Handbook of Research on Systems Biology Applications in Medicine

Handbook of Research on Systems Biology Applications in Medicine Andriani Daskalaki Max Planck Institute for Molecular Genetics, Berlin, Germany

Volume I

Medical Information science reference Hershey • New York

Director of Editorial Content: Senior Managing Editor: Managing Editor: Assistant Managing Editor: Typesetter: Cover Design: Printed at:

Kristin Klinger Jennifer Neidig Jamie Snavely Carole Coulson Sean Woznicki Lisa Tosheff Yurchak Printing Inc.

Published in the United States of America by Information Science Reference (an imprint of IGI Global) 701 E. Chocolate Avenue, Suite 200 Hershey PA 17033 Tel: 717-533-8845 Fax: 717-533-8661 E-mail: [email protected] Web site: http://www.igi-global.com and in the United Kingdom by Information Science Reference (an imprint of IGI Global) 3 Henrietta Street Covent Garden London WC2E 8LU Tel: 44 20 7240 0856 Fax: 44 20 7379 0609 Web site: http://www.eurospanbookstore.com Copyright © 2009 by IGI Global. All rights reserved. No part of this publication may be reproduced, stored or distributed in any form or by any means, electronic or mechanical, including photocopying, without written permission from the publisher. Product or company names used in this set are for identi.cation purposes only . Inclusion of the names of the products or companies does not indicate a claim of ownership by IGI Global of the trademark or registered trademark. Library of Congress Cataloging-in-Publication Data Handbook of research on systems biology applications in medicine / Andriani Daskalaki, editor. p. ; cm. Includes bibliographical references and index. Summary: “This book highlights the use of systems approaches including genomic, cellular, proteomic, metabolomic, bioinformatics, molecular, and biochemical, to address fundamental questions in complex diseases like cancer diabetes but also in ageing”--Provided by publisher. ISBN 978-1-60566-076-9 (h/c) 1. Biological control systems--Handbooks, manuals, etc. 2. Medicine--Research--Handbooks, manuals, etc. I. Daskalaki, Andriani. [DNLM: 1. Systems Biology--methods. 2. Models, Theoretical. QU 26.5 H2367 2009] R852.H36 2009 610.72--dc22 2008020863 British Cataloguing in Publication Data A Cataloguing in Publication record for this book is available from the British Library. All work contributed to this book set is original material. The views expressed in this book are those of the authors, but not necessarily of the publisher.

If a library purchased a print copy of this publication, please go to http://www.igi-global.com/agreement for information on activating the library's complimentary electronic access to this publication.

Editorial Advisory Board

Ralf Herwig Max Planck Institute for Molecular Genetics, Germany Chuchuka Enwemeka New York Institute of Technology, USA Christoph Wierling Max Planck Institute for Molecular Genetics, Germany Elisabeth Maschke-Dutz Max Planck Institute for Molecular Genetics, Germany James Adjaye Max Planck Institute for Molecular Genetics, Germany Athina Lazakidou University of Piraeus, Greece Sofia Kossida Academy of Athens, Greece Melpomeni Lazakidou General Hospital Salzburg, Austria Anastasia Kastania Athens University, Greece

List of Contributors

Abdeljaoued-Tej, Ines / ESSAI-UR Algorithmes et Structures, Tunisia............................................ 377 Adolphs, Julia / Freie Universität Berlin, Germany.......................................................................... 573 Ahmed, Jessica / Charité Universitaetsmedizin Berlin, Germany..................................................... 423 Albrecht, Daniela / Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany.......................................................................................... 403 Al.eri, Roberta / CNR - Institute for Biomedical Technologies, Italy and CILEA, Italy................... 476 Argyropoulos, Christos / University of Pittsburgh Medical Center, USA......................................... 221 Bagos, Pantelis G. / University of Central Greece, and University of Athens, Greece.............. 167, 182 Baumann, Marc / Biomedicum, Helsinki University, Finland........................................................... 694 Benkahla, Alia / Institut Pasteur de Tunis, Tunisia............................................................................ 377 Benovoy, David / McGill University and Genome Québec Innovation Centre, Canada................... 262 Beuthan, Jürgen / Charité Universitaetsmedizin Berlin, Germany................................................... 673 Boutayeb, Abdesslam / Faculté des sciences Oujda-Morocco, Morocco.................................. 798, 809 Brakhage, Axel A. / Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany and Friedrich Schiller University (FSU), Germany........ 403 Brazhe, Alexey R. / Technical University of Denmark, Denmark and Moscow State University, Russia.............................................................................................................................................. 656 Brazhe, Nadezda A. / Technical University of Denmark, Denmark and Moscow State University, Russia.............................................................................................................................................. 656 Bryan, Kenneth / University College Dublin (UCD), Ireland........................................................... 826 Cho, Kwang-Hyun / Korea Advanced Institute of Science and Technology (KAIST), Korea.............. 11 Clevert, Djork-Arné / Charité Universitaetsmedizin Berlin, Germany and Johannes Kepler University Linz, Austria................................................................................................................... 251 Cunningham, Pádraig / University College Dublin (UCD), Ireland................................................ 826 Daskalaki, Andriani / Max Planck Institute for Molecular Genetics, Germany............................... 643 Daskalakis, Antonis / University of Patras, Greece........................................................................... 221 de Bono, Bernard / European Bioinformatics Institute, UK and University of Malta, Malta........... 714 de Carvalho Lima Lobato, Ana Katerine / Federal University of Rio Grande do Norte, Brazil and Potiguar University, Brazil....................................................................................................... 458 Dellagi, Koussay / Institut Pasteur de Tunis, Tunisia......................................................................... 377 Derouich, Mohamed / Faculté des sciences Oujda-Morocco, Morocco.................................... 798, 809 Desai, Prerak / Utah State University, USA....................................................................................... 278

Deu.hard, Peter / Zuse Institute Berlin, Germany; Freie Universität Berlin, Germany; and DFG Research Center Matheon, Germany............................................................................................... 759 DiFranco, Matthew / University College Dublin (UCD), Ireland..................................................... 826 Dressler, Cathrin / Laser- und Medizin-Technologie GmbH, Berlin, Germany................................. 673 Esposti, F. / Politecnico di Milano, Italy............................................................................................. 541 Evelo, C.T.A. / University of Maastricht, The Netherlands................................................................ 339 Flack, L.K. / University of Queensland, Australia............................................................................. 209 Foley, Ross / University College Dublin (UCD), Ireland................................................................... 826 Gallagher, William M. / University College Dublin (UCD), Ireland................................................ 826 Georgiev, G. / Institute of Mechanics and Biomechanics, Bulgaria..................................................... 27 Ghazal, Peter / University of Edinburgh Medical School, Scotland and Centre for Systems Biology at Edinburgh, Scotland.......................................................................................................... 1 Gillies, Duncan / Imperial College London, UK................................................................................ 516 Gopalakrishnan, Vanathi / University of Pittsburgh, USA............................................................... 126 Guizani-Tabbane, Lamia / Institut Pasteur de Tunis, Tunisia........................................................... 377 Guthke, Reinhard / Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany.......................................................................................... 403 Hache, Hendrik / Max Planck Institute for Molecular Genetics, Germany....................................... 497 Hamblin, Michael R. / Massachusetts General Hospital - Boston, USA; Harvard Medical School, USA; and Harvard-MIT Division of Health Sciences and Technology, USA.................................. 588 Hamodrakas, Stavros J. / University of Athens, Greece........................................................... 167, 182 Hossbach, Julia / Charité Universitaetsmedizin Berlin, Germany..................................................... 423 Kleffe, Jürgen / Charité Universitaetsmedizin Berlin, Germany....................................................... 291 Kniemeyer, Olaf / Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany........................................................................................... 403 Kossida, Sophia / Biomedical Research Foundation of the Academy of Athens, Greece and Biomedicum, Helsinki University, Finland...................................................................................... 694 Kotev, V. / Institute of Mechanics and Biomechanics, Bulgaria........................................................... 27 Kowald, Axel / Medizinisches Proteom Center (MPC), Ruhr-Universität Bochum, Germany.......... 312 Kuznetsov, Andrew / Freiburg University, Germany........................................................................... 97 Kwan, Tony / McGill University and Genome Québec Innovation Centre, Canada......................... 262 Lambin, P. / GROW Research Institute, University of Maastricht, The Netherlands........................ 339 Maffezzoli, A. / Politecnico di Milano, Italy....................................................................................... 541 Majewski, Jacek / McGill University and Genome Québec Innovation Centre, Canada.................. 262 Makrantonaki, Evgenia / Dessau Medical Center, Germany and Charité Universitaetsmedizin Berlin, Germany............................................................................................................................... 331 Maksimov, Georgy V. / Moscow State University, Russia................................................................. 656 Maschke-Dutz, Elisabeth / Max Planck Institute for Molecular Genetics, Germany......................... 74 Mavituna, Ferda / The University of Manchester, UK....................................................................... 458 McLachlan, G.J. / University of Queensland, Australia.................................................................... 209 Meinel, Thomas / Max Planck Institute for Molecular Genetics, Germany...................................... 143 Mendoza, Luis / Universidad Nacional Autónoma de México, Mexico............................................. 530 Milanesi, Luciano / CNR - Institute for Biomedical Technologies, Italy........................................... 476 Miled, Slimane Ben / Institut Pasteur de Tunis, Tunisia and ENIT-LAMSIN, Tunisia...................... 377 Minet, Olaf / Charité Universitaetsmedizin Berlin, Germany............................................................ 673 Mishra, Alok / Imperial College London, UK.................................................................................... 516

Moschopoulos, Charalampos / Biomedical Research Foundation of the Academy of Athens, Greece....694 Mosekilde, Erik / Technical University of Denmark, Denmark......................................................... 656 Mulrane, Laoighse / University College Dublin (UCD), Ireland...................................................... 826 Munoz-Hernandez, Raul / The University of Manchester, UK......................................................... 458 Nikiforidis, George / University of Patras, Greece............................................................................ 221 Nikolov, S. / Institute of Mechanics and Biomechanics, Bulgaria........................................................ 27 Numata, Jorge / Freie Universität Berlin, Germany.......................................................................... 731 Orešič, Matej / VTT Technical Research Centre of Finland, Finland................................................ 354 Pavlov, Alexey N. / Saratov State University, Russia......................................................................... 656 Petrov, V. / Institute of Mechanics and Biomechanics, Bulgaria.......................................................... 27 Pham, Tuan D. / James Cook University, Australia........................................................................... 117 Preissner, Robert / Charité Universitaetsmedizin Berlin, Germany.................................................. 423 Rasche, Axel / Max-Planck-Institute for Molecular Genetics, Germany................................... 251, 361 Reinecke, Isabel / Zuse Institute Berlin, Germany............................................................................. 759 Rexhepaj, Elton / University College Dublin (UCD), Ireland........................................................... 826 Sakellaropoulos, George / University of Patras, Greece................................................................... 221 Santiago-Cortés, Elizabeth / Universidad Nacional Autónoma de México, Mexico........................ 530 Seigneuric, R. / GROW Research Institute, University of Maastricht, The Netherlands................... 339 Sgourakis, Nikolaos G. / Rensselaer Polytechnic Institute, USA...................................................... 167 Signorini, M.G. / Politecnico di Milano, Italy.................................................................................... 541 Sosnovtseva, Olga V. / Technical University of Denmark, Denmark................................................. 656 Sreenath, Sree / Case Systems Biology Initiative, Case Western Reserve University, USA................. 11 Starmans, M.H.W. / GROW Research Institute, University of Maastricht, The Netherlands........... 339 Stier, Heike / Charité Universitaetsmedizin Berlin, Germany............................................................ 291 Theodosiou, Athina / Biomedical Research Foundation of the Academy of Athens, Greece............. 694 van Erk, A. / University of Maastricht, The Netherlands................................................................... 339 van Riel, N.A.W. / Eindhoven University of Technology, The Netherlands....................................... 339 Vicini, Paolo / University of Washington, USA................................................................................... 556 Vidal-Puig, Antonio / Institute of Metabolic Science, Addenbrooke’s Hospital, UK......................... 354 Watson, R. William / University College Dublin (UCD), Ireland..................................................... 826 Weimer, Bart / Utah State University, USA........................................................................................ 278 Wellstead, Peter / The Hamilton Institute, National University of Maynooth, Ireland........................ 11 Wolkenhauer, Olaf / University of Rostock, Germany......................................................................... 11 Wouters, B.G. / GROW Research Institute, University of Maastricht, The Netherlands................... 339 Wrede, Paul / Charité Universitaetsmedizin Berlin, Germany.......................................... 291, 423, 438 Wruck, Wasco / Max Planck Institute for Molecular Genetics, Germany......................................... 239 Zabarylo, Urszula / Charité Universitaetsmedizin Berlin, Germany................................................ 673 Zouboulis, Christos C. / Dessau Medical Center, Germany and Charité Universitaetsmedizin Berlin, Germany............................................................................................................................... 331

