Amyloid Precursor Protein A Practical Approach

Amyloid Precursor Protein A Practical Approach © 2005 by CRC Press LLC Amyloid Precursor Protein A Practical Approach...

Author: Weiming Xia | Huaxi Xu

19 downloads 645 Views 10MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

Amyloid Precursor Protein A Practical Approach

© 2005 by CRC Press LLC

Amyloid Precursor Protein A Practical Approach EDITED BY

Weiming Xia and Huaxi Xu

CRC PR E S S Boca Raton London New York Washington, D.C.


2245_C000.fm Page iv Monday, November 15, 2004 4:06 PM

Library of Congress Cataloging-in-Publication Data Xia, Weiming. Amyloid precursor protein : a practical approach / by Weiming Xia, Huaxi Xu. p. cm. Includes bibliographical references and index. ISBN 0-8493-2245-6 (alk. paper) 1. Amyloid beta-protein precursors — Laboratory manuals. I. Xu, Huaxi. II. Title. QP552.A45X53 2004 616.8′047—dc22

2004058142

This book contains information obtained from authentic and highly regarded sources. Reprinted material is quoted with permission, and sources are indicated. A wide variety of references are listed. Reasonable efforts have been made to publish reliable data and information, but the author and the publisher cannot assume responsibility for the validity of all materials or for the consequences of their use. Neither this book nor any part may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, microfilming, and recording, or by any information storage or retrieval system, without prior permission in writing from the publisher. All rights reserved. Authorization to photocopy items for internal or personal use, or the personal or internal use of specific clients, may be granted by CRC Press, provided that $1.50 per page photocopied is paid directly to Copyright Clearance Center, 222 Rosewood Drive, Danvers, MA 01923 USA. The fee code for users of the Transactional Reporting Service is ISBN 0-8493-2245-6/05/$0.00+$1.50. The fee is subject to change without notice. For organizations that have been granted a photocopy license by the CCC, a separate system of payment has been arranged. The consent of CRC Press does not extend to copying for general distribution, for promotion, for creating new works, or for resale. Specific permission must be obtained in writing from CRC Press for such copying. Direct all inquiries to CRC Press, 2000 N.W. Corporate Blvd., Boca Raton, Florida 33431. Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation, without intent to infringe.

Visit the CRC Press Web site at www.crcpress.com © 2005 by CRC Press No claim to original U.S. Government works International Standard Book Number 0-8493-2245-6 Library of Congress Card Number 2004058142 Printed in the United States of America 1 2 3 4 5 6 7 8 9 0 Printed on acid-free paper


2245_C000.fm Page v Monday, November 15, 2004 4:06 PM

Preface Amyloid precursor protein (APP) is an extensively studied single transmembrane protein. Our vast knowledge of this protein is derived from thousands of reports published during the past decade. In fact, many scientists from different disciplines have used their well-established experimental procedures to examine the characteristics of this molecule. Hence, their published reports display nearly all aspects of biological techniques used in genetics, molecular biology, cell biology, and biochemistry. As a result, APP may be viewed as a unique model protein to illustrate a wide array of basic and advanced biological techniques used in many laboratories. The major aim of this book is to demonstrate the critical techniques utilized in the experiments selected from many significant findings that contribute to our understanding of APP biology. Each technique will be presented in the format of a standard protocol, providing step-by-step instructions for bench scientists carrying out similar studies on APP and other proteins. Theoretical background and discussions will be provided in the introduction section, and a brief description of the goal will also be presented. These protocols will form the core of our approach in elucidating the function of a protein. The antibodies used in each experiment will be described and are cited on the list of antibodies to APP and Aβ proteins at the front of this book It is our intention to contrast basic and advanced methods and demonstrate how development of biological techniques significantly affects the way we examine our molecular targets. An important feature of this book is the presentation of modifications applied to standard procedures used in examining a membrane protein. These modifications will likely help readers consider similar alterations in their own experimental procedures. The fact that most experiments we perform every day do not lead to conclusive answers strongly indicates that actively modifying our approach is essential to perform biological experiments and achieve definitive results. The descriptions of the modifications will help justify similar alterations in readers’ own experimental approaches. Another goal of this book is to include commonly used experimental procedures and clearly present them in the format of a protocol to serve as a laboratory manual for bench scientists working on different aspects of the biological functions of APP and other membrane proteins. Most experimental procedures can be carried out in a regularly equipped laboratory, but a few protocols require sophisticated core facilities. In addition, multistep protocols will be broken down into several independent protocols, allowing an investigator to create parallel experiments to accelerate the achievement of results. This book will also describe a set of previously published milestone studies on APP. Results summarized here will not only provide a complete picture of our current understanding of APP, but also confer future direction for continued investigation of this protein in normal cellular function and in disease.


2245_C000.fm Page vi Monday, November 15, 2004 4:06 PM

Due to rapid expansion of our knowledge of APP biology, this book will cover the most up-to-date research activities. More importantly, we emphasize practical techniques used to address key questions related to APP and similar membrane proteins. Hence, this book will offer a framework for studying other membrane proteins and provide detailed, step-wise procedures to achieve specific aims. It will be suitable for students who are learning basic experimental approaches to address biological questions and also for bench scientists who seek immediate assistance and practical approaches for studying proteins.


2245_C000.fm Page vii Monday, November 15, 2004 4:06 PM

Contributors Karen Hsiao Ashe Department of Neurology University of Minnesota Minneapolis, Minnesota

Erica A. Fradinger Center for Neurologic Diseases Brigham and Women’s Hospital Harvard Medical School Boston, Massachusetts

Jorge Busciglio Department of Neurobiology and Behavior University of California Irvine, California

Denise Galatis Department of Pathology The University of Melbourne Melbourne, Victoria, Australia

Dongming Cai Fisher Center for Research on Alzheimer’s Disease The Rockefeller University New York, New York

Arun K. Ghosh Department of Chemistry University of Illinois at Chicago Chicago, Illinois

William A. Campbell Center for Neurologic Diseases Brigham and Women’s Hospital Harvard Medical School Boston, Massachusetts Roberto Cappai Department of Pathology The University of Melbourne Melbourne, Victoria, Australia Atul Deshpande Department of Neurobiology and Behavior University of California Irvine, California Susanne C. Feil Biota Structural Biology Laboratory St. Vincent’s Institute of Medical Research Fitzroy, Victoria, Australia


Gunnar Gouras Department of Neurology and Neuroscience Weill Medical College of Cornell University New York, New York Heike S. Grimm Center for Molecular Biology University of Heidelberg Heidelberg, Germany Marcus O.W. Grimm Center for Molecular Biology University of Heidelberg Heidelberg, Germany Tobias Hartmann Center for Molecular Biology University of Heidelberg Heidelberg, Germany

2245_C000.fm Page viii Monday, November 15, 2004 4:06 PM

Pablo Helguera Department of Neurobiology and Behavior University of California Irvine, California

Samir Kumar Maji Center for Neurologic Diseases Brigham and Women’s Hospital Harvard Medical School Boston, Massachusetts

Stanley Jones Premkumar Iyadurai Department of Neurology University of Minnesota Minneapolis, Minnesota

William J. McKinstry Biota Structural Biology Laboratory St. Vincent’s Institute of Medical Research Fitzroy, Victoria, Australia

Gerald Koelsch Protein Studies Program Oklahoma Medical Research Foundation Oklahoma City, Oklahoma

Chica Mori Center for Neurologic Diseases Brigham and Women’s Hospital Harvard Medical School Boston, Massachusetts

Edward H. Koo Department of Neurosciences University of California, San Diego La Jolla, California

William J. Netzer Fisher Center for Research on Alzheimer’s Disease The Rockefeller University New York, New York

Markus P. Kummer Department of Neurosciences University of California, San Diego La Jolla, California Noel D. Lazo Center for Neurologic Diseases Brigham and Women’s Hospital Harvard Medical School Boston, Massachusetts

Andreas J. Paetzold Center for Molecular Biology University of Heidelberg Heidelberg, Germany Michael W. Parker Biota Structural Biology Laboratory St. Vincent’s Institute of Medical Research Fitzroy, Victoria, Australia

Cynthia A. Lemere Center for Neurologic Diseases Brigham and Women’s Hospital Harvard Medical School Boston, Massachusetts

Alejandra Pelsman Department of Neurobiology and Behavior University of California Irvine, California

Feng Li Center for Neuroscience and Aging The Burnham Institute La Jolla, California

Thomas Ruppert Center for Molecular Biology University of Heidelberg Heidelberg, Germany


2245_C000.fm Page ix Monday, November 15, 2004 4:06 PM

Dongwoo Shin Department of Chemistry University of Illinois at Chicago Chicago, Illinois

Vajira Weerasena Protein Studies Program Oklahoma Medical Research Foundation Oklahoma City, Oklahoma

Xiaoyan Sun Center for Neurologic Diseases Brigham and Women’s Hospital Harvard Medical School Boston, Massachusetts

Michael S. Wolfe Center for Neurologic Diseases Brigham and Women’s Hospital Harvard Medical School Boston, Massachusetts

Reisuke H. Takahashi Department of Neurology and Neuroscience Weill Medical College of Cornell University New York, New York

Weiming Xia Center for Neurologic Diseases Brigham and Women’s Hospital Harvard Medical School Boston, Massachusetts

Akihiko Takashima Brain Science Institute Institute of Physical and Chemical Research Saitama, Japan

Huaxi Xu Center for Neuroscience and Aging The Burnham Institute La Jolla, California

Jordan Tang Protein Studies Program Oklahoma Medical Research Foundation Oklahoma City, Oklahoma

Tsuneo Yamazaki Department of Neurology Graduate School of Medicine Gunma University Gunma, Japan

David B. Teplow Center for Neurologic Diseases Brigham and Women’s Hospital Harvard Medical School Boston, Massachusetts

Hui Zheng Department of Molecular and Human Genetics Baylor College of Medicine Houston, Texas

Eva G. Zinser Center for Molecular Biology University of Heidelberg Heidelberg, Germany


2245_C000.fm Page xi Monday, November 15, 2004 4:06 PM

Table of Contents List of Antibodies to APP and Aβ Proteins Chapter 1

Biochemical Characterization of Amyloid Precursor Protein

Weiming Xia Chapter 2

Assays for Analysis of APP Secretion and Recycling

Markus P. Kummer, Tsuneo Yamazaki, and Edward H. Koo Chapter 3

Strategies for Crystallizing the N-Terminal Growth Factor Domain of Amyloid Precursor Protein

William J. McKinstry, Susanne C. Feil, Denise Galatis, Roberto Cappai, and Michael W. Parker Chapter 4

Analysis of Amyloid Precursor Protein Processing Protease β-Secretase: Tools for Memapsin 2 (β-Secretase) Inhibition Studies

Gerald Koelsch, Vajira Weerasena, Dongwoo Shin, Arun K. Ghosh, and Jordan Tang Chapter 5

Assays for Amyloid Precursor Protein γ-Secretase Activity

William A. Campbell, Michael S. Wolfe, and Weiming Xia Chapter 6

Cell-Free Reconstitution of β-Amyloid Production and Trafficking

Dongming Cai, William J. Netzer, Feng Li, and Huaxi Xu Chapter 7

Studying Amyloid β-Protein Assembly

Erica A. Fradinger, Samir Kumar Maji, Noel D. Lazo, and David B. Teplow Chapter 8

Intracellular Accumulation of Amyloid β and Mitochondrial Dysfunction in Down’s Syndrome

Jorge Busciglio, Alejandra Pelsman, Pablo Helguera, and Atul Deshpande


2245_C000.fm Page xii Monday, November 15, 2004 4:06 PM

Chapter 9

Linking Alzheimer’s Disease, β-Amyloid, and Lipids: A Technical Approach

Marcus O.W. Grimm, Andreas J. Paetzold, Heike S. Grimm, Eva G. Zinser, Thomas Ruppert, and Tobias Hartmann Chapter 10 Regulation of Amyloid Precursor Protein Processing by Lithium Xiaoyan Sun and Akihiko Takashima Chapter 11 Immunocytochemical Analysis of Amyloid Precursor Protein and Its Derivatives Gunnar Gouras and Reisuke H. Takahashi Chapter 12 Pathological Detection of Aβ and APP in Brain Chica Mori and Cynthia A. Lemere Chapter 13 Creating APP Transgenic Lines in Mice Stanley Jones Premkumar Iyadurai and Karen Hsiao Ashe Chapter 14 Generation of Amyloid Precursor Protein Knockout Mice Hui Zheng


2245_C000.fm Page xiii Monday, November 15, 2004 4:06 PM

List of Antibodies to APP and Aβ Proteins Name

Source

Immunogen (Specific)

22C11

Chemicon Cat# MAB348 N terminal, purified recombinant APP A4 fusion protein

Alz-90 (1.D5)

Chemicon Cat# MAB349 Synthetic aa 511-608 of APP pre A4-695

369

S. Gandy C terminal APP [email protected] Elan Pharmaceuticals Specific to carboxyl terminus of β-secretase cleavage site of APP D. Selkoe Residues 595–611 of [email protected]. APP695 (α-sAPP) harvard.edu D. Selkoe Against 20 C terminal [email protected]. residues of APP harvard.edu D. Selkoe Against 20 C terminal [email protected]. residues of APP harvard.edu David Miller Residues 672–695 of [email protected] APP695 Elan Pharmaceuticals Residues 444–591 of APP (β−APPs and APP) Elan Pharmaceuticals Residues 676–695 of APP695 E.H. Koo Residues 380–665 of APP [email protected] EH. Koo Recognize [email protected] nonoverlapping epitopes in extracellular region of APP

APP 192

1736

C7

C8

R57 8E5 13G8 1G7 5A3


Host Description (Formulation) Methods in Chapter Monoclonal mouse (lyophilized, azide) Monoclonal mouse (purified, lyophilized, azide) Polyclonal

IH, WB

6

WB

8

IH, WB

6

Polyclonal

IH, WB

1

Polyclonal

WB

1

Polyclonal

IH, IP

1, 5, 12

Polyconal

IP, WB

8

Polyclonal

WB

5

Monoclonal

WB

12

Monoclonal

IP, WB

1, 5

Monoclonal

IP, IF, WB IP, IF, WB

2

Monoclonal

2

2245_C000.fm Page xiv Monday, November 15, 2004 4:06 PM

4G8

Signet Cat# 9200, 9220

6E10

Signet Cat# 9300, 9320

1280

D. Selkoe [email protected]. harvard.edu Genetics Company Cat# AB-10

W0-2

G2-10

Genetics Company Cat# AB-10

G2-11

Genetics Company Cat# AB-11

MBC40

β-amyloid 1-42

H. Yamaguchi [email protected] H. Yamaguchi [email protected] Chemicon Cat# AB5078P

21F12

Elan Pharmaceuticals

R1282

D. Selkoe [email protected]. harvard.edu

MBC42

Amino acid residues Monoclonal, 17–24 of β-amyloid mouse peptide (reactive to aa (crude, 17–24 Aβ and to APP) ascites) Amino acid residues 1–17 Monoclonal, of β-amyloid peptide mouse (reactive to aa 1–17 Aβ (crude, and to APP) ascites) Raised to Aβ 1–40 Polyclonal (reactive to Aβ and P3) aa 1–10 of N terminal of human Aβ (high affinity to amyloid peptides Aβ1-38, Aβ1-39, Aβ1-40, Aβ1-43, and Aβ1-44) Amino acid residues 31–40 of human Aβ peptide at C terminal (Aβ-peptide, aa 31–40; not Aβ1-38, Aβ1-39, Aβ1-42, Aβ1-43, or Aβ1-44) Amino acid residues 33–42 of human Aβ 42 peptide at C terminal (Aβ-peptide, aa 33–42; not Aβ1-38, Aβ1-39, Aβ1-40, Aβ1-43, or Aβ1-44) Amino acid residues 1–40 of β-amyloid peptide (reactive to Aβ 40) Amino acid residues 1–42 of β-amyloid peptide (reactive to Aβ 42) β-amyloid 1-42 (recognizes β-amyloid 1-42) β-amyloid 33-42

Aβ 1−40

ELISA, IH, IP, WB

6, 12

ELISA, IH, IP, WB

6, 10, 12

IP

1

Monoclonal mouse

ELISA, WB

9

Monoclonal mouse

ELISA, WB

9

Monoclonal mouse

ELISA, WB

9

Monoclonal

IH, WB

10, 11, 12

Monoclonal

IH, WB

10, 11, 12

Polyclonal rabbit

WB, IH, IF, IP, ELISA IH, ELISA, WB IH, IP

11

Monoclonal mouse Polyclonal rabbit

12

12

IH = Immunohistochemistry; WB = Western blot; IP = Immunoprecipitation; IF = Immunofluorescence; ELISA = Enzyme-linked immunosorbent assay.


2245_book.fm Page 1 Wednesday, November 3, 2004 2:59 PM

1

Biochemical Characterization of Amyloid Precursor Protein Weiming Xia

CONTENTS 1.1 1.2 1.3 1.4 1.5

Introduction Main Scheme of Approaches Results Discussion Protocols 1.5.1 Overexpression of APP in Mammalian Cells by Transient Transfection 1.5.2 Selection of Stable Cell Line Overexpressing APP 1.5.3 Determination of Protein Concentration by BCA 1.5.4 Identification of APP and Its Derivatives by Western Blot 1.5.5 Radiolabeling of Cells with [35S]-Met 1.5.6 Identification of Full-Length APP and Its Derivatives by Immunoprecipitation 1.5.7 Determination of Half-Life of APP 1.5.8 Co-Immunoprecipitation of APP-Interacting Protein 1.5.8.1 Preparation 1.5.8.2 Pre-Absorption of Protein A-Sepharose 1.5.8.3 Pre-Clearing of Cell Lysates 1.5.8.4 Set Up Co-IP 1.5.8.5 Wash Co-IP 1.5.9 Conjugation of Antibody to Protein A-Sepharose Acknowledgments References

0-8493-2245-6/05/$0.00+$1.50 © 2005 by CRC Press



1.1 INTRODUCTION Amyloid precursor protein (APP) is a single transmembrane protein that undergoes sequential proteolysis to generate multiple peptides, including the amyloid β-peptide (Aβ) — the major component of the senile plaques that are diagnostic hallmarks of Alzheimer’s disease (AD).1,2 AD accounts for more than 50% of cases of dementia in the elderly and has a prevalence estimated at 15 to 20 million patients worldwide. It is associated with progressive memory loss that leads to profound dementia and eventually death, although a patient can have the disease for as long as 10 to 15 years before death. The pathology of AD is characterized by extracellular neuritic plaques consisting of Aβ and intracellular neurofibrillary tangles.3 A central role for Aβ in the pathogenesis of AD was first discovered by finding APP mutations in a subset of familial AD (FAD) cases that occurred as inherited autosomal dominant disease.4,5 The APP gene is located on chromosome 21, and mutations found in APP occur either within the Aβ peptide sequence (A692G6 and E693Q,7,8 APP770 numbering) or immediately flanking the Aβ peptide sequence including KM670/671NL (Swedish mutation),9 I716V,10 and V717I,G,F mutations.5,11,12 Mutations in APP are rare but they have been very informative. Patients carrying trisomy 21 (Down’s syndrome) develop the histopathology of AD in early midlife, presumably because they have three copies of the APP gene and a documented increase in APP transcription13 that leads to augmented Aβ deposition. The double mutation in APP at the Aβ N terminus (Swedish mutation) leads to a marked increase in Aβ production,9,14–16 as confirmed in primary skin fibroblasts and the plasma of presymptomatic and symptomatic carriers.17 The mutations at APP716 or 7175,11,12 lead to hypersecretion of the longer and more amyloidogenic Aβ42 peptide.10,18 When human APP containing the Val → Phe mutation19 or the Swedish mutation20 is overexpressed in transgenic mice, a time-delayed accumulation of both diffuse and neuritic Aβ plaques develops. These various studies provide strong circumstantial evidence for the early mechanistic role of abnormal APP metabolism and Aβ deposition in AD neuropathology. In this chapter, we will discuss several basic biochemical approaches routinely used to study full-length APP and shorter peptides derived from proteolytic cleavages of APP holoprotein (Figure 1.1); the same approaches can be used to characterize any newly identified proteins.

