IFMBE Proceedings Series Editor: R. Magjarevic
Volume 35
The International Federation for Medical and Biological Engineering, IFMBE, is a federation of national and transnational organizations representing internationally the interests of medical and biological engineering and sciences. The IFMBE is a non-profit organization fostering the creation, dissemination and application of medical and biological engineering knowledge and the management of technology for improved health and quality of life. Its activities include participation in the formulation of public policy and the dissemination of information through publications and forums. Within the field of medical, clinical, and biological engineering, IFMBE’s aims are to encourage research and the application of knowledge, and to disseminate information and promote collaboration. The objectives of the IFMBE are scientific, technological, literary, and educational. The IFMBE is a WHO accredited NGO covering the full range of biomedical and clinical engineering, healthcare, healthcare technology and management. It is representing through its 60 member societies some 120.000 professionals involved in the various issues of improved health and health care delivery. IFMBE Officers President: Herbert Voigt, Vice-President: Ratko Magjarevic, Past-President: Makoto Kikuchi Treasurer: Shankar M. Krishnan, Secretary-General: James Goh http://www.ifmbe.org
Previous Editions: IFMBE Proceedings BIOMED 2011, “5th Kuala Lumpur International Conference on Biomedical Engineering 2011” Vol. 35, 2011, Kuala Lumpur, Malaysia, CD IFMBE Proceedings NBC 2011, “15th Nordic-Baltic Conference on Biomedical Engineering and Medical Physics” Vol. 34, 2011, Aalborg, Denmark, CD IFMBE Proceedings CLAIB 2011, “V Latin American Congress on Biomedical Engineering CLAIB 2011” Vol. 33, 2011, Habana, Cuba, CD IFMBE Proceedings SBEC 2010, “26th Southern Biomedical Engineering Conference SBEC 2010 April 30 – May 2, 2010 College Park, Maryland, USA”, Vol. 32, 2010, Maryland, USA, CD IFMBE Proceedings WCB 2010, “6th World Congress of Biomechanics (WCB 2010)”, Vol. 31, 2010, Singapore, CD IFMBE Proceedings BIOMAG2010, “17th International Conference on Biomagnetism Advances in Biomagnetism – Biomag2010”, Vol. 28, 2010, Dubrovnik, Croatia, CD IFMBE Proceedings ICDBME 2010, “The Third International Conference on the Development of Biomedical Engineering in Vietnam”, Vol. 27, 2010, Ho Chi Minh City, Vietnam, CD IFMBE Proceedings MEDITECH 2009, “International Conference on Advancements of Medicine and Health Care through Technology”, Vol. 26, 2009, Cluj-Napoca, Romania, CD IFMBE Proceedings WC 2009, “World Congress on Medical Physics and Biomedical Engineering”, Vol. 25, 2009, Munich, Germany, CD IFMBE Proceedings SBEC 2009, “25th Southern Biomedical Engineering Conference 2009”, Vol. 24, 2009, Miami, FL, USA, CD IFMBE Proceedings ICBME 2008, “13th International Conference on Biomedical Engineering” Vol. 23, 2008, Singapore, CD IFMBE Proceedings ECIFMBE 2008 “4th European Conference of the International Federation for Medical and Biological Engineering”, Vol. 22, 2008, Antwerp, Belgium, CD IFMBE Proceedings BIOMED 2008 “4th Kuala Lumpur International Conference on Biomedical Engineering”, Vol. 21, 2008, Kuala Lumpur, Malaysia, CD IFMBE Proceedings NBC 2008 “14th Nordic-Baltic Conference on Biomedical Engineering and Medical Physics”, Vol. 20, 2008, Riga, Latvia, CD IFMBE Proceedings APCMBE 2008 “7th Asian-Pacific Conference on Medical and Biological Engineering”, Vol. 19, 2008, Beijing, China, CD IFMBE Proceedings CLAIB 2007 “IV Latin American Congress on Biomedical Engineering 2007, Bioengineering Solution for Latin America Health”, Vol. 18, 2007, Margarita Island, Venezuela, CD
IFMBE Proceedings Vol. 35
Noor Azuan Abu Osman, Wan Abu Bakar Wan Abas, Ahmad Khairi Abdul Wahab, and Hua-Nong Ting (Eds.)
5th Kuala Lumpur International Conference on Biomedical Engineering 2011 (BIOMED 2011) 20–23 June 2011, Kuala Lumpur, Malaysia
123
Editors Assoc. Prof. Dr. Noor Azuan Abu Osman University of Malaya Department of Biomedical Engineering Faculty of Engineering 50603 Kuala Lumpur Malaysia E-mail:
[email protected] Dr. Ahmad Khairi Abdul Wahab University of Malaya Department of Biomedical Engineering Faculty of Engineering 50603 Kuala Lumpur Malaysia E-mail:
[email protected] Prof. Dr. Ir. Wan Abu Bakar Wan Abas University of Malaya Department of Biomedical Engineering Faculty of Engineering 50603 Kuala Lumpur Malaysia E-mail:
[email protected] Dr. Hua-Nong Ting University of Malaya Department of Biomedical Engineering Faculty of Engineering 50603 Kuala Lumpur Malaysia E-mail:
[email protected] ISSN 1680-0737 ISBN 978-3-642-21728-9
e-ISBN 978-3-642-21729-6
DOI 10.1007/ 978-3-642-21729-6 Library of Congress Control Number: 2011930406 © International Federation for Medical and Biological Engineering 2011 This work is subject to copyright. All rights are reserved, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilm or in any other way, and storage in data banks. Duplication of this publication or parts thereof is permitted only under the provisions of the German Copyright Law of September 9, 1965, in its current version, and permissions for use must always be obtained from Springer. Violations are liable to prosecution under the German Copyright Law. The use of general descriptive names, registered names, trademarks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The IFMBE Proceedings is an Official Publication of the International Federation for Medical and Biological Engineering (IFMBE) Typesetting & Cover Design: Scientific Publishing Services Pvt. Ltd., Chennai, India. Printed on acid-free paper 987654321 springer.com
About IFMBE
The International Federation for Medical and Biological Engineering (IFMBE) was established in 1959 to provide medical and biological engineering with a vehicle for international collaboration in research and practice of the profession. The Federation has a long history of encouraging and promoting international cooperation and collaboration in the use of science and engineering for improving health and quality of life. The IFMBE is an organization with membership of national and transnational societies and an International Academy. At present there are 52 national members and 5 transnational members representing a total membership in excess of 120 000 worldwide. An observer category is provided to groups or organizations considering formal affiliation. Personal membership is possible for individuals living in countries without a member society The International Academy includes individuals who have been recognized by the IFMBE for their outstanding contributions to biomedical engineering. Objectives The objectives of the International Federation for Medical and Biological Engineering are scientific, technological, literary, and educational. Within the field of medical, clinical and biological engineering its aims are to encourage research and the application of knowledge, and to disseminate information and promote collaboration. In pursuit of these aims the Federation engages in the following activities: sponsorship of national and international meetings, publication of official journals, cooperation with other societies and organizations, appointment of commissions on special problems, awarding of prizes and distinctions, establishment of professional standards and ethics within the field, as well as other activities which in the opinion of the General Assembly or the Administrative Council would further the cause of medical, clinical or biological engineering. It promotes the formation of regional, national, international or specialized societies, groups or boards, the coordination of bibliographic or informational services and the improvement of standards in terminology, equipment, methods and safety practices, and the delivery of health care. The Federation works to promote improved communication and understanding in the world community of engineering, medicine and biology. Activities Publications of IFMBE include: the journal Medical and Biological Engineering and Computing, the electronic magazine IFMBE News, and the Book Series on Biomedical Engineering. In cooperation with its international and regional conferences, IFMBE also publishes the IFMBE Proceedings Series. All publications of the IFMBE are published by Springer Verlag. The Federation has two divisions: Clinical Engineering and Health Care Technology Assessment. Every three years the IFMBE holds a World Congress on Medical Physics and Biomedical Engineering, organized in co-operation with the IOMP and the IUPESM. In addition, annual, milestone and regional conferences are organized in different regions of the world, such as Asia Pacific, Europe, the Nordic-Baltic and Mediterranean regions, Africa and Latin America. The administrative council of the IFMBE meets once a year and is the steering body for the IFMBE: The council is subject to the rulings of the General Assembly, which meets every three years. Information on the activities of the IFMBE can be found on the web site at: http://www.ifmbe.org.
Foreword
It is with great pleasure to present to you a collection of over 200 high quality technical papers from more than 10 countries at the 5th Kuala Lumpur International Conference on Biomedical Engineering (BIOMED 2011), which is held in conjunction with the 8th Asian Pacific Conference on Medical and Biological Engineering (APCMBE 2011). This international conference is jointly organized by Department of Biomedical Engineering, University of Malaya, Malaysia, and Society of Medical and Biological Engineering, Malaysia (MSMBE). The papers cover various topics of Biomedical engineering such as artificial organs, bioengineering education, bioinformatics, biomaterials, biomechatronics, biomechanics, bioinstrumentation, bionanotechnology, biomedical and physiological modelling, biosignal processing, clinical engineering, bioMEMS, medical imaging, prothetics and orthotics, and tissue engineering. This set of papers is the current research work being carried out in various disciplines of Biomedical engineering, including new and innovative researches in emerging areas. The conference program highlights five plenary talks by five prominent researchers/academicans of different areas: Professor Dr. Michael R. Neuman (Michigan Technological University, Michigan, USA), Professor Dr. Walter Herzog (University of Calgary, Canada), Professor Dr. Xiao-Ping Li (National University of Singapore, Singapore), Professor Dr. Alberto Avolio (Macquarie University, Sydney, Australia), and Professor Dr. Arthur F.T. Mak (The Hong Kong Polytechnic University, Hong Kong). Besides that, we also invite Prof. Dr. James Goh (National University of Singapore, Singapore), Prof. Dr. Ichiro Sakuma (University of Tokyo, Japan) and Prof. Dan Bader (University of Southampton, Uk) to give invited talks. Hope that you will find enlightening ideas from the papers for your research and study. Happy reading the proceedings and have a nice day. Assoc. Prof. Dr. Noor Azuan Abu Osman Chairperson, Organising Committee, Biomed 2011. Prof. Dr. Ir. Wan Abu Bakar Wan Abas President, Society of Medical and Biological Engineering, Malaysia (MSMBE)
Conference Details
Name 5th Kuala Lumpur International Conference on Biomedical Engineering 8th Asian Pacific Conference on Medical and Biological Engineering
Short Name BioMed 2011 APCMBE 2011
Venue Kuala Lumpur, Malaysia, 20-23 June 2011 Proceedings Editors
International Advisory Board
Treasurer
Noor Azuan Abu Osman Wan Abu Bakar Wan Abas Ahmad Khairi Abdul Wahab Hua-Nong Ting
Dan Bader (United Kingdom) Herbert F. Voigt (USA) Ichiro Sakuma (Japan) James Goh Cho Hong (Singapore) John Webster (USA) Jos AE Spaan (The Netherlands) Joseph D. Bronzino (USA) Makoto Kikuchi (Japan) Marc Madou (USA) Metin Akay (USA) Michael R. Neuman (USA) Nikola Kasabov (New Zealand) Ratko Magjarevic (Croatia) Shankar Krishnan (USA) Walter Herzoq (Canada)
Siew-Cheok Ng, PhD
Organized by Department of Biomedical Engineering, Faculty of Engineering, University of Malaya, Malaysia Co-Organized by Society of Medical and Biological Engineering, Malaysia (MSMBE) Supported by University of Malaya Ministry of Higher Education, Malaysia Tourism Malaysia IFMBE Asia-Pacific Working Group Chair: Ichiro Sakuma Vice Chair: Kang-Pin Lin Secretary: Siew-Lok Toh
Scientific and Technical Programme Committee Wan Abu Bakar Wan Abas Hua-Nong Ting Salmah Karman Norazmira Md Noh Mohd Shuhaibul Fadly Mansor Protocol Committee Fatimah Ibrahim Nahrizul Adib Kadri
Organizing Committee Chairperson
Special Task Committee
Noor Azuan Abu Osman
Ahmad Khairi Abdul Wahab Belinda Murphy
Norita Mohd Zain Nahrizul Adib Kadri Suraya Abdul Rahman Siew Cheok Ng Lim Einly
Secretary
Logistic Committee
Norita Mohd Zain Nahrizul Adib Kadri Ummi Syahirah Md Ali
Ahmad Nazmi Ahmad Fuad Suraya Abd Rahman
Vice-Chairperson
X
Social Program Committee Kama Bistari Muhammad Facilities Committee Fadzli Abu Bakar Student Committee Ummi Syahirah Md Ali Sponsors Committee Belinda Murphy Nur Azah Hamzaid Raha Mat Ghazali Elia Ameera Ali
Conference Details
Promotion Committee Ahmad Khairi Abdul Wahab Wan Azhar Wan Mohd Ibrahim Nasrul Anuar Abd Razak Mohd Faiz Mohamed Said Tutorial/Workshop Committee Hua-Nong Ting Mohd Shuhaibul Fadly Mansor Members Herman Shah Abdul Rahman Illida Mohd Nawi
Noranida Ariffin Fairus Hanum Mohamad Mohd Hanafi Zainal Abidin Adhli Iskandar Putera Hamzah Mohd Firdaus Mohd Jamil Mohd Asni Mohamad Hafizuddin Asman Razalee Rahimi Abdul Manaf Ahmad Firdaus Omar Noor Aini Dochik Norhazura Abdullah Neamah Suhaimi Mohd Faiz Mohd Mokhtar Mohd Fahmi Rusli
Table of Contents
Plenary Cardiovascular Modeling: Physiological Concepts and Simulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Avolio
1
Effect of Pain Perception on the Heartbeat Evoked Potential . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . X.P. Li
2
In-vivo Cartilage Mechano-Biology: How to Make Progress in Osteoarthritis Research . . . . . . . W. Herzog, T.R. Leonard, Z. Abusara, S.K. Han, A. Sawatsky
3
Sensors and Instrumentation to Meet Clinical Needs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M.R. Neuman
7
Tissues Injuries from Epidermal Loadings in Prosthetics, Orthotics, and Wheeled Mobility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A.F.T. Mak
8
Invited Paper Computer Aided Surgery for Minimally Invasive Therapy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ichiro Sakuma
9
Role of Mechanical Loading in the Aetiology of Deep Tissue Injury . . . . . . . . . . . . . . . . . . . . . . . . . . C. Oomens, S. Loerakker, K. Nicolay, D. Bader
10
Tissue Engineering Approaches to the Treatment of Spinal Disorders . . . . . . . . . . . . . . . . . . . . . . . . J.C.H. Goh, H.K. Wong, S. Abbah, E.Y.S. See, S.L. Toh
11
Artificial Organs Study of the Optimal Circuit Using Simultaneous Apheresis with Hemodialysis . . . . . . . . . . . . . . A. Morisaki, M. Iwahashi, H. Nakayama, S. Yoshitake, S. Takezawa
12
Bioengineering Education Biomedical Engineering Education under European Union Support . . . . . . . . . . . . . . . . . . . . . . . . . . M. Cerny, M. Penhaker, M. Gala, B. Babusiak OBE Implementation and Design of Continual Quality Improvement (CQI) for Accreditation of Biomedical Engineering Program University of Malaya . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S. Karman, K. Hasikin, H.N. Ting, S.C. Ng, A.K. Abdul Wahab, E. Lim, N.A. Hamzaid, W.A.B. Wan Abas
16
20
XII
Table of Contents
Ocular Lens Microcirculation Model, a Web-Based Bioengineering Educational Tool . . . . . . . . . S.E. Vaghefi
25
Bioinformatics Analysis of Skin Color of Malaysian People . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . L.M. Abdulhadi, H.L. Mahmoud, H.A. Mohammed
29
Comparison of Spectrometer, Camera, and Scanner Reproduction of Skin Color . . . . . . . . . . . . . H.L. Mahmoud, L.M. Abdulhadi, A. Mahmoud, H.A. Mohammed
33
Context and Implications of Blood Angiogenin Level Findings in Healthy and Breast Cancer Females of Malaysia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . V. Piven, Y.A. Manaf, M.A. Abdullah
37
Detection of Acute Leukaemia Cells Using Variety of Features and Neural Networks . . . . . . . . A.S. Abdul Nasir, M.Y. Mashor, H. Rosline
40
Biomaterials A Novel Phantom for Accurate Performance Assessment of Bone Mineral Measurement Techniques: DEXA and QCT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Emami, H. Ghadiri, M.R. Ay, S. Akhlagpour, A. Eslami, P. Ghafarian, S. Taghizadeh
47
Calcination Effects on the Sinterability of Hydroxyapatite Bioceramics . . . . . . . . . . . . . . . . . . . . . . C.Y. Tan, R. Tolouei, S. Ramesh, B.K. Yap, M. Amiriyan
51
Chitin Fiber Reinforced Silver Sulfate Doped Chitosan as Antimicrobial Coating . . . . . . . . . . . . C.K. Tang, A.K. Arof, N. Mohd Zain
55
Effects of Joule Heating on Electrophoretic Mobility of Titanium Dioxide (TiO2 ), Escherichia Coli and Staphylococcus Aureus (Live and Dead) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . P.F. Lee, M. Misran, W.A.T. Wan Abdullah
60
Electrochromic Property of Sol-Gel Derived TiO2 Thin Film for pH Sensor . . . . . . . . . . . . . . . . . . J.C. Chou, C.H. Liu, C.C. Chen
69
Failure Analysis of Retrieved UHMWPE Tibial Insert in Total Knee Replacement . . . . . . . . . . S. Liza, A.S.M.A. Haseeb, A.A. Abbas, H.H. Masjuki
73
Influence of Magnesium Doping in Hydroxyapatite Bioceramics Sintered by Short Holding Time . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S. Ramesh, R. Tolouei, C.Y. Tan, M. Amiriyan, B.K. Yap, J. Purbolaksono, M. Hamdi
80
In-vitro Biocompatibility of Folate-Decorated Star-Shaped Copolymeric Micelle for Targeted Drug Delivery . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . N.V. Cuong, Y.L. Li, M.F. Hsieh
84
Mercury (II) Removal Using CNTS Grown on GACs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . K.A. Nassereldeen, S.E. Mirghami, N.W. Salleh
88
Table of Contents
XIII
Optical Properties Effect of Cadmium Sulfide Quantum Dots towards Conjugation Process . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S.A. Shamsudin, N.F. Omar, S. Radiman
92
Synthesis of Hydroxyapatite through Dry Mechanochemical Method and Its Conversion to Dense Bodies: Preliminary Result . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S. Adzila, I. Sopyan, M. Hamdi
97
The Effect of Ball Milling Hours in the Synthesizing Nano-crystalline Forsterite via Solid-State Reaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 102 K.L. Samuel Lai, C.Y. Tan, S. Ramesh, R. Tolouei, B.K. Yap, M. Amiriyan The Effect of Titanium Dioxide to the Bacterial Growth on Lysogeny Broth Agar . . . . . . . . . . . N.H. Sabtu, W.S. Wan Zaki, T.N. Tengku Ibrahim, M.M. Abdul Jamil
105
Thermal Analysis on Hydroxyapatite Synthesis through Mechanochemical Method . . . . . . . . . . A.S.F. Alqap, S. Adzila, I. Sopyan, M. Hamdi, S. Ramesh
108
Biomechatronics Continuous Passive Ankle Motion Device for Patient Undergoing Tibial Distraction Osteogenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C.T. Ang, N.A. Hamzaid, Y.P. Chua, A. Saw
112
Musculoskeletal Model of Hip Fracture for Safety Assurance of Reduction Path in Robot-assisted Fracture Reduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S. Joung, S. Syed Shikh, E. Kobayashi, I. Ohnishi, Ichiro Sakuma
116
Speed Based Surface EMG Classification Using Fuzzy Logic for Prosthetic Hand Control . . . . S.A. Ahmad, A.J. Ishak, S.H. Ali
121
Biomechanics Activity of Upper Body Muscles during Bowing and Prostration Tasks in Healthy Subjects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M.K.M. Safee, W.A.B. Wan Abas, N.A. Abu Osman, F. Ibrahim
125
Analysis of the Effect of Mechanical Properties on Stress Induced in Tibia . . . . . . . . . . . . . . . . . . B. Sepehri, A.R. Ashofteh-Yazdi, G.A. Rouhi, M. Bahari-Kashani
130
Comparative Studies of the Optimal Airflow Waveforms and Ventilation Settings under Respiratory Mechanical Loadings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S.L. Lin, S.J. Yeh, H.W. Shia
134
Development of Inexpensive Motion Analysis System–Preliminary Findings . . . . . . . . . . . . . . . . . Y.Z. Chong, J. Yunus, K.M. Fong, Y.J. Khoo, J.H. Low
139
Diabetic Foot Syndrome-3-D Pressure Pattern Analysis as Compared with Normal Subjects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H.S. Ranu, A. Almejrad
143
XIV
Table of Contents
Effects of Arterial Longitudinal Tension on Pulsatile Axial Blood Flow . . . . . . . . . . . . . . . . . . . . . . Y.Y. Lin Wang, W.K. Sze, J.M. Chen, W.K. Wang
148
Effect of Extracellular Matrix on Smooth Muscle Cell Phenotype and Migration . . . . . . . . . . . . T. Ohashi, Y. Hagiwara
151
Effects of the Wrist Angle on the Performance and Perceived Discomfort in a Long Lasting Handwriting Task . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . N.Y. Yu, S.H. Chang
153
Estimation of Muscle Force with EMG Signals Using Hammerstein-Wiener Model . . . . . . . . . . . R. Abbasi-Asl, R. Khorsandi, S. Farzampour, E. Zahedi
157
Hip 3D Joint Mechanics Analysis of Normal and Obese Individuals’ Gait . . . . . . . . . . . . . . . . . . . . M.H. Mazlan, N.A. Abu Osman, W.A.B. Wan Abas
161
Impact Load and Mechanical Respond of Tibiofemoral Joint . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A.A. Oshkour, N.A. Abu Osman, M.M. Davoodi, M. Bayat, Y.H. Yau, W.A.B. Wan Abas
167
Investigation of Lung Lethargy Deformation Using Finite Element Method . . . . . . . . . . . . . . . . . . M.K. Zamani, M. Yamanaka, T. Miyashita, R. Ramli
170
Knee Energy Absorption in Full Extension Landing Using Finite Element Analysis . . . . . . . . . . M.M. Davoodi, N.A. Abu Osman, A.A. Oshkour, M. Bayat
175
Knee Joint Stress Analysis in Standing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A.A. Oshkour, N.A. Abu Osman, M.M. Davoodi, M. Bayat, Y.H. Yau, W.A.B. Wan Abas
179
Mechanical Behavior of in-situ Chondrocyte at Different Loading Rates: A Finite Element Study . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E.K. Moo, N.A. Abu Osman, B. Pingguan-Murphy, S.K. Han, S. Federico, W. Herzog
182
Posture and EMG Evaluation of Assist Functions of Full-Body Suits . . . . . . . . . . . . . . . . . . . . . . . . . T. Kitawaki, Y. Inoue, S. Doi, A. Egawa, A. Shiga, T. Iizuka, M. Kawakami, T. Numata, H. Oka
187
Posture Control and Muscle Activation in Spinal Stabilization Exercise . . . . . . . . . . . . . . . . . . . . . . Y.T. Ting, L.Y. Guo, F.C. Su
190
Preliminary Findings on Anthropometric Data of 19-25 Year Old Malaysian University Students . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Y.Z. Chong, X.J. Leong
193
Quantification of Patellar Tendon Reflex by Motion Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . L.K. Tham, N.A. Abu Osman, K.S. Lim, B. Pingguan-Murphy, W.A.B. Wan Abas
197
Quantitative Analysis of the Human Ankle Viscoelastic Behavior at Different Gait Speeds . . . Z. Safaeepour, A. Esteki, M.E. Mousavi, F. Tabatabaei
200
Response of the Human Spinal Column to Loading and Its Time Dependent Characteristics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H.S. Ranu, A.S. Bhullar, A. Zakaria
203
Shoulder’s Modeling via Kane’s Method: Determination of Torques in Smash Activity . . . . . . . F.H.M. Ariff, A.S. Rambely, N.A.A. Ghani
207
Table of Contents
XV
Simulation of Brittle Damage for Fracture Process of Endodontically Treated Tooth . . . . . . . . . S.S.R. Koloor, J. Kashani, M.R. Abdul Kadir
210
Stress Distribution Analysis on Semi Constrained Elbow Prosthesis during Flexion and Extension Motion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M. Heidari, M. Rafiq Bin Dato Abdul Kadir, A. Fallahiarezoodar, M. Alizadeh
215
Stress Distribution of Dental Posts by Finite Element Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . P.H. Liu, G.H. Jhong
219
Temporal Characteristics of the Final Delivery Phase and Its Relation to Tenpin Bowling Performance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . R. Razman, W.A.B. Wan Abas, N.A. Abu Osman, J.P.G. Cheong
222
The Biomechanics Analysis for Dynamic Hip Screw on Osteoporotic and Unstable Femoral Fracture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H.F. Wu, K.A. Lai, M.T. Huang, H.S. Chen, K.C. Chung, F.S. Yang
225
Hemodynamic Activities of Motor Cortex Related to Jaw and Arm Muscles Determined by Near Infrared Spectroscopy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . L.M. Hoa, .N. Huan, N.V. Hoa, D.D. Thien, T.Q.D. Khoa, V.V. Toi
229
Time-Dependent EMG Power Spectrum Parameters of Biceps Brachii during Cyclic Dynamic Contraction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 233 S. Thongpanja, A. Phinyomark, P. Phukpattaranont, C. Limsakul Transcutaneous Viscoelastic Properties of Brain through Cranial Defects . . . . . . . . . . . . . . . . . . . . H. Nagai, D. Takada, M. Daisu, K. Sugimoto, T. Miyazaki, Y. Akiyama
237
Two Practical Strategies for Developing Resultant Muscle Torque Production Using Elastic Resistance Device . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S.J. Aboodarda, A. Yusof, N.A. Abu Osman, F. Ibrahim
241
Biomedical Instrumentation A Novel Body Temperature Measuring and Data Transmitting System Using Bio-Sensors and Real-Time Transmission Technique . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245 S. Manazir Hussain, Ijlal Shahrukh Ateeq, Kamran Hameed, Aisha Tahir, S.M. Omair, S. Imran Alam, Sana H. Khan A Quantitative Study of Gastric Activity on Feeding Low and High Viscosity Meals . . . . . . . . . K. Takahashi, A. Kobayashi, H. Inoue
249
A Study of Extremely Low Frequency Electromagnetic Field (ELF EMF) Exposure Levels at Multi Storey Apartment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . R. Tukimin, W.N.L. Mahadi
253
Accuracy Improvement for Low Perfusion Pulse Oximetry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . J.M. Cho, N.H. Kim, H.S. Seong, Y.S. Kim
258
Application of a Manometric Technique to Verify Nasogastric Tube Placement in Intubated, Mechanically Ventilated Patients . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H.S. Chen, K.C. Chung, S.H. Yang, T.H. Li, H.F. Wu
262
XVI
Table of Contents
Assessment of Diabetics with Various Degrees of Autonomic Neuropathy Based on Cross-Approximate Entropy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C.C. Chiu, S.J. Yeh, T.Y. Li
266
Automated Diagnosis of Melanoma Based on Nonlinear Complexity Features . . . . . . . . . . . . . . . . N. Karami, A. Esteki
270
Bowel Ischemia Monitoring Using Rapid Sampling Microdialysis Biosensor System . . . . . . . . . . E.P. C´ orcoles, S. Deeba, G.B. Hanna, P. Paraskeva, M.G. Boutelle, A. Darzi
275
Changes in Cortical Blood Oxygenation Responding to Arithmetical Tasks and Measured by Near-Infrared Spectroscopy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . N.N.P. Trinh, N.H. Binh, D.D. Thien, T.Q.D. Khoa, V.V. Toi
279
Color Coded Heart Rate Monitoring System Using ANT+ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F.K. Che Harun, N. Uyop, M.F. Ab Aziz, N.H. Mahmood, M.F. Kamarudin, A. Linoby
283
Control Brain Machine Interface for a Power Wheelchair . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C.R. Hema, M.P. Paulraj
287
Design and Development of Microcontroller Based ECG Simulator . . . . . . . . . . . . . . . . . . . . . . . . . . A.D. Paul, K.R. Urzoshi, R.S. Datta, A. Arsalan, A.M. Azad
292
Development of CW CO2 Laser Percussion Technique . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S. Sano, Y. Hashishin, T. Nakayama
296
Electric Field Measurement for Biomedical Application Using GNU Radio . . . . . . . . . . . . . . . . . . I. Hieda, K.C. Nam
300
EZ430-Chronos Watch as a Wireless Health Monitoring Device . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . I.N.A. Mohd Nordin, P.S. Chee, M. Mohd Addi, F.K. Che Harun
305
Face Detection for Drivers’ Drowsiness Using Computer Vision . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . V.V. Dixit, A.V. Deshpande, D. Ganage
308
Histological Study to Estimate Risks of Radon Inhalation Dose on a Lung Cancer: In vivo . . . A.H. Ismail, M.S. Jaafar, F.H. Mustafa
312
Influence of Hair Color on Photodynamic Dose Activation in PDT for Scalp Diseases . . . . . . . . F.H. Mustafa, M.S. Jaafar, A.H. Ismail, A.F. Omar, H.A. Houssein, Z.A. Timimi
315
Measurement and Diagnosis Assessment of Plethysmographycal Record . . . . . . . . . . . . . . . . . . . . . M. Augustynek, M. Penhaker, J. Semkovic, P. Penhakerova, M. Cerny
320
Measurement of Available Chlorine in Electrolyzed Water Using Electrical Conductivity . . . . K. Umimoto, H. Kawanishi, Y. Shimamoto, M. Miyata, S. Nagata, J. Yanagida
324
Measuring the Depth of Sleep by Near Infrared Spectroscopy and Polysomnography . . . . . . . . N.T.M. Thanh, L.H. Duy, L.Q. Khai, T.Q.D. Khoa, V.V. Toi
328
Multi-frequency Microwave Radiometer System for Measuring Deep Brain Temperature in New Born Infants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. Sugiura, H. Hirata, J.W. Hand, S. Mizushina
332
Table of Contents
XVII
Number of Pulses of rTMS Affects the Inter-Reversal Time of Perceptual Reversal . . . . . . . . . . K. Nojima, S. Ge, Y. Katayama, K. Iramina
336
Permittivity of Urine between Benign and Malignant Breast Tumour . . . . . . . . . . . . . . . . . . . . . . . . E.S. Arjmand, H.N. Ting, C.H. Yip, N.A. Mohd Taib
340
Problems and Solution When Developing Intermittent Pneumatic Compression . . . . . . . . . . . . . N.H. Kim, H.S. Seong, J.W. Moon, J.M. Cho
344
Pulse Oximetry Color Coded Heart Rate Monitoring System Using ZigBee . . . . . . . . . . . . . . . . . . F.K. Che Harun, N. Zulkarnain, M.F. Ab Aziz, N.H. Mahmood, M.F. Kamarudin, A. Linoby
348
Study of Electromagnetic Field Radiation on the Human Muscle Activity . . . . . . . . . . . . . . . . . . . M.S.F. Mansor, W.A.B. Wan Abas, W.N.L. Wan Mahadi
352
The pH Sensitivity of the Polarization Capacitance on Stainless-Steel Electrodes . . . . . . . . . . . . J.G. Bau, H.C. Chen
356
Ultrasound Dosimetery Using Microbubbles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E. Rezayat, E. Zahedi, J. Tavakkoli
359
Visualization of Measured Data for Wireless Devices BluesenseAD . . . . . . . . . . . . . . . . . . . . . . . . . . O. Krejcar, D. Janckulik, M. Kelnar
363
Voltammetric Approach for In-vivo Detecting Dopamine Level of Rat’s Brain . . . . . . . . . . . . . . . G.C. Chen, H.Z. Han, T.C. Tsai, C.C. Cheng, J.J. Jason Chen
367
Wearable ECG Recorder with Acceleration Sensors for Measuring Daily Stress . . . . . . . . . . . . . . Y. Okada, T.Y. Yoto, T.A. Suzuki, S. Sakuragawa, H. Mineta, T. Sugiura
371
Wireless Sensor Network for Flexible pH Array Sensor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . J.C. Chou, C.C. Chen, M.S. Wu
375
Bionanotechnology Application of Gold Nanoparticles for Enhanced Photo-Thermal Therapy of Urothelial Carcinoma . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Y.J. Wu, C.H. Chen, H.S.W. Chang, W.C. Chen, J.J. Jason Chen
380
Nanobiosensor for the Detection and Quantification of Specific DNA Sequences in Degraded Biological Samples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M.E. Ali, U. Hashim, S. Mustafa, Y.B. Che Man, M.H.M. Yusop
384
Polysilicon Nanogap Formation Using Size Expansion Technique for Biosensor Application . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. Nazwa, U. Hashim, T.S. Dhahi
388
Biomedical and Physiological Modelling A Modified Beer-Lambert Model of Skin Diffuse Reflectance for the Determination of Melanin Pigments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 393 A.F.M. Hani, H. Nugroho, N. Mohd Noor, K.F. Rahim, R. Baba
XVIII
Table of Contents
A Review of ECG Peaks Detection and Classification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T.I. Amani, S.S.N. Alhady, U.K. Ngah, A.R.W. Abdullah
398
An Image Approach Model of RBC Flow in Microcirculation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . W.C. Lin, H.H. Liu, R.S. Liu, K.P. Lin
403
An Image-Based Anatomical Network Model and Modelling of Circulation of Mouse Retinal Vasculature . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . P. Ganesan, S. He, H. Xu, Y.H. Yau
407
Analysis of Normal and Atherosclerotic Blood Vessels Using 2D Finite Element Models . . . . . K. Kamalanand, S. Srinivasan, S. Ramakrishnan
411
Comparative Analysis of Preprocessing Techniques for Quantification of Heart Rate Variability . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . W.M.H. Wan Mahmud, M.B. Malarvili
415
Detection of Influence of Stimuli or Sevices on the Physical Condition and Satisfaction with Unconscious Response Reflecting Activities of Autonomic Nervous System . . . . . . . . . . . . . . . . . . H. Okawai, S. Ichisawa, K. Numata
420
Determination of Reflectance Optical Sensor Array Configuration Using 3-Layer Tissue Model and Monte Carlo Simulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 424 N.A. Jumadi, K.B. Gan, M.A. Mohd Ali, E. Zahedi Effects of ECM Degradation Rate, Adhesion, and Drag on Cell Migration in 3D . . . . . . . . . . . . . H.C. Wong, W.C. Tang
428
Finite Element Analysis of Different Ferrule Heights of Endodontically Treated Tooth . . . . . . . J. Kashani, M.R. Abdul Kadir, Z. Arabshahi
432
How to Predict the Fractures Initiation Locus in Human Vertebrae Using Quantitative Computed Tomography (QCT) Based Finite Element Method? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Zeinali, B. Hashemi, A. Razmjoo
436
Influence of Cancellous Bone Existence in Human Lumbar Spine: A Finite Element Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M. Alizadeh, J. Kashani, M.R. Abdul Kadir, A. Fallahi
439
Laser Speckle Contrast Imaging for Perfusion Monitoring in Burn Tissue Phantoms . . . . . . . . . A.K. Jayanthy, N. Sujatha, M. Ramasubba Reddy
443
Microdosimetry Modeling Technique for Spherical Cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M. Nazib Adon, M. Noh Dalimin, N. Mohd Kassim, M.M. Abdul Jamil
447
Recurrent Breast Cancer with Proportional Homogeneous Poisson Process . . . . . . . . . . . . . . . . . . C.C. Chang
450
Simulation of the Effects of Electric and Magnetic Loadings on Internal Bone Remodeling . . . A. Fathi Kazerooni, M. Rabbani, M.R. Yazdchi
458
Study of Hematocrit in Relation with Age and Gender Using Low Power Helium – Neon Laser Irradiation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 463 H.A.A. Houssein, M.S. Jaafar, Z. Ali, Z.A. Timimi, F.H. Mustafa
Table of Contents
XIX
Three-Dimensional Fluid-Structure Interaction Modeling of Expiratory Flow in the Pharyngeal Airway . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 467 M.R. Rasani, K. Inthavong, J.Y. Tu
Biosignal Processing A Hybrid Trial to Trial Wavelet Coherence and Novelty Detection Scheme for a Fast and Clear Notification of Habituation: An Objective Uncomfortable Loudness Level Measure . . . . Mai Mariam
472
Application of Data Mining on Polynomial Based Approach for ECG Biometric . . . . . . . . . . . . . K.A. Sidek, I. Khalil
476
Brain Waves after Short Duration Exercise Induced by Wooden Tooth Brush as a Physical Agent – A Pilot Study . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F. Reza, H. Omar, A.L. Ahmed, T. Begum, M. Muzaimi, J.M. Abdullah
480
Change Point Detection of EEG Signals Based on Particle Swarm Optimization . . . . . . . . . . . . . M.F. Mohamed Saaid, W.A.B. Wan Abas, H. Arof, N. Mokhtar, R. Ramli, Z. Ibrahim
484
Comparative Analysis of the Optimal Performance Evaluation for Motor Imagery Based EEG-Brain Computer Interface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Y.S. Ryu, Y.B. Lee, C.G. Lee, B.W. Lee, J.K. Kim, M.H. Lee
488
Comparison of Influences on P300 Latency in the Case of Stimulating Supramarginal Gyrus and Dorsolateral Prefrontal Cortex by rTMS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. Torii, K. Nojima, A. Matsunaga, M. Iwahashi, K. Iramina
492
Cortical Connectivity during Isometric Contraction with Concurrent Visual Processing by Partial Directed Coherence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S.N. Ramli, N.M. Safri, R. Sudirman, N.H. Mahmood, M.A. Othman, J. Yunus
496
Cross Evaluation for Characteristics of Motor Imagery Using Neuro-feedback Based EEG-Brain Computer Interface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Y.S. Ryu, Y.B. Lee, W.J. Jeong, S.J. Lee, D.H. Kang, M.H. Lee
500
EEG Artifact Signals Tracking and Filtering in Real Time for Command Control Application . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M. Moghavvemi, A. Attaran, M.H. Moshrefpour Esfahani
503
EEG Patterns for Driving Wireless Control Robot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H. Azmy, N. Mat Safri, F.K. Che Harun, M.A. Othman
507
Effects of Physical Fatigue onto Brain Rhythms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S.C. Ng, P. Raveendran
511
Evaluation of Motor Imagery Using Combined Cue Based EEG-Brain Computer Interface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D.H. Choi, Y.B. Lee, W.J. Jeong, S.J. Lee, D.H. Kang, M.H. Lee
516
Fitting and Eliminating to the TMS Induced Artifact on the Measured EEG by the Equivalent Circuit Simulation Improved Performance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 519 Y. Katayama, K. Iramina
XX
Table of Contents
Gender Identification by Using Fundamental and Formant Frequency for Malay Children . . . . H.N. Ting, A.R. Zourmand
523
Improving Low Pass Filtered Speech Intelligibility Using Nonlinear Frequency Compression with Cepstrum and Spectral Envelope Transformation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M.H. Mohd Zaman, M.M. Mustafa, A. Hussain
527
Long-Term Heart Rate Variability Assessment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M. Penhaker, T. Stula, M. Augustynek
532
Neural Network Classifier for Hand Motion Detection from EMG Signal . . . . . . . . . . . . . . . . . . . . Md.R. Ahsan, M.I. Ibrahimy, O.O. Khalifa
536
Performance Comparison between Mutative and Constriction PSO in Optimizing MFCC for the Classification of Hypothyroid Infant Cry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Zabidi, W. Mansor, Y.K. Lee, I.M. Yassin, R. Sahak
542
Periodic Lateralized Epileptiform Discharges (PLEDs) in Post Traumatic Epileptic Patient—Magnetoencephalographic (MEG) Study . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. Begum, F. Reza, H. Omar, A.L. Ahmed, S. Bhaskar, J.M. Abdullah, J.T.K.J. Tharakan
548
Premonitory Symptom of Septic Shock in Heart Rate Variability . . . . . . . . . . . . . . . . . . . . . . . . . . . . Y. Yokota, Y. Kawamura, N. Matsumaru, K. Shirai
552
Review of Electromyographic Control Systems Based on Pattern Recognition . . . . . . . . . . . . . . . S.A. Ahmad, A.J. Ishak, S.H. Ali
556
Speaker Verification Using Gaussian Mixture Model (GMM) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H. Hussain, S.H. Salleh, C.M. Ting, A.K. Ariff, I. Kamarulafizam, R.A. Suraya
560
Speaker-Independent Vowel Recognition for Malay Children Using Time-Delay Neural Network . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B.F. Yong, H.N. Ting
565
Feasibility of Using the Wavelet-Phase Stability in the Objective Quantification of Neural Correlates of Auditory Selective Attention . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Y.F. Low, K.C. Lim, Y.G. Soo, D.J. Strauss
569
Clinical Engineering Sharing the Medical Resource: The Feasibility and Benefit of Global Medical Instruments Support and Service . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M.J. Tzeng, C.Y. Lee, Y.Y. Huang
574
BioMEMS Hybrid Capillary-Flap Valve for Vapor Control in Point-of-Care Microfluidic CD . . . . . . . . . . . . T. Thio, A.A. Nozari, N. Soin, M.K.B.A. Kahar, S.Z.M. Dawal, K.A. Samra, M. Madou, F. Ibrahim
578
Semi-automated Dielectrophoretic Cell Characterisation Module for Lab-on-Chip Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . N.A. Kadri, H.O. Fatoyinbo, M.P. Hughes, F.H. Labeed
582
Table of Contents
XXI
Medical Imaging A Preliminary Study of Compression Efficiency and Noise Robustness of Orthogonal Moments on Medical X-Ray Images . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 587 K.H. Thung, S.C. Ng, C.L. Lim, P. Raveendran Activities of Oxy-Hb and DeOxy-Hb on Motor Imaging and Motor Execution by Near-Infrared Spectroscopy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 591 D.H.T. Nguyen, N.V.D. Hau, T.Q.D. Khoa, V.V. Toi An Overview: Segmentation Method for Blood Cell Disorders . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M.F. Miswan, J.M. Sharif, M.A. Ngadi, D. Mohamad, M.M. Abdul Jamil
596
Assessment of Ischemic Stroke Rat Using Near Infrared Spectroscopy . . . . . . . . . . . . . . . . . . . . . . . F.M. Yang, C.W. Wu, C.Y. Lu, J.J. Jason Chen
600
Brain Lesion Segmentation of Diffusion-Weighted MRI Using Thresholding Technique . . . . . . . N. Mohd Saad, L. Salahuddin, S.A.R. Abu-Bakar, S. Muda, M.M. Mokji
604
Characterization of Renal Stones from Ultrasound Images Using Nonseparable Quincunx Wavelet Transform . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S.R. Shah, M.D. Desai, L. Panchal, M.R. Desai
611
Cluster Approach for Auto Segmentation of Blast in Acute Leukimia Blood Slide Images . . . . N.H. Harun, M.Y. Mashor, H. Rosline
617
Comparison of the Basal Ganglia Volumetry between SWI and T1WI in Normal Human Brain . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . W.B. Jung, Y.H. Han, J.H Lee, C.W. Mun
623
Computer-Aided Diagnosis System for Pancreatic Tumor Detection in Ultrasound Images . . . C. Wu, M.H. Lin, J.L. Su
627
Detection of Gastrointestinal Disease in Endoscope Imaging System . . . . . . . . . . . . . . . . . . . . . . . . . C.S. Low, K.S. Sim, A.L. Lee, H.Y. Ting, C.P. Tso, S.Y. Chuah
631
Digital Image Analysis of Chronic Ulcers Tissues . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A.F.M. Hani, L. Arshad, A.S. Malik, A. Jamil, B.B. Felix Yap
635
Early Ischemic Stroke Detection through Image Colorization Graphical User Interface . . . . . . . K.S. Sim, M.K. Ong, C.K. Tan, C.P. Tso, A.H. Rozalina
639
Evaluation of the Effects of Chang’s Attenuation Correction Technique on Simlar Transverse Views of Cold and Hot Regions in Tc-99m SPECT: A Phantom Study . . . . . . . . . . . . . . . . . . . . . . I.S. Sayed, A. Harfiza
643
Efficiency of Enhanced Distance Active Contour (EDAC) for Microcalcifications Segmentation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S.S Yasiran, A. Ibrahim, W.E.Z.W.A. Rahman, R. Mahmud
650
Estimating Retinal Vessel Diameter Change from the Vessel Cross-Section . . . . . . . . . . . . . . . . . . M.Z. Che Azemin, D.K. Kumar
655
XXII
Table of Contents
Face-Central Incisor Morphometric Relation in Malays and Chinese . . . . . . . . . . . . . . . . . . . . . . . . . L.M. Abdulhadi, H. Abass
659
Fingertip Synchrotron Radiation Angiography for Prediction of Diabetic Microangiopathy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. Fujii, N. Fukuyama, Y. Ikeya, Y. Shinozaki, T. Tanabe, K. Umetani, H. Mori
663
Hybrid Multilayered Perceptron Network Trained by Modified Recursive Prediction Error-Extreme Learning Machine for Tuberculosis Bacilli Detection . . . . . . . . . . . . . . . . . . . . . . . . . M.K. Osman, M.Y. Mashor, H. Jaafar
667
Intelligent Spatial Based Breast Cancer Recognition and Signal Enhancement System in Magnetic Resonance Images . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F.K. Chia, K.S. Sim, S.S. Chong, S.T. Tan, H.Y. Ting, Siti Fathimah Abbas, Sarimah Omar
674
Investigating the Mozart Effect on Brain Function by Using Near Infrared Spectroscopy . . . . H.Q.M. Huy, T.Q.D. Khoa, V.V. Toi
678
Latex Glove Protein Estimation Using Maximum Minimum Area Variation . . . . . . . . . . . . . . . . . . K.P. Yong, K.S. Sim, H.Y. Ting, W.K. Lim, K.L. Mok, A.H.M. Yatim
682
Measurement of the Area and Diameter of Human Pupil Using Matlab . . . . . . . . . . . . . . . . . . . . . . N.H. Mahmood, N. Uyop, M.M. Mansor, A.M. Jumadi
686
Medical Image Pixel Extraction via Block Positioning Subtraction Technique for Motion Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H.S.D.S. Jitvinder, S.S.S. Ranjit, S.A. Anas, K.C. Lim, A.J. Salim
690
Monte Carlo Characterization of Scattered Radiation Profile in Volumetric 64 Slice CT Using GATE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 694 A. Najafi Darmian, M.R. Ay, M. Pouladian, A. Shirazi, H. Ghadiri, A. Akbarzadeh Multi-Modality Medical Images Feature Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H. Madzin, R. Zainuddin, N.S. Mohamed
698
Parametric Dictionary Design Using Genetic Algorithm for Biomedical Image De-noising Application . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H. Nozari, G.A. Rezai Rad, M. Pourmajidian, A.K. Abdul Wahab
704
Quantification of Inter-crystal Scattering and Parallax Effect in Pixelated High Resolution Small Animal Gamma Camera: A Monte Carlo Study . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F. Adibpour, M.R. Ay, S. Sarkar, G. Loudos
708
Quantitative Assessment of the Influence of Crystal Material and Size on the Inter Crystal Scattering and Penetration Effect in Pixilated Dual Head Small Animal PET Scanner . . . . . . . N. Ghazanfari, M.R. Ay, N. Zeraatkar, S. Sarkar, G. Loudos
712
Rapid Calibration of 3D Freehand Ultrasound for Vessel Intervention . . . . . . . . . . . . . . . . . . . . . . . K. Luan, H. Liao, T. Ohya, J. Wang, Ichiro Sakuma
716
Segmentation of Tumor in Digital Mammograms Using Wavelet Transform Modulus Maxima on a Low Cost Parallel Computing System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hanifah Sulaiman, Arsmah Ibrahim, Norma Alias
720
Table of Contents
The Correlation Analyses between fMRI and Psychophysical Results Contribute to Certify the Activated Area for Motion-Defined Pattern Perception . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S. Kamiya, A. Kodabashi, Y. Higashi, M. Sekine, T. Fujimoto, T. Tamura
XXIII
724
Prosthetics and Orthotics A New Method for Measuring Pistoning in Lower Limb Prosthetic . . . . . . . . . . . . . . . . . . . . . . . . . . ´ H. Gholizadeh, N.A. Abu Osman, A.G. L´ u v´ıksd´ ottir, M. Kamyab, A. Eshraghi, S. Ali, W.A.B. Wan Abas
728
Ambulatory Function Monitor for Amputees . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S.N. Ooi, N.A. Abu Osman
732
Anthromorphic Design Methodology for Multifingered Arm Prosthesis . . . . . . . . . . . . . . . . . . . . . . U.S. Md Ali, N.A. Abu Osman, N. Yusoff, N.A. Hamzaid, H. Md Zin
735
Approximation Technique for Prosthetic Design Using Numerical Foot Profiling . . . . . . . . . . . . . A.Y. Bani Hashim, N.A. Abu Osman, W.A.B. Wan Abas, L. Abdul Latif
739
Comparison Study of the Transradial Prosthetics and Body Powered Prosthetics Using Pressure Distribution Approach . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . N.A. Abd Razak, N.A. Abu Osman
743
Effect of Position in Fixed Screw on Prosthetic Temporomandibular Joint . . . . . . . . . . . . . . . . . . . P.H. Liu, T.H. Huang, J.S. Huang
747
Evaluation of EMG Feature Extraction for Movement Control of Upper Limb Prostheses Based on Class Separation Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Phinyomark, S. Hirunviriya, A. Nuidod, P. Phukpattaranont, C. Limsakul
750
Modeling and Fabrication of Articulate Patellar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H.H. Rifa’t, Y. Nukman, N.A. Abu Osman, L.K. Gym, M.Z. Harizam
755
Pistoning Measurement in Lower Limb Prostheses – A Literature Review . . . . . . . . . . . . . . . . . . . A. Eshraghi, N.A. Abu Osman, M.T. Karimi, H. Gholizadeh, S. Ali
758
Prosthetics and Orthotics Services in the Rehabilitation Clinics of University Malaya Medical Centre . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 762 S. Ali, N.A. Abu Osman, H. Gholizadeh, A. Eshraghi, P.M. Verdan, L. Abdul Latif Prosthetic Foot Design: The Significance of the Normalized Ground Reaction Force . . . . . . . . . A.Y. Bani Hashim, N.A. Abu Osman, W.A.B. Wan Abas, L. Abdul Latif
765
Rehabilitation Engineering A Survey on Welfare Equipment Using Information Technologies in Korea and Japan . . . . . . . H.S. Seong, N.H. Kim, Y.A. Yang, E.J. Chung, S.H. Park, J.M. Cho
769
Biomechanical Analysis on the Effect of Bone Graft of the Wrist after Arthroplasty . . . . . . . . . M.N. Bajuri, M.R. Abdul Kadir, M.Y. Yahya
773
XXIV
Table of Contents
Can Walking with Orthosis Decrease Bone Osteoporosis in Paraplegic Subjects? . . . . . . . . . . . . . M.T. Karimi, S. Solomonidis, A. Eshraghi
778
Design and Development of Arm Rehabilitation Monitoring Device . . . . . . . . . . . . . . . . . . . . . . . . . . R. Ambar, M.S. Ahmad, M.M. Abdul Jamil
781
Development of Artificial Hand Gripper for Rehabilitation Process . . . . . . . . . . . . . . . . . . . . . . . . . . A.M. Mohd Ali, M.Y. Ismail, M.M. Abdul Jamil
785
Motor Control in Children with Developmental Coordination Disorder–Fitts’ Paradigm Test . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S.H. Chang, N.Y. Yu
789
Quantitative Analysis of Conductive Fabric Sensor Used for a Method Evaluating Rehabilitation Status . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B.W. Lee, C.K. Lee, Y.S. Ryu, D.H. Choi, M.H. Lee
793
Study on Posture Homeostasis One Hour Pilot Experiment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G.W. Lin, T.C. Hsiao, C.W. Lin
797
The Development of Muscle Training System Using the Electromyogram and Interactive Game for Physical Rehabilitation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 801 K.S. Kim, J.H. Kang, Y.H. Lee, C.S. Moon, H.H. Choi, C.W. Mun
Tissue Engineering A Preliminary Study on Magnetic Fields Effects on Stem Cell Differentiation . . . . . . . . . . . . . . . . Azizi Miskon, Jatendra Uslama
805
A Preliminary Study on Possibility of Improving Animal Cell Growth . . . . . . . . . . . . . . . . . . . . . . . M.Y. Jang, C.W. Mun
811
Dynamic Behaviour of Human Bone Marrow Derived-Mesenchymal Stem Cells on Uniaxial Cyclical Stretched Substrate – A Preliminary Study . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H.Y. Nam, B. Pingguan-Murphy, A.A. Abbas, A.M. Merican, T. Kamarul
815
Effect of Herbal Extracts on Rat Bone Marrow Stromal Cells (BMSCs) Derived Osteoblast–Preliminary Result . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C.T. Poon, W.A.B. Wan Abas, K.H. Kim, B. Pingguan-Murphy
819
Fabrication and In-vivo Evaluation of BCP Scaffolds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Behnamghader, R. Tolouei, R. Nemati, D. Sharifi, M. Farahpour, T. Forati, A. Rezaei, A. Gozalian, R. Neghabat
823
Fabrication of Porous Ceramic Scaffolds via Polymeric Sponge Method Using Sol-Gel Derived Strontium Doped Hydroxyapatite Powder . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 827 I. Sopyan, M. Mardziah, Z. Ahmad Hydrogel Scaffolds: Advanced Materials for Soft Tissue Re-growth . . . . . . . . . . . . . . . . . . . . . . . . . . 831 Z.A. Abdul Hamid, A. Blencowe, J. Palmer, K.M. Abberton, W.A. Morrison, A.J. Penington, G.G. Qiao, G. Stevens
Table of Contents
XXV
Process Optimization to Improve the Processing of Poly (DL-lactide-co-glycolide) into 3D Tissue Engineering Scaffolds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M.E. Hoque, Y.L. Chuan, I. Pashby, A.M.H. Ng, R. Idrus
836
The Fabrication of Human Amniotic Membrane Based Hydrogel for Cartilage Tissue Engineering Applications: A Preliminary Study . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . I.H. Hussin, B. Pingguan-Murphy, S.Z. Osman
841
General Papers Artificial Oxygen Carriers (Hemoglobin-Vesicles) as a Transfusion Alternative and for Oxygen Therapeutics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 845 H. Sakai Enzymatic Synthesis of Soybean Oil Based-Fatty Amides . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E.A. Jaffar Al-Mulla
849
Rat Model of Healing the Skin Wounds and Joint Inflammations by Recombinant Human Angiogenin, Erythropoietin and Tumor Necrosis Factor-α . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Gulyaev, V. Piven
854
Author Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
859
Keyword Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
865
Cardiovascular Modeling: Physiological Concepts and Simulation A. Avolio Australian School of Advance Medicine, Macquarie University, Sydney, Australia
Abstract— Modeling concepts are utilized whenever relationships are described between two or more quantities. One of the most elementary cardiovascular models is the relationship between mean arterial blood pressure and mean arterial blood flow in a vascular bed, described as vascular resistance. For simulation purposes, the electrical analogy is conventionally used where voltage (V) is analogous to pressure (P) and current (I) is analogous to flow (Q), such that the equivalent ohmic resistance (R) is obtained from the relationship P = Q.R. This analogy to Ohm’s Law (V=I.R) implies a linear relationship, such that R can be determined for any value of P and Q. However, the physiological constituents of R, that is, vascular geometry and blood viscosity, are also functions of P and Q. Hence the relationship between P and Q is inherently nonlinear, with the degree of nonlinearity depending on the anatomical location along the arterial tree and so the value of velocity of blood flow. This concept applying to steady values of P and Q is extended to time varying signals, P(t) and Q(t), where steady state oscillations are described in the frequency (ω) domain such that the relationship between oscillatory pressure (P(ω)) and flow (Q(ω)) is vascular impedance (Z(ω)), and where R is the zero-frequency value of Z(ω).