Table of Contents

Foreword . .......................................................................................................................................xxxiii Preface . ............................................................................................................................................ xxxv Acknowledgment . ................................................................................................................................ xl Volume I Section I Basic Concepts in Medical Systems Biology Chapter I Pathway Biology Approach to Medicine ................................................................................................ 1 Peter Ghazal, University of Edinburgh Medical School, Scotland and Centre for Systems Biology at Edinburgh, Scotland Chapter II Systems and Control Theory for Medical Systems Biology . ............................................................... 11 Peter Wellstead, The Hamilton Institute, National University of Maynooth, Ireland Sree Sreenath, Case Systems Biology Initiative, Case Western Reserve University, USA Kwang-Hyun Cho, Korea Advanced Institute of Science and Technology (KAIST), Korea Olaf Wolkenhauer, University of Rostock, Germany Chapter III Mathematical Description of Time Delays in Pathways Cross Talk . ................................................... 27 S. Nikolov, Institute of Mechanics and Biomechanics, Bulgaria V. Petrov, Institute of Mechanics and Biomechanics, Bulgaria V. Kotev, Institute of Mechanics and Biomechanics, Bulgaria G. Georgiev, Institute of Mechanics and Biomechanics, Bulgaria Chapter IV Deterministic Modeling in Medicine .................................................................................................... 74 Elisabeth Maschke-Dutz, Max Planck Institute for Molecular Genetics, Germany

Chapter V Synthetic Biology as a Proof of Systems Biology ................................................................................ 97 Andrew Kuznetsov, Freiburg University, Germany Section II Advanced Computational Methods for Systems Biology Chapter VI Computational Models for the Analysis of Modern Biological Data ................................................. 117 Tuan D. Pham, James Cook University, Australia Chapter VII Computer Aided Knowledge Discovery in Biomedicine ................................................................... 126 Vanathi Gopalakrishnan, University of Pittsburgh, USA Section III Genomics and Bioinformatics for Systems Biology Chapter VIII Function and Homology of Proteins Similar in Sequence: Phylogenetic Profiling . .......................... 143 Thomas Meinel, Max Planck Institute for Molecular Genetics, Germany Chapter IX Computational Methods for the Prediction of GPCRs Coupling Selectivity ..................................... 167 Nikolaos G. Sgourakis, Rensselaer Polytechnic Institute, USA Pantelis G. Bagos, University of Central Greece, and University of Athens, Greece Stavros J. Hamodrakas, University of Athens, Greece Chapter X Bacterial β-Barrel Outer Membrane Proteins: A Common Structural Theme Implicated in a Wide Variety of Functional Roles ................................................................................................ 182 Pantelis G. Bagos, University of Central Greece, and University of Athens, Greece Stavros J. Hamodrakas, University of Athens, Greece Section IV Experimental Techniques for Systems Biology Chapter XI Clustering Methods for Gene-Expression Data .................................................................................. 209 L.K. Flack, University of Queensland, Australia G.J. McLachlan, University of Queensland, Australia

Chapter XII Uncovering Fine Structure in Gene Expression Profile by Maximum Entropy Modeling of cDNA Microarray Images and Kernel Density Methods ............................................................... 221 George Sakellaropoulos, University of Patras, Greece Antonis Daskalakis, University of Patras, Greece George Nikiforidis, University of Patras, Greece Christos Argyropoulos, University of Pittsburgh Medical Center, USA Chapter XIII Gene Expression Profiling with the BeadArrayTM Platform ............................................................... 239 Wasco Wruck, Max Planck Institute for Molecular Genetics, Germany Chapter XIV The Affymetrix GeneChip® Microarray Platform .............................................................................. 251 Djork-Arné Clevert, Charité Universitaetsmedizin Berlin, Germany and Johannes Kepler University Linz, Austria Axel Rasche, Max-Planck-Institute for Molecular Genetics, Germany Chapter XV Alternative Isoform Detection Using Exon Arrays . ........................................................................... 262 Jacek Majewski, McGill University and Genome Québec Innovation Centre, Canada David Benovoy, McGill University and Genome Québec Innovation Centre, Canada Tony Kwan, McGill University and Genome Québec Innovation Centre, Canada Chapter XVI Gene Expression in Microbial Systems for Growth and Metabolism ................................................ 278 Prerak Desai, Utah State University, USA Bart Weimer, Utah State University, USA Chapter XVII Alternative Splicing and Disease ........................................................................................................ 291 Heike Stier, Charité Universitaetsmedizin Berlin, Germany Paul Wrede, Charité Universitaetsmedizin Berlin, Germany Jürgen Kleffe, Charité Universitaetsmedizin Berlin, Germany Section V Systems Biology and Aging Chapter XVIII Mathematical Modeling of the Aging Process . .................................................................................. 312 Axel Kowald, Medizinisches Proteom Center (MPC), Ruhr-Universität Bochum, Germany

Chapter XIX The Sebaceous Gland: A Model of Hormonal Aging ......................................................................... 331 Evgenia Makrantonaki, Dessau Medical Center, Germany and Charité Universitaetsmedizin Berlin, Germany Christos C. Zouboulis, Dessau Medical Center, Germany and Charité Universitaetsmedizin Berlin, Germany Section VI Systems Biology Applications in Medicine Chapter XX Systems Biology Applied to Cancer Research ................................................................................... 339 R. Seigneuric, GROW Research Institute, University of Maastricht, The Netherlands N.A.W. van Riel, Eindhoven University of Technology, The Netherlands M.H.W. Starmans, GROW Research Institute, University of Maastricht, The Netherlands A. van Erk, University of Maastricht, The Netherlands C.T.A. Evelo, University of Maastricht, The Netherlands B.G. Wouters, GROW Research Institute, University of Maastricht, The Netherlands P. Lambin, GROW Research Institute, University of Maastricht, The Netherlands Chapter XXI Systems Biology Strategies in Studies of Energy Homeostasis In Vivo ............................................. 354 Matej Orešič, VTT Technical Research Centre of Finland, Finland Antonio Vidal-Puig, Institute of Metabolic Science, Addenbrooke’s Hospital, UK Chapter XXII Approaching Type 2 Diabetes Mellitus by Systems Biology ............................................................. 361 Axel Rasche, Max-Planck-Institute for Molecular Genetics, Germany Chapter XXIII Systems Biology and Infectious Diseases .......................................................................................... 377 Alia Benkahla, Institut Pasteur de Tunis, Tunisia Lamia Guizani-Tabbane, Institut Pasteur de Tunis, Tunisia Ines Abdeljaoued-Tej, ESSAI-UR Algorithmes et Structures, Tunisia Slimane Ben Miled, Institut Pasteur de Tunis, Tunisia and ENIT-LAMSIN, Tunisia Koussay Dellagi, Institut Pasteur de Tunis, Tunisia

Chapter XXIV Systems Biology of Human-Pathogenic Fungi . ................................................................................. 403 Daniela Albrecht, Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany Reinhard Guthke, Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany Olaf Kniemeyer, Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany Axel A. Brakhage, Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany and Friedrich Schiller University (FSU), Germany

Volume II Section VII Systems Biology and Drug Design Chapter XXV Development of Specific Gamma Secretase Inhibitors ...................................................................... 423 Jessica Ahmed, Charité Universitaetsmedizin Berlin, Germany Julia Hossbach, Charité Universitaetsmedizin Berlin, Germany Paul Wrede, Charité Universitaetsmedizin Berlin, Germany Robert Preissner, Charité Universitaetsmedizin Berlin, Germany Chapter XXVI In Machina Systems for the Rational De Novo Peptide Design ......................................................... 438 Paul Wrede, Charité Universitaetsmedizin Berlin, Germany Chapter XXVII Applications of Metabolic Flux Balancing in Medicine . ................................................................... 458 Ferda Mavituna, The University of Manchester, UK Raul Munoz-Hernandez, The University of Manchester, UK Ana Katerine de Carvalho Lima Lobato, Federal University of Rio Grande do Norte, Brazil and Potiguar University, Brazil Section VIII Data Integration and Data Mining Chapter XXVIII Multi-Level Data Integration and Data Mining in Systems Biology . ................................................ 476 Roberta Al.eri, CNR - Institute for Biomedical T echnologies, Italy and CILEA, Italy Luciano Milanesi, CNR - Institute for Biomedical Technologies, Italy

Chapter XXIX Methods for Reverse Engineering of Gene Regulatory Networks ..................................................... 497 Hendrik Hache, Max Planck Institute for Molecular Genetics, Germany Chapter XXX Data Integration for Regulatory Gene Module Discovery . ................................................................ 516 Alok Mishra, Imperial College London, UK Duncan Gillies, Imperial College London, UK Chapter XXXI Discrete Networks as a Suitable Approach for the Analysis of Genetic Regulation .......................... 530 Elizabeth Santiago-Cortés, Universidad Nacional Autónoma de México, Mexico Luis Mendoza, Universidad Nacional Autónoma de México, Mexico Chapter XXXII Investigating the Collective Behavior of Neural Networks: A Review of Signal Processing Approaches . ..................................................................................... 541 A. Maffezzoli, Politecnico di Milano, Italy F. Esposti, Politecnico di Milano, Italy M.G. Signorini, Politecnico di Milano, Italy Chapter XXXIII The System for Population Kinetics: Open Source Software for Population Analysis ...................... 556 Paolo Vicini, University of Washington, USA Section IX Systems Biology in Photochemical Processes Chapter XXXIV Photosynthesis: How Proteins Control Excitation Energy Transfer ................................................... 573 Julia Adolphs, Freie Universität Berlin, Germany Chapter XXXV Photodynamic Therapy: A Systems Biology Approach . .................................................................... 588 Michael R. Hamblin, Massachusetts General Hospital - Boston, USA; Harvard Medical School, USA; and Harvard-MIT Division of Health Sciences and Technology, USA Chapter XXXVI Modeling of Porphyrin Metabolism with PyBioS .............................................................................. 643 Andriani Daskalaki, Max Planck Institute for Molecular Genetics, Germany

Section X Modeling Cellular Physiology Chapter XXXVII Interference Microscopy for Cellular Studies . ................................................................................... 656 Alexey R. Brazhe, Technical University of Denmark, Denmark and Moscow State University, Russia Nadezda A. Brazhe, Technical University of Denmark, Denmark and Moscow State University, Russia Alexey N. Pavlov, Saratov State University, Russia Georgy V. Maksimov, Moscow State University, Russia Erik Mosekilde, Technical University of Denmark, Denmark Olga V. Sosnovtseva, Technical University of Denmark, Denmark Chapter XXXVIII Fluorescence Imaging of Mitochondrial Long-Term Depolarization in Cancer Cells Exposed to Heat-Stress ....................................................................................................................... 673 Cathrin Dressler, Laser- und Medizin-Technologie GmbH, Berlin, Germany Olaf Minet, Charité Universitaetsmedizin Berlin, Germany Urszula Zabarylo, Charité Universitaetsmedizin Berlin, Germany Jürgen Beuthan, Charité Universitaetsmedizin Berlin, Germany Section XI Tools for Molecular Networks Chapter XXXIX Protein Interactions and Diseases ....................................................................................................... 694 Athina Theodosiou, Biomedical Research Foundation of the Academy of Athens, Greece Charalampos Moschopoulos, Biomedical Research Foundation of the Academy of Athens, Greece Marc Baumann, Biomedicum, Helsinki University, Finland Sophia Kossida, Biomedical Research Foundation of the Academy of Athens, Greece and Biomedicum, Helsinki University, Finland Chapter XL The Breadth and Depth of BioMedical Molecular Networks: The Reactome Perspective ................ 714 Bernard de Bono, European Bioinformatics Institute, UK and University of Malta, Malta

Section XII Mathematical Modeling Approaches Chapter XLI Entropy and Thermodynamics in Biomolecular Simulation .............................................................. 731 Jorge Numata, Freie Universität Berlin, Germany Chapter XLII Model Development and Decomposition in Physiology .................................................................... 759 Isabel Reinecke, Zuse Institute Berlin, Germany Peter Deuflhard, Zuse Institute Berlin, Germany; Freie Universität Berlin, Germany; and DFG Research Center Matheon, Germany Chapter XLIII A Pandemic Avian Influenza Mathematical Model ............................................................................ 798 Mohamed Derouich, Faculté des sciences Oujda-Morocco, Morocco Abdesslam Boutayeb, Faculté des sciences Oujda-Morocco, Morocco Chapter XLIV Dengue Fever: A Mathematical Model with Immunization Program . ............................................... 809 Mohamed Derouich, Faculté des sciences Oujda-Morocco, Morocco Abdesslam Boutayeb, Faculté des sciences Oujda-Morocco, Morocco Section XIII Data Processing in Histopathology Chapter XLV Automated Image Analysis Approaches in Histopathology ............................................................... 826 Ross Foley, University College Dublin (UCD), Ireland Matthew DiFranco, University College Dublin (UCD), Ireland Kenneth Bryan, University College Dublin (UCD), Ireland Elton Rexhepaj, University College Dublin (UCD), Ireland Laoighse Mulrane, University College Dublin (UCD), Ireland R. William Watson, University College Dublin (UCD), Ireland Pádraig Cunningham, University College Dublin (UCD), Ireland William M. Gallagher, University College Dublin (UCD), Ireland