1.2 MAIN SCHEME OF APPROACHES To characterize a newly cloned gene product, transient transfection is a quick and simple way to enrich the protein of interest for biochemical analysis. Here we present a standard protocol to transiently transfect a mammalian expression vector containing APP cDNA into Chinese hamster ovary (CHO) cells (Protocol 1.5.1). During the 24 to 48 hr post-transfection, cells can either be harvested for immediate analysis or used for screening of clones to make a cell line stably expressing APP. In the latter case, the selection drug (based on the selection marker in the expression vector used for transient transfection) will be used for screening (Protocol 1.5.2).



FIGURE 1.1 Proteolytic cleavage of amyloid precursor protein by α-, β- and γ-secretases. APP is proteolytically processed by two alternative pathways. First, α-secretase cleaves slightly N terminal to the beginning of the APP transmembrane domain (at residues 16 and 17 of the Aβ region) and generates a major secreted derivative (α-APPs) and a ~10-kDa C-terminal fragment (C83). C83 can be cleaved by a protease activity called γ-secretase to yield p3. Alternative cleavage of APP by the β-secretase (called BACE or memapsin 2) generates a soluble N-terminal fragment (β-APPs) and a 12-kDa C-terminal fragment of APP (C99) that can be further cleaved by γ-secretase to yield two major species of Aβ ending at residue 40 (Aβ40) or 42 (Aβ42).

A large number of antibodies against different regions of APP are available from many laboratories and commercial sources. Using these antibodies, cell lysates with equivalent amounts of protein concentrations (determined by Bicinchoninic Acid Kit [BCA]; Protocol 1.5.3) can be separated by SDS-PAGE followed by Western blotting analysis (Protocol 1.5.4). An alternative approach would be to metabolically label cells with [35S]-methionine (Met) (Protocol 1.5.5), and lyse the radiolabeled cells for immunoprecipitation with specific antibodies (Protocol 1.5.6). Radiolabeling cells followed by immunoprecipitation usually enhances the signal-to-noise ratios of overexpressed proteins. Proteins identified by Western blot and immunoprecipitation usually represent mature species at steady state levels. To examine the process of protein maturation, cells can be pulse-labeled with [35S]-Met followed by chasing in nonradioactive media for various periods of time (Protocol 1.5.7). Cell lysates will then be immunoprecipitated with specific antibodies. A simple co-immunoprecipitation method using an antibody against a candidate protein (e.g., presenilin) can be used to determine whether this protein interacts with APP (Protocol 1.5.8). By using free antibody or protein A sepharose-conjugated



antibody (Protocol 1.5.9), co-immunoprecipitation is widely used to confirm a candidate protein that specifically interacts with APP.

1.3 RESULTS APP occurs in three alternatively spliced forms of 695, 751, and 770 residues, and these proteins undergo N- and N + O glycosylation as well as phosphorylation. In CHO cells stably expressing APP, both N- and N + O-glycosylated APP holoproteins can be detected by immunoprecipitation of radiolabeled cells with antibody C7, which was raised against the last 21 amino acids of the APP C terminus (APP675–695, APP695 numbering; Figure 1.2a). APP is proteolytically processed by at least two broad alternative pathways (Figure 1.1). First, cleavage of APP by β-secretase (called BACE or memapsin 2)21–24 generates a soluble N-terminal fragment (β-APPs, Figure 1.2b), and a C-terminal stub of APP (C99, Figure 1.2d),25 which can be further cleaved by a protease activity called γ-secretase to yield two major species of Aβ ending at residue 40 (Aβ40) or 42 (Aβ42). See Figure 1.2e.26,27 Since soluble β-APPs and Aβ generated in radiolabeled cells are secreted into media, they can be detected by immunoprecipitation of media with

a.

b.

c.

100

100 β-APPs

N+O-APP

α-APPs

N-APP 100

d. 14

e. 6 C99 C83

Aβ 3

p3

FIGURE 1.2 Detection of APP and its derivatives by immunoprecipitation. (a) Both N- and N+O-glycosylated APP holoproteins were immunoprecipitated from radiolabeled CHO cells stably expressing APP with antibody C7, which was raised against the last 21 amino acids of the APP C terminus. (b) Soluble β-APPs from radiolabeled cells were secreted into media and could be detected by immunoprecipitation of media with specific antibody 192 which specifically recognizes the C termini of β-APPs. (c) Soluble α-APPs can be detected by immunoprecipitation of growth media with antibody 1736 which recognizes the C termini of α-APPs. (d) APP-expressing cells were lysed and immunoprecipitated with antibody C7, followed by Western blotting with another C terminus antibody, 13G8, to detect C99 and C83. (e) Both Aβ and p3 were immunoprecipitated from growth media of radiolabeled APPexpressing CHO cells using antibody 1280, which was raised against the whole region of Aβ.



specific antibodies. Antibody 192 can specifically recognize the C termini of β-APPs (Figure 1.2b). Antibody 1280 was raised against the whole region of Aβ, and can thus recognize both Aβ and p3 (Figure 1.2e). Alternative cleavage slightly N terminal to the beginning of the APP transmembrane domain (at residues 16–17 of the Aβ region) by a α-secretase protease28,29 generates the major secreted derivatives, α-APPs (Figure 1.2c), precluding Aβ formation (nonamyloidogenic).30,31 The ~10-kDa C-terminal stub (C83, Figure 1.2d) can be cleaved by γ-secretase to yield p340 and p342 (Figure 1.2e),32 which can be recognized by antibody 1280. Soluble α-APPs can be detected by immunoprecipitation of growth media with antibody 1736, which recognizes the C termini of α-APPs (Figure 1.2c). Another approach to detecting APP and its derivatives is to perform immunoprecipitation followed by Western blotting; this approach does not require radiolabeling of cells. For example, APP-expressing cells can be lysed and immunoprecipitated with antibody C7. The immunoprecipitates, full length APP, C83, and C99, all carry the antigen for C7, namely, the C terminus of APP. After immunoprecipitates are separated by SDS-PAGE, Western blotting with another C-terminal antibody, 13G8, can be used to detect these peptides. This is a convenient approach to detect full length APP as well as C99 and C83 (Figure 1.2d). The temporal events of APP glycosylation and proteolytic processing occur within a very short period. Within a half hour of protein translation, the majority of APP is glycosylated, as determined by pulse-chase labeling of APP expressing cells with [35S]-Met (Figure 1.3). After APP-expressing cells were incubated with Metfree media for 45 min at 37˚C, cells were pulse-labeled with [35S]-Met for 5 min, and then the medium was changed to regular Dulbecco’s modified Eagle’s medium and chased for 0.25 to 5 hr. Cells were lysed and immunoprecipitated with antibody C7, followed by SDS-PAGE. The half life of APP was very short (~30 min) and most of the holoprotein was either degraded or proteolytically cleaved by β- or α-secretase to generate C99/C83 within 1.5 hr (Figure 1.3). Like the APP holoprotein, almost all of the C83/C99 was either degraded or cleaved by γ-secretase, and no C83/C99 was detectable after 5 hr (Figure 1.3). To determine the spatial distribution of immature and mature APP, membrane vesicles enriched in different subcellular compartments were separated by fractionation on discontinuous Iodixanol sucrose gradients (see Chapter 5). A total of 12 fractions were collected, and each fraction was analyzed by Western blotting. For endoplasmic reticulum (ER)-rich fractions, an antibody against the ER marker protein, calnexin, was used (Figure 1.4a). The densest fractions (1 through 4) had the strongest immunoreactivities for calnexin, indicating that these fractions contained ER vesicles. For Golgi/trans-Golgi network (TGN)-enriched fractions, β-1,4-galactosyltransferase activity in each fraction was measured, i.e., the addition of [3H]-galactose onto the oligosaccharides of an acceptor protein, ovomucoid, was measured.33 Since β-1,4-galactosyltransferase is a marker for Golgi/TGN-type vesicles, fractions 4 through 8 were enriched in Golgi/TGN vesicles (Figure 1.4b). Alternatively, an



0

15

30

90 120

300 min

210 N+O-APP N-APP 110 71

28 18 14

C99 C83

6

FIGURE 1.3 Maturation of APP and turnover of APP and C terminal fragments. CHO cells stably expressing APP were pulse-labeled for 5 min and chased for 0 to 5 hr. Cell lysates were immunoprecipitated with C7. The half life of APP was ~30 min, and a portion of APP holoprotein was cleaved by β- or α-secretase to generate C99/C83 within 1.5 hr. Most C83 and C99 were either degraded or cleaved by γ-secretase, and no C83/C99 was detectable after 5 hr.

antibody against another Golgi/TGN marker protein, syntaxin 6, can be used to characterize these subcellular fractions. When these subcellular fractions were probed for APP distribution with APP monoclonal antibodies 5A3/1G7, which can detect both N- and N + O-glycosylated APP proteins (Figure 1.4c), fractions 1 through 3 only had N-glycosylated APP proteins. The lack of further glycosylation of these immature APP proteins suggests that N-glycosylated APP resides primarily in the ER (Figure 1.4c).34–36 Both N- and N + O-glycosylated APP proteins were observed from fraction 4 to fraction 8, indicating that post-translational modification is completed during the passage of APP into the Golgi/TGN compartment.34 Post-translationally modified APP continues to transport through the central vacuolar pathway and finally reaches the cell surface. A large portion of APP undergoes endocytosis and is re-internalized to endosomes (see Chapter 2). To examine whether another AD-linked gene product, presenilin 1 (PS1), interacts with APP, co-immunoprecipitation of APP and PS1 was carried out (Protocol 1.5.8). When cells were lysed and lysates were immunoprecipitated with PS1 antibodies X81, R22, or 4627 (against N-terminal, middle, and C-terminal regions of PS1, respectively) followed by Western blotting with the APP C-terminal antibody 13G8, full-length APP was clearly detected (Figure 1.5). The specificity of this interaction was demonstrated by the observation that only the N-glycosylated form of full-length APP co-precipitated with PS1 (Figure 1.5).



a.

200

97

calnexin

b.

c.

Galactosyltransferase Activity (cpm)

68

800 600 400 200 0

200 N+O-APP N-APP 97 68 1

2

3

4

5

6

7

8

9

10

11 12

FIGURE 1.4 Characterization of immature and mature APP in subcellular fractions. (a) Distribution of the ER marker protein (calnexin) in discontinuous Iodixanol gradient fractions was detected by Western blotting with anti-calnexin antibody (densest fraction, lane 1; lightest fraction, lane 12). (b) Distribution of the Golgi/TGN marker β-1,4-galactosyl transferase activity was mainly in fractions 4 through 8. (c) The same fractions were immunoblotted with APP monoclonal antibodies 5A3/1G7. Fractions 1 through 3 were rich in ER vesicles and contained solely N-glycosylated APP; fractions 4 through 8 were rich in Golgi/TGN vesicles which contained both N- and N + O-glycosylated APP. Fraction 4 represented a transition fraction in the discontinuous gradient and contained both ER and Golgi/TGN proteins. (From Xia, W. et al. Proc. Natl. Acad. Sci. USA, 97, 9299–9304, 2000; Xia, W. et al. Biochemistry 37, 16465–16471, 1998. With permission.)

1.4 DISCUSSION This chapter has presented several basic approaches to characterize the biochemical properties of APP. These experimental procedures are routinely utilized in many laboratories, and the protocols listed in this chapter usually serve as starting methods to study transmembrane proteins. Various modifications can be introduced to meet special needs for individual proteins. While more than a dozen transfection reagents are available to introduce expression vectors into mammalian cells, the toxicity of reagents usually counteracts the transfection efficiency. Therefore, it is necessary to titrate the amount of DNA/transfection reagent to obtain the optimal transfection efficiency with minimum toxicity. A simple test is to co-transfect the gene of interest with another vector expressing green fluorescent protein (GFP), and the expression levels of GFP can be monitored under a fluorescent microscope 24 to 48 hr post-transfection. If cellular toxicity is



PS1 antibody X81

4627

APP antibody R22

Preimm

C7

N+O-APP N-APP 110

1

2

3

4

5

FIGURE 1.5 Co-immunoprecipitation of APP and PS1. Lysates from APP- and PS1-expressing cells were co-immunoprecipitated with either PS1 antibodies (X81, 4627, or R22) or preimmune serum (preimm), followed by Western blotting with APP antibody 13G8. The APP species that co-immunoprecipitated with PS1 co-migrated with the N-glycosylated form of APP detected on straight Western blots of the lysates. The lower band in lanes 2 through 4 is nonspecific. (From Xia, W. et al. Proc. Natl. Acad. Sci. USA, 97, 9299–9304, 2000. With permission.)

obvious even when a low amount of DNA/transfection reagent is used, then overexpressing the target gene may cause enough cellular damage that raising a stable cell line is not feasible. Detection of proteins by immunoprecipitation and/or Western blot largely depends on the specificity of an antibody. Nevertheless, the choice of detergent in the lysis buffer is important to successfully lyse a membrane protein. This is especially critical when co-immunoprecipitation is performed to search for any interacting proteins that form a complex with the transmembrane protein. Because many transmembrane proteins tend to interact nonspecifically and form aggregates under non-physiological conditions, i.e., overexpression of two transmembrane proteins in transiently transfected cells, stringent conditions should be tested to differentiate a specific protein–protein interaction versus nonspecific hydrophobic aggregation. In some cases, steric hindrance may interfere with an antibody binding to a specific region during co-immunoprecipitation, Therefore, using multiple antibodies against different regions of the protein for co-immunoprecipitation is necessary to confirm a specific interaction. Reverse co-immunoprecipitation should be carried out to prove a direct interaction between two proteins. In addition, examining the occurrence and localization of the complex will also help explain the physiological significance of the interaction between two proteins. In conclusion, the standard protocols listed in this chapter provide an outline of experiments that can be immediately performed to study a new protein. Understanding the basic biochemical properties of a protein is not only the basis for future in vitro and in vivo studies, but also represents the first step to explore its biological function.



1.5 PROTOCOLS 1.5.1 OVEREXPRESSION OF APP IN MAMMALIAN CELLS BY TRANSIENT TRANSFECTION 1. Split CHO cells in a six-well plate the day before transfection so that they are 90 to 95% confluent the following day. Plate cells in 1.5 ml of their normal growth medium. 2. For each well of cells, dilute 4 µg of DNA in 250 µl medium without serum (e.g., Opti-MEM I). Additionally, dilute 12 µl Lipofectamine 2000 (Invitrogen, #11668-019) in 250 µl Opti-MEM I for each well of cells and incubate for 5 min at room temperature. 3. Combine diluted Lipofectamine and the DNA within 30 min. Incubate at room temperature for 20 min to allow DNA–Lipofectamine complexes to form. 4. Add 500 µl of the DNA–Lipofectamine mixture to each well of cells and mix gently. 5. Incubate cells at 37˚C in a CO2 incubator for 24 to 48 hr. Growth medium may be replaced after 4 to 6 hr.

1.5.2 SELECTION

OF

STABLE CELL LINE OVEREXPRESSING APP

1. At 48 hr post-transfection, detach the cells by brief trypsin treatment, count the cells, and make serial dilutions to obtain a final concentration of 1 cell/100 µl of media containing a selection drug (e.g., G418). Transfer 100 µl of media to each well of a 96-well plate, resulting in a final cell count of approximately one cell per well. A total of six to eight plates should be prepared for selection of multiple clones of the stable cell line. 2. Formation of a single colony of cells in individual wells is monitored under a microscope after a growth period of 2 weeks. Only wells containing single colonies of cells will be selected. Transfer cells to a 24-well plate for growth. 3. Prepare duplicate wells of cells from the same clone and lyse one well of cells for measuring expression levels of APP by Western blot. 4. Any candidate clones with satisfactory expression levels of APP will be grown in large quantities for long-term storage.

1.5.3 DETERMINATION

OF

PROTEIN CONCENTRATION

BY

BCA

1. Prepare BSA standards in lysis buffer [50 mM Tris, pH 7.6, 150 mM NaCl, 2 mM EDTA, 1% NP-40 and a protease inhibitor cocktail (5 µg/ml leupeptin, 5 µg/ml aprotinin, 2 µg/ml pepstatin A, and 0.25 mM phenylmethylsulfonyl fluoride)] so that there is a serial dilution of BSA from 1 mg/ml down to 15.5 µg/ml. 2. In a 96-well plate, add 25 µl of sample or standard to each well.



3. Mix 50 parts of solution A to 1 part of solution B from the BCA Protein Assay Reagent (Pierce, #23225). Add 200 µl of this working reagent to each well. 4. Cover the plate with foil and incubate for 30 min at 37˚C. 5. Read the plate at an absorbance of 562 nm.

1.5.4 IDENTIFICATION

OF

APP

AND ITS

DERIVATIVES

BY

WESTERN BLOT

1. Lyse samples with 3× sample buffer (10% SDS, 0.3 M Tris, 50% glycerol, 10% β-mercaptoethanol and a trace amount of bromophenol blue). 2. Heat samples at 100˚C for 5 min. 3. For BioRad Criterion gels, run at 200 V in running buffer (25 mM Tris, 192 mM glycine, 1% (w/v) SDS, pH 8.3) for 50 to 55 min. 4. Transfer gel to a 0.2-µm supported nitrocellulose membrane (BioRad, #162-0097) at 100 V for 1 hr at 4˚C in transfer buffer (20% methanol, 25 mM Tris, 192 mM glycine, 1% (w/v) SDS, pH 8.3). 5. Block the membrane in 5% milk in PBS-T (0.05% Tween-20) with agitation for 30 min at room temperature. 6. Wash two times with PBS-T for 2 min. 7. Incubate in primary antibody in PBS-T overnight at 4˚C or for 2 hr at room temperature. 8. Wash for 15 min, then wash for 5 min, three times in PBS-T. 9. Incubate 1 hr at room temperature in secondary antibody diluted 1:10,000 in PBS-T. The type of secondary antibody (antimouse, antirabbit, etc.) will depend on the primary antibodies used (monoclonal/mouse vs. polyclonal/rabbit antibodies). 10. Wash for 15 min, then wash for 5 min, three times in PBS-T. 11. Place the membrane on a transparency and add ECL Plus mixture (1 ml A plus 25 µl B; Amersham) to cover entire membrane for 1 min. 12. Place second transparency over membrane and expose for various periods (e.g., 15 sec, 30 sec, 1 min, and 5 min).