The non-linearities are also inherent in the impedance model, since the elastic properties of the arterial wall makes constitutive parameters such as wave speed and vessel diameter pressure dependent. However, in the range of pressure excursions during the cardiac cycle, the effects of non-linearity are relatively small, hence allowing closed form expressions of impedance based on vascular and blood properties, such that the input impedance spectrum can describe the complete hemodynamics of the vascular bed. When applied to the ascending aorta or the pulmonary artery, it describes the dynamic load on the left and right ventricles respectively. When the impedance model is applied to distributed structures such as branching vascular trees, it can be used to investigate underlying concepts related to optimal functions determined by allometric relationships of cardiovascular parameters (eg heart rate) and body size. Simulation of wave propagation in arterial models can be used determine factors that contribute to the change in pulse waveform throughout the arterial tree and inclusion of non-linear properties, such as pressure-dependent elasticity, can simulate changes in arterial hemodynamics due to gravitational effects on arteries, as occurs with changes from supine to upright posture.
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, p. 1, 2011. www.springerlink.com
Effect of Pain Perception on the Heartbeat Evoked Potential X.P. Li Department of Mechanical & Division of Bioengineering National University of Singapore
Abstract— Pain as an unpleasant sensory and emotional experience, if uncontrolled or undertreated, can seriously impair the quality of life. In many cases, the failure to adequately treat pain is due to the lack of accurate pain assessment tools, especially when subjective self-report methods are not applicable due to patients’ inability to formulate their pain experience (e.g. young children, incapacitating brain conditions). Therefore, there is a need for measures of pain which do not rely on patients’ ability to self-report. In this study, the relationship between the Heartbeat Evoked Potential(HEP) and acute pain perception was investigated. The aim was to examine the effect of acute tonic cold pain on the HEP and to test whether or not pain perception can be reflected by the HEP. Simultaneous electroencephalogram (EEG) and electrocardiogram (ECG) were recorded from 21 healthy young adults in three conditions: passive no-task control, no-pain control and cold pain
induced by cold pressor test (CPT). The HEP was obtained by using ECG R-peaks as event triggers. Prominent HEP deflection was observed in both control conditions mainly over the frontal and central locations, while it was significantly suppressed in the cold pain condition over the right-frontal, rightcentral and midline locations. A comparison of the data in the first and last 5 minutes of cold pain condition showed that lower subjective pain ratings were accompanied by higher HEP magnitudes. A correlation analysis showed that the mean HEP magnitude over the midline locations was significantly negatively correlated with subjective pain ratings. In conclusions, cold pain induces significant suppression of the HEP across a number of scalp locations, and the suppression is correlated with self-report of pain, indicating the potential of the HEP to serve as an alternative pain measure.
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, p. 2, 2011. www.springerlink.com
In-vivo Cartilage Mechano-Biology: How to Make Progress in Osteoarthritis Research W. Herzog, T.R. Leonard, Z. Abusara, S.K. Han, and A. Sawatsky University of Calgary/Faculty of Kinesiology, Human Performance Laboratory, Calgary, Canada Abstract— Cartilage mechano-biology has typically been performed in isolated tissue explants exposed to hydrostatic pressure, or subjected to confined or unconfined loading conditions. Although these approaches offer great control over the experiments, they do not reflect the physiological loading and boundary conditions of cartilage in the intact joint. Here, we will describe recent approaches that allow for evaluation of cartilage and chondrocyte biomechanics and signaling in the intact cartilage and intact joint of live animals. Although not as well controlled as experiments performed on tissue explants, the in vivo work offers the opportunity to study chondrocyte mechanics and signaling as well as tissue biomechanics for physiologically relevant loading situations and with natural boundary conditions.
Below, we will describe some of our recent work aimed at understanding the mechano-biology of joints, articular cartilage tissue, and chondrocytes (articular cartilage cells) in the intact joint, subjected to normal or near physiological loading patterns. The disadvantage of this approach is that experimental conditions are not as well controlled as in the in situ and in vitro approaches common to this field, but the overwhelming advantage is that observations made in vivo are likely to reflect much better what might cause the onset and progression of OA. The studies selected for presentation here are focused on (i) muscle weakness as an independent risk factor for OA, (ii) muscle imbalance as a cause for knee pain, and (iii) the mechano-biology of chondrocytes in the intact joint.
Keywords— Osteoarthritis, knee biomechanics, chondrocyte signaling, muscle weakness, live cell imaging.
I. INTRODUCTION Osteoarthritis (OA) is a disease of the joint that affects approximately 10% of all Canadians and about 50% of all Canadians aged 65 years or older. With an increase in the average age of the population, an ever increasing number of people will be affected by OA. In Canada, the estimated cumulative costs for OA by the year 2040 are predicted to be $CDN 1.4 trillion. Osteoarthritis is associated with pain, swelling of the joint, functional impairment, and a loss in joint range of motion (e.g.[1]). These clinical signs are caused by a loss of cartilage from the articulating surfaces of bones, osteophyte formation, loss of subchondral bone, damage to menisci and other internal structures (e.g.[2]). Osteoarthritis research has primarily focused on articular cartilage and most of it has been done on isolated tissues or cells (e.g.[3]). Using such approaches has the advantage that tissues and cells are well controlled and the experimental conditions are highly repeatable. However, isolating pieces of tissues or cells, and subjecting them to loading through hydrostatic pressure, pressure plates or other instruments, is highly non-physiological, and although it might help define mechanical and biological properties, it is debatable whether these properties remain the same in the joint that is loaded by inertial forces and muscular contractions.
II. BACKGROUND AND PURPOSE A. Muscle Weakness Osteoarthritis is associated with muscle weakness. In fact, muscle weakness has been said to be a better predictor of OA than either joint space narrowing or pain [4;5]. However, it is not clear if muscle weakness is a condition arising after the onset of OA, or if muscle weakness is an independent risk factor for the onset and progression of OA [6]. Purpose: The purpose of this study was to develop a model of muscle weakness and test the hypothesis that muscle weakness is an independent risk factor for the onset and progression of OA. Methods: Muscle weakness was produced in one year old, female New Zealand white rabbits by injecting botulinum toxin type-A (BTXA) into the quadriceps musculature for times ranging from 1-6 months [7]. Contralateral limbs served as saline injected controls while other animals served as normal controls. Strength, muscle mass, muscle structure and knee histology (Mankin score) were evaluated to determine if muscle weakness caused joint degeneration. Results: Following BTXA injections for 1-6 months into the quadriceps musculature of rabbits, muscle strength was decreased to about 20% of original, muscle mass was reduced by approximately half, fat invasion into the muscle
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 3–6, 2011. www.springerlink.com
4
W. Herzog et al.
replaced contractile material by about 50%, and the Mankin scores on the retropatellar surface were increased, indicating that knee joint degeneration was increased following BTXA-induced muscle weakness [Figure 1] [8;9].
white rabbits by VM ablation. Patellofemoral contact pressures were measured using Fuji Presensor film and patellar tracking relative to the femur was quantified using markers attached to bone pins on patella and femur and high-speed video filming (200Hz). Results: Ablation of the VM did not cause a change in isometric patellofemoral contact pressure distributions across the physiological range of joint movement [Figure 2], and also did not cause systematic changes in patellar tracking along the femur. However, patellar tracking was systematically shifted towards the medial aspect of the femur during active compared to passive knee extension/flexion trials. Also, patellar tracking was systematically different for active flexion compared to active extension of the knee.
Fig. 1 Cross-sectional histological view of the vastus lateralis from a control animal (right), and a BTX-A treated animal receiving six injections in a six months treatment period. Note the loss of contractile tissue (dark) and the increase in fat (light) in the experimental (left) compared to the control muscle Discussion: The results of this study indicate that muscle weakness is an independent risk factor for OA onset and progression. Needless to say that in an in-vivo study with freely ambulating animals, muscle weakness may cause a series of contaminating conditions: for example, altered gait patterns, and changed behavior. Nevertheless, whatever the detailed reasons for the increased knee joint degeneration following quadriceps weakness, weakness was the catalyst for these events to occur. Conclusion: We concluded from the results of this and similar other studies on BTXA-induce muscle weakness that quadriceps weakness is an independent risk factor for the onset and possibly also for the progression of OA [10]. B. Muscle Imbalance Imbalance of muscle forces around joints has been associated with joint pain and functional limitations. Specifically, vastus medialis (VM) weakness in the knee extensor group has been related to mal-tracking of the patella, causing pain and leading to joint degeneration [11]. Purpose: The purpose of this study was to test if VM weakness causes mal-tracking of the patella, thereby creating conditions for knee pain and degeneration. Methods: Weakness in the VM was introduced in the knee extensor muscles of one year old, female New Zealand
Fig. 2 Selected patellofemoral contact pressure distributions at knee angles of 30, 60, and 90˚ with the VM intact (left column) and the VM transected (middle column). Overlaying the contact pressures measured before and after VM ablation showed no systematic shifts in patellofemoral pressures, suggesting that VM strength was not important in patellar tracking (right column)
Discussion: In contrast to clinical believe, anecdotal evidence, and conservative treatment protocols, VM weakness (achieved by complete ablation of VM) did not change patellar tracking in the femoral groove, nor did it change the contact pressures in the patellofemoral joint. The rabbit knee is similar in its musculoskeletal structure to the human knee in that it has a VM with fibre alignment about 45° to the medial side of the femur axis [Figure 3]. Therefore, one would have expected to see a medial shift as has been proposed in humans. However, this was not observed, likely because the VM line of action is along its aponeurosis (rather than along the fibre direction as has been assumed tacitly), thereby creating this surprising result.
IFMBE Proceedings Vol. 35
In-vivo Cartilage Mechano-Biology: How to Make Progress in Osteoarthritis Research
5
and cell shapes are obtained by reconstructing chondrocytes based on stacks of images separated by 0.5µm. Biological signaling is measured from intra-cellular calcium fluxes using fluorescence microscopy. Mechanical loading is controlled either by indentation (in situ) or by muscular contractions [15]. Results: Chondrocytes deform quickly ( 98% relative density when sintered between 1100ºC–1300ºC. However, the addition of 0.5 wt% MgO when sintered at 1100°C was found to be most beneficial in aiding sintering with samples exhibiting the highest Young’s modulus of 122.15 GPa and fracture toughness of 1.64 MPam1/2 as compared to 116.57 GPa and 1.18 MPam1/2 for the undoped HA. Keywords— Hydroxyapatite, MgO, Mechanical properties, Sinterability.
I. INTRODUCTION The development of advanced ceramics for biomedical applications is one of the fastest growing research areas. Due to the apatitic structure of human hard tissues, hydroxyapatite Ca10(PO4)6OH2 (HA) appear to be the best studied compounds among different forms of calcium phosphate ceramics [1]. Bone crystals are formed in a biological environment through the process of biomineralization [2]. The major inorganic component of bone mineral is a CaPbased apatite phase contains trace ions such as Na+, Mg2+ and K+, which are known to play a significant role in its overall performance [3]. Mg-deficiency could cause poor mechanical reliability of HA, thus, limiting its application to non-stressed loaded regions [4]. As a result, it is favorable to incorporate these ions that are found in human bone to improve the mechanical properties of synthetic HA without any decomposition. For instance, Li et al. [5] reported decomposition products such as TCP and TTCP were present
in the structure when HA were doped with zirconia. Evis et al. [6] described the presence of TCP in HA when magnesium was added and samples sintered above 1000ºC. These secondary phases would have an adverse influence on the mechanical properties and biodegradability of the HA ceramics [7]. In this work, the primary objective is to study the phase stability and sinterability of synthesized HA ceramics by wet precipitation method when doped with up to 1 wt% magnesium oxide (MgO) via a new profile for conventional pressureless sintering.
II. METHODS AND MATERIALS The HA powder used in the present work was prepared according to a novel wet chemical method comprising precipitation from aqueous medium involving calcium hydroxide and orthophosphoric acid [8]. The dopant used in this work was obtained from a commercial available MgO powder (99.99% purity) and amount of dopant used were 0.1, 0.5 and 1.0 wt%. The synthesized HA and MgO powder were mixed in 150mls of ethanol and followed by ball milling for 1 hour. After the mixing, the wet slurry was dried, crushed and sieved to obtain fine powder. The green samples were uniaxial compacted at about 1.3 MPa to 2.5 MPa into rectangular bar (4 × 13 × 32 mm) and circular discs (20 mm diameter) samples. The compacts were subsequently cold isostatically pressed at a pressure of 200 MPa (Riken Seiki, Japan). This was followed by consolidation of the particles by pressureless sintering performed in air using a rapid heating furnace (ModuTemp, Australia), over the temperature range of 1000ºC to 1300ºC, with ramp rate of 2oC/min. (heating and cooling) and soaking time of one minute for each firing. All sintered samples were then polished to a 1 µm finish prior to testing. The phase stability studies of all samples were characterized by using X-ray diffraction (XRD-6000, Shimadzu, Japan). The bulk densities of the samples were determined by the water immersion technique (Mettler Toledo, Switzerland). The Young’s
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 80–83, 2011. www.springerlink.com
Influence of Magnesium Doping in Hydroxyapatite Bioceramics Sintered by Short Holding Time
modulus (E) by sonic resonance was determined for rectangular samples using a commercial testing instrument (GrindoSonic: MK5 “Industrial”, Belgium). The modulus of elasticity or Young’s modulus was calculated using the experimentally determined resonant frequency [9]. The fracture toughness (KIc) of the samples were determined using the Vickers indentation method (Matsuzawa, Japan). The indentation load (< 200 g) was applied and held in place for 10 seconds. Five indentations were made for each sample and the average value was taken. The KIc value was calculated using the equation derived by Niihara [10].
III. RESULTS AND DISCUSSION The sinterability of the HA compacts were compared in terms of phase stability, relative density, Vickers hardness, fracture toughness and Young’s modulus. All the samples, regardless of sintering conditions and dopant addition have not shown any cracking or distortion after sintering. XRD phase analysis showed that through the sintering of MgO-doped and undoped HA samples, no secondary phases such as TCP, CaO and calcium hydroxide were verified as shown in Figure 1.
81
that could have played a role in hindering dehydroxylation in the HA matrix during high temperature sintering. The densification curves as a function of sintering temperatures is shown in Figure 2. In general, the bulk density variation of all the composition studied exhibited a similar trend with increasing sintering temperature. A general observation that can be made from ‘figure 2’ is that the dopant incorporated has minor effect on the measured bulk density of HA samples. All the samples attained above 98% of theoretical density when sintered above 1200ºC. The relationship between the Young’s modulus of the sintered body, sintering temperature and MgO additions are shown in Figure 3. The inclusion of MgO in HA lattice, particularly for the higher dopant concentration, was found to be beneficial in enhancing the stiffness of the sintered HA body. As shown in Figure 3, the highest value of 124.4 GPa is recorded for HA samples containing 0.5wt% MgO when sintered at 1200ºC.
Fig. 2 Relative density variation as a function of sintering temperatures for HA with different amount of MgO
Fig. 1 XRD patterns of (a) undoped HA and HA containing (b) 0.1 wt%, (c) 0.5 wt% and (d) 1 wt% MgO samples sintered at 1200ºC
The XRD results indicated that the phase stability of HA was not disrupted by the sintering schedule and temperature, pressing conditions prior to sintering as well as the dopant addition. This result is very encouraging as there are some findings showing that the addition of other materials into HA matrix may lead to decomposition of HA and formation of TCP and CaO [11, 12]. Sintering at high temperatures, above 1300ºC, has been reported in the literature to be detrimental as HA phase instability was observed. However, in the present work, decomposition of HA phase was not observed even when sintered at 1300ºC. This observation could be associated with the high local humid atmosphere
Fig. 3 The effect of sintering temperatures and MgO addition on the Young’s modulus of HA
IFMBE Proceedings Vol. 35
82
S. Ramesh et al.
The variation of the average Vickers hardness and fracture toughness of samples sintered at various temperatures is shown in Figure 4 and Figure 5, respectively. The beneficial effect of MgO especially for the 0.5 wt% addition in enhancing the hardness and toughness of HA has been revealed. ‘Figure 4’ shows that the measured hardness of all the samples revealed a similar trend, i.e. the hardness increased rapidly to a maximum value and then decreased slowly with increasing sintering temperatures. For example, the hardness of the undoped HA ceramic peaked at 1100ºC (8.1GPa) and further increase in temperature > 1100oC resulted in a decrease in the hardness.
highlighted here that the KIc value obtained for the MgO-doped HA is very encouraging, as most researchers had reported that the experimental KIc values for HA varied from 0.9 MPam1/2 to about 1.2 MPam1/2 [13-15]. Moreover, this improved in toughness in the presences of dopants reported by these researchers was accompanied by HA phase decomposition. Due to the results can concluded that MgO plays an important role in suppressing grain growth and this will lead to higher fracture strength and hence higher fracture toughness.
IV. CONCLUSION This study has shown that the incorporation of small amount of magnesium oxide can be beneficial in enhancing the mechanical properties without affecting the HA phase stability even when sintered at 1300ºC. MgO doping, however was found to have a minor effect on the bulk density of sintered HA regardless of the sintering temperature employed. The addition of 0.5 wt% MgO and when sintered at 1100°C was found to be most beneficial as the HA samples exhibited the highest Young’s modulus of 122.15 GPa and fracture toughness of 1.64 MPam1/2. Fig. 4 Effect of sintering temperature and MgO addition on the Vickers hardness of HA
AKNOWLEDEMNET The authors gratefully acknowledge the support provided by the Ministry of Science, Technology and Innovation of Malaysia (MOSTI), and SIRIM Berhad.
REFRENCES
Fig. 5 The effect of sintering temperature and MgO addition on the fracture toughness of HA The fracture toughness of all compositions exhibited very similar trend as the sintering temperature increased (figure 5). The results show that the addition of MgO was effective in enhancing the fracture toughness (KIc) of the synthesized HA, particularly when sintered at 1100ºC. The 0.5 wt% MgO-doped HA samples exhibited the highest fracture toughness of 1.64 ± 0.17 MPam1/2 as compared to 1.36 ± 0.05 MPam1/2 measured for the undoped HA. It should be
1. G. Muralithran and S. Ramesh, “The effect of MnO2 addition on the sintering behavior of hydroxyapatite,” Biomed. Eng. App, Basis & Comm., Vol. 12, pp.43-48, 2000. 2. J. K. Samar and A. Bhatt. Himesh, “Nanocrystalline hydroxyapatite doped with magnesium and zinc: Synthesis and characterization,” Mater. Sci and Eng., Vol. 27, pp. 837-848, 2007. 3. P. Quinten Ruhé, Joop G.C. Wolke, Paul H.M. Spauwen and John A. Jansen, “Calcium Phosphate Ceramics for Bone Tissue Engineering,” in Tissue Engineering and Artificial Organs, 3rd ed., Joseph D. Bronzino, Ed. Taylor & Francis, 2006, pp. 38-1. 4. W. Suchanek and M. Yoshimura, “Processing and properties of hydroxyapatite-based biomaterials for use as hard tissue replacement implants,” J. Mater. Res., Vol. 13, pp. 94-117, 1998. 5. J. Li, L. Hermansson, and R. Soremark, “High strength biofunctional zirconia: mechanical properties and static fatigue behaviour of zirconia-apatite composites,” J. Mater. Sci.: Mater. Med., Vol. 4, pp. 50-54, 1993. 6. Z. Evis, M. Usta, and I. Kutbay, “Hydroxyapatite and zirconia composites: Effect of MgO and MgF2 on the stability of phases and sinterability,” Materials Chemistry and Physics, Vol. 110, pp. 68-75, 2008.
IFMBE Proceedings Vol. 35
Influence of Magnesium Doping in Hydroxyapatite Bioceramics Sintered by Short Holding Time 7. E. Landi, A. Tampieri, G. Celotti, S. Sprio, M. Sandri and G. Logroscino, “Sr-substituted hydroxyapatites for osteoporotic bone replacement,” Acta Biomaterialia, Vol. 3, pp. 961-969, 2007. 8. S. Ramesh, “A method for manufacturing hydroxyapatite bioceramic,” Malaysia Patent 2004, No. PI. 20043325. 9. ASTM E1876-97, “Standard test method for dynamic Young’s modulus, shear modulus and Poisson’s ratio by impulse excitation of vibration,” Annual Book of ASTM Standards. 1998. 10. K. Niihara, “Indentation microfracture of ceramics – its application and problems,” Ceramic Jap., Vol. 20, pp.12-18, 1985. 11. Royer, J. C.Viguie, M. Heughebaert, and J. C. Heughebaert, “Stoichiometry of hydroxyapatite: Influence on the flexural strength,” J. Mater. Sci.: Mater. In Med., Vol. 4, pp.76-82, 1993. 12. P. E. Wang and T. K. Chaki, “Sintering behaviour and mechanical properties of hydroxyapatite and dicalcium phosphate,” J. Mater. Sci.: Mater. In Med., Vol. 4, pp. 150-158, 1993.
83
13. C. K. Wang, C. P. Ju and Lin J. H. Chern, “Effect of doped bioactive glass on structure and properties of sintered hydroxyapatite,” Mat. Chem. Phys., Vol. 53, pp. 138-149, 1998. 14. S. Gautier, E. Champion and D. Bernache-Assollant, “Processing, microstructure and toughness of Al2O3 platelet reinforced hydroxyapatite,” J. Euro. Ceramic, Vol. 17, pp. 1361-1369, 1997. 15. Z. Evis, M. Usta and I. Kutbay, “Improvement in sinterability and phase stability of hydroxyapatite and partially stabilized zirconia composites,” J. Euro. Ceramic, Vol. 29, pp. 621-628, 2009. Author: Institute: Street: City: Country: Email:
IFMBE Proceedings Vol. 35
Professor Ramesh Singh University Malaya KL Malaysia
[email protected] In-vitro Biocompatibility of Folate-Decorated Star-Shaped Copolymeric Micelle for Targeted Drug Delivery N.V. Cuong1,2, Y.L. Li1, and M.F. Hsieh1,* 1
2
Department of Biomedical Engineering, Chung Yuan Christian University, 200, Chung Pei Rd., Chung Li, Taiwan Department of Chemical Engineering, Ho Chi Minh City University of Industry, 12 Nguyen Van Bao St, Ho Chi Minh, Vietnam
Abstract— The drug delivery systems using conventional nanocarriers are associated with the systemic toxicity and poor bioavailability of drug due to lack of its specificity. The objective of this study is to overcome these limitations by introduction of folic targeting ligand in drug delivery system to deliver drug within tumor cells via passive and active-mediated endocytosis. Hence, the folate decorated-micelles based on the starshape FOL-PEG-PCL copolymer were prepared for targeting to the folate receptor overexpressing in human breast cancer cells. The structure was characterized by 1H NMR, FT-IR and DSC. The self assembly of amphiphilic copolymer was investigated. The particle size of the micelle was 110.5 nm. The safety evaluation of copolymeric micelle including the in vitro nitric oxide production and hemolytic tests. The results obtained from macrophage response and hemolysis test suggest that the micelle prepared in this study had moderate in vitro toxicity and could be safely used for intravenous injection in animal. Keywords— Doxorubicin, Targeted Delivery, Polymeric Micelle.
I. INTRODUCTION A drug delivery system using nanocarrier (i.e., polymeric nanoparticle and polymeric micelles) that was accumulated in tumor cells only on passive targeting mechanisms. This delivery system faces intrinsic limitation to its specificity [1]. To overcome these limitations, introduction of various targeting ligands or antibody in drug delivery system has provided opportunity to deliver drug within tumor cells via receptor-mediated endocytosis [2]. Among them, vitamin B12: folic acid (folate) has been widely employed as a targeting moiety for various anti-cancer drugs [3]. The folate receptor (FR) is a 38 kDa glycosylphosphatidylinositol-anchored protein that binds to the vitamin folic acid with high affinity (Kd < 1 nM). The folate receptors have been known to overexpress in several human tumors including ovarian and breast cancers, while it is highly restricted in normal tissues. Cellular uptake of folate is enhanced by reduced folate carrier and/or proton-coupled folate transporter or the glycosylphophatidylinositol-linked folate receptor (FR) [3]. Recently, folic acid was conjugated to biodegradable polymeric micellar system for doxorubicin targeted delivery. For example, poly(D,L-lactic-co-glycolic
acid)-poly(ethylene glycol) was conjugated to folic acid to deliver DOX (PLGA–PEG–FOL) that exhibited more potent cytotoxic effect on KB cells than free doxorubicin [4]. In other study, doxorubicin-loaded polymeric micelles targeting folate receptors using pH-sensitive micelles composed of poly(L-histidine-co-L-phenlyalanine-b-PEG and poly(L-lactic acid)-b-PEG-folate was reported. This micelle formulation effectively suppressed the growth of existing MDR tumors in vitro and in vivo [5]. In this study, the preparation and characterizations of folate-decorated star-shaped copolymers are presented. Additionally, the in-vitro biocompatibility of copolymeric micelles, including hemolysis and cytotoxicity were also investigated.
II. MATERIALS AND METHODS A. Materials Pentaerythritol ethoxylate (EO/OH: 15/4), ε-caprolactone, doxorubicin hydrochloride (DOX·HCl), 2-diphenyl-1,3,5hexatriene (DPH), and dimethylsulfoxide (DMSO) were purchased from Sigma-Aldrich Chem. Co. Inc. The stannous octoate (Sn(Oct)2) was obtained from MP Biomedicals Inc., USA. The tetrahydrofuran (THF) was distilled from metallic sodium and benzophenone. Triethylamine (TEA), hexane and diethyl ether were purchased from ECHO Chemicals (Miaoli, Taiwan). Cystamine dihydrochloride (Cystamine·2HCl, >98 %) was purchased from Acros Organics, New Jersey, USA. B. Characterizations of Block Copolymers The formation of copolymer was confirmed by 1H NMR, H NMR spectra of the block copolymers were then recorded by using a Bruker spectrometer operating at 500 MHz using CDCl3 and DMSO as solvents. 1
C. Synthesis of Star-Shaped Poly(ε-caprolactone)Poly(Ethylene Glycol) Block Copolymer: PCL-PEG-FOL Under a nitrogen atmosphere, to a DCM solution (5 mL) of OH-PEG-NH2 (240 mg, 0.07 mmol) and star-shaped
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 84–87, 2011. www.springerlink.com
In-vitro Biocompatibility of Folate-Decorated Star-Shaped Copolymeric Micelle for Targeted Drug Delivery
polymer PCL-NPC (105 mg, 0.017 mmol) (ratio 4:1), and TEA 10 uL were stirred at rt for 48 h. Folic acid (0.05 mmol, 22 mg) and DCC (0.06 mmol, 12.4 mg) were dissolved in DMSO (3 mL). The mixture was stirred at rt for 24 h and with DMAP (0.006 mmol, 1.0 mg) were added to above solution. The precipitated product was removed by centrifuge. The mixture was dialyzed against DMSO for 24 h and DD water for 24 h and lyophilized.
85
determined by Greiss reagent (1% sulfanilamide, 2.5% H3PO4, 0.1% naphthylethylenediamine dihydrochloride). Briefly, 100 μL of culture medium was added to 100 μL of Greiss reagent solution and incubated for 15 min. The absorbance was then measured at 540 nm [7]. In the control experiments, macrophages were incubated in a lipopolysaccharides (LPS) solution (100 ng/mL) and a micelle-free medium. Moreover, total protein extract was determined by Micro BCA Protein Assay.
D. Determination of Critical Micelle Concentration The critical micelle concentration (CMC) of copolymers was determined by UV-Vis spectroscopy (JASCO UV-530, Tokyo, Japan) using 1,2-diphenyl-1,3,5-hexatriene (DPH) as the fluorescent probe. Samples for UV-Vis measurement were prepared based on previous literature [6]. The concentration of the aqueous copolymer solution ranged between 1.0 mg/mL and 10-4 mg/mL. Next, a 1.0 mL polymeric solution was added to a 10 µL DPH solution (0.4 mM in MeOH) to give a 4×10-6 M DPH/polymeric solution. The resulting solution was incubated in dark place for 5 h. Additionally, the UV-Vis absorption of incubated solution was measured in a range of 250-500 nm. Finally, the absorbance at 359 nm was selected to determine the CMC. E. Preparation and Characterization of Micelle Micelle was prepared by dissolving 5 mg of copolymer in 1.0 mL mixture of THF and DMSO (1:1, v/v) and, then, 1.0 mL of deionized water (18.2 mΩ-cm purity) was added under stirring. The resulting solution was placed at room temperature for 3 h and, then, was transferred to a dialysis bag and dialyzed against deionized water for 24 h (MWCO: 8,000 Da, Spectrum Laboratories, CA, USA). The solution was diluted to 0.5 mg/mL for particle size measurement. Particle size and zeta potential measurements: The particle size and particle size distribution were determined by dynamic light scattering (DLS) using Zetasizer 3000HSA instrument (Malvern, UK) at a fixed angle of 90o and laser wavelength of 633.0 nm at 25 oC. The average diameter was estimated by the CONTTIN analytical method. Additionally, the zeta potential was measured using an aqueous dip cell in automatic mode using Zetasizer 3000HSA, Malvern instrument. F.
Measurement of Nitric Oxide Production of Micelle
RAW 264.7 macrophage cells were seeded in a 96-well plate (1×104 cells/well) and incubated in 37°C, 5% CO2 for 1 day. Micellar solution at various concentrations was added to the cells in a final volume of 0.2 mL. The supernatants were collected after 24 h and NO production was
G. In vitro Hemolytic Test of Micelle The experimental procedure described here is an adjustment of standard F-756-00 [8], which is based on colorimetric detection of Drabkin’s solution. 0.7 mL of micellar solution at various concentrations was incubated in 0.1 mL of rabbit red blood cells at 37 oC and for 3 h. Following incubation, the solution was centrifuged at 3800 rpm for 15 min. To determine the supernatant hemoglobin, 0.75 mL of Drabkin’s solution was added to 0.25 mL of supernatant and the sample was allowed to stand for 15 min. The amount of cyanmethemoglobin in the supernatant was measured by spectrophotometer (JASCO UV-530, Tokyo, Japan) at a wavelength of 540 nm and then compared to a standard curve (hemoglobin concentrations ranging from 0.003 to 1.2 mg/mL). The percent hemolysis refers to the hemoglobin concentration in the supernatant of a blood sample not treated with micelles to the obtained percentage of micelle-induced hemolysis. H. Cytotoxicity: MTT Assay The cell viability was expressed as a percentage of the control. The in vitro cytotoxicity of micelle was tested against human breast cancer cell lines: MCF-7 by a cell viability assay (MTT assay). MCF-7 cells were seeded in 96well plate at a density of 5×103 cells/well and were incubated at 37 oC under a humidified atmosphere containing 5% CO2 for 24 h before assay. After that, the cells were further incubated in media containing various concentrations of micelle. After 24 h, the medium was removed and washed with PBS. MTT solution was added to each well followed by 4 h of incubation at 37 oC. Subsequently, the medium was removed and violet crystals were solubilized with DMSO (200 ìL). After shaking slowly twice for 5 s, the absorbance of each well was determined using a Multiskan Spectrum spectrophotometer (Thermo Electron Corporation, Waltham, MA, U.S.) at 570 nm and 630 nm. The cell viability (%) was calculated as the ratio of the number of surviving cells in micelle-treated samples to that of control.
IFMBE Proceedings Vol. 35
86
N.V. Cuong, Y.L. Li, and M.F. Hsieh
III. RESULT AND DISCUSSIONS A. Synthesis of Star-Shaped Poly(ε-caprolactone)Poly(Ethylene Glycol) Block Copolymer: PCL-PEG-FOL The star-shaped PCL-PEG-FOL was synthesized by coupling reaction between PCL-PEG-OH and folic acid using DCC-DMAP. Before the coupling reaction, the aminated PEG was allowed to react with PCL-NPC to form star-shaped PCL-PEG-OH. Next, the free hydroxyl group of star-shaped copolymer reacted with γ-carboxylic group of folic acid because of higher reactivity of γ-carboxylic group than the α-carboxylic group. The structure of star-shaped PCL-PEG-FOL was characterized by NMR. The spectrum of star-shaped folic copolymer shows typical peaks for PCL (at 4.05, 2.29, 1.64 and 1.32 ppm) and PEG segments. Additionally, the peaks appear at 6.61, 7.21 and 7.56 ppm which belong to aromatic protons, and peaks at 8.01 and 8.32 ppm are corresponded to aliphatic amide proton and pteridine proton, respectively. The peaks at 2.5 and 3.3 ppm originated from DMSO and HOD, respectively. B. Micellization Behavior of Star-Shaped PCL-PEG-FOL in Aqueous Solution The critical micelle concentration (CMC) of star-shaped PCL-PEG-FOL was determined by fluorescence techniques using DPH as a probe. The results indicated that at a copolymer concentration below the CMC, the intensity of I359 is almost constant. The intensity ratio increases sharply when the polymer concentration increases beyond the CMC and DPH is accumulated into the hydrophobic core of the micelle. The CMC value was 62.5×10-3 mg/mL. Polymeric micelle was prepared via a dialysis method and the size distribution and zeta potential were determined by DLS in water at a concentration of 0.5 mg/mL. The monomodal peak was observed with diameter of 110.5 nm. The polydispersity index of the particle size distribution was 0.45. The zeta potential was -8.4 mV, it is more negative than micelle without folic conjugation (-2.5 mV). C.
micellar concentration of 1.0 mg/mL. In contrast, the LPS (100 ng/mL) significantly increased the NO production by macrophage cells (about 426% of control).
Fig. 1 Effects of star-shaped FOL-PEG-PCL micelle on the level of nitric oxide in RAW264.7 cells. Data represents the mean ± standard error of the mean of four experiments (p F
7
0.15
7.39
0.0039
0.094 0.12 0.62 3.306 E-003 0.18 0.020 0.041 0.19
1 1 1 1
4.52 5.55 29.86 0.16
0.0624 0.0429 0.0004 0.6992
1 1 1 1
0.094 0.12 0.62 3.306E -003 0.18 0.020 0.041 0.19
8.66 0.97 1.98 9.38
0.0164 0.3502 0.1926 0.0135
0.19
9
0.021
1.46
17
significant
significant
Cellulose Acetobacter xylinum
of
Cellulose carrier modified with polyethleneimine Camel backbone Activated carbon (Indian almond) Sago waste carbon CNT-GAC
1. 65μg/g(chloralkali wastewater 2. 80μg/gsynthetic wastewater 288.0 mg/g 28.24 mg/g
Reference A.Rezaee al.,2005
et
Navarro al.,1996
et
55.6 mg/g
Hassan SS et al.,2008 Inbaraj & Sulochana,2006 Kadivelu,2004
6.405 mg/g
This study
94.43 mg/g
Based on Table 3, it shows that there are many studies on the removal of Hg (II) using various types of adsorbent. However, the adsorbent capacity for each adsorbent is different due to the variation in the operating parameters (pH, agitation speed, dosage, temperature and many more). Thus, this comparative study was conducted to further understand the mechanism of adsorption and compare the types of adsorbents that were previously used to remove Hg (II).
IV. CONCLUSIONS
From the analysis, the Model F-value of 7.39 implies the model is significant. There is only a 0.39% chance that a "Model F-Value" this large could occur due to noise. Values of "Prob > F" less than 0.0500 indicate model terms are significant. In this case B, C, AB are significant model terms. Values greater than 0.1000 indicate the model terms are not significant. If there are many insignificant model terms (not counting those required to support hierarchy), model reduction may improve your model. The parameters involved in this study, which are pH, contact time, agitation speed and adsorbent dosage can be analyzed by graphical representation. One plot factor and 3-dimensional interaction plot were used to show the interaction between those parameters. The linear effect of changing the level of a single factor in the range of low (-1) and high (+1) levels was shown in one plot factor, while other factors are fixed at certain values. The 3-dimensional plot shows the interaction between the actual factors.
The effects of heavy metals such as lead, mercury, copper, zinc and cadmium on human health have been studied extensively. Excessive ingestion of them can cause accumulative poisoning, cancer, nervous system damage, etc. Since human beings are exposed to hazardous metal such as mercury, a great concern on how to overcome the effect should be investigated. Carbon nanotubes and activated carbon are found to be efficient as an adsorbent to remove heavy metal from wastewater. This study concentrates on the removal of heavy metals from wastewater by using carbon nanotubes grown on granulated activated carbon (GAC), where mercury was chosen as the heavy metal. The efficiency of the adsorption was determined in term of percentage removal. The four parameters that were chosen to determine the optimization of the process are pH, agitation speed, contact time and also the adsorbent dosage used, which is the CNT grown on GAC. The results showed that the most significant factor contributing to the adsorption process was the contact time. This model term gives the highest F-value in
IFMBE Proceedings Vol. 35
Mercury (II) Removal Using CNTS Grown on GACs
91
ANOVA analysis, which is 29.86. It is also shown that the four parameters are significant from the ANOVA analysis. From the result, the optimal conditions for mercury (II) ions removal occur at adsorbent dosage of 5 mg, pH 5, agitation speed of 150 rpm and contact time of 120 minutes.
ACKNOWLEDGMENT The author acknowledge the financial help from the research grant EDW A10-160-0713 of IIUM.
REFERENCES 1. Kabbashi,N.A., Atieh,MA., Al-Mamun,A., Mirghami, Mohamed ES, Alam, Md.Z., & Yahya,N. (2008) Kinetic adsorption of application of carbon nanotubes for Pb(II) removal from aqueous solution. Journal of Environmental Sciences, 21, 539–544 2. Torres,J., Olivares,S., De La Rosa,D., Lima,L., Martinez,F.,Munita,C.S.,& Favaro,D.I.T.(1998).Removal of Mercury(II) and methylmercury from solution by tannin adsorbents. Journal of Radioanalytical and Nuclear Chemistry, Vol.240, p.361-365
3. Canstein,H.V, Li,Y., Timmis,K.N., Deckwer,W.-D.,& Wagner,D.B.(1999), Removal of Mercury from Chloralkali Electrolysis Wastewater by a Mercury-Resistant Pseudomonas putida Strain. Applied and Environmental Microbiology, 65(12), 5279–5284. South J, Blass B (2001) The future of modern genomics. Blackwell, London 4. Goyal,M., Bhagat,M., & Dhawan,R. (2009). Removal of mercury from water by fixed bed activated carbon columns. Journal of Hazardous Materials, 171, 1009–1015. 5. Pavlogeorgatos,G.,& Kikilias,V.(2003), The Importance of Mercury Determination and Speciation to The Health of The General Population. Global Nest: The Int.Journal ,4(2-3), 107-125 6. Zabihi,M., Ahmadpour,A., & Haghighi,A.A.,(2010) Studies on adsorption of mercury from aqueous solution on activated carbons prepared from walnut shell. Journal of Hazardous Materials, 174,251–256. 7. Sakamoto,H., Ichikawa,T.,Tomiyasu,T., & Sato,M.(2004). Mercury Concentration in Environmental Samples of Malaysia.Faculty of Science,Kagoshima University,37,83-90
Author: Institute: Street: City: Country: Email:
IFMBE Proceedings Vol. 35
Nassereldeen Ahmed Kabbashi International Islamic University Malaysia Jalan Gombak Gombak Malaysia
[email protected] Optical Properties Effect of Cadmium Sulfide Quantum Dots towards Conjugation Process S.A. Shamsudin1, N.F. Omar2, and S. Radiman1 1
2
School of Applied Physics, UniversitiKebangsaan Malaysia,Bangi, Malaysia School of materials and mineral resources engineering, Engineering Campus, UniversitiSains Malaysia, NibongTebal, Malaysia
Abstract— Sphere-shaped cadmium sulfide quantum dots (CdS QDs) with well-controlled morphology and uniform size were successfully synthesized by using simple colloidal method with addition of thiolglycolic acid as stabilizer. Size and optical properties of CdS QDs could be tuned by altering the CdS QDs surface with capped ligand Polyethylenimine (PEI) while their aqueous isoelectric charge was adjusted by changing the pH solution with added sodium hydroxide (NaOH). Morphology, optical properties and surface charge of CdS QDs have been characterized by transmitted electron microscopic (TEM), absorption spectra analysis, photoluminescence spectroscopy and Nanozeta potential, respectively. Furthermore, CdSlysozyme conjugates have been obtained by electrostatic interaction between CdS QDs and lysozyme, which is lysozyme protein with isoelectric +11.2 mV. Surface change after conjugation process was investigated. Optical absorption edge and intensity of luminescence was not affected after conjugation process. Keywords— CdS QDs, Polyethylenimine (PEI), Optical Properties, CdS-lysozyme conjugates, Electrostatic interaction.