Detailed Table of Contents

Foreword . .......................................................................................................................................xxxiii Preface . ............................................................................................................................................ xxxv Acknowledgment . ................................................................................................................................ xl Volume I Section I Basic Concepts in Medical Systems Biology Chapter I Pathway Biology Approach to Medicine ................................................................................................ 1 Peter Ghazal, University of Edinburgh Medical School, Scotland and Centre for Systems Biology at Edinburgh, Scotland Systems biology provides a new approach to studying, analyzing and ultimately controlling biological processes. Biological pathways represent a key sub-system level of organization that seamlessly perform complex information processing and control tasks. The aim of pathway biology is to map and understand the cause-effect relationships and dependencies associated with the complex interactions of biological networks and systems. Drugs that therapeutically modulate the biological processes of disease are often developed with limited knowledge of the underlying complexity of their specific targets. Considering the combinatorial complexity from the outset might help identify potential causal relationships that could lead to a better understanding of the drug-target biology as well as provide new biomarkers for modeling diagnosis and treatment response in patients. This chapter discusses the use of a pathway biology approach to modeling biological processes, providing a new framework for experimental medicine in the post-genomic era. Chapter II Systems and Control Theory for Medical Systems Biology . ............................................................... 11 Peter Wellstead, The Hamilton Institute, National University of Maynooth, Ireland Sree Sreenath, Case Systems Biology Initiative, Case Western Reserve University, USA Kwang-Hyun Cho, Korea Advanced Institute of Science and Technology (KAIST), Korea Olaf Wolkenhauer, University of Rostock, Germany

In this chapter the authors describe systems and control theory concepts for systems biology and the corresponding implications for medicine. The context for a systems approach to the life sciences is outlined, followed by a brief history of systems and control theory. The technical aspects of systems and control theory are then described in a way oriented toward their biological and medical application. This description is then used as a reference base against which to indicate specific areas where systems and control theory aspects of systems biology have strong medical implications. Chapter III Mathematical Description of Time Delays in Pathways Cross Talk . ................................................... 27 S. Nikolov, Institute of Mechanics and Biomechanics, Bulgaria V. Petrov, Institute of Mechanics and Biomechanics, Bulgaria V. Kotev, Institute of Mechanics and Biomechanics, Bulgaria G. Georgiev, Institute of Mechanics and Biomechanics, Bulgaria In this chapter the authors investigate how the inclusion of time delay alters the dynamic properties of (a) delayed protein cross talk model, (b) time delay model of RNA silencing (RNA interference), and (c) time delay in ERK and STAT interaction. The consequences of a time delay on the dynamics of those systems are analyzed using Hopf’s theorem and Lyapunov-Andronov theory. The analytical calculations predict that time delay acts as a key bifurcation parameter, which is confirmed by numerical simulations. Chapter IV Deterministic Modeling in Medicine .................................................................................................... 74 Elisabeth Maschke-Dutz, Max Planck Institute for Molecular Genetics, Germany This chapter describes the basic mathematical methods for the deterministic kinetic modeling of biochemical systems. Mathematical analysis methods, the respective algorithms, and appropriate tools and resources, as well as established standards for data exchange, model representations, and definitions are presented. The methods comprise time-course simulations, steady-state search, parameter scanning, and metabolic control analysis among others. An application is demonstrated using a test-case model that describes parts of the extrinsic apoptosis pathway and a small example network demonstrates an implementation of metabolic control analysis. Chapter V Synthetic Biology as a Proof of Systems Biology ................................................................................ 97 Andrew Kuznetsov, Freiburg University, Germany Biologists have used a reductionist approach to investigate the essence of life. In previous years, scientific disciplines have merged with the aim of studying life on a global scale in terms of molecules and their interactions. Based on high-throughput measurements, Systems Biology adopts mathematical modeling and computational simulation to reconstruct natural biological systems. Synthetic Biology seeks to engineer artificial biological systems starting from standard molecular compounds coding in DNA. Can Systems and Synthetic Biology be combined with the idea of creating a new science—SYS Biology—that will not demarcate natural and artificial realities? What will this approach bring to medicine?

Section II Advanced Computational Methods for Systems Biology Chapter VI Computational Models for the Analysis of Modern Biological Data ................................................. 117 Tuan D. Pham, James Cook University, Australia Computational models have been playing a significant role for the computer-based analysis of biological and biomedical data. Given the recent availability of genomic sequences, microarray gene expression, and proteomic data, there is an increasing demand for developing and applying advanced computational techniques for exploring these types of data. For example, functional interpretation of gene expression data, deciphering of how genes and proteins work together in pathways and networks, and extracting and analyzing phenotypic features of mitotic cells for high throughput screening of novel anti-mitotic drugs. Successful applications of advanced computational algorithms to solving modern life-science problems will make significant impacts on several important and promising issues related to genomic medicine, molecular imaging, and the scientific knowledge of the genetic basis of diseases. This chapter reviews the fusion of engineering, computer science, and information sciences with biology and medicine, to address some latest technical developments in the computational analyses of modern biological data: microarray gene expression data, mass spectrometry data, and bioimaging. Chapter VII Computer Aided Knowledge Discovery in Biomedicine ................................................................... 126 Vanathi Gopalakrishnan, University of Pittsburgh, USA This chapter provides a perspective on three important collaborative areas in systems biology research that represent biological problems of clinical significance. The first area deals with macromolecular crystallization, which is a crucial step in protein structure determination. The second deals with proteomic biomarker discovery from high-throughput mass spectral technologies, while the third area is protein structure prediction and complex fold recognition from sequence and prior knowledge of structure properties. For each area, successful case studies are revisited from the perspective of computer-aided knowledge discovery using machine learning and statistical methods. Information about protein sequence, structure, and function is slowly accumulating in standardized forms within databases. Methods are needed to maximize the use of this prior information for prediction and analysis purposes. This chapter provides insights into such methods by which information available in existing databases can be processed and combined with systems biology expertise to expedite biomedical discoveries Section III Genomics and Bioinformatics for Systems Biology Chapter VIII Function and Homology of Proteins Similar in Sequence: Phylogenetic Profiling . .......................... 143 Thomas Meinel, Max Planck Institute for Molecular Genetics, Germany

The calculation of sequence similarity is an easily feasible way to compute protein comparisons. The comparison of complete proteomes touches one of the earliest topics in bioinformatics—the biologically meaningful organization of proteins in protein families. Several approaches that interpret function or evolutionary aspects of proteins from sequence similarity are reviewed. In particular, this reflects the arsenal of techniques introduced until now. Phylogenetic profiling, a method that compares a set of genes or proteins by their presence or absence across a given set of organisms, is also presented in this chapter. Proteins in a functional context, for example, a pathway or a protein complex, are represented by identical or similar phylogenetic profiles. The detection of functional contexts by phylogenetic profiling is playing a prospective role as an analytic tool also in systems biology. Already established tools for phylogenetic profiling as well as particular biological examples based on the SYSTERS protein family data set are presented. Chapter IX Computational Methods for the Prediction of GPCRs Coupling Selectivity ..................................... 167 Nikolaos G. Sgourakis, Rensselaer Polytechnic Institute, USA Pantelis G. Bagos, University of Central Greece, and University of Athens, Greece Stavros J. Hamodrakas, University of Athens, Greece GPCRs comprise a wide and diverse class of eukaryotic transmembrane proteins with well-established pharmacological significance. As a consequence of recent genome projects, there is a wealth of information at the sequence level that lacks any functional annotation. These receptors, often quoted as orphan GPCRs, could potentially lead to novel drug targets. However, typical experiments that aim at elucidating their function are hampered by the lack of knowledge on their selective coupling partners at the interior of the cell, the G-proteins. Up-to-date computational efforts to predict properties of GPCRs have been focused mainly on the ligand-binding specificity, while the aspect of coupling has been less studied. Here, we present the main motivations, drawbacks, and results from the application of bioinformatics techniques to predict the coupling specificity of GPCRs to G-proteins, and discuss the application of the most successful methods in both experimental works that focus on a single receptor and large-scale genome annotation studies. Chapter X Bacterial β-Barrel Outer Membrane Proteins: A Common Structural Theme Implicated in a Wide Variety of Functional Roles ................................................................................................ 182 Pantelis G. Bagos, University of Central Greece, and University of Athens, Greece Stavros J. Hamodrakas, University of Athens, Greece β-barrel outer membrane proteins constitute the second and less studied class of transmembrane proteins. They are present exclusively in the outer membrane of Gram-negative bacteria and presumably in the outer membrane of mitochondria and chloroplasts. During the last few years, remarkable advances have been made towards the understanding of their functional and structural features. It is now well-known that β-barrels are performing a large variety of biologically important functions for the bacterial cell. Such functions include acting as specific or non-specific channels, receptors for various compounds, enzymes, translocation channels, structural and adhesion proteins. These functional roles are of great importance for the survival of the bacterial cell under various environmental conditions or for the pathogenic proper-

ties expressed by these organisms. We review in this chapter the currently available literature regarding the structure and function of bacterial outer membrane proteins. We emphasize the functional diversity expressed by a common structural motif such as the β-barrel, and we provide evidence from the current literature for dozens of newly discovered families of transmembrane β-barrels. Section IV Experimental Techniques for Systems Biology Chapter XI Clustering Methods for Gene-Expression Data .................................................................................. 209 L.K. Flack, University of Queensland, Australia G.J. McLachlan, University of Queensland, Australia Clustering methods are used to place items in natural patterns or convenient groups. They can be used to place genes into clusters, with the genes placed in clusters having similar expression patterns across the tissue samples of interest. They can also be used to cluster tissues into groups on the basis of their gene profiles. Some of the methods used are hierarchical agglomerative clustering, k-means clustering, self organizing maps, and model-based methods. This chapter’s focus is on using mixtures of multivariate normal distributions to provide model-based clusterings of tissue samples and of genes. Chapter XII Uncovering Fine Structure in Gene Expression Profile by Maximum Entropy Modeling of cDNA Microarray Images and Kernel Density Methods ............................................................... 221 George Sakellaropoulos, University of Patras, Greece Antonis Daskalakis, University of Patras, Greece George Nikiforidis, University of Patras, Greece Christos Argyropoulos, University of Pittsburgh Medical Center, USA The presentation and interpretation of microarray-based genome-wide gene expression profiles as complex biological entities are considered to be problematic due to their featureless, dense nature. Furthermore microarray images are characterized by significant background noise, but the effects of the latter on the holistic interpretation of gene expression profiles remains under-explored. We hypothesize that a framework combining Bayesian methodology for background adjustment in microarray images with model-free modeling tools, may serve the dual purpose of data and model reduction, exposing hitherto hidden features of gene expression profiles. Within the proposed framework, microarray image restoration and noise adjustment is facilitated by a class of prior Maximum Entropy distributions. The resulting gene expression profiles are non-parametrically modeled by kernel density methods, which not only normalize the data, but facilitate the generation of reduced mathematical descriptions of biological variability as mixture models. Chapter XIII Gene Expression Profiling with the BeadArrayTM Platform ............................................................... 239 Wasco Wruck, Max Planck Institute for Molecular Genetics, Germany