1.5.5 RADIOLABELING

OF

CELLS

WITH [35S]-MET

1. Aspirate media from cells cultured in 35-, 60-, or 100-mm dishes. Incubate cells with methionine-free medium for 15 to 30 min at 37˚C. 2. Add appropriate volume of methionine-free medium (0.75 ml for 35-mm dish, 2 ml for 60-mm dish and 5 ml for 100-mm dish). 3. Add [35S]-methionine to each dish to reach a final specificity of 100 to 200 µCi/ml. Incubate at 37˚C for the desired time; for abundant proteins, 2 to 4 hr is generally sufficient. If labeling for >6 hr, it may be necessary to supplement with fetal calf serum (10% or less) or 5 to 10% DMEM. 4. Collect cells for immunoprecipitation of target proteins. For secreted proteins, collect medium for immunoprecipitation.



1.5.6 IDENTIFICATION OF FULL-LENGTH APP AND ITS DERIVATIVES BY IMMUNOPRECIPITATION 1. Culture cells to confluence in a 10-cm dish (~3 mg of protein), then briefly wash them twice in PBS. (For storage, 2 ml of 20 mM EDTA in PBS is added and cells are collected and centrifuged at 3500 g for 5 min. Cell pellets can be frozen at –80˚C.) 2. Cells are lysed in an IP Lysis buffer (50 mM Tris, pH 7.6, 150 mM NaCl, 2 mM EDTA, 1% NP-40 and a protease inhibitor cocktail [5 µg/ml leupeptin, 5 µg/ml aprotinin, 2 µg/ml pepstatin A, and 0.25 mM phenylmethylsulfonyl fluoride (Sigma)]). Incubate lysates on ice for 20 min. Centrifuge lysates at 3500 g for 5 min. Transfer supernatant to a fresh tube. 3. Lysates are precleared with 20 µl of protein A-sepharose CL-4B (Sigma, #P-3391) at 100 mg/ml in STEN buffer (50 mM Tris, pH 7.6, 150 mM NaCl, 2 mM EDTA, 0.2% NP-40) for 0.5 hr at 4˚C. Supernatants are transferred for immunoprecipitation with primary antibodies with 20 µl protein A-sepharose or protein G-agarose (for a monoclonal antibody) at 4˚C for 2 hr. 4. Immunoprecipitates are washed in a 0.5 M STEN buffer (50 mM Tris, pH 7.6, 500 mM NaCl, 2 mM EDTA, and the same protease inhibitor cocktail described above) for 15 min at 4˚C. Centrifuge the samples at 3500 g for 5 min at 4˚C and discard the supernatant. 5. Immunoprecipitates are washed in a SDS-STEN buffer (50 mM Tris, pH 7.6, 150 mM NaCl, 0.1% SDS, 2 mM EDTA, and the protease inhibitor cocktail) for 15 min at 4˚C. Centrifuge the samples at 3500 g for 5 min at 4˚C and discard the supernatant. 6. Immunoprecipitates are washed in a STEN buffer (50 mM Tris, pH 7.6, 150 mM NaCl, 0.2% NP-40, 2 mM EDTA, and the protease inhibitor cocktail) for 15 min at 4˚C. Centrifuge the samples at 3500 g for 5 min at 4˚C. Discard the supernatant, then elute the immunoprecipitates with 3× sample buffer (10% SDS, 0.3 M Tris, 50% glycerol, 10% β-mercaptoethanol and a trace amount of bromophenol blue), heat at 100˚C for 5 min, and separate the samples on a 4 to 20% tris-glycine gel by SDS-PAGE (BioRad, Criterion). 7. Gels are stained in Coomassie blue [0.2% Coomassie in destain solution (50% methanol, 18% acetic acid)] followed by destaining in destain solution for 30 to 45 min to fix proteins. Dry gel after washing gel in Gel-Dry solution (Invitrogen, #LC4025-4) for 30 min. Expose gel in phosphorimager for imaging or to film at –80˚C. 8. Alternatively, confluent cells can be directly lysed in lysis buffer without radiolabeling, and immunoprecipitates can be separated by electrophoresis followed by Western blot, using standard procedures provided by the manufacturer, e.g., ECL Plus detection kit from Amersham.



1.5.7 DETERMINATION

OF

HALF-LIFE

OF

APP

The half-life of a target protein can be determined by pulse-chase labeling of cells followed by immunoprecipitation with its specific antibody. In addition to determining the rate of holoprotein turnover, the course of protein maturation can also be observed. 1. Growth media of confluent CHO cells are replaced with methionine (Met)free media, and cells are incubated at 37˚C for 45 min before the media are aspirated. 2. Cells are pulse labeled with prewarmed Met-free media containing 100 µCi/ml of [35S]-Met for 5 to 15 min. 3. [35S]-Met-containing media are removed, and cells are washed twice with regular DMEM media. 4. Cells are chased in prewarmed DMEM media for an appropriate period before they are collected for immunoprecipitation.

1.5.8 CO-IMMUNOPRECIPITATION

OF

APP-INTERACTING PROTEIN

1.5.8.1 Preparation 1. Thaw Co-IP lysis buffer (50 mM Tris, pH 7.6, 150 mM NaCl, 2 mM EDTA, 1% NP-40, 0.5% Triton X-100, 0.5% BSA, and a protease inhibitor cocktail) at room temperature. 2. Thaw cell pellets/membrane vesicles on ice, and leave protein A-sepharose on ice. 1.5.8.2 Pre-Absorption of Protein A-Sepharose 1. Pipet 2 ml of Co-IP lysis buffer into an Eppendorf tube, then add up to 200 µl of protein-A sepharose. Since each sample will be equally divided and co-immunoprecipitated with an immune antibody or a control preimmune serum, 40 µl of protein A-sepharose will be needed for each sample of cell lysate. 2. Rotate the Eppendorf tube for at least 4 hr at 4˚C (in the cold room). 1.5.8.3 Pre-Clearing of Cell Lysates 1. Lyse the pellets/vesicles with 1 ml of Co-IP lysis buffer and incubate on ice for 20 min. 2. Centrifuge at 3500 g for 5 min. 3. Transfer supernatant into a new tube. 4. Vortex protein A-sepharose briefly, and add 20 µl of protein A-sepharose into each tube. 5. Rotate samples for at least 4 hr at 4˚C (in the cold room).



1.5.8.4 Set Up Co-IP 1. Label new Eppendorf tubes: two per cell lysate, one for the sample to be immunoprecipitated with preimmune serum (Pre) and the other for the immune serum. 2. Pipet 2 µl of preimmune serum (1:200 dilution) into each preimmune sample. For easier pipetting, create a larger volume by combining the total amount of preimmune serum for all Pre samples with about 100 µl of lysis buffer. Add equal amounts to each tube. 3. For a co-IP of presenilin, for example, put 1 µl of antibody X81 and 1 µl of antibody 4627 (1:200 dilution; dilution ratio should be the same as that of preimmune; adjust if necessary) to each sample. For easier pipetting, add the total amounts of X81 and 4627 for all immune samples into a tube with about 100 µl of lysis buffer. Add equal amounts to each tube. 4. Spin down the cell samples and preabsorbed protein A-sepharose at 3500 g for 5 min. 5. Equally divide the supernatant from each sample and aliquot it into two tubes that contain preimmune serum or immune serum. 6. Remove most of the supernatant of preabsorbed protein A-sepharose, and leave a sufficient amount of buffer equivalent to two times the volume of protein A-sepharose. 7. Vortex preabsorbed protein A-sepharose and transfer 20 µl into each tube. 8. Rotate samples for at least 4 hr (in the cold room). 1.5.8.5 Wash Co-IP Two solutions will be used: 0.5 M STEN (50 mM Tris, pH 7.6, 500 mM NaCl, 2 mM EDTA, and the protease inhibitor cocktail) and STEN (50 mM Tris, pH 7.6, 150 mM NaCl, 0.2% NP-40, 2 mM EDTA, and the protease inhibitor cocktail). 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.

Spin samples at 3500 g for 5 min. Aspirate the supernatant without touching the immunoprecipitates. Pipet 750 µl of 0.5 M STEN into each tube. Rotate samples for 15 min (in the cold room). Spin samples at 3500 g for 5 min. Aspirate the supernatant. Pipet 750 µl STEN into each tube. Rotate samples for 15 min in the cold room. Spin samples at 3500 g for 5 min. Aspirate most, but not all, of the supernatant. Use a P20 Pipetman to remove the last of the supernatant. Do not take up any beads. 11. Add 20 µl of 3× sample buffer (10% SDS, 0.3 M Tris, 50% glycerol, 10% β-mercaptoethanol, and a trace amount of bromophenol blue) into each sample.



12. 13. 14. 15.

Vortex the samples, and heat at 100˚C for 5 min. Spin at 18,000 g for 5 min. Load samples into the gel. Do not take up any beads. Proceed to Western blot for detection of co-immunoprecipitates.

Many elements must be monitored carefully for successful detection of protein complexes. Several key components are: 1. Proper preabsorption of protein A-sepharose and preclearing of cell lysate will reduce nonspecific binding of proteins to protein A-sepharose. Without these two steps, the complex will be immunoprecipitated in samples incubated with preimmune serum due to nonspecific binding to protein A-sepharose. 2. The choice of detergents affects the stringency of co-immunoprecipitation as well as the maintenance of the intact complex. Another detergent that can be used to replace 0.5% Triton X-100 and 1% NP-40 is 1% CHAPSO. A battery of detergents must be tested to detect a specific interaction between two proteins.

1.5.9 CONJUGATION

OF

ANTIBODY

TO

PROTEIN A-SEPHAROSE

Most co-immunoprecipitation experiments are carried out using unconjugated antibody (e.g., serum) and protein A-sepharose (or protein G-agarose), and the immunoprecipitates are detected by Western blot. The best method is to use polyclonal antibodies for immunoprecipitation and monoclonal antibodies for Western blot. However, if the choice of antibodies is limited and the same type of antibody must be used for both immunoprecipitation and Western blot, the cross-reactivity of IgG heavy and light chains eluted from the immunoprecipitates will lead to a much higher background at molecular weights of ~25 kDa and above ~55 kDa. Although it does not completely eliminate free heavy and light chains, conjugation of primary antibody for immunoprecipitation to protein A-sepharose will significantly reduce the number of IgG heavy and light chains eluted from immunoprecipitates, thus reducing the background of the Western blot. 1. Suspend 2 g of protein A-sepharose beads in 16 ml of conjugation buffer (50 mM Tris, pH 7.6, 150 mM NaCl, 2% BSA) to make a final concentration of 125 mg/ml protein A-sepharose. This will give a final yield of eight tubes of 2-ml conjugated beads. 2. Combine each 1 ml of resuspended beads with 125 µl antiserum. Incubate 1 hr at room temperature with rocking, then place 2 ml of beads plus antiserum per 15 ml conical tube. 3. Centrifuge for 5 min at 3000 g. Save the supernatant in case of a coupling problem. 4. Resuspend the beads in 10 ml of 0.2 M sodium borate buffer, pH 9.0 (heat to dissolve the precipitates prior to usage). Centrifuge the beads and repeat the wash as before. Bring up in 10 ml of sodium borate buffer. Remove 100 µl of supernatant to check later (A).



5. Add 50 mg dimethyl pimelimidate (DMP; Sigma, #D8388, store at –20˚C) to each tube. Ensure that pH >8.3. Incubate for 30 min at room temperature with rocking. Remove 100 µl of supernatant to check later (B). 6. To stop the reaction, spin the beads at 3000 g for 5 min. Add 10 ml 0.2 M ethanolamine (pH 8.0) per tube. Wash one more time with 10 ml 0.2 M ethanolamine, then incubate in 10 ml ethanolamine for 2 hr at room temperature with rocking. 7. Centrifuge and transfer each pellet to a 2-ml Eppendorf tube. 8. Add 1 ml 100 mM glycine, pH 3.0; mix and then spin at 10,000 g for 30 sec. Remove the supernatant and wash one time with 1 ml 100 mM Tris pH 8.0; mix and spin. Expose beads to glycine buffer for as short a time as possible. 9. Resuspend beads in 1 ml PBS with 0.01% thimerosal for each tube. Remove 100 µl of supernatant to check later (C). To check the efficiency of conjugation, the amount of remaining IgG can be detected in the supernatant (A, B, and C) by Western blot. With the above protocol, the conjugated antibodies with protein A-sepharose are usually stable for >1 year at 4˚C.

ACKNOWLEDGMENTS This work was supported in part by National Institutes of Health (AG 17593) and the Foundation for Neurologic Diseases. I would like to thank many of my colleagues at the Center for Neurologic Diseases, especially Dr. Dennis Selkoe, who fosters a superb research environment.

REFERENCES 1. Selkoe, D.J. The genetics and molecular pathology of Alzheimer’s disease, in Neurologic Clinics: Dementia, DeKosky, S.T. et al., Eds., W.B. Saunders, Philadelphia, 2000, 18, 903–921. 2. Selkoe, D.J. and Podlisny, M.B. Deciphering the genetic basis of Alzheimer’s disease. Annu. Rev. Genomics Hum. Genet. 3, 67–99, 2002. 3. Selkoe, D.J. Cell biology of the amyloid β-protein precursor and the mechanism of Alzheimer’s disease. Annu. Rev. Cell Biol. 10, 373–403, 1994. 4. Kang, J. et al. The precursor of Alzheimer’s disease amyloid A4 protein resembles a cell-surface receptor. Nature 325, 733–736, 1987. 5. Goate, A. et al. Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer’s disease. Nature 349, 704–706, 1991. 6. Hendriks, L. et al. Presenile dementia and cerebral haemorrhage linked to a mutation at codon 692 of the β-amyloid precursor protein gene. Nature Genet. 1, 218–221, 1992. 7. Levy, E. et al. Mutation of the Alzheimer’s disease amyloid gene in hereditary cerebral hemorrhage, Dutch-type. Science 248, 1124–1126, 1990. 8. van Broeckhoven, C. et al. Amyloid β-protein precursor gene and hereditary cerebral hemorrhage with amyloidosis (Dutch). Science 248, 1120–1122, 1990.



9. Mullan, M. et al. A pathogenic mutation for probable Alzheimer’s disease in the APP gene at the N-terminus of β-amyloid. Nature Genet. 1, 345–347, 1992. 10. Eckman, C. et al. A new pathogenic mutation in the APP gene (I716V) increases the relative proportion of Aβ 42(43). Human Mol. Genet. 6, 2087–2089, 1997. 11. Chartier-Harlin, M.C., Crawford, F., and Houlden, H. Early-onset Alzheimer’s disease caused by mutations at codon 717 of the β-amyloid precursor protein gene. Nature 353, 844–846, 1991. 12. Murrell, J., Farlow, M., Ghetti, B., and Benson, M.D. A mutation in the amyloid precursor protein associated with hereditary Alzheimer’s disease. Science 254, 97–99, 1991. 13. Neve, R.L., Finch, E.A., and Dawes, L.R. Expression of the Alzheimer amyloid precursor gene transcripts in the human brain. Neuron 1, 669–677, 1988. 14. Citron, M. et al. Mutation of the β-amyloid precursor protein in familial Alzheimer’s disease increases β-protein production. Nature 360, 672–674, 1992. 15. Cai, X.D., Golde, T.E., and Younkin, G.S. Release of excess amyloid β protein from a mutant amyloid β protein precursor. Science 259, 514–516, 1993. 16. Citron, M. et al. Excessive production of amyloid β-protein by peripheral cells of symptomatic and presymptomatic patients carrying the Swedish familial Alzheimer’s disease mutation. Proc. Natl. Acad. Sci. USA 91, 11993–11997, 1994. 17. Scheuner, D. et al. Secreted amyloid β-protein similar to that in the senile plaques of Alzheimer’s disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked to familial Alzheimer’s disease. Nature Med. 2, 864–870, 1996. 18. Suzuki, N. et al. An increased percentage of long amyloid β protein secreted by familial amyloid β protein precursor (βAPP717) mutants. Science 264, 1336–1340, 1994. 19. Games, D. et al. Alzheimer-type neuropathology in transgenic mice overexpressing V717F β-amyloid precursor protein. Nature 373, 523–527, 1995. 20. Hsiao, K. et al. Correlative memory deficits, Aβ elevation, and amyloid plaques in transgenic mice. Science 274, 99–102, 1996. 21. Vassar, R. et al. β-secretase cleavage of Alzheimer’s amyloid precursor protein by the transmembrane aspartic protease BACE. Science 286, 735–741, 1999. 22. Sinha, S. et al. Purification and cloning of amyloid precursor protein β-secretase from human brain. Nature 402, 537–540, 1999. 23. Yan, R. et al. Membrane-anchored aspartyl protease with Alzheimer’s disease β-secretase activity. Nature 402, 533–537, 1999. 24. Lin, X. et al. Human aspartic protease memapsin 2 cleaves the β-secretase site of β-amyloid precursor protein. Proc. Natl. Acad. Sci. USA 97, 1456–1460, 2000. 25. Seubert, P. et al. Secretion of β-amyloid precursor protein cleaved at the aminoterminus of the β-amyloid peptide. Nature 361, 260–263, 1993. 26. Haass, C. et al. Amyloid β-peptide is produced by cultured cells during normal metabolism. Nature 359, 322–325, 1992. 27. Shoji, M. et al. Production of the Alzheimer amyloid β protein by normal proteolytic processing. Science 258, 126-129, 1992. 28. Lammich, S. et al. Constitutive and regulated α-secretase cleavage of Alzheimer’s amyloid precursor protein by a disintegrin metalloprotease. Proc. Natl. Acad. Sci. USA 96, 3922–3927, 1999. 29. Buxbaum, J.D. et al. Evidence that tumor necrosis factor alpha converting enzyme is involved in regulated α-secretase cleavage of the Alzheimer amyloid protein precursor. J. Biol. Chem. 273, 27765–27767, 1998.



30. Esch, F.S. et al. Cleavage of amyloid β-peptide during constitutive processing of its precursor. Science 248, 1122–1124, 1990. 31. Sisodia, S.S., Koo, E.H., Beyreuther, K., Unterbeck, A., and Price, D.L. Evidence that β-amyloid protein in Alzheimer’s disease is not derived by normal processing. Science 248, 492–495, 1990. 32. Haass, C., Hung, A.Y., Schlossmacher, M.G., Teplow, D.B., and Selkoe, D.J. β-Amyloid peptide and a 3-kDa fragment are derived by distinct cellular mechanisms. J. Biol. Chem. 268, 3021–3024, 1993. 33. Bretz, R. and Staubli, W. Detergent influence on rat-liver galactosyl transferase activities towards different acceptors. Eur. J. Biochem. 77, 181–192, 1977. 34. Weidemann, A. et al. Identification, biogenesis and localization of precursors of Alzheimer’s disease A4 amyloid protein. Cell 57, 115–126, 1989. 35. Oltersdorf, T. et al. The Alzheimer amyloid precursor protein: identification of a stable intermediate in the biosynthetic/degradative pathway. J. Biol. Chem. 265, 4492–4497, 1990. 36. Haass, C. et al. Swedish mutation causes early-onset AD by β-secretase cleavage within the secretory pathway. Nature Med. 1, 1291–1296, 1995.