I. INTRODUCTION Semiconductor quantum dots (QDs) are attracting great interest in applications such as display devices and biochemical fluorescent tag due to their photo stable, sizetunable, narrow bandwidth photoluminescence and chemically functionalizable surfaces[1]. QDs also can emit intense light in the region from near-infrared to ultraviolet due to exciton recombination [2,3]. Optoelectronic properties [4,5] of II–VI group like CdS has advantages due to direct band gap (Eg = 2.41 eV), high absorption coefficient, good conversion efficiency, high thermal stability and easy to synthesis [6]. The study of QDs in the strong-confinement regime becomes clear when one considers the Bohr radii of excitons in semiconductors, which are typically ~10 nm or less. If ae and ah are the Bohr radii of the electron and hole, then strong confinement will occur [7]. This phenomenon is called quantum confinement effectwhich modified the electronic structure of QDs. The small electron and hole masses, imply large confinement energies and make the band gap energy is widened, leading to a blue shift in the band gap,
emission spectra etc. Thus, electronic spectra of CdS QDs with energy spacing’s that can be much larger than the energy gaps of the bulk CdS [8,9]. The surface states will play a more important role in the nanoparticles, due to their large surface-to-volume ratio with a decrease in particle size. For QDs, radiative or nonradiative recombination of an exciton at the surface states becomes dominant in its optical properties with a decrease of particle size [10-12]. Luminescence efficiency of QDs has been sufficiently improved by a surface passivation technique[13]. Surface passivation is used to reduce non-radiative surface recombination of charge carriers, which behaving as non-radiative relaxation centers for the electron-hole recombination.By applying proper surface passivation ligands to eliminate surface traps that aroused by dangling bonds, it will lead to luminescence enhancement [14–21]. CdS QDs colloidal solutions must be prepared not only as water-soluble, but it should be biocompatible and able to react with the biomacromolecules such as proteins. Wang et al. use mercaptoacetic acid to react with the CdS nanoparticles, the mercapto group binds to a Cd atom, and the polar carboxylic acid group renders the nanoparticles water soluble and biocompatible. The free carboxyl group is also available for covalent coupling to various biomolecules by covalent interaction to reactive amine groups [22]. Thioglycolic acid (TGA) also contain carboxylic group, which was previously used as the stability agent to prevent the chalcogenidenanocrystals from aggregating [23]. Optical properties for the obtained CdS QDs capped by PEI and the conjugation process between CdS and lysozyme were discussed in this experiment.
II. EXPERIMENTAL A. Apparatus The Transmission Electron Microscopic (TEM) image of QDs were obtained using a Transmission Electron Microscope CM12 (Philips) operating at a 100 kV accelerating voltage. After sonication, the colloidal solutions of CdS QDs in aqueous were dropped onto 50Å thick carbon coated
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 92–96, 2011. www.springerlink.com
Optical Properties Effect of Cadmium Sulfide Quantum Dots towards Conjugation Process
copper grids with the excess solution immediately wicked away. Fluorescence spectrum was performed by using a F7000 spectrofluorometer (Hitachi, Japan)with a quartz cell (1 cm×1 cm). The fluorescence spectra were recorded at λex = 422 nm. The optical absorption spectra were measured by a UV- 2450 UV-Vis spectrophotometer (Shimadzu, Japan).ZetaSizer Nano ZS90 (Malvern Instrument, Worcs, UK) equipped with 4 mW He–Ne Laser was used to determine surface charge.
93
about 5.4 nm. The min diameter of the CdScapped with PEI is smaller by 0.65 nmthan CdS QDsmin diameter. In addition, TEM showed that the solublization and cross-linking steps did not result in aggregation.
(a)
(b)
B. Material and Reagent
C. Procedure In the present study, we investigated the effect of passivation agent employed on CdS QDs surface were investigated. The basic CdS colloids were prepared following a method described by Shamsudin et al.[24]. CdS quantum dots were synthesized by colloidal method using TGA as stabilizing agent. Briefly, 0.3 mmol Cd Acetate were dissolved in 65ml of water and 20µl of thioglicolic acid (TGA) were added under stirring. The pH value was adjusted with pH modifier 0.1 MNaOHto pH9. 0.02 mmol Sodium Sulfide were dissolved in 35 ml of water. The oxygen in the system was removed by the flowing of nitrogen. Under stirring condition, Na2S was added. Then, the colloidal CdSwas kept in stirring condition overnight at room temperature. Proper amounts of PEIs were added into the performed CdS solution with a microsyringe. We used the capped CdS QDs-PEI to conjugate with the lysozyme (lys) viaelectrostatic interaction. 1.0 ml of buffer NaOH-KH2PO4 (pH 7.28), 1.5 ml of colloids (2.0 × 10−6mol l−1), and an appropriate volume of sample or protein working solution were added, then diluted with water and mixed thoroughly.
Fig. 1 TEM images of (a)CdS QDs and (b)CdS QDs capped with PEI B. Absorbance Spectrum The observations were explained bycomparison of the absorbance spectrabetween CdS QDs solutions in the absence and in the presence of PEI. The situation is clearly seen from Fig. 2which illustratedCdS QDs in the presence of PEI exhibit absorption edges which is blue-shifted with decreasing particle size.Significant absorbance spectrum for CdS in the presentof PEI at 428nm when compared with absorbance spectrum in the absence of PEI (439nm), reflecting the quantum confinement effect of the CdS QDs[25].This corresponds mainly characterized by a bandgap between the valence band and the conduction electron band, which is a function of the diameter of QDs, called a size quantization effect [26].
Absorbance (a.u)
Cadmium acetate was purchased from Fluka, Switzerland. PEIs with 10,000 molecular weight,thioglycollic acid (TGA),hen egg-white lysozyme and sodium sulphide were sourced from Sigma-aldrich, German. Sodium hydroxide was obtained from Needham Suffolk, England.TGAmodified CdS was synthesized as follows [24]. All reagents were of analytical grade and were used as received without further purification. Distilled water was used throughout the whole experiment.
4 3 2 1 0
b
a
370 400 430 460 490 Wavelenght (nm)
Fig. 2 The absorbance spectra of CdS QDs solutions in the absence (a) and in the presence (b) of PEI
III. RESULT AND DISCUSSION C. Band Gap Energy
A. TEM Images of Quantum Dots TEM images of CdSQDs and CdS QDs capped with PEIare shown in Fig. 1. Themin diameter of the CdSQDs is
The effect of quantum confinement in semiconductors is supported by rigorous theoretical calculations by Brus [27]. The linear and resonant nonlinear optical properties will
IFMBE Proceedings Vol. 35
94
S.A. Shamsudin, N.F. Omar, and S. Radiman
exhibit the greatest enhancement when the QDs radius R is much smaller than the Bohr radius of the exciton (aB) in the parent bulk material [7]. The fundamental absorption, which corresponds to electron excitation from the valence band to conduction band, can be used to determine the value of the optical band gap [25].The relation between the band gap (Eg) and maximum wavelength ( λmax) can be written as:
ܧ ൌ ఒ
(1)
ೌೣ
where, Egis the band gap of the material, h is Planks constant, cisspeed of light andλmaxis the absorbance peak wavelength [27]. Base on this equation, band gap is inversely proportionalto wavelength (λ max).Equation (2) is used for analyses on optic absorbance spectrum to determine band gap energy for difficult spectra and unclear peaks. ሺߙ݄ݒሻଶ ൌ ܭ൫݄ ݒെ ܧ ൯
(2)
where, αis absorbance constant, hv is photon discrete energy and Egis the band gap. Absorbance constant value can be calculated using equation (3) in the below.
α =
1 − log I t I o A = t log e t log e
(3)
(αhv)2 (eV/m)2
where,tisquartz cuvettecell thickness, ItandIoare transmission and incidence light intensity, respectively andAis sample absorbancefrom UV-Vis measurement. Band gap energy is illustrated in graph (αhv)2versusphoton energythat which is shown in Fig.3 is 2.99eV through calculation with using equations (2) and (3).
800
a b 400 0 2.5
2.8
Upon excitation wavelength, λex = 400nm with open slit for both emission and excitation are 5nm for both CdS QDs and CdS QDs modified with PEI, exhibited photoluminescence with the maximum emission at 540nm, which is the peaks of photoluminescence intensity is located in green-yellow peak range in wavelength 400nm-660nm. This emission peaks were assigned to an electron-hole recombination in the CdS QDs and is further indicative of the quantum size effect. Jie et al.[28] have been capped CdS QDs with three difference molecular weight of PEI, showed photoluminescence spectrum shape changes very little as a function of the ligand, indicating little or no excitation transfer between QD and the ligand PEI for these samples. They also mentioned, PEI is a kind of Lewis base and Lewis bases can be caused by photoluminescence enhancement. Based on that fact, we just used only one kind of PEI with 10,000 of molecular weight. For the latter function, the two major factors of the capping density and the electron donation ability were important factors for passivating the surface defects. If the surface defects could not be sufficiently passivated, therefore, the photoluminescence intensity became small. The photoluminescence intensity increased with the increasing electron donation ability of the amines group(s). It was shown that the electron transfer from the capping ligand to the surface atoms of the CdS QDs was effectively passivated the surface defects. Therefore, the chemical role of the amines affects the luminescence properties [29]. By taking the amines as coordinating agents in the removal of cadmium metal into consideration [13], the alkylamines in the solution should behave not only as capping ligands, but also complex ligands as Cd-amine in the source solution. Polymer-capped nanocrystals can preserve their original optical properties and enhance some attractive features without any aggregation because amine acts as an anchor to the surface of the particle[30]. PEI was cationic in nature; it carried a positive charge and so could be absorbed onto the negatively charged CdS QDs surfaces by electrostatic attraction [31]. Therefore, PEI can be usednot onlyas a passivation ligand but also as a dispersion agent in aqueous medium of CdS QDs.
3.1
Photon Energy (eV)
Fig. 3 The band gap energy of CdS QDs solutions in the absence (a) and in the presence (b) of PEI
D. Photoluminescence Spectra As shown in Fig. 4, changing of photoluminescence spectra can be studied by the interaction between CdS QDs and PEI molecules in aqueous solutions. Thephotoluminescence intensity drastically enhanced in spectra observed upon CdS QDs modified with PEI, which containing amine group.
Fig. 4 The photoluminescence spectraof CdS QDs solutions in the absence (a) and in the presence (b) of PEI
IFMBE Proceedings Vol. 35
Optical Properties Effect of Cadmium Sulfide Quantum Dots towards Conjugation Process
E. Conjugation Process by Electrostatic Interaction Optical Properties Effects: The absorption intensities have shown in Fig. 5which increased from 3.6 to 3.9. Juan et al. [32]have reported that the absorbancepeaks have a blue shift, because the aggregation of lysozyme on the surface of nanoparticles broadens the energy gap of the nanostructure, and thus cause a blue shift on the absorbance spectrum. However for our experiment,it was seen that the absorbance peaks have not givenany effect of wavelength shifted after conjugation process. Here we assume the lysozyme was well absorbed on CdS QDs surface and no aggregation has been done.Other than that, the size of CdS QDs has not been affected by this conjugation process.
95
Surface Charge: Further investigation of this electrostatic interaction, the charge of CdS QDs and conjugate CdSlys was measured by pH values on their surfaces. The pH value greatly affected the interaction between CdS QDs and lysozyme. The surface of CdSQDs has given by Zeta potential result is -1.32 mV, and the isoelectric point (pI) of lysozyme is +11.2 mV as reported by Juan et al. [32]. Based on zeta potential theory, the surface charge become negative when the solution in alkaline condition.Whilethe solution is adjusted to acidic condition, the surface charge turns to positive. We believe this negative charge CdS QDs and positive charge lysozyme has been conjugated by electrostatic interaction.
IV. CONCLUSIONS We fabricated the well-ordered CdS QDs assemblies with lysozyme. The resulting of conjugation has been showed that the optical properties have not been affected by electrostatic interaction. We expect that following more rigorous testing as toxicity test upon biology materials could afford entry of CdS QDs capped with PEI into devices or components for molecular biology, biotechnology and biomedicine.
ACKNOWLEDGMENT Fig. 5 Comparison of absorption peaks between CdS QDs and conjugate CdS-Lys
The effect of photoluminescence intensity upon conjugation process was observed via photoluminescence spectra that areshown in Fig. 6. This observation found that the CdS QDs photoluminescence intensity showed a little increase after conjugation process. Specifically,the intensity increase from 15225to 15935, which the CdS QDs photoluminescence peak has not shifted toward other wavelength region upon this electrostatic interaction.
Fig. 6 Effect of photoluminescence intensity upon conjugation process
We thank UKM for giving us the full grant of UKMOUP-NBT-27-138/2008 and UKM- ST- 01- FRGS00632006.
REFERENCES 1. Sibel E. D., Rıdvan S., Sibel B., Deniz H., Adil D., Arzu E (2008) Quantum dot nanocrystals having guanosine imprinted nanoshell for DNA recognition. Talanta 75: 890–896 2. Raffaelle R. P., Castro S. L., Hepp A. F., and Bailey S. G. (2002) Quantum dot solar cells. Prog.Photovolt: Res. Appl. 10:433–439 3. Trindade T., O’Brien P., Pickett N.L. (2001) Nanocrystalline Semiconductors: Synthesis, Properties, and Perspectives. Chem. Mater. 13:3843-3858 4. Brus L.E. (1991) Quantum Crystallites and Nonlinear Optics. Appl. Phys. A 53:465-474 5. Ghazali A., Zainal Z., Hussein M.Z., Kassim A. (1998) Cathodicelectrodeposition of SnS in the presence of EDTA in aqueous media. Solar Energy Materials and Solar Cells 55:237-249 6. Gouri S. P., Purabi G. ,Pratima A. (2008) Structural and stability studies of CdS and SnS nanostructures synthesized by various routes. Journal of Non-Crystalline Solids 354: 2195–2199 7. Wise, F. (2000) Lead Salt Quantum Dots: The Limit of Strong Quantum Confinement. Account of Chemical Research 33:773-780 8. Krishnan R., Norma R. de Tacconi, Chenthamarakshan C. R. (2001) Semiconductor-Based Composite Materials: Preparation, Properties, and Performance. Chem. Mater. 13:2765-2782
IFMBE Proceedings Vol. 35
96
S.A. Shamsudin, N.F. Omar, and S. Radiman
9. Alivisatos A. P. (1996) Semiconductor Clusters, Nanocrystals, and Quantum Dots Science. Science 271:933-937 10. Anderson M. A., Gorer S., Penner R .M. (1997) A Hybrid Electrochemical/Chemical Synthesis of Supported, Luminescent Cadmium Sulfide Nanocrystals. J. Phys. Chem. B101:5895-5899. 11. Henshaw G., Parkin I. P. , Shaw G (1996) Convenient, low-energy synthesis of metal sulfides and selenides; PbE, Ag(2)E, ZnE, CdE (E=S, Se). CHEM COMMUN 10:1095-1096 12. Hirai T., Bando Y., Komasawa I. (2002) Immobilization of CdS Nanoparticles Formed in Reverse Micelles onto Alumina Particles and Their Photocatalytic Properties. J. Phys. Chem. B106(35): 8967-8970 13. Bowe C. A., Pooré D. D., Benson R. F., Martin D. F. (2003) Extraction of heavy metals by amines adsorbed onto silica gel. J Environ Sci Health ATox Hazard Subst Environ Eng. 38 (11):2653-2660 14. Majetich S.A., Carter A.C.(1993) Surface Effects on the Optical Properties of Cadmium Selenide Quantum Dots. J. Phys. Chem., 97:(34)8727- 8731 15. Selvan B.S.T., Bullen C., Ashokkumar M., Mulvaney P. (2001) Synthesis of Tunable, Highly Luminescent QD-Glasses Through Sol-Gel Processing. Adv. Mater. 13:985-988 16. Seker F., Meeker K., Kuech T.F., Ellis A.B. (2000) Surface Chemistry of Prototypical Bulk II–VI and III–V Semiconductors and Implications for Chemical Sensing. Chem. Rev. 100:2505- 2536 17. Meyer G. J., Lisensky G. C., Ellis A. B. (1988) Evidence for Adduct Formation at the Semiconductor-Gas Interface. Photoluminescent Properties of Cadmium Selenide in the Presence of Amines. J. Amer. Chem. Soc. 110:4914-4918 18. Lisensky G. C., Penn R. L., Murphy C. J., Ellis A. B. (1990) ElectroOptical Evidence for the Chelate Effect at Semiconductor Surfaces. Science 248:840 19. Winder E.J., Moore D.E., Neu D.R., Ellis A.B., Geisz J.F., Kuech T.F. (1995) Detection of ammonia, phosphine, and arsine gases by reversible modulation of cadmium selenide photoluminescence intensity. J. Cryst. Growth 148 63-69. 20. Murphy C. J., Lisensky G. C., Leung L. K., Kowach G. R., Ellis A. B. (1990) Photoluminescence-Based Correlation of Semiconductor Electric Field Thickness with Adsorbate Hammett Substituent Constants. Adsorption of Aniline Derivatives onto Cadmium Selenide. J. Amer. Chem. Soc. 112:8344 21. Murphy C.J., Ellis A.B. (1990) The coordination of mono- and diphosphines to the surface of cadmium selenide . Polyhedron 9 19131918. 22. Wang L., Wang L., Zhu C., Wei X.W., Kan X. (2002) Preparation and application of functionalized nanoparticles of CdS as a fluorescence probe. AnalyticaChimicaActa 468:35–41
23. Zhang H., Ma X., Ji Y., Xu J., Yang D. (2003) Single crystalline CdSnanorods fabricated by a novel hydrothermal method. Chemical Physics Letters 377:654–657 24. Shamsudin S.A., Radiman S., Ghamsari M. S., Khoo K. S. (2009) Synthesis CdSnanocrystals in various pH values. AIP Conference Proceeding 1136:292-296 (proceeding paper) 25. Kuldeep S.R., Patidar D., Janu Y., Saxena N.S., Kananbala, S., Sharma, T.P. (2008) Structural and optical charcterization of chemically synthesized zns nanoparticles. Chalcogenide Letter 5 (6) :105-110 26. 26. Hwang S.-H., Moorefield C.N., Wang P., Jeong K.-U., Chong S.Z.D., Kotta, K.K. ,Newkome G.R. (2006) Construction of CdS quantum dots via a regioselective dendritic functionalized cellulose template. Chemical Communication 3495- 3497 27. Brus, L.E. (1984) Electron–electron and electron-hole interactions in small semiconductor crystallites: The size dependence of the lowest excited electronic state. Journal of Chemical Physics 80: 4403-4409 28. Jie M., Jun-Na Y., Li-Na W., Wei-Sheng, L. (2008) Easily prepared high-quantum yield CdS quantum dots in water using hyperbranchedpolyethylenimine as modifier. Journal of Colloid and Interface Science 319: 353-356 29. Nose K., Fujita H., Omata T., Shinya O.Y.M., Nakamura H., Maeda H. (2007). Chemical role of amines in the colloidal synthesis of CdSe quantum dots and their luminescence properties. Journal of Luminescence 126:21-26 30. Chun, F., Qi, X.Y., Fan, Q.L., Wang, L.H. & Huang, W. (2007). A facile route to semiconductor nanocrystal-semiconducting polymer complex using amine-functionalized rod–coil triblock copolymer as multidentate ligand. Nanotechnology 18 (3): 035704 31. Zhang, Y. & Jon, B. (2008) Effect of dispersants on the rheology of aqueous silicon carbide suspensions. Ceramics International 34: 13811386 32. Juan Li., Xi-Wen H. Yun-Li W. Wen-You L., Yu-Kui, Z. (2007) Determination of lysozyme at the nanogram level by a resonance lightscattering technique with functionalized CdTe nanoparticles. Analytical Sciences 23:331-335
Author: SitiAisyahBintiShamsudin Institute: Street: City: Country: Email:
IFMBE Proceedings Vol. 35
University Kebangsaan Malaysia Selangor Bangi Malaysia
[email protected] Synthesis of Hydroxyapatite through Dry Mechanochemical Method and Its Conversion to Dense Bodies: Preliminary Result S. Adzila1,3, I. Sopyan2, and M. Hamdi1 1
2
Department of Engineering Design and Manufacture, University of Malaya, Kuala Lumpur, Malaysia Department of Manufacturing and Materials Engineering, International Islamic University Malaysia, Kuala Lumpur, Malaysia 3 Department of Materials Engineering and Design, University of Tun Hussein Onn Malaysia, Johor, Malaysia
Abstract— Hydroxyapatite (HA) powder has been prepared through mechanochemical synthesis from a dry powder mixture of calcium hydroxide Ca(OH)2 and di-ammonium hydrogen phosphate (NH4)2HPO4. Three different rotation speeds of 170 rpm (M1), 270 rpm (M2) and 370 rpm (M3) were used in this method. The as synthesized powder analyzed by FTIR and XRD confirmed the formation of HA structure with nano crystallite size in all milling speeds. XRD results showed the wide broad peaks of HA powders narrowed and crystallinity increased (31.0-42.5%) when the milling speed was accelerated to 370 rpm. The powders were compacted using cold isostatic pressing at 200 MPa and then subjected to 1150oC, 1250oC and 1350oC sintering. The sintered compacts were mechanically tested by Vickers microhardness indentation method. Powder synthesized at 370 rpm was found to have a significant hardness, 5.3 GPa obtained after 1250oC sintering. Keywords— Hydroxyapatite, Mechanochemical, Milling speed, Sintering, Vickers microhardness.
Various morphology, stoichiometry and level of crystallinity can be achieved depend on the technique and methods use for synthesis process. There have been several methods applied in synthesized HA nanocrystalline powder consist of co-precipitation [9], emulsion/microemulsion [15], solgel [16], hydrothermal [17] and mechanochemical [18]. Mechanochemical method is simple and low cost compared to other methods. The chemical processes occurring during mechanical action on solids became to be more specific and versatile. Besides, mechanochemical treatment has been recently receiving attention as an alternative route in preparing materials characterized by better biocompatibility with natural bone [18, 19]. Since then, there are several studies using a wet medium in mechanical milling have been reported [20-22] instead of milling in dry condition [18,23]. In this present study, HA powder was prepared through mechanochemical route without using any wet medium. The effect of speed will be investigated into powder properties as well as sintered dense bodies.
I. INTRODUCTION Hydroxyapatite (HA) is usually used for a number of biomedical applications in the forms of granules, blocks, as coating [1-4], as composite with polymer and ceramic [5-7], for bone augmentation and middle-ear implants [4]. HA has shown also the benefits in therapeutic antitumor vaccine [8] and was useful for drug delivery and antibiotics [9-10]. HA naturally contained in human bone as the crystals within collagen. The high strength and crack resistance or fracture toughness are necessary for the reliable work of an implant in the body [11]. Many improvements have been made earlier to overcome the limitation of HA in loading application by controlling microstructures via novel sintering technique or utilization of nano powders and by adding dopants [12-13]. Development of dense HA ceramics with superior mechanical properties is possible if the starting powder is stoichiometric with better powder properties such as crystallinity, agglomeration, and morphology. A decrease in grain size to nano scale in dense sintered materials is a desired parameter to enhance the mechanical and biological properties of HA-based bioceramic materials [14].
II. MATERIALS AND METHODS The two precursors for synthesis HA powder were commercially available calcium hydroxide Ca(OH)2 (R&M Chemicals) and di-ammonium hydrogen phosphate (NH4)2HPO4 (Systerm). The reaction of the two precursors as follows 5Ca(OH)2 + 3(NH4)2HPO4 → Ca5(PO4)3OH + 6NH3 + (1) 9H2O In the planetary ball mill, the precursor powders with molar ratio of 1.67 Ca/P were loaded and mixed in stainless steel vials and ball as a milling medium. Powder to ball mass ratio was 1/6 and the milling time was taken to 15 hours with three different rotation or milling speeds; 170 rpm (M1), 270 rpm (M2) and 370 rpm (M3). To determine the weight loss, the as synthesized powders were subjected to thermal analysis in a heating rate of 10oC/min from room temperature to 1300oC under atmosphere using Perkin Elmer Phyris Diamond TG-DTA equipment.
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 97–101, 2011. www.springerlink.com
98
S. Adzila, I. Sopyan, and M. Hamdi
Phases in the as synthesized powders were identified using an X-ray diffractometer (CuKα, Shimadzu XRD 6000 diffractometer). All measurement were performed at room temperature with the range of 2θ=25-55oC at 2oC/min scan speed. All samples were analyzed by referring to standards of the Joint Committee of Powder Diffraction Standards (JCPDS) card number, 09-0432 [24]. The functional group of both the as synthesized powders and the powders after sintering were analyzed using a Perkin-Elmer Spectrum FTIR spectrometer of 4000-400cm-1 scanning range with resolution of 4 cm-1. The as synthesized powders were uniaxially pressed into pellets in a steel die of 10.5 mm in diameter using 2.5 MPa loading for two minutes , followed by cold isostatic pressing (CIP) at 200 MPa for five minutes. The green bodies were sintered at three different temperatures; 1150oC, 1250oC and 1350oC with both heating and cooling rates were 5oC/min in two hours holding time. Sintered compacted powders were then subjected to Vickers microhardness testing using indentation technique (MVK H2) after polished at 1000 grid of silicon carbide.
calculate the crystallite size. Table 1 shows the crystallite sizes of the samples. The crystallite size was not proportional with the milling speed, so it was not affected by the various speed applied. In contrast, the crystallinity of the powders was increased as the speed level up to until 370 rpm. Table 1 Crystallite size and crystallinity of HA powder Sample
Milling Speed (rpm)
Crystallite size (nm)
Crystallinity (%)
M1 M2 M3
170 270 370
4.71 3.08 4.87
31.0 32.0 42.5
III. RESULTS A. X-Ray Diffraction (XRD) Analysis
Fig. 1 XRD patterns of as-synthesized HA powder with various milling speeds
Figure 1 shows the XRD patterns of the as synthesized powder at three different milling speeds. HA characteristic with the broad peaks already appeared in lower milling speed of 170 rpm. However, the powder still containing the unreacted precursor belongs to di-ammonium hydrogen phosphate (DAP). As the milling speed increased to 270 rpm, the HA peaks intensely growth with peaks improved. The DAP peaks were not detected. At 370 rpm, the narrow peaks observed with the new peaks of HA detected at (112) and (212) compared to previous milling speeds. The crystallite size of the powders was calculated using Scherrer formula [25] ܦൌ
ୡ୭ୱඥனమ ାன୭మ
(1)
where D is the crystallite size (nm); k is the shape coefficient, 0.9; λ is the wave length (nm); θ is the diffraction angle (o); ߱ is the experimental full width at half maximum (FWHM); ߱ is the standard FHWM value. For this purpose, FWHM at (002) (2θ=25.8o) has been chosen to
B. Thermal Gravimetric Analysis (TGA) The graph in figure 2 shows that all of powder samples start to loss the weight below 100oC. This situation is attributed to the evaporation of adsorbed water and phase transformation occurs until 900oC. This trend was continuous until 1300oC. C. Fourier Transform Infra Red (FTIR) The chemical functional group of the synthesized calcium phosphate powder was determined by using FTIR analysis. Figure 3 for example shows the FTIR spectra for HA powder through dry mechanochemical synthesis with different speeds. Phosphate (PO4) band have four vibration modes ν1, ν2, ν3, and ν4. All samples indicate that at ν1 and ν2 modes, PO4 band was appeared at around 962 cm-1 and 474 cm-1 respectively. ν3 mode also consist of PO4 band at around 1088 cm-1 and 1023 cm-1. Besides that the PO4 band also was detected at ν4 mode at around 599 cm-1 and 560 cm-1.
IFMBE Proceedings Vol. 35
Synthesis of Hydroxyapatite through Dry Mechanochemical Method and Its Conversion to Dense Bodies: Preliminary Result
Fig. 2 TGA graphs of milled HA powders at different speed heated to 1300oC in air (heating rate=10oC/min)
From M1 HA powders, ν1, ν3 and ν4 modes became weak when sintering temperature increased from 1150oC to 1350oC except for ν2 mode which disappeared when sintering temperature increased. This trend also similar with M2 and M3 HA powders. The weak band of hydroxyl group was detected at 628 cm-1 [22, 26] from all of the as synthesized HA powders at different milling speeds. In M1 HA powders, the hydroxyl band exists clearly at 1150oC compared to the as synthesized powder, and changed to a weak band at 1250oC until vanished at 1350oC sintering temperature. On the other hand, M2 HA powder reduced the OH band from 1150oC to 1250oC and lost consequently at 1350oC. In contrary, the small hydroxyl band only stayed at 1150oC and fully removed at 1250oC and 1350oC. Band around 1635-1646 cm-1 was attributed to the present of water in all powder samples. At the same time, the broad band of absorbed moisture can be seen at the range of 3200-3600 cm-1[27]. These bands totally disappeared when subjected to the heat treatment from 1150oC to 1350oC sintering temperature. D. Vickers Micro Hardness The effect of sintering temperature on the Vickers hardness is shown in figure 4. In this test, M3 compacted powder yielded significant hardness, 5.3 GPa when sintered at 1250 oC followed by M1 compacted powder, 5.1 GPa sintered at 1350oC. Only hardness in M1 compacted powder was continuously increased with sintering temperature compared to M2 and M3 compacted powders which were increased initially at 1250oC and then dropped when they reached at 1350oC sintering temperature. At 1150oC, hardness in M2 compacted powder (4.6 GPa) was found higher than M3 and M1 (2.9 GPa and 2.1 GPa).
99
Fig. 3 The FTIR spectra of HA powder milled at 370 rpm rpm before (a) and after sintering at 1150oC (b), 1250oC (c) and 1350oC (d). [( ): H2O), ( ): PO4, ( ): OH]
Fig. 4 Microhardness graph for sintered compacted powder samples at three different milling speed
IV. DISCUSSION From XRD analysis, nanocrystallite size of HA powder obtained after milling at different speed denoted as M1, M2 and M3. HA structure starts to form in early of milling speed, 170 rpm. At this speed, another phase which is believed belongs to precursor, was existed and it indicated that the process was not reacted at all. Higher milling speed has led to the formation of single HA without formation of any secondary phase. The crystallinity was increased from 3142.5% with the milling speed and it can be seen from the peaks which were intensely growth as the speed increased. Mechanical milling on powders size did not affected by milling speed and the size around 3 to 5 nm yielded through this method. This size was significantly lower than previous study by Silva et al [28] using CaHPO4, CaCO3 and NH4H2PO4 as precursors in dry milling at 370 rpm for 15 hours. It is noted that the weight of all powder samples dropped at the range of 900oC an above might be associated with the formation of β-TCP by releasing the hydroxyl group. This condition was similar with FTIR spectra where hydroxyl
IFMBE Proceedings Vol. 35
100
S. Adzila, I. Sopyan, and M. Hamdi
group merely disappeared as heated from 1150oC -1350oC. In addition, the phosphate band was maintained but the peak was reduced until 1350oC. During sintering process, some of impurities were detected from the band in the range of 1970 cm-1 - 2600 cm-1. At 1150oC, greater hardness is shown by M2 compacted powder, 4.6 GPa which related to the smaller crystallite size obtained compared to M1 and M3 compacted powders. At 1250oC, significant hardness was found in M3 compacted powder, 5.3 GPa followed by M2 compacted powder. This consolidation might be attributed to the sintering effect on M3 powder compaction.
V. CONCLUSION The dry mixture of Ca(OH)2 and (NH4)2HPO4 from different milling speeds has been successfully produced nanocrystalline hydroxyapatite. The milled HA at different speeds were analyzed by XRD, FTIR and TGA analysis. HA powder was obtained in all milling speeds. All of HA powders showed the continuous weight loss until 1300oC. The M3 compacted HA powder was found to have a greater hardness, 5.3 GPa at 1250oC. FTIR analysis of sintered compacted powder results in weak bands when temperature increased. The higher milling speed has increased the percent of crystallinity of the powders obtained. The morphology analysis and powder characterization after synthesized and sintering process will be carried out in future study.
ACKNOWLEDGEMENT The authors are grateful to Biomedical Engineering Research Group of International Islamic University Malaysia (IIUM) for supporting this research.
REFERENCES [1] M. Wei, et al. (2005) Precipitation of hydroxyapatite nanoparticles: effects of precipitation method on electrophoretic deposition," Journal of materials science. Materials in medicine, 16:319-324. [2] S. W. K. Kweh, et al. (2000) Plasma-sprayed hydroxyapatite (HA) coatings with flame-spheroidized feedstock: microstructure and mechanical properties. Biomaterials 2: pp. 1223-1234. [3] X. Zheng, et al.(2000) Bond strength of plasma-sprayed hydroxyapatite/Ti composite coatings. Biomaterials 21:841-849. [4] N. Patel, et al. (2001). Calcining influence on the powder properties of hydroxyapatite. Journal of materials science. Materials in medicine 12:181-188. [5] H. Liu and T. J. Webster (2010) Mechanical properties of dispersed ceramic nanoparticles in polymer composites for orthopedic applications. International journal of nanomedicine, 5: 299-313.
[6] I. B. Leonor, et al. (2003) In vitro bioactivity of starch thermoplastic/hydroxyapatite composite biomaterials: an in situ study using atomic force microscopy. Biomaterials 24: 579-585. [7] J. Ni and M. Wang (2002) In vitro evaluation of hydroxyapatite reinforced polyhydroxybutyrate composite. Materials Science and Engineering: C 20: 101-109. [8] D. R. Ciocca, et al. (2007) A pilot study with a therapeutic vaccine based on hydroxyapatite ceramic particles and self-antigens in cancer patients. Cell stress & chaperones 12:33-43. [9] S. Sotome, et al.(2004) Synthesis and in vivo evaluation of a novel hydroxyapatite/collagen-alginate as a bone filler and a drug delivery carrier of bone morphogenetic protein. Materials Science and Engineering: C 24: 341-347. [10] S. Wang, et al. (2010) Towards sustained delivery of small molecular drugs using hydroxyapatite microspheres as the vehicle. Advanced Powder Technology 21:268-272. [11] T. J. Webster, et al. (2004) Osteoblast response to hydroxyapatite doped with divalent and trivalent cations. Biomaterials 25: 21112122. [12] J. Wang and L. L. Shaw (2009) Nanocrystalline hydroxyapatite with simultaneous enhancements in hardness and toughness. Biomaterials 30:6565-6572. [13] I. Sopyan and A. Natasha (2009) Preparation of nanostructured manganese-doped biphasic calcium phosphate powders via sol–gel method. Ionics 15:735-741. [14] C. Y. Tang, et al.(2009) Influence of microstructure and phase composition on the nanoindentation characterization of bioceramic materials based on hydroxyapatite. Ceramics International 35:2171-2178. [15] G. K. Lim, et al.(1999) Nanosized hydroxyapatite powders from microemulsions and emulsions stabilized by a biodegradable surfactant. Journal of Materials Chemistry 9:1635-1639. [16] Ramesh Singh, Iis Sopyan, Mohammed Hamdi (2008) Synthesis of Nano sized hydroxyapatite powder using sol-gel technique and its conversion to dense and porous body. Indian Journal of Chemistry 47:1626-1631. [17] K. Ioku, et al.(2006) Hydrothermal preparation of tailored hydroxyapatite. Journal of Materials Science 41:1341-1344. [18] B. Nasiri-Tabrizi, et al.(2009) Synthesis of nanosize single-crystal hydroxyapatite via mechanochemical method. Materials Letters 63:543-546. [19] J. Salas, et al.(2009) Effect of Ca/P ratio and milling material on the mechanochemical preparation of hydroxyapaptite. Journal of Materials Science: Materials in Medicine 20:2249-2257. [20] K. C. B. Yeong, et al.(2001) Mechanochemical synthesis of nanocrystalline hydroxyapatite from CaO and CaHPO4. Biomaterials 22:2705-2712. [21] N. Y. Mostafa (2005) Characterization, thermal stability and sintering of hydroxyapatite powders prepared by different routes. Materials Chemistry and Physics 94:333-341. [22] S.-H. Rhee (2002) Synthesis of hydroxyapatite via mechanochemical treatment. Biomaterials 23:1147-1152. [23] C. C. Silva, et al.(2003) Structural properties of hydroxyapatite obtained by mechanosynthesis. Solid State Sciences 5:553-558. [24] F. B. O. Markovic M. & Tung M S. (2004) J Res Natl Inst Stand Technol.109:553. [25] T. Tian, et al. (2008) Synthesis of Si-substituted hydroxyapatite by a wet mechanochemical method. Materials Science and Engineering: C. 28:57-63.
IFMBE Proceedings Vol. 35
Synthesis of Hydroxyapatite through Dry Mechanochemical Method and Its Conversion to Dense Bodies: Preliminary Result [26] [F. BO. (1974) Infrared studies of apatites II. Preparation of normal and isotopically substituted calcium, strontium, and barium hydroxyapatites and spectra-structure-composition correlations. Inorganic Chemistry 13:207–214. [27] D. Choi and P. N. Kumta (2007) Mechano-chemical synthesis and characterization of nanostructured [beta]-TCP powder. Materials Science and Engineering: C. 27: 377-381. [28] A. G. P. C.C.Silva et al. (2004) Properties and in vivo investigation of nanocrystalline hydroxyapatite obtained by mechanical alloying. Materials Science and Engineering: C . 24: 549-554.
101
Corresponding Author:
Author: Dr. Iis Sopyan Institute: Department of Manufacturing and Materials Engineering International Islamic University Malaysia Street: PO Box 10 City: Kuala Lumpur Country: Malaysia Email:
[email protected] IFMBE Proceedings Vol. 35
The Effect of Ball Milling Hours in the Synthesizing Nano-crystalline Forsterite via Solid-State Reaction K.L. Samuel Lai1, C.Y. Tan1, S. Ramesh2, R. Tolouei1, B.K. Yap1, and M. Amiriyan1 1
Ceramics Technology Laboratory, COE, Universiti Tenaga Nasional, Jalan IKRAM-UNITEN, 43009 Kajang, Selangor, Malaysia 2 Department of Engineering Design and Manufacturing, College of Engineering, Universiti Malaya, KL, Malaysia
Abstract— The effect of ball milling hours on the manufacture of nano-crystalline forsterite powder was investigated in terms of particle size and phase stability. A quasi-mechanical activation method followed by heat treatment was successfully employed to produce nano-crystalline forsterite powder. During the attempt, ball milling hours were manipulated to study its effects on the particle size. XRD analysis was then conducted on the heat treated powders to determine the critical particle size. Based on XRD traces, it was revealed that 7 hours of low-energy ball milling was sufficient to produce crystalline forsterite powders. Subsequent FWHM studies also affirmed the critical particle size (≈ 41 nm) required to successfully transform MgO and Mg3Si4O10(OH)2 into pure forsterite powder. Keywords— Forsterite, Synthesis, Bioceramic.
I. INTRODUCTION Recent studies suggest that forsterite ceramics has the potential of being developed as a bioactive ceramic for biomedical purposes. This potential can be found attributed to its chemical composition (Mg2SiO4) whereby Mg is reported to contribute towards the bone mineralization of calcined tissues [1,2], and Si as an indispensible mineral during the preliminary stages of bone calcification [3]. Furthermore, the high proliferation rates exhibited by forsterite during a cytotoxicity study has also approve of its usage as a biomedical implant [1]. Besides the biological attraction of forsterite, forsterite is also found to be in possession of favorable mechanical properties. Existing mechanical tests conducted on forsterite samples have revealed high fracture toughness in forsterite ceramics, in which its maximum fracture toughness was reported to be approximately 4.3 MPa·m1/2 [3]. Additionally, it was established that the fracture toughness of forsterite is in surplus of the lower fracture limit in human bone (2.0 MPa·m1/2) [4], therefore making forsterite a potentially suitable material for future developments of high load bearing biomedical implants. However, the manufacture of crystalline forsterite via solid-state reactions accompanied with subsequent heat
treatment are often found to lack homogeneity [5,6], and often results in undesirable intermediate phases (i.e. clinoenstatite (MgSiO3)) [5]. In general, the homogeneity issue of forsterite is often linked to the sluggish formation of silicates since the diffusivity of the formed compounds are relatively low [7]. Furthermore, MgSiO3 is often associated as an undesired phase since it is a detrimental element to the high temperature properties of forstertite [8]. To overcome the homogeneity issues of forsterite, researchers have necessitated the involvement of mechanical energy as a mean of refining the powder particle size [5,7], often into nanoparticles whereby documented studies have proved that particles within the nano-meter range were able to boost diffusion process and enhance the chemical reactions between the starting precursors [5]. Additionally, literature also suggests that the refinement of particle size increased the reacting interface of the starting precursors, therefore enhancing the reaction kinetics or the reactants during heat treatment [5]. With the objective of pursuing for a more economical method of manufacturing forsterite ceramics, the present work investigates the potential usage of conventional, low energy ball-milling. Investigation was carried out on the effect of ball-milling hours on the conversion of magnesium oxide (MgO) and talc (Mg3Si4O10(OH)2) into pure forsterite. Subsequent examination of the XRD traces yielded positive results, indicating positive prospects of manufacturing nano-crystalline forsterite via solid-state reaction without the need for high-mechanical energy.
II. METHODS AND MATERIALS Nano-crystalline forsterite powder was prepared using a quasi-mechanical activation method whereby forsterite reactants were ball-milled on a uni-direction, variable speed, table top ball-milling machine. Forsterite reactants comprises of MgO (Merck, 97%) and Mg3Si4O10(OH)2 (SigmaAldrich, 99%) whereby ethanol (HmbG, 98%) was employed as the solvent. MgO and Mg3Si4O10(OH)2 powders were weighed using a weight balance of accuracy up to
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 102–104, 2011. www.springerlink.com
The Effect of Ball Milling Hours in the Synthesizing Nano-crystalline Forsterite via Solid-State Reaction
4 decimal points (Mettler Toledo, Switzerland). The weighed powders were then subjected to high frequency vibrations with an ultrasonic cleaner (Liarre, Italy) to break existing powder agglomerates to ensure a homogenous mixing. MgO was initially mixed with 100 ml of ethanol and ultrasonified for 2 minutes, followed by the addition of Mg3Si4O10(OH)2 into the ultrasonified MgO mix for an additional 2 minutes of high frequency vibration. The ultrasonified powders were then ball-milled at 3500 rpm for 1, 5, 7 and 10 hours respectively. Subsequently, the ball-milled slurry was then dried at 60°C (Memmert) and sieved (230μm) prior to heat treatment at 1200°C for 2 hours. Phase stability studies of the all the heat treated powders were then carried out by using X-ray diffractometer (Rigaku Geiger-Flex Difractometer, Japan). Subsequently the powder particle size was then obtained based on the FWHM theory, whereby the peak width was calculated according to the Scherrer’s equation. The critical particle size was then obtained by comparing both XRD traces and calculated particle size.
103
Thorough study on the XRD trace was evident that conventional, low-energy ball milling was capable of producing pure forsterite powder after subjecting the reactants to 7 hours of milling time as shown in Figure 2. The ability to form pure forsterite after 7 hours of ball-milling in the current work was not in agreement with the previously reported findings [5, 7] and was furthermore able to prove otherwise on the need for high mechanical energy to overcome the formation of the intermediate phases. Therefore, this creates a potentially efficient as well as cost saving method of producing pure forsterite.
III. RESULTS AND DISCUSSION The XRD analysis of produced forsterite powder shown in Figure 1 reveals peaks that were obtained based on the heat treated powders that were ball-milled for 1,5,7 and 10 hours respectively. The presence of intermediate phases for forsterite powders milled at 1 hr (MgO and MgSiO3) and 5 hr (MgO) were noted as shown in Figure 1.
Fig. 2 XRD pattern of forsterite powder milled at 7 hours On the successful formation of forsterite, it was hypothesized that prolonged ball-milling hours could have led to the shrinkage of particle size, thus assisting the conversion of the starting precursors into pure forsterite. To affirm this, a FWHM study was conducted on the as-received, before heat treatment powders to obtain the particle size of the milled powders. According to Scherrer’s equation (Equation 1), it is observed that the peak width is inversely proportional to the crystallite size. Therefore in order to obtain the powder particle size, further XRD examination as shown in Figure 3 on the ball-milled, untreated powders is carried out. (1)
Fig. 1 XRD pattern of forsterite powder milled at various hours (●= Mg2SiO4, ▼= MgSiO3, ■ = MgO)
IFMBE Proceedings Vol. 35
whereby, B = peak width K = crystal shape factor = 1 λ = wavelength θ = Bragg angle
104
K.L. Samuel Lai et al.
assume a significant role in the conversion of MgO and Mg3Si4O10(OH)2 into pure Mg2SiO4. It was also further proved that the conventional, low energy ball-milling was capable of obtaining the nano-particles required to produce nano-crystalline forsterite.
AKNOWLEDEMNET The authors would like to thank UNITEN for providing the financial support under the grant no J510050318. In addition, the support provided by SIRIM Berhad in carrying out this research is gratefully acknowledged. Fig. 3 XRD patterns of forsterite powder milled at various hours (before heat treatment)
REFRENCES 1.
By coupling the width of the most prominent peaks (≈ 28.6°) in Figure 3 with Scherrer’s equation (Equation 1), calculated results indicated that particle size decreased with increasing ball-milling time as indicated in Figure 4. With the obtained results in Figure 4, this therefore validates the earlier drawn hypothesis on the refinement of powder particle size and its significance towards the formation of pure forsterite. In the current work, it has been observed that the successful formation of nano-crystalline forsterite occurred at a critical particle size of approximately 41 nm.
2. 3.
4.
5.
6.
7.
8.
9.