This chapter describes the application of the BeadArrayTM technology for gene expression profiling. It introduces the BeadArrayTM technology, shows possible approaches for data analysis, and demonstrates to the reader how the technology performs in comparison to alternative microarray platforms. With this technique, results of high quality can be achieved so that many researchers consider employing it for their projects. It can be expected that it will gain a lot in importance in the future. The author hopes that this resumé will introduce researchers to this novel way of performing gene expression experiments, thus giving them a profound base for judging which technology to employ. Chapter XIV The Affymetrix GeneChip® Microarray Platform .............................................................................. 251 Djork-Arné Clevert, Charité Universitaetsmedizin Berlin, Germany and Johannes Kepler University Linz, Austria Axel Rasche, Max-Planck-Institute for Molecular Genetics, Germany Readers shall find a quick introduction with recommendations into the Preprocessing of Affymetrix GeneChip® microarrays. In the rapidly growing field of microarrays, gene expression, especially the Affymetrix GeneChip arrays, is an established technology present for over ten years on the market. Used in biomedical research, the mass of information demands statistics for its analysis. This chapter presents the particular design of GeneChip arrays, where much research has already been invested and some validation resources for the comparison of the methods are available. For a basic understanding of the preprocessing we emphasize the steps–namely: back­ground correction, normalization, perfect match correction, summarization–coup­led with alternative probe-gene assignments. Combined with a recommendation of successful methods, a first use of the new technology becomes possible. Chapter XV Alternative Isoform Detection Using Exon Arrays . ........................................................................... 262 Jacek Majewski, McGill University and Genome Québec Innovation Centre, Canada David Benovoy, McGill University and Genome Québec Innovation Centre, Canada Tony Kwan, McGill University and Genome Québec Innovation Centre, Canada Eukaryotic genes have the ability to produce several distinct products from a single genomic locus. Recent developments in microarray technology allow monitoring of such isoform variation at a genome-wide scale. In our research, we have used Affymetrix Exon Arrays to detect variation in alternative splicing, initiation of transcription, and poly-adenylation among humans. We demonstrated that such variation is common in human populations and has an underlying genetic component. Here, we use our study to illustrate the use of Exon Arrays to detect alternative isoforms, to outline the analysis involved, and to point out potential problems that may be encountered by researchers using this technology. Chapter XVI Gene Expression in Microbial Systems for Growth and Metabolism ................................................ 278 Prerak Desai, Utah State University, USA Bart Weimer, Utah State University, USA Systems biology is increasingly underpinning our concept of microbial physiology. However, the tools needed for this approach produce such large data sets that we become paralyzed trying to link the data

with the biological interpretation. Often, microbiologists are forced to use unfamiliar statistical tools that require computer science skills that are beyond our experience. Therefore, the analysis phase prohibits the full integration of the tools associated with the burgeoning genome sequences that are publicly available. Mining the genomes for hidden gems of metabolic content is on the verge of exploding with new tools for metabolic flux predictions. However, experimental evidence to verify the models is not keeping pace. Merging bioinformatics with “-omics” tools to verify the metabolic models will be highlighted. The goal of this chapter is to provide an overview of “-omics” tools to study microbial metabolism that is accessible to a newcomer to microbial systems biology; yet, provide some new linking growth with genetic regulation information that will appeal to experienced physiologists. A systems biology context will be the underpinnings of this submission to link the growth (cell division) and survival (non-culturable) with metabolism and metabolic changes. Chapter XVII Alternative Splicing and Disease ........................................................................................................ 291 Heike Stier, Charité Universitaetsmedizin Berlin, Germany Paul Wrede, Charité Universitaetsmedizin Berlin, Germany Jürgen Kleffe, Charité Universitaetsmedizin Berlin, Germany Alternative splicing is an important part of the regular process of gene expression. It controls time and tissue dependent expression of specific splice forms and depends on the correct function of about 60 splicing factor proteins of which many are the product of alternative splicing itself. It is therefore not surprising that even minor sequence disturbances can cause mis-spliced gene products with pathological effects. We survey some common diseases which can be traced back to a malfunction of alternative splicing, including cystic fibrosis, beta-thalassemia, spinal muscular atrophy, and cancer. Cancer also often results from even mis-spliced splicing factors leading to randomly spliced non-functional isoforms of several genes. Section V Systems Biology and Aging Chapter XVIII Mathematical Modeling of the Aging Process . .................................................................................. 312 Axel Kowald, Medizinisches Proteom Center (MPC), Ruhr-Universität Bochum, Germany Aging is a complex biological phenomenon that practically affects all multicellular eukaryotes. It is manifested by an ever increasing mortality risk, which finally leads to the death of the organism. Modern hygiene and medicine has led to an amazing increase in average life expectancy over the last 150 years. However, the underlying biochemical mechanisms of the aging process are still poorly understood. However, a better understanding of these mechanisms is increasingly important, since the growing fraction of elderly people in the population confronts our society with completely new and challenging problems. The aim of this chapter is to provide an overview of the aging process, discuss how it relates to system biological concepts, and explain how mathematical modeling can improve our understanding of biochemical processes involved in the aging process. We concentrate on the modeling of stochastic effects

that become important when the number of involved entities (molecules, organelles, cells) is very small and the reaction rates are low. This is the case for the accumulation of defective mitochondria, which we describe mathematically in detail. In recent years, several tools became available for stochastic modeling, therefore we also provide a brief description of the most important ones. Of course, mitochondria are not the only target of modeling efforts in aging research. Therefore, the chapter concludes with a brief survey of other interesting computational models in this field of research. Chapter XIX The Sebaceous Gland: A Model of Hormonal Aging ......................................................................... 331 Evgenia Makrantonaki, Dessau Medical Center, Germany and Charité Universitaetsmedizin Berlin, Germany Christos C. Zouboulis, Dessau Medical Center, Germany and Charité Universitaetsmedizin Berlin, Germany This chapter introduces an in vitro model as a means of studying human hormonal aging. For this purpose, human sebaceous gland cells were maintained under a hormone-substituted environment consisting of growth factors and sex steroids in concentrations corresponding to those circulating in young and postmenopausal women. The authors suggest that hormone decline, occurring with age, may play a significant role not only in the maintenance of skin homeostasis, but also in the initiation of aging. Furthermore, skin, the largest organ of the body, offers an alternative approach to understanding the molecular mechanisms underlining the aging process. Section VI Systems Biology Applications in Medicine Chapter XX Systems Biology Applied to Cancer Research ................................................................................... 339 R. Seigneuric, GROW Research Institute, University of Maastricht, The Netherlands N.A.W. van Riel, Eindhoven University of Technology, The Netherlands M.H.W. Starmans, GROW Research Institute, University of Maastricht, The Netherlands A. van Erk, University of Maastricht, The Netherlands C.T.A. Evelo, University of Maastricht, The Netherlands B.G. Wouters, GROW Research Institute, University of Maastricht, The Netherlands P. Lambin, GROW Research Institute, University of Maastricht, The Netherlands Complex diseases such as cancer have multiple origins and are therefore difficult to understand and cure. Highly parallel technologies such as DNA microarrays are now available. They provide a data deluge which needs to be mined for relevant information and integrated to existing knowledge at different scales. Systems Biology is a recent field which intends to overcome these challenges by combining different disciplines and provide an analytical framework. Some of these challenges are discussed in this chapter.

Chapter XXI Systems Biology Strategies in Studies of Energy Homeostasis In Vivo ............................................. 354 Matej Orešič, VTT Technical Research Centre of Finland, Finland Antonio Vidal-Puig, Institute of Metabolic Science, Addenbrooke’s Hospital, UK In this chapter the authors report on their experience with analysis and modeling of data obtained from studies of animal models related to obesity and metabolic syndrome. The complex interactions of genetic and environmental factors contributing to the failure of energy balance that lead to obesity, as well as tight systemic regulation to maintain energy homeostasis, require application of the systems biology strategy at the physiological level. In vivo systems offer the possibility of investigating not only the effects of specific genetic modifications or treatments in selected tissues and organs, but also to elucidate compensatory allostatic mechanisms induced to maintain the homeostasis of the whole system. A key challenge for systems biology is to characterize different systems’ responses in the context of activated pathways. One possible strategy is based on reconstruction of tissue specific pathways using lipidomics, or metabolomics in general, in combination with proteomic and transcriptomic profiles. This approach was applied to an obese mouse model and revealed activation of multiple liver pathways that may lead to metabolic products that may impair insulin sensitivity. Chapter XXII Approaching Type 2 Diabetes Mellitus by Systems Biology ............................................................. 361 Axel Rasche, Max-Planck-Institute for Molecular Genetics, Germany We acquired new computational and experimental prospects to seek insight and cure for millions of afflicted persons with an ancient malady. Type 2 diabetes mellitus (T2DM) is a complex disease with a network of interactions among several tissues and a multifactorial pathogenesis. Research conducted in human and multiple animal models has strongly focused on genetics so far. High-throughput experimentation techniques, such as microarrays, provide new tools to amend current knowledge. By integrating those results, the aim is to develop a systems biology model assisting the diagnosis and treatment. Beside experimentation techniques and platforms, or rather general concepts for a new term in biology and medicine, this chapter joins the conceptions with a rather actual medical challenge. It outlines current results and envisions a possible alley to the comprehension of T2DM Chapter XXIII Systems Biology and Infectious Diseases .......................................................................................... 377 Alia Benkahla, Institut Pasteur de Tunis, Tunisia Lamia Guizani-Tabbane, Institut Pasteur de Tunis, Tunisia Ines Abdeljaoued-Tej, ESSAI-UR Algorithmes et Structures, Tunisia Slimane Ben Miled, Institut Pasteur de Tunis, Tunisia and ENIT-LAMSIN, Tunisia Koussay Dellagi, Institut Pasteur de Tunis, Tunisia This chapter reports a variety of molecular biology informatics and mathematical methods that model the cell response to pathogens. First, the authors the main steps of the immune response, then list the high throughput biotechnologies, generating a wealth of information on the infected cell and some of the immune related databases. Last, they explain how to extract meaningful information from these sources. The modeling aspect is divided into modeling molecular interaction and regulatory networks, through

dynamic Boolean and Bayesian models, and modeling biochemical networks and regulatory networks, through Differential/Difference Equations. The interdisciplinary approach explains how to construct a model that mimics the cell’s dynamics and can predict the evolution and the outcome of infection. Chapter XXIV Systems Biology of Human-Pathogenic Fungi . ................................................................................. 403 Daniela Albrecht, Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany Reinhard Guthke, Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany Olaf Kniemeyer, Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany Axel A. Brakhage, Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany and Friedrich Schiller University (FSU), Germany This chapter describes a holistic approach in order to understand the molecular biology and infection process of human-pathogenic fungi. It comprises the whole process of analyzing transcriptomic and proteomic data. Starting with biological background, information on Aspergillus fumigatus and Candida albicans, two of the most important fungal pathogens, are given. Afterwards, techniques to create transcriptome and proteome data are described. The chapter continues by explaining methods for data processing and analysis. It shows the need for, and problems with data integration as well as the role of standards, ontologies, and databases. General aspects of these three major topics are explained and connected to the research on human-pathogenic fungi. Finally, the near future of this research topic is highlighted. This chapter aims to provide an overview on analyses of data from different cellular levels of human-pathogenic fungi. It describes their integration and application of systems biology methodologies.

Volume II Section VII Systems Biology and Drug Design Chapter XXV Development of Specific Gamma Secretase Inhibitors ...................................................................... 423 Jessica Ahmed, Charité Universitaetsmedizin Berlin, Germany Julia Hossbach, Charité Universitaetsmedizin Berlin, Germany Paul Wrede, Charité Universitaetsmedizin Berlin, Germany Robert Preissner, Charité Universitaetsmedizin Berlin, Germany Secretases are aspartic proteases, which specifically trim important, medically relevant targets like the amyloid-precursor protein (APP) or the Notch-receptor. Therefore, changes in their activity can lead to dramatic diseases like M. Alzheimer caused by aggregation of peptidic fragments. On the other hand, the secretases are interesting targets for molecular therapy of the multiple myeloma, because in this case, the over-expressed Notch-receptor does not emerge into the native conformation until the cleavage by the

gamma secretase occurs. In this chatper, the authors focus on a novel methodology of structure-based drug development that is feasible without prior knowledge of the target structure—analogy modelling. This combination of similarity screening, fold recognition, ligand-supported modelling, and docking is exemplarily illustrated for the structure of the membranal gamma secretase and specific inhibitors Chapter XXVI In Machina Systems for the Rational De Novo Peptide Design ......................................................... 438 Paul Wrede, Charité Universitaetsmedizin Berlin, Germany Peptides fulfill many tasks in controlling and regulating cellular functions. They are key molecules in systems biology. There is a great demand in science and industry for a fast search of innovative peptide structures. In this chapter, a combination of a computer-based guided search of novel peptides in sequence space with their biological experimental validation is introduced. The computer-based search uses an evolutionary algorithm, including artificial neural networks, as fitness function and a mutation operator, called the PepHarvester. Optimization occurs during 100 iterations. This system, called DARWINIZER, is applied in the de novo design of neutralizing peptides against auto antibodies from DCM (dilatative cardiomyopathy) patients. Another approach is the optimization of peptide sequences by an ant colony optimization process. This biologically-oriented system identified several novel weak binding T-cell epitopes. Chapter XXVII Applications of Metabolic Flux Balancing in Medicine . ................................................................... 458 Ferda Mavituna, The University of Manchester, UK Raul Munoz-Hernandez, The University of Manchester, UK Ana Katerine de Carvalho Lima Lobato, Federal University of Rio Grande do Norte, Brazil and Potiguar University, Brazil Recently, metabolic flux analysis (MFA) has attracted great interest for researchers in metabolic engineering. The objective of MFA is to identify the factors and mechanisms responsible to improve cell metabolism or properties. This approach has been widely used for the quantification of intracellular fluxes in metabolism of bacteria, yeast, filamentous fungi, and animal cells. The ease of formulation, versatility in use and general spectrum of application, has made the metabolic flux analysis method a potential approach for the analysis of metabolic physiology and the design of optimal bioprocesses. This chapter is divided in six topics: Streptomyces and antibiotic production; Review of metabolic engineering and metabolic flux analysis; Basic concepts of metabolic flux analysis; Reconstruction of Streptomyces metabolism; Metabolic modelling and Applications of metabolic flux analysis for antibiotic production in Streptomyces. Section VIII Data Integration and Data Mining Chapter XXVIII Multi-Level Data Integration and Data Mining in Systems Biology . ................................................ 476 Roberta Alfieri, CNR - Institute for Biomedical Technologies, Italy and CILEA, Italy Luciano Milanesi, CNR - Institute for Biomedical Technologies, Italy