2

Assays for Analysis of APP Secretion and Recycling Markus P. Kummer, Tsuneo Yamazaki, and Edward H. Koo

CONTENTS Abstract 2.1 Introduction 2.2 Main Scheme of Approaches 2.3 Methods 2.3.1 Iodination of Antibody 2.3.2 Preparation of Cells 2.3.3 Kinetics of Secretion and Endocytosis of APP 2.3.4 Steady State Level of APP Endocytosis 2.3.5 Recycling of APP 2.3.6 Morphological Analysis 2.4 Discussion Acknowledgments References

ABSTRACT The trafficking of the amyloid precursor protein (APP) involves the concomitant secretion and endocytosis of APP from the cell surface. In addition, APP recycles between the endocytic compartment and the cell surface. This complex sequence of events can be studied by a reliable and reproducible assay based on the binding of a radiolabeled APP antibody. Using this technique, the secretion and internalization of APP can be measured simultaneously under normal and perturbated conditions in APP transfected cells. Furthermore, this method is readily adaptable to morphologically examine the pathways of APP trafficking from the cell surface.

0-8493-2245-6/05/$0.00+$1.50 © 2005 by CRC Press



2.1 INTRODUCTION APP is a type I membrane protein that undergoes constitutive shedding both intracellularly and at the cell surface to release a large secreted ectodomain derivative (sAPP). APP is transported in the secretory pathway from the golgi to the plasma membrane where it can be cleaved by α-secretase to release the N terminal APP ectodomain (sAPPα) or internalized and transported to the endosomal–lysosomal pathway. APP trafficking has been actively investigated in order to determine the cellular sites where Aβ is generated. From these studies, a major pathway of Aβ generation is from APP that is processed following internalization from the cell surface in the endocytic pathway, although the precise organelles where β- and γ-secretase cleavages take place remain to be defined.1 APP internalization is mediated via clathrin-coated pits2,3 in the canonical receptor-mediated endocytic pathway. Recently, however, it has been shown that a fraction of APP is associated with detergent-resistant membranes and that lipid rafts are apparently sites of Aβ production as well.4–7 Whether raft-associated APP is internalized and, if so, whether this pool subsequently merges with the nonraft pool is unclear. Following internalization, a fraction of APP returns to the cell surface for additional rounds of endocytosis or secretion. The internalization signal for APP resides within its cytoplasmic domain and belongs to the NPXY-type signal, one of several well-recognized motifs. This signal is present in APP, β-integrin, and low density lipoprotein receptor (LDLR) protein family members among others, and controls the rapid internalization of these integral membrane proteins.8 Although this signal represents the minimal amino acid sequence shared by all these proteins, it may be not sufficient for efficient internalization. In LDLR, an additional aromatic amino acid residue upstream of the NPXY motive has become an accepted signal for internalization. In the case of APP, the signal is mediated by the longer GYENPTY sequence. Mutagenesis studies of this motif revealed that the predominant signal lies in the YENP tetrapeptide.9 Several cytosolic adaptor proteins such as Fe65, X11, and the mammalian Dab1 bind to the cytoplasmic YENPTY motif via their phosphotyrosine interaction domains.10–12 They affect the subcellular trafficking and proteolytic processing of APP in different ways. Fe65, for example, increases the secretion of APP and promotes A secretion, whereas X11 retards APP catabolism and inhibits Aβ secretion.13,14

2.2 MAIN SCHEME OF APPROACHES The analysis of APP processing in the endocytic pathway has been difficult because of the concurrent secretion and internalization of APP molecules from the cell surface. The assay described presents a reliable and reproducible method to measure the secretion of sAPP and APP internalization from the cell surface simultaneously. Radiolabeled antibodies have been successfully used as surrogates to natural ligands to investigate the internalization of other transmembrane receptors like LDLR, transferrin, CD4, or macrophage Fc receptors.15–18 This protocol contains the procedure for radioiodination of the monoclonal APP antibody, 1G7, and four variations for analyzing the trafficking of APP (Figure 2.1).



Incubation with radiolabeled antibody

at 37°C

Steady-state level of internalization (method 2.3.4)

at 4°C

Labeling of cell surface pool Wash and incubate at 37°C

Cool to 4°C, acid wash, warm to 37°C

Recycled molecules (method 2.3.5)

Kinetics of secretion and internalization (method 2.3.3)

FIGURE 2.1 Schematical overview about the different methods to characterize APP trafficking using a radiolabeled antibody.

The first method describes a pulse/chase experiment to analyze the kinetics of APP secretion and internalization. In the second method, APP internalization is investigated under steady state conditions. The third method addresses the recycling of APP to the cell surface. The fourth and final is a morphological approach to examine APP internalization. These methods using the monoclonal antibody 1G7 have been successfully applied to determine the trafficking of APP in a variety of cells including primary neurons and transfected CHO, B103, and N2a cell lines.9,19–21

2.3 METHODS 2.3.1 IODINATION

OF

ANTIBODY

The monoclonal antibody 1G7 was raised against human APPs purified from APPtransfected CHO cells and recognizes an epitope in the extracellular domain of APP between residues 380 and 665, as defined by its reactivity against a bacterial fusion protein with this sequence, thereby excluding both the KPI and Aβ domains.19 The specificity of this antibody for APP was demonstrated previously by immunoprecipitation and immunofluoresence studies.1,22 The 1G7 antibody is radioiodinated using IODO-GEN precoated iodination tubes (Pierce, Rockford, IL; #28601). This method results in indirect labeling without contact of the antibody to the iodination reagent, thereby reducing oxidative damage



to the antibody. Excessive iodine is finally removed by gel filtration, typically with a disposable NAP-5 (Sephadex G-25) column (Amersham Biosciences, Piscataway, NJ; #17-0853-01). The entire procedure must be performed in an approved protective hood to avoid uptake of free radioactive iodine. 1. Pre-equilibrate a NAP-5 column with 10 ml of Dulbecco’s phosphatebuffered saline (DPBS). 2. Rinse an IODO-GEN-coated iodination tube with 0.5 ml DPBS. 3. Add 300 µl DPBS directly to the bottom of the tube. Add 1 mCi Na125I in 10 mM NaOH. Incubate for 6 min, gently swirling the tube every 30 sec. This step results in the generation of iodous ions (I+) by oxidation of iodide (I–) by the iodination reagent. 4. Remove and add the activated iodide to 200 µl DPBS containing 100 µg of 1G7 antibody in a new screw cap tube. The final volume with the activated iodide solution is 500 µl. 5. Incubate the mixture for 6 min, gently flicking the tube every 30 sec. During this incubation, iodous ions undergo electrophilic attack at the ortho ring positions of tyrosine residues. 6. Remove the labeling solution and add it to a pre-equilibrated NAP-5 column. Drain the column and discard the flow-through. 7. Elute the column with 980 µl DPBS. Add 20 µl of 100 mg/ml crystalline BSA as a carrier protein to a final concentration of 2 mg/ml. 8. Determine radiospecific activity of the labeled antibody in a gamma counter. Typically, the radiospecific activity will be 7,500 to 15,000 cpm/fmol (3 to 6 µCi/µg) when 66 nm (100 µg) of antibody is labeled by this procedure. In our experience, the antibody is stable for up to 4 weeks when stored at 4˚C.

2.3.2 PREPARATION

OF

CELLS

APP-transfected cells are seeded in 12 well plates 48 hr before the assay and grown to confluence. Nonspecific binding by the antibody and the endogenous APP signal are subtracted by analyzing untransfected cells grown in parallel. Alternatively, radiolabeled antibody binding can be competed with excess cold antibody.

2.3.3 KINETICS

OF

SECRETION

AND

ENDOCYTOSIS

OF

APP

This protocol examines the trafficking of APP by pulse/chase analysis. A population of surface APP molecules is initially bound to radiolabeled antibody at 4˚C and is then, after removal of unbound antibody, allowed to transit when rewarmed to 37˚C. At various time points, the supernatant containing the secreted APP is collected and any remaining antibody is removed from the cell surface by acid washes. Finally, the cell pellet is lysed (acid resistant fraction) to obtain the internalized APP fraction and all samples are measured in a gamma counter.



1. Chill the cells on ice to stop membrane trafficking. 2. Wash the cells twice with 2 ml of ice cold binding medium consisting of RPMI containing 20 mM HEPES (pH 7.5) supplemented with 0.2% bovine serum albumin. 3. Add approximately 0.4 µg 125I-IG7 antibody in 400 µl binding medium per well (~7 nM final) and allow binding of the antibody for 1 hr on ice. The Kd for this reaction is 1.23 nM for a CHO cell line stably overexpressing APP.19 Therefore, this concentration is at least fivefold the concentration needed for half-maximal saturation. 4. Wash the cells twice with binding medium and twice with ice cold DPBS. 5. Place the cells in 2 ml of prewarmed medium and incubate at 37˚C for various periods. 6. Collect the medium and chill cells rapidly by adding 2 ml of ice cold DPBS at pH 2.5. Incubate the cells for another 5 min. Collect the supernatant, repeat the acidic wash to remove residual surface-bound antibody and pool both supernatants. The acid wash detaches 90 to 95% of cell surface-bound antibody 7. Lyse the cells by adding 2 ml of 0.2 N NaOH. 8. Measure the radioactivity of all fractions in a gamma counter. To calculate the specific binding, the radioactivity from untransfected control cells is subtracted from the counts obtained from the transfected cells in each condition. The results obtained at each time point are expressed as a percentage of total radioactivity from the three fractions (medium, acid wash and cell lysate). The anticipated result should show a rapid release of sAPP into the medium with a half life of 10 min. Consequently, cell surface APP recovered by the two acid washes should rapidly decline and remain at low levels. The remaining cell surface APP is internalized within 10 min of rewarming to 37˚C. The internalized pool declines concurrently with an increase in the secreted pool, because of recycling of APP to the cell surface and subsequent secretion into the medium. After 30 min, the secreted pool remains stable whereas the internalized fraction declines, presumably because of degradation. If the experiment is prolonged to more than 30 min, one should take into account that some of the radiolabeled antibody may be degraded and therefore free radioactivity-liberated. Under these circumstances, the medium and cell lysate should first be precipitated with trichloroacetic acid to recover the antibody-bound radioactivity only. As a consequence of the precipitation, the total radioactivity will be less than 100%.

2.3.4 STEADY STATE LEVEL

OF

APP ENDOCYTOSIS

To measure the rate of APP endocytosis under steady state conditions, the radiolabeled antibody is allowed to bind at 37˚C, resulting in a concomitant uptake of radioiodinated antibody by APP internalization. This follows the method established for assessing



the internalization of transferrin receptor under steady state conditions. After incubation, the cell surface-bound pool is removed by acid washes whereas the internalized fraction is recovered by cell lysis. This straightforward method is a facile approach for comparing the efficiency of APP endocytosis in cell lines transfected with different APP mutants or constructs of other proteins that may affect APP internalization. 1. Wash the cells twice with prewarmed binding medium. 2. Add approximately 7 nmol 125I-IG7 antibody in 400 µl binding medium per well and allow binding and internalization of the antibody for 30 to 60 min at 37˚C. 3. Chill the cells on ice and wash the cells four times with ice cold DPBS. 4. Remove the cell surface-bound antibody by two consecutive washes with 2 ml of ice cold DPBS at pH 2.5 for 5 min each on a shaker and pool both supernatants. 5. Lyse the cells by adding 2 ml of 0.2 N NaOH. 6. Measure the radioactivity of both fractions in a gamma counter. The radioactivity from untransfected control cells is subtracted from the counts resulting from the transfected cells to obtain specific binding values. The results are expressed as percents of the cell lysate (acid-resistant) and cell surface (acid-labile) fractions to reflect the percent of APP internalized from the cell surface.

2.3.5 RECYCLING

OF

APP

Internalized APP recycles and is secreted 10 to 30 min after endocytosis.19 The amounts of APP and secreted APP released from the endocytosed pool are analyzed by incubation of the cells with radioiodinated antibody at 37˚C and subsequent removal of any cell surface-bound antibody by acid washes. After rewarming the medium containing secreted APP is collected and cell surface APP is detached by two consecutive acid washes. The medium is precipitated with trichloroacetic acid to recover the antibody-bound radioactivity only. 1. Wash the cells twice with prewarmed binding medium. 2. Add approximately 7 nmol 125I-IG7 antibody in 400 µl binding medium per well and allow binding and internalization of the antibody for 15 min at 37˚C. 3. Wash the cells four times with ice cold DPBS. 4. Remove the cell surface-bound antibody by two consecutive washes with 2 ml of ice cold DPBS at pH 2.5 for 3 min each and discard the supernatants. 5. Wash the cells twice with ice cold binding medium, then add prewarmed medium and return cells to the 37˚C incubator. 6. Collect the medium after 5 to 30 min. Precipitate the medium with TCA. 7. Lyse the cells by adding 2 ml of 0.2 N NaOH. 8. Measure the radioactivity of both fractions in a gamma counter.



To obtain the specific binding, the radioactivity from untransfected control cells is subtracted from the counts resulting from the transfected cells. The radioactivity from the medium is computed after precipitation with trichloroacetic acid to measure the antibody-bound radioactivity. The results are expressed as radioactivity from the TCA precipitation as a percentage of the radioactivity from both fractions (lysate and TCA precipitate). The expected result should be a gradual increase of APP in the medium over 30 min, suggesting that internalized APP and therefore the bound radiolabeled antibody are recycled to the cell surface and secreted into the medium. In contrast to that, the counts in the pellets should decrease.

2.3.6 MORPHOLOGICAL ANALYSIS To visualize directly the trafficking routes of cell surface APP, immunofluorescence detection of APP antibody added to living cells combined with suitable organelle markers is a straightforward method to morphologically evaluate the internalization pathways of APP localization sites. However, it is important to be aware that the antibody may induce perturbations to the normal internalization pathways. To avoid cross-linking of cell surface APP, the results from whole antibody should be confirmed with Fab fragments or with other antibodies recognizing different epitopes. The choice of cell types is also an important consideration. The ideal cells should be adherent and have large cytoplasms for easy visualization. Importantly, the cells must remain adherent during the many washes and incubations on ice. Rat hippocampal neurons cultured at low density are also suitable, but the neuritic processes are easily damaged during the procedure. The following is our standard protocol for visualizing internalization of cell surface APP in CHO cells. 1. CHO cells stably transfected with APP 751 are grown on coverslips and cultured in standard medium. 2. The cells are chilled on ice for 15 min and washed with ice cold DPBS to stop membrane trafficking. 3. Coverslips are then incubated with anti-APP monoclonal antibodies (1G7 alone or combined with 5A3) in cold DPBS for 1 hr on ice. 4. The cells are washed 5 times with cold DPBS and then incubated with prewarmed regular medium for various times (0 to 60 min) at 37°C. The cells are then fixed with cold 4% formaldehyde (freshly prepared from paraformaldehyde) in PBS for 15 min. 5. Following fixation, the cells are permeabilized for 5 min with 0.3% Triton X-100 in PBS, washed 3 times with PBS, and incubated with fluorescein isothionate (FITC)-conjugated anti-mouse secondary antibody for 1 hr at room temperature. 6. If desired, double labeling with another antibody, such as to organelle marker, can be used at this point. 7. The cover slips are mounted on slide glasses and visualized with conventional epifluorescence or confocal microscopy.



2.4 DISCUSSION In this chapter, we have described assays based on the binding of a radioiodinated or unlabeled monoclonal antibody to investigate the aspects of APP trafficking in cultured cells. The use of an antibody for kinetic analysis of APP trafficking from the cell surface may be the only possible approach because of the lack of a physiological soluble ligand for APP at the cell surface. Biotinylation of cell surface APP is possible but this would be very cumbersome for obtaining kinetic information. The 1G7 antibody used in this protocol has been shown to bind to cell surface APP in a saturable and competitive manner. This antibody is also not labile at 37°C, i.e., not readily detached from APP. Other APP antibodies recognizing the extracellular region of APP can certainly be used, but these same parameters should be tested first. Additionally, the concentration for half-maximal saturation should be measured by Scatchard plot analysis to determine the antibody concentration necessary for the assay. To verify that the experimental conditions do not result in a general perturbation of endocytosis, the internalization of another transmembrane protein should be measured. In this case, the uptake of transferrin by the transferrin receptor is frequently used as a control.21 For this purpose bovine holo-transferrin (Sigma) is iodinated as described and added to the cells exactly as described by Zuk et al.23 In summary, the approach described in this chapter provides rapid and accurate estimates for APP secretion and endocytosis as well as morphological assessment of the internalization pathways. In this way, the complex APP trafficking pathways in neurons and non-neural cells can be analyzed. In particular, the influence of mutations within the cytoplasmic domains of APP or the impacts of cytosolic APP binding proteins on the processing of APP can be determined.

ACKNOWLEDGMENTS This work was supported in part by NIH Grant AG 12376. We thank Drs. Christian Haass, Claus Pietrzik, Ruth Perez, and Dennis Selkoe for helpful discussions.

REFERENCES 1. Koo, E.H. and Squazzo, S.L. Evidence that production and release of amyloid betaprotein involves the endocytic pathway. J. Biol. Chem. 269, 17386, 1994. 2. Nordstedt, C. et al. Identification of the Alzheimer beta/A4 amyloid precursor protein in clathrin-coated vesicles purified from PC12 cells. J. Biol. Chem. 268, 608, 1993. 3. Yamazaki, T., Koo, E.H., and Selkoe, D.J. Trafficking of cell-surface amyloid betaprotein precursor. II. Endocytosis, recycling and lysosomal targeting detected by immunolocalization. J. Cell Sci. 109, 999, 1996. 4. Simons, M. et al. Cholesterol depletion inhibits the generation of beta-amyloid in hippocampal neurons. Proc. Natl. Acad. Sci. USA 95, 6460, 1998. 5. Aplin, A.E. et al. Effect of increased glycogen synthase kinase-3 activity upon the maturation of the amyloid precursor protein in transfected cells. Neuroreport 8, 639, 1997.