Fig. 4 Effect of milling hours on the crystallite size of forsterite powder
Ni S, Chou L, Chang J (2007) Preparation and characterization of forsterite (Mg2SiO4) bioceramics. Ceramics Inter 33:83 – 88 DOI 10.1016/j.ceramint.2005.07.021 Schwarz K, Milne DB (1972) Growth-promoting effects of silicone in rats, Nature 239:333 – 334. Kharaziha M, Fathi MH (2010) Improvement of mechanical properties and biocompatibility of forsterite bioceramic addressed to bone tissue engineering materials. J Mech Behav Biomed Mater 3:530 – 537 DOI 10.1016/j.jmbbm.2010.06.003. Suchanek W, Yashima M, Kakihana M et al (1997) Hydroxyapatite ceramics with selected sintering additives. Biomaterials 18:923 – 933 DOI 10.1016/S0142-9612(97)00019-7 Tavangarian F, Emadi R, Shafyei A (2010) Influence of mechanical activation and thermal treatment time on nanoparticle forsterite formation mechanism. Powder Tech 198:412 – 416 DOI 10.1016/j.powtec.2009.12.007 Kosanovic C, Stubicar N, Tomasic N et al (2005) Synthesis of forsterite powder by combined ball milling and thermal treatment. J Alloys Comp 389:306 – 309 DOI 10.1016/j.jallcom.2004.08.015 Kiss SJ, Kostić E, Djurović D et al (2001) Influence of mechanical activation and fluorine ion on forsterite formation. Powder Tech 114: 84 – 88 DOI 10.1016/S0032-5910(00)00268-0 Fathi MH, Kharaziha M (2009) The effect of fluorine ion on fabrication of nanostructure forsterite during mechanochemical synthesis. J Alloys Comp 472:540 – 545 DOI 10.1016/j.jallcom.2008.05.032 Cullity BD, Stock SR (2001) Elements of X-ray diffraction, 3rd Edition (Prentice Hall, Inc.) 167-170.
Author: Dr. Chou Yong Tan
IV. CONCLUSION The effects of ball-milling time on the formation of forsterite have affirmed that the particle size of the reactants
Institute: Street: City: Country: Email:
IFMBE Proceedings Vol. 35
University Tenaga Nasional UNITEN-IKRAM Kajang Malaysia
[email protected] The Effect of Titanium Dioxide to the Bacterial Growth on Lysogeny Broth Agar N.H. Sabtu, W.S. Wan Zaki, T.N. Tengku Ibrahim, and M.M. Abdul Jamil Faculty of Electrical and Electronic Engineering, Universiti Tun Hussein Onn Malaysia, Johor, Malaysia
Abstract— In this paper, the effect of Titanium dioxide powder to the bacterial growth on Lysogeny broth (LB) were investigated. LB agar used as a nutrient media to grow bacteria from drain water mixed with different weight of TiO2 The image of the cultured plate was captured using webcam. Then the size of bacterial colonies was measured by Microsoft Visual Basic software. The result shows that the Titanium dioxide powder are able to decrease the growth of bacterial colonies in the drain water sample. This finding suggests that the Titanium dioxide have a potential to be used as purification agent in water treatment process. Keywords— Titanium dioxide, LB agar, Bacterial colonies, Microsoft visual basic software.
I. INTRODUCTION Monitoring the environmental quality in water, soil or air is very important to ensure that these environments comply with pre-defined government limits for particular bacteria, fungi or moulds. In drinking water samples especially, high levels of bacteria contamination can lead to the rapid spread of illness which in some cases can be fatal. Titanium dioxide, also known as titanium (IV) oxide or titania, is the naturally occurring oxide of titanium with the chemical formula known as TiO2. It is noteworthy for its wide range of applications such as in solar cells, photocatalysis, chemical sensors, white pigment, and as optical coatings [1]. Recently, the potential application of this material is in the removal of inorganic and organic pollutants in water treatment process [2,3,4]. Photocatalytic activity of TiO2 thin films also has been investigated for environmental purification and self-cleaning applications, governed by the photo-induced decomposition of organic pollutants [5]. In this study, the effect of titanium powder to the bacterial growth on LB agar was investigated. The bacteria were acquired from the drain water and the size of bacterial colonies on the LB agar were measured using developed Microsoft Visual Basic software.
II. METHODOLOGY The LB agar was prepared by immersed two LB tablet into 100ml of distilled water in a beaker. The mixture was
heated to 100˚C then cooling down to 40-50˚C before poured into half of the petri plate. The bacterial from the water sample was cultured onto the nutrient media using wire loop. The water sample was prepared by adding different weight of TiO2 to 50 ml of drain water in a beaker and left for three hours. The weight of TiO2 powder was set to 1 gram, 2 gram, and 3 gram respectively. After a loop was created, the petri plate was placed inside the incubator for 24 hours with temperature of 37 ˚C. After incubated for 1 day, the Petri plate was taken out and placed under the webcam to be analyzed by the Microsoft Visual Basic software. The image of bacterial colonies will be displayed on the interface of the system and the size of the colonies will be calculated automatically. Figure 1 shows the flowchart of the developed software.
Fig. 1 Flowchart of software development for measuring bacterial colonies size
There are many method that can be used to count the bacteria colony such as Fuzzy formalism [6], distance transform [7] and model-based image segmentation [8]. In this project, the bacterial colonies size was measured by the difference in the image pixel values. The color of LB agar
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 105–107, 2011. www.springerlink.com
106
N.H. Sabtu et al.
without bacterial colony will be bright yellow but if the colonies exist, the color will change to dark yellow. The changes in color will change the image pixel values, thus the size of the bacterial colonies can be calculated. The result then can be saved in database system created using Microsoft Office Access.
III. RESULTS AND ANALYSIS The experiment to observe the effect of the titanium dioxide powder on the bacterial growth was performed by varying the weight of TiO2 powder immersed into 50ml of drain water. Figure 2, 3 and 4 shows the result. Fig. 4 LB agar sample with 3 gram of TiO2 powder As in Figure 2, the image of the bacterial colonies were in dark yellow color and the white pigment inside the media is the TiO2 powder. The result shows that the size of the bacterial colonies decreased as the amount of TiO2 powder was increased. Next the image of this sample was analyzed by the developed Microsoft Visual Basic Software as shown by Figure 5. Bacteria colonies
Fig. 2 LB agar sample with 1gram of TiO2 powder
Bacteria colonies
Fig. 5 The developed software to calculate the size of bacterial colonies on LB agar
Fig. 3 LB agar sample with 2 gram of TiO2 powder
The result of the automated system will be saved in Microsoft Office Access 2007 for future references. Using this software, the size of bacterial colonies according to the weight ratio of TiO2 powder can be determined. The results of these findings were plotted as shown by the Figure 6.
IFMBE Proceedings Vol. 35
The Effect of Titanium Dioxide to the Bacterial Growth on Lysogeny Broth Agar
REFERENCES
Size of Bacterial Colonies versus Weight of Titanium Dioxide Powder
Size (Cm^2)
25 20 15 10 5 0 0
1
2
107
3
Weight (gram)
Fig. 6 The size of Bacerial colonies plotted against different weight of TiO2
The result shows that the size of the bacterial colonies decreased as the amount of TiO2 powder increased. This preliminary finding suggests that the TiO2 is powerful oxidizing agent that breaks down organic chemicals and kills microorganisms [9].
IV. CONCLUSIONS In a conclusion, the findings from this study shows that the TiO2 powder able to reduce the amount of bacteria colonies in the water sample. This would make the material can be used as purification agent to maintain hygiene and prevent the spreading of pathogenic infection in water treatment process. Besides, the developed software for measure the bacterial colonies size using Visual Basic Software offer huge advantages in terms of time saving and accuracy of measurement compared to the manual counting method.
1. Zhang Y, Crittenden J.C. et al. (1994) Fixed-bed photocatalysts for solar decontamination of water, Environ. Sci. Technol., 28: 435–442. 2. Dheaya M.A.A, Patrick S.M.D et al. (2009) Photocatalytic inactivation of E. coli in surface water using immobilised nanoparticle TiO2 films, J. Water Research, 43:47-54. 3. Hassan A.K, Chaure N.B. et al. (2003) Structural and electrical studies on sol–gelderived spun TiO2 thin films, J. Phys. D: Appl. Phys., 36:1120-1123. 4. Seong Y.B., Seung Y. C. et al. (2005) Synthesis of Highly Soluble TiO2 Nanoparticle with Narrow Size Distribution, Bull. Korean Chem. Soc., 26(9):1333-1334. 5. Yan H., Chunwei Y. (2006) Low-temperature Preparation of Photocatalytic TiO2 Thin Films, J. Mater. Sci. Technol., 22: 239-244. 6. Marotz J., Lu’bbert C et al. (2000) Effective object recognition for automated counting of colonies in petri dishes (automated colony counting), Computer Methods and Programs in Biomedicine, 66: 183–198. 7. Mukherjee D.P.,Amita P et al. (1994) Bacterial colony counting using distance transform, International Journal of Bio-Medical Computing, 38:131-140. 8. Bernard R, Kanduser M et al. (2001), Model-based automated detection of mammalian cell colonies, Phys Med Biol., 46(11): 3061-3072. 9. Block S.S., Seng B.P. et al. (1997) Chemically enhanced sunlight for killing bacteria, Journal of Solar Energy Engineering, 119:85-91.
Author: Institute: Street: City: Country: Email:
IFMBE Proceedings Vol. 35
Wan Suhaimizan bin Wan Zaki Universiti Tun ussein Onn Malaysia Parit Raja Batu Pahat, Johor Malaysia
[email protected] Thermal Analysis on Hydroxyapatite Synthesis through Mechanochemical Method A.S.F. Alqap1,3, S. Adzila2,4, I. Sopyan1, M. Hamdi2, and S. Ramesh2 1
Department of Manufacturing and Materials Engineering, International Islamic University Malaysia, Kuala Lumpur, Malaysia 2 Department of Engineering Design and Manufacture, University of Malaya, Kuala Lumpur, Malaysia 3 Mechanical Engineering Program, University of Bengkulu, Bengkulu, Indonesia 4 Department of Material Engineering and Design, Universiti Tun Hussein Onn Malaysia, Johor, Malaysia
Abstract— Thermal analysis of hydroxyapatite formation through dry mechanochemical method has been studied. The calcium phosphate was synthesized using calcium hydroxide and di-ammonium hydrogen phosphate as the precursors. The ball milling of 1/6 ball-powder mass ratio was employed on mixtures of calcium hydroxide and di-ammonium hydrogen phosphate in three different speeds 170, 270 and 370 rpm for 15 h. As ball-milled powders were then sintered at 1150, 1250 and 1350oC for 2 h, then subjected to TGA, XRD and FTIR for phase characterization. Calcium phosphates with ammonium are phases of the material. The ammonium is trace of phosphorus precursor. Choosing condition of the process and type of precursors determines type of reactions and its products. Keywords–– Heating, Milling, Hydroxyapatite, Calcium phosphate, Phase transformation.
I. INTRODUCTION Hydroxyapatite (HA) is main concern of many works to develop a biomaterial for biomedical application. Many types of synthesis method have been performed for its production. One of them is mechanochemical process. Mechanical factor has been greatly involved in many synthesis processes where mechanical strength is as success key of phase transformation and chemical reactivity. In ceramic fields, the mechanical milling was proven successful to drive a chemical reaction to synthesize HA from calcium and phosphorus precursors either in dry [1, 2] or wet method [3-5]. Prolonged mechanical milling has induced amorphous phase transforming from β-TCP (tricalcium phosphate) that makes the new phase more soluble than the source phase and more feasible to produce biphasic phase containing βTCP and HA after aging in a solution [6]. The mechanical factor also is involved to make calcium phosphate precursors more reactive for setting reaction [7]. Here the dry mechanical milling is attempted to synthesize HA from calcium and phosphorus precursors. Any phases as result of mechanically induced thermal reaction are discussed.
II. MATERIALS AND METHODS The mechanical milling is attempted on an objective to synthesize hydroxyapatite phase based on the reaction as follows 5Ca(OH)2 + 3(NH4)2HPO4 → Ca5(PO4)3OH + 6NH3 + 9H2O
Calcium hydroxide (CH, Ca(OH)2) and di-ammonium hydrogen phosphate ((NH4)2HPO4, DAP) are commercially available of, respectively, R&M Chemicals and Systerm. The planetary ball mill is performed to induce mechanical effect using a powder to ball mass ratio as 1/6 for 15 hours of running and stopping with three different speeds; 170, 270 and 370 rpm. Sintering is then given on the as-milled powders for different high temperatures 1150, 1250 and 1350˚C for 2 hours with 5˚C/min heating and cooling rates. Phase characterizations are attempted by using of a Perkin Elmer Phyris Diamond TG-DTA of 10˚C/min heating rate to evaluate thermal stability, a Shimadzu XRD 6000 diffractometer at the range of 2θ=25-55˚C and 2˚C/min scan speed to evaluate phases and a Perkin-Elmer Spectrum FTIR spectrometer of 4000-400cm-1 scanning range with resolution of 4 cm-1 to evaluate the functional group of chemical bonding.
III. RESULTS Thermal characterization is important to know material reactivity under specific temperature. Different speed obviously affects weight loss and weight gain of the material under TGA test. TG and DTA tests divide the material into regions as detailed in Table 1. How are the lines pattern in the regions of endo and exothermal and during weight gain and weight loss that observed from TGDTA tests are shown in Figure 1 and Figure 2. Phases that appear after thermal reaction are evaluated by XRD and the patterns are depicted in Figure 3. Finally, IR spectra that has been obtained to evaluate functional group of chemical bonding from FTIR characterization is given in Figure 4.
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 108–111, 2011. www.springerlink.com
Thermal Analysis on Hydroxyapatite Synthesis through Mechanochemical Method
109
Table 1 TGDTA tests divide material reactivity into areas of loss-gain in weight and Endo-Exothermal as well TGDTA rpm
30-190ÛC (I)
190-400ÛC (II)
170 (DTA)
Endo (-)
Go up to (+)
270 (DTA) 370 (DTA)
As above As above
As above As above
400-800ÛC (III) Continuous in Exo (+) As above As above
170 (TGA)
Fast to W/L
W/L
W/L
270 (TGA)
Fast to W/L
370 (TGA)
Fast to W/L
Jump to W/G at 600ÛC + W/L W/L with fluctuation W/L with W/L fluctuation W/L: weight loss
800-1000ÛC (IV) Still in (+) and down to (-) As above As above W/G at 900 + fast to W/L
1000-1100ÛC (V)
1100-1300ÛC (VI)
Continuous in Endo (-) As above As above
Go up to (+) As above As above
W/L + small W/G
Go up to W/G
W/L
A few W/G
W/L
A few W/G
W/G at 900ÛC + fast to W/L W/G at 900ÛC + fast to W/L W/G: weight gain
Fig. 1 DTA patterns of three samples of different speeds at 10˚C/min Fig. 2 The example of TGA patterns. The patterns are for the 270 and 170 rpm speed samples with the inset to high the scale
heating rate
Fig. 3 The XRD tests of three different speeds: 170 rpm (upper), 270 rpm (middle), and 370 rpm (lower) at three different heating temperatures: 1150˚C (left), 1250˚C (middle), and 1350 ˚C (right)
Fig. 4 The IR spectra test characterizes the appearance of certain element by its functional group with its transmittance percentage (%T) showing the degree of intensity. The appearance intensity among available functional groups is comparable (left). The example of complete IR spectra is taken after 1350 heating. 170 rpm black, 270 rpm blue and 370 rpm red (right)
IFMBE Proceedings Vol. 35
110
A.S.F. Alqap et al.
IV. DISCUSSIONS In the region I (see Table 1) the sample heating reaction absorbs heating from its surrounding as result of decomposition of ADP and water evaporation as DTA records in negative region, i.e. endothermal, and accordingly TGA records as weight loss. All of the three speeds have similar condition at the region I where losing rate is tremendously high. The formation of calcium ammonium phosphate with water crystal, CaNH4PO4.6H2O (CAP), is possible at around 50˚C only. By heating, the amount of water crystal decreases then the weight decreases. On the way of this heating DAP decomposes into ammonia (NH3) and ammonium di-hydrogen phosphate (ADP). ADP then decomposes into NH3 and phosphoric acid. Then the phosphoric acid produces water and H4P2O7. From H4P2O7, P2O5 and water show up. This condition causes the system is rich of Ca2+, OH-, NH4+, water crystal, CaO, HPO42- and so variation of H-P-O and P-O ions on. Another work of ADP with calcium precursor in aqueous synthesis by Alqap and coworker [8] is worthy for comparison. In the region II, CAP decomposes to CaHPO4 and NH3. Then CaHPO4 transform to calcium pyrophosphate (CPP) with constitutional water. This stage causes the region II going to weight gain gradually, accordingly DTA records as going to positive region, i.e. exothermal region. The gradual increase is because the formation of the new crystal is followed by dehydration of crystal water. Slow down in dehydration rate makes the slope of increment steeper and slower in the range of 400-600˚C. In the region III, the DTA reaction is being continuously at positive or exothermal region. In the range of 600-700˚C the formation of calcium pyrophosphate is still possible (see Figure 2). The formation of the new phase does not significantly happen for the 170 and 370 rpm speeds. They show only very tiny increase in gradual manner. This is not as the 270 rpm speed that suddenly jumps to increase its weight by 1%. The fluctuation in weight gain and weight loss is observed at those samples in further way. In between 700-800˚C, a formation of amorphous apatite is possible. This formation with very tiny weight gain before 800˚C is observed. In the region IV, especially at 900˚C, all the samples have weight gain before they go to lose their weight again. Here HA forms. In the region V, HA gradually decompose into βTCP. This decomposition that observed as faster to 1100˚C and gradually slower further is interesting. Difference density between HA and βTCP is only around 0.08 while between βTCP and αTCP around 0.3 g/cm3. It should be other reason to explain this phenomenon. In the region VI, the 170 rpm sample inclines direction from weight loss to weight gain at 1200˚C, while the two others continuously lose the weight but a few jump in weight at the end (see Figure 2). These weight gains
accordingly are recorded as inclination point from endo to exothermal by DTA. This explains that there should be a formation of new crystal takes place. XRD characterization shows that the 170 rpm speed gives two major peaks after 1150 and 1250˚C heating at 38.3˚ and 44.5˚ 2θ, and after 1350˚C heating at 29.5˚ which is followed by minor peaks at 30.5˚, 31.5˚, 32˚ and so on. The 270 rpm speed gives one major peak 29.5˚ after 1150˚C heating, minor peaks at 31˚, 31.7˚ and so on. In the next heating, 1250˚C, these peaks are reduced in intensity. After 1350˚C heating, the major peak disappears while the minor peaks become significant, i.e., at 30.5˚, 31.3˚, 31.7˚ and so on. The 370 rpm speed delineates all the major peaks and the minor peaks become the characteristic peaks of the sample but still with tiny peaks. After 1150˚C heating peaks of 31.5˚, 32˚ and so on appear. The same appearance is also after 1250 and 1350˚C, however the intensity of the 1250˚C heating is small. The major peaks at 29.5˚, 38.3˚ and 44.5˚ may belong to ADP which as pure component has characteristic peaks at 29˚, 33.3˚, 37.5˚ and 45˚. The minor peaks can be counted at 29.5˚ 2θ as CPP (29.55˚), CaHPO4.2H2O, DCPD (29.5˚), or CaPO3(OH).2H2O, CPH (29.3˚), at 30.5˚ as α-TCP (30.8˚), at 31˚ as β-TCP and at 31.7˚ as HA. (JCPDS cards: CPP # 33-297, DCPD #2-85, CPH #9-77, β-TCP #9-169, α-TCP #9-348, HA #9-432). The minor of the calcium phosphate phases with the major appearance of ADP is very interesting. The minor and major appearance suggests that the former is possibly coated by the later, or because the former is crystalline while the later is amorphous. From XRD, the recovery of weight at > 1100˚C of TGA test is possible by the formation of N-H structure. FTIR test show the pattern as shown in Figure 4. The main peaks that appear in the IR spectra [9] are mainly at 3630 /cm region and its surrounding for O-H and N-H, 3350 /cm region and its surrounding for N-H or C-H, 2157/cm region and below for N-H, C-O, C-N or N-O, 1020/cm region and surrounding for P-O and 560/cm region and surrounding for P-O also. Using D(%Transmittance) that is different between %T point initially starts at 4000/cm and %T point at a characteristic peak of the wave number mentioned earlier, the degree of intensity is depicted in the left of Figure 4. At all of the three speeds, O-H as water molecule appears after synthesis (the figure is not shown here), but not after heating. After three heatings O-H of crystal is observed. The O-H as crystal interestingly increases with heating temperature increases. It suggests that the increase in heating temperature may exert crystal water in the particle as contribution of products of many reactions above discussed. However, the 270 rpm speed at 1250˚C heating has the lowest in the crystal water (see Figure 4 at left). The 3350 and 2157 /cm regions confirm
IFMBE Proceedings Vol. 35
Thermal Analysis on Hydroxyapatite Synthesis through Mechanochemical Method
the appearance of N-H functional bonding systems. C and O that may come from the air during milling can be neglected here because the system is sealed. The 3350 /cm significantly increase for the 370 rpm speed after 1350˚C heating. The 2157 /cm region is strengthened by heating not by speed. The 1020 /cm region is strengthened by speed and by heating, especially at 1250. The region of 560 is reduced by speed, but the 370 speed strengthens the region. The 3350 and the 2157 /cm peaks strengthen each other such NH structure significantly appear and compete with the orthophosphate peaks, i.e. 1020 and 560 /cm regions (see Figure 4). The N-H does not appear significantly in either the range of 3300-2800 /cm or 1456-1400 /cm as Salas et al found [10], it may be the condition there and here are different like that people found carbonate systems in different regions between dry and wet processes. The increase in speed increases the intensity of 1020 /cm region, however, it is true if the sample is heated at 1250˚C. Among three speeds and three heatings the 270 speed and 1350˚C heating gives better appearance of calcium phosphate. Indeed, the continuous heating drives the phase transformation takes place from a non stable phase to more stable. The dry condition, however, maintains some traces keeping in touch with the particles. In further cooling these traces transform to form the complex structure like calcium ammonia ortho- phosphate. The above facts suggest that dry process supports the appearance of NH3 instead of NH4OH. NH4OH appears because NH3 reaction of the phosphorus precursor with water in a aqueous system. This NH4OH is responsible to cause the formation of hydroxyapatite success in such a way that water washes out ammonium from phosphorus precursor and exert a condition such conducive that hydroxyapatite formation takes place. In dry condition the situation is much different. Mobility of particle is more limited, once the particle sticks on the wall or the ball then no more mobility is expected, hence, the reactivity now fully depends on heating and the mass ratio of ball and particle. However, the condition is not fulfilled enough by the heating and mass ratio. There is another factor affecting reaction products at the end, that is physical properties of precursors such as hygroscopic, wettability, melting, boiling and polymerization that could affect condition of the reaction and its steps advance as this work has found out it here.
V. CONCLUSIONS The dry milling process involving calcium hydroxide and di-ammonium hydrogen phosphate (DAP) has been employed to produce calcium phosphate powders. Three
111
different conditions of speed and heating have shown their effects on the phase transformation. The characterization revealed that the calcium phosphate phases appear with ammonia trace remained from phosphorus precursors.
ACKNOWLEDGEMENT The authors are grateful to Biomedical Engineering Research Group of International Islamic University Malaysia (IIUM) for supporting this research.
REFERENCES 1. Nasiri-Tabrizi, B., P. Honarmandi, R. Ebrahimi-Kahrizsangi, and P. Honarmandi (2009) Synthesis of nanosize single-crystal hydroxyapatite via mechanochemical method. Materials Letters 65:543-546. 2. Silva, C.C., A.G. Pinheiro, M.A.R. Miranda, J.C. Góes, and A.S.B. Sombra (2003) Structural properties of hydroxyapatite obtained by mechanosynthesis. Solid State Sciences 5:553-558. 3. Yeong, K.C.B.W., J.Ng, S. C. (2001) Mechanochemical synthesis of nanocrystalline hydroxyapatite from CaO and CaHPO4. Biomaterials 22: 2705-2712. 4. Mostafa, N.Y.(2005) Characterization, thermal stability and sintering of hydroxyapatite powders prepared by different routes. Materials Chemistry and Physics 94:333-341. 5. Rhee, S.-H.(2002) Synthesis of hydroxyapatite via mechanochemical treatment. Biomaterials 23:1147-1152. 6. Gburecka, U., Grolms, O., Barralet, J.E., Grover, L.M., Thull, R.(2003) Mechanical activation and cement formation of b-tricalcium phosphate. Biomaterials 24:4123–4131. 7. Song, Y., Feng, Z., Wang, T.(2007) In situ study on the curing process of calcium phosphate bone cement. Journal of Material Sciences: Materials in Medicine 18:1185–1193. 8. Alqap, A.S.F., Sopyan, I.(2009) Low temperature hydrothermal synthesis of calcium phosphate ceramics: effect of excess Ca precursor on phase behaviour. Indian Journal of Chemistry 48A: 1492-1500. 9. Smith, B. (1999) Infrared spectral interpretation, a systematic approach. CRC Press, Boca Raton. 10. Salas, J., Benzo, Z., Gonzalez, G., Marcano, E., Gomez, C. (2009) Effec of Ca/P ratio and milling material on the mechanical preparation of hydroxyapatite. Journal of Material Sciences: Materials in Medicine 20:2249-2257.
Corresponding Author:
Author: Dr. Iis Sopyan Institute: Department of Manufacturing and Materials Engineering International Islamic University Malaysia Street: PO Box 10 City: Kuala Lumpur Country: Malaysia Email:
[email protected] IFMBE Proceedings Vol. 35
Continuous Passive Ankle Motion Device for Patient Undergoing Tibial Distraction Osteogenesis C.T. Ang1, N.A. Hamzaid1, Y.P. Chua2, and A. Saw2 1
2
Biomedical Engineering, University Malaya, Kuala Lumpur, Malaysia Department of Orthopaedic Surgery, University Malaya Medical Centre, Kuala Lumpur, Malaysia
Abstract— This paper describes the development of a portable, easy to use, and standalone Continuous Passive Motion (CPM) device for ankle which intend to reduce the workload of physiotherapist due to increased number of patients, long term of treatments with Ilizarov Ring, and inconvenience of patients to attend to physiotherapy session frequently. The main elements in constructing CPM device for ankle were discussed in two parts: hardware and software. Hardware parts include the design of mechanical structure, and the specification of motors. While software parts are the programming codes using PIC18F4520. Expected results are the functionality of CPM device with user control. Keywords— Continuous Passive Motion, Ankle, Ilizarov Ring, Microcontroller Programming.
I. INTRODUCTION In the United Kingdom, there was an increase of Ilizarov External Fixator sales between year 1993 and 1997 by 286%, while centres which apply Ilizarov Fixators increased from 15 to 44 [6]. Patients with Ilizarov Ring are also encouraged to apply functional load through the treated limb by using the limb as normal as possible [7]. However, during the treatment with Illizarov external fixator, movement of joints maybe difficult due to pain over the metal-skin wound, surgical wound or tightness of the soft tissue that is being stretched. Psychologically, these reduced the willingness of patient to load on the treated limb. The most common problem after tibial lengthening using an Ilizarov Ring is the reduced range of motion (ROM) in the ankle which is mainly controlled by Achilles’ tendon [1]. Similar complications of loss of ROM of ankle were also supported by Taylor [14]. One of the ways to keep the ankle moving is by stretching them passively by another person or with the use of the patient’s unaffected limbs, i.e. the upper limbs. One way of passively reducing loss of ROM in dorsiflexion which happens more severely than plantarflexion is the use of string or elastic band to keep the foot in position [14]. The inconvenience of patients to attend physiotherapy sessions frequently may be due to long term wearing of external fixator (6-8 months for lengthening of 4 cm) [12]
and the small number of physiotherapist available. These become the major factors of increasing patient with remarked reduction in range of motion (ROM) due to joint stiffness or causing downward pointing of the foot. All these implications cause the recovery time of patients to be extended and further physiotherapy treatments are needed. To increase ROM of ankle, physiotherapy treatments or other similar effect treatments are needed. However, due to increase of Ilizarov Ring users, long term of treatments, difficulties in accessing to physiotherapist and the small number of physiotherapist, the need of ankle CPM device for patient with Ilizarov Ring are highly required. Some research had shown the effectiveness of CPM in reducing passive ankle joint stiffness in healthy subjects (i.e. cyclic stretching) [4, 8] and also among patients with stroke [13]. Moreover, several studies [4, 9, 13] also showed that prolonged static stretching is effective in reducing ankle joint resistance, increasing ankle joint ROM and improving gait characteristics in spastic ankles. Besides increasing the ROM of joints, the CPM device was found to increase volume of blood flow in the femoral vein at the ankle joint. A 123% increase of blood flow during the first five minutes to 142% after 15 minutes was found by Bonnaire in his research [2]. Overall, CPM applied after orthopedic surgery is found to prevent joint stiffness and reduce formation of haematomas and edema [10]. It is suggested that ROM exercises done earlier such as the use of CPM demonstrated improvement in the biomechanical behavior of in vitro tendons rupture. Hence, CPM might be a better rehabilitation method for patients recovering from Achilles tendon ruptures [3]. Due to the several positive effects shown by previous research, it is applicable to provide CPM device in order to treat ankle joint stiffness among patients who undergo tibial distraction osteogenesis.
II. MATERIALS AND METHODS A. Mechanical Design and Actuator Mechanical Design: In hardware design, major parts were the mechanical structures which were able to support the
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 112–115, 2011. www.springerlink.com
Continuous Passive Ankle Motion Device for Patient Undergoing Tibial Distraction Osteogenesis
foot and gives appropriate motion to the ankle by the actuator. In considering the mechanical structure, it should be a lightweight material but strong enough to support the weight of leg. Besides, according to Ilizarov Ring treatments for Tibial Distraction Osteogenesis, normally only one leg is treated, hence, the device was designed to be a single pedal. According to the training done manually by physiotherapist, dorsiflexion of ankle is normally done with a maximum of 30° while plantarflexion of ankle is done at a maximum of 50° [5]. Pause time of around 10 second will be included depending on condition at the maximum input degree of both plantar and dorsiflexion. Hence, the mechanical structure was designed so that it will have a range of movement of 30° above and 50° below standard zero degree level. The torque of the motor was required to be high enough to maintain in the position during pausing period. In the design of an intelligent stretching device, the device was built so that the footplate can be adjusted in all directions to align the ankle axis so that it is in line with the motor shaft [13]. Hence the centre of rotation was designed so that it is suitable for most patients, in which the measurement is made according to majority user foot size. To reduce the amount of torque required by the motor, the device was designed to be used by patients in sitting or supine position. The lower limb is straightened by supporting the foot with a chair or stool. Ankle exercise with sitting position together with extended knee was also proven to give the best performance for ankle perceived movements due to the stretched of calf muscle [11]. Figure 1 shows the built mechanical structure of ankle CPM. Two blocks and a moveable hinge were applied to accommodate the Ilizarov Ring and fix the position of the Ilizarov Ring to prevent slip during the ankle stretch training exercise. Actuator: In choosing the most suitable motor, torque is in prior consideration instead of speed. Low speed is preferable so that device will not cause any harm to the patient during the training. A 24Vdc DC Iron Core Motor model R555 with output speed of 3500rpm and output torque of 10Ncm was chosen and step down using gear box to 80rpm. With an external gear system (1:100) as shown in figure 1 output torque is further reduced to 195Nm. B. Software Functional Block As shown in Figure 2, the design of the ankle CPM device can be divided into three major units with its components. The Input Acquire Unit (IAU), consists of potentiometer, was used
113
to obtain the changes of degree at the pedal. Obtained voltage was first converted from analogue to digital so that it can be further processed to reduce noise. IAU is important in monitoring the pedal movement and also provides output to the display to alert users.
Fig. 1 Mechanical Structure of ankle CPM Output Control Unit (OCU) is the unit which made the movement of pedal possible. OCU consists of DC motor where the motor was controlled by the PWM output from the Central Processing Unit (CPU). CPU which mainly consists of microcontroller managed all the process by obtaining input, processing input into understandable value and output to the OCU and User Interface Unit (UIU). UIU is an important feature in communicating with users. Various parameters, status or condition of device is continuously displayed on the LCD display. The different signals are also conveyed to the users by using LEDs with different colors, indicating different condition of the device. Users are also being prompted to input parameters accordingly via keypad and switches. In software programming, there were considerations that have to be taken into account such as the ability of hardware to response to the output given by the microcontroller. In a mechatronic device, software programming functions as the main controller controlling the desired movement and functions. A good programming should be covering all the possibilities that might occur during the operation of device.
IFMBE Proceedings Vol. 35
114
C.T. Ang et al.
IAU ADC Converter Potentiometer
CPU PIC18F4520 SK40C
OCU PWM signals Motor Driver DC Motor
NO
UIU LCD display LED Keypad Switch
YES
Fig. 2 Functional Block Diagram
NO
C. Flow Chart As shown in Figure 3, once the device was turned on, it will prompt the user to input the required parameters. With these parameters, the value obtained from potentiometer was compared followed by cycle number comparison. Once these two parameters were fulfilled, the program ends and shows that the training has ended. When the emergency stop button was pressed, even at the middle of the training, the controller will direct the device to return to zero degree from any instance of degree. There were also Reset button to reset the whole program and ON/OFF toggle switch to reduce power consumption.
IFMBE Proceedings Vol. 35
YES
Fig. 3 Flow Chart on Software Program
Continuous Passive Ankle Motion Device for Patient Undergoing Tibial Distraction Osteogenesis
115
can be made so that the device can be applied clinically on patients and various experimental data can be collected.
III. EXPECTED RESULTS Figure 4 shows the operation of the device which produces force to move the foot in plantar and dorsiflexion. This figure also shows the position of normal Ilizarov Ring placement and the ROM of ankle which should be in the same axis for both device ROM and ankle ROM. The expected results from this study are the ability of this device to function accordingly as programmed and be able to apply on patients who undergo tibial distraction osteogenesis. The device should meet its objective that is functional, standalone, easy to use and portable. And most importantly is to be safe for both users and operators.
Fig. 4 Device Operation
IV. DISCUSSION AND FUTURE WORKS Mechanical structure built are functional, however, it can be further improved to a changeable point of ROM so that it fit patients with different sizes of feet. Besides, the material usage of mechanical structure can be also further improved to reduce the weight and enhance portability. Improvement can also be made on software controller where Bluetooth device can be added to ease the usage of patient. Miniaturized of the user interface with circuit optimization can also be further develop so that the device is made lighter and more user friendly.
REFERENCES 1. Barreto, B. V. (2007). Complications of Ilizarov leg lengthening: a comparative study between patients with leg discrepancy and short stature. International Orthopaedics (SICOT) 31 , 587-591. 2. Bonnaire, F. (1994). Mechanical dynamic ankle passive motion for physical prevention of thrombosis: changes in hemodynamics in the lower pressure system with new dynamic splints. 97:366-71. 3. Bressel E, M. P. (n.d.). Biomechanical behavior of the plantar flexor muscle-tendon unit after an achilles tendon rupture. Am J Sports Med , 29(3): 321-326. 4. Bressel E, M. P. (2002). The effect of prolonged static and cyclic stretching on ankle joint stiffness, torque relaxation, and gait in people with stroke. . Phys Ther 82 , 880-887. 5. Dai, J. S. (2004). Sprained Ankle Physiotherapy Based Mechanism Synthesis and Stiffness Analysis of a Robotic Rehabilitation Device. Autonomous Robots 16 , 207-218. 6. Graham. (1999). Personal Communication. Smith and Nephew Surgical Products. 7. Ilizarov, G. (1989). Tension-stress effect on the genesis and growth of tissues: Part I The influence of stability of fixation and soft tissue preservation. Clinical Orthopaedics and Related Research 238 , 249281. 8. McNair P, D. E. ( 2001). Stretching at the ankle joint: viscoelastic responses to holds and continuous passive motion. Med Sci Sports Exerc 33 , 354-358. 9. Nuyens, G. (2002). Reduction of spastic hypertonia during repeated passive knee movements in stroke patients. Arch Phys Med Rehabil , 83:930-5. 10. O’Driscoll SW, G. N. (2000). Continuous passive motion (CPM): theory and principles of clinical application. . J Rehabil Res Dev , 37:179-88. 11. Refshauge, K. M. (1995). Perception of Movement at the Human Ankle: Effect of Leg Position. Journal of Physiology , 243-248. 12. Saw A., C. Y. (2008). Patient Handbook on Limb Lengthening and Reconstruction with External Fixator. Kuala Lumpur: New Voyager Corporation. 13. Selles, R. W. (2005). Feedback-Controlled and Programmed Stretching of the Ankle Plantarflexors and Dorsiflexors in Stroke: Effects of a 4-Week Intervention Program. American Congress of Rehabilitation Medicine and the American Academy of Physical Medicine and Rehabilitation , 86. 14. Taylor, G. J. (1988). Ankle motion after external fixation of tibial fractures. Journal of the Royal Society of Medicine , 81.
Author: Institute: City: Country: Email:
V. CONCLUSIONS The built ankle CPM device was successfully functioning to provide motion and control. However, further improvements
IFMBE Proceedings Vol. 35
ANG CHENG TIAN UNIVERSITY OF MALAYA KUALA LUMPUR MALAYSIA
[email protected] Musculoskeletal Model of Hip Fracture for Safety Assurance of Reduction Path in Robot-Assisted Fracture Reduction S. Joung1, S. Syed Shikh1, E. Kobayashi1, I. Ohnishi2, and I. Sakuma1 1
Department of Precision Engineering, the University of Tokyo, Tokyo, Japan 2 Graduate School of Medicine, the University of Tokyo, Tokyo, Japan
Abstract— We have developed a fracture-reduction assisting robotic system for hip fracture. The robotic system provides power assistance to surgeons during the reduction procedure and simulated fracture reduction trials using a polyurethanemade bone model has shown good reduction results. While the system can reduce surgeon’s burden, it also has the possibility to damage soft tissues around bone fragments. It is required to predict or monitor forces produced by the reduction procedure from a safety point of view. To this end we have developed a musculoskeletal model of hip fracture that provides the force acting on muscles from the relative position of bone fragments. Though many musculoskeletal models of limbs have reported, there are few studies that apply it to fracture reduction. In addition, the musculoskeletal model allows us to simulate the reduction force acting on muscles, given reduction path. Two usage methods of the reduction force simulation are proposed for safe reductions. One is to find the gentle reduction path that minimizes the reduction force. The reduction force is simulated according to two reduction paths, and the path with lesser reduction force is identified as the gentle path. The other application is to serve as a detection tool where unexpected large reduction forces can be identified by comparing the measured force with the simulated force in real-time. The consideration about personal error of the muscle geometry and parameter is required. At present, the second function of using the developed simulation to detect unexpected large reduction forces has not been integrated to the robotic system. This will be part of our future work. Keywords— fracture-reduction robot, safety, musculoskeletal model, fracture-reduction path, fracture-reduction force.
I. INTRODUCTION Occurrence of hip fracture in elderly patients with osteoporosis is expected to increase in an aging society. Most cases of hip fracture are surgically treated and in these cases, fracture reduction that describes the medical procedure to restore a fractured bone to its original alignment should be conducted before fixation of bone fragments. A fracture table is often used to assist pulling power of a lower limb. However, fracture tables have few degrees of freedom and no safe methods are available to avoid the application of excessive force to the injured limb. A robot assisted fracture reduction has the possibility to assist surgeons in handling
translations and rotations of the bone while minimizing human error and at the same time increasing the level of precision. We have developed such a system and reported the related problems and countermeasures from a safety point of view [1]. Fracture-reduction force acting on lower limb during fracture-reduction procedure is the one of keywords to assure safety in using the robotic system. We have proposed the designs of mechanical failsafe units and a software force limiter in order to prevent excessive forces to the limb and have shown their usefulness from experimental evaluations. Some useful clinical data for estimating the limitation of the fracture-reduction force have been already reported though more need to be done in order for it to be a decisive criterion [2,3]. The aim of this paper is to strengthen the safety of a robot assisted fracture-reduction system by introducing a musculoskeletal model, which can predict and manage the fracture-reduction force. The musculoskeletal modeling of the hip fracture is useful for increasing the safety of the robot assisted fracture reduction. This model simulates the forces and moments to each joint movement. Two following functions are expected with this simulation. • •
The gentle reduction path, which minimizes the reduction force, can be decided on from among the reduction paths that are generated by the navigation system. An unexpected large reduction force can be detected during the fracture reduction by comparing the reduction force measured in real time with the simulated reduction force.
Though there have been several studies about the modeling of the lower extremities [4,5], the application of this modeling to hip fracture reduction is not found. In this study, the musculoskeletal modeling method is introduced, and the model is applied to the hip fracture. Finally, the reduction force is simulated for two reduction paths.
II. METHOD The musculoskeletal model requires the muscle force simulation and the musculoskeletal geometry. For the muscle force simulation, Hill-based muscle models have been used for
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 116–120, 2011. www.springerlink.com
Musculoskeletal Model of Hip Fracture for Safety Assurance of Reduction Path in Robot-Assisted Fracture Reduction
several studies [4,6,7]. A Hill-based muscle model, shown in Fig. 1, typically consists of three components: a contractile element, a parallel elastic element, and a series elastic element. The parallel and series elastic element are simple nonlinear elastic elements. The contractile element is described by a force-length relationship; this is the result of changes in overlap between the actin and myosin filaments in the sarcomere [8]. The force-generating properties of a specific muscle actuator are derived by scaling of the Hill-based model[8]. For this, four parameters and three curves are required. These are: the peak isometric muscle force ( ), the optimal muscle-fiber length ( ), the pennation angle( ), and the tendon slack length( ). The means the muscle length that can develop the maximum muscle force ( ). The means the length at which a tendon begins to develop force when stretched, and the pennation angle specifies the angle between the muscle fibers and the tendon. For a given musculo-tendon length and activation level, the model determines the musculo-tendon force following equation with the given curves and parameters (1) The functions of and are calculated using the normalized active and passive curves, respectively. The normalized curves and the parameters can be found at the webpage of the ISC (International Society of Biomechanics [9]). The curves are provided as a list of control points, and the curves are made by interpolating the given control points. In this study, the active force are not considered on the assumption that relaxants that block transmission of nerve impulses to the muscles were given in high doses before the fracture reduction; this means the active force is not developed. Therefore, the active term of Eq. (1) can be canceled and this can be rewritten by Eq. (2).
117
(2)
The musculoskeletal geometry is required for the calculation of the muscle length. The musculoskeletal geometry consists of the three dimensional location of muscle attachment and the position relation of bones such as the pelvis, femur, tibias, and feet. There have been several attempts to develop a database for the lower extremities [10-12]. The model of Brand et al. [12] is used in this study because they provide a full database of the 43 muscles. The attachment points of each muscle are described based on the coordinates of the attached bone. The graphically reconstructed model of muscles and each coordinate of the bone are shown in Figure 2. Unlike the given coordinates in Brand et al., the coordinates for the femur are divided into the proximal and the distal in order to determine the fracture position. The coordinates of the force sensor are added to calculate the muscle forces and moments at the position of the force sensor, which will be compared to the force measured in real-time. The forces and moments at the coordinates of the force sensor are calculated with the geometry model of the lower extremities and the muscle-force model as described by the following: 1. The coordinates of the pelvic and the distal femur are measured by the navigation system 2. Each muscle length is calculated based on the measured coordinates 3. Muscle forces are calculated using the Eq. (2) 4. The force( ) and moment( ) at the force sensor are calculated by Eq. (3) and Eq. (4), respectively.
3
4
Fig. 1 Hill-based musculotendon actuator model IFMBE Proceedings Vol. 35
118
S. Joung et al.
(a)
Fig. 2 Constructed muscle geometry and coordinates of the bone The muscle geometry is presented based on the pelvic coordinate
where i means the number of the muscle, means the force developed by ith muscle, is the vector from the force sensor to the insertion position of the ith muscle, and is the transformation matrix from the sensor coordinate to the distal coordinates. The distal bone fragment can be moved by modifying , which is the transformation matrix from the pelvic to the distal bone fragment. Thus, the reduction path . can be expressed by enumerating Two reduction paths that have ten steps from the initial position to the goal position are made as shown in Figure 3. These are expressed using six parameters that express , three for the translation and three for the rotation. The two paths have the same initial position and goal position, but different paths. With the initial position, the distal bone fragment is pulled up to pelvic-y is designated as minus- and externally rotated-b is plus-. The reduction methods for the two paths are similar: the traction of the distalincreasing of y-, reduction of external rotation-decreasing of b-, and the reposition of the traction-decreasing of y-. However, traction distance, rotation angle, and moving timing are a little different.
III. RESULTS The forces and moments at the force sensor are simulated for each path. Figure 4 shows the simulated forces and moments to the path in Figure 3. With the reduction path1, the maximum force and moment is 273N and -58Nm at step 7,
(b)
Fig. 3 Reduction path, the path is presented using six parameters that express ; (a) path1 and (b) path2 respectively. The maximum force is 382N at step 6, and the maximum moment is -101Nm at step 5 in the case of the reduction path2. It can be found that the reduction path1 requires smaller reduction force and moments than the reduction path2.
IV. DISCUSSIONS The reduction force simulation has been developed and the application methods are devised. This method is common for muscle simulations, but there are few studies that apply it to fracture reduction. Advantages include the ability to find the gentle reduction path that minimizes the reduction force from among the reduction paths that are generated from the navigation system. In addition, fracture-reduction force of two difference paths can be simulated.
IFMBE Proceedings Vol. 35
Musculoskeletal Model of Hip Fracture for Safety Assurance of Reduction Path in Robot-Assisted Fracture Reduction
119
the simulation parameters, the peak muscle force of the glutaeus medius is larger than that of the glutaeus minimus. Nevertheless, the simulation results show that the passive force of the glutaeus minimus is bigger than that of the glutaeus medius. This can be explained by a difference of the tendon slack length at which force begins to develop when stretched. The tendon slack length of the glutaeus medius is bigger than that of the glutaeus minimus. Thus, the larger muscle length for developing a passive force is required in the glutaeus medius than in the glutaeus minimus. We have developed the musculoskeletal model of hip fracture to predict or monitor forces produced by the reduction procedure. We could find the gentle reduction path from comparing reduction forces against to two reduction paths. Though the simulation was developed, the muscle geometry and parameter have personal error. And it should be more discussed. One simple and conventional solution is to scale the geometry and parameter used in this study to the frame of the patient. Future work includes integrating the function of detecting unexpected large reduction forces to the current robot system.
(a)
(b)
ACKNOWLEDGMENT
Fig. 4 Simulated forces and moments (a) against path1 and (b) against path2
This work was supported by Health Labour Sciences Research Grant.