The availability of a large number of specific resources especially for the experimental researchers is something difficult for users who tried to explore gene, protein, and pathway data for the first time. This chapter finally aims to highlight the complexity in the systems biology data, providing an overview of the data integration and mining approaches in the context of systems biology with some specific example for the Cell Cycle database and the Cell Cycle models simulation. Chapter XXIX Methods for Reverse Engineering of Gene Regulatory Networks ..................................................... 497 Hendrik Hache, Max Planck Institute for Molecular Genetics, Germany In this chapter we discuss and compare different methods and applications for reverse engineering of gene regulatory networks developed in recent years. Inferring gene networks from different kinds of experimental data are a challenging task that emerged, especially with the development of high throughput technologies. Various computational methods based on diverse principles were introduced to identify new regulations among genes. The mathematical aspects of the models are highlighted and the applications are mentioned. Chapter XXX Data Integration for Regulatory Gene Module Discovery . ................................................................ 516 Alok Mishra, Imperial College London, UK Duncan Gillies, Imperial College London, UK By integrating data from various sources, this chapter introduces the techniques that have been used to identify the genetic regulatory modules. Data relating to the functioning of individual genes can be drawn from many different and diverse experimental techniques. Each piece of data provides information on a specific aspect of the cell regulation process. The chapter argues that integration of these diverse types of data is essential in order to identify biologically relevant regulatory modules. A concise review of the different integration techniques is presented, together with a critical discussion of their pros and cons. A very large number of research papers have been published on this topic, and the authors hope that this chapter will present the reader with a high-level view of the area, elucidating the research issues and underlining the importance of data integration in modern bioinformatics. Chapter XXXI Discrete Networks as a Suitable Approach for the Analysis of Genetic Regulation .......................... 530 Elizabeth Santiago-Cortés, Universidad Nacional Autónoma de México, Mexico Luis Mendoza, Universidad Nacional Autónoma de México, Mexico Biological systems are composed of multiple interacting elements; in particular, genetic regulatory networks are formed by genes and their interactions mediated by transcription factors. The establishment of such networks is critical to guarantee the reliability of transcriptional performance in any organism. The study of genetic regulatory networks as dynamical systems is a helpful methodology to understand the transcriptional behavior of the genome. From a number of theoretical studies, it is known that networks present a complex dynamical behavior that includes stability, redundancy, homeostasis, and multistationarity. In this chapter we present some particular biological processes modeled as discrete networks to show that the theoretical properties of networks have a clear biological interpretation.

Chapter XXXII Investigating the Collective Behavior of Neural Networks: A Review of Signal Processing Approaches . ..................................................................................... 541 A. Maffezzoli, Politecnico di Milano, Italy F. Esposti, Politecnico di Milano, Italy M.G. Signorini, Politecnico di Milano, Italy In this chapter, authors review main methods, approaches, and models for the analysis of neuronal network data. In particular, the analysis concerns data from neurons cultivated on Micro Electrode Arrays (MEA), a technology that allows the analysis of large ensemble of cells for long period recordings. The goal is to introduce the reader to the MEA technology and its significance in both theoretical and practical aspects of neurophysiology. The chapter analyzes two different approaches to the MEA data analysis: the statistical methods, mainly addressed to the network activity description, and the system theory methods, more dedicated to the network modeling. Finally authors present two original methods, introduced independently. The first method involves innovative techniques in order to globally quantify the degree of synchronization and inter-dependence on the entire neural network. The second is a new geometrical transformation performing very fast whole-network analysis: this method is useful for singling out collective-network behaviors with a low-cost computational effort. The chapter has the aim of providing an overview of methods dedicated to the quantitative analysis of neural network activity measured through MEA technology. Until now many efforts were devoted to biological aspects of this problem without taking in to account the computational and methodological signal processing questions. This is precisely what we tried to do by our contribution that we hope could be a starting point in an interdisciplinary cooperative research approach. Chapter XXXIII The System for Population Kinetics: Open Source Software for Population Analysis ...................... 556 Paolo Vicini, University of Washington, USA Population kinetic analysis (population kinetics) is an increasingly important tool for modeling and analyzing biomedical kinetic (that is, time-dependent, or time series) data affected by an unfavorable signal-to-noise ratio and relatively short duration. This chapter describes the philosophy behind the SPK, its components, and its current implementation as a Web service available at http://spk.rfpk.washington. edu. The SPK is first and foremost an open source product, and as such, it builds on the availability of many open source tools. This in turn allows for a very flexible modular structure and rapid deployment of new features and user documentation. With the open source release of the SPK, it is our hope that this software tool will turn into a collaborative effort spanning many user communities and developers associated with population kinetic analysis. Section IX Systems Biology in Photochemical Processes Chapter XXXIV Photosynthesis: How Proteins Control Excitation Energy Transfer ................................................... 573 Julia Adolphs, Freie Universität Berlin, Germany

This chapter introduces the theory of optical spectra and excitation energy transfer of light harvesting complexes in photosynthesis. The light energy absorbed by protein bound pigments in these complexes is transferred via an exciton mechanism to the photosynthetic reaction center where it drives the photochemical reactions. The protein holds the pigments in optimal orientation for excitation energy transfer and creates an energy sink by shifting the local transition energies of the pigments. In this way, the excitation energy is directed with high efficiency (close to 100 %) to the reaction center. In the present chapter, this energy transfer is studied theoretically. Based on crystal structure data the excitonic couplings are calculated taking into account also the polarizability of the protein. The local transition energies are obtained by two independent methods and are used to predict the orientation of the FMO protein relative to the reaction center. Chapter XXXV Photodynamic Therapy: A Systems Biology Approach . .................................................................... 588 Michael R. Hamblin, Massachusetts General Hospital - Boston, USA; Harvard Medical School, USA; and Harvard-MIT Division of Health Sciences and Technology, USA This chapter focus on studies of PDT that have employed a systems biology approach. Many cell pathways and signaling systems are engaged after PDT and although many of these cellular changes have been elucidated by traditional biochemical and cell biology techniques, the newer technologies of “-omics” are increasingly being brought to bear on this problem. In particular, these technologies involve the use of gene-expression micro-arrays. We will cover protective responses induced by PDT that include activation of transcription factors, heat shock proteins, antioxidant enzymes, and antiapoptotic pathways. Elucidation of these mechanisms might result in the design of more effective combination strategies to improve the antitumor efficacy of PDT. Chapter XXXVI Modeling of Porphyrin Metabolism with PyBioS .............................................................................. 643 Andriani Daskalaki, Max Planck Institute for Molecular Genetics, Germany Physiological and biochemical evidence indicates that flow of substrates into the porphyrin pathway is controlled by the synthesis of d–aminolevulinic acid (ALA), the first committed precursor of the porphyrin pathway. The basis of the selectivity of ALA-based (Photodynamic Therapy) PDT or (Photodynamic Diagnosis) PDD has been correlated with the metabolic rate of the cells or with the differential expression of enzymes along the heme biosynthetic pathway. Although light is required to trigger the synthesis of ALA and the differentiation of chloroplasts (Reinbothe and Reinbothe, 1996), a feedback inhibition of ALA synthesis by an end product of the porphyrin pathway is thought to be involved in the regulation of influx into the pathway. Both the nature of the product and the mechanism involved in effecting feedback inhibition remain unknown. Thus, the modeling of the porphyrin pathway may fill this void and allow researchers to address this question of long-standing importance.

Section X Modeling Cellular Physiology Chapter XXXVII Interference Microscopy for Cellular Studies . ................................................................................... 656 Alexey R. Brazhe, Technical University of Denmark, Denmark and Moscow State University, Russia Nadezda A. Brazhe, Technical University of Denmark, Denmark and Moscow State University, Russia Alexey N. Pavlov, Saratov State University, Russia Georgy V. Maksimov, Moscow State University, Russia Erik Mosekilde, Technical University of Denmark, Denmark Olga V. Sosnovtseva, Technical University of Denmark, Denmark This chapter describes the application of interference microscopy and double-wavelet analysis to the non-invasive study of cell structure and function. We present different techniques of phase and interference microscopy and discuss how variations in the intrinsic optical properties of a cell can be related to the intracellular processes. Particular emphasis is given to the newly developed phase modulation laser interference microscope. We show how this setup, combined with wavelet analysis of the obtained data series, can be applied to live cell imaging and to investigate the rhythmic intracellular processes and their mutual interactions. We hope that the discussion will contribute to the understanding and learning of new methods for non-invasive investigation of intracellular processes. Chapter XXXVIII Fluorescence Imaging of Mitochondrial Long-Term Depolarization in Cancer Cells Exposed to Heat-Stress ....................................................................................................................... 673 Cathrin Dressler, Laser- und Medizin-Technologie GmbH, Berlin, Germany Olaf Minet, Charité Universitaetsmedizin Berlin, Germany Urszula Zabarylo, Charité Universitaetsmedizin Berlin, Germany Jürgen Beuthan, Charité Universitaetsmedizin Berlin, Germany This chapter deals with the stress response of mitochondria to heat which is the central agent of thermotherapy. Thermotherapies function by inducing lethal heat inside target tissues. Spatial and temporal instabilities of temperature distributions in targets require optimized treatment protocols and reliable temperature-control methods during thermotherapies. Since solid cancers present predominant targets to thermotherapy, we analyzed hyperthermic stress-induced effects on mitochondrial transmembrane potentials in breast cancer cells (MX1). Heat sensitivities and stress reactions might be extremely different among different tissue species and tissue dignities; it is very important to investigate tissue-specific stress responses systematically. Even though this chapter will provide little information, only to the enlightenment of systemic cellular heat stress mechanisms, it may contribute to deepening the basic knowledge about systemic stress responses. In addition, the data presented here might support optimizing of treatment protocols applied during thermotherapy, particularly LITT and hyperthermia.

Section XI Tools for Molecular Networks Chapter XXXIX Protein Interactions and Diseases ....................................................................................................... 694 Athina Theodosiou, Biomedical Research Foundation of the Academy of Athens, Greece Charalampos Moschopoulos, Biomedical Research Foundation of the Academy of Athens, Greece Marc Baumann, Biomedicum, Helsinki University, Finland Sophia Kossida, Biomedical Research Foundation of the Academy of Athens, Greece and Biomedicum, Helsinki University, Finland The direct connection of proteomics with human diseases is now unquestionable and proteomics have become a scientific section of great research interest. In this chapter, we present a detailed description of the nature of protein interactions and describe the more important methodologies that are being used for their detection. The authors review the mechanisms leading to diseases and involving protein interactions, and refer to specific diseases such as Huntington’s disease and cancer. Finally, we give an overview of the most popular computational methods which are used for the prediction or the healing of the diseases. Chapter XL The Breadth and Depth of BioMedical Molecular Networks: The Reactome Perspective ................ 714 Bernard de Bono, European Bioinformatics Institute, UK and University of Malta, Malta From a genetic perspective, disease can be interpreted in terms of a variation in molecular sequence or expression (dose) that impairs normal physiological function. To understand thoroughly the knock-on effect such pathological changes may have, it is crucial to map out the physiological relationship affected genes maintain with their functional neighbors. The goal of the Reactome project is to build such a network knowledgebase for all human genes. Constructing a map of such extent and scope requires a considerable range of expertise, so this project collaborates with field experts to integrate their pathway knowledge into a single quality-checked human model. This resource dataset is systematically crossreferenced to major molecular and literature databases, and is accessible to the community in a number of well-established formats. As an evolving network systems resource, Reactome is also starting to provide increasingly powerful and robust tools to investigate tissue-specific biology and steer targeted drug design. Section XII Mathematical Modeling Approaches Chapter XLI Entropy and Thermodynamics in Biomolecular Simulation .............................................................. 731 Jorge Numata, Freie Universität Berlin, Germany Thermodynamics is one of the best established notions in science. Some recent work in biomolecular modeling has sacrificed its rigor in favor of trendy empirical methods. Even in cases when physics-based