6. Bouillot, C. et al. Axonal amyloid precursor protein expressed by neurons in vitro is present in a membrane fraction with caveolae-like properties. J. Biol. Chem. 271, 7640, 1996. 7. Ehehalt, R. et al. Amyloidogenic processing of the Alzheimer beta-amyloid precursor protein depends on lipid rafts. J. Cell Biol. 160, 113, 2003. 8. Bonifacino, J.S. and Traub, L.M. Signals for sorting of transmembrane proteins to endosomes and lysosomes. Annu. Rev. Biochem. 72, 395, 2003. 9. Perez, R.G. et al. Mutagenesis identifies new signals for beta-amyloid precursor protein endocytosis, turnover, and the generation of secreted fragments, including Abeta42. J. Biol. Chem. 274, 18851, 1999. 10. Borg, J.P. et al. The phosphotyrosine interaction domains of X11 and FE65 bind to distinct sites on the YENPTY motif of amyloid precursor protein. Mol. Cell. Biol. 16, 6229, 1996. 11. Fiore, F. et al. The regions of the Fe65 protein homologous to the phosphotyrosine interaction/phosphotyrosine binding domain of Shc bind the intracellular domain of the Alzheimer’s amyloid precursor protein. J. Biol. Chem. 270, 30853, 1995. 12. Howell, B.W. et al. The disabled 1 phosphotyrosine-binding domain binds to the internalization signals of transmembrane glycoproteins and to phospholipids. Mol. Cell. Biol. 19, 5179, 1999. 13. Borg, J.P. et al. The X11alpha protein slows cellular amyloid precursor protein processing and reduces Abeta40 and Abeta42 secretion. J. Biol. Chem. 273, 14761, 1998. 14. Sabo, S.L. et al. Regulation of beta-amyloid secretion by FE65, an amyloid protein precursor-binding protein. J. Biol. Chem. 274, 7952, 1999. 15. Pelchen-Matthews, A., Armes, J.E., and Marsh, M. Internalization and recycling of CD4 transfected into HeLa and NIH3T3 cells. EMBO J. 8, 3641, 1989. 16. Mellman, I.S. et al. Internalization and degradation of macrophage Fc receptors during receptor-mediated phagocytosis. J. Cell Biol. 96, 887, 1983. 17. Hopkins, C.R. and Trowbridge, I.S. Internalization and processing of transferrin and the transferrin receptor in human carcinoma A431 cells. J. Cell Biol. 97, 508, 1983. 18. Beisiegel, U. et al. Monoclonal antibodies to the low density lipoprotein receptor as probes for study of receptor-mediated endocytosis and the genetics of familial hypercholesterolemia. J. Biol. Chem. 256, 11923, 1981. 19. Koo, E.H. et al. Trafficking of cell-surface amyloid beta-protein precursor. I. Secretion, endocytosis and recycling as detected by labeled monoclonal antibody. J. Cell Sci. 109, 991, 1996. 20. Soriano, S. et al. Expression of beta-amyloid precursor protein-CD3gamma chimeras to demonstrate the selective generation of amyloid beta(1-40) and amyloid beta(142) peptides within secretory and endocytic compartments. J. Biol. Chem. 274, 32295, 1999. 21. Pietrzik, C.U. et al. The cytoplasmic domain of the LDL receptor-related protein regulates multiple steps in APP processing. EMBO J. 21, 5691, 2002. 22. Yamazaki, T., Selkoe, D.J., and Koo, E.H. Trafficking of cell surface beta-amyloid precursor protein: retrograde and transcytotic transport in cultured neurons. J. Cell Biol. 129, 431, 1995. 23. Zuk, P.A. and Elferink, L.A. Rab15 mediates an early endocytic event in Chinese hamster ovary cells. J. Biol. Chem. 274, 22303, 1999.



3

Strategies for Crystallizing the N-Terminal Growth Factor Domain of Amyloid Precursor Protein William J. McKinstry, Susanne C. Feil, Denise Galatis, Roberto Cappai and Michael W. Parker

CONTENTS Abstract 3.1 Introduction 3.2 Overview of Approach 3.3 Bioinformatics Analysis of APP 3.4 Biological Roles of GFD 3.5 Previous Crystallization Studies 3.6 Expression of Recombinant GFD in Pichia pastoris. 3.6.1 Materials 3.6.2 Method for Cloning 3.6.3 Method for Expression 3.7 Purification of GFD 3.7.1 Method 3.8 Crystallization of GFD 3.8.1 Materials 3.8.2 Method 3.9 Discussion Acknowledgments References

ABSTRACT The normal physiological roles of amyloid precursor protein (APP) remain largely unknown despite much research. A knowledge of APP function will not only provide insights into the genesis of Alzheimer’s disease, but may also prove vital in the development of an effective therapy. Here we describe our strategies for determining the three-dimensional atomic structure of APP, highlighting our work on the N-terminal growth factor domain. 0-8493-2245-6/05/$0.00+$1.50 © 2005 by CRC Press



3.1 INTRODUCTION The normal physiological function of amyloid precursor protein (APP) remains largely unknown although a number of studies suggest that it acts as a cell surface receptor. APP shares a similar architecture,1 cellular orientation, and localization2,3 to known (type I) cell surface receptors. APP mutations associated with familial Alzheimer’s disease (FAD) cause constitutive activation of Go, a member of the heteromeric G protein family whose members serve as signal tranducers of cell surface receptors.4 It has been suggested that the FAD mutations may interfere with the possible dimerization of APP that leads to signal transduction, as may be the case with other cell surface receptors. The APP cytoplasmic domain binds to a number of proteins consistent with the possibility that APP functions as a receptor involved in signal transduction. For example, this domain binds to Fe65 protein, a protein related to oncogenic signal transducers.5 Other binding partners have been discovered including APP-BP1,6 X11,7 UV-DDB,8 Tip60,9 Numb,10 and ShcA/Grb2.11 Another series of studies have shown that an antibody directed toward the APP N-terminal domain stimulates G protein and MAP kinase activity.12,13 The antibody is presumably mimicking the action of a still-to-be-identified physiological ligand. The APP gene has been knocked out in mice, resulting in reduced body mass, reduced locomotor activity, and in some cases gliosis, indicating impaired neuronal function.14 In summary, current knowledge suggests APP is a potential Go-coupled receptor with ligand-regulated function, although the physiological roles of APP remain to be established. The uncertainty about the normal physiological roles of APP led us to embark on a structural investigation of the molecule. The availability of an atomic structure of APP might greatly aid studies directed toward understanding the normal functions of APP and might also prove useful for the design of novel therapeutics to combat Alzheimer’s disease.

3.2 OVERVIEW OF APPROACH APP represents a difficult target for crystallization. It is a heterogeneous membrane protein with multiple glycosylation, phosphorylation, and sulfation sites. Membrane proteins are very difficult to crystallize and only a small fraction of all protein crystal structures are of this type. In the case of APP, this problem can be circumvented by expressing APP fragments missing the transmembrane anchor. Highly heterogeneous proteins are difficult to crystallize and thus it is a common practice to minimize heterogeneity wherever possible. The heterogeneity of the protein bought about by glycosylation can be minimized or eliminated by glycosylases or mutating out potential glycosylation sites. Excessive phosphorylation can be overcome with the judicious use of phosphatases. APP is likely to be a highly mobile protein since it consists of numerous domains (see below). Multidomain proteins can be difficult to crystallize as protein flexibility can interfere with the crystallization process. A common strategy to overcome this problem is to target smaller fragments that might be more amenable to crystallization.



The structure of the entire molecule can then be constructed by assembling the individual structures together.

3.3 BIOINFORMATICS ANALYSIS OF APP Before we embarked on crystallization studies, an in-depth analysis of the APP primary structure was carried out. Such an analysis can be very useful in deciding what fragments should be expressed and purified for crystallization trials. APP is a 90- to 130-kDa protein that is conserved among animal species and is expressed and secreted from a variety of tissues (see References 15 and 16 for reviews). There are at least 10 isoforms of APP due to alternative splicing of a single gene. The predominant isoform in neuronal tissues is a 695-amino acid protein. Its amino acid sequence reveals it is an integral membrane protein with a single transmembrane domain near the C-terminal end of the molecule (Figure 3.1). APP molecules from a variety of organisms have been sequenced. The locations of putative domains in the primary structure of APP have been determined based on extensive sequence alignments, secondary structure predictions, and database searches for similar sequences (Figure 3.1). The most highly conserved region of the molecule occurs at the N-terminal end, a cysteine-rich region that includes a heparin-binding domain (D1 or growth factor domain, GFD) and a metal-binding domain (D2 or copper binding domain, CuBD). All APP isoforms contain highly acidic domains; 45% of their residues are either Asp or Glu (D3). Two larger isoforms, APP751 and APP770, include an additional exon that encodes a domain with sequence similarity to a Kunitz protease inhibitor domain (KPI).17,18 The APP770 isoform also possesses a domain (D5) with similarity to the MRC OX-2 antigen, a neuronal membrane glycoprotein belonging to the immunoglobulin superfamily.18 Next is a 275-amino acid stretch that secondary structure predictions suggest consists of two domains: a highly helical domain (D6a) and a domain of little regular structure D1 growth factor

NH2-

D2 D3 CuBD acidic

115

100

D4 D5 KPI OX-2

56 19

D6 heparin binding

275

Αβ

D8 TM cytoplasmic

24 46 -COOH

β_ γ CHO membrane anchor clathrin secretase binding sites Go binding

FIGURE 3.1 Domain structure of APP. Domains are labeled D1 to D8 and the number of residues in each domain is indicated. The three-dimensional structure of GFD is shown as an alpha-carbon trace at the N-terminal end of the molecule. Known locations of carbohydrate attachment are denoted by “CHO.” Sites of proteolytic degradation are marked by Greek letters. The transmembrane (TM) is highlighted by dark shading. The location of the proteolytic breakdown product, Aβ, is also indicated.



(D6b). The transmembrane (TM) region and cytoplasmic tail (D8) are located at the C-terminal end of the molecule.

3.4 BIOLOGICAL ROLES OF GFD The N-terminal region of APP, including GFD, has previously been shown to stimulate neurite outgrowth19 and regulate synaptogenesis.20 Furthermore, an antibody directed toward GFD stimulates G protein and MAP kinase activity.12,13 GFD has a known heparin-binding site.19 Heparan sulfate proteoglycans may play a key role in Alzheimer’s disease pathogenesis: exogenous heparin induces APP production and amyloidogenic secretion21 and a number of heparin-binding growth factors are expressed at increased levels in the brains of affected patients.22 Small heparin fragments have been proposed as possible drugs in preventing or retarding the disease.23 To learn more about this critical domain, we determined its three-dimensional structure by x-ray crystallography.

3.5 PREVIOUS CRYSTALLIZATION STUDIES We presented our original crystallization of GFD in 1999.24 We expressed a fragment of APP consisting of residues 18 to 350 and hence encompassing the putative N terminal domain, copper-binding domain and acidic-rich region of the molecule (Figure 3.1). Our intention was to crystallize the intact fragment but trace proteases generated a smaller fragment in the crystallization trials. Nevertheless, the smaller fragment yielded well diffracting crystals that led to the structural determination of GFD. N-terminal sequencing and mass spectrometry revealed the crystals consisted of a proteolytic breakdown product, residues 23 to 128. The final atomic model consisted of residues 28 to 123 indicating that residues 23 to 27 and 124 to 128 were too mobile to be seen in the electron density maps calculated from x-ray diffraction patterns generated from the crystals. To obtain better crystals of GFD, we decided to express GFD alone. We chose domain boundaries based on the crystal structure and omitted the most flexible regions to enhance the chances of obtaining high quality crystals (see below). We have now shown that expression of a fragment consisting of residues 28 to 123 crystallizes identically to the longer length fragment and the details are presented below.

3.6 EXPRESSION OF RECOMBINANT GFD IN PICHIA PASTORIS Recombinant secreted GFD (APP residues 28 to 123) was produced in the methylotrophic yeast Pichia pastoris using standard molecular biology protocols and P. pastoris protocols (Invitrogen, Carlsbad, CA). We chose the P. pastoris system as it offered high-level expression in a eukaryotic cell. In the first step, GFD was cloned into the P. pastoris expression plasmid pIC9 and then introduced into the P. pastoris cells as described below.



3.6.1 MATERIALS The following media were used: 1. Yeast extract peptone dextrose (YPD) medium consisting of 1% (w/v) bacto yeast extract, 2% (w/v) peptone, and 2% (w/v) glucose. 2. Minimal methanol (MM) medium consisting of 1.34% (yeast nitrogen base without amino acids, 4 × 10-5% w/v) biotin and 2.0% (v/v) methanol. 3. Buffered methanol complex (BMMY) consisting of MM plus 1% (w/v) bacto yeast extract, 2% w/v peptone in 0.1 M phosphate buffer, pH 6.0. 4. Minimal dextrose (MD) plates, consisting of 1.34% (yeast nitrogen base without amino acids, 4 × 10-5% w/v) biotin, 1% dextrose, and 15 g agar for 1 liter. 5. Yeast extract peptone methanol (YPM) consisting of 1% (w/v) bacto yeast extract, 2% (w/v) peptone, and 3% (v/v) methanol.

3.6.2 METHOD

FOR

CLONING

1. The DNA encoding GFD is generated by polymerase chain reactin (PCR) using primers GGTCGACAAAAGAGAGGCTCTGCTGGCTGAACCCCAGATTG and GAATTCTTATACAAACTCACCAACTAAG. 2. The PCR product is cloned as a Xho1-EcoR1 fragment into the P. pastoris vector pIC9 (Invitrogen). 3. The construct is linearized with BglII prior to transformation into P. pastoris strain GS115 by electroporation. 4. A 5-ml quantity of GS115 is grown overnight in YPD in a 50-ml conical flask at 30oC. 5. On the following day, inoculate the overnight culture into 500 ml YPD in a 2-liter flask. Grow to OD600 of 1.3 to 1.5. 6. Centrifuge (1500 × g for 5 min) and resuspend cells in 500 ml ice cold water. 7. Centrifuge and resuspend in 250 ml ice-cold water. 8. Centrifuge and resuspend in 20 ml ice-cold 1 M sorbitol. 9. Centrifuge and resuspend in 1 ml ice-cold 1 M sorbitol. 10. Mix 80 µl of cells with 10 µg linearized pIC9-GFD DNA in a 0.2-cm electroporation cuvette on ice. Electroporate according to manufacturer’s recommended conditions for yeast. 11. Cells are spread onto MD plates and grown at 30oC for 2 to 5 days. 12. Colonies are grown in 5 ml YPD for 2 days, centrifuged and then grown in 1 ml BMMY for 2 days. 13. Expressing clones are identified by silver stain sodium dodecyl sulfate– polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the culture supernatants. The expressing clones are then grown in culture to produce large amounts of GFD for crystallography and biological assays as described below.


3.6.3

METHOD

FOR

EXPRESSION

1. Shaker flask cultures are grown by inoculating a suitable high-level expression clone into 500 ml YPD in a 2-liter baffled flask. 2. Cultures are grown for 48 hr at 3oC on an orbital shaker (250 rpm) to a cell density between 45 and 60 × 107 cells/ml (optical density of 15 to 20 at 600 nm). 3. Cells are harvested by centrifugation (2000 × g for 5 min), resuspended in 500 ml YPM, and grown for 48 hr at 30ºC on an orbital shaker (250 rpm). 4. Condition media containing the expressed GFD are harvested by centrifugation (14000 × g for 30 min) and filtered through a 0.45-µm filter.

3.7 PURIFICATION OF GFD GFD is known to bind heparin,19 and this property was used to purify the protein from the cell supernatants. Purification was performed using a Beckman 510 Protein Purification Workstation (Beckman Instruments, Fullerton, CA) fitted with a singlechannel wavelength detector tuned to 280 nm and a 1-cm path length analytical flow cell.

3.7.1 METHOD 1. A heparin–hyperD column (1.6 × 12 cm, Biosepra S.A., Cergy Saint Christophe, France) is equilibrated in 10 mM sodium phosphate buffer, pH 7.0, at a flow rate of 2.5 ml/min. The column is washed with equilibration buffer until the baseline returns to zero. 2. The supernatant is loaded directly onto the heparin–hyperD column. 3. Bound proteins are eluted with a 250-ml linear 0 to 2.0 M NaCl gradient in column equilibration buffer. 4. Next, 5-ml fractions are collected and analyzed by both SDS-PAGE and immunoblotting using a monoclonal antibody that recognizes this domain.12,13,25 5. Fractions containing GFD are pooled and buffer-exchanged into 20 mM Tris HCl, pH 8.0. 6. A QHyperD anion exchange column (4.6 × 100 mm, Biosepra S.A.) is equilibrated with 20 mM Tris HCl, pH 8.0. 7. The pooled fractions from the heparin column are loaded onto the QHyperD column and bound proteins eluted with a 50-ml linear gradient of NaCl (0 to 500 mM) in column equilibration buffer. 8. GFD elutes at a concentration of 50 mM NaCl. 9. The purified GFD will be >99% pure as judged by Coomassie blue staining of an overloaded SDS–polyacrylamide gel (Figure 3.2). 10. The purified GFD is concentrated between 4 and 5 mg/ml for crystallization trials. Care must be taken to maintain the purified GFD at 4oC because the protein readily forms microcrystals if allowed to warm up.


FIGURE 3.2 GFD purity as assessed by SDS-PAGE and Coomassie blue staining. Molecular weight markers are shown in the left column, with their masses in kDa.

3.8 CRYSTALLIZATION OF GFD Proteins can be made to crystallize by the addition of certain precipitants such as salts and organic solvents, most commonly ammonium sulfate or polyethylene glycol, under unusually precise conditions of pH, temperature and protein concentration. Many factors can influence successful crystallization including protein and precipitant concentrations, ionic strength, vibration, protein flexibility, protein purity, small molecule additives, temperature, and so on. The detailed physics behind crystallization are not well understood. The process is usually considered in terms of phase diagrams where the vertical axis corresponds to the protein solubility and the horizontal axis refers to some experimental parameter such as pH or precipitant concentration. Consider the behavior of a typical protein solution. At low protein and precipitant concentrations, the protein stays in solution (i.e., it is undersaturated). As the concentration of protein or precipitant increases, the protein becomes less soluble until supersaturation occurs whereby the protein comes out of solution as either an amorphous precipitate or as ordered crystals. All crystallization experiments for APP were conducted using the hanging drop vapor diffusion method.26 The wells of a tissue culture tray were filled with a precipitant solution and a mixture of protein and precipitant solution was applied to the surface of a coverslip that was then placed over the well of a culture dish, the drop facing down (Figure 3.3). The protein and precipitant in the drop slowly become more concentrated and a point is reached when the protein reaches supersaturation and will form an amorphous precipitate or crystal nuclei. When the precipitate or crystals form, the protein concentration decreases. Crystals may begin to form at any time, from the start of the equilibration process until long after equilibrium has been reached, and may form after precipitation of the protein has occurred.



Hanging Drop

Cover Slip

Reservoir

FIGURE 3.3 Crystallization by the vapor diffusion hanging drop method. (Courtesy of Geoffrey Kong.)

The point of supersaturation is governed by the protein and the type of precipitant used. The rate of equilibration is governed by temperature, drop size, and the type of precipitant used. The protein in the drop only becomes more concentrated if the precipitant or salt concentration is higher in the well. It is not possible to determine a priori what conditions will be required for the crystallization of a new protein. Many possible crystallization conditions could have been tested and trials were carried out using large screens under many different conditions. The crystallization protocol for GFD is explained below.

3.8.1 MATERIALS 1, Tissue culture plates are available from ICN Biochemicals, Inc. (Aurora, OH). 2. Chemicals for crystallization may be obtained from Fluka (Buchs, Switzerland) or Sigma-Aldrich (Sydney, Australia). 3. Amicon protein microconcentrators may be obtained from Amicon, Inc. (Beverly, MA).