REFERENCES
Fig. 5 Variation of passive force of the glutaeus medius and the glutaeus minimus for the simulation of path2
The passive force of each muscle can also be calculated. For instance, figure 5 shows the variation of passive force of the glutaeus medius and the glutaeus minimus for the simulation of path 2. In general, the glutaeus medius is stronger and bigger than the glutaeus minimus. Comparing
1. S. Joung, H. Liao, E. Kobayashi et al.(2010) Hazard analysis of fracture-reduction robot and its application to safety design of fracturereduction assisting robotic system, 2010 International Conference on Robotics and Automation, pp 1522-1561 2. Y. Maeda, N. Sugano, M. Saito, et al (2008) Robot-assisted femoral fracture reduction: Preliminary study in patients and healthy volunteers. Comput Aided Surg, 13(3):148-156 3. T. Gosling, R. Westphal, J. Fauulstich et al. (2006) Forces and torques during fracture reduction: Intraoperative measurements in the femur. J Orthop Res, 24(3):333-338 4. S.L. Delp, J.P. Loan, M.G. Hoy et al. (1990) An interactive graphicsbased model of the lower extremity to study orthopaedic surgical procedures. IEEE T Bio-Med Eng, 37(8):757-767 5. S.L. Delp, F.C. Anderson, A.S. Arnold et al. (2007) Opensim: Opensource software to create and analyze dynamic simulations of movement. IEEE T Bio-Med Eng, 54(11):1940-1950 6. U Glitsch and Baumann W. (1997) The three-dimensional determination of internal loads in the lower extremity. J Biomech, 30(1112):1123-1131 7. Soest Arthur J. and Bobbert Maarten F. (1993) The contribution of muscle properties in the control of explosive movements. Biol Cybern, 69(3):195-204 8. M. Gordon, A. F. Huxley, and F. J. Julian. (1966) The variation in isometric tension with sarcomere length in vertebrate muscle fibers. J Physiol, 184(1):170-192
IFMBE Proceedings Vol. 35
120
S. Joung et al.
9. International Society of Biomechanics at http://isbweb.org/data/delp/ index.html 10. TM Kepple, HJ Sommer III, KL Siegel, and SJ Stanhope. (1998) A three-dimensional musculoskeletal database for the lower extremities. J Biomech, 31:77-80 11. Thomas L. Wickiewicz, Roland R. Roy, Perry L. Powell et al. (1983) Muscle architecture of the human lower limb. Clin Orthop Relat R, 179:275-282
12. Brand RA, Crowninshield RD, Wittstock CE et al. (1982) A model of lower extremity muscular anatomy. J Biomech Eng, 104(4):304-310 Author: Institute: Street: City: Country: Email:
IFMBE Proceedings Vol. 35
Sanghyun Joung the University of Tokyo 7-3-1, Hongo, Bunkyo-ku, Tokyo Japan
[email protected] Speed Based Surface EMG Classification Using Fuzzy Logic for Prosthetic Hand Control S.A. Ahmad1, A.J. Ishak1, and S.H. Ali2 1
Dept of Electrcial and Electronic Engineering, Faculty of Engineering, Universiti Putra Malaysia, Selangor, Malaysia 2 Dept of Electrical, Electronics and System, Faculty of Engineering and Built Environment, Universiti Kebangsaan Malaysa, Selangor, Malaysia
Abstract— Electromyographic (EMG) signal is an established technique for the control of a prosthetic hand. In its simplest form, the signals allow for opening a hand and subsequent closing to grasp an object. An EMG control system consists of two main components: feature extraction and classification. Using the information from different speeds of contraction, this paper describes the classification stage of the signal in determining the final grip postures of the hand. Fuzzy logic (FL) system is used in classifying the final information and the results demonstrate the ability of the system to discriminate the output successfully. Keywords— prosthesis control, electromyography, fuzzy logic, feature extraction, classification.
I. INTRODUCTION The human hand is a complex biological system with twenty seven bones. A multitude of muscles and tendons provide multiple degrees of freedom of movements and an array of over 17,000 tactile sensors for sensory feedback mechanisms [1]. Prosthetic hands have been designed to provide either functional and/or visual replacement for individuals with amputation or a natural birth defect. Commercial hand prostheses provide the user with limited dexterity and functionality due to the restricted number of grip patterns that may be achieved. The last few decades have shown continuous work on prosthetic hand developments with the ultimate aim of developing a prosthetic hand that is able to mimic the functionality and control of the human hand. For example, the US Department of Defense's Advanced Research Project Agency has put a large investment into prosthetic arm research with the aim to have a mechanical limb with significant function and sensory perception of a natural limb controlled via the amputee's nervous system [2]. To improve the functionality of the artificial hand, two main factors have to be considered in the development process. Those two factors are the structural design of the artificial hand and the control mechanism of the hand. Rapid growth in the structural design of the artificial hand can be seen and there is renewed interest in the development of
hands with multiple degrees of freedom that lead to multiple grip hand postures [3, 4]. The control mechanism has become the main concern in the prosthetic hand development process. Various methods have been proposed in controlling the operation of an artificial hand and surface electromyography has become an established technique as the control mechanism for prosthesis control application. The concept of using surface electromyography signal for prosthesis control has started since 1940s [5]. By using the residual muscles on the amputee's arm, they have been used as the control channel to determine the final movement of the hand. The simplest application is to either open or close a hand. Attempts to recognize patterns in the surface electromyography signal for control purposes have been investigated and it has been demonstrated that this control method is robust for the prosthesis control. Pattern recognition aims to classify the surface electromyography data based on statistical information extracted from the signal and determine the final output of the device operation. Even though the amputees may not have fully functioning muscles, it has been shown that they are able to generate repeatable surface electromyography patterns during movements [6]. The aim of this research is to develop simple and robust ECS in discriminating four different grip postures by using two SEMG signals as the control channel. This paper emphasizes the classification stage of the ECS where the extracted features will be discriminated accordingly to determine the final output of the system. A FL classifier has been used in this work and its designed was based on the findings in the feature extraction stage.
II. ELECTROROMYOGRAPHIC CONTROL SYSTEM Fig.1 shows the general block diagram of ECS based on pattern recognition. It consists of two main modules: feature extraction and classification. Each module plays important role for the success of the system but they can be adjusted (merge or omit) depend on the implementation of the system.
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 121–124, 2011. www.springerlink.com
122
S.A. Ahmad, A.J. Ishak, and S.H. Ali
metronome. During the maximum speed, the participant was asked to perform the task based on their ability. SEMG1 SEMG2
Feature extraction
Classification
Prosthesis
Fig. 1 The block diagram of an electromyographic control system (ECS)
A. SEMG Data Acquisition SEMG1 and SEMG 2 labeled in Fig. 1 are the control channels for the system. The SEMG data are acquired from the surface of the skin by placing electrodes over the person's muscle. Different muscles responsible on different movement. Therefore, the electrode must be placed on the muscles that are to be investigated. For example, the extensor and flexor muscles are responsible for wrist flexion/extension movement. It is important to place the electrode on the accurate location as correct placement of the electrodes will give strong SEMG signals and gives a good distinction between movements. Inaccurate placement of the electrodes will affect the performance of the classifier [7]. Normally, the electrodes are accompanied by miniature pre-amplifiers. In this work, it focuses on the wrist muscles which are the flexor carpi ulnaris (FCU) and extensor carpi radialis (ECR). This pair of antagonistic muscles was selected as they are the muscles responsible for the wrist movement. Typically the flexor and extensor muscles are used in the SEMG control application for prosthetic hand [8, 9]. SEMG data were acquired from twenty healthy participants’ wrist muscles. The experimental protocol used in this investigation was approved by the School of Electronics ancd Computer Science, university of Southampton. The SEMG signals were acquired using Noraxon Ag/AgCl dual electrodes (diameter 15 mm, centre spacing 20mm). They were placed on the forearm above FCU and ECR with a reference electrode at the elbow. The procedures for the electrodes placement were referred from the SENIAM guidelines [10]. This is to ensure a stable and maximum pickup area of the SEMG signals. Also, the surface was cleaned with rubbing alcohol to reduce the impedance at the surface. The SEMG signals were sampled at 1,500 Hz using a Noraxon 2400T in conjunction with Noraxon Myoresearch XP Master Edition (version 1.06) software. The participants were asked to do movements that related to these particular muscles which were wrist flexion, wrist extension and cocontraction. All the movements were done at different speeds; 60 beep per minute (bpm), 90 bpm, 120 bpm and maximum speed. The speed was controlled by using a
B. Feature Extraction Feature extraction is a process where the raw SEMG signal is represented into a feature vector which is then used to separate the desired output, e.g. different hand grip postures. The success of the ECS based on pattern recognition depends on the selection and extraction of features [6]. To get a reasonable processing time, the recorded SEMG data were pre-processed. There are various methods to do this but the most widely used is data segmentation because it can improve the accuracy and the response time to the controller. All the raw SEMG data were post-processed using the following methods: 1) Approximate entropy (ApEn) [11]
ApEn (m,r, N) = Φ m ( r ) − Φ m +1 ( r )
(1)
2) Mean absolute value
Xi =
1 N
N
∑x
k
; i = 1,......, I
(2)
k =1
3) Kurtosis
∑ kurtosis =
N i =1
(X i − X )4
( N − 1)σ 4
(3)
The investigation focused on the analysis of the ApEn as the main method and other methods were used to support the performance of the ApEn. The whole data was first divided into overlapping segments of length 200 data values (N), which is about 130 ms duration with a delay of one point to the next segment. For prosthetic control, calculations should be less than 200ms. Otherwise the delay would be too long for practical use. A sample window of 200 samples (130 ms) is a very good balance between having enough sample to give robust estimated of ApEn and delay time. A moving data window was applied to the data sequence and ApEn within data is calculated repeatedly. The moving ApEn is obtained as the windows moves point by point along the time axis. The work carried out in this stage has been reported here [12, 13] and will not be discussed in detail. C. Classification The information obtained during feature extraction will be then fed into a classifier. A classifier should be able to map different patterns and match them appropriately. An efficient classifier should be able to classify patterns in a short duration to meet the real-time constraint of prosthetics
IFMBE Proceedings Vol. 35
Speed Based Surface EMG Classification Using Fuzzy Logic for Prosthetic Hand Control
123
device. However, due to the nature of EMG signal it is possible to see a large variation in the value of the feature used. This variation may be due to the electrode placement or sweat. The next section will discuss in detail of the classifier design for this project.
III. CLASSIFIER DESIGN This classifier is built using the information on the contraction speed where earlier investigation has shown that moving ApEn, MAV and kurtosis show differences of their magnitudes at different speeds of contraction. For this type of classifier, the dip that can be observed at the start and end of a contraction in ApEn analysis will be used to trigger and stop the classification process respectively (see Figure ?). With this method, the processor power consumption could be saved as the system doesn't need to do continuous classification. Three speeds have been defined in this work and they are SLOW (60bpm), MEDIUM (90bm)) and FAST (120bpm) speeds. The four-state classifier system is to classify the extracted information from wrist movements and cocontraction at different speeds in selecting one of the four outputs. The operation of the system is as follows: 1) 2) 3) 4) 5) 6) 7)
Wrist flexion at the SLOW speed – STATE1 Wrist flexion at the MEDIUM speed – STATE2 Wrist flexion at the FAST speed – STATE3 Wrist extension at the SLOW speed – STATE1 Wrist extension at the MEDIUM speed – STATE2 Wrist extension at the FAST speed – STATE3 Co-contraction at the SLOW speed – STATE4
The subject has to do two movements which are wrist flexion/extension at the speed of 60 bpm (SLOW, S), 90 bpm (MEDIUM, M) and 120bpm (HIGH, H) and cocontraction only at 60bpm (C). The feature extraction of two SEMG signals gives six features: ApEn1 (A1), MAV1 (B1), kurtosis1 (C1) from the FCU and ApEn2 (A2), MAV2 (B2) and kurtosis2 (C2) from ECR. The FL classifier will discriminate the information from the feature extraction process into four different states namely STATE1 (S1), STATE2 (S2), STATE3 (S3) and STATE4 (S4). The MF for the inputs and the output of the system is shown in Figure 2. In the top left plot of Figure 6.3 is the MF of the input A1. In order from left to right: co-contrcation (C), HIGH (H, 120bpm), MIDDLE (M, 90bpm), SLOW (S, 60bpm) and RELAX (R). These functions are derived from the mean and SD obtained in the signal processing stage. The means between speeds of the contraction have small but substantial differences.
Fig. 2 The membership function for the inputs and the output of the four state system. Inputs A1, B1 and C1 are from FCU and A2, B2 and C2 are from ECR. S: SLOW, M: MEDIUM, H: HIGH, C: Co-contraction, R: RELAX After several cycles of testing, possible changes of the MF for each input were explored. The changes included modification of the MF shape and range of values of the inputs but the same results were obtained. It has been found that poor classification results are due to the kurtosis input from both SEMG channels. These tests have led to the exclusion of kurtosis for further analysis in the ECS development for this type of classifier.
IV. RESULTS AND DISCUSSION Fig. 3 shows the results of the revised ECS during wrist flexion/extension at 60bpm when kurtosis is removed. It can be seen clearly the classifier is able to select the correct output, which in this case is STATE1 (S1), labeled (a) and (b), where from the output MF, the range is between 0 until 0.3. Even though there are glitches during the classification result in one contraction, the average of the values produces the correct output state.
IFMBE Proceedings Vol. 35
124
S.A. Ahmad, A.J. Ishak, and S.H. Ali
Fig. 4 (continued)
REFERENCES
Fig. 3 The result of the classification system for wrist flexion and wrist extension at 60bpm for the revised four states system
1.
The analysis of accuracy (Fig. 4) of the four-system has shown that from the speeds of contraction perspective, during wrist flexion/extension, the classifier was able to select STATE1 (S1) and STATE2 (S2) accordingly but not at STATE3 (S3) which is when the contraction is performed at the speed of 120bpm.
2. 3. 4. 5. 6. 7. 8.
9.
10.
Fig. 4 The accuracy (in %) of the ECS during 1. wrist exion/extension at 60bpm (SLOW) - top, 2. Wrist flexion/extension at 90bpm (MEDIUM) middle and 3. Co-contraction at 60bpm - bottom, for the revised four-state system
11. 12. 13.
Carrozza, M., Dario, P., Zecca, M., & Micera, S. (2002a). Control of multifunctional prosthetic hands by processing the electromyographic signal. Crit. Rev Biomed Engineering, 30, 459-485. Evans-Pughe, C. (2006). Smarter prosthetics. Tech. rep., IET - Engineering and Technology. Mitchell, W. R., M. (2008). Development of a clinically viable multifunctional hand prosthesis. In MyoElectric Controls/Powered Prosthetics Sympossium. TouchBionics (2007). The i-limb hand.URL http://www.touchbionics.com Plettenburg, D. H. (2006). Upper Extremity Prosthetics, Current Status & Evaluation. VSSD Asghari Oskoei, M., & Hu, H. (2007). Myoelectric control systems - a survey. Biomedical Signal Processing and Control, 4 (4), 275-294 Hargrove, L., Englehart, K., & Hudgins, B. (2006). The effect of electrode displacements on pattern recognition based myoelectric control. In IEEE Ann.Intl. Conf. on Engineering in Medicine and Biology Society, 2203-2206). Ajiboye, A., & Weir, R. (2005). A heuristic fuzzy logic approach to EMG pattern recognition for multifunction prosthesis control. IEEE Trans. on Biomedical Eng, 52 (11), 280-291. Karlik, B., M.O., T., & M., A. (2003). A fuzzy clustering neural network architecture for multifunction upper- limb prosthesis. IEEE Trans. on Biomedical Engineering, 50 , 1255-1261. Hermans, H., Freriks, B., Merletti, R., Stegeman, D., Blok, J., Rau, G., Disselhorst-Klug, C., & Hagg, G. (1999). SENIAM 8, European Recommendations for surface Electromyography, results of the SENIAM project. Rossingh Research and Development. Pincus, S. M. (1991). Approximate entropy as a measure of system complexity. Proc Natl Acad Sci U S A, 88 (6), 2297-2301. Ahmad, S. A. and Chappell, P. H. (2008) Moving Approximate Entropy Applied to Surface Electromyographic Signal, Biomedical Signal Processing and Control, Vol. 3, pp. 88–93, 2008. Ahmad, S.A. Ahmad and Chappell, P. H. (2009) Surface EMG Pattern Analysis of the Wrist Muscles at Different Speeds of Contraction, Journal of Medical Engineering and Technology.
IFMBE Proceedings Vol. 35
Activity of Upper Body Muscles during Bowing and Prostration Tasks in Healthy Subjects M.K.M. Safee, W.A.B. Wan Abas, N.A. Abu Osman, and F. Ibrahim Department of Biomedical Engineering, Faculty of Engineering, University of Malaya, 50603 Kuala Lumpur, Malaysia
Abstract— This paper investigate the activity of the neck extensors (NE), sternocleidomastoideus (SCM), trapezius (TRP), deltoid (DT), biceps brachii (BB), triceps brachii (TB), rectus abdominal (RA), and erector spine (ES) muscles in healthy subjects during bowing and prostration using surface electromyography (EMG). A group of student aged between 23 to 28 years voluntarily participated in this study. The subjects were asked to perform two types of flexion positions, namely bowing (90o forward flexion with the hands on the respective knees) and prostration (flexion with the palms of the hands and the forehead flat on the floor). The motion signals of the muscles were recorded. The finding indicated that during the bowing, there was contraction of the NE, DT, TB, and RA muscles while the muscle relaxation was found in the SCM, TRP, BB, and ES. During prostration, there was contraction at the SCM, DT, TB, and RA but muscle relaxation was found at the NE, TRP, BB, and ES. For the muscles that showed electrical activity in both the postures, the Wilcoxon Rank Sum Test showed a statistically no significant difference between bowing and prostration only for DT (p = 0.534) and but statistically significant difference for RA and TB (p 1 kHz is desirable [8]. A multi-telemeter system requires a PC or a recorder for data recording, and the measuring system (sending and receiving) is generally large. For this reason, a behavioral field of the subject is limited in the range where data communication is possible. The system developed in this study is light-weight and smaller than a normal Holter electrocardiograph and multi-telemeter equipment. In addition, it has three acceleration sensors (left-right, top-bottom, forwardbackward) to monitor body movements, which enables us to estimate what the subject was doing at that time. This will be useful information in understanding the stress variations for an extended period of time. Replacement of the battery and the memory card is simple and easy, and an ECG can be measured without time limitations. Even a year-long monitoring of ANS activities (stress) is possible. Three-axis acceleration data were used to identify the subject’s behavior (walking, reclining, lying down, or sitting). Thus it is possible to separate psychological accentuations of sympathetic nervous activity from those induced by simple posture changes or body movements. Monitoring a vertigo patient’s behavior in everyday life is one of the promising
applications in the medical field. It would be very helpful to know the correlation pattern between ANS activity and the timing of a dizzy turn which might be estimated by postural changes (acceleration signals) in the understanding and treatment of vertiginous patients. Quantification of 3-D and 2D trajectories remains a challenge.
VI. CONCLUSIONS A wearable electrocardiograph with three acceleration sensors and its analysis program for monitoring ANS changes and body movements for extended period of time were developed. The system availability was demonstrated by the consecutive three-day experiment and analysis data showed long-term change of ANS and short-term change by tension or body movement. Clinical applications for monitoring vertigo patients are in progress.
REFERENCES 1. Mercado S et al. (2007) Responding to the Health Vulnerabilities of the Urban Poor in the “New Urban Settings” of Asia, at http://www.who.or.jp/2007/Bellagio.pdf 2. Yamaguchi T, Shioji I, Sugimoto A et al. (2002) Psychological stress increases bilirubin metabolites in human urine. Biochem Biophys Res Commun 293: 517–520 3. Hellhammer DH, Wüst S, Kudielka BM (2009) Salivary cortisol as a biomarker in stress research. Psychoneuroendocriono 34 : 163-171 4. Wilczynska A, De Meester F, Singh Ram B et al. (2010) Heart rate and blood pressure in the context of nutritional and psychological analysis: a case study. Eur J Med Res 15, Suppl 2 : 217-213 5. Task Force of the European Society of Cardiology the North American Society of Pacing Electrophysiology (1996) Heart Rate Variability, Standards of Measurement, Physiological Interpretation, and Clinical Use. Circulation 93: 1043-1065 6. Ito H, Nozaki M, Kaji Y et al. (2001) Shift work modifies the circadian patterns of heart rate variability in nurses. Int J Cardiol 79: 231-236 7. Kobayashi H, Ishibashi K, Nogchi H et al. (1999) Heart Rate Variability: An Index for monitoring and analyzing human autonomic activities. Appl Human Sci 18: 53-59 8. Nakata A, Haratani T, Takahashi et al. (2004) Job stress, social support, and prevalence of insomnia in a population of Japanese daytime workers. Soc Sci Med 59: 1719-1730 9. Pickering TG, Devereux RB, James GD et al. (1996) Environmental influences on blood pressure and the role of job strain. J. Hypertens Suppl 14: S179-S185
Author: Institute: Street: City: Country: Email:
IFMBE Proceedings Vol. 35
Yoshio Okada Industrial Research Institute of Shizuoka Prefecture Aoi-ku, Makigaya 2078 Shizuoka Japan
[email protected],
[email protected] Wireless Sensor Network for Flexible pH Array Sensor J.C. Chou1,2,3,*, C.C. Chen2, and M.S. Wu3 1
Department of Electronic Engineering, National Yunlin University of Science and Technology, Douliou, Yunlin, Taiwan, R.O.C. 2 Graduate School of Engineering Science and Technology, National Yunlin University of Science and Technology, Douliou, Yunlin, Taiwan, R.O.C. 3 Graduate School of Optoelectronics, National Yunlin University of Science and Technology, Douliou, Yunlin, Taiwan, R.O.C.
Abstract— In this study, a wireless sensor network (WSN) for flexible pH array sensor has been developed by virtual software of National Instrument (NI) Laboratory Virtual Instrument Engineering Workbench (LabVIEW). The measurement data were received from measurement node and sent to a gateway connecting with computer through WSN. The WSN has been combined successfully with flexible pH array sensor. And the sensitivity and linearity of the flexible pH array sensor received through WSN are 53.39 mV/pH and 0.990 in pH concentrations between pH1 and pH13 at room temperate (25 oC), respectively. Therefore, the developed WSN can be applied to the flexible pH array sensor practically. Keywords— Wireless sensor network, Flexible array sensor, Radio frequency sputtering, Screen-printing, pH sensitivity.
I. INTRODUCTION Due to sensing devices should be small and low price, the thick-film technology became more suitable and promising for large-scale, cost-effective, fast and highly reproducible production of electrochemical sensors [1, 2]. Manufacturing sensors and biosensors on plastic by means of screen-printing has attracted considerable attention that owing to the proliferation of handheld, portable consumer electronics. Plastic substrates possess many attractive advantages of biocompatibility, flexibility, light weight, shock resistance, softness and transparency [3]. And screenprinting is especially recommended as simple and fast method for mass production of disposable electrochemical sensors [4]. Hence, the development of biosensor tended towards low cost, small size and easy fabrication by screen printing in the future [5]. Wireless sensor network (WSN) is an emerging technology that has a wide range of potential applications including environment monitoring, smart spaces, medical systems, and robotic exploration. Such networks consist of large numbers for distributed nodes that organize themselves into
a multihop wireless network. Each node has one or more sensors, embedded processors, and low power radios, and is normally battery operated. Typically, these nodes coordinate to perform a common task [6]. As the promising application of wireless sensor networks, the global chip makers and organizations established wireless sensor network technology standards such as IEEE 802.15.4, MiWi, SimpleTI, SMAC, Smart Dust [7], ZigBee, Z-Wave, etc. And the application range from environmental monitoring to position of personnel and productions, industrial control, building and home automation, health care, and medical fields. In 2010, the estimative shipments of the wireless sensor network nodes are more than 100 million, and the sales amount are over two billion U.S. dollars. According to the mention above, the primary researches focused on the attempt to use the NI wireless sensor network module for V-T measurement system. And the flexible array sensor was applied to detect the response voltage for pH buffer solution, in this study.
II. EXPERIMENTAL A. Fabrication of Flexible pH Array Sensor In this study, the flexible electrodes were fabricated in basis with polyethylene terephthalate (PET) substrate, and using the radio frequency (R.F.) sputtering system to deposit ruthenium dioxide (RuO2) as the sensing membrane on the PET substrate [8, 9]. Afterward the screen-printed technique was used to coat the conductive layer (silver leading wire) and the insulation layer (epoxy paste) on the sensing membrane (RuO2 layer). The novel structure of 2×4 flexible array sensor was improved from the prior 1×2 structure [10, 11]. The flexible array sensor was produced using a semiautomatic screen printer (Model HJ-55AD3, Taiwan, R.O.C.). And each piece of PET substrate has three array sensors. First, the PET substrate was cleaned with deionized
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 375–379, 2011. www.springerlink.com
376
J.C. Chou, C.C. Chen, and M.S. Wu
(D. I.) water and ethanol in an ultrasonic oscillator 10 minutes and baked at 120 oC for 10 minutes. Then, eight RuO2 thin films were deposited on the PET substrate by using radio frequency sputtering system. And eight strips of silver paste were coated on PET substrate for slightly connected with eight RuO2 thin films and baked at 120 oC over for 20 minutes. Finally, the insulating layer of epoxy paste was coated on the top of array sensor and baked at 140 oC over for 40 minutes. The flexible array sensor electrode consists of a flexible PET substrate, eight RuO2 sensing films with 2.5 mm diameter, eight leading wires, and sensing windows on insulation layer of epoxy with 1.5 mm diameter. The diagram of the flexible array sensor was shown in Fig. 1.
Fig. 2 Diagram of array sensor measurement system
III. RESULT AND DISCUSSION A. Function of WSN Measurement Platform
Fig. 1 Fabrication framework of flexible array sensor B. Measurement System In this study, the detection temperature was controlled at 25 oC during measuring process. The hydrogen ion detection has three methods in this study. They were multi-meter (Model: Agilent HP34401A, Agilent, U.S.A.), NI data acquisition system (DAQ card) and NI wireless sensor network module (WSN), respectively. Among the HP34401A multi-meter for measurement has some disadvantages, such as only single sensor measurement one time, stationary for measurement instrument. However, NI DAQ card and NI WSN system have some advantages of multi channel (Max 16 channels), portable and the cheap price of device. Finally, the NI LabVIEW 2009 (Model: LabVIEW 2009, National Instrument Corp., U.S.A.) was selected for analytic software to estimate the sensitivity and linearity. The voltage-time (V-T) curves were performed by using the voltage-time (V-T) measurement system which consists of NI DAQ card or NI WSN system, a read-out circuit, twoelectrode cell and a personal computer (PC) as shown in Fig. 2. The operation parameter of the temperature were set for room temperature and the measurement time was set for 5 minute.
In this study, the operational interface of the WSN measurement system with LabVIEW software was designed. The interface of the WSN measurement system was divided into three parts: Parameter Setting, Measure Curve, and Data Analysis. As mentioned above, the interface of the measurement system is shown in Fig. 3. Parameter Setting: The interface of “Parameter Setting” was composed of “Selecting Instrument”, “Physical Channels”, “Global Calibrations (scale)” and “Time Interval (sec/scale)”. The “Selecting Instrument” of “Step 1” has three modes that are “HP 34401 (RS-232)”, “NI Instruments” and “Wireless Sensor Network”, respectively. The mode of “HP 34401 (RS-232)” used the instrument of HP 34401A multimeter to acquire measurement data via the RS-232 cable. Another mode of “NI Instruments” was based on DAQ card of NI USB-6210 that was an acquisition device with 16 inputs, 16-bits and 250kS/s multifunction I/O. Finally, the mode of the “Wireless Sensor Network” was used for wireless measurement. Furthermore, the “Physical Channels” of “Step 1” was to decide the channel amount with measurement. The “Global Calibrations (scale)” of “Step 2” was to set the interval of scale with system measure. And the “Time Interval (sec/scale)” of “Step 2” was the septal second for each scale. Finally, pushed the button of “Step 3” and decided the saving path of the measurement data. Measure Curve: The interface of “Measure Curve” wascomposed of the measure diagram and value with real-time display and two buttons, Pause and Stop. The coordinate units of curve were output voltage (mV) and time (sec), and the measuring value can show 16 channels maximal. The operation interface of the “Measure Cureve” was shown in Fig. 4.
IFMBE Proceedings Vol. 35
Wireless Sensor Network for Flexible pH Array Sensor
377
Table 1 Sensitivities and linearities of flexible pH array sensor were measured with I-V, WSN, and DAQ card systems I-V Measurement WSN Measurement DAQ Card System System System Sensitivity Linearity Sensitivity Linearity Sensitivity Linearity No (mV/pH) (mV/pH) (mV/pH) 53.02 0.967 53.80 0.998 1 56.74 0.998 51.75 0.989 52.72 0.998 2 54.41 0.997 3
50.04
0.996
52.25
0.990
51.86
0.999
4
49.77
0.994
53.39
0.988
52.54
0.998
B. Measurement Results of Current-Voltage System The current-voltage (I-V) measurement system is composed of Keithley 236 Semiconductor Parameter Analyzer and a readout circuit of n-MOSFET. The sensitivity and linearity of flexible array sensor measured in the concentrations between pH1 and pH13 at room temperature (25 oC) were represented in Table 1. The ranges of sensitivity and linearity were from 49.77 mV/ pH to 56.74 mV/pH and from 0.994 to 0.998, respectively. At present, the pH array sensors have been fabricated successfully and applied to I-V measurement system. Fig. 3 Interface of “Parameter Setting” for WSN measurement system Data Analysis: The interface of “Data Analysis” was designed for the analyses of sensitivity and linearity, which is shown in Fig. 4.
C. Measurement Results of Voltage-Time System The V-T measurement system for hydrogen ion detection has two methods in our laboratory, which were HP 34401A multi-meter and DAQ card, respectively. The results of sensitivity and linearity for V-T measurement with HP 34401A multimeter device are 53.38 mV/pH and 0.999 (not shown in Table 1) from pH1 to pH13 at 25 oC, respectively. Another V-T measurement system is DAQ card. In comparison between the HP 34401A multi-meter and DAQ card, the DAQ card was set the same condition that single sensor was measured one time. The measurement results of sensitivity and linearity measured by V-T measurement system with DAQ card device are 53.80 mV/pH and 0.998 from pH1 to pH13 at 25 oC, respectively, as shown in Table 1. The sensitivity and linearity of above two devices were almost the same. According to above results, the DAQ card device is feasible for V-T measurement. D. Measurement Results of WSN System
Fig. 4 Interfaces of “Measure Curve” and “Data Analysis” for WSN measurement system
In this study, the characteristic of the hydrogen array sensor was measured by using WSN measurement system. And the WSN measurement system was based on DAQ card
IFMBE Proceedings Vol. 35
378
J.C. Chou, C.C. Chen, and M.S. Wu
voltage-time (V-T) measurement system. The voltage-timebased WSN measurement system was comprised of read-out circuit, four-channel analog input measurement node (NI WSN-3202, USA) and a gateway coordinate to connect with personal computer (PC). The measurement system was based on LabVIEW software that was designed for a real-time and dynamic measurement system. The analog signal was acquired for the measurement node WSN-3202 that input analog signal range was set from -10V to +10V. The analog signal was transformed to digital signal via WSN-3202. Afterwards, the digital signal was transmitted to the gateway coordinator (WSN-9791 Ethernet Gateway). Finally, the gateway collected the all measurement data from each measurement nodes (WSN-3202) and sent the data to a computer via Ethernet cable. Then, the received digital signal was analyzed via computer software for LabVIEW, and calculated the sensitivity and linearity. Furthermore, the hardware architecture of wireless sensor network module is comprised of sensor device, read-out circuit and measurement node of WSN-3202, as shown in Fig. 5.
Fig. 6 Measurement curve and interface of WSN measurement system
IV. CONCLUSIONS The wireless sensor network measurement system with flexible array sensor has been presented. Then the LabVIEW software was based on a personal computer and the measurement data can be acquired, processed, analyzed, and presented via wireless sensor network. And according to the experimental results, the sensitivities and linearity of flexible array sensor measured by V-T measurement system with DAQ card or WSN system are excellent. Hence, they can replace the conventional and expensive of instrument for VT measurement system.
ACKNOWLEDGMENT
Fig. 5 Hardware architecture of wireless sensor network Finally, the measurement curve and interface of WSN measurement system is shown in Fig. 6. And the sensitivity and linearity of flexible array sensor in the concentrations between pH1 and pH13 were represented in Table 1. The sensitivities and the linearities were 51.75 mV/ pH to 53.39 mV/pH and 0.967 to 0.990, respectively. In order to prove that the NI-WSN device was feasible for pH measurement, the same sensor was used for DAQ card device, and the sensitivity and linearity of flexible array sensor in the concentrations between pH1 and pH13 were represented in Table 1. The sensitivities and linearity were from 51.86 mV/ pH to 53.80 mV/pH and from 0.998 to 0.999, respectively. According to above results, the NI-WSN device was feasible for hydrogen ion detection.
The authors would like to thank the National Chip Implementation Center (CIC) to support for CMOS fabrication. This study is supported by National Science Council, The Republic of China, under the contracts NSC 97-2221E-224-058-MY3.
REFERENCES 1. Tymecki Ł, Zwierkowska E, Koncki R (2005) Strip bioelectrochemical cell for potentiometric measurements fabricated by screenprinting. Anal. Chim. Acta 538: 251-256 2. Tymecki Ł, Zwierkowska E, Koncki R (2004) Screen-printed reference electrodes for potentiometric measurements. Anal. Chim. Acta 526: 3-11 3. Michael C M, Habib A, Wang D et al. (2007) Highly ordered nanowire arrays on plastic substrates for ultrasensitive flexible chemical sensors. Nat. Mater. 6: 379-384 4. Robert K, Marco M (1997) Screen-printed ruthenium dioxide electrodes for pH measurements. Anal. Chim. Acta 351: 143-149 5. Akyildiz I F, Su W, Sankarasubramaniam Y et al. (2002) Wireless sensor networks: a survey. Computer Networks 38: 393-422
IFMBE Proceedings Vol. 35
Wireless Sensor Network for Flexible pH Array Sensor 6. Wei Y, John H, Estrin E D (2004) Medium access control with coordinated adaptive sleeping for wireless sensor networks. IEEE/ACM Trans. Networking 12: 493-506 7. Ilyas M, Mahgoub I (2006) Smart dust : sensor network applications, architecture, and design. Boca Raton: CRC/Taylor & Francis 8. Tsai Y H (2007) Fabrication and analysis of the ascorbic acid biosensor based on the ruthenium oxide sensing electrode, Master thesis, Graduate School of Optoelectronics, National Yunlin Institute of Technology, Yunlin, Taiwan 9. Chou J C, Tsai Y H, Chen C C (2008) Development of a disposable all-solid-state ascorbic acid biosensor and miniaturized reference electrode fabricated on single substrate. IEEE Sens. J. 8: 1571-1577 10. Chou J C, Chen W C, Chen C C (2009) Flexible sensor array with programmable measurement system, Proceedings of The International Conference on Chemical and Biomolecular Engineering (ICCBE 2009), Tokyo, Japan, 2009, pp. 340-344
379 11. Chou J C, Chen C C (2009) Weighted data fusion for flexible pH sensors array. Biomed. Eng. Appl. Basis Commun. 21: 365-369
Author: Jung-Chuan Chou Institute: Department of Electronic Engineering, National Yunlin University of Science and Technology, Street: 123, Sec.3, University Rd. City: Douliou, Yunlin Country: Taiwan, R.O.C. Email:
[email protected] IFMBE Proceedings Vol. 35
Application of Gold Nanoparticles for Enhanced Photo-Thermal Therapy of Urothelial Carcinoma Y.J. Wu1, C.H. Chen1,2, H.S.W. Chang3, W.C. Chen4, and J.J. Jason Chen1 1
Institute of Biomedical Engineering, National Cheng Kung University, Tainan, Taiwan 2 China Medical University and Beigang Hospital, Chiayi, Taiwan 3 Institute of Biomedical Engineering, Chung Yuan Christian University, Taichung, Taiwan 4 Department of urology, School of Medicine, China Medical University and Hospital, Taoyuan, Taiwan
Abstract— The aim of this study is to utilize photothermal therapy (PTT) to treat urothelial cancer using the unique optical properties- surface plasmon resonance of gold nanoparticles (GNPs). The GNPs were conjugated with anti-EGFR and antiMUC7 antibody for tumor targeting. The conjugated GNPs were exposed under a green light laser (532nm) to produce the enough thermal energy and to kill the transitional cell carcinomas (TCC). Our results show that the cancer cells (MBT2, T24, 9202, 8301) were damaged at relatively lower energy (10 W/cm2, 1.6 Hz with 300 ms) compared with the group without added GNPs. The damage was directly related to the applied laser energy and irradiation time. The therapeutic effects of superficial disease in situ by intravesical GNP agents instillation will be further performed in animal study of C3H mice. It is expected that the mini-invasive technology of PPT with GNPs not only reduces the high recurrence of TCC but also avoids the side effects from traditional chemotherapy. Keywords— Gold nanoparticels, Photothermal therapy, Surface plasmon resonance, Transitional cell carcinoma, Adjuvant therapy.
I. INTRODUCTION Photothermal therapy (PTT) is a manner of treatment, which is based on the nanoparticles particular optical properties and using laser light at the same wavelength to irradiate. Because of the unique optical properties of gold nanoparticles (GNPs), various PPT techniques have been successfully used for cancer treatment in recent years [1]. In virtue of the arrangement of free electrons from particle surface, called surface plasmon resonance, the region of gold nanoparticle absorption wavelength depends on their particle size, shape and chemical structure [2]. The GNPs resulted in excellent photothermal property. Compared with other types of nanoparticles such as core-shell nanoparticles, cerium oxide (CeO2), TiO2, ZnO, magnetic nanoparticles or quantum dots, GNPs not only posses excellent chemical stability but also exhibit high affinities to biomolecules for cancer treatment or detection. In addition, GNPs have more biological compatibility and non-cytotoxicity which can provide the best possibility to clinical applications in the future.
The application of cancer therapy using nanotechnology has been widely applied to breast cancer, oral cavity cancer, cervical, lung carcinoma and brain cancer etc. However, the treatment for bladder cancer has been rarely investigated in the past research, especially in vivo study. Bladder carcinoma is a relatively common malignancy in urinary tract. Patients who have primary transitional cell carcinoma (TCC) in bladder were usually more than 90% [3]. In addition, superficial disease represents the majority (70-85%) of all diagnosed cases [4]. Bacillus Calmette-Guerin (BCG) is used as a potent intravesical therapy for superficial bladder cancer (non-muscle invasive), but the high recurrence in the superficial bladder carcinoma is widespread. Even though intravesical adjuvant therapy such as Bacillus CalmetteGuerin or Mitomycin-C (MMC) or Epirubicin etc. have been used in clinical, the recurrence rate is still close to 50% (40% and 53% in BCG and chemotherapy) with 15% disease progression in the test groups. These results show poor therapeutic effect with less benefit in any instillation agent. Furthermore, these adjuvant therapies may affect the patient inclination for treatment due to some side effects involved cystitis, fever, haematuria or urinary frequency. In recent years, the potential markers for urothelial carcinoma included epidermal growth factor receptor (EGFR), mucin 7(MUC7) and cytokeratin 20 (CK20) have been developed [5]. In our previous study, we use these targets as photothermal cancer therapeutic agents in conjunction with spherical gold nanoparticles of an average diameter of 48 nm. Research has shown that spherical shaped particles with diameters between 30 and 50 nm have the most uptake into mammalian cells [6]. Moreover, if the radii of particles were less than 50 nm and have higher density, it will move closer to endothelium layer and enhance the treatment effects. In this study, 48 nm gold nanoparticles is used as an adjuvant therapy to assist the surgical operation in superficial bladder cancer treatment. The therapeutic effect of superficial bladder cancer in situ is evaluated. TCC cell lines are used to test the curative effect as a prerequisite for the next carcinoma in situ animal study.
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 380–383, 2011. www.springerlink.com
Application of Gold Nanoparticles for Enhanced Photo-Thermal Therapy of Urothelial Carcinoma
381
II. MATERIALS AND METHODS This study selected four kinds of TCC cell lines including murine bladder cancer (MBT-2) and human bladder cancer (T24, 9202, 8301) to verify the therapeutic effect of monoclonal anti-MUC7 antibody/GNPs in comparison with polyclonal anti-EGFR antibody/GNPs used in previous study [7]. A. Bladder Tumor Cells Culture The malignant urothelial cell lines (UCC), MBT-2 (Murine) T24, 9202 and 8301 (Human) were cultured as monolayers at 37oc in atmospheric pressure. The culture medium of Roswell Park Memorial Institure 1640 (Gibco-BRL) containes 10% fetal bovine serum and 1% penicillinstreptomycin. Fig. 1 Reduction of antibody disulfide bonds B. Preparation of Gold Nanoparticles The GNPs were prepared using chloroauric acid reduction according to the method developed by Turkevich et al [8]. In brief, hydrogen tetrachloroaurate (III) trihydrate (Sigma) was diluted in D.D. water (Millipore) to a final concentration of 1.0×10-3 M. Then 34.6×10-3 M trisodium citrate (J.T. Baker) was added to the boiling gold chloroauric acid solution under vigorous stirring until it is well dispersed. When the color of solution turned to purplish red, the formed GNPs solution was removed from heat to cool at room temperature for at least 30 min. The particle suspension was centrifuged and diluted in 20×10-3 M HEPES buffer (pH7.4, Sigma) to the final concentration of 0.8 optical density at 532 nm. For better sterility, the particle suspension was finally filtered by Millipore filter of 0.22 μM. C. Semi anti-EGFR and anti-Mucin7 Antibody Labeled GNPs In order to enhance the efficiency of conjugation between GNPs and antibody compare with hydrophobic interaction, half-antibody fragments creation is adopted [9]. In principle, because of the GNPs have a high affinity with sulfhydryl group, the half-antibody will be produced by this reduction and has great ability to combine with each other (as shown in Figure 1). The steps to reduce the antibodies followed the works of Mahnke et al [10]. The antibody was dissolved at a concentration of 10 mg/ml in 20 mM sodium phosphate buffer (PH7.5) containing 150 mM NaCl and 10 mM ethylene diamine tetraacetic acid (EDTA). Then 6 mg of 2mercaptoethylamine (2-MEA) was added to the antibody solution.
After the solution dissolved, the reaction mixture was incubated for 90 min at 37°C. Lastly, the reduced antibody was purified by gel filtration column equilibrated with the same buffer containing 5 mM EDTA to remove the excess 2-MEA. We further changed the dialysis buffer 2 times to assure that the desalted antibody was purified. D. GNP/Cell Carcinoma Incubation and Laser Therapy Experiment The IgG conjugated GNPs were added into above urinary bladder carcinoma cell lines in 6-well tissue culture plate with 1 cc per well. After incubation at 37oc for 30 min, the cell/anti-EGFR/Au were washed three times to remove the unbound suspension. The 532 nm green light laser system (IDAS) provides a stable and safe power for experiment. The wavelength is overlapped with the GNPs absorption region to promote the thermal efficiency. The pulse mode was used to prevent overheating the medium. After incubation for 30 min, the cell lines which immersed GNPs suspension were exposed to 532 nm laser at various power densities for 500 times. The cell images were taken using Motic AE21 microscope under 40 x to test cell viability stained with 0.4% trypan blue (Sigma). E. Orthotopic Bladder Cancer Animal Model In order to verify the efficiency of the therapy, an animal study is required. The urinary bladder cancer model developed by Xiao et al was adopted [11]. Firstly, we use Credé’s method to evacuate the urine after the C3H mouse was anaesthetized. Then the mouse bladder was catheterized with a 24gauge plastic cannula by some inert lubricant for agents
IFMBE Proceedings Vol. 35
382
Y.J. Wu et al.
seeding. The bladder mucosa was destroyed with 0.1 N of hydrochloric acid (HCl) and neutralized by potassium hydroxide (KOH) of 0.1 N. After waiting for 15 s, the bladder was flushed with some sterile phosphate-buffered saline (PBS). Immediately after the mice bladder instillation, the 1×106 MBT2 cells were inoculated via the urethra for tumor seeding. In order to evaluate the tumor progression, the mice were sacrificed for section examination on each 14 days post-inoculation.
III. RESULTS AND DISCUSSION A. Preparation of Gold Nanoparticles From the image shown in Figure 2, we can observe the size and shape of gold nanoparticles by atomic force microscope (AFM). The particles were spherical shaped, and the average diameter was 48 nm. The UV/Vis spectrophotometer shows that the absorption spectrum was at about 532 nm. The wavelength was overlapped with the absorption region of laser with better thermal efficiency.
Fig. 3 (A),(B) SEM Images demonstrate the existence of semi antiEGFR/GNPs with different magnifications (10000 x and 100000 x). (C) The SEM-EDS analysis of the element Au distribution of MBT2 cells
Fig. 2 AFM and UV/Vis spectrophotometer image shows the GNPs size, shape and absorption wavelength
B. Observation of Cells/Semi Antibody/GNPs In order to confirm the existence of our semi antiEGFR/GNPs, we used scanning electron microscope (SEM) and transmission electron microscopy (TEM) to observe the distribution of gold. As the SEM images shown in Figure 3, we can notice that the semi anti-EGFR/GNPs were binding to the MBT2 cells clearly in various parts. The weight of element Au occupied 5.36% in terms of total element content which proved the existence of GNPs. The TEM images (as shown in Figure 4B) also illustrate the existence of the semi anti-EGFR/GNPs. We can find that there is a small amount of cellular uptake of nanoparticles through endocytosis. The size-dependent GNPs may potentially move into the tumors which makes it easier to enhance the treatment [8].
Fig. 4 (A) TEM image of MBT2 cell lines. (B) TEM image of MBT2 cell lines with added semi anti-EGFR/GNPs C. Laser Therapy Experiment For the laser experiment, different kinds of TCC (MBT2, T24, 9202, 8301) cell lines have been tested. As shown in Figure 5, our preliminary results demonstrate that the cancer cells were damaged at relatively lower energy (10 W/300 ms) compared with the cell without added semi antibody/GNPs (30 W/300 ms). Furthermore, the combination of two kinds of antibody/GNPs provided stronger ability for targeting tumor and improving the treatment effect.
IFMBE Proceedings Vol. 35
Application of Gold Nanoparticles for Enhanced Photo-Thermal Therapy of Urothelial Carcinoma
383
IV. CONCLUSION Our preliminary results indicate the immunized GNPs can be used as a PTT agent to assist the cancer therapy. The EGFR and MUC7 antibodies which combine with GNPs can target on the specific region of cell membrane. Therefore, the laser power used was about half of the energy to injury the cancer cells when the GNPs were added. The overlapping wavelength between our GNPs and laser will produce the stronger thermal energy and consequently promote the efficiency of cancer treatment.
ACKNOWLEDGMENT This study is supported by a NSC grant in Taiwan. NSC grant number: 98-2320-B-039-006.
REFERENCES Fig. 5 Observation of MBT2 cell damage after laser treatment with different conditionings D. Observation of C3H Mice Animal Model The orthotopic bladder cancer model was verified by the histological section, as shown in Figure 6. The result shows apparent tumor in the bladder lumen with EGFR over expression in the tumors. Most important of all, all of the tumors were superficial without muscle invasiveness. The superficial bladder cancer is the most suitable time for initiation of adjuvant intravesical therapies.