energy functions are used, entropy is forgotten or left “for later versions”. This text gives an overview of the utility of a more rigorous treatment of thermodynamics at the molecular level to understand protein folding and receptor-ligand binding. It begins with an intuitive explanation of thermodynamics: enthalpy is the quantity of energy, while entropy stands for its quality. Recent advances in entropy from information theory and physical chemistry are outlined as they apply to biological thermodynamics. A reliable calculation of equilibrium constants for elementary reactions among biochemical metabolites and kinetic rates of enzymes from first principles would be an invaluable advance for the field of systems biology. The methods presented in this chapter carry such potential. Chapter XLII Model Development and Decomposition in Physiology .................................................................... 759 Isabel Reinecke, Zuse Institute Berlin, Germany Peter Deuflhard, Zuse Institute Berlin, Germany; Freie Universität Berlin, Germany; and DFG Research Center Matheon, Germany Some model development concepts can be used for mathematical modeling in physiology as well as a graph theoretical approach for a decomposition technique in order to simplify parameter estimation. These methods are presented on the basis of a complex mathematical model for the human menstrual cycle. First, some modeling fundamentals are introduced and applied to the model development of the human menstrual cycle. Then it is shown how a complex mathematical model in physiology can be handled if a large number of parameters are used in the model where the parameter values are not known for the most part. A method is presented to divide the model into smaller, disjoint model parts in order to simplify parameter estimation. At the same time, it is shown how this technique works in the case of the human menstrual cycle. The principles for model development and decomposition can be used for other physiological models as well. Chapter XLIII A Pandemic Avian Influenza Mathematical Model ............................................................................ 798 Mohamed Derouich, Faculté des sciences Oujda-Morocco, Morocco Abdesslam Boutayeb, Faculté des sciences Oujda-Morocco, Morocco Worldwide, seasonal outbreaks of influenza affect millions of people, killing about 500,000 individuals every year. Human influenza viruses are classified into three serotypes: A, B, and C. Only influenza A viruses can infect and multiply in avian species. During the last decades, important avian influenza epidemics have occurred. So far, the epidemics among birds have been transmitted to humans, but the most feared problem is the risk of pandemics that may be caused by person-to-person transmission. The present mathematical model deals with the dynamics of human infection by avian influenza both in birds and in humans. Stability analysis is carried out and the behavior of the disease is illustrated by simulation with different parameters values. Chapter XLIV Dengue Fever: A Mathematical Model with Immunization Program . ............................................... 809 Mohamed Derouich, Faculté des sciences Oujda-Morocco, Morocco Abdesslam Boutayeb, Faculté des sciences Oujda-Morocco, Morocco

Dengue fever is a re-emergent disease affecting more than 100 countries. Its incidence has increased fourfold since 1970 and nearly half the world population is now at risk. In the present paper, a mathematical model with immunization is proposed to simulate the succession of two epidemics with variable human populations. Stability of the equilibrium points is carried out and simulation is given for different parameters settings. Section XIII Data Processing in Histopathology Chapter XLV Automated Image Analysis Approaches in Histopathology ............................................................... 826 Ross Foley, University College Dublin (UCD), Ireland Matthew DiFranco, University College Dublin (UCD), Ireland Kenneth Bryan, University College Dublin (UCD), Ireland Elton Rexhepaj, University College Dublin (UCD), Ireland Laoighse Mulrane, University College Dublin (UCD), Ireland R. William Watson, University College Dublin (UCD), Ireland Pádraig Cunningham, University College Dublin (UCD), Ireland William M. Gallagher, University College Dublin (UCD), Ireland The field of histopathology has encountered a key transition point, with the progressive move towards the use of digital slides and automated image analysis approaches. This chapter discusses the various methods and techniques involved in the automation of image analysis in histopathology. Important concepts and techniques are explained in the five main areas of workflow within image analysis in histopathology; data acquisition, the digital image, image pre-processing, segmentation and machine learning. Furthermore, examples of the application of these concepts and techniques in histopathological research are then given.

xxxiii

Foreword

Systems biology has been in the focus of intense public and private research in recent years evoking high expectations and hopes with regard to the solution of emerging problems in the health care sector. The notion of systems biology is rather broad agglomerating mathematical and computational methods, experimental techniques and biomedical applications. At its core, systems biology aims at the explanation of physiology and disease from the level of interacting components such as molecular pathways, regulatory networks, cells, organs and, ultimately, the entire organism. This is complementary to the single-protein (-target) approach that had been the primary research paradigm for a long time condensed in the term “reductionism”. However, with the increasing amount and heterogeneity of data generated by modern experimental techniques and the increasing power of computational hardware, it has become evident that such reductionism can no longer be maintained as the primary research paradigm. The essential tool of systems biology research is the computer. With the use of computational methods systems biology aims at an understanding of biological processes using mathematical models of different granularity. The purpose of these models is the generation of in silico predictions, for example on the state of a particular disease or the effect of the therapy on the individual patient. With the use of data integration methods systems biology utilises a comprehensive experimental read-out on different levels of cellular information in order to fit the parameters in these models. And, finally, at the intersection of several key research disciplines systems biology links these mathematical models to practically relevant research questions and contributes to the generation and testing of hypotheses and the planning of experiments. These new approaches are about to revolutionize our knowledge on disease mechanisms and on the interpretation of data from high-throughput technologies. Systems biology approaches are necessary in several respects. First, with respect to the increasing complexity of research, it is very likely that systems biology contributes to the formulation and solution of new paradigms able to describe the underlying complex biological problems. Secondly, with respect to the increasing complexity of experimental techniques, new problems arise that must be solved by integration rules. For example, in practice often several laboratories are working with different experimental techniques at the same research question. A fundamental challenge is thus to search through the exhaustive set of data and extract meaningful information. Thirdly, with respect to these increasing demands on the mathematical modelling it becomes more and more evident that the development of computational modelling approaches itself must be connected much closer to the experimental observations in order to proof usefulness and relevant predictive power of these approaches. Having acknowledged that systems biology holds such high promises for future biomedical research, I am delighted to write the Foreword to this “Handbook of Research on Systems Biology Applications in Medicine” as its scope and content provide both, students and researchers, from various disciplines with a broad introduction of systems biology methodologies and show their usefulness on a multitude of applications.

xxxiv

The book targets systems biology on a rather practical level from two directions – from an experimental and a methodological direction. The experimental path contributes articles that highlight applications in important problem domains, for example human diseases such as cancer, type-2 diabetes mellitus, infectious diseases, influenza and ageing, among others, as well as in specific processes such as apoptosis and photosynthesis and with respect to specific experimental techniques such as chip analyses, interference microscopy, proteinprotein interactions, synthetic biology, de novo peptide design and photodynamic therapy. The reader approaching the book from this path will find in-depth descriptions of these biological phenomena, of the practical problems in analysing these phenomena along with a description of computational solutions for these analyses. The methodological path contributes articles that describe multivariate statistical methods such as clustering, gene expression analysis, normalisation methods as well as analysis methods for kinetic models such as metabolic flux analysis, metabolic control analysis among others and, additionally data integration methods in terms of experimental data, pathways and mathematical models. The reader approaching the book from this path will find introduction and description of relevant computational methods and a demonstration how these methods are applied to practical problems. Taken together both paths allow researchers from different disciplines to catch a common basis. In summary, by presenting such a broad mixture of articles the book gives relevant insights into the different research disciplines that are touched by systems biology such as mathematics, biology, chemistry, medicine and information theory. Students and researchers from these fields might get interested in a specialisation towards this new discipline. On the other hand, researchers coming from the systems biology field will get valuable information on real practical problems and potential approaches to these problems that could benefit from systems biology methods. Thus, the book gives both sides a good starting point to walk on further on this fascinating new road. Ralf Herwig Group Leader, Max-Planck-Institute for Molecular Genetics March 2008 Ralf Herwig studied physics and mathematics at the Technical and the Free University Berlin and finished his PhD in 2001 on clustering methods for gene expression data. He was awarded for the Heinz-Billing-Price for Scientific Computation of the Max-Planck Society in 1999 and was an honor student of the American Academy of Achievement in 2000. Since 2001 he is group leader at the Max-Planck-Institute for Molecular Genetics. His research focuses on multivariate statistical methods, data integration systems and computational modelling. Ralf Herwig has contributed to 50 scientific publications and was coauthor of the first textbook on systems biology in 2005.

xxxv

Preface

Systems biology integrates theoretical and experimental research and applies to various areas related to medicine. However, a few things are known in the medical profession about the theories and techniques behind systems biology. In the future, as systems biology techniques progress, it may become possible to study complex diseases at a multitude of levels within the cell, from transcriptional changes, to changes in metabolic flux through genetic pathways. Complete genome sequencing of hundreds of pathogenic and model organisms in the past decade has provided the information required for studies of gene function. Functional genomics and proteomics approaches, when combined with computational biology and the emerging discipline of systems biology, finally allow us to begin comprehensive mapping of cellular and molecular networks and pathways. However, one of the main difficulties we still face is how best to integrate these disparate data sources and use them to better understand, diagnose, and treat biological systems during disease. The systems biology approach of integrating protein expression data with clinical data such as histopathology, clinical functional measurements, medical imaging scores, patient demographics, and clinical outcome provides a powerful tool for linking biomarker expression with biological processes that can be segmented and linked to disease presentation. Systems biology and new technologies enable predictive and preventative medicine. This biology is revolutionizing the field of medical research and creating a new breed of medical researchers.Systems biology yields insights that may aid in the treatment of cancer by combining different disciplines and providing an analytical framework. The existence of heterogeneity of treatment effects is apparent when evaluating patient response to a drug in clinical trials and in clinical practice. Adverse drug reactions are being linked to enzymatic deficiencies or mutations. Therefore one of the great challenges for 21st century medicine is to deliver effective therapies that allow clinicians to choose the correct drug, dose, or intervention for any patient before the start of therapy. (Meyer and Zanger, 1997; Eichelbaum and Burk, 2001; Srivastava, 2003, Nicholson J. K., 2006). The creation of detailed maps of “signaling networks” linkages between various pathways of genes and proteins that resemble complicated wiring diagrams (Hahn C and Weinberg R.A., 2002), provide a better understanding of the disease at a molecular level. Many diseases can be explained by defects in pathways, and new treatments often involve finding drugs that correct those defects. This approach can result to a more individualized, and potentially more effective approach to diagnosis and treatment. Some of these challenges, as well as the development of systems biology techniques and platforms for translating genomic and pathway research into clinical healthcare are discussed in this the handbook. Systems biology provides us with a common language for both describing and modelling the integrated action of regulatory networks at many levels of biological organization from the subcellular through the cell, tissue, and organ, right up to the whole organism. Molecular epidemiology concerns the measurement of the fundamental biochemical factors that underlie population disease demography

xxxvi

and understanding the health of different nations. This subject naturally lends it to systems biology approaches. Hence, systems biology is certain to play a major role in the future of both the development of personalized medicine and in molecular epidemiological studies. To access the latest research related to the applications of systems biology in medicine, I decided one year ago to launch a handbook project where researchers from all over the world would assist me in providing the necessary coverage of each respective discipline in systems biology. The primary objective of this project was to define the technologies, terms, and acronyms related to the systems biology and its medical applications. The handbook will highlight the use of systems approaches including genomic, cellular, proteomic, metabolomic, bioinformatics, molecular, and biochemical, to address fundamental questions in complex diseases like cancer and diabetes, also in ageing.

