 promoter tagging 269 protein 245 linkage map 31 protein-DNA interactions 3 1 protein-linkage map 31 protein-protein interaction 31 rare-cutting endonucleases 111 Ras 31 receptor-mediated 59 recombinant fowlpox virus 151 herpesvirus of turkeys (HVT) 151 IBDV (rIBDV) 151 vaccine 151 reporter gene 31 genes 269 restriction fragment length polymorphism 1 retroviral 59 reverse genetics 151 ribozyme 111 ribozyme-directed chemotherapy 111 RNA 111 processing 111 splicing 1 1 1 Saccharomyces cerevisiae 3 1 salicyclic acid (SA) 197 salinity 245 SCID 59 signal transduction 197 small GTP-binding proteins 197 soil 245 stress 245 systemic acquired resistance (SAR) 197 systemin 197 therapeutic intervention 31 tissue-specific 269 trans-splicing 111 transactivation assay 31 transcription factor 3 1 transformation 269 transgene 269 transgenic plants 197, 313 transposon 269 tribrid system 31 tumoranalysis 1

353 two-dimensional DNA electrophoresis 1 two-hybrid system 31

viral 59 virus-like particles 151

vaccine vectors 297 vectors 59

yeast 3 1 expression 15 1