Fig. 6 Histological sections of C3H mice bladder tumor with different magnifications (40 x, 100 x and 100000 x). We can notice that the arrangement of epidermal cells and nuclear contours were irregular (excessive proliferation of tumor cells)
1. Lu W, Arumugam S R, Senapati D et al. (2010) Multifunctional OvalShaped Gold-Nanoparticle Based Selective Detection of Breast Cancer Cells Using Simple Colorimetric and Highly Sensitive TwoPhoton Scattering Assay. J Am Chem Soc 4:1739-1749 2. Link S, El-Sayed M A (2003) Optical properties and ultrafast dynamics of metallic nanocrystals. Annu Rev Phys Chem 54:331-346 3. Lamm D L, Torti F M (1996) Bladder Cancer. J Clin 46:93-112 4. Puntoni M, Zanardi S, Branchi D et al. (2007) Prognostic Effect of DNA Aneuploidy from Bladder Washings in Superficial Bladder Cancer. Cancer Epidemiol Biomarkers Prev 16:979-983 5. Villares G J, Zigler M, Blehm K et al. (2007) Targeting EGFR in bladder cancer. World J Urol 25:573-579 6. Chithrani B D, Ghazani A A, Chan W C W (2006) Determining the Size and Shape Dependence of Gold Nanoparticle Uptake into Mammalian Cells. Nano Letters 6:662-668 7. Chen C H, Wu Y J, Chang H S W et al. (2010) Photothermal Therapy of Urothelial Cancer Using Anti-EGFR/au Nanoparticles, IFMBE Proc. vol 31, World Congress on Biomech. & Biomed. Eng., Singapore, 2010, pp 1185–1188 8. Kimling J, Maier M, Okenve B et al. (2006) Turkevich Method for Gold Nanoparticle Synthesis Revisited. J Phys Chem B 110:1570015707 9. Hirsch J D, Haugland R P (2005) Conjugation of Antibodies to Biotin. Humana Press, Totowa 10. Mahnke K, Qian Y, Knop J et al. (2003) Induction of CD4+/CD25+ regulatory T cells by targeting of antigens to immature dendritic cells. Blood 101:4862-4869 11. Xiao Z, McCallum T J, Brown K M et al.(1999) Characterization of a novel transplantable orthotopic rat bladder transitional cell tumour model. Br J Cancer 81:638–646
Author: Yi-Jhen Wu Institute: Institute of Biomedical Engineering, National Cheng Kung University Street: No.1 Daxue Rd. East Dist. City: Tainan 701 Country: Taiwan Email:
[email protected] IFMBE Proceedings Vol. 35
Nanobiosensor for the Detection and Quantification of Specific DNA Sequences in Degraded Biological Samples M.E. Ali1, U. Hashim1, S. Mustafa2, Y.B. Che Man2, and M.H.M. Yusop2 1
Institute of Nano Electronic Engineering (INEE), Universiti Malaysia Perlis, Kangar, Malaysia 2 Halal Products Research Institute, Universiti Putra Malaysia, Serdang, Malaysia
Abstract— A 27-nucleotide AluI fragment of swine cytochrome b (cytb) gene was integrated to a 3-nm diameter citrate-tannate coated gold nanoparticle to fabricate a species specific nanobiosensor. The biosensor was applied to authenticate pork adulteration in autoclaved pork-beef mixtures. The sensor was found to be sensitive enough to detect 0.5% and 1% pork in raw and 2.5-h autoclaved mixed samples in a single step without any separation or washing. The hybridization kinetics of the hybrid sensor was studied with synthetic targets from moderate to extreme target concentrations and a sigmoidal relationship was found. The kinetic curve was used to develop a convenient method for quantifying and counting target DNA copy number. The biosensor probe was hybridized with a target DNA that was several-folds shorter than a typical PCR-template. This offered the detection and quantitation of potential targets in highly processed meat products or extensively degraded samples where PCR-based identification technique might not work due to the degradation of comparatively longer DNA. The assay was a viable alternative approach of qPCR for detecting, quantifying and counting copy number of shorter size DNA sequences in degraded samples to address a range of biological problems such as food analysis, biodiagnostics, environmental monitoring, genetic screening and forensic investigations. Keywords— Species specific nanobiosensor, hybrid nanobioprobe, hybridization kinetics, sigmoidal relationship, synthetic oligo-targets.
I. INTRODUCTION Selective detection of specific DNA sequences is increasingly important to address a wide range of biological issues such as bio-diagnostics and genetics [1-3], food analysis [4] and forensics [5]. Over the recent years, multitudes of PCR assays are developed outlining the detection of species specific DNA sequences for meat and meat product authentication [4, 6-7]. Better stability, codon-degeneracy and universal tissue distribution are some of the factors that made DNA to be the analyte of choice [6-7]. The key region of choosing PCR as a preferred analytical tool is its extraordinary ability to amplify a selective segment of DNA from as little as single copy to easily detectable quantities and the consequent amelioration of sample purification processes [3].
However, the PCR process itself has some difficult-to control-limitations that often produces artifacts in the final results [6]. It also frequently produces cross-species amplification when shorter DNA target is used [6-7]. Hybrid bio-materials composed of functionalized nanoparticles, covalently linked to biomolecules such as peptides, proteins and polynucleotides, are spectracularly interesting for their size dependent properties and dimensional similarities to biomacromolecules [8-9].These nanobioconjugates are potential agents for multiplexed bioassays, materials synthesis, ultrasensitive optical detection and imaging, in vivo magnetic resonance imaging (MRI), longcirculating carriers for targeted drug release and structural scaffold for tissue engineering [8-10]. Thiol-capped gold nanocrystals (GNCs), covalently linked to fluorophore-lebeled olionucleotide through metalsulfur bond are shown to detect specific sequences and single-nucleotide mismatches [8-9]. However, such studies are limited to the laboratory level model experiments with synthetic oligo-targets. No studies so far explored the sequence and mismatch detecting power of the fluorophorelabeled-oligo-nanoparticle conjugates in heterogeneous biological samples. Hybridization kinetics of such nanobioconjugates is also need to be explored. In the current report, we have structurally and functionally integrated a 27-nucleotide segment of swine mitochondrial (mt) cytb gene to a 3-nm diameter citrate-tannatecoated gold nanocrystal to fabricate a novel class of species specific nanobiosensor to determine pork adulteration in raw and highly processed mixed meat specimens. Verification and quantification of pork adulteration in meat and meat products are important for Halal authentication, allergy and cholesterol related health issues and enforcement of accurate food labeling to protect consumer interests [4, 6-7].
II. MATARIALS AND METHODS A. Design of Swine Specific Oligo-Probes A 27-bp AluI fragment (429-455bp) of swine (Sus scrofa) cytb (GenBank # HM010474 in NCBI data base) was chosen
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 384–387, 2011. www.springerlink.com
Nanobiosensor for the Detection and Quantification of Specific DNA Sequences in Degraded Biological Samples
as a porcine specific marker. This fragment showed high degree of intraspecies similarities and interspecies dissimilarities by NCBI-BLAST analysis against nonredundant nucleotide collection and ClustalW alignment program. The probes were synthesized by IDT, USA, with suggested modifications as shown in Table 1. The synthetic targets (complementary, non-complementary and single-mismatch) were supplied by the 1st Base, Malaysia. Table 1 Oligonucleotide sequences used in the study Name Sequences (5ƍĺ3ƍ) Probe aTMR-A6CTGATAGTAGATTTGTGATGACCGTAG-A6(CH2)6SH Complementary target CTACGGTCATCACAA ATCTACTATCAG Non-complementary target ACGTAACTGCTGTGGCCTGGTCGCTGA Single mismatched target CTACGGTCATCACAAAT bTTACTATCAG a 6-carboxy tetra-methyl rhodamine, bmismatched base
B. Synthesis of Colloidal God Nanoparticles Small gold nanoparticles ((GNPs) were prepared according to bibliography [11].The colloidal sol was characterized by Hitachi 7100 transmission electron microscope and PerkinElmer Lamda 25 UV-vis spectroscopy. The average size of the particles was assigned to 3 ± 0.2 nm in diameter by measuring 500 particles. The approximate number and concentration of the particles were calculated according to Heiss et al [12-13] and were found to be 2.01 x 1011 NPS/µl and 335 nM. C. Preparation of Hybrid Nanobioprobes The custom made probes were mixed with GNPs in a ratio of 3:1 and the mixture was incubated overnight at 20°C in a shaking water bath. The oligo-conjugated particles were aged and purified according to Maxwell et al [8].The average number of attached oligo-probe per particle was also determined by 2-mercaptoethanol digestion following Maxwell and coworkers [8].
385
E. Specificity and Sensitivity in Mixed Biological Samples Separate aliquots of 100g of pork-beef binary admixtures were prepared by mixing fresh pork and beef in a ratio of 100:0, 50:50, 25:75, 10:90, 5:95, 1:99, 0.5: 99.5, 0.1:99.9 and 0:100 (w/w). The mixtures were autoclaved at 120°C for 2.5-h and DNAs were extracted from 100 mg sample in triplicates using MasterPureTM DNA Purification Kit (Epicentre Biotechnologies, Madison, USA) as per the protocol supplied by the manufacturer. The purity and concentration of extracted DNA samples were checked by Eppendorf UVvis Biophotometer (Eppendorf, Germany). The extracted total DNA (500 µg/ml) was digested with AluI (New England Biolabs, UK) restriction enzymes. The digestions were performed in a total volume of 1 ml, containing 600 µl of total DNA, 300 U of restriction enzymes and 100 µl of digestion buffer (New England Biolabs, UK) for 8-h at 37°C in a shaking water bath. The digestions were confirmed by electrophoresis on 3% agarose gel. The hybridization reaction was performed in a total volume of 2.5 ml in triplicates with 10 nM probes and 60 µg/ml of AluI digested mixed DNA. LOD of mixed sample was determined by incubating 10 nM hybrid probes with serially diluted AluI digested pork-beef DNA mixture for 60 min in a 2.5 ml reaction volume. F. Fluorescence Measurement The emission spectra were collected in 10-mm cuvette with 2-ml volume in PerkinElmer LS55 fluorescence spectrometer with excitation at 545-nm. Each spectrum was an average of 5-scan at the scan speed of 200 nm/min with 5-nm slit width. The background was subtracted by replacing sample with 2:1 ratio of 10 mM PBS and hybridization buffer. For the determination of LOD, a series of fluorescence spectra were obtained in triplicates and average fluorescence intensity at 579nm was plotted as a function of target concentration.
III. RESULTS AND DISCUSSION
D. Specificity and Sensitivity Tests An aliquot of the purified nanoparticle probes was diluted to 10 nM with hybridization buffer (90 mM KCl, 10 mM Tris, pH 8). To determine specificity, the probes were incubated with a 4-fold excess (60 nM) of complementary, non-complementary and single-mismatch targets (Table 1) at 70°C for 5 min to allow strand separation and then at 40°C for 30-60 min to allow hybridization. To determine the limit of detection (LOD), the 8-fold excess of complementary targets were serially diluted from 120 nM to 3.66 nM with hybridization buffer and were incubated for 60min with 10 nM nanoparticle probes.
A. Detection and Quantification Principle Earlier studies has shown that hybrid materials composed of single-stranded DNA (ssDNA) covalently linked to a small gold nanoparticle (2-3 nm in diameter) via sulfur-gold bond at one extremity and a fluorescent dye to the other, can assume two distinct conformations: (1) a constrained conformation with stem-loop or arch-like appearance before target binding and (2) a straight conformation with rodlike appearance after target binding. In the closed structure, the fluorophore and the GNP are held in close proximity and the fluorescence is quenched by non-radiative energy
IFMBE Proceedings Vol. 35
386
M.E. Ali et al.
transfer from dye to the metal. On the other hand, in the open state the fluorophore is thrown in far apart (>2 nm) from the metal particle and emits fluorescence [8-9]. Thus it can be assumed that the degree of fluorescence emission depends on the degree of target binding. The maximum fluorescence is observed when the probe is saturated with the targets and the base-line fluorescence is realized in the absence of any targets. Based on this assumption, a standard curve can be generated with known concentrations of probes and targets and the concentration of the unknown can be obtained by plugging the observed fluorescence in the standard curve. Fig. 2 Detection of specific DNA sequences and single nucleotide mismatches using swine specific nanobiosensor probes. From top to bottom are perfectly complementary (red curve); single nucleotide mismatch (green curve); non-complementary targets (pink curve) and freeprobe (blue curve) According to the latter group, low ionic strength hybridization buffer (90 mM KCl, 10 mM Tris, pH 8.0) more precisely differentiates perfectly matched and mismatched sequences at ambient temperatures. Although, the latter group achieved higher sensitivity, the gold particles they used were too small and unstable above 50°C. Using relatively more stable citrate-tannate coated GNPs with relatively large diameter and low ionic strength hybridization buffer [9] we achieved specificity which was higher than Maxwell et al [8] and close to Dubertret et al [9]. Fig. 1 Schematic presentation of quantification and operating principles of swine nanobiosensor probes B. Species Specificity of the Prepared Nanobiosensor The fluorescence spectra of 10 nM porcine nanobiosensor probes with 4-fold molar excess (60 nM) of complementary (red curve: top one), single-mismatch (green curve: 2nd from the top) and non-complementary targets (pink curve: 3rd from the top) are shown in Fig.3. Only base line fluorescence was observed with the non-complementary targets. However, single-mismatch targets produced 65-70% less fluorescence than that of the perfectly match targets. Thus it was clearly demonstrated that the fabricated nanobiosensor was highly specific in discriminating complementary, noncomplementary and single-mismatch sequences. Maxwell et al achieved 55% quenching with 2.5 nm diameter gold nanoparticle probes where gold nanoparticles were produced by reducing sodium borohydride [11]. Dubertret et al achieved 75% reduction in fluorescence with molecular beacon and 1.4 nm diameter gold nanocrystals [12].
C. Pork Detection in Mixed Biological Samples The fluorescence spectra 2.5-h autoclaved pork-beef binary admixtures in various percentages are shown in Fig.3.
Fig. 3 Pork detection in autoclaved pork-beef binary admixtures by swine specific nanobiosensor probes. From top to bottom are 100%, 50%, 25%, 10%, 5%, 1%, 0.5%, 0.1%, and 0% pork in pork-beef mixture. The base line fluorescence of the free probes was mixed with that of 0% pork
IFMBE Proceedings Vol. 35
Nanobiosensor for the Detection and Quantification of Specific DNA Sequences in Degraded Biological Samples
The swine specific biosensor probe clearly detected 1% (sky-blue curve: 6th from the top in Fig. 3) in extensively autoclaved pork-beef mixtures. This clearly reflected the high sensitivity and specificity of hybrid nanoparticle conjugates to trace out target DNA in food products processed by severe heat and pressure that are implicated to degrade DNA [6-7]. The higher sensitivity (0.5%) of the hybrid nanobioprobe was achieved in raw meat mixtures (not shown). This is probably due to the more available targets in unprocessed meat samples. Real-time PCR with less than 120 bp DNA template are reported to detect 0.1% adulteration in moderately sterilized game bird species [7]. However, PCR assays with shorter size template DNA are reported to produce artifacts results and cross-species amplification [6]. Moreover, PCR cannot use the template DNA as short as 27 bp which is used in this study. The size of the probe DNA used in this report is comparable to that of the primers used in PCR assays [4, 6-7]. Thus it is not possible to apply PCR assays in extremely degraded samples where the current method can be applied. D. Hybridization Kinetics and Target Quantification A plot of target DNA concentration versus fluorescence intensity at constant concentration of probe yielded a hyperbolic curve (Fig. 4). This reflected that at too low concentration of target (< 1/8 fold), probe-target interaction is too low to open the closed structure (Fig. 1) and at too high concentration of target (> 6 fold), the probe is saturated with the targets. Using a moderate concentration of targets (shown by blue circle) a linear curve was obtained with R2 = 0.995. Thus the curve was applied to quantify and calculate target DNA copy number in mixed samples.
Fig. 4 Standard curves of the hybridization kinetics of swine nanobiosensor probes with synthetic target. The probe to target copy number ratios are shown in each points. The linear part of the curve is shown in the inset
387
IV. CONCLUSIONS A convenient method for the detection, quantification and calculating copy number of target DNA in highly degraded mixed biological samples is developed by combination of biology and nanotechnology. We believe our approach will find application in food analysis, genetic screening, biodiagnostics and forensic investigation.
ACKNOWLEDGMENT This Research was supported by grants “RUGS No. 9031” to Prof. Y. B. Che Man and “MOSTI No. 05-01-35SF-1030” to Prof. U. Hashim.
REFERENCES 1. Rees J (2002) Complex disease and the new clinical sciences. Science 296: 698-701 2. Hood L, Galas D (2003) The Digital Code of DNA. Nature 421: 444448. 3. Li H, Rothberg LJ (2004) Label free colorimetric detection of specific sequences in genomic DNA amplified by polymerase chain reaction. J Am Chem Soc 126: 10958-10961 4. Che Man YB, Aida A A, Raha AR, Son R (2007) Identification of pork derivatives in food products using species specific polymerase chain reaction (PCR) for halal verification. Food Control. 18: 885-889 5. Butler JM (2005) Forensic DNA typing-biology, technology and genetics of STR markers. Elsevier Academic Press, USA. 2nd Edn. 6. Hird H, Chisholm A, Sanchez A, Harnandez M, Goodier R, Schneede K, Boltz C, Popping B (2006) Effect of heat and pressure processing on DNA fragmentation and implication for the detection of meat using a real-time polymerase chain reaction. Food Addit Contam 23 (7): 645-650 7. Rojas M, Gonzalez I, Pavon MA, Pegels N, Logo A, Harnandez PE, Garcia T, Martin R (2010) Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game bird. Food Addit Contam: Part A 27: 749-763 8. Maxwell DJ, Taylor JR, Nie S (2002) Self-assembled nanoparticle probes for recognition and detection of biomolecules. J Am Chem Soc 124: 9606-9612 9. Dubertret B, Calame M, Libchaber AJ (2001) Single-mismatch detection using gold -quenched fluorescent oligonucleotides. Nat Biotechnol 19 (4) : 365-370 10. Kurtis A, Wilkinson C (2001) Nanotechniques and approaches in biotechnology.Trends Biotechnol.19 : 97-101 11. Preparing colloidal gold for electron microscopy. Technical data sheet #787, Polyscience Inc. Rev: 002, Active: 09/Feb/2009. 12. Haiss W, Thanh NTK., Aveyard Ferning DG (2007) Determination of size and concentration of gold nanoparticles from UV-vis Spectra. Anal Chem 79: 4215-4224 13. Using UV-vis as a tool to determine size and concentration of spherical gold nanoparticles (SGNPs) (2008) Nanopartz Tech. note 801 * Corresponding author: Md. Eaqub Ali Institute: INEE, University Malaysia Perlis Street: Kangar-Alor Star, City: Kangar Country: Malaysia Email:
[email protected] IFMBE Proceedings Vol. 35
Polysilicon Nanogap Formation Using Size Expansion Technique for Biosensor Application T. Nazwa, U. Hashim, and T.S. Dhahi Institute of Nano Electronic Engineering (INEE) University Malaysia Perlis (UniMAP), Researcher, Perlis, Malaysia
Abstract— Nanobiosensor based on nanogap capacitor is widely used for measuring dielectric properties of DNA, protein and biomolecule. The purpose of this paper is to report on the fabrication and characterization polysilicon nanogap patterning using novelty technique. Overall, the polysilicon nanogap pattern was fabricated based on conventional lithographic techniques. For size expansion technique, by employing simple dry thermal oxidation, the couple of nanogap pattern has been expanded to lowest nanogap value. The progress of nanogap pattern expansion were verified by using SEM. Conductivity, resistivity and capacitance test were performed to characterize and to measure electrical behavior of full device fabrication.SEM characterization emphasis on the expansion of polysilicon nanogap pattern increasing with respect to oxidation time. Electrical characterization shows that nanogap enhanced the sensitivity of the device at the value of nano Ampere of current. These simple least-cost method does not require complicated nanolithography method of fabrication but still possible to serve as biomolecular junction. This approach can be applied extensively to different design of nanogap structure down to several nanometer levels of dimensions. A method of preparing a nanogap electrode according to the present innovation has an advantage of providing active surface that can be easily be modified for immobilizations of biomolecules. Keywords— Lateral nanogap, biosensor, Polysilicon, oxide semiconductor, conventional lithographic.
I. INTRODUCTION The present invention relates to a process of forming an electrode having a nanogap. A nanogap electrode means an electrode having a gap distance of about 1-100 nm. As a process of preparing a nanogap electrode comes out in recent years, new technology has been developed at a fast speed in the field of measuring and applying the characteristics of nano-tube, nano-particle, encountered nano-wire, or the like as well as materials having the size of nanometer scale, such as protein and DNA. Nanogap device can be employed to the measurement of whole range of biological recognition systems including other protein-biomolecule binding interactions and nucleic acid hybridization [6]. But, the capability of devices were hampered by the resolution limit and mechanical instabilities of commonly used electron –sensitive resists.
Measuring the electrical properties is become limited by the difficulties when trying to hook a single molecule and place it between two electrodes. At the nanometer level, the optimum size of nanogap achieved is depending on the material selection. Most of the invention of nanogap using metal as electrode that is required additional process like annealing to get desired pattern [1]. This requirement will add constraint in material selection for nanogap pattern. For thin metallic nanogap pattern, numerous properties need to be bothered including wetting behavior, recrystallization temperature and granulity. In recent years, there has been proposed a method of forming a nanogap or angstrom (Å) gap by means of mechanical break junction [2]. But these methods are only practical for a method of forming a very narrow gap of about 1~5 nm, but still complicated to prepare a nanogap having the range of 4-100 nm. Moreover, these methods are not easy to be commercialized due to its low reproducibility and it is impossible to prepare an arbitrary-shaped nanogap or multiple nanogaps. On the other hand, a method of forming a nanogap electrode on a semiconductor substrate by wet-etching of a mesa structure is publicly known [3]. These methods however, cannot be a cost-effective and it is very difficult to prepare the nanogap of 100 nm or less due to the restriction of its process when the conventional semiconductor process technologies are used. Most of the methods of preparing a nanogap electrode by employing the metallic pattern is formed by electron beam lithography, photo lithography, X-ray lithography, and printing method [7]. But most of the methods are very complicated and hard to control. By the aid of development in modern chemistry, the expectation to get electrical function for one molecule with desired electrical function is reasonable. A number of methods for fabricating nanogap electrodes have already been established. But our goal is to develop a least-cost method of fabrication that can be applied in batch production. This method is introduced and compared to get better finding of the technique. The inspection of the nanogap pattern will be done by using JEOL SEM observation. Further characterization of full device in terms of resistivity, capacity and permittivity has been analyzed by using Semiconductor Parameter Analyzer (SPA), Spectrum analyzer, IV-CV Station.
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 388–392, 2011. www.springerlink.com
Polysilicon Nanogap Formation Using Size Expansion Technique for Biosensor Application
II. EXPERIMENTAL A. Fabrication Process Prior to fabrication process, silicon substrates (100) 4 inch size need to be all set. Before applying further process onto wafer, some properties like thickness (Si thickness) and sheet resistance have been checked. The silicon substrates were cleaned and rinsed with de-ionized water. The proper wet cleaning of substrates were done by using RCA1 at 75’C to reduce undesirable particles, organic particle ,metal ion complex lying on the wafer. The deposition of Si3N4 were employed by using Plasma-enhanced chemical vapor deposition (PECVD).Plasma nitrides always contain a large amount of hydrogen which provides the enhancement in electrical conductivity, stability and mechanical stress of thin layer of wafer. By using low pressure chemical vapor deposition (LPCVD) machine, about 400 nm layer of polysilicon has been deposited on top of nitrate film at 400’C with 80 sccm silane gases supplied. The thickness of polysilicon is designed to be thicker to bear the loading of compression stress from Aluminium deposition plus to increase the value of capacitor. Theoretically, for every 1µm of SiO2 grown, about 0.46 µm of silicon is consumed. The thickness required to support the expansion of nanogap pattern were initially estimated based on kinetics of thermal oxidation principles. It is estimated that for every 1µm of SiO2 grown, about 0.46µm of silicon is consumed (Ruska 1987). Each layer thickness of deposition was checked by Spectrophotometer and Hawk 3D Nanoprofiler. Aluminium is required to be deposited about 150nm by using thermal evaporator machine. For further reason, aluminium was acting as a hard mask to bear the inflexible ion bombardment during poly-silicon RIE process. Then, for the conventional photolithography process, a positive photoresist were coated onto the flat surface of the substrates. The thickness could be estimated by adding 3 drops of photoresist (PR12000A) can provide about 1000nm. During photolithography process, the substrates were exposed to 10s through mask 1 shown in fig. 1(b). After development, aluminium layer was removed in the alum etch medium. The substrates were soft baked for 20s to remove the residue solvent used in the development. A permanent pattern is thus were created in the substrate after the removal of photoresist step by using acetone. Polysilicon nanogap pattern on the substartes were dry etched by using RIE recipe of 50sccm of SF6 , 10sccm of O2 ,1.0Pa of pressure, 250 bias and etch for 10s.Then, completely etched the aluminium by using alum etches to get final pattern of nanogap structure. The dry
389
oxidation were carried out at 1000 ‘C for different time ranging starting from 40mins until the oxidation growth were stop. The polysilicon nanogap patterns were expanded to the closest gap size. Same procedures were applied to fabrication of pad using mask 2 in fig.2. The Ti/Au will be deposited about 60nm and 100nm respectively. By using another pad chrome mask, photolithography process was employed to produce the Ti/Au pad for electrical characterization of nanogap electrodes.
(a)
(b)
(c)
(d)
Fig. 1 (a) Design specification of the mask 1 (b) Schematic design of mask 1- shows the actual arrangement of device design on chrome mask which consist of 160 dies with 6 different designs. Design is having no gap. (c) Design specification of the mask 2 (d) Schematic design of mask 2
Fig. 2 Process flow; (a) Starting Material, (b)Deposit Si3N4, (c)Deposit poly-silicon, (d) Deposit Al, (e) Resist coating, (f) Soft bake, (g) Exposure mask, (h) Develop resist (i) Poly-silicon RIE, (j) Alum etch and stripe resist, ion(k) Dry oxidation, (l) Poly-silicon nanogap pattern with pad Pt/Au fabrication( Electrical checking of the device can be performed on the fabricated pad)(Repeat step (a) to (j) for mask 2). Fig. 3 shows the circuit after serial impedance is measured, a simple resistor model is developed representing the substrate and polysilicon layer. The capacitor also found in series to describe the device with no liquid test
IFMBE Proceedings Vol. 35
390
T. Nazwa, U. Hashim, and T.S. Dhahi
RTOTAL=RSUB+RPOLYSILICON +RTI +RAU
CGAP
(a) (a)
CSAMPLE
(b) Fig. 3(a) Lumped-element model of dry nanogap electrodes;(b) (b)
Lump-element model of spacer and gap
III. RESULTS Polysilicon is chosen as a pattern because it is known to be compatible with high temperature processing and interfaces very well with thermal Si3N4. Complete conversion of microgap down to lower nanogap profile width can be reliable by adding some simple technique. In this project, conventional photolithography with combination of dry thermal oxidation is proposed to transform from 3.13 µm to 42nm. This technique, include experimentally, thermal expansion of nanogap can enlarge the nanogap pattern so the optimum nanolevel gap can be achieved. The initial dimension of chrome mask is 3.73 µm. After photolithography taken place, the sizes were photolithographically reduced to 3.13µm .When the layer thickness increased, the coupling effect of diffusion and chemical reaction became dominant and the growth of the layer of oxide became nonlinear. The polysilicon patterns were expanded and caused the nanogap to reduce to 2.57µm after 2 hours oxidation. Owing to the nature of oxidation process, the nanogap keeps on expanding during dry thermal oxidation. After completing 7 hours oxidation time, rapid expansion of polysilicon nanogap pattern up to 42nm is acquired after six times oxidation accomplished. Further increasing the oxidation time does not lead to any expansion of nanogap pattern. This means that, after 7 hours oxidation, the polysilicon layer is completely oxidized. By indicating the trend of oxide growth with respect to time, the expansion of nanogap can be easily controlled to the maximum oxide growth.
(c)
(d)
(e)
Fig. 4 SEM image of poly-silicon pattern after dry oxidation for (a) 1 hour (b) 2 hours (c) 3 hours (d) 4 hours (e) 5 hours (f)6 hours (g) 7 hours (sample 1)
IFMBE Proceedings Vol. 35
Polysilicon Nanogap Formation Using Size Expansion Technique for Biosensor Application
391
RTOTAL CAIR
(f)
Fig. 5 (C-F) characterization for dry nanogap device (sample 1) (g)
Fig. 4 (continued)
IV. DISCUSSIONS Fig. 5 demonstrates the electrical characterization that has been carried out to check the performance of device. In fig. 4(a), the Capacitance–Frequency (C–F) characterization of nanogap by connecting a two-point probe method were done by using a Keithley 4200 semiconductor characterization system. Experiments were performed for dry measured capacitance for typically by sweeping frequencies from 1 Hz to 1 MHz at room temperature with 30 MV input signal(0 V,DC, Offset ). The results were indicated that the device is very stable. The model is accurate for100 Hz to 100 kHz but deviates at very low and high frequency. Further increasing the value of frequency were not lead to the increasing of the capacity and remain stable until the frequency reach to 100 kHz, then capacitance was increased rapidly similar to electrical behavior that was to be seen with the frequency increasing and the permittivity staying almost stable until it reached the frequency value of 100 kHz, then the permittivity increased rapidly, and by physical view we can confirm that the conductivity between the gap is almost non-existent. To understand metal-oxide-semiconductor (MOS) Capacitor CV curves, a high frequency (HF) CV curve for an n-type semiconductor substrate is illustrated in Figure 8. A CV curve can be divided into three regions: accumulation, depletion, and inversion. Each of the three regions is described for an n-type complementary MOS (CMOS). This application is conducted using the Keithley Model 4200-SPAS to make C-V measurements.
Fig. 6 The CV curve of a-Si micro-gap structure Figure 6 shows the accumulation region for an n-type CMOS when applied with a negative voltage. A C-V test has measured the nanogap capacitance in the strong accumulation region, where for an n-type MOS-C, the voltage was positive enough that the capacitance remains constant, and the CV curve slope is flat. The oxide thickness can be extracted from the oxide capacitance. However, the CV curve for a very thin oxide often cannot “saturate” to a flat slope. As the electrode voltage moved toward the negative values, the CMOS started to differ from the parallel-plate capacitor. Roughly at the point where the electrode voltage became negative, the following occur. The negative electrode were electrostatically repelled the electrons from the substrate- tooxide/well-to-oxide interface. A carrier-depleted area forms beneath the oxide, creating an insulator. (The absence of freemoving charges distinguishes an insulator from a conductor). As a result, the HF-CV analyzer measures two capacitances in series: the oxide capacitance and the depletion capacitance. As the electrode voltage becomes more negative, the following occur. (i) The depletion zone penetrates more deeply into the semiconductor. (ii) The depletion capacitance becomes smaller, and consequently, the total measured capacitance becomes smaller. Therefore, the CV curve slope is negative in the depletion region.
IFMBE Proceedings Vol. 35
392
T. Nazwa, U. Hashim, and T.S. Dhahi
In the third region, for an n-type CMOS, as the electrode voltage decreased beyond the threshold voltage, dynamic carrier generation and recombination move toward the net carrier generation. The negative electrode voltage both generates electron-hole pairs and attracts the minority carriers toward the electrode. Again, because the oxide is a good insulator, these minority carriers accumulated at the substrate- to-oxide/well-to-oxide interface. The accumulated minority-carrier layer is called the inversion layer because the carrier polarity is inverted. Above a certain negative electrode voltage, most available minority carriers are in the inversion layer, and further electrode-voltage decreases do not deplete the semiconductor further. That is, the depletion region reaches a maximum depth. The Keithley 4200 SPA has built-in support to control external IV analyzers used to provide more clarification and to offer a more rigorous examination of a-Si micro-gap material. The IV resistance curve in Figure 7 shows that the resistance derived is high (RES=4.13891e009ohm); therefore, it behaves as an insulator due to the lack of voltage.
Fig. 7 IV capacitor curve of the nanostructure For the polysilicon nanogap structure, as the electrode voltage moves toward the negative values, the CMOS starts to differ from the parallel-plate capacitor. Roughly, at the point where the electrode voltage is applied, a constant current is passed through the unconnected nanogap. This current is held constant, which forms a micro-gap due to the isolation of the electrode from another and the linear curve is clear between the applied voltage and current for the capacitor.
V. CONCLUSIONS The methods to fabricate and characterize nanogap were demonstrated. Two chrome masks are used to fabricate this micro-gap, where polysilicon material is used to pattern the gap. The electrical characterizations in this research were done by using Semiconductor Parameter Analyzer (SPA), Spectrum Analyzer, IV-CV Station for electrical characteristic, Conductivity, resistivity and capacitance tests are performed to
characterize and check the structure of the device, which resulted in a small micro-gap as was revealed by further I-V curve results that showed a current in nano-amps. These devices are not just have the potential to serve as biomolecular junctions because their size reduces electrode polarization effects regardless of frequency but still can maintain the bioactivity during characterization of the biomolecules.
ACKNOWLEDGMENT We are grateful for fruitful discussions with our collaborators at the Institute of Nano Electronic Engineering (INEE) at University Malaysia Perlis (UniMAP). This work was supported by INEE at UniMAP, through the Nano Technology project. The views expressed in this publication are those of the authors and do not necessarily reflect the official view of the funding agencies on the subject.
REFERENCES 1. R.Somenath ,Z.Gao (2009), Nanostructure-based electrical biosensors, Journal of Nano today 4,pp.318-334 2. H. Spelthahn, A.Phogossian & M. J.Schoning (2009), Self-alligned nanogaps and nanochannels via conventional photolithography and pattern-size reduction technique. Journal of Eletrochemica Acta 54, pp.6010-6014 3. F.Favier (2009), Nanogaps for sensing. Journal of Procedia Chemistry 1,pp. 746-749 4. C.Xiang, J.Kim & R.Penner.(2009), Reconnectable Sub-5nm Nanogaps in ultralong Gold nanowires,. Nano Lett.,9 (5) pp.2133-2138 5. N.Bastianon,(2004)Fabricating Nano-gap Metal Electrodes using photolithography,NNIN REU.pp.22-24 6. C.Tsai.,T.Chang, C.Chen, F.Ko. &P.Chen,(2005),An ultra sensitive DNA detection by using gold nanoparticle multilayer in nanogap electrode, Journal of Microelectronic Engineering 78-79,pp. 546-555 7. M.Yi,K.Jeong,& P.Lee (2005),Theoretical and Experimental study towards of nanogap biosensor, Journal of Biosensor and Bioelectronics 20,pp.1320-1326 8. D.Carlo, H.Kang, X.Zeng, K.Jeong & P.Lee,(2003) Nanogap –based dielectric immunosensing, Transducer 03T,the 12th International Conference on Solid State Sensors, Actuators and Microsystems,Boston,June 8-12,2003,pp.1180-1183 9. H.Kageisima,M.Uematsu,K.Akagi,S.Tsuneyeki,T.Akiyama, & T. Siraishi(2006);Mechanism of oxide deformation during silicon thermal oxidation,Journal of Pysica B 376-377,pp. 407-410 10. C.Kao, W.H.Sung & C.S.Chen (2008); Investigation of te doping thickness effects of polysilicon oxide by rapid thermal N20 oxidation, Journal of Microelectronic Engineering 85,pp408-413 11. E.Lee & J.Roh (1991); Effect of wet oxidation on the electrical properties of sub 10-nm thick silicon nitride films, Journal of tin solids film,2005,pp. 246-251 12. T.Tanii,T.Hosaka,T.Miyake,G.Zhang,T.Zako,T.Funatsu & I.Odomori (2005);Prefential immobilization of biomolecules on silicon microstructure array by means of electron beam lithograpy on organosilane self-assembled monolayer resist, Journal of Applied Surface Science,234,pp102-106 13. F.Bordi, C.Cametti & T.Gili( 2001); Reduction of the contribution of electrode polarization effects in the radiowave dielectric measurements of highly conductive biological cell suspensions, Journal of Bioelectrochemistry, 54(2001),pp.53-61
IFMBE Proceedings Vol. 35
A Modified Beer-Lambert Model of Skin Diffuse Reflectance for the Determination of Melanin Pigments A.F.M. Hani1, H. Nugroho1, N. Mohd Noor2, K.F. Rahim2, and R. Baba2 1
Centre for Intelligent Signal and Imaging Research, Universiti Teknologi PETRONAS, 31750 Tronoh, Malaysia 2 Dermatology Department, Hospital Kuala Lumpur, 50586 Kuala Lumpur, Malaysia
Abstract— In skin care industry and dermatology, analysis of human skin tone is an important parameter for evaluating the current condition of the skin. Research has shown that the human skin tones are due to the combination of skin chromophores (pigments) such as melanin, haemoglobin, bilirubin and beta-carotene. Several works on skin modelling have been reported but none has been specifically developed to classify and measure types of melanin. In this research, the spectral responses of different human skin phototypes are investigated for melanin pigment (pheomelanin and eumelanin) analysis. We propose skin pigmentation model based on a modified Beer-Lambert model of skin diffuse reflectance to measure types of melanin. A clinical study involving 118 participants with different skin phototypes (SPTs) is conducted where the skin reflectance data of participants are measured using Spectrophotometer Konica Minolta 2600c. Applying the data to the proposed skin model, it was found the pheomelanin concentration is -4.6E5± 5.4E-6 moles/l for SPT III, -5.9E-5±6.4E6 moles/l for SPT IV, and -8.2E-5±9.8E-6moles/l for SPT V and the eumelanin concentration is 9.7E-5±7.3E-6 moles/l for SPT III, 1.2E-4±1.03E-5 moles/l for SPT IV, and 1.6E-4±1.7E-5 moles/l for SPT V. Results show that proposed model can be used for pigmentation analysis to measure melanin pigments types in skin. Keywords— skin chromophores, melanin, pheomelanin, eumelanin, modified Beer-Lambert law.
skins. Pheomelanin gives rise to the pinkish to reddish colours in human skin while eumelanin gives rise tobrownish and blackish colours. Skin choromophores such as haemoglobin are found in blood. There are two types of haemoglobin; oxygenated and deoxygenated haemoglobin. In the arteries, 90-95% is oxygenated haemoglobin, and in the veins, only 47% of the haemoglobin is oxygenated [Meglinsky, 2003]. Several works on skin modelling have been reported and generally they can be categorised into deterministic and non deterministic approaches. A. Deterministic Approaches Anderson [Anderson, 1981], Wan [Wan, 1981], Diffey [Diffey, 1983], Cotton [Cotton, 1996] and Doi [Doi, 2003] used Kulbelka-Munk (K-M) model to compute absorption and scattering coefficients of incident light in skin tissues. Another approach is based on multi spectral imaging. One of these approaches, called Spectrophotometric Intracutaneous Analysis (SIA) is used for early identification of malignant melanoma in human skin [Moncrieff, 2002]. Another approach is based on spectrophotometer. Weather [Weather, 1989] and Dwyer [Dwyer, 1998] reported a high correlation between spectral data of a specific light spectrum obtained from spectrophotometer and concentration skin chromosphores (melanin and haemoglobin).
I. INTRODUCTION In skin care industry and dermatology, analysis of human skin tone is an important parameter for evaluating the current condition of the skin. Research has shown that the human skin tones are due to the combination of skin chromophores (pigments) such as melanin, haemoglobin, bilirubin and beta-carotene [Buxton, 2003]. Tsumura however proposed that skin tone is mainly determined by melanin in the epidermal layer and haemoglobin in the derma layer [Tsumura, 2008]. Melanin is produced by melanocytes. Melanin has different two components namely, pheomelanin (reddish skin appearance) and eumelanin (brownish skin appearance) [Diffey, 1983]. Eumelanin is more abundant in people with dark skin. Pheomelanin is found in both light and dark
B. Non Deterministic Approaches One of the non deterministic approaches is the Monte Carlo method. Prahl proposed a Monte Carlo based algorithm to model light transport in tissue during laser radiation [Prahl, 1989]. Wang extended the simulation to model light transport in multi layered tissue [Wang, 1995]. Both studies are fundamental for the analysis of skin using Monte Carlo simulation. The other non deterministic approach is the Independent Component Analysis (ICA). Tsumura [Tsumura, 1999] separated the spatial distribution of melanin and haemoglobin by employing linear independent component analysis of a skin colour image. Ahmad Fadzil et al. [Ahmad Fadzil, 2009] reported that they able to measure repigmentation correctly in vitiligo cases.
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 393–397, 2011. www.springerlink.com
394
A.F.M. Hani et al.
In general the above methods can be used to characterise the structure and properties of skin. However they do not classify nor measure in detail the types of melanin (eumelanin and pheomelanin) which is important in understanding the underlying causes of skin pigmentation disorder. In this research, the spectral reflectance of human skin will be applied to a proposed pigmentation model in order to analyse and measure the melanin content (pheomelanin and eumelanin) for use in clinical assessment of skin pigmenation disorders.
II. SKIN PIGMENTATION MODEL FOR MELANIN PIGMENTS
Askin (λ ) = ε eumelanin (λ )C eumelanin I eumelanin (λ ) +
ANALYSIS
Wang and Steven L. Jacques reported a Monte Carlo simulation of light transport in multi-layered tissue (MCML) that it is still used nowadays as the state of art of skin optics simulation [Tsumura, 2008]. The MCML program constitutes the following operations for photons:- (1) Photon launching, (2) generating the propagation distance, (3) moving the photon, (4) internal reflection, (5) photon absorption, (6) changing photon direction by scattering, (7) calculating observable quantities such as diffuse reflectance and specular reflectance. This forward model is iteratively used in the inverse optical scattering techniques to obtain the skin quantitative values of pigmentation from the measured diffuse reflectance. However, the Monte Carlo skin analysis requires a great deal of computation time to perform the inverse optical scattering calculation. Shimada proposed a simple analytical model based on modified Beer-Lambert Law for an inhomogeneous scattering medium [Shimada, 2001]. The absorbance, A, is defined from the reflectance, R, of the skin which is considered to be a semi-infinite medium. A = − log10 R (1) The absorbance, A of a homogeneous scattering medium, with molar absorption and molar concentration are ε and C, can be calculated as follows, A = εC l (C ) + G
m
∑ Ai (λ ) + G (λ ) i =1
A(λ ) =
(3)
m
∑ ε (λ )C l (C , … , C i
i =1
i i
1
ε pheomelani n (λ )C pheomelani n I pheomelani n (λ ) +
ε oxy − haemoglobi n (λ )C oxy − haemoglobi n I oxy − haemoglobi n (λ ) + ε deoxy − haemoglobi n (λ )C deoxy − haemoglobi n I deoxy − haemoglobi n (λ ) + ε beta − carotene (λ )C beta − carotene I beta − carotene (λ ) + ε biliribin (λ )C bilirubin I bilirubin (λ ) + A0 (λ ) A0 (λ ) = A0' (λ ) + G (λ )
m
, λ ) + G (λ )
(4) (5)
where A0 (λ ) is the absorbance of skin base.
III. CLINICAL STUDY A baseline clinical study is conducted to analyse melanin pigmentation for participants with no skin pigmentation disorder of different skin phototypes (SPT) using on Fitzpatrick classification as shown in Table 1. Based on Fitzpatrick skin phototype (SPT) classification, it accepted that:i. Asians generally have skin types III, IV and V. ii. Caucasians generally have skin types I and II, and iii.Africans and South Asians generally have skin types VI. Table 1 Fitzpatrick Skin Phototype (SPT)
(2)
,
where G and l (C ) are scattering loss and mean path length, respectively. For an inhomogeneous scattering medium, the absorbance, A for each wavelength proposed by Shimada [13] is given as follows
A(λ ) =
where the subscript, i, refers to the ith chromophore. l i (λ ) is the path length in the area in which the ith chromophore is distributed. l i (λ ) depends on not only Ci but also C1, . . . , Cm, but the effects of Cj (j≠ i) are small. The path length in the area where plural chromophores exist is considered as path length of both chromophores. l i (λ ) and G(λ) vary with wavelength λ because the scattering coefficients are different at each λ. Skin has 4 types of pigments, eumelanin, pheomelanin, beta-carotene and bilirubin. It can be formulated as follows,
SP T I II III
Unexposed Skin Colour White White White
IV V VI
Light brown Brown Dark brown
Sun Response History Always burns, never tans Always burns, tans minimally Burns minimally, tans gradually and uniformly Burns minimally, always tans well Rarely burns, tans darkly Never burns, tans darkly
In the clinical study, the classification of the study population (SPT III, IV and V) is determined from the L*a*b
IFMBE Proceedings Vol. 35
A Modified Beer-Lambert Model of Skin Diffuse Reflectance for the Determination of Melanin Pigments
values of the buttock based on Lee Yin Yin [Lee Yin Yin, 2009]. Standard classifications of SPT are based on interview and judgment of physician. Lee Yin Yin reported a relationship between L*a*b values and SPT classification. She computed means of L*a*b values of SPT III, IV and V using K-means clustering method. We classify participant based on their nearest Euclidean distance computed from their L*a*b values and Dr Lee’s mean values. This approach to obtain the SPT classification is used due to its objectiveness. The process flow of the study protocol is shown in Figure 1 below. Participant
395
SPT Distribution 56 41
21
0 SPT I
0
0 SPT III
SPT III
SPT IV
SPT V
SPT VI
Fig. 3 SPT Distribution Figure 4 shows the spectral reflectance data of SPT III, IV and V participants.
Sign informed consent f orm Spectral Reflectance
Data samples of Buttocks obtained using Spectrophotometer
60 SPT III SPT IV
50
SPT V 40 Intensity
Spectral analysis of skin ref lectance data
Melanin pigmentation analysis
30 20 10
Fig. 1 Process Flow of Study Protocol
0
For each participant, we obtained their spectral reflectance data using spectrophotometer Konica Minolta 2500 C and apply the proposed skin model to obtain the pheomelanin and eumelanin concentration.
IV. RESULTS AND ANALYSIS Spectral reflectance data of 118 participants (22 females and 96 males) were measured in the study. Figure3 show the participant distribution based on ethnic origin.
350
450
550
650
750
Wavelength
Fig. 4 Spectral Reflectance Data of SPT III, SPT IV and SPT V Participants As seen from Figure 4, it is observed that the spectral reflectance curves of SPT II, SPT III and SPT IV are clearly differentiated. Using multiple linear regression analysis (Eq. 5) obtained from the proposed skin pigment model, we can estimate the concentration of pheomelanin and eumelanin. Figures 5 and 6 show the estimated pheomelanin and eumelanin from each participant.
Ethnic Origin 4% 2% 4%
4%
62%
Pheomelanin
African
15% 9%
Arabic
0.00E+00
Cambodian
-1.00E-05 2
Caucasian Chinese
-2.00E-05
Indian
-3.00E-05 moles/l
Malay
Fig. 2 Ethnic origin distribution
3
4
5
-4.00E-05 -5.00E-05 -6.00E-05 -7.00E-05 -8.00E-05
The SPT distribution is shown in Figure 3; 21 participants with SPT III, 56 with SPT IV, and 41 with SPT V. Note that no participants in SPT I, II and VI categories were available at the time of study. IFMBE Proceedings Vol. 35
-9.00E-05 -1.00E-04
SPT
Fig. 5 Estimated concentration of pheomelanin
6
396
A.F.M. Hani et al. Eumelanin 2.00E-04
moles/l
1.50E-04 1.00E-04 5.00E-05 0.00E+00 2
3
4
5
6
SPT
moles/l for SPT III, 1.2E-4±1.03E-5 moles/l for SPT IV, and 1.6E-4 ±1.7E-5 moles/l for SPT V. As reported from other researchers, higher pheomelanin concentrations and lower eumelanin concentrations are expected in lower SPT. The melanin pigmentation analysis from this study is in concurrence with previous findings of skin melanin pigment for different skin phototypes. Thus, the proposed skin model can be used to infer melanin pigments namely pheomelanin and eumelanin concentration from spectral reflectance data of skin.