Organisa ti on of the H andb ook The handbook is roughly divided into 13 sections. Section I, “Basic Concepts in Medical Systems Biology,” introduces the readers to some basic concepts in the field of systems biology, and the systematic study of complex interactions in biological systems in order to understand better the entirety of processes that happen in diseases as cancer and diabetes. A cellular network can be modeled mathematically using methods coming from chemical kinetics and control theory. Due to the large number of parameters, variables and constraints in cellular networks, numerical and computational techniques are often used. This Section contains 5 chapters. Chapter I and II introduce the basic concepts in medical systems biology. Chapter I discusses the use of a pathway biology approach to modelling biological processes, providing a new framework for experimental medicine. Chapter II presents principles used in medical systems biology and describe systems and control theory concepts for systems biology and the corresponding implications for medicine. Chapter III describes the inclusion of time delay in pathway cross talk models. Chapter IV explains how deterministic modelling is applied to systems biology. Chapter V introduces Synthetic Biology, as an engineering approach to Systems Biology. Section II, “Advanced Computational Methods for Systems Biology” serves as a comprehensive introduction to computational methods supporting systems biology research.This part introduces advanced computational methods related to systems biology. Chapter VI describes technical developments in the computational analyses of modern biological data: microarray gene expression data, mass spectrometry data, and bioimaging. Chapter VII provides a perspective on three important collaborative areas in systems biology research, macromolecular crystallization, proteomic biomarker discovery from high-throughput mass spectral technologies and protein structure prediction and complex fold recognition. Section III “Genomics and Bioinformatics for Systems Biology” provides examples of genomics and bioinformatics applications supporting systems biology research. Chapter VIII describes methods for sequence similarity calculation as well as detection of functional contexts by phylogenetic profiling. Chapter IX provide insight into the application of computational tools to calculate the coupling specificity of important receptors like G-protein coupled receptors (GPCRs), which could present novel drug targets. Chapter X describes the importance of identifying Bacterial β-barrel outer membrane proteins in the completely sequenced genomes as these proteins could serve as potential targets for drugs or vaccines. Section IV describes “Experimental Techniques for Systems Biology” Clustering methods are used to study specific problems in genomics, such as the analysis of time-course experiments. Therefore,

xxxvii

Chapter XI is focused on model-based clusterings of tissue samples and of genes. Chapter XII propose a novel theoretical framework for data and model reduction of gene expression profiles generated by microarray experiments. Chapter XIII introduces the BeadArrayTM technology for gene expression profiling, shows possible approaches for data analysis and demonstrates to the reader how the technology performs in comparison to alternative microarray platforms. The authors in Chapter XIV provide a basic understanding of the gene expression data processing with the Affymetrix Technology. Chapter XV illustrate the use of Exon Arrays to detect alternative isoforms, and point out potential problems that may be encountered by researchers using this technology. Chapter XVI focuses on microbial metabolism from a systems biology perspective. Chapter XVII introduces the aspects of alternative splicing in human disease, and its investigation by means of computational large-scale analyses. In Section V, “Systems Biology and Aging”, Chapter XVIII introduces an in vitro model as a means of studying human hormonal aging. In addition, Chapter XIX provide an overview of the aging process, discuss how it relates to system biological concepts and explain how mathematical modelling can improve our understanding of biochemical processes involved in the aging process. Section VI, “Systems Biology Applications in Medicine” has been streamlined to focus on the topics most relevant to applications of systems biology in medical problems. In Chapter XXI the authors report on their experience with analysis and modelling of data obtained from studies of animal models related to obesity and metabolic syndrome. Chapter XXII describes modelling approaches in Type 2 Diabetes mellitus. The authors in Chapter XXIII list the high throughput biotechnologies generating a wealth of information on the infected cell and some of the immune related databases and finally explain how to extract meaningful information from these sources. Chapter XXIV describes the integration of data from different cellular levels of human-pathogenic fungi and the application of systems biology methodologies. Section VII, “Systems Biology and Drug Design”, provides a thorough overview of novel methodologies in medical research. Chapter XXV focus on a novel methodology of structure-based drug development feasible without prior knowledge of the target structure: analogy modelling. Chapter XXVI introduce a combination of a computer based guided search of novel peptides in sequence space with their biological experimental validation. Chapter XXVII describe metabolic modelling and applications of metabolic flux analysis for antibiotic production. Section VIII, “Data Integration and Data Mining,” confer an understanding of data integration processes in systems biology.Chapter XXVIII describe data integration and data mining techniques in the context of systems biology studies. Chapter XXIX compare different methods and applications for reverse engineering of gene regulatory networks developed in recent years. Data relating to the functioning of individual genes can be drawn from many different and diverse experimental techniques. Chapter XXX introduces the techniques that have been used to identify the genetic regulatory modules by integrating data from various sources.Chapter XXXI presents some particular biological processes modeled as discrete networks to show that the theoretical properties of networks have a clear biological interpretation. In Chapter XXXII the authors review main methods, approaches and models for the analysis of neuronal network data. Chapter XXXIII describes the philosophy behind the SPK tool for Population kinetic analysis (population kinetics) for modelling and analyzing biomedical kinetic, its components and its current implementation as a web service. The evolution of photosynthesis is driven by selection of genes for photochemical energy conversion that is robust and, yet effective, in a fluctuating light environment. The dynamic regulation of photosynthesis relies on an interplay of multiple sensory, transmission and executive modules that can be studied by the tools of systems biology (Csete and Doyle 2002). Therefore, Section IX, “Systems Biology in Photochemical Processes” is focused on Photochemistry and its applications, highlighting

xxxviii

the new understanding of the genetics of PDT. Chapter XXXIV introduces the theory of optical spectra and excitation energy transfer of light harvesting complexes in photosynthesis. Chapter XXXV focus on studies of Photodynamic Therapy (PDT) that have employed a systems biology approach. Both the nature of the product and the mechanism involved in effecting feedback inhibition remain unknown. Thus, the modelling of porphyrin pathway introduced in Chapter 36 may fill this void and allow researchers to address these questions of importance. Section X, “Modeling Cellular Physiology” deals with the study of cellular microstructures in biology by microscopy. Chapter XXXVII describes the application of interference microscopy and doublewavelet analysis to the non-invasive study of cell structure and function. Chapter XXXVIII deals with the stress response of mitochondria to heat which is the central agent of thermotherapy. Section XI, “Tools for Molecular Networks,” includes two chapters. Chapter XXXIX reviews the mechanisms leading to diseases and involving protein interactions and refers to specific diseases such as Huntington’s disease and cancer. Chapter XL introduce a network systems resource, Reactome which is also starting to provide powerful and robust tools to investigate tissue-specific biology and steer targeted drug design. Section XII, “Mathematical Modeling Approaches,” includes mathematical modeling that allows us to link epidemiology, physiology and physics to systems biology. Chapter XLI gives an overview of the utility of a more rigorous treatment of thermodynamics at the molecular level to understand protein folding and receptor-ligand binding. Chapter XLII introduces some modelling fundamentals that are applied to the model development of the human menstrual cycle. Chapter XLIII describes mathematical model which deals with the dynamics of human infection by avian influenza both in birds and in humans. Chapter XLIV presents a mathematical model with immunization is proposed to simulate the succession of two epidemics with variable human populations. Section XIII, “Data Processing in Histopathology”, presents automated image analysis approaches which can serve as a valuable aide to clinical pathologists and systems biology researchers in the domain of histopathology. Chapter XLV discusses some of the most important techniques and given examples of their use in the area up to now. The handbook covers basic biological and mathematical concepts important for systems biology. The chapters are oriented to describe the relation between basic science and medical issues. Topics that are covered in this handbook are (a) Foundations of systems biology (2) Pathophysiology of complex diseases and systems biology approach to therapy. The Handbook of Research on Systems Biology Applications in Medicine contains over three hundred pages of information and more than hundred figures. Besides having the traditional text, this information source also has a glossary of terms and definitions, contributions from more than 90 international experts, in-depth analysis of issues, concepts, new trends, and advanced technologies. This handbook allows the inclusion of more than 100 high-quality illustrations. While providing the information that is critical to an understanding of the basic of systems biology, this edition focuses more directly and extensively than ever on applications of medical systems biology. The diverse and comprehensive coverage of multiple disciplines in the field of systems biology in this handbook will contribute to a better understanding all topics, research, and discoveries in this evolving, significant field of study. This handbook provides information for both science and biotechnology researchers and also medical doctors in obtaining a greater understanding of the concepts, issues, problems, trends, challenges and opportunities related to this field of study. In shaping this book, I committed myself to making the textbook as useful as possible to students and advanced researchers coping with the demands of modern medical research. I hope will make the Handbook of Research on Systems Biology Applications in Medicine a helpful tool-not only for the student

xxxix

who needs an expert source of basic knowledge in systems biology, but also for the advanced medical researcher who needs clear, concise, and balanced information on which to conduct his research Thanks to a very hard-working advisory editorial board of scientists, excellent authors who fulfilled our invitations, and a very efficient publisher providing clear procedures and practices for a quality production, readers may now enjoy Chapters on some of the major ideas that have concerned systems biology applications in medicine. Andriani Daskalaki Max Planck Institute, Berlin, Germany July 2008

R eferences Csete, M.E., Doyle, J.C. (2002). Reverse Engineering of Biological Complexity. Science, 295: 16641669. Eichelbaum M, Burk O (2001) CYP3A (2001). Genetics in drug metabolism. Nat Med, 7: 285–288. Hahn C. and Weinberg Robert A. (2002). A Subway Map of Cancer Pathways. Nature Reviews Cancer. Klipp E. Klipp E., Herwig R., Kowald A., Wierling C., Lehrach H. (2005). Systems Biology in Practice: Concepts, Implementation and Applications. Nicholson J. K. (2006). Global systems biology, personalized medicine and molecular epidemiology Mol Syst Biol, 2, 52 Meyer UA, Zanger UM (1997). Molecular mechanisms of genetic polymorphisms of drug metabolism. Annu Rev Pharmacol Toxicol, 37, 269–296 Srivastava P. (2003). Drug metabolism and individualized medicine. Curr Drug Metab, 4, 33–44

xl

Acknowledgment

The editor sincerely acknowledges the help of all persons involved in the collation and review process of this handbook, without whose support the project would not have been satisfactorily completed. Deep appreciation and gratitude is due to Prof. Dr. Hans Lehrach, Director of the Department of Vertebrate Genomics Max-Planck-Institut) for giving me tha opportunity to work in the field of systems biology and generating the idea of this book. I have received generous encouragement and assistance from all staff members of the bioinformatics group. Special thanks go to Dr. Ralf Herwig for his generous encouragement and assistance. I wish to express my appreciation to my colleagues, who, as experts in their fields, have helped us with constructive criticism and helpful suggestions. I acknowledge especially the contributions of the following individuals: Prof Peter Wellstead, Christoph Wierling, and Elisabeth Maschke-Schutz. Most of the authors of chapters included in this handbook also served as referees for chapters written by other authors. Thanks go to all those who provided constructive and comprehensive reviews. However, some of the reviewers must be mentioned as their reviews set the benchmark. Reviewers who provided the most comprehensive, critical and constructive comments include: Dr. Athina Lazakidou from the University of Piraeus, Dr. Sophia Kossida from the Foundation of Biomedical Research; and Dr. Cathrin Dressler from Laser- und Medizin-Technologie GmbH, Berlin. Special thanks also go to the publishing team at IGI Global, whose contributions throughout the whole process from inception of the initial idea to final publication have been invaluable. In particular to Julia Mosemann, who continuously prodded via e-mail for keeping the project on schedule and to Mehdi Khosrow-Pour, whose enthusiasm motivated me to initially accept his invitation for taking on this project. I would also like to thank Dr. Sophia Kossida, who read a semi-final draft of the manuscript and provided helpful suggestions for enhancing its content. And last but not least, my father, Dimitirios Daskalaki, for his unfailing support and encouragement during the months it took to give birth to this book. In closing, I wish to thank all of the authors for their insights and excellent contributions to this handbook. Andriani Daskalaki, PhD Max Planck Institute, Berlin, Germany July 2008

Section I

Basic Concepts in Medical Systems Biology



Chapter I

Pathway Biology Approach to Medicine Peter Ghazal University of Edinburgh Medical School, Scotland, and Centre for Systems Biology at Edinburgh, Scotland

abstract Systems biology provides a new approach to studying, analyzing, and ultimately controlling biological processes. Biological pathways represent a key sub-system level of organization that seamlessly perform complex information processing and control tasks. The aim of pathway biology is to map and understand the cause-effect relationships and dependencies associated with the complex interactions of biological networks and systems. Drugs that therapeutically modulate the biological processes of disease are often developed with limited knowledge of the underlying complexity of their specific targets. Considering the combinatorial complexity from the outset might help identify potential causal relationships that could lead to a better understanding of the drug-target biology as well as provide new biomarkers for modelling diagnosis and treatment response in patients. This chapter discusses the use of a pathway biology approach to modelling biological processes and providing a new framework for experimental medicine in the post-genomic era.

INTR OD UCTI ON An increasing number of biological experiments and more recently clinical based studies are being conducted using large-scale genomic, proteomic and metabolomic techniques which generate high-dimensional data sets. Such approaches require the adoption of both hypothesis and data driven strategies in the analysis and interpretation of results. In particular, data-mining and pattern recognition methodologies have proven particularly useful in this field. The increasing amount of information available from high-throughput experiments has initiated a move from focussed, single gene and protein investigations

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Pathway Biology Approach to Medicine

to the study of multiple component interactions. Vitally, when the output from high dimensional data is integrated with the wealth of information from previously published investigations, the assembly of known and novel network characteristics is possible. The cause-effect association and annotation of multiple genes and gene products by such methods can aptly be described as pathway biology. Pathway data is variously categorised in terms of metabolic pathways, molecular interactions, gene regulatory networks, signalling pathways and which, are often represented differently and in isolation. In recent years there has been an increasing effort in representing biological pathways using computer science based methodologies. These efforts include databases that aim to curate pathways, such as KEGG (Kanehisa et al., 2006), Reactome (Joshi-Tope et al., 2005), aMAZE (Lemer et al., 2004) or PATIKA (Dogrusoz et al., 2005); databases of experimentally and computationally derived protein interactions, such as MPPI (Pagel et al., 2005) and DIP (Salwinski et al., 2004); or tools that aim to extract pathway information from the scientific literature, examples include PathwayAssist (Nikitin et al., 2003) and Ingenuity Pathway Analysis (Ingenuity Systems). However, a common factor in all these resources is the need to describe pathways visually in order to understand their complexity In this regard a biological interaction network based on electronic circuitry diagrams provided an informative approach and aims to provide a compact description of the entity relationships in a pathway (Kohn, 1999; Kohn et al., 2006). Kitano et al have extended this approach by introducing a simple notational system for state transitions (Funahashi et al 2003) for the representation of process flow in signalling pathways (Kitano, 2003, Kitano et al 2005). While considerable advances are being made there will be an increasing need to ensure that such pathway descriptions remain intuitive to biologists in general, involving logic and, in particular, an integrative view of molecular interactions, gene regulatory networks and signalling pathways while maintaining compliance with a more formal description of biological processes. This has been the primary motivation behind the Edinburgh Process Notation which uses and exends core aspects of the Kitano notation (Moodie et al, 2006). Collectively, these efforts have been and are part of a community wide effort to develop graphical notation standards (www. sbgn.org). To date much of this work has focussed on experimental cell signalling based systems and little work has been conducted regarding physiological systems and using clinical data. Here, we discuss a practical guide to a pathway biology approach in medicine. The intended aim is to help translate systems biology from bench science to medical research and ultimately toward clinical use. We particularly put forward the use of logic as a strategy for studying pathways and present arguments for the suitability of logical models for the analysis of clinically derived data.