3.8.2 METHOD 1. The purified protein is dialyzed into 5 mM Tris HCl buffer, pH 7.5. 2. The protein is concentrated to 10 mg/ml in Amicon concentrators. 3. Take a tissue culture plate and fill the reservoirs with 1 ml of solutions containing from 18 to 26% (w/w) PEG 10K (steps of 2%) and 100 mM HEPES buffer, ranging from pH 7.0 to 8.0 (steps of 0.5 pH units). 4. Grease the rims of the wells with petroleum jelly. 5. Mix 2 µl of protein with 2 µl of reservoir solution on a cover slip and hang the cover slip over 1 ml of reservoir solution. 6. Store the trays in a constant temperature room set to 22°C. 7. Crystals should appear in a number of the drops after 4 days. 8. The crystals take 2 weeks to grow to maximal dimensions of approximately 0.2 × 0.2 × 0.4 mm (Figure 3.4).



FIGURE 3.4 Crystals of GFD. The largest crystal is 0.3 mm in its longest dimension.

3.9 DISCUSSION The availability of well-diffracting crystals was the vital first step in determining the three-dimensional atomic structure of GFD by x-ray crystallography.26 GFD was found to adopt a compact, globular fold consisting of nine β-strands and one α-helix tethered together by three disulfide bridges (Cys 38 to Cys 62; Cys 73 to Cys 117; Cys 98 to Cys 105; see Figure 3.5). Sequence alignments of APP orthologues and paralogues show their GFD regions are well conserved with sequence identities ranging from 36 to 84%; all the cysteine residues are strictly conserved. This suggests that the fold described here is maintained across the APP family. An electrostatic calculation based on the three-dimensional structure demonstrated a highly positively charged surface on one side of the domain including a peptide region, residues 96 to 110, that was previously identified as part of a heparinbinding site.19 Maintenance of the disulfide bridge in this region is critical for neurite outgrowth19 and activation of MAP kinase,27 suggesting that the conformation of the loop is important. The surface is dominated by the β-hairpin loop (residues 96 to 110) representing the most mobile region of the structure. The overall fold of the GFD did not resemble any protein of known three-dimensional structure. However, like APP, a number of growth factors also possess disulfide-bonded β-hairpin loops implicated in proteoglycan binding. These include midkine,28 hepatocyte growth factor29 and vascular endothelial growth factor.30 In all cases, the loop is long, flexible, and highly charged with basic residues. These properties appear ideal for binding heparin oligosaccharides where the flexibility would allow induced fit binding via the positively charged residues around the sulfate moieties of the carbohydrate.


FIGURE 3.5 Structure of GFD. A ribbon diagram indicating the location of secondary structure with helices as coils and β-strands as arrows. The disulfide bridges are shown in ball-and-stick form and the tip of the β-hairpin loop is indicated. This figure was drawn with MOLSCRIPT.34

The extracellular domain of APP has been shown to be a potent mediator of thyrocyte proliferation31 and can potentiate the phosphorylation of the tyrosine kinase (trkA) receptor caused by nerve growth factor binding.32 The N-terminal cysteinerich region can inhibit platelet activation33 emphasizing the role of this region in modulating cellular pathways and function. Presumably, the growth-promoting activity of APP is expressed after it is released from membranes through the action of secretases. In conclusion, the structural similarities to some growth factors in concert with the known growth promoting properties of APP and its N-terminal domain led to the conclusion that GFD can be classified as a new member of the cysteine-rich growth factor superfamily.



ACKNOWLEDGMENTS This work was supported by grants from the National Health and Medical Research Council of Australia to R.C. and M.W.P. W.J.M. is a NHMRC Industry Fellow and M.W.P. is a NHMRC Senior Principal Research Fellow.

REFERENCES 1. Kang, J. et al. The precursor of Alzheimer’s disease amyloid A4 protein resembles a cell-surface receptor. Nature 325, 733, 1987. 2. Weidemann, A. et al. Identification, biogenesis, and localization of precursors of Alzheimer’s disease A4 amyloid protein. Cell 57, 115, 1989. 3. Schubert, W. et al. Localization of Alzheimer beta A4 amyloid precursor protein at central and peripheral synaptic sites. Brain Res. 563, 184, 1991. 4. Okamoto, T. et al. Intrinsic signaling function of APP as a novel target of three V642 mutations linked to familial Alzheimer’s disease. EMBO J. 15, 3769, 1996. 5. Zambrano, N. et al. Interaction of the phosphotyrosine interaction/phosphotyrosine binding-related domains of Fe65 with wild-type and mutant Alzheimer’s beta-amyloid precursor proteins. J. Biol. Chem. 272, 6399, 1997. 6. Chow, N. et al. APP-BP1, a novel protein that binds to the carboxyl-terminal region of the amyloid precursor protein. J. Biol. Chem. 271, 11339, 1996. 7. Borg, J.P. et al. The phosphotyrosine interaction domains of X11 and FE65 bind to distinct sites on the YENPTY motif of amyloid precursor protein. Mol. Cell. Biol. 16, 6229, 1996. 8. Watanabe, T. et al. A 127-kDa protein (UV-DDB) binds to the cytoplasmic domain of the Alzheimer’s amyloid precursor protein. J. Neurochem. 72, 549, 1999. 9. Cao, X. and Südhof., T.C. A transcriptionally active complex of APP with Fe65 and histone acetyltransferase Tip60. Science 293, 115, 2001. 10. Roncarati, R. et al. The gamma-secretase-generated intracellular domain of betaamyloid precursor protein binds Numb and inhibits Notch signaling. Proc. Natl. Acad. Sci. USA 99, 7102, 2002. 11. Russo, C. et al. Signal transduction through tyrosine-phosphorylated C-terminal fragments of amyloid precursor protein via an enhanced interaction with Shc/Grb2 adaptor proteins in reactive astrocytes of Alzheimer’s disease brain. J. Biol. Chem. 277, 35282, 2002. 12. Okamoto, T. et al. Ligand-dependent G protein coupling function of amyloid transmembrane precursor. J. Biol. Chem. 270, 4205, 1995. 13. Murayama, Y. et al. Cell surface receptor function of amyloid precursor protein that activates Ser/Thr kinases. Gerontology 42, 2, 1996. 14. Zheng, H. et al. beta-Amyloid precursor protein-deficient mice show reactive gliosis and decreased locomotor activity. Cell 81, 525, 1995. 15. Hendriks, L. and Van Broeckhoven, C. A beta A4 amyloid precursor protein gene and Alzheimer’s disease. Eur. J. Biochem. 237, 6, 1996. 16. Mattson, M.P. Cellular actions of beta-amyloid precursor protein and its soluble and fibrillogenic derivatives. Physiol. Revs. 77, 1081, 1997. 17. Kitaguchi, N. et al. Novel precursor of Alzheimer’s disease amyloid protein shows protease inhibitory activity. Nature 331, 530, 1988. 18. Ponte, P. et al. A new A4 amyloid mRNA contains a domain homologous to serine proteinase inhibitors. Nature 331, 525, 1988.



19. Small, D.H et al. A heparin-binding domain in the amyloid protein precursor of Alzheimer’s disease is involved in the regulation of neurite outgrowth. J. Neurosci. 14, 2117, 1994. 20. Morimoto, T. et al. Involvement of amyloid precursor protein in functional synapse formation in cultured hippocampal neurons. J. Neurosci. Res. 51, 185, 1998. 21, Leveugle, B. et al. Heparin promotes beta-secretase cleavage of the Alzheimer’s amyloid precursor protein. Neurochem. Int. 30, 543, 1997. 22. Fenton, H. et al. Hepatocyte growth factor (HGF/SF) in Alzheimer’s disease. Brain Res. 779, 262, 1998. 23. Leveugle, B. et al. Heparin oligosaccharides that pass the blood–brain barrier inhibit beta-amyloid precursor protein secretion and heparin binding to beta-amyloid peptide. J. Neurochem. 70, 736, 1998. 24. Rossjohn, J. et al. Crystal structure of the N-terminal, growth factor-like domain of Alzheimer amyloid precursor protein. Nature Struct. Biol. 6, 327, 1999. 25. Hilbich, C. et al. Amyloid-like properties of peptides flanking the epitope of amyloid precursor protein-specific monoclonal antibody 22C11. J. Biol. Chem. 268, 26571, 1993. 26. McPherson, A., Crystallization of Biological Macromolecules, Cold Spring Harbor Laboratory Press, New York, 1999. 27. Greenberg, S.M. et al. Amino-terminal region of the beta-amyloid precursor protein activates mitogen-activated protein kinase. Neurosci. Lett. 198, 52, 1995. 28. Iwasaki, W. et al. Solution structure of midkine, a new heparin-binding growth factor. EMBO J. 16, 6936, 1997. 29. Zhou, H. et al. The solution structure of the N-terminal domain of hepatocyte growth factor reveals a potential heparin-binding site. Structure 6, 109, 1998. 30. Fairbrother, W.J. et al. Solution structure of the heparin-binding domain of vascular endothelial growth factor. Structure 6, 637, 1998. 31. Pietrzik, C.U. et al. From differentiation to proliferation: the secretory amyloid precursor protein as a local mediator of growth in thyroid epithelial cells. Proc. Natl. Acad. Sci. USA 95, 1770, 1998. 32. Akar, C.A. and Wallace, W.C. Amyloid precursor protein modulates the interaction of nerve growth factor with p75 receptor and potentiates its activation of trkA phosphorylation. Mol. Brain. Res. 56, 125, 1998. 33. Henry A. et al. Inhibition of platelet activation by the Alzheimer’s disease amyloid precursor protein. Br. J. Haematol. 103, 402, 1998. 34. Kraulis, P.J. MOLSCRIPT: a program to produce both detailed and schematic plots of proteins. J. Appl. Crystallogr. 24, 946, 1991.


2245_C004.fm Page 41 Wednesday, November 3, 2004 3:20 PM

4

Analysis of Amyloid Precursor Protein Processing Protease β-Secretase: Tools for Memapsin 2 (β-Secretase) Inhibition Studies Gerald Koelsch, Vajira Weerasena, Dongwoo Shin, Arun K. Ghosh, and Jordan Tang

CONTENTS 4.1 4.2 4.3

Introduction Assay of Memapsin 2 Activity Synthesis of Memapsin 2 Inhibitors Based on APP Sequence 4.3.1 N-(tert-butoxycarbonyl)-L-leucine-N′-methoxy-N′-methylamide (3) 4.3.2 N-(tert-butoxycarbonyl)-L-leucinal (4) 4.3.3 Ethyl (4S,5S)- and (4R,5S)-5-[(tert-butoxycarbonyl)amino]-4hydroxy-7-methyloct-2-ynoate (5) 4.3.4 (5S,1′S)-5-[1′-[(tert-Butoxycarbonyl)amino]-3′-methylbutyl]dihydrofuran-2(3H)-one (7) 4.3.5 (3R,5S,1′S)-5-[1′-[(tert-butoxycarbonyl)amino)]-3′-methylbutyl]-3 methyl dihydrofuran-2(3H)-one (8) 4.3.6 (2R,4S,5S)-5-[(tert-Butoxycarbonyl)amino]-4-[(tertbutyldimethylsilyl)oxy ]-2,7-dimethyloctanoicacid (9) 4.3.7 (2R,4S,5S)-5-[(fluorenylmethyloxycarbonyl)amino]-4-[(tertbutyldimethyl silyl)oxy]-2,7-dimethyloctanoic acid (10) 4.3.8 Coupling of Di-Isostere in Solid-Phase Peptide Synthesis 4.4 Determination of Inhibition Constants 4.5 Summary References

0-8493-2245-6/05/$0.00+$1.50 © 2005 by CRC Press



4.1 INTRODUCTION

Fluorescence Intensity

Memapsin 2 (BACE, ASP-2) is the membrane-anchored aspartic protease that processes APP at the β-secretase site.1–5 The resulting C terminal fragment, C99, is further processed by γ-secretase to produce amyloid-β (Aβ) peptide.6 Since Aβ is intimately related to the pathogenesis of Alzheimer’s disease, a great deal of interest surrounds the design and testing of memapsin 2 inhibitors. The first potent transition state inhibitor of memapsin 2, OM99-2 (Figure 4.1), was designed based on a slightly modified sequence around the β-secretase processing site of APP Swedish mutant.7 This inhibitor had a Ki of 1.6 nM. When the complete subsite specificity of memapsin 2 was determined,8 the most preferred residues were used to design OM00-3 (Figure 4.2) which had a Ki of 0.3 nM.9 The crystal structures of these inhibitors bound to the catalytic unit of memapsin 2 have been reported.10,11 These structures define the interactions of the protease active sites with the inhibitors and also predict the locations of the APP substrate binding positions during the hydrolysis. Memapsin 2 is a type I transmembrane protein with the catalytic domain located on the lumenal face of the plasma membrane.1–5 Likewise, its most notorious substrate, APP, has the same topology as the β-secretase cleavage site located within 28 amino acids of the plasma membrane surface. In vivo memapsin 2 may be regulated by factors including expression, post-translational modifications and membrane component compositions such as “lipid rafts” and endocytotic and vesicular trafficking to acidic compartments such as endosomes. Nonetheless, small peptide substrates representing the β-secretase cleavage site in APP are capably cleaved by memapsin 2,5,12 demonstrating the independence of in vivo biochemical regulation from its fundamental proteolytic function. Similarly, retroviral proteases demonstrate complex in vivo characteristics, requiring dimerization in the form of gag-pol precursor proteins with subsequent activation from these precursor multiproteins. These proteases are still able to cleave peptide substrates in vitro and autoprocess a mini-precursor form of the protease.13,14 Despite the complexity of the in vivo environment of the retroviral proteases, clearly 0.35

0.30

0.25

0.20 0

50

100

150

200

Time (sec)

FIGURE 4.1 Continuous fluorescence assay of memapsin 2 activity using an Mca/Dnp internally quenched fluorogenic substrate. Memapsin 2 was incubated with substrate (3 µM) at pH 4.0, 37˚C and emission at 393 nm was monitored continuously with excitation at 328 nm. Increased fluorescence intensity over time indicates proteolysis of the substrate. Linear regression is used to determine the initial velocity (V0) of the uninhibited enzyme.



the development of potent HIV inhibitors has been successful using peptide-based in vitro enzyme assays. Thus it is likely that memapsin 2 inhibitors with pharmaceutical application for modulation of Aβ production may be developed from the assay of small peptide substrates that model the fundamental proteolytic function, superseding the complexity of the memapsin 2 function in vivo. The assay of memapsin 2 activity, syntheses of transition-state memapsin 2 inhibitors, and measurements of their potencies are described in the following sections.

4.2 ASSAY OF MEMAPSIN 2 ACTIVITY Continuous assay of memapsin 2 activity is a necessary prelude to the measure of its inhibition and permits rapid analysis of inhibition potency and determination of inhibition constants. An internally quenched fluorogenic substrate for memapsin 2 was designed to mimic the β-secretase cleavage site of APP (substrate FS-2 in Reference 12) with the sequence Mca–Ser–Glu–Val–Asn–Leu–Asp–Ala–Glu–Phe– Lys(Dnp)–NH2 [Mca–(Asn670, Leu671)–APP770 (667–675)–Lys(Dnp) amide] and is available from Bachem (Torrance, CA, #2485). It contains the (7-methoxycoumarin4-yl)acetyl fluorophore (Mca) at the amino terminus (effectively at the P6 position) and the quenching chromophore group N-2,4-dinitrophenyl (Dnp) attached to the ε-amino group of Lys in the P′5 position. Upon excitation of the Mca group at 328 nm, energy is transferred to the Dnp group with limited photon emission detectible at 393 nm (fluorescence resonance energy transfer or FRET). Cleavage of the intervening peptide results in diffusion of the two products, each containing a respective fluorophore and quenching chromophore group. This permits the excitation of the Mca group of the N-terminal product, resulting in unquenched emission at a wavelength of 393 nm (λex = 328 nm, λem = 393 nm). Increased fluorescence intensity at this excitation–emission wavelength pair allows continuous monitoring of proteolytic activity (Figure 4.1). Cleavage at the β-secretase site alone by memapsin 2 was confirmed by mass spectrometry.12 The assay of β-secretase activity using the Mca–Dnp substrate is accomplished by the addition of 1.75 ml 0.1 M sodium acetate, pH 4.0, to an aliquot of dimethyl sulfoxide (DMSO) in a 1.0 × 1.0-cm quartz cuvette thermostatted cell holder preequilibrated to 37˚C. The DMSO is added to the aliquot of sodium acetate such that the final DMSO concentration is 10% (including the amounts of substrate and inhibitor to be added, which are dissolved in DMSO). Memapsin 2 activity versus substrate FS-2 was found to be optimal at this concentration of DMSO.12 Memapsin 25,12 enzyme stock (typically 6 µM, 50 µl aliquot) is added, followed by substrate (20 µl of 300 µM stock FS-2 in DMSO; see Reference 12) to initiate the reaction (2 ml total volume). Fluorescence intensity over a 5-min period was monitored with excitation at 328 nm and emission at 393 nm, using a detector voltage of 700 V on an Aminco Bowman luminescence spectrometer. Fit of the linear portion of the signal to a linear model produces a typical signal of 10-3 fluorescence units per second (FU/sec). A typical time trace for hydrolysis of FS-2 by memapsin 2 is shown in Figure 4.1. The determined rate of reaction is proportional to the rate of cleavage of molar amounts of substrate per unit volume, but requires conversion of the observed initial



velocity (in FU/sec) using the response factor of known concentrations of fluorophore and the ratio of free flourophore to that of the cleavage product, due to the inner filter effect of intermolecular quenching.15 However, this correction is not necessary in the determination of the inhibition constant Kiapp (see below) because relative initial velocities are determined at a fixed substrate concentration.

4.3 SYNTHESIS OF MEMAPSIN 2 INHIBITORS BASED ON APP SEQUENCE Transition state theory indicates that an enzyme will bind most tightly to its substrate when the substrate adopts a conformation approximating the transition state in the progression toward product formation. Thus the enzyme induces or stabilizes the substrate in that conformation, lowering the activation energy to permit more frequent progression to product. Inhibition of this process is therefore best accomplished with compounds that mimic the transition state of the scissile bond and are thus potent inhibitors of β-secretase.16 Peptide-based inhibitors of β-secretase have been described by our laboratory.8,9,17 The synthesis of OM99-2 and OM00-3 consists of two major steps. The first is the synthesis of a Leu*Ala dipeptide transition state isostere (that will be referred to as the di-isostere; the asterisk represents the hydroxyethylene moiety) with appropriate protective groups. The second step is to use solid-phase peptide synthesis to incorporate the di-isostere into the inhibitor. The synthesis of the Leu*Ala di-isostere using commercial BOC-leucine as a starting material is outlined in Figure 4.2. The Fmoc-protected di-isostere (compound 10 in Figure 4.2) is inserted in a coupling step as for other amino acid residues in the peptide synthesis. In this manner, it is possible to develop inhibitors to exploit the substrate specificity of memapsin 29 by incorporating various standard or nonstandard amino acids into the peptide. Thus incorporation of the di-isostere in solidphase peptide synthesis creates a molecule endowed with the potential to inhibit memapsin 2 activity. Detailed steps for the synthesis of the Leu*Ala di-isostere are discussed in the following sections. The compound numbers appearing in parentheses in the headings below correspond to Figure 4.2.