Fig. 6 Estimated concentration of eumelanin Experiment performed by Vincensi et al (Vincensi, 1998) indicated that increasing skin pigment (SPT I to VI) correlates with changes in pheomelanin/melanin production ratios among SPT. Lower SPT will have higher pheomelanin and lower eumelanin production ratio. From Figures 5 and 6, it can be seen that the data obtained confirms that the model can be used to estimate the concentrations of pheomelanin and eumelanin in skin. Table 2 shows the mean +/- standard deviation values of pheomelanin and eumelanin concentration for the various SPT participants. Table 2 Mean±SD of Pheomelanin and Eumelanin Concentrations in skin phototypes Melanin Pheomelanin Eumelanin
SPT III (moles/l)
SPT IV (moles/l)
SPT V (moles/l)
-4.6E5± 5.4E-6
-5.9E-5 ±6.4E-6
9.7E-5 ±7.3E-6
1.2E-4 ±1.03E-5
-8.2E-5 ±9.8E6 1.6E-4 ±1.7E-5
The pheomelanin concentration decreases as the SPT increases and the eumelanin increases as the SPT increase. A negative value of pheomelanin indicates negative contribution to the overall absorption process.
V. CONCLUSION In this paper, we have developed a skin pigmentation model for melanin pigment (eumelanin /pheomelanin) analysis. The proposed model is based on modified Beer-Lambert law of skin reflectance model. Clinical study involving 118 participants with three different skin phototypes (SPTs) is conducted. In the study, it was found that the pheomelanin concentration is -4.6E5±5.4E-6 moles/l for SPT III, -5.9E5±6.4E-6 moles/l for SPT IV, and -8.2E-5±9.8E-6 moles/l for SPT V) and the eumelanin concentration is 9.7E-5±7.3E-6
ACKNOWLEDGMENT The research work is a collaborative work between Universiti Teknologi PETRONAS and Hospital Kuala Lumpur. The authors would like to thank the assistance of Romuald Jolivot from University of Burgundy in the data collection.
REFERENCES ff
1. Paul Buxton (2003) ABC of Dermatology, BMJ Publishing 2. Tsumura N, Kawazoe D, Nakaguchi T et al. (2008) Regression-Based Model of Skin Di use Reflectance for Skin Color Analysis. Optical Review Vol. 15 No.6:292:294. 3. 3. Diffey, B. (1983) A mathematical model for ultraviolet optics in skin. Physics in Medicine and Biology 28: 647–657 4. Meglinsky, I. ,and Matcher, S. (2003) Computer simulation of the skin reflectance spectra. Computer Methods and Program in Biomedicine 179–186. 5. Anderson, Parish. (1981) The optics of human skin. Journal of Investigative Dermatology 1981: 13-19 6. Wan, Anderson and Parish J. (1981) Analytical modeling for the optical properties of the skin with in vitro andin vivo applications. Photochemstry and Photobiology , 1981: 493–499 7. Cotton, S and Claridge, E. (1996) Developing a predictive model of skin colouring. SPIE vol. 2708: 814-825 8. Doi M and Tominaga S. (2003) Spectral estimation of human skin color using the Kubelka-Munk theory, Proc. SPIE 5008, 221; doi:10.1117/12.472026 9. Moncrieff M, Cotton S, Claridge E et al. (2002) Spectrophotometric Intracutaneous Analysis: a new technique for imaging pigmented skin lesions , British Journal of Dermatology 2002:448–457 10. Weather JW, Saffar MH, Leslie G, et al. (1989) A portable scanning reflectance spectrophotometer using visible wavelength for the rapid measurement of skin pigments. Physics in Medicine and Biology 1989 11. Dwyer T, Muller HK, Blizzard L et al. (1998) The use of spectrophotometry to estimate melanin density in Caucasian . Cancer Epidemiology, Biomarkers and Prevention 1998:203-206. 12. Prahl S, Keijze M, Jacques S, et al. (1989) A Monte Carlo model of light propagation in tissue. SPIE Institute Series 5 1989:102-111. 13. Wang L, Jacques S,and Zheng L. (1995) MCML – Monte Carlo modelling of light transport in multi-layered tissues. Computer Methods and Programs in Biomedicine, 1995 14. Tsumura N, Haneishi H, Miyake Y. (1999) Independent component analysis of skin colour image. J. of Optic. Soc. of Am A 1999: 21692176.
IFMBE Proceedings Vol. 35
A Modified Beer-Lambert Model of Skin Diffuse Reflectance for the Determination of Melanin Pigments 15. Ahmad MH, Norashikin, S., Suraiya, HH. and Nugroho, H. (2009) Independent component analysis for assessing therapeutic response in vitiligo skin disorder. Journal of Medical Engineering Technology 2009:101-109 16. Shimada M, Yamada Y, Itoh M, et al. (2001) Melanin and blood concentration in human skin studied by multiple regression analysis: assessment by Monte Carlo simulation. Physics in Medicine and Biology 2001:2397–2406
397
17. Lee Yin Yin. (2009) Measurement of Skin Photo Type, Advanced Master of Dermatology Thesis, Bangi: UKM, 2009. 18. Vincensi MR, d’Ischia M, Napolitano A, Procaccini EM, et al. (1998) Phaeomelanin versus eumelanin as a chemical indicator of ultraviolet sensitivity in fair-skinned subjects at high risk for melanoma: a pilot study. Melanoma Res 8:53–8
IFMBE Proceedings Vol. 35
A Review of ECG Peaks Detection and Classification T.I. Amani1, S.S.N. Alhady1, U.K. Ngah1, and A.R.W. Abdullah2 1
Imaging and Computational Intelligence Group (ICI), Universiti Sains Malaysia, School of Electrical Electronics Engineering, 14300, Nibong Tebal, Seberang Prai Selatan, Pulau Pinang, Malaysia 2 Universiti Sains Malaysia, Pediatric Department, 16150, Kubang Kerian, Kelantan, Malaysia
Abstract— This paper describes several methods used in identifying peaks of Electrocardiogram (ECG) signals. Precise recognition of ECG peaks will provide useful information for doctors to diagnose any heart disorder or abnormalities as well as for cardiac arrhythmias classification. Generally, several methods have been applied in detecting real ECG peaks. These include template matching, wavelet transform, fuzzy logic and neural network. A review based on technical works, experimental testing and investigation from experts, researchers and professionals have been carried out to analyze the techniques in terms of accuracy and suitability for ECG analysis. In addition, this paper summarizes details of technical works done by others based on their respective methods. As a result, neural network is proposed for future ECG implementation systems due to its unique characteristics even though some limitations of the network might also be inherent. Keywords— Fuzzy logic, wavelet transform, template matching and neural network.
I. INTRODUCTION Heart diseases are the major killer that causes mortality all over the country [1], [2]. This dire situation has initiated serious attention action from scientists, technical expertise and health care professionals. Much efforts have been invested in implementing various technologies for heart disorder diagnosis to enable doctors recognize earlier symptoms of heart problems for further assistance. An electrocardiogram (ECG) system provides signals containing useful information to doctors. Several cardiac arrhythmias could be easily identified when abnormalities of ECG signals are observed. Generally, normal healthy ECG signals have P, Q, R, S and T waves with standard measurement values and these could be different in terms of features or morphological attributes for abnormal ECG signals [3]. A review has been done which summarized methods used in ECG analysis and peaks detection. The methods found to be involved are fuzzy logic, wavelet transform, template matching and neural networks.
II. ECG ANALYSIS TECHNIQUES A. Fuzzy Logic Fuzzy logic is multi valued logic which means it is not limited to specific values or numbers. In contrast to Boolean logic which possessed logic 0 and 1, fuzzy logic not only has logic 0 and 1 but it is also accommodates values in between them. Using the fuzzy methods, it is easy to check, modify, add or delete any fuzzy variables whenever it is necessary to obtain better automated analysis. Due to this factor, it has also been extensively used in cardiac arrhythmias classification such as Left bundle branch block (LBBB), Normal sinus rhythm (NSR), Ventricular fibrillation (VF), and so on [4]. Fuzzy classifier was implemented to discriminate those arrhythmias comprises of two major function blocks which is the Electrocardiogram (ECG) Parametizer, and Fuzzy classifier. Two blocks work mutually with their respective tasks. In the ECG Parametizer, ECG features such as peak intervals, amplitudes, gradients and so on are detected using Daubechies wavelets technique. These features then used to calculate non-linear parameters of ECG signals. They are described as spectral entropy, poincare plot geometry, largest Lyapunov exponent and detrended fluctuation analysis. All of these non-linear parameters will be fed as inputs to fuzzy classifiers for arrhythmias classification by applying Mamdani fuzzy method.
Fig. 1 Structure of fuzzy ECG classifier [4] Figure 1shows the algorithm of the proposed ECG fuzzy classifier which can be summarized as below:
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 398–402, 2011. www.springerlink.com
A Review of ECG Peaks Detection and Classification
• • • •
399
The first step is initialization whereby ECG data is obtained from database and features extraction is done including the pre-processing stage. Fuzzification – Calculation of fuzzy equivalence relation for inputs-outputs matching. Defuzzification – Matching data from the pre-processing stage with the data from the training set. Classification – Cardiac arrhythmia will be classified according to their characteristics vectors.
Table 1tabulates the range of input parameters used in fuzzy classification model. Table 1 Input parameters range [4]
i.
ii.
iii.
If half search interval contains more than two candidate peaks, just selected two out of all the peaks whichever having largest average ∆YP. Equation (1) is used to calculate largest average ∆YP [5]. Average - ∆YP = ½ [ ∆YP(i) + ∆YP(i-1)] (1) If half search interval contains only two candidate peaks, then the fuzzy criteria is applied, else if half search interval contains only one candidate peak, select that particular peak as the real peak. In the case when half search interval not contain any candidate peaks, then all the non-candidate peaks are treated as candidate peaks. Then, step (i), (ii), (iii are executed) to identify the real peak. If no candidate peaks, the real peaks are considered absent. The real peak identified in the first half search interval is selected as the P peak while in the second half search interval is considered as the T peak as it follows the subsequent alphabet letter.
Table 2 Cardiac arrhythmia classification [4] Fig. 2 ECG intervals division [5] Once the P and T waves are identified, the remaining waveforms considered as noisy peaks and thus, filtered out. Finally, the attributes of P and T waves were calculated for diagnosis purposes [5]. This method might be less accurate since it is more to assumption based. The result obtained to classify cardiac arrhythmia as shown in figure 2. The accuracy achieved is 93.13% [4]. Another study revealed that fuzzy logic could be used to recognize P and T waves of ECG signals using fuzzy criteria defined. By considering all the waves in between the search interval, both of these two waves can be correctly identified according to the fuzzy criteria. Fuzzy criteria: If there is no interwave segment in between two candidate peaks, then both peaks will be selected as a real-biphasic-peak and the process to identify real peaks is over. Otherwise, if it is more than two, then, it should follow fuzzy membership calculation in order to find peak P and T accurately. There are several waves associated in between QRS complex wave to the subsequent of QRS wave. There might be 4 possibilities encountered in this search interval:
B. Wavelet Transform Another method used for ECG peaks detection is wavelet transform. It is normally used for analyzing heart rate fluctuations due to its ability processing data at different scales and resolutions. Besides that, wavelets are normally used to represent data and other functions whenever the equations satisfy certain mathematical expressions. Basically, a wavelet equation depends on two parameters, scale a, and position . These parameters vary continuously over the real (jεz , z is an integer set), then the numbers. If scale wavelet is called dyadic wavelet and its corresponding transform is called Discrete Wavelet Transform (DWT). The related equation [6] is
IFMBE Proceedings Vol. 35
(1)
400
T.I. Amani et al.
Fourier transform of ψ 2j(t) must satify the equation (2) to cover the whole frequency domain. (2) Then, R wave peak is determined by analyzing slopes of given ECG signals. In most cases, ECG signals will be shifted due to the shifting of associated iso-electric baseline under various abnormalities. In order to resolve this problem, threshold level is introduced. Peaks exceeding the threshold level will be counted as R waves. Then, pre and post gradients of the wave will be computed. ECG signals obtained will be characterized according to their respective features such as P wave onsets, QRS complex, T wave, QRS duration and so on. After characterization, ECG signals contains noise components will be identified and removed by filtering using DWT method. The signals also de-trended to avoid baseline shifting due to the low frequency component by decomposed them into 5 levels as in figure (3).
Fig. 3 Decomposed 5 levels signal [6] Then, reconstruction of approximation (A5) and details (D5) signals at level 5 is done for the summation of A5 and D5. The summation of both parameters represented baseline shifting in a low frequency. This low frequency is removedto get real ECG without baseline shifting. Hence, the remaining signals which contain high frequency and also needed to be removed are de-trended. Discarding high frequency noises might also lose some information of the original signals including sharpest features. This problem is accomplished by applied thresholding, which it discards only the signal parts that exceed the defined limit. The final signal (de-trended and de-noises) now contains only high amplitude spikes. These are denoted as R-waves. However, there are also some noisy spikes after the R wave with the amplitude approximately as R wave. This been solved by setting threshold voltage label (TP) by considering average amplitude of R waves. Thus, any spikes appeared after R waves assumed as noises and are ignored. R wave is the sharpest peak in normal ECG with positive and negative slopes. Positive slope refers to a pre-gradient (before R-wave peak) while negative slope refers to postgradient (after R-wave). In order to detect R-peak, both slopes are calculated and if the values exceed the TP limit, it is taken as the R-wave [6].
C. Template Matching Template matching also frequently applied in ECG analysis. Template matching is simply defined as taking a portion of an image that is going to be matched with the template image (source image) [7]. Past attempts have been made to detect real time P and R wave in exercise electrocardiogram by using cross-correlation and template matching algorithm. This cross-correlation technique will generate a co-efficient value which is used to quantify the similarity between arrhythmia waveform template and examined ECG signals. High cross-correlation co-efficient indicates many similarities in terms of morphological attributes between the template signal and the examined signal [8], [9]. P wave in ECG signals has small amplitude and is hardly detected. Thus, template matching is used to improve the accuracy in P wave detection. Maximum detection accuracy of P wave will be the same as R wave procedures. ECG signals given will be divided into corresponding segments according to the respective templates. Referring to the figure (4), RE means R wave point estimation, RI is represented interval from the previous R peak signal to the next R peak signal. RT-1 stands for previous R wave time position while RT is the latest R wave time position. RA and RB are used for range estimation purposes. The same abbreviations also applied for P wave. Point estimation for R wave (RE) is calculated from RT-1 + RI. The range estimation has been set within the limit RA ≤RE ≤ RB and defined as RE – (RI*0.15) and RE + (RI*0.15). Range estimation value is very much useful to select the range that maximizes the match between template and ECG signals. After ECG signals fed into this system, the system will trace the peaks that exceed the threshold limit within the range estimation and mark as R peak candidates. Then, correlation was performed between all candidates of R peaks and R template signal to identify accurately next R wave time position (RT). A candidate signals which the correlation more than 0.85 will be defined as the next R wave (RT). R interval (RI) and R wave template were updating during identifation process once each new ECG signal arrives. This is to ensure the R wave can be distinguished from noise and artifacts.
IFMBE Proceedings Vol. 35
Fig. 4 Template matching diagram [8]
A Review of ECG Peaks Detection and Classification
401
Another study showing that how template matching being used to classify ECG signals of Normal Sinus Rhythm (NSR), Ventricular Fibrillation (VF) and Ventricular Tachycardia (VT). Firstly, the templates of those signals are prepared. Template for NSR and VT are obtained from single beat representation of the signals. The characteristic to distinguish both signals are easily recognized as NSR clearly has complete PQRST peaks while VT signal has wide QRS complex. VF signal possessed behavior of noiselike characteristics. Therefore, it is better approach to represent noise-like characteristics for VF template by applying multi-beat waveforms signature. Then, examined ECG signals are cross-correlated with the templates to find correlation coefficient. The equation used to calculate correlation coefficient is as follows [9]
layer and an output layer is the best ANN structure. The parameters value of input layer used is 48 neurons, hidden layer consists of 25 neurons, output layer used 7 neurons, learning rate at 0.01 and error goal at 0.0001 with optimum value of momentum term. The simulation output of ANN training and relationship between number of neurons and evaluation factor presented as follows
(3)
whereby x denoted for windowed signal length, y represented for template length, m is means of the series and l is stands for lag of the correlated series. If the correlation coefficient value is approximate to 1, there is high similarity in terms of morphological attributes between templates and examined ECG signals. Thus, unknown signals will be classified according to the types of those templates. If the value of coefficient near to 0, it means otherwise [9]. D. Neural Network Another effort to classify ECG image is by neural network approach. Features including mean, minimum and maximum value, range, variance, standard deviation and mean absolute deviation were extracted using wavelet transformation and fed to Artificial Neural Network (ANN) classifier. In this experiment, features vector of each original image, horizontal, vertical, diagonal details data, approximation and image reconstruction consists of 48 data. It represented as (48x1) in matrix form. Since 63 ECG images were used, thus, it resulted of (48x63) total data features. These have been simplified by dividing data into 9 batches make it becomes (48x7) per batch for easier processing. Then, empirical evaluation (EV) factor has been used to find the best architecture of ANN by applying the formula depicted as follow [10]
Based on computation done, it is observed that neural network architecture with feed forward backpropagation method of 3 layers consists of one input layer, one hidden
Fig. 5 Simulation of ANN training [10]
This proposed ANN has been trained by applying 63 ECG images represented different types of heart diseases. It is followed by another 60 ECG images to check system performance accuracy and classification of the chosen algorithm. The accuracy is computed given by the expression [10] Simulation carried out showed that performance accuracy is 92% [10]. Neural network exhibits unique characteristics. It is independent processing system, which means degradation of major network performance does not affect the other network’s functions. Furthermore, latest matlab version also provides multifunction of neural networks which facilitate faster in computerized diagnosis.
III. CONCLUSIONS As a conclusion, respective methods process the information signals in their own way. Justification of capability recommended neural network being used for further implementation of ECG analysis system. This is due to its advantages even though there might also be some inherent limitations of the method proposed.
IFMBE Proceedings Vol. 35
402
T.I. Amani et al.
REFERENCES [1] Atul Sethi, Siddharth Arora, Abhishek Ballaney, Frequency domain analysis of ECG signals using auto-associative neural networks, International Conference on Biomedical and Pharmaceutical Engineering 2006 (ICBPE 2006), 531-536 [2] P.Sasikala, Dr. R.S.D. WahidaBanu, Extraction of P wave and T wave in electrocardiogram using wavelet transform, International Journal of Computer Science and Information Technologies, Vol. 2(1), 2011, 489-493 [3] Scheidt S, Basic Electrocardiography: Abnormalities of electrocardiographic patterns, Vol. 6/36. 32 pp. Ciba Pharmaceutical Company, Summit, N.J [4] Mrs.B.Anuradha, V.C. Veera Reddy, (2005-2008), Cardiac arrhythmia classification using fuzzy classifiers, 353-359 [5] S.S. Mehta, S.C. Saxena and H.K. Verma, Recognition of P and T waves in electrocardiograms using fuzzy theory, Proceedings RC IEEE-EMBS & 14th BMESI – 1995, 2.54-2.55
[6] M.A.Khayer and M.A. Haque, ECG peak detection using wavelet tran form, 3rd International Conference on Electrical & Computer Engineering ICECE 2004, 28-30 December 2004, Dhaka, Bangladesh, ISBN 984-32-1804-4, 518-521 [7] A website at http://en.wikipedia.org/wiki/Template_matching [8] Hiroki Hasegawa, Takuya Watanabe and Takashi Uozumi, Retime P and R wave detection exercise electrocardiogram [9] Foo Joo Chin, Qiang Fang, member IEEE, Tao Zhang, Irena Cosic, senior member IEEE, A fast critical arrhythmic ECG waveform identification method using cross-correlation and multiple template matching, 32nd Annual International Conference of the IEEE EMBS Buenos Aires, Argentina, August 31-September 4,2010,1922-1925 [10] Mazhar B.Tayel, Mohamed E.El-Bouridy, ECG images classification using features extraction based on wavelet transformation and neuralnetwork, AIML 06 International Conference, 13-15 June 2006, Sharm El Sheikh, Egypt, 105-107
IFMBE Proceedings Vol. 35
An Image Approach Model of RBC Flow in Microcirculation W.C. Lin1, H.H. Liu1, R.S. Liu2, and K.P. Lin1 1
2
Department of Electrical Engineering, Chung Yuan Christian University, Taiwan Department of Nuclear Medicine, Taipei Veterans General Hospital and National Yang-Ming University Medical School, Taiwan
Abstract— Information in blood flow of microcirculation plays an important role in health assessment. Recently, some numerical and experimental studies of blood flow in large arteries have been utilizing complex models although the simulations can be adapted to microcirculation flows. However, the complex formula of blood flow in microvascular networks is difficult to employ in practical application. Therefore, a building block approach was proposed to simplify the blood flow model. Frame-to-frame visual inspection was taken as a strategy to determine the characteristics of curvature and velocity along interested segment in unitary microvessel. This useful finding is a simple method to construct a simple model that can be helpful to understand parameters and the relation between curvature and velocity in the RBC route. Keywords— microcirculation, blood flow, visual inspection, building block.
Recently, some numerical and experimental studies of blood flow in large arteries have attempted to accurately replicate in vivo arterial geometries while others have utilized complex models. They introduced an IB-LBM method for simulating RBC deformation and motion in shear and channel flow [12]. Although the simulations can be adapted to microcirculation flows, the complex formula of blood flow in microvascular networks is difficult to employ in practical application. The aim of this study was to develop a building block approach in order to simplify the blood flow model. It may become a useful tool for modeling RBCs flow in microcirculation. This framework could help the numerical simulation of blood flow for describing blood flow through the factual data in microvascular research.
II. METHODS I. INTRODUCTION The relationship between blood flow in microcirculation and the clinical physiology in blood circulation has been a wide-reaching and in-depth understanding. Various risk factors of diseases can be related to corresponding changes in microcirculation. For instance, Raynaud’s syndrome[1,2], hypertension[3,4] or diabetes[5,6] are usually accompanied with impaired microcirculation. Therefore, information in blood flow of microcirculation is essential in health assessment and angiopathy prevention. Thus, dynamic observation of microvascular mechanisms provides a deeper understanding of diseases and their relationship to the physiological function of microcirculation. Quantization of the red blood cell (RBC) velocity in micro-vessels is a means of such observation. However, the flow measurement of RBC in micro vessels is still a challenge with current techniques. The flow in large vessels is able to be measured by using electro-magnetic blood flowmeter or ultrasonic Doppler flowmeter. There has been plenty of useful information obtained from the changes in blood flow and viscous properties of blood during physiological events. A major limitation of such measurements unable to relate microvascular perfusion to a specific given tissue has been observed within individual micro-vessels to the topographical succession of arterioles, capillaries, and venules.
A. Microscopy and Imaging Acquisition There have been different blood flow measure techniques introduced in other studies [9-11]. The electromagnetic blood flowmeter and ultrasonic Doppler flowmeter are useful for larger blood vessel measurement but not suitable for microcirculation. In general, intravital video microscopy involves the use of a fluorescence microscope in a living animal for realtime observation, monitoring, recording can be applied in quantitative analysis of specific variables and events. However, some detrimental effects may arise with fluorescence microscopy on living tissues, such as the following: (1) The fluorophore itself may interfere with the signaling pathway or alter cellular function in some way. (2) The excitation light itself may damage the living tissue, which may affect the behavior of the sample or even cause its death. (3) The effect arises as a result of the combination of fluorophores and excitation light is clearly not an option with live cell imaging. Our microscopic system without fluorescently labeling provides precise and continuous quantitative data of blood flow rate in individual small vessels. The microcirculation is imaged by the penetrating white light from the side. The green channel is absorbed by hemoglobin of erythrocytes
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 403–406, 2011. www.springerlink.com
404
W.C. Lin et al.
which can be observed as dark moving cells. A magnifying lens projects the image onto a camera. The imaging light collected by the central part of the light guide is optically isolated from the illuminating white light from the lightemitting diodes (LEDs). These LEDs are arranged in a ring form at the tip of the light guide, which directly illuminate the area of interest (see Fig.1). B. Building Blocks of RBCs Flow by Visual Inspection Cutaneous red blood cell velocity in vivo can be measured by using microscopy technique. However, unlike simulated blood flow images, there is no standard to determine the accuracy of the techniques for computing blood flow velocities. The principle of the frame-to-frame visual inspection method is one of the ways to determine the blood velocity by directly observing the movement of cells between two consecutive frames. Many recent studies have been done on the reference of blood flow through visual inspection method. There exists a commercialized software named “Cap-Image” (http://www.drzeintl.de/CAP_english.htm) which is based on the same theory with computer-assisted method to calculate RBC velocity. Therefore, the frame-to-frame visual inspection was taken as a golden standard on assisting software development for RBC velocity estimation. For our study target, the RBCs of frog are Nucleated (having a nucleus) and are considerably bigger in size than human RBC. As a result, it has optimum characteristic of appearance for observing RBC motion in microvessel.
The curvature theory, that is local expressions, was used to discuss the route of RBC motion. The curvature is determined as
κ
κ =
y '' (1 + y '2 ) 3/ 2
(1)
Where y = f(x) denotes the equation of curve lines, x is the position of RBC center in coordinate axis. In this study, the frog RBC motion for 500 individual pictures was retrieved from the video. The interval between the neighboring two pictures was measured one thirtieth second. Fig. 2(a) shows the direction of RBC motion in microvessels. Fig. 2(b) displays the major microvessel that was selected for the statistics by random sampling. There are different groups can be found in this microvessel of sharp curves that the approach three pictures continue to flow as Fig. 2(c) shows. Therefore, for the experiment of accurate statistics, 88 specimens were collected for further research. For the preparation of three continuing pictures, the differentiable RBC center was searched by naked eyes. Thus the three points of RBC center can be determined with the nonlinear curve f(x) fitting and this curve line is similar to the process of the RBC motion. After the RBC center was confirmed, we can choose 110 samples of the RBCs to compute diameter (18.64 μm) and standard deviation (3.68).
III. EXPERIMENT RESULTS
Fig. 1 The schematic representation of the microscopic system. The microcirculation is directly penetrated and illuminated from the side by white lighting source. The green channel is absorbed by hemoglobin of erythrocytes which are observed as dark moving cells
The result of fitting put into the equation (1) that the curvature of second RBC (C1) can be calculated. Figure 3 depicts the curvature total number of individual range at the second RBC. The RBC transit in the curve of microvessel that the curvatures show a Gaussian distribution accumulate between 1.2× 10−8 and 2.9× 10−8. Note that the curvature range between 1 × 10−9 and 3.5× 10−8 are separated to 6 intervals so that the curvature value 1.5× 10−8 on behalf of the range between 1.2× 10−8 and 1.7× 10−8. The rest curvature may be deduced by analogy. The curvature depends on the average velocity in the second RBC as shown in Figure 4.The velocity decrease with increasing curvature, the outcome reveals the way of the RBC motion on the larger curvature that the average velocity is slow. On the last, the nonlinear equation y = f(x) = a2 + b + cwas used to fit Fig. 4 and the constant of a, b, c
IFMBE Proceedings Vol. 35
An Image Approach Model of RBC Flow in Microcirculation
405
and d can be determined as 3.15× 104, −3.34× 103 and4.46× 102. This useful finding is a simple method to construct a model that can know therelation between curvature and velocity in the RBC route.
Number
30
20
10
0
0
1
2
3 −8
−1
Curvature (10 m )
Fig. 3 The curvature total number of individual range at the second RBC 700 600
400
−6
V (10 m/s)
500
300 200 0.5
1.0
1.5
2.0
2.5 −8
3.0
3.5
−1
Curvature (10 m ) Fig. 4 The average curvature of individual range dependence of the average velocity of second RBC
IV. CONCLUSIONS
Fig. 2 (a) The RBC flow directions are shown in microvessel network of frog web; (b) one section in microvessel was selected for the statistics by random sampling; (c) The symbols of C0, C1 and C2 are indicated that same RBC center at difference time in successive frames.
Building block approach is a fast and effective way for modeling RBCs flow in microcirculation. Using obtained parameters, which are the curvature and velocity, we could rebuild blood flow with realistic properties. In the future study, the tumor capillary bed will be modeled as a capillary tree of bifurcating segments whose geometrical construction involves deterministic and random parameters. Furthermore, the simulated data of blood flow could be a reference in angiopathy physiology research.
ACKNOWLEDGMENT This research was granted and supported by National Research Program for the Department of Industrial Technology (DoIT) of the Ministry of Economic Affairs (MOEA), R.O.C
IFMBE Proceedings Vol. 35
406
W.C. Lin et al.
(99-EC-17-A-19-S1-163),Genomic Medicine, Taiwan (Molecular and Genetic Imaging Core, NSC99-3112-B-010-015) and NSC99-2221-E-033-012-MY3 . We thank them for their generous financial assistance.
REFERENCES [1]
[2]
[3]
[4]
[5]
[6]
Wollersheim H., Reyenga J. and Thien T . Laser Doppler velocimetry of fingertips during heat provocation in normals and in patients with Raynaud’s phenomenon Scand, J. Clin. Lab. Invest. 48, 91–5(1988). Bertuglia S., Leger P., Colantuoni A., Coppini G., Bendayan P. and Boccalon H. Different flowmotion patterns inhealthy controls and patients with Raynaud’s phenomenon Technol, Health Care 7 ,113–23 (1999). E. Bonacci, N. Santacroce, N. D’Amico, and R. Mattace., Nail-fold capillaroscopy in the study of microcirculation in elderly hypertensive patients, Arch. Gerontol. Geriatr. suppl. 5, 79-83 (1996). Cesarone M R, Incandela L, Ledda A, De Sanctis M T,Steigerwalt R, Pellegrini L, Bucci M, Belcaro G andCiccarelli R. Pressure and microcirculatory effects of treatment with lercanidipine in hypertensive patients and invascular patients with hypertension Angiology 51, 53– 63 (2000). Chung-Hsing Chang, Rong-Kung Tsai, Wen-Chuan Wu, Song-Ling Kuo, and Hsin-Su Yu., Use of dynamic capillaroscopy for studying cutaneous microcirculation in patients with diabetes mellitus, Mircrovascular Research 53, 121-127 (1997). E. Tibiriçá, E. Rodrigues, R.A. Cobas and M.B. Gomes., Endothelial function in patients with type 1 diabetes evaluated by skin capillary recruitment, Mircrovascular Research 73, 107-112 (2007).
[7]
Jain, R.K. Ward-Hartley, K. Tumor Blood Flow-Characterization, Modifications, and Role in Hyperthermia,Sonics and Ultrasonics, IEEE Transactions on,31(5)504- 525,1984. [8] Katsuyoshi Hori, March Suzuki , Shigeru Tanda, Sachiko Saito .Characterization of Heterogeneous Distribution of Tumor Blood Flow in the Rat. Cancer Science.Volume 82 Issue 1, pp. 109 – 117, 1991. [9] Arthur M. Iga, Sandip Sarkar, Kevin M. Sales, Marc C. Winslet and Alexander M. Seifalian, Quantitating Therapeutic Disruption of Tumor Blood Flow with Intravital Video Microscopy, Cancer Research 2006; 66: (24). December 15, 2006. [10] Sugii Y., Nishio S., Okamoto K. In vivo PIV measurement of red blood cell velocity field in microvessels considering mesentery motion. Physiological Measurement, Volume 23, Number 2, pp. 403416(14),2002. [11] Bollinger A, Butti P, Barras J P, Trachsler H and Siegenthaler W, Red blood cell velocity in nailfold capillaries of man measured by a television microscopy technique Microvasc. Res. 7 62–72, (1974). [12] Moore JA et al, Computational blood flow modeling based on in vivo measurements. Annals of Biomedical Engineering ,1999, 27(5):62740.
Author: Kang-Ping Lin Institute: Department of Electrical Engineering, Chung Yuan Christian University Street: 200, Chung Pei Red. City: Chung Li, 32023 Country: Taiwan (ROC) Email:
[email protected] IFMBE Proceedings Vol. 35
An Image-Based Anatomical Network Model and Modelling of Circulation of Mouse Retinal Vasculature P. Ganesan1, S. He2, H. Xu3, and Y.H. Yau1 1
Faculty of Engineering, University of Malaya, Kuala Lumpur, 50603, Malaysia 2 School of Engineering, University of Aberdeen, Aberdeen, AB24 1TR, UK 3 School of Medicine, Dentistry and Biomedical Science, Queen's University Belfast, Belfast, BT12 6BA, UK
Abstract— The paper presents an image-based network model of retinal vasculature taking account of the 3D vascular distribution of the retina. Mouse retinas were prepared using flat-mount technique and vascular images were obtained using confocal microscopy. The vascular morphometric information obtained from confocal images was used for the model development. The network model developed directly represents the vascular geometry of all the large vessels of the arteriolar and venular trees and models the capillaries using uniformly distributed meshes. The vasculatures in different layers of the retina, namely the superficial, intermediate and deep layer, were modelled separately in the network and were linked through connecting vessels. The branching data of the vasculatures was recorded using the method of connectivity matrix of network (the graph theory). Such an approach is able to take into account the detailed vasculature of individual retinas concerned. Using such network model, circulation analyses to predict the spatial distribution of the pressure, flow, hematocrit, apparent viscosity and wall shear stress in the entire retinal vasculature can be carried out. Keywords— Murine retina; network topology; morphological data; network model; spatial pressure; flowrate; velocity; and wall shear stress.
I. INTRODUCTION Circulation analyses using a detailed image-based anatomical vascular model of physiological systems have been proven useful in enhancing biologists' understanding of the hemodynamics of the system and thereby improve the treatment of circulation related diseases. This is important since vascular circulation related diseases such as hypertension, atherosclerosis and diabetes are major health problems in modern society. In this regards, murine retina, which has a vascular distribution similar to that of human retina (holangiotic type), is often used as a substitute for human retina for studies of retinal vasculature, hemodynamics and blood flow regulation under both physiological and pathological conditions. Although murine retinal vasculature has been examined for many years, the understanding of the hemodynamics of the network of the retina is still incomplete. Circulation analysis using a detailed image-based
anatomical vascular model of retinal vasculature can potentially produce important information to improve our understanding. A relatively good understanding of the retinal anatomy and vascular network including human retina has been developed through extensive studies using staining and perfusion techniques to reveal the vasculature [1]. Retinal vasculature can be described using a three-layer distribution model with the artery, arteriolar branches and the veins in the top (or superficial) layer and the capillary networks in the middle (or intermediate) layer and the bottom (or deep) layer. The venular branches sit in the deep layer and move transversely to connect the veins in the superficial layer. In addition, retinal vasculature and circulation, which can be visualized directly in vivo, have been observed using various fundus imaging techniques. For example, directional laser Doppler velocimetry (LDV) has been used for velocity and flowrate measurement and retinal vessel analyser (RVA) for online retinal vascular diameter measurement [2]. However, very little work has been done in the context of circulation modelling of retinal network based on a detailed description of the topology of the retinal vasculature [3]. This is despite of the great potential such work has in enhancing our understanding of the circulation in the retina. It is known from previous studies that the circulation in microvasculature can be modeled using Poiseuille’s equation assuming the blood as a Newtonian fluid with a constant viscosity and the blood vessels are considered to be rigid. Such assumptions are justified to be a good approximation provided the non-dimensional Womersley and Reynolds numbers is significantly less than unity. However, blood flow especially in microvessel of a diameter 3) organic solvents, the overall efficiency of the enzyme changed [25]. So, hexane was chosen the solvent in the subsequent experiments. Hence, the polarity of different solvents in terms of their log-P values played crucial role. Table 2 Effect of catalyst loading on conversion of soybean oil into fatty amides. Other reaction conditions: Thiourea/palm oil molar ratio = 5.0: 1.0, Hexane = 20 ml and Reaction temperature = 40 °C, pH = 7 and Lipozyme = 0.05 mg Organic solvent
Conversion, %
Heptane Hexane Toluene Chloroform
81 94 78 59
Characteristic bands of soybean oil were observed at, 2912, 2854, 1744, cm-1 resulting from, C–H asymmetric stretching of CH2, C–H symmetric stretching of CH2, C=O stretching of ester (glyceride), respectively [10]. The fatty amides spectra show absorption bands at 3310, 1621 and 1043 cm-1 attributed to -NH2 group stretching, C=O stretching and C-N stretching of amide, respectively. The disappearance of the peak at 1744 cm-1 and presence of the peaks at 3310, 1621 and 1043 cm-1 indicate that fatty amides have been formed [5]. (ii). 1H NMR spectra of Fatty Amides (400MHz) (CD3 COOD): δ 0.88 (t, J = 8.2 Hz, 3H, CH3), 1.17 (m, H, CH2), 1.62 (2H, 2 x CH2 CH2 CO NH2), 2.03 (4H, 2 x CH2 CH = CH), 2.41 (t, J = 10.3 Hz, 2H, CH2 CO NH2), 5.33 (2H, CH = CH), 6.04 (br, S, 2H, CO NH2).
IV. CONCLUSIONS
E. Optimal Condition The percentage of conversion into fatty amides increased with increasing reaction time. The highest conversion percentage was obtained when the process was carried for 24 h. The reaction rate change after this time was small as the reaction reached the equilibrium state. The conversion percentage of soybean oil into fatty amides was highest when the ration of thiourea to soybean oil was 5.0 mmol: 1.0
In this study, a new environmentally friendly and abundant raw material was used for synthesis of fatty amides. The reaction was carried out via treatment of soybean oil with thiourea by immobilized lipase in presence of hexane as an organic solvent. The method employed offers technical simplicity, high percentage of conversion, easy isolation of enzyme from the products and other components in the reaction mixture. The product can be used as organic reagents for extraction of metal ions from aqueous solution and for clay modification to produce polymer nanocomposites.
IFMBE Proceedings Vol. 35
Enzymatic Synthesis of Soybean Oil Based-Fatty Amides
REFERENCES 1. Omura, S.; Katagiri, M.; Awaya, J.; Furukawa, T.; Umezawa, I.; Oi, N.; Mizoguchi, M.; Aoki, B.; Shindo, M. Relationship between the structures of fatty acid amide derivatives and their antimicrobial activities. Antimicrob. Agents Chemother. 6, 207–215 (1974). 2. Biermann. U.; Friedt, W.; Lang, S.; Luhs, W.; Machmuller, G.; Metzger, O. New syntheses with oils and fats as renewable raw materials for the chemical industry. Angew. Chem. Inte. 39, 2206–2224 (2000). 3. Maag, H. Fatty acid derivatives: important surfactants for household, cosmetics and industrial purposes. J. Am. Oil Chem. Soc. 61, 259–267 (1984). 4. Kuo, T.M.; Kim, H.; Hou, C.T. Production of novel compound 7,10,12-trihydroxy-8(E)-octadecenoic acid from ricinoleic acid by Pseudomonas aeruginosa PR3. Curr. Microbiol. 43, 198–203 (2001). 5. Al-Mulla, E.A.J.; Yunus W.M.Z.; Ibrahim N.A. Abdul Rahman M.Z. Enzymatic synthesis of fatty amides from soybean oil J. Oieo sci., 59, 59-64 (2010). 6. Chen, C.H.; Sih, C.J. General Aspect and Optimization of Enantioselective Biocatalysis in Organic Solvents: The Use of lipases. Angewandte Chemie International Edition 28, 695-707 (1989). 7. Medina, A.R.; Cerdan, L.E.; Gimenez, A.G.. Paez, B.C.. Gonzales, M.J.; Grima, E.M. Lipase-Catalyzed Esterification of Glycerol and Polyunsaturated Fatty Acids from Fish and Microalgae Oils. J. Biotech. 70, 379-391 (1999). 8. Mittelbach, M. Lipase Catalyzed Alcoholysis of Sunflower Oil. J. Amer. Oil Chem. Soc. 67, 168-176 (1990). 9. Hacking, M.A.; Akkus, H.; Van Rantwijk, F.; Sheldon, R.A.. Lipase and Esterase-Catalyzed Acylation of Hetero-Substituted Nitrogen Nucleophiles in Water and Organic Solvents. Biotech. Bioeng. 68, 84-91 (2000). 10. Mohamad, S.; Yunus, W.; Haron, M.; Abdul Rahman, M.Z. Enzymatic synthesis of fatty hydrazides from palm oils. J. Oleo Sci. 57, 263-267 (2008). 11. Dedy, S.; Yunus, W.M.Z.; Jelas H.; Sidik S. Enzymatic Synthesis of Fatty Hydroxamic Acids from Palm Oil. J. Oieo sci. 54, 33-38 (2004). 12. Zoete, M.C.; Kock-van A.C.; van, F.; Sheldon, R.A. Lipase catalyzed ammoniolysis of lipids: a facile synthesis of fatty acid amides. J. Mol. Catal. B: Enz. 1, 109–113 (1996).
853 13. Litjens, M.J.; Sha, M.; Straathof, A.J.; Jongejan, J.A.; Heijnen, J.J. Competitive lipase catalyzed ester hydrolysis and ammoniolysis in organic solvents: equilibrium model of solid liquid vapor system. Biotechnol. Bioeng. 65, 347–356 (1999). 14. Levinson, W.E.; Kuo, T.M.; Kurtzman, C.P. Lipase catalyzed production of novel hydroxylated fatty amides in organic solvents. Enz. Microb. Technol. 37, 126–130 (2005). 15. Al-Mulla E.A.J.; Yunus W.M.Z.; Ibrahim N.A. Abdul Rahman M.Z. Synthesis and Characterization of N,N'-Carbonyl Difatty Amides from palm oil. J. Oieo sci., 58, 467-471 (2009). 16. E.A.J. Al-Mulla, K.W.S. Al-Janabi, Chin. Chem. Lett. (2010), in press. 17. Hoidy, H. W.; Ahmad M. B.; Al-Mulla, E. A. J.; Yonus, W.M.Z.' Ibrahim, N. A. Chemical sunthesis of palm oil-based difatty acyl thiothiourea. J. Oieo sci., 59, 229-133 (2010). 18. Al-Mulla E.A.J.; Yunus W.M.Z.; Ibrahim N.A. Abdul Rahman M.Z Difatty Acyl Thiourea from Corn Oil: Synthesis and Characterization. J. Oieo sci., 59, 157-160 (2010). 19. Hoidy, W. H.; Al-Mulla, E.A.J.; Al-Janabi, K.W. Mechanical and thermal properties of PLLA/PCL modified clay nanocomposites. J. Polym. Environ. 18, 608-618 (2010). 20. Al-Mulla, E.A.J.; Suhail, H.S.; Aowda, S.A. New biopolymer nanocomposites based on epoxidized soybean oil plasticized poly(lactic acid)/fatty nitrogen compounds modified clay: Preparation and characterization. Ind. Crops Prod. 33, 23-29 (2011). 21. Benini; Stefano; Wojciech. R.; Rypniewski, Keith, S.; Wilson, Silvia M.; Stefano C.; Stefano M. A new proposal for thiourease mechanism based on the crystal structures of the native and inhibited enzyme from Bacilus pasteurii: why thiourea hydrolysis costs two nickels. Structure 7, 205-216 (1999). 22. Romero, M.D.; Calvo, L.; Alba, C.; Daneshfar, A.; Ghaziaskar, H.S. Enzematic synthesis of isomyl acetate with immobilized Candida antarcteca lipase in n-hexane, Enzyme Microb. Technol. 37, 42-48 (2005). 23. Gandhi, N.N.; Sawant, S.B.; Joshi, J.B.; Studies on the lipozyme catalysed synthesis of butyl laurate. Biotechnol. Bioeng. 46, 1-12 (1995). 24. Al-Mulla E.A.J.; Yunus W.M.Z.; Ibrahim N.A. Abdul Rahman M.Z. Enzymatic Synthesis of Palm Olein-based Fatty Thiohydroxamic Acids. J. Oieo sci., 59, 569-573 (2010). 25. Gunawan, E.R.; Basri, M.; Rahman, M.B.; Salleh, A.B.; Rahman, R.N. Lipase-catalyzed synthesis of palm-based wax ester. J. Oleo Sci. 53, 471-477 (2004).
IFMBE Proceedings Vol. 35
Rat Model of Healing the Skin Wounds and Joint Inflammations by Recombinant Human Angiogenin, Erythropoietin and Tumor Necrosis Factor-α A. Gulyaev1 and V. Piven2,* 1
National Centre for Biotechnology of Kazakhstan/Laboratory of Toxicology, 010000, 13/1, Valikhanova Str., Astana, Kazakhstan University Technology Petronas/Fundamental and Applied Science Department, Bandar Seri Iskandar, 31750 Tronoh, Malaysia
2
Abstract— This study is a part of an effort on the development of a new generation of wound healing medicines based on recombinant human peptides and cytokines, namely angiogenin (rhu-ANG), erythropoietin (rhu-EPO) and tumor necrosis factor alpha (rhu-TNF-α). The screening of a few drug matrixes was conducted and high purity polyethylene oxide was found to be the most appropriate one. Three gel forms of peptides were concocted and investigated in the study. Four rat models of surgical skin muscle wounds and two of joint acute and adjuvant arthritic inflammations were developed and tested with foresaid gels in comparison with conventional gel Solcoseryl and Butadion ointment. Plethora of morphocytological and hematological data was produced for all tested materials and improvement of wound/inflammation healing process with all peptides compared to Solcoseryl and Butadion was proven. Keywords— Wound healing, rhu-angiogenin, rhu-TNF-α, rhu-erythropoietin.
I. INTRODUCTION Wound healing in the skin and muscle tissues involves the concerted interplay of several cell types including keratinocytes, fibroblasts, endothelial cells, platelets and macrophages. The proliferation, migration, infiltration, and differentiation of these cells result in the formation of new tissue and finally wound closure [1]. This process is controlled by a signaling network of a variety of growth factors, cytokines and chemokines. Presently most important of them are considered the families of epidermal growth factor (EGF), fibroblast growth factor (FGF), vascular endothelial growth factor (VEGF), transforming growth factor beta (TGF-beta), granulocyte macrophage colony stimulating factor (GM-CSF), platelet-derived growth factor (PDGF), connective tissue growth factor (CTGF), interleukins (ILs), and tumor necrosis factor-alpha [1]. Only three of them, (PDGF, bFGF, and GM-CSF) are being used for treatment of patients whereby only PDGF has been tested in the clinical trials [2]. Meanwhile, plethora of data was reported recently on angiogenic potency of ANG, EPO and TNF-α [3]. There is an opinion that their roles in wound management are underestimated and more emphasis should be
given to the development of wound healing pharmaceutical products based on recombinant ANG, EPO and TNF-α. Given study deals with the rat models of wound cure based on these recombinant substances in comparison with traditional gel Solcoseryl that promotes angiogenesis via an increase of oxygen uptake by cells, stimulation of ATP synthesis, collagen formation and improvement of glucose transport. The cure of inflammatory arthritis was compared with Butadion ointment. The screening of a few drug matrixes was conducted and high purity polyethylene oxide was found to be the most appropriate for the said purpose. It seems to be logic to compare the specific roles of foresaid substances. and their efficacy in wound healing process.