Litera t ure and da t a mining: st amp c ollecting The first task at hand is toward the acquisition of pathway information. In this regard information relating to the components and interactions of pathways need to be compiled, integrated and visualised using research synthesis methodology (Cooper and Hedges 1994). This generally follows a four stage process: i.



A literature review should be undertaken to identify relevant pathway components and interactions. This can be performed using standard Entrez PubMed queries involving keywords, author searches and the use of Boolean operators. A variety of tools can also be used to facilitate this process, e.g. PDQ wizard (Grimes et al 2006). A manual review of the resultant articles is an es-

Pathway Biology Approach to Medicine

sential undertaking to ensure relevance and accuracy. The literature set should be classified on whether interactions can be attributed to a species (human or mouse), cell type (macrophage or dendritic cell) and technique used to identify the interaction. ii. The next step is to extend the literature search using a data mining approach. This can use a combination of open resources and proprietary software. These resources include but not limited to KEGG (www.genome.jp/kegg/), HPRD (www.hprd.org), Chilibot (www.chilibot.net), Pathway Assist (www.ariadnegenomics.com) and Ingenuity Pathway Analysis (Ingenuity Systems, USA), and can be used to reinforce established molecular interactions and identify new signalling components or interactions. In general they provide an online resource of curated, text-mined and experimental information on protein-protein and protein-gene interactions for producing networks of molecular interaction. iii. A graphical representation of components of the pathway can be achieved by a variety of packages yEd (www.yworks.com), EPE (Sorokin et al 2006), Cell Designer (Funahashi et al 2003) using preferably the SBGN notation. It should be noted that the resulting diagrams represent a ‘consensus’ view of a pathway and should not be taken as a canonical pathway. iv. Lastly a database model for the storage, analysis and sharing of pathway data is essential and under certain cases will need to be linked to anonymised clinical data. Curation of pathway information into a database allows for data browsing, querying, analysing and downloading. Several approaches to the storage and analysis of network interaction data have been published (Bader at al 2003, Hermjakob et al 2004, Joshi-Tope et al 2005) however this area is still in its infancy and will likely see further development in the future. Most notably, none to date have been shown to be extensible to the integration of clinical data. In this regard it is important to note that clinical data from subjects should be stored in separate databases that are fully compliant to confidentiality and data protection law.

Figure 1.



Pathway Biology Approach to Medicine

Mode lling: f orma lizing dependencies The above exercise, particularly the graphical representation, provides an excellent starting point for capturing known knowledge around pathways. However, these diagrams remain essentially pictorial in nature and include a varietal range of fine and course grained information. As such they are not yet sufficiently developed to move seamlessly toward mathematical translation. Thus a key challenge to systems level studies of pathways still remains with how best to model them and this is not an insignificant step. In general, pathway modeling requires a representation that captures the cause-effect relationships associated with each interaction, but that this should be in the first instance conceptually and computationally simple. With simple representation, computational efficient scanning of pathways for the upstream interactions that control downstream behavior is both tractable and computationally efficient. Several modelling schemes have been proposed as suitable representations for pathways. Ordinary and partial differential equations have proven to be very successful in modeling metabolic pathways (Kell, 2006, Fell, 1992), although they require precise information on concentration and reaction rates, which is largely unknown for most pathways. Accordingly approaches that deal with less or more variable data such as stochastic schemes capture very well the random nature of individual molecular events (McAdams, 1997, Arkin, 1998), but they describe very inefficiently the certainty that accompanies large numbers of proteins. Petri nets have also been considered and whilst the formulation is computationally simple, it is also conceptually complex (Hofe 1998, Kuffner 2000). Stochastic petri nets [Goss, 1998] and hybrid petri nets (Matsuno 2000) have been proposed as extensions. Pi calculus has been used to describe the pathways as a symbolic construction to which quantitative models can be fitted (Pinney et al 2003, Regev et al 2004). Finally, a particularly tractable approach is the use of logic to describe pathways. In this regard the application of Boolean logic as a modelling scheme, is now more recently receiving increasing interest (see Watterson et al 2008). Thus logical graphical models can provide an ideal first base for abstracting a range of formal mathematical models of a pathway. Ultimately these models will require standards for exchange such as SMBL and version control (Hucka 2003). Formal representation of a biologically validated model would next follow. Formal models permit the in silico testing of the ‘what if’ scenarios and that these predictions should go through a cycle of experimental verification. This cycle enables formal models to build on an iterative process of refinement.

E xperiment ati on: sing ular pathw ay appr oach For the reasons of focus and tractability the above pathway biology approach necessarily takes the position of building or constructing a consensus around a single pathway. This has the advantage of defining a sub-system making a more efficient approach for both experimental and computational investigation. However, an assumption is that the current state of literature reflects a sufficient level of understanding about the biology. Thus, while building a graphical representation of a biological pathway from the literature caution should be taken with regard as to whether the literature represents the true underlying biology. Accordingly, it is important to consider how best to biologically validate or experimentally test the constructed pathways. Since the assembled pathways consist of multiple components, gene or



Pathway Biology Approach to Medicine

protein analytic approaches would be expensive and time consuming. For this reason reliable multiplex high-throughput technologies (such as using RNAi or microarrays) would be the method of choice. For example, a microarray approach would be to identify ‘active’ connected regions of the network that show statistically significant changes in expression under different experimental conditions. For this purpose the method of Ideker and colleagues (2002) can be used together with simulation studies for rigorous statistical testing against random networks. Importantly, the results from such statistical and simulation analyses can be informative in revealing both node and edge behaviour and should fit the anticipated biological response. If the results of such analysis have a poor fit to the biology then this might be indicative of a not so good fit for validation purposes. A poor fit might suggest that other key components of the pathway are missing. In this case consideration should be given to further experimental testing. Ideally this would involve a combination of both high throughput driven exploration and hypothesis based mechanistic studies. In the case of a good fit it is likely that there exist many unknown or poorly characterised components of the pathway. In this case, a range of unbiased comprehensive screens such as traditional genetic and more recent molecular based biochemical and functional loss-of-function and gain-of-function screens. Exemplar approaches would include but are not restricted to proteomic based studies such as co-complex purification coupled with mass spectroscopy, yeast two hybrid protein interaction screens, genome-wide RNAi assays and forward genetic approaches. These approaches have been extensively covered in a number of excellent reviews on systems biology. Ultimately these assays should lead on to hypothesis testing of mechanism of action of pathway components. Mechanism based evaluation of pathways can be readily extrapolated to the analysis of clinical samples. For these studies it is important that care is taken in defining precisely the clinical phenotype of the subjects to be studied and the use of robust clinical and laboratory standard operating procedures are essential.

Cl inica l da t a: tract

abi lity

A key constraint in clinical research is in obtaining sufficient number of subjects, especially the control groups and, the amount and availability of sample material outside the medical treatment path of the patients. Thus full consideration including ethical issues has to be given on what and how many samples are available for a particular study. Most importantly it is essential that the clinical phenotype is clearly defined and minimises potential heterogeneity in the patient population. There can also be obvious limitations with regard to obtaining invasive biopsy specimens and the preferred option for both recruitment purposes and the patients would be a non-invasive sampling. A relatively benign noninvasive specimen that can be highly informative is whole blood. Here relatively but readily accessible small samples can be taken and used for systemic measurements of disease condition and treatment response (e.g. Smith et al 2007). For these reasons whole blood sampling is an area receiving increasing interest and is amenable to transcriptomic, proteomic and metabolic screening. In order to ensure the level of security and confidentiality expected for the storage of this sensitive data, the following steps are recommended. The data should be kept on a server protected by security measures at a physical, network and application level. The data should be adequately backed up and archived. Only authorized collaborators should be allowed use of the system and will be subjected to effective authentication as well as auditing. Approval from the local Clinical Data Protection Officer and senior medical officer (following Caldicott Guardian Principles) should be sought to comply with 

Pathway Biology Approach to Medicine

the confidentiality and data protection requirements. Ultimately for the purpose of integrating pathway, clinical records and high throughput data a medical bioinformatic (MBI) system will need to be established, requiring application tools to migrate anonymised data from the clinical databases to pathway database.

Co ncept ua l cha llenge of multip le pathw ay dependencies medicine

in

As a consequence of measuring patient samples using systems biology approach of high through-put technologies multiple cellular and molecular pathways are simultaneously recorded. This raises a major scientific limitation and sets the challenge of how to deal with analysis and understanding of the underlying cross-talk and dependencies in the myriad of potential interrelated networks and pathways. While a clear way forward is yet to be defined we would like to propose a conceptual framework aimed at classifying multiple pathway interrelationships and dependencies. In this regard we consider three types of pathway interdependencies that might help in the future toward a functional classification of clinical data. The types of pathway interrelationships can be labelled as process, sharing and fit: •

•

•

In the process type an output or activity of one pathway produces a resource or input used by another pathway. For instance, the sterol biosynthesis pathway leads to the production of certain oxy-sterols that form ligands for the activation of the Liver X Receptor (LXR) pathway. In the case of sharing, a single resource or pathway is used as inputs by a range of different multiple activities or pathways. For example the Janus Kinase-Signal Transducers and Activators of Transcription (JAK-STAT) signalling pathway is activated by more than 50 cytokines or growth factors. Whereas in the case of a pathway fit, different multiple pathway activities produce a single or common resource. For example a wide range of multiple cytokine, chemokine and pathogen recognition signalling pathways lead to the activation of Nuclear Factor Kappa B (NFKB), a central transcription factor for the regulation of both innate and adaptive immunity.

All of these types of interrelated activities can be coordinated in a hierarchical, non-hierarchical or emerging way and are likely to involve cells, genes, proteins and/or metabolites.

Co nc luding R emarks We hope this report provides a useful starters guide to the application of pathway biology and how it can be extended to clinical research. Ultimately, we anticipate that a comprehensive understanding of pathway structures will also allow us to predict potential disease indications or therapeutic complications or side effects that a treatment could incur. Accordingly pathway biology has future potential to contribute toward a new foundation for the next generation of medicine and clinical practice. Here we envision the use of clinical data and current best evidence coupled with pathway knowledge to make decisions about the care of individual patients.



Pathway Biology Approach to Medicine

A ckn ow ledgment I would like to thank all my colleagues in the Division of Pathway Medicine and our sponsors including the Wellcome Trust, EU FP6 programme, BBSRC and MRC.

R eferences Akutsu, T., Miyano, S., & Kuhara S. (1999). Identification of genetic networks from a small number of gene expression patterns under the Boolean network model. Pac Symp Biocomp, 4, 17. Akutsu, T., Miyano, S., & Kuhara, S. (2000). Inferring qualitative relations in genetic networks and metabolic pathways. Bioinformatics, 16, 727. Albert, R., Jeong, H., & Barabasi, A.-L. (2000). Error and attack tolerance of complex networks. Nature, 406, 378. Albert, R. & Othmer, H. (2003). The topology of the regulatory interactions predicts the expression pattern of the Drosphilia segment polarity genes. Journal of Theoretical Biology, 223, 1. Arkina, A., Rossb, J. & McAdams, H.H. (1997). Proc Natl Acad Sci USA, 94, 814 Arkin A., Ross, J., & McAdams H.H. (1998). Stochastic kinetic analysis of developmental pathway bifurcation in phage lambda-infected escherichia coli cells. Genetics, 149, 1633. Calvano, S.E., Xiao, W., Richards, D.R., Felciano, R.M., Baker, H.V., Cho, R.J., Chen, R.O., Brownstein, B.H., Cobb