4.3.1 N-(TERT-BUTOXYCARBONYL)-L-LEUCINE-N′-METHOXY-N′-METHYLAMIDE (3) To a stirred solution of N,O-dimethylhydroxyamine hydrochloride (5.52 g, 56.6 mmol) in dry dichloromethane (25 mL) under N2 atmosphere at 0˚C, 1-methylpiperidine (6.9 mL, 56.6 mmol) is added dropwise. The resulting mixture is stirred at 0˚C for 30 min. In a separate flask, N-(tert-butyloxycarbonyl)-L-leucine (BOC-leucine, 2) (11.9 g, 51.4 mmol) is dissolved in a mixture of THF (tetrahydrofuran, 45 mL) and dichloromethane (180 mL) under N2 atmosphere. The resulting solution is cooled to –20˚C. To this solution is added 1-methylpiperidine (6.9 mL, 56.6 mmol) followed by isobutyl chloroformate (7.3 mL, 56.6 mmol). The resulting mixture is stirred for 5 min at –20˚C and the above solution of N,O-dimethylhydroxyamine is added to it. The reaction mixture is kept at –20oC for



FIGURE 4.2 Scheme for synthesis of Leu*Ala di-isostere. Letters accompanying arrows refer to reagents and conditions: (a) LiAlH4, Et2O, –40oC, 30 min (86%); (b) LDA, HC≡C-CO2Et, THF, –78oC, 30 min, then 4, –78oC, 1 hr (42%); (c) H2, Pd-BaSO4, EtOAc; (d) AcOH, PhMe, reflux, 6hr (74%); (e) LiHMDS, MeI, THF, –78oC, 20 min (76%); (f) aqueous LiOH, THFH2O, 23oC, 10 hr; (g) TBDMSCl, imidazole, DMF, 24 hr (90%); (h) CF3CO2H, CH2Cl2, 0oC, 1.5 hr; (i) Fmoc-OSu, aqueous NaHCO3, dioxane, 23oC, 8 hr (61%).

30 min and then warmed to 23˚C. The reaction is quenched with water and the layers are separated. The aqueous layer is extracted with dichloromethane (3 × 100 mL). The combined organic layers are washed with 10% citric acid, saturated sodium bicarbonate, and brine. The organic layer is dried over anhydrous Na2SO4 and concentrated under the reduced pressure. The residue is purified by flash silica gel chromatography (25% ethyl acetate–hexane) to yield the title compound 3 as a pale yellow oil.



4.3.2 N-(TERT-BUTOXYCARBONYL)-L-LEUCINAL (4) To a stirred suspension of lithium aluminum hydride (770 mg, 20.3 mmol) in dry diethyl ether (60 mL) at –40oC under N2 atmosphere is added N-tert-butyloxycarbonyl-L-leucine-N′-methoxy-N′-methylamide (5.05 g, 18.4 mmol) in diethyl ether (20 mL). The resulting reaction mixture is stirred for 30 min, after which the reaction is quenched with 10% NaHSO4 solution (30 mL). The resulting reaction mixture is then warmed to 23˚C and stirred at that temperature for 30 min. The resulting solution is filtered and the filter cake is washed with two portions of diethyl ether. The combined organic layers are washed with saturated sodium bicarbonate and brine and dried over anhydrous MgSO4. Evaporation of the solvent under reduced pressure yields the title aldehyde 4 (3.41 g) as a pale yellow oil. The resulting aldehyde is used immediately without further purification.

4.3.3 ETHYL (4S,5S)- AND (4R,5S)-5-[(TERT-BUTOXYCARBONYL)AMINO]4-HYDROXY-7-METHYLOCT-2-YNOATE (5) To a stirred solution of diisopropylamine (1.1 mL, 7.9 mmol) in dry THF (60 mL) at 0oC under N2 atmosphere is added n-BuLi (1.6 M in hexane, 4.95 mL, 7.9 mmol) dropwise. The resulting solution is stirred at 0oC for 5 min and then warmed to 23˚C and stirred for 15 min. The mixture is cooled to –78oC and ethyl propiolate (801 µL) in THF (2 mL) is added dropwise over a period of 5 min. The mixture is stirred for 30 min, after which N-BOC-L-leucinal 4 (1.55 g, 7.2 mmol) in 8 mL of dry THF is added. The resulting mixture is stirred at –78oC for 1 hr, after which the reaction is quenched with acetic acid (5 mL) in THF (20 mL). The reaction mixture is warmed to 23˚C and brine solution is added. The layers are separated and the organic layer is washed with saturated sodium bicarbonate and dried over Na2SO4. Evaporation of the solvent under reduced pressure provides a residue that is purified by flash silica gel chromatography (15% ethyl acetate–hexane) to afford a 3:1 mixture of acetylenic alcohols 5.

4.3.4 (5S,1′′S)-5-[1′′-[(TERT-BUTOXYCARBONYL)AMINO]-3′′METHYLBUTYL]-DIHYDROFURAN-2(3H)-ONE (7) To a stirred solution of the above mixture of acetylenic alcohols (1.73 g, 5.5 mmol) in ethyl acetate (20 mL) is added 5% Pd–BaSO4 (1 g). The resulting mixture is hydrogenated at 50 psi for 1.5 hr. After this period, the catalyst is filtered off through a plug of Celite and the filtrate concentrated under reduced pressure. The residue is dissolved in toluene (20 mL) and acetic acid (100 µL). The reaction mixture is refluxed for 6 hr, after which the reaction is cooled to 23˚C and the solvent is evaporated to produce a residue purified by flash silica gel chromatography (40% diethyl ether–hexane) to yield the (5S,1S′)-γ-lactone 7 (0.94 g, 62.8%) and the (5R,1S′)-γlactone 6 (0.16 g, 10.7%).



4.3.5 (3R,5S,1′′S)-5-[1′′-[(TERT-BUTOXYCARBONYL)AMINO)]3′′-METHYLBUTYL]-3-METHYL DIHYDROFURAN-2(3H)-ONE (8) To a stirred solution of the lactone 7 (451.8 mg, 1.67 mmol) in dry THF (8 mL) at –78oC under N2 atmosphere is added lithium hexamethyldisilazane (3.67 mL, 1.0 M in THF) over a period of 3 min. The resulting mixture is stirred at –78oC for 30 min to generate lithium enolate. After this period, CH3I (228 µL) is added dropwise and the resulting mixture stirred at –78˚C for 20 min. The reaction is quenched with saturated aqueous NH4Cl solution and allowed to warm to 23˚C. The reaction mixture is concentrated under reduced pressure and the residue extracted with ethyl acetate (3 × 100 mL). The combined organic layers are washed with brine and dried over anhydrous Na2SO4. Evaporation of the solvent affords a residue that is purified by silica gel chromatography (15% ethyl acetate–hexane) to furnish the alkylated lactone 8 (0.36 g, 76%) as an amorphous solid.

4.3.6 (2R,4S,5S)-5-[(TERT-BUTOXYCARBONYL)AMINO]-4-[(TERTBUTYLDIMETHYLSILYL)OXY ]-2,7-DIMETHYLOCTANOICACID (9) To a stirred solution of lactone 8 (0.33 g, 1.17 mmol) in THF (2 mL) is added 1 N aqueous LiOH solution (5.8 mL). The resulting mixture is stirred at 23˚C for 10 hr, after which the reaction mixture is concentrated under reduced pressure and the remaining aqueous residue cooled to 0oC and acidified with 25% citric acid solution to pH 4. The resulting acidic solution is extracted with ethyl acetate (3 × 50 mL). The combined organic layers are washed with brine, dried over Na2SO4 and concentrated to yield the corresponding hydroxy acid (330 mg) as a white foam. This hydroxy acid is used directly for the next reaction without further purification. To the hydroxy acid (330 mg, 1.1 mmol) in anhydrous DMF is added imidazole (1.59 g, 23.34 mmol) and tert-butyldimethylchlorosilane (1.76 g, 11.67 mmol). The resulting mixture is stirred at 23˚C for 24 hr. After this period, MeOH (4 mL) is added and the mixture stirred for 1 hr. The mixture is then diluted with 25% citric acid (20 mL) and extracted with ethyl acetate (3 × 20 mL). The combined extracts are washed with water and brine and dried over anhydrous Na2SO4. Evaporation of the solvent produces a viscous oil that is purified by flash chromatography over silica gel (35% ethyl acetate–hexane) to afford the silyl protected acid 9.

4.3.7 (2R,4S,5S)-5-[(FLUORENYLMETHYLOXYCARBONYL)AMINO]4-[(TERT-BUTYLDIMETHYL SILYL)OXY]-2,7-DIMETHYLOCTANOIC

ACID

(10)

To a stirred solution of the acid 9 (0.17 g, 0.41 mmol) in dichloromethane (2 mL) at 0oC is added trifluoroacetic acid (500 µL). The resulting mixture is stirred at 0oC for 1 hr and an additional 500 µL of trifluoroacetic acid is added to the reaction mixture. The mixture is stirred for an additional 30 min and the progress of the reaction monitored by thin layer chromatography (TLC). After this period, the solvents are carefully removed under reduced pressure at a bath temperature not



exceeding 5oC. The residue is dissolved in dioxane (3 mL) and NaHCO3 (300 mg) in 5 mL of H2O. To this solution is added Fmoc-succinimide (166.5 mg, 0.49 mmol) in 5 mL of dioxane. The resulting mixture is stirred at 23˚C for 8 hr. The mixure is then diluted with H2O (5 mL) and acidified with 25% aqueous citric acid to pH 4. The acidic solution is extracted with ethyl acetate (3 × 50 mL). The combined extracts are washed with brine, dried over Na2SO4, and concentrated under reduced pressure to yield a viscous oil residue. Purification of the residue by flash chromatography over silica gel affords the Fmoc-protected acid 10.

4.3.8 COUPLING

OF

DI-ISOSTERE

IN

SOLID-PHASE PEPTIDE SYNTHESIS

The solid-phase peptide synthesis protocol may be utilized for the synthesis of inhibitors. The synthesis is initiated with Wang resin (0.3 mmol) precoupled with a carboxy terminal amino acid of choice and capped with a N-9-fluorenylmethyloxycarbonyl(Fmoc) alpha amino-protecting group. The coupling of N-Fmoc-Ala, isostere 10 is accomplished as follows. The removal of the N-Fmoc group from the peptide chain downstream of the di-isostere is carried out in 20% piperidine in dimethylforamide for 15 min. The peptide coupling reaction is accomplished with 2-(1Hbenzotriazol-1-yl) 1,1,3,3-tetramethyluronium tetrafluoroborate, 1-hydroxybenzotriazole and diisopropylethylamine (3.3 equivalents each) in N-methyl pyrolidine. After the di-isostere coupling, other Fmoc-protected derivatives are coupled. After the last residue coupling step, the peptide is cleaved from the solid-state resin using 95% trifluoroacetic acid, which also removes all the side chain-protecting groups including the silyl-group of 10. The inhibitors are purified in reversed-phase high performance liquid chromatography (HPLC) using a C18 column equilibrated in 0.1% trifluoroacetic acid in H2O with a linear gradient of acetonitrile from 0 to 25% over 25 min.

4.4 DETERMINATION OF INHIBITION CONSTANTS Because the inhibitors of interest are very potent and have Ki values in the nM range, the inhibition constants cannot be determined accurately by conventional steadystate kinetics. The inhibition constant Kiapp is determined from nonlinear regression of the model of Bieth.18 Proteolytic activity in the presence of inhibitor (Vi) and full activity free of inhibitor (V0) are measured with a constant concentration of the enzyme. The mixture of the enzyme and inhibitor is pre-equilibrated for 20 min and the reaction is initiated by the addition of the substrate. The relative activity (a) is the ratio of Vi /V0 and is determined at various concentrations of inhibitor. The apparent inhibition constant, Kiapp, may be determined from a plot of relative activity (a) versus [I] (Figure 4.3) based on Equation 1:

(

)

2

1 − I 0 +  E 0 + K iapp − I 0 +  E 0 + K iapp − 4 I 0  E 0 a= 2  E 0



Relative Activity

1.2 1.0 0.8 0.6 0.4 0.2 0.0 0

200

400

[I], nM

FIGURE 4.3 Determination of Kiapp from a profile of relative activity vs. inhibitor concentration. Initial velocities (Vi) were determined at various concentrations of inhibitor and expressed relative to the initial velocity of uninhibited control reaction (V0) (solid symbols). Nonlinear regression of the data (solid line) with Equation 1 determines Kiapp.

Nonlinear regression of the data with the above equation to obtain Kiapp may be accomplished using GraFit.19 Typically 5 to 10 determinations of relative activity over a range of [I] will produce an error of the fit to ±5 to 10%. Sensitivity of the model to [E]0 requires that the concentration of the enzyme stock be determined accurately. Simple conversion of optical density measurements at 280 nm may not provide accurate information. Rather it is preferred to determine the number of active sites by titration using a tight-binding inhibitor.20 The data from determination of [E]0 by this method may also be used to confirm the Kiapp value for the titrating inhibitor, using additional determinations at [I] beyond the range of the linear relationship between a and [I]. The obtained Kiapp measurement may be dependent upon substrate concentration [12] and may be corrected by the relationship:

(

K iapp = K i 1 + S  K m

)

4.5 SUMMARY Inhibitors of aspartic proteases may be developed from peptide substrate templates. In the case of memapsin 2, by employing the basic sequence of a good substrate from the APP Swedish mutant and the principle of a transition-state mimic,21 potent inhibitors like OM99-2 can be developed. In this chapter we provide basic methods for such work. The synthesis of a transition-state isostere in the place of the scissile peptide bond is essential for a tight-binding transition-state inhibitor. The synthetic procedure of a blocked two-residue isostere has the advantage that it can be used in standard solid-phase peptide synthesis of a long inhibitor. This approach is suitable to explore diverse amino acid sequences, including nonstandard amino acids.8,17 The second essential aspect in inhibitor development is the kinetic assay for inhibition potency. A fluorogenic substrate based on a slightly modified sequence of the APP Swedish mutant is described. This assay,12 based on the principle of fluorescence resonance energy transfer, is very sensitive and has been reliably used to determine competitive inhibition constants using a model for tight-binding inhibitors.8,17



REFERENCES 1. Vassar, R. et al. β-Secretase cleavage of Alzheimer’s amyloid precursor protein by the transmembrane aspartic protease BACE. Science 286, 735–741, 1999. 2. Sinha, S. et al. Purification and cloning of amyloid precursor protein β-secretase from human brain. Nature 402, 537–540, 1999. 3. Yan, R. et al. Membrane-anchored aspartyl protease with Alzheimer’s disease β-secretase activity. Nature 402, 533–537, 1999. 4. Hussain, I. et al. Identification of a novel aspartic protease (Asp 2) as β-secretase. Mol. Cell. Neurosci. 14, 419–427, 1999. 5. Lin, X. et al. Human aspartic protease memapsin 2 cleaves the β-secretase site of β-amyloid precursor protein. Proc. Natl. Acad. Sci. USA 97, 1456–1460, 2000. 6. Selkoe, D.J. Translating cell biology into therapeutic advances in Alzheimer’s disease. Nature 399A, 23–31, 1999. 7. Mullan, M. et al. A locus for familial early-onset Alzheimer’s disease on the long arm of chromosome 14, proximal to the alpha 1-antichymotrypsin gene. Nature Genet. 2, 340–342, 1992. 8. Ghosh, A.K. et al. Design of potent inhibitors for human brain memapsin 2 (β-secretase). J. Am. Chem. Soc. 122, 3522–3523, 2000. 9. Turner, R.T., III et al. Subsite specificity of memapsin 2 (β-secretase): implications for inhibitor design. Biochemistry 40, 10001–10006, 2001. 10. Hong, L. et al. Structure of the protease domain of memapsin 2 (β-secretase) complexed with inhibitor. Science 290, 150–153., 2000. 11. Hong, L. et al. Crystal structure of memapsin 2 (β-secretase) in complex with an inhibitor OM00-3. Biochemistry 41, 10963–10967, 2002. 12. Ermolieff, J. et al. Proteolytic activation of recombinant pro-memapsin 2 (pro-βsecretase) studied with new fluorogenic substrates. Biochemistry 39, 12450–12456, 2000. 13. Ermolieff, J., Lin, X., and Tang, J. Kinetic properties of saquinavir-resistant mutants of human immunodeficiency virus type 1 protease and their implications in drug resistance in vivo. Biochemistry 36, 12364–12370, 1997. 14. Co, E. et al. Proteolytic processing mechanisms of a miniprecursor of the aspartic protease of human immunodeficiency virus type I. Biochemistry 33, 1248–1254, 1994. 15. Liu, Y., Kati, W., Chen, C.-M., Tripathi, R., Molla, A., and Kohlbrenner, W. Use of a fluorescence plate reader for measuring kinetic parameters with inner filter effect correction. Anal. Biochem. 267, 331–335, 1999. 16. Ghosh, A.K., Hong, L., and Tang, J. β-Secretase as a therapeutic target for inhibitor drugs. Curr. Med. Chem. 9, 1135–1144, 2002. 17. Ghosh, A.K. et al. Structure-based design: potent inhibitors of human brain memapsin 2 (β-secretase). J. Med. Chem. 44, 2865–2868, 2001. 18. Bieth, J. Some kinetic consequences of the tight binding of protein-proteinase inhibitors to proteolytic enzymes and their application to the determination of dissociation constants, in Bayer Symposium V, Proteinase Inhibitors: Proceedings of the 2nd International Research Conference, Fritsch, H., Tschesche, H., and Greene, L.J., Eds., Springer-Verlag, Berlin, 1974, p. 463. 19. Leatherbarrow, R.J. GraFit Version 3.0, Erithacus Software Ltd., Staines, U.K., 1990. 20. Tomasselli, A.G. et al. Substrate analogue inhibition and active site titration of purified recombinant HIV-1 protease. Biochemistry 29, 264–269, 1990. 21. Marciniszyn, J., Jr., Hartsuck, J.A., and Tang, J. Mode of inhibition of acid proteases by pepstatin. J. Biol. Chem. 251, 7088–7093, 1976.