II. MATERIALS AND METHOD Recombinant human cytokines. Rhu-ANG of clinical grade was obtained by culturing a highly productive E.coli strain BL21(DE3)pZZSA employing the innovative BIOKprocess based on gas-vortex bioreactor [4]. For this purpose the recombinant plasmid pET-21a-d(+)-based vector system that carries the synthetic gene of hu-ANG was cloned into ordinary E.coli plasmid vector. A rhu-ANG 0.01% gel in polyethylene oxide was manufactured for the study by ZAO Sajany (Novosibirsk). Rhu-EPO was produced from the cultured biomass of the recombinant strain CHOpE-9. It has been developed by transformation of the cells CHO-Kldhfr with constructed recombinant plasmid pKEP-9 obtained from the ovary cells of the Chinese hamster. For that purpose the fragment Bst EII-BglII (2383 bp) of the plasmid pSV-Ep-gpt which was modified by the human-EPO gene was inserted into the Sma-I site of the vector plasmid pNUT (5733bp) containing the murine metallothionein promoter MT-I and the gene of dihydrofolate reductase [5]. RhuТNF-α was manufactured by use the recombinant E.coli strainSG20050 with cloned into it plasmid pTNF311Δ which is coding the expression of hu-TNF-α from 5-th to 157-th amino acid under a control of a couple of early promoters of the phage T7 [6]. Both rhu-EPO and rhu-TNF-α in gel form in polyethylene oxide were provided by the State Research Centre for Virology and Biotechnology
N.A. Abu Osman et al. (Eds.): BIOMED 2011, IFMBE Proceedings 35, pp. 854–857, 2011. www.springerlink.com
Rat Model of Healing the Skin Wounds and Joint Inflammations
VECTOR (Novosibirsk). Commercial gel Solcoseryl and Butadion ointment were used in the study. Rat surgical wound model. 25 inbred rats (250g to 300 g) were involved in healing of four лштвы ща surgical wounds models produced under animals etherization: A) Flat skin muscle excision at cervical-scapular area, 3 sq cm; B) Skin incision on the mid dorsum down to the plantar fascia, 3 cm; C) Acute arthritis (induced by injection of 0.1 ml 2% formalin solution into the soil at the back of the left hind ankle; the right leg is a control); D) Adjuvant arthritis (induced by injection of 0.1ml of FCA (Freund’s Complete Adjuvant) into the ankle much as in C). The gels were administered once a day topically onto a wound (TOP, for A&B) or by rubbing in the skin followed by putting a plaster (RUBP, for C&D) onto the area of inflammation at rat’s left hind leg as right hind leg serves as a control (RLControl). Blood samples were collected for the hematological tests (HT) from caudal vein before the experiment starts and then on weekly basis. Materials for morphological investigation of wound (MIW) were obtained from sacrficed animals (by decapitation) on 3,7,10,14 and 21st days. The tissue specimens were taken from the wound areas that are contiguous to normal skin and subjected to routine histological treatment [7]. Data were processed in line with the Student-test. Cytological investigations (CI) were conducted on Kamaev’s smears[8].
855
III. RESUTS AND DISCUSSION A flat skin muscle excision model (Figure 1). The wound healing was characterized by the time of primary scab seizure; the term and quality of granulation occurrence, the epithelium development and maturation (visually) and by morphological data.
Fig. 1 FSME model (Flat skin muscle excision model) The wound healing was estimated by the time of primary scab seizure; the term of occurrence and quality of granulation; epithelium development and maturation (visually); and morphological data.
Table 1 Materials and methods of a study Experimental Group
Y
Wound model (Rats No./Groups No.), application mode, assessment mode
X
Z A (25/5)
B (25/5)
C (20/4)
D (20/4)
CONTROL
w/o gel
w/o gel
RLControl
RLControl
Gel ANG
TOP MIW, HT, CI
TOP, MIW, HT, CI
RUBP, oncometry, amputation
RUBP, oncometry, amputation
Gel EPO
TOP MIW, HT, CI
TOP MIW, HT, CI
RUBP, oncometry, amputation
RUBP, oncometry, amputation
Gel TNF-α
TOP MIW, HT, CI
TOP MIW, HT, CI
RUBP, oncometry, amputation
RUBP, oncometry, amputation
Gel Solcoseryl
TOP MIW, HT, CI
TOP MIW, HT, CI
RUBP, oncometry, amputation
RUBP, oncometry, amputation
Butadion cream
-
-
RUBP, oncometry, amputation
RUBP, oncometry, amputation
Fig. 2 FSME model. CONTROL (without a gel application), 5th day. x200, stained with HE (hematoxylin/eosin) Morpho-cytological data: Traumatic inflammation; neutrophilic&serofibrinous exudation (X ); blood vessel dilation (Y ); and inflammatory infiltration in derma (Z ); formation of feeble epithelium at the wound periphery.
The detailed analysis of histological, cytological and morphological findings from the A, B, C, D models studies revealed evident improvement of the wound healing process in the case of separate application of tested cytokines
IFMBE Proceedings Vol. 35
856
A. Gulyaev and V. Piven
X
Z
Y
Fig. 6 FSME model. Gel-Solcoseryl, 5th day, x200, stained with HE
Fig. 3 FSME model. Gel-ANG, 5th day. x200, stained with HE Morpho-cytological data: Swelling of fibrinous &leucocytal layer due to the gel matrix absorbtion (X ); neutrophiles shrink (Y ); reduced dermal inflammatory infiltration; extensive hemorrhages occurred with numerous new fibroblast formations around the blood vessel (Z ).
Morpho-cytological data: characteristic features are swelled fibrous formations (X ); numerous purulent inclusions observed though being less extensive that in the CONTROL (Y ); inflammatory infiltration in the derma reduced.
compared to the CONTROL and Solcoseryl Groups. A few preliminary experiments carried out in the same way as in foresaid ones also revealed the improvement in wound healing with blended gels of all three peptides in question. Below are present the brief data on the cure of acute and adjuvant arthritis with cytokines versus the conventional anti-inflammatory ointment Butadion (phenylbutazone).
Fig. 4 FSME model. Gel-EPO, 5th day. x200, stained with HE Morpho-cytologic data: more matured granulation tissue with elaborated network of blood vessels (X ) and macrophages; shrinking of fibrinous /leucocytal layer; extensive deep-laid edematous areas and plasma absorbtion occurred (Y )
X
Y
Fig. 5 FSME model. Gel-TNF-α, 5th day, x200, stained with HE Morpho-cytological data: Generally the healing pattern is similar to gelEPO; only thin detached superficial fibrinous /leucocytal layer was observed (X ); matured granulation tissue was developed (Y ).
Fig. 7 Manifestations of the acute (left) and adjuvant (right) arthritis The efficacy of healing of acute and adjuvant arthritis was measured by the Index of Inflammation (IoI) as follows: IoI = [(Mi – M0) / M0] x 100% , where Mi is the mass of a stump (amputated leg) of the rat cured by respective substance and, M0, is the mass of the stump non-cured animal. Anti-inflammatory efficiency seems to be still higher with Butadion. Most potent cytokine in both cases was proved to be rec-EPO. However as show the morphocytological findings the pattern of healing of the adjuvant wound was considerably better with recombinant cytokines then with Butadion. The best of them was found to be again rec-EPO. It might indicate the prevalence of impotency of direct oxygen delivery in arthritis compared to the blood capillary growth in the cases of A,B.C.D.
IFMBE Proceedings Vol. 35
Rat Model of Healing the Skin Wounds and Joint Inflammations
857
Table 2 Index of Inflammation in model arthritis Index of Inflammation (IoI), % Experimental Group
Acute arthritis, after 48 hour cure
Adjuvant arthritis, after 48 hour cure
CONTROL
-
-
Gel ANG
5,27 +/- 4.08
12.11 +/- 7.82
Gel EPO
0.09 +/- 0.11.46
-2.57 +/- 4.22
Gel TNF-α
3.46+/- 6.41
3.17 +/- 5.40
Butadion
-10.10 +/- 3.73
-2.49 +/- 8.60
IV. CONCLUSIONS This phenomenological study has shown that rhuangiogenin, rhu-erythropoietin and rhu-TNF-α promise the chances of development individual and likely complex blended drugs for the management of skin lesions. A matrix that most easily releases an active substance was found to be the gel of polyethylene oxide. The best improvement in cure of adjuvant wounds was found in the case of cure with rhu-erythropoietin. This study suggests a principal possibility of development of novel gene therapeutic products for wounds management in human, however the detailed investigations of the mechanisms of healing effects of recombinant human peptides and cytokines on molecular level is to be conducted beforehand.
REFERENCES 1. Barrientos S, Stojadinovic O, Golinko MS, et al. (2008) Growth factors and cytokines in wound healing. Wound Repair Regen. Sept-Oct., 1616(5):585-601 2. Shen JT, Falanga V, (2003) Incorporating Medical and Surgical Dermatology, J. Cutaneous Medicine and Surgery, 7(3), 217-224 3. Shraddha VB, Bhoomika RG, Mayur MP, (2010) Angiogenic targets for potential disorders, Fundamental and Clinical Pharmacology, 17:1, 29-47, DOI: 10.1111/j.1472-8206.2010.00814.x 4. Mertvetsov N, Stephanovich L, (1997) Angiogenin and mechanism of angiogenesis, Novosibirsk, Nauka Publisher, p.77 (in Russian) 5. Patent of Russian Federation #2118662, application # 97108266/13, Priority of 10.09.1998 6. Patent of Russian Federation #2236433, application #2001132071/15, Priority of 28.11.2001. 7. Gabitov V, Beisembaev A, Akramov E, Piven V, etc. (2005) Dfficacy of rhu-angiogenin in regenerative process in aseptic surgical wound. Morpho-cytological rat model, Proc. 6th Natl. Congr. On Genetics, Kuala Lumpur. 8. Sarkisov DS, Remezoy PI (1960) Experimental modeling of human diseases, 320-322.
Author: Vladimir Piven Institute: University Technology Petronas Street: Bandar Seri Iskandar Country: Malaysia E-mail:
[email protected] ACKNOWLEDGMENT We thank the State Research Centre for Virology and Biotechnology VECTOR and ZAO SAJANY (both Novosibirsk) for providing the recombinant substances.
IFMBE Proceedings Vol. 35
Author Index
A Ab Aziz, M.F. 283, 348 Abass, H. 659 Abbah, S. 11 Abbas, A.A. 73, 815 Abbasi-Asl, R. 157 Abbas, Siti Fathimah 674 Abberton, K.M. 831 Abd Razak, N.A. 743 Abdul Hamid, Z.A. 831 Abdul Jamil, M.M. 105, 447, 596, 781, 785 Abdul Latif, L. 739, 762, 765 Abdul Nasir, A.S. 40 Abdul Wahab, A.K. 20, 704 Abdulhadi, L.M. 29, 33, 659 Abdullah, A.R.W. 398 Abdullah, J.M. 480, 548 Abdullah, M.A. 37 Aboodarda, S.J. 241 Abu Osman, N.A. 125, 161, 167, 175, 179, 182, 197, 222, 241, 728, 732, 735, 739, 743, 755, 758, 762, 765 Abu-Bakar, S.A.R. 604 Abusara, Z. 3 Adibpour, F. 708 Adzila, S. 97, 108 Ahmad, M.S. 781 Ahmad, S.A. 121, 556 Ahmad, Z. 827 Ahmed, A.L. 480, 548 Ahsan, Md.R. 536 Akbarzadeh, A. 694 Akhlagpour, S. 47 Akiyama, Y. 237 Alam, S. Imran 245 Alhady, S.S.N. 398 Ali, M.E. 384 Ali, S. 728, 758, 762 Ali, S.H. 121, 556 Ali, Z. 463 Alias, Norma 720 Alizadeh, M. 215, 439 Almejrad, A. 143 Alqap, A.S.F. 108
Chang, H.S.W. 380 Chang, S.H. 153, 789 Che Azemin, M.Z. 655 Che Harun, F.K. 283, 305, 348, 507 Che Man, Y.B. 384 Chee, P.S. 305 Chen, C.C. 69, 375 Chen, C.H. 380 Chen, G.C. 367 Chen, H.C. 356 Chen, H.S. 225, 262 Chen, J.M. 148 Chen, W.C. 380 Cheng, C.C. 367 Cheong, J.P.G. 222 Chia, F.K. 674 Chiu, C.C. 266 Cho, J.M. 258, 344, 769 Choi, D.H. 516, 793 Choi, H.H. 801 Chong, S.S. 674 Chong, Y.Z. 139, 193 Chou, J.C. 69, 375 Chua, Y.P. 112 Chuah, S.Y. 631 Chuan, Y.L. 836 Chung, E.J. 769 Chung, K.C. 225, 262 C´ orcoles, E.P. 275 Cuong, N.V. 84
Amani, T.I. 398 Ambar, R. 781 Amiriyan, M. 51, 80, 102 Anas, S.A. 690 Ang, C.T. 112 Arabshahi, Z. 432 Ariff, A.K. 560 Ariff, F.H.M. 207 Arjmand, E.S. 340 Arof, A.K. 55 Arof, H. 484 Arsalan, A. 292 Arshad, L. 635 Ashofteh-Yazdi, A.R. 130 Ateeq, Ijlal Shahrukh 245 Attaran, A. 503 Augustynek, M. 320, 532 Avolio, A. 1 Ay, M.R. 47, 694, 708, 712 Azad, A.M. 292 Azmy, H. 507 B Baba, R. 393 Babusiak, B. 16 Bader, D. 10 Bahari-Kashani, M. 130 Bajuri, M.N. 773 Bani Hashim, A.Y. 739, 765 Bau, J.G. 356 Bayat, M. 167, 175, 179 Begum, T. 480, 548 Behnamghader, A. 823 Bhaskar, S. 548 Bhullar, A.S. 203 Bin Dato Abdul Kadir, M. Rafiq 215, 432, 439, 773 Binh, N.H. 279 Blencowe, A. 831 Boutelle, M.G. 275 C Cerny, M. 16, 320 Chang, C.C. 450
D
210,
Daisu, M. 237 Darzi, A. 275 Datta, R.S. 292 Davoodi, M.M. 167, 175, 179 Dawal, S.Z.M. 578 Deeba, S. 275 Desai, M.D. 611 Desai, M.R. 611 Deshpande, A.V. 308 Dhahi, T.S. 388 Dixit, V.V. 308 Doi, S. 187 Duy, L.H. 328
860 E Egawa, A. 187 Emami, A. 47 Eshraghi, A. 728, 758, 762, 778 Eslami, A. 47 Esteki, A. 200, 270 F Fallahi, A. 439 Fallahiarezoodar, A. 215 Farahpour, M. 823 Farzampour, S. 157 Fathi Kazerooni, A. 458 Fatoyinbo, H.O. 582 Federico, S. 182 Felix Yap, B.B. 635 Fong, K.M. 139 Forati, T. 823 Fujii, T. 663 Fujimoto, T. 724 Fukuyama, N. 663 G Gala, M. 16 Ganage, D. 308 Ganesan, P. 407 Gan, K.B. 424 Ge, S. 336 Ghadiri, H. 47, 694 Ghafarian, P. 47 Ghani, N.A.A. 207 Ghazanfari, N. 712 Gholizadeh, H. 728, 758, 762 Goh, J.C.H. 11 Gozalian, A. 823 Gulyaev, A. 854 Guo, L.Y. 190 Gym, L.K. 755 H Hagiwara, Y. 151 Hamdi, M. 80, 97, 108 Hameed, Kamran 245 Hamzaid, N.A. 20, 112, 735 Han, H.Z. 367 Han, S.K. 3, 182 Han, Y.H. 623
Author Index Hand, J.W. 332 Hani, A.F.M. 393, 635 Hanna, G.B. 275 Harfiza, A. 643 Harizam, M.Z. 755 Harun, N.H. 617 Haseeb, A.S.M.A. 73 Hashemi, B. 436 Hashim, U. 384, 388 Hashishin, Y. 296 Hasikin, K. 20 Hau, N.V.D. 591 He, S. 407 Heidari, M. 215 Hema, C.R. 287 Herzog, W. 3, 182 Hieda, I. 300 Higashi, Y. 724 Hirata, H. 332 Hirunviriya, S. 750 Hoa, L.M. 229 Hoa, N.V. 229 Hoque, M.E. 836 Houssein, H.A.A. 315, 463 Hsiao, T.C. 797 Hsieh, M.F. 84 Huan, .N. 229 Huang, J.S. 747 Huang, M.T. 225 Huang, T.H. 747 Huang, Y.Y. 574 Hughes, M.P. 582 Hussain, A. 527 Hussain, H. 560 Hussin, I.H. 841 Huy, H.Q.M. 678 I Ibrahim, Arsmah 650, 720 Ibrahim, F. 125, 241, 578 Ibrahimy, M.I. 536 Ibrahim, Z. 484 Ichisawa, S. 420 Idrus, R. 836 Iizuka, T. 187 Ikeya, Y. 663 Inoue, H. 249 Inoue, Y. 187 Inthavong, K. 467
Iramina, K. 336, 492, 519 Ishak, A.J. 121, 556 Ismail, A.H. 312, 315 Ismail, M.Y. 785 Iwahashi, M. 12, 492 J Jaafar, H. 667 Jaafar, M.S. 312, 315, 463 Jaffar Al-Mulla, E.A. 849 Jamil, A. 635 Janckulik, D. 363 Jang, M.Y. 811 Jason Chen, J.J. 367, 380, 600 Jayanthy, A.K. 443 Jeong, W.J. 500, 516 Jhong, G.H. 219 Jitvinder, H.S.D.S. 690 Joung, S. 116 Jumadi, A.M. 686 Jumadi, N.A. 424 Jung, W.B. 623 K Kadri, N.A. 582 Kahar, M.K.B.A. 578 Kamalanand, K. 411 Kamarudin, M.F. 283, 348 Kamarulafizam, I. 560 Kamarul, T. 815 Kamiya, S. 724 Kamyab, M. 728 Kang, D.H. 500, 516 Kang, J.H. 801 Karami, N. 270 Karimi, M.T. 758, 778 Karman, S. 20 Kashani, J. 210, 432, 439 Katayama, Y. 336, 519 Kawakami, M. 187 Kawamura, Y. 552 Kawanishi, H. 324 Kelnar, M. 363 Khai, L.Q. 328 Khalifa, O.O. 536 Khalil, I. 476 Khan, Sana H. 245 Khoa, T.Q.D. 229, 279, 328, 591, 678
Author Index Khoo, Y.J. 139 Khorsandi, R. 157 Kim, J.K. 488 Kim, K.H. 819 Kim, K.S. 801 Kim, N.H. 258, 344, 769 Kim, Y.S. 258 Kitawaki, T. 187 Kobayashi, A. 249 Kobayashi, E. 116 Kodabashi, A. 724 Koloor, S.S.R. 210 Krejcar, O. 363 Kumar, D.K. 655 L Labeed, F.H. 582 Lai, K.A. 225 Lee, A.L. 631 Lee, B.W. 488, 793 Lee, C.G. 488 Lee, C.K. 793 Lee, C.Y. 574 Lee, J.H 623 Lee, M.H. 488, 500, 516, 793 Lee, P.F. 60 Lee, S.J. 500, 516 Lee, Y.B. 488, 500, 516 Lee, Y.H. 801 Lee, Y.K. 542 Leonard, T.R. 3 Leong, X.J. 193 Li, T.H. 262 Li, T.Y. 266 Li, X.P. 2 Li, Y.L. 84 Liao, H. 716 Lim, C.L. 587 Lim, E. 20 Lim, K.C. 569, 690 Lim, K.S. 197 Lim, W.K. 682 Limsakul, C. 233, 750 Lin, C.W. 797 Lin, G.W. 797 Lin, K.P. 403 Lin, M.H. 627 Lin, S.L. 134 Lin, W.C. 403
861 Lin Wang, Y.Y. 148 Linoby, A. 283, 348 Liu, C.H. 69 Liu, H.H. 403 Liu, P.H. 219, 747 Liu, R.S. 403 Liza, S. 73 Loerakker, S. 10 Loudos, G. 708, 712 Low, C.S. 631 Low, J.H. 139 Low, Y.F. 569 Lu, C.Y. 600 Luan, K. 716 ´ ottir, A.G. 728 L´ u v´ıksd´ M Madou, M. 578 Madzin, H. 698 Mahmood, N.H. 283, 348, 496, 686 Mahmoud, A. 33 Mahmoud, H.L. 29, 33 Mahmud, R. 650 Mak, A.F.T. 8 Malarvili, M.B. 415 Malik, A.S. 635 Manaf, Y.A. 37 Manazir Hussain, S. 245 Mansor, M.M. 686 Mansor, M.S.F. 352 Mansor, W. 542 Mardziah, M. 827 Mariam, Mai 472 Mashor, M.Y. 40, 617, 667 Masjuki, H.H. 73 Mat Safri, N. 496, 507 Matsumaru, N. 552 Matsunaga, A. 492 Mazlan, M.H. 161 Md Ali, U.S. 735 Md Zin, H. 735 Merican, A.M. 815 Mineta, H. 371 Mirghami, S.E. 88 Miskon, Azizi 805 Misran, M. 60 Miswan, M.F. 596 Miyashita, T. 170 Miyata, M. 324
Miyazaki, T. 237 Mizushina, S. 332 Moghavvemi, M. 503 Mohamad, D. 596 Mohamed, N.S. 698 Mohamed Saaid, M.F. 484 Mohammed, H.A. 29, 33 Mohd Addi, M. 305 Mohd Ali, A.M. 785 Mohd Ali, M.A. 424 Mohd Kassim, N. 447 Mohd Noor, N. 393 Mohd Nordin, I.N.A. 305 Mohd Saad, N. 604 Mohd Taib, N.A. 340 Mohd Zain, N. 55 Mohd Zaman, M.H. 527 Mok, K.L. 682 Mokhtar, N. 484 Mokji, M.M. 604 Moo, E.K. 182 Moon, C.S. 801 Moon, J.W. 344 Mori, H. 663 Morisaki, A. 12 Morrison, W.A. 831 Moshrefpour Esfahani, M.H. 503 Mousavi, M.E. 200 Muda, S. 604 Mun, C.W. 623, 801, 811 Mustafa, F.H. 312, 315, 463 Mustafa, M.M. 527 Mustafa, S. 384 Muzaimi, M. 480 N Nagai, H. 237 Nagata, S. 324 Nakayama, H. 12 Nakayama, T. 296 Nam, H.Y. 815 Nam, K.C. 300 Nassereldeen, K.A. 88 Najafi Darmian, A. 694 Nazib Adon, M. 447 Nazwa, T. 388 Neghabat, R. 823 Nemati, R. 823 Neuman, M.R. 7
862 Ng, A.M.H. 836 Ng, S.C. 20, 511, 587 Ngadi, M.A. 596 Ngah, U.K. 398 Nguyen, D.H.T. 591 Nicolay, K. 10 Noh Dalimin, M. 447 Nojima, K. 336, 492 Nozari, A.A. 578 Nozari, H. 704 Nugroho, H. 393 Nuidod, A. 750 Nukman, Y. 755 Numata, K. 420 Numata, T. 187 O Ohashi, T. 151 Ohnishi, I. 116 Ohya, T. 716 Oka, H. 187 Okada, Y. 371 Okawai, H. 420 Omair, S.M. 245 Omar, A.F. 315 Omar, H. 480, 548 Omar, N.F. 92 Omar, Sarimah 674 Ong, M.K. 639 Ooi, S.N. 732 Oomens, C. 10 Oshkour, A.A. 167, 175, 179 Osman, M.K. 667 Osman, S.Z. 841 Othman, M.A. 496, 507 P Palmer, J. 831 Panchal, L. 611 Paraskeva, P. 275 Park, S.H. 769 Pashby, I. 836 Paul, A.D. 292 Paulraj, M.P. 287 Penhaker, M. 16, 320, 532 Penhakerova, P. 320 Penington, A.J. 831 Phinyomark, A. 233, 750 Phukpattaranont, P. 233, 750 Pingguan-Murphy, B. 182, 197, 815, 819, 841
Author Index Piven, V. 37, 854 Poon, C.T. 819 Pouladian, M. 694 Pourmajidian, M. 704 Purbolaksono, J. 80 Q Qiao, G.G.
831
R Rabbani, M. 458 Radiman, S. 92 Rahim, K.F. 393 Rahman, W.E.Z.W.A. 650 Ramakrishnan, S. 411 Ramasubba Reddy, M. 443 Rambely, A.S. 207 Ramesh, S. 51, 80, 102, 108 Ramli, R. 170, 484 Ramli, S.N. 496 Ranjit, S.S.S. 690 Ranu, H.S. 143, 203 Rasani, M.R. 467 Raveendran, P. 511, 587 Razman, R. 222 Razmjoo, A. 436 Reza, F. 480, 548 Rezaei, A. 823 Rezai Rad, G.A. 704 Rezayat, E. 359 Rifa’t, H.H. 755 Rosline, H. 40, 617 Rouhi, G.A. 130 Rozalina, A.H. 639 Ryu, Y.S. 488, 500, 793 S Sabtu, N.H. 105 Safaeepour, Z. 200 Safee, M.K.M. 125 Sahak, R. 542 Sakai, H. 845 Sakuma, Ichiro 9, 116, 716 Sakuragawa, S. 371 Salahuddin, L. 604 Salim, A.J. 690 Salleh, N.W. 88 Salleh, S.H. 560 Samra, K.A. 578 Samuel Lai, K.L. 102
Sano, S. 296 Sarkar, S. 708, 712 Saw, A. 112 Sawatsky, A. 3 Sayed, I.S. 643 See, E.Y.S. 11 Sekine, M. 724 Semkovic, J. 320 Seong, H.S. 258, 344, 769 Sepehri, B. 130 Shah, S.R. 611 Shamsudin, S.A. 92 Sharif, J.M. 596 Sharifi, D. 823 Shia, H.W. 134 Shiga, A. 187 Shimamoto, Y. 324 Shinozaki, Y. 663 Shirai, K. 552 Shirazi, A. 694 Sidek, K.A. 476 Sim, K.S. 631, 639, 674, 682 Soin, N. 578 Solomonidis, S. 778 Soo, Y.G. 569 Sopyan, I. 97, 108, 827 Srinivasan, S. 411 Stevens, G. 831 Strauss, D.J. 569 Stula, T. 532 Su, F.C. 190 Su, J.L. 627 Sudirman, R. 496 Sugimoto, K. 237 Sugiura, T. 332, 371 Sujatha, N. 443 Sulaiman, Hanifah 720 Suraya, R.A. 560 Suzuki, T.A. 371 Syed Shikh, S. 116 Sze, W.K. 148 T Tabatabaei, F. 200 Taghizadeh, S. 47 Tahir, Aisha 245 Takada, D. 237 Takahashi, K. 249 Takezawa, S. 12 Tamura, T. 724 Tan, C.K. 639
Author Index Tan, C.Y. 51, 80, 102 Tan, S.T. 674 Tanabe, T. 663 Tang, C.K. 55 Tang, W.C. 428 Tavakkoli, J. 359 Tengku Ibrahim, T.N. 105 Tham, L.K. 197 Thanh, N.T.M. 328 Tharakan, J.T.K.J. 548 Thien, D.D. 229, 279 Thio, T. 578 Thongpanja, S. 233 Thung, K.H. 587 Timimi, Z.A. 315, 463 Ting, C.M. 560 Ting, H.N. 20, 340, 523, 565 Ting, H.Y. 631, 674, 682 Ting, Y.T. 190 Toh, S.L. 11 Toi, V.V. 229, 279, 328, 591, 678 Tolouei, R. 51, 80, 102, 823 Torii, T. 492 Trinh, N.N.P. 279 Tsai, T.C. 367 Tso, C.P. 631, 639 Tu, J.Y. 467 Tukimin, R. 253 Tzeng, M.J. 574
863 Uslama, Jatendra 805 Uyop, N. 283, 686 V Vaghefi, S.E. Verdan, P.M. W Wan Abas, W.A.B. 20, 125, 161, 167, 179, 197, 222, 352, 484, 728, 739, 765, 819 Wan Abdullah, W.A.T. 60 Wan Mahadi, W.N.L. 253, 352 Wan Mahmud, W.M.H. 415 Wan Zaki, W.S. 105 Wang, J. 716 Wang, W.K. 148 Wong, H.C. 428 Wong, H.K. 11 Wu, C. 627 Wu, C.W. 600 Wu, H.F. 225, 262 Wu, M.S. 375 Wu, Y.J. 380 X Xu, H.
U Umetani, K. 663 Umimoto, K. 324 Urzoshi, K.R. 292
25 762
407
Y Yahya, M.Y. 773 Yamanaka, M. 170
Yanagida, J. 324 Yang, F.M. 600 Yang, F.S. 225 Yang, S.H. 262 Yang, Y.A. 769 Yap, B.K. 51, 80, 102 Yasiran, S.S 650 Yassin, I.M. 542 Yatim, A.H.M. 682 Yau, Y.H. 167, 179, 407 Yazdchi, M.R. 458 Yeh, S.J. 134, 266 Yip, C.H. 340 Yokota, Y. 552 Yong, B.F. 565 Yong, K.P. 682 Yoshitake, S. 12 Yoto, T.Y. 371 Yu, N.Y. 153, 789 Yunus, J. 139, 496 Yusof, A. 241 Yusoff, N. 735 Yusop, M.H.M. 384 Z Zabidi, A. 542 Zahedi, E. 157, 359, 424 Zainuddin, R. 698 Zakaria, A. 203 Zamani, M.K. 170 Zeinali, A. 436 Zeraatkar, N. 712 Zourmand, A.R. 523 Zulkarnain, N. 348
Keyword Index
3 3-D foot print device 143 3D joint angle 161 3D joint power 161 3D scaffold 841 3-Dimensional 167 4 400- Series thermistor 245 A A/D converter 363 Accelerometer 732 Accuracy 262 Acetylcholine 663 Actinic keratoses 315 Activity monitor 732 Acute Leukaemia 40 Acute leukemia blood images 617 Adjuvant therapy 380 Adsorption 88 Affine moment invariants 668 Air pressure monitoring 344 Air pump/motor control 344 Airflow 134 Ambulation 732 Amperometry 367 Anastomosis 275 Angiogenin 37 Animal PET 713 Ankle 112 Ankle joint 200 ANOVA 88, 352 ANT+ 283 Antheromatous disease 663 Anthropometric 193 Antimicrobial 55 Apnea 467 Arithmetic 279 Arm rehabilitation 781 Arm Swing 222 Arrhythmia 292, 552 Arthroplasty 773 Articulate patellar 755 Artifact 504 Artificial hand gripper 785
Artificial intelligence 542 Artificial knee cap 755 Artificial neural network 536, 667 Atheromatous disease 663 Atherosclerosis 411 Attenuation correction 643 Auditory late response 569 Auditory selective attention 569 Automatic speech recognition 565 Autonomic nervous system 371, 420 Autonomic neuropathy 266 Available chlorine 324 B Bactericidal activity 324 Bacterial colonies 105 Ball size 190 Bayesian inference 450 BCI 507 Beat 320 Benign 340 Bio-amplifier Bioceramic 103 Bioengineering 25 Biological tissue 296 Biomarker 37 Biomechanics 222, 229 Biomedical CT image 706 Biomedical engineering 16 Biomedical instrumentation 139 Biomedical measurement 303 Biomedical signal processing 542 BioMEMS 578 Biometric field 686 Biometrics 476 Bio-sensor 245, 275, 388 Block of Interest 686 Block positioning 686 Block-based 686 Blood cell 596 Blood disorder 596 Blood flow 403 Blood perfusion 444 Blood pressure 678 Blood substitutes 845 Blood vessel 411
Bluetooth 363 BMI 503 Body motion wave (BMW) 420 Body powered prosthetics 743 Bone marrow 815 Bone mechanics 130 Bone mineral density 47 Bone tissue engineering Boundaries 650 Bowel ischemia 275 Bowing 126 Bradford 682 Brain 237 Brain activities 328 Brain computer interface 488, 501, 516, 591 Brain machine interfaces 287 Brain temperature 332 Brain wave frequency 480 Breast cancer 37, 674 Breast tumor 340, 722 Brittle cracking 214 Bubble technology insoles 147 Burn wounds 443 C C# 363 Calcination 51 Calcium phosphate 108 Calibration 359, 716 Cancellous bone 440 Cancer cells 582 Capacitance 356 Capillary valve 578 Cartilage tissue engineering 841 CdS QDs 92 CdS-lysozyme conjugates 92 Cell death 182 Cell growth 812 Cell mechanics 182 Cell migration 428 Cell orientation 815 Cell viability 811 Cell-ECM interactions 428 Cells 447 Center of pressure 797 Cepstrum 528
866 Ceramic scaffolds 836 Change point detection 484 Children speech 523, 564 Chin 29 Chitin 55 Chitosan 55 Chondrocyte 182 Chondrocyte signaling 3 Circuit flow rate 12 Circuit pressure 12 Circuit priming volume 12 Classification 40, 121, 556, 611 Closed-loop control 789 Cluster index 750 Clustering 617, 621 CNT-GAS 88 Cognitive task 279 Color 639, 698 Color coded 283 Combined cue 516 COM-COP inclination angles 190 Common average reference 511 Common-mode noise reduction 258 Communication 320 Comparative analysis 488 Complete blood count 596 Complexity 270 Compression 587 Compressive failure 436 Compressive stress 167, 179 Computational modeling 25 Computer aided design (CAD) 735 Computerized evaluation 153 Consistency 222 Contact pressure 167 Continuous passive motion 112 Contractile phenotype 151 Contrast 643 Contrast normalization 631 Contrast stretching 604 Conventional lithographic 388 Core stability ball exercise 190 Correct rate 724 Correlation analysis 724 CR-39 NTDs 312 Cross evaluation 500 Cross-approximate entropy (Co-ApEn) 266 Cross-correlation 655 CST EM STUDIO ® 448 CT 694 Current source density 511 CW CO2 laser 296 Cyclic uniaxial loading 815 Cyclic voltammetry 357, 367 Cytochrome C oxidase 602
Keyword Index D Damage mechanics 210 Data preprocessing 415 Decompressive craniotomy 237 Dental post 219 Detectability 643 Detector 534 Developing countries 574 Developmental coordination disorder 789 DEXA 47 DHS 225 Diabetic and normal subjects 144 Diabetics 266 Dielectric constant 340 Dielectrophoresis 582 Differentiate Diffusion 60 Digital camera 33 Digital filter 258 Digital image analyzer 659 Digital mammograms 720 Digital scanner 33 Discrete wavelet transform 536 Disinfect 324 Donations 574 Dopamine 367 Dorsolateral prefrontal cortex 492 Double layer 356 Doxorubicin 84 Drowsiness detection 308 Drowsiness monitoring 308 DWI 604 Dynamic air pressure sensor 420 E Early infarct 640 ECM degradation 430 Edge Detection 720 Education 16, 25 EEG signal processing 287 Elastic tubing 241 Elbow joint 215 Electric field intensity 301 Electric fields 447 Electric loading 459 Electrical conductivity 324 Electrical double layer 60 Electrocardiogram (ECG) 283, 320, 476, 532 Electrochromic 69 Electroencephalography (EEG) 484, 488, 500, 503, 507, 511, 516, 519, 548 Electrogastrography (EGG) 249 Electrolyzed water 324
Electromagnetic field radiation 352 Electromyogram 801 Electromyographic control 556 Electromyography (EMG) 352, 536, 750 Electromyography (EMG) signal 121, 125, 157, 233, 536, 750 Electrophoretic mobility 60 Electrostatic Interaction 93 Endodontically treated teeth 210, 432 Endoscopy 631 Energy absorption 175 Enhance distance active contour 650 Epilepsy 548 Equal error rate 562 Equiangular tight frame (ETF) 705 Equivalent circuits 519 Ergonomics 155 ERP 492 Ethernet 245 Euler/Cardanic angle 161 Eumelanin 393 European union 16 Evaluation 517 Evoked 549 Exhalation 470 Explicit dynamics procedure 213 Extracellular matrix 151 Extrusion 837 eZ430-Chronos 305 F Face 659 Face detection 308 Fast fourier transform (FFT) 507 Fatty amides 849 FEA 171 Feature analysis 698 Feature extraction 41, 557, 751 Feature selection 750 Feedforward neural networks 542 Ferrule effect 432 Fibrin 841 Filtration 533 Fine motor 789 Finite element 130 Finite element analysis 169, 179, 180, 219, 432, 747, 776 Finite element method 179, 436 Finite element model 411 Finite element modeling 182 Finite element study 439 Finite integration technique 447 FIR filter 258 Flap valve 578
Keyword Index
867
Flex sensor 785 Flexible array sensor 375 Flexion relaxation 125 Flowrate 407 Fluid-structure interaction 398, 467 Flux peak 463 fMRI 724 Foot slide 222 Force estimation 157 Formant frequency 523 Forsterite 102 Fracture reduction force 116 Fracture reduction path 116 Fracture reduction robot 116 Freehand ultrasound 716 Frequency compression 527 Front 30 Full extension landing 175 Full-body suit 187 Function Fitting 519 Fundamental frequency 523 Fusing IT technology 769 Fuzzy K-means 617 Fuzzy Logic 121, 398
Heating 108 Hematocrit (HCT) 463 Hemodynamic response 600 Hemoglobin 635 He-Ne laser 463 Herbal extract 819 High frequency hearing loss 527 Histogram normalization 631 Homeostasis 797 Hounsfield units 639 Human amniotic membrane 841 Human computer interaction 536 Human pupil measurement 686 Human spine 203 Human vertebra 436 Hybrid nanobioprobe 384 Hybridization kinetics 384 Hydrogel scaffolds 831 Hydroxyapatite 51, 80, 97, 108, 823 Hypothermia 332 Hypothyroid 542 Hysteresis 200
G
ICA 635 IIR filter 258 Ilizarov ring 112, 139 Image recognition 631 Impact 130, 182 Impedance 356 In vivo 315, 823, 312 Inclination 797 Induced artifact 519 Inexpensive 139 Infants 332 Integrin expression 151 Interactive game 801 Interconnected pore structures 827 Inter-crystal scattering 708, 712 Interfacing technique 245 Internal bone remodeling 458 Inverse dynamics 161 In-vivo subcutaneous implantation 831 Ion resonance frequency 811 IQ test 678 Iris recognition 686 Iron deposition 623 IronCad 735 Ischemia 332 Ischemic stroke 639 Isometric contraction 496 Isotonic contraction 233
Gait analysis system 139 Gamma-law 604 Gastroesophageal reflux disease (GERD) 249 Gastrostomy 249 GATE 694, 708, 712 Gaussian mixture model 560 Gendarussa vulgaris 819 Gender identification in children 523 Genetic algorithm 704 GMISS 574 GNU radio 300 Gold nanoparticles 380 Granulation tissue 635 Graph 739, 765 Graphical user interface 686 Graying 769 Ground reaction force 765 H Habituation 472 Haemodialysis 12 Hair color 315 Hammerstein-Wiener model 157 Hand prosthesis 735 Handwriting 153 Heart disease 116 Heart period 415 Heart rate 305, 415, 532 Heart rate monitor 283, 348 Heart rate variability 371, 415, 552, 249
I
K Kane’s method 207 Knee biomechanics 3 Knee joint 175
L Lab-on-chip 582 LabVIEW 305 LAN 245 Laser percussion 296 Laser speckle 443 Laser-induced sound 296 Late auditory evoked potential 472 Lateral nanogap 388 Latex glove 682 LB agar 105 Legendre 587 Lesion recognition 674 Liner 728, 758 Liposome 845 Lipozyme 849 Live cell imaging 3 Loading 203 Longitudinal stress 148 Long-term 532 Look up table 292 Loss factor 340 Loss tangent 340 Low pass filtered speech 527 Low perfusion index 258 Low power portable medical equipment 332 Low-cost 732 LSCI 443 Lumbar interbody fusion 439 Lung cancer 170, 312 M Magnetic fields 805 Malay vowel 523 Malay vowel recognition 565 Malaysian university student 193 Malignant 340 Mammogram Manometer 262 Manometry 262 Mathematical model 428 Matlab distributed computing server 720 MCF-7 811 Mean frequency 233 Mechanical design 735 Mechanical properties 51, 80 Mechanical pump Mechanically ventilated patients 262 Mechanochemical 97 Median frequency 233 Medical robotic 785 Medical-grade silicone 29, 33 MEG 480, 548 Melanin 393 Melanoma 270
868 Memory biomaterials 143 Mercury 88 Mesenchymal stem cell 815 Method evaluating rehabilitation status 793 MG-63 811 MGF 704 MgO 80 Microangiography 663 Microbubbles 359 Microcalcifications 643 Microcirculation 25 Microcontroller programming 112, 139 Microdialysis 275 Microfluidic compact disc 578 Microphone 296 Microprocessor 320 Microsoft visual basic software 105 Microwave radiometry 332 Microwave sintering 827 Milling 108 Milling Speed 97 Miswak (Kayu Sugi) 480 MMV 682 Modified Beer-Lambert law 393 Monitoring 552 Monitoring device 781 Monte carlo simulation 424 Morphological analysis 627 Morphological data 407 Morphometric relation 659 Motion analysis 197 Motion assists 187 Motion changes 690 Motion-defined pattern 724 Motor control 496, 789 Motor cortex 229 Motor execution 591 Motor imagery 488, 500, 516 Motor imaging 591 Movement analysis 157 Moving K-means 617, 631 Mozart effect 678 MRI 674 MTT assay 811 Multilayer perceptron 40, 476 Multi-modality medical images 698 Murine retina 407 Muscle 125 Muscle activation 190 Muscle activity 352 Muscle weakness 3 Muscular activity 187 Musculoskeletal Model 116
Keyword Index N Nasogastric tube placement 262 Near- infrared spectroscopy 229, 591, 600 Negative feedback 245 Network model 407 Network topology 407 Neural network 287, 398, 476 Neurofeedback 500 Neuron activity 591 Neurorehabilitation 480 Neuroscience 678 Neurovascular coupling 600 NIRS machine 678 Nitric oxide 845 Noise robustness 587 Non- rapid eyes movement (NREM) Nonlinear 170, 266 Nonlinear feature extraction 270 Nonlinear finite element analysis 210 Nonlinear resonance 359 Non-stationary 484 Novelty detection 472 Numerical profile 739 O Ocular lens 25 OpenCV 308 Open-loop control 789 Optical properties 92, 424 Optimal performance 488 Optimization 134 Orthogonal moments 587 Orthosis 778 Orthotics 762 Osteoarthritis 3, 841 Osteoblast 819 Osteoporosis 225, 778 Oxidation 73 Oxide semiconductor 388 Oxygen saturation 305 P P300 492 Parallax 712 Parallel processing 720 Parametric dictionary (PD) 704 Parietal region 279 Parkinson's disease 367 Partial directed coherence 496 Particle swarm optimization 484, 542 Patellar 755 Patellar tendon reflex 197
Pattern recognition 556 PDT 348 Penetration 708 Perceptual reversal 336 Permittivity 300, 340 pH sensitivity 375 pH sensor 71 Phalange 735 Phantom 47 Phase stability Phase transformation 108 Pheomelanin 393 Photothermal therapy 380 Physical agent 480 Physical fatigue 511 Pistoning 758 Pixelated scintilator 708 Plantar foot pressures 143 Plaque 144 Plasmapheresis 12 PLEDs 158 Plethysmography 320 Point-of-care 578 Poisson process 450 Polyethylenimine (PEI) 92 Polymeric micelle 84 Polynomial 476 Polysilicon 389 Polysomnography 328 Porous calcium phosphates 827 Positioning substraction 690 Post 432 Posture 797 Posture balance 190 Power spectrum 233 Pressure distribution 744 Pressure mat 797 Process parameter 837 Proliferation 815, 819 Prosthesis 556, 732, 735, 750 Prosthesis control 121 Prosthetic foot 739, 741 Prosthetics 765 Prostration 126 Psoriasis 315 Pulse oximeter 320 Pulse oximetry 258, 260 Pulse wave 320 Pupil recognition 686 PWM 293 Q QALY 576 Quantitative computed tomography 47, 436
Keyword Index Quasi-stiffness 200 Quincunx wavelet 615 R Rabbit 312 Radio frequency (RF) 367 Radio frequency sputtering 376 Radium-226 312 Random dot kinematogram 724 RANSAC 716 Rapid eyes movement (REM) 328 Rapid prototyping 837 Rat BMSC 819 Recurrent breast cancer 451 Reference analysis 451 Reflectance optical sensor array 424 Rehabilitation 241, 785, 801 Respiratory mechanics 135 Retinal vessel diameter 655 Retrieval study 73 RF module 306 Rheumatoid arthritis 773 Rhu-angiogenin 854 Rhu-erythropoietin 854 Rhu-TNF-Į 854 Root fracture 432 RR Interval 532 RS-232 interface 321 rTMS 336, 492 S Safety 116 Satisfaction 420 Saturation 320 Saturation component 618, 621 Scaffold 823,836 Scatter 694 Screen-printing 375 SDR 302 Segmentation 597, 604, 720 Self-organizing map (SOM) 627 Semi-infinte tissue 424 Senior-friendly industry 769 Septic shock 552 Serum 37 Shape 698 Short-time fourier transform (STFT) 250 Shoulder 207 Sigmoidal relationship 384 Signal enhancement 674 Silver ion 55 Silver sulfate 55 Simulation 459 Single sweeps 570
869 Sinterability 54, 80 Sintering 97 Sinusoidal 484 Skin and hair optics 315 Skin chromophores 393 Small animal imaging 708 Smooth muscle cells 151 Socket 758 Soft-tissue engineering 831 Solenoid valve control 344 Sol-Gel method 69 Somatosensory evoke potential 600 Soybean oil 849 Spatial pressure 407 Speaker verification 560 Species specific nanobiosensor 384 SPECT 643 Spectral envelope 527 Speech intelligibility 527 Spinal column 203 Spinal cord injury 778 SPR 696 SrHA porous scaffolds 829 Stability 775 Stainless-steel 356 Stair ascending 161 Star topology 245 Statistical test 463 Stem cells 815 Stiffness 237 Strength training 241 Stress 371 Stress concentration 219 Stress distribution 215, 439, 747 Stress-relaxation 203 Stretching exercise 148 Strip-type conductive fabric sensor 793 Structural similarity 631 Study 16 Superior parietal lobule 336 Support vector machine 270 Supramarginal gyrus 492 Surface charge 60 Surface plasmon resonance 380 Suspension 728,758 SWI 623 Synchrotron radiation 663 Synthesis 102 synthetic oligo-targets 384 Synthetic phenotype 151 T Tactile 237 Targeted delivery 84
Targeted oxygen delivery 845 Tchebichef 587 Technomedicum 69 Template matching 398 Texture analysis 627 Texture characterization 611 Texture descriptor 698 Thiourea 849 Thoracoscopy 170 Thresholding 604 Tibia 130 Tibiofermoral joint 179 Time delay neural network 565 Time dependent 203 Tissue engineering 811, 823, 836 Tissue phantom 443 Tissue sections 667 Titanium dioxide 69,105 Tooth 659 Torques 207 Total elbow arthroplasty 215 Total knee replacement 73, 755 Total temporomandibular joint 747 Traction 428 Training system 641 Transabdominal 424 Transcranial magnetic stimulation 519 Transfusion alternative 847 Transitional cell carcinoma 380 Transmittance 69 Transradial prosthetics 743 Transtibial prosthesis 728 Trend 552 Tricalcium phosphate 823 Tuberculosis bacilli detection 667 U UHMWPE 73 Ulcers 635 Ultrasound 359 Ultrasound image 627 UMMC 762 Unconscious response 420 Unstable fracture 225 Urine 340 V Variability 222 Variable BPM option 293 Variable external resistance training 241 Velocity 407 Ventilator 134 Vessel profile 656 Vickers microhardness 98
870 Viscoelastic stiffness 201 Viscoelasticity 237 Viscosity 60 Visual processing 499 Visualization 363 VL-spectrometer 29, 30 Volumetry 624 W Wall shear stress 408 Warning 309 Wavelet 569 Wavelet coherence 473 Wavelet decomposition 613
Keyword Index wavelet transform 398 Wavelet transform modulus maxima 720 Wavelet-phase stability 569 Wear 73 Wearable computing technology 795 Wearable monitoring 371 Wearable system 140 Weight bearing 728 Weight reduction Wire 226 Wireless heart rate 283 Wireless sensor network 375 Welfare equipments 771
Welfare of Korea and Japan 769 White blood cells 40 Wound healing 854 Wrist 773 Writer’s cramp 153 WSN 348 Z ZigBee wireless sensor technology 348 Zygoma 30