5

Assays for Amyloid Precursor Protein γ-Secretase Activity William A. Campbell, Michael S. Wolfe, and Weiming Xia

CONTENTS Abstract 5.1 Introduction 5.2 Main Scheme of Approaches 5.3 Method 5.3.1 Assaying γ-Secretase Activity in Living Cells 5.3.2 Subcellular Fractionation of Membrane Vesicles 5.3.3 In Vitro γ-Secretase Activity Assay Using Endogenous Substrate 5.3.4 Determining pH Dependence of γ-Secretase Activity Using Vesicles 5.3.5 Protease Inhibitor Profiling of γ-Secretase Activity Using Fractions 5.3.6 Cell Membrane Preparation for Exogenous Substrate Assay 5.3.6.1 Buffers 5.3.7 M2 Flag Purification of E. coli-Generated γ-Secretase Substrates 5.3.7.1 Buffers 5.3.8 In Vitro γ-Secretase Activity Assay Using Exogenous Substrate 5.4 Discussion References

ABSTRACT γ-Secretase cleavage, mediated by a complex of presenilin (PS), nicastrin, PEN-2, and APH-1, is the final proteolytic step in generating amyloid beta (Aβ) protein and the Notch intracellular domain. Aβ and Notch are critical in the pathogenesis of Alzheimer’s disease (AD) and in development, respectively. In addition to cleaving amyloid precursor protein (APP) and Notch, γ-secretase also cleaves over a dozen additional type I transmembrane domain proteins. γ-Secretase activity can be measured in vivo by collecting conditioned media from tissue cultured cells and in vitro 0-8493-2245-6/05/$0.00+$1.50 © 2005 by CRC Press



by incubating endogenous substrate with total microsomes or with Golgi/trans-Golgi network (TGN)-enriched microsomal vesicles or incubating recombinant substrate with solubilized membranes. For APP, Western blotting or enzyme-linked immunosorbent assay (ELISA) has been used to quantify the generation of Aβ40, Aβ42, and amyloid intracellular domain (AICD). These methods can be applied to study the γ-secretase cleavage of any γ-secretase substrate in a variety of experimental conditions.

5.1 INTRODUCTION Genetic and neuropathological studies suggest that processing of amyloid precursor protein (APP) to C99 and then to amyloid β protein (Aβ), the major component of destructive neuritic plaques found in brains of AD patients, plays an important role in the neuronal loss that leads to AD.1 The final proteolytic event in generating Aβ, which is mainly a 40- or 42-residue peptide, is accomplished through presenilin (PS)-dependent γ-secretase cleavage of the C99 peptide.1 In addition to APP, γ-secretase also cleaves over a dozen type I transmembrane proteins such as the Notch proteins involved in cell fate determination, ErbB4 tyrosine receptor kinase and cadherins.2–5 The growing list of γ-secretase substrates includes APP, Notch,2 E-cadherin and N-cadherin,5,6 ErbB4 tyrosine receptor kinase,4 CD44,7,8 Nectin1α,9 Delta and Jagged,10,11 LRP,12 DCC,13 APLP1 and APLP2,14–16 p75 neurotrophin receptor,17 Syndecan 3,18 glutamate receptor subunit 3,19 and colony stimulating factor 1.20 The biological significance of this cleavage is not clear in most cases, although one normal function may be to release intracellular domains that regulate gene transcription in the nucleus, in at least some cases. While absolute identification of the catalytic component of γ-secretase activity has been elusive, mounting evidence points to PS1 and PS2. Numerous studies have demonstrated that PS is necessary for γ-secretase cleavage and Aβ generation. For example, mutation of two critical aspartate residues in transmembrane (TM) domains 6 and 7 of PS1 or PS2 abolishes Aβ generation in cultured cells21–23 and in transgenic mice.24 PS knockout neurons do not produce any Aβ.25,26 PS1 and PS2 bind to the immediate substrates of γ-secretase, C99/C83, in the major sites of Aβ generation, i.e., Golgi/trans-Golgi network (TGN)-type vesicles.27 Finally, using aspartyl protease transition-state analogue γ-secretase inhibitors to probe the active site of the enzyme revealed that these inhibitors bind directly to PS N- and C-terminal fragments (NTF and CTF).28,29 PS and PS homologues also have nonclassic protease motifs conserved from bacteria to humans,30,31 and the sequence motifs of PS are similar to a signal peptide peptidase.32 Signal peptide peptidase forms a homodimer that is labeled by an active site-directed γ-secretase inhibitor, indicating that the active sites of signal peptide peptidase and PS/γ-secretase are similar.33 PS1 and PS2 are homologous eight transmembrane domain-spanning proteins that undergo constitutive endoproteolysis by an unknown enzyme termed presenilinase to generate functional stable heterodimers of NTF and CTF.34,35 Familial AD (FAD) mutations in PS1 or PS2 lead to increased production of the longer, more



amyloidogenic version of Aβ, the 42-residue version, Aβ42.34,36–41 Knockout of PS1 in mice is embryonic lethal.42 Conditional knockout of PS1 in the brain results in deficits of long-term potentiation and cognition43 while restricted expression of PS1 in the brain in the background of PS1 knockout mice leads to skin tumorigenesis.44 Many studies have implicated the PS fragments, along with mature Nicastrin, APH-1 (anterior pharynx defective), and PEN-2 (presenilin enhancer), as the functional components of the γ-secretase complex. N-linked glycosylation of nicastrin in the Golgi apparatus is associated with its entry into the active γ-secretase complex, and this mature form interacts preferentially with the functional PS1 heterodimers.45–50 Down-regulation of APH-151,52 or PEN-251,53 by RNAi in cells is associated with reduced levels of PS1 NTF and CTF heterodimers and deficient γ-secretase function. Overexpressing APH-1 stabilizes the full-length (FL) PS1, whereas reducing PEN-2 decreases endoproteolytic processing of PS1.54–56 Many reports have shown that co-expression of PS1, Nicastrin, APH-1, and PEN-2 results in increased PS1 endoproteolysis and γ-secretase activity, both in mammalian cells54–59 and in yeast.60 To measure γ-secretase activity, cell-based assays using the endogenous C99 substrate were used initially. Living cells can be treated with γ-secretase inhibitors and γ-secretase activity can be measured by release of soluble Aβ into the tissue culture medium. Using total membrane vesicles isolated from tissue culture cells, γ-secretase was found to be pH-dependent and showed maximal activity at pH between 6.3 and 6.4.61 After separation of intact, fully functional membrane vesicles from cultured cells on discontinuous Iodixanol gradients, γ-secretase activity was predominantly localized to Golgi/TGN-rich vesicles.62 PS bound to the immediate substrates of γ-secretase, the C-terminal fragments of APP, in these Golgi/TGN-rich vesicles.27 Subsequently, γ-secretase activity was solubilized to partially characterize its activity using a recombinant substrate containing an initiating methionine, C99, and a Flag epitope (C100Flag). Anti-PS1 antibodies were found to immunoprecipitate γ-secretase activity from these solubilized membranes.63 Next, a Notch-based substrate, N100Flag, was created using an N-terminal methionine, 99 residues of the Notch1 sequence beginning from the ligand-dependent S2 cleavage site, and a C-terminal Flag sequence.64 The C100Flag and N100Flag substrates were then used to further characterize the γ-secretase activity that cleaves APP and Notch.64,65 With the help of these substrates and the detergent-dependent assay, the presenilin–γ-secretase complex was isolated from solubilized membrane preparations in an activitydependent manner using an immobilized active site-directed inhibitor, and the complex was found to contain Nicastrin and C83.64 A comparison of C100Flag and N100Flag proteolysis suggested that the responsible proteases are identical, with each substrate preventing cleavage of the other, and both substrates being cleaved at two distinct regions in the transmembrane domain.65

5.2 MAIN SCHEME OF APPROACHES Characterization of γ-secretase activity can be obtained by cellular assays of γ-secretase activity and by detergent solubilization of γ-secretase. The assays described present reliable and reproducible methods to measure the cleavage of the C99



fragment of APP to generate Aβ40, Aβ42, and AICD, and should be applicable to measure the γ-secretase cleavage of any γ-secretase substrate. This protocol contains the procedures for analyzing γ-secretase activity in living cells in vitro using endogenous substrate in total membrane microsomes and in Golgi/TGN-rich fractions and in vitro using solubilized membranes and E. coligenerated recombinant γ-secretase substrates. The first method describes measuring Aβ secreted from living tissue culture cells. The second method describes the subcellular fractionation of membrane vesicles on discontinuous Iodixanol gradients to separate intact, functional ER-rich vesicles from Golgi/TGN-rich vesicles. In the third method, γ-secretase activity is measured in the Golgi/TGN-rich fractions. In the fourth method, the optimal pH for γ-secretase activity is determined using total membrane vesicles. The next method describes protease inhibitor profiling to discover the protease class of γ-secretase. The sixth method describes the preparation of solubilized cell membranes that retain functional γ-secretase enzymes. The seventh method describes the use of an M2 anti-Flag immunoaffinity isolation procedure to purify the γ-secretase substrates from E. coli. The last method details the γ-secretase activity assay using recombinant substrates. An outline of this scheme is presented in Figure 5.1. Subcellular fractionation of membrane organelles has been successfully used to measure γ-secretase activity in Golgi/TGN-rich vesicles.27,57,62,66,67 Solubilized γ-secretase has been used successfully to measure the cleavage of recombinant substrates C100Flag and N100Flag.63–65,68 Measuring secreted A β in living cells (Method 1)

Isolation of total microsomal membranes (Method 2) Endogenous substrate

Exogenous substrate

Subcellular fractionation (Method 2)

Cell membrane preparation (Method 6)

γ−secretase activity in Golgi/TGN-rich fractions Purification of substrates

(Method 3)

(Method 7)

pH dependence (Method 4)

Protease inhibitor profiling

γ−secretase activity in solubilized membranes

(Method 5)

(Method 8)

Western blot and/or ELISA

FIGURE 5.1 Methods discussed in this chapter.



5.3 METHOD 5.3.1 ASSAYING γ-SECRETASE ACTIVITY

IN

LIVING CELLS

The first method to measure γ-secretase activity presented here is accomplished by collecting conditioned media from cultured cells treated either with a vehicle control or a γ-secretase inhibitor. Treating living cells with a γ-secretase inhibitor causes an increase in the immediate substrates of γ-secretase, the APP CTF’s C99 and C83, and decreases the total amount of Aβ secreted into the tissue culture medium (Figure 5.2). 1. Culture cells to confluence. 2. Make stock concentrations of a γ-secretase inhibitor in 100% dimethyl sulfoxide (DMSO). 3. Dilute the γ-secretase inhibitor or vehicle (DMSO) into the tissue culture media to achieve the desired final concentration in 1% DMSO. 4. After a 4-hr incubation, collect the conditioned medium and centrifuge it at 10,000 × g for 5 min to pellet cells or cell debris. 5. Remove the supernatant and store it at –80˚C until analysis by ELISA. 6. The cells can be collected, lysed and subjected to immunoprecipitation with APP polyclonal antibody C7 followed by Western blot analysis with a. 14 0

10

20

30

40

50

Dose (uM)

Relative Aβ Total

b.

1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0

n=8

0

7.5 10 12.5 15 17.5 20 22.5 25

30 40

50

Dose (uM)

FIGURE 5.2 Treatment of living cells with a γ-secretase inhibitor increases APP CTFs (C-terminal fragments) and decreases the amount of Aβ secreted into the media. (a) Chinese hamster ovary cells overexpressing wild-type (wt) human APP were treated with increasing concentrations (µM) of γ-secretase inhibitor compound 1,73,74 and cell lysates were immunoprecipitated with APP polyclonal antibody C7 followed by Western blotting with APP monoclonal antibody 13G8 to visualize the APP C terminal fragments (i.e., γ-secretase substrates). (b) Aβ levels in the conditioned media of cells treated with increasing doses of compound 1 were determined by ELISA. Aβ levels in each experiment were normalized to mock-treated (1% DMSO) samples and averaged (n = 8). (Reprinted from Xia, W. et al. Neurobiol. Dis. 2000, 7, 673–681. With permission.)



APP monoclonal antibody 13G8 to visualize the APP C-terminal fragments (i.e., γ-secretase substrates). Polyclonal antibody C769 and monoclonal antibody 13G870 (gift of P. Seubert and D. Schenk) are directed against APP732–751 (APP751 numbering).

5.3.2 SUBCELLULAR FRACTIONATION

OF

MEMBRANE VESICLES

The fractionation employs discontinuous Iodixanol gradients that are used because they effectively separate ER- from Golgi/TGN-rich vesicles in a way that preserves vesicle structure and function, allowing detection of γ-secretase activity upon incubation of Golgi/TGN-rich vesicles at 37˚C.62,71 The viscosity of the gradient medium is a major determinant of the sedimentation rate. The osmotic activity of the medium is also important because subcellular organelles are osmotically sensitive. Thus, although sucrose, glycerol, and Ficoll are widely used for gradient fractionation of cellular membranes, they are not ideal in osmolality and viscosity. The main advantage of using an Iodixanol gradient is that osmolality and viscosity remain relatively constant with changes in the density of the gradient. Under this mild iso-osmotic condition, each organelle can be isolated functionally intact, without loss of water, as the density of the gradient increases. 1. Culture five 15-cm dishes until confluent (~1 × 108 cells). 2. Detach the cells with 20 mM EDTA in PBS (8 mL/15-cm plate). 3. Pellet the cells by spinning for 5 min at 4˚C, 1000 rpm. The cell pellet can be frozen at –80˚C indefinitely. 4. Resuspend the cell pellet in 3 mL of cold homogenization buffer (0.25 M sucrose, 10 mM HEPES, 1 mM EDTA) with freshly added protease inhibitors. 5. Break open the cells with ten strokes of a Dounce homogenizer and pass the cells through a 27-gauge needle five times. 6. Pellet the nuclei and unbroken cells by centrifugation at 1500 × g for 10 min at 4˚C. Save the postnuclear supernatant. 7. Extract the pellet again by resuspending in 4 mL of homogenization buffer and centrifuge at 1500 × g for 10 min at 4˚C. Save the postnuclear supernatant. 8. Combine the two supernatants and centrifuge for 1 hr at 65,000 × g, 4˚C, to pellet total membrane vesicles. 9. For measuring γ-secretase activity in total vesicles, the vesicles are washed in 0.1 M sodium carbonate (pH 11.3) on ice to remove peripherally associated membrane proteins and centrifuged at 100,000 × g for 1 hr. The vesicle precipitate is then resuspended in incubation buffer (10 mM KOAc, 1.5 mM MgCl2). One portion is lysed with Laemmli sample buffer (10% SDS, 0.3 M Tris, 50% glycerol, 0.1% bromophenol blue, 10% β-mercaptoethanol) for Western blot or 2X guanidium HCl (1 M guanidium HCl, 2% NP-40, 2 mM EDTA) for ELISA for basal γ-secretase activity. The other portion is incubated at 37˚C for de novo γ-secretase activity (see below).



10. For separation of ER- and Golgi/TGN-rich vesicles, the membrane vesicles are used to prepare subcellular fractions by resuspending the microsomal pellet in 800 µL of homogenization buffer on ice. Different percentages of Iodixanol, 5,59-[(2-hydroxy-1-3- propanediyl)-bis(acetylamino)]bis[N,N-9-bis(2,3-dihydroxypropyl-2,4,6-triiodo-1,3-benzenecarboxamide] are made by diluting with OptiPrep (Accurate Chemical, Westbury, NY, 60% Iodixanol). 11. A gradient stock solution of 50% Iodixanol is prepared by diluting in 0.25 M sucrose, 6 mM EDTA, 60 mM HEPES, pH 7.4, at a 5:1 ratio. Different densities of Iodixanol are established by diluting this stock with 0.25 M sucrose homogenization buffer. 12. The Iodixanol gradient is poured in 13 mL Beckman SW41 centrifuge tubes by careful underlayering, adding each layer under the first layer with a long needle, as follows: 1 mL 2.5% Iodixanol 2 mL 5% Iodixanol 2 mL 7.5% Iodixanol 2 mL 10% Iodixanol 0.5 mL 12.5% Iodixanol 2 mL 15% Iodixanol 0.5 mL 17.5% Iodixanol 0.5 mL 20% Iodixanol 0.3 mL 30% Iodixanol 13. Load the resuspended vesicles on top of the gradient and centrifuge in an SW41 rotor at 200,000 × g for 2.5 hr at 4˚C. Decrease the acceleration and deceleration rates of the centrifuge so the gradient is not disturbed. 14. Collect 12 fractions ~1 mL at a time by puncturing the bottom of the tube with a 22-gauge needle. Seal the top of the tube with Parafilm prior to puncturing to control the flow of the gradient from the tube. Store the fractions indefinitely at –80˚C.

5.3.3 IN VITRO γ-SECRETASE ACTIVITY ASSAY USING ENDOGENOUS SUBSTRATE The 12 fractions must be characterized by Western blotting with the ER-specific marker calnexin and the Golgi/TGN-specific marker syntaxin 6 or by measuring the activity of the Golgi-specific enzyme galactosyltransferase to determine which fractions are Golgi/TGN-enriched.62,66 Typically, the first three fractions contain calnexinpositive ER-rich vesicles, the fourth fraction contains a mixture of ER and Golgi/TGN vesicles, and fractions five through eight contain Golgi/TGN-rich vesicles that can be used for measuring γ-secretase activity.62 Instead of using each individual fraction, the first four fractions can be combined and considered ER-rich vesicles; fractions five through eight can be combined and considered Golgi/TGNrich vesicles (Figure 5.3a). These vesicles can now be incubated at 37˚C for measurement of de novo γ-secretase activity, for example, by Aβ-specific ELISA or Western blotting for AICD after incubation.


3.0

30

60

90

30

60

90

0.0

15 30

2

1

0

Golgi/TGN

16

120

1.0

d. min

120

15 15

90 120 120 PS1 cell lysate

5

10

5

10

3 3

60

2 2

1

Golgi/TGN

2.0

10

c.

0.0

1

< Syntaxin6

3 5

36

1.0 0

] Calnexin

Golgi/TGN 2.0

0.5

98

3.0

0

/TGN

0.5

b.

Golgi ER

Relative A β40Level

a.

Relative A β42Level


Amyloid Precursor Protein A Practical Approach

Amyloid Precursor Protein: A Practical Approach

Protein Structure: A Practical Approach

Protein structure. A practical approach

Protein Expression: A Practical Approach (Practical Approach Series)

Protein Expression: A Practical Approach (Practical Approach Series)

Protein Phosphorylation: A Practical Approach (Practical Approach Series) 2nd ed

Protein Structure Prediction: A Practical Approach

Protein Purification Applications: A Practical Approach

Protein Purification Techniques: A Practical Approach

Amyloid Prions and Other Protein Aggregates

Arabidopsis: A Practical Approach (Practical Approach Series)

Apoptosis: A Practical Approach (Practical Approach Series)

Macrophages: A Practical Approach (Practical Approach Series)

Immunodiagnostics: A Practical Approach (Practical Approach Series)

Protein Localization by Fluorescence Microscopy: A Practical Approach (Practical Approach Series)

Protein Purification Techniques: A Practical Approach, Second Edition

Holography. A Practical Approach

MDCT: A Practical Approach

Immunodiagnostics: A Practical Approach

MHC: A Practical Approach

Holography: A Practical Approach

Lymphocytes: A Practical Approach

Bioinformatics: A Practical Approach

Biosensors: a practical approach

Biosensors: a practical approach

Apoptosis. A Practical Approach

Immunodiagnostics: A Practical Approach

MDCT A Practical Approach

Plasmids: A Practical Approach

Macrophages: A Practical Approach

Amyloid Precursor Protein A Practical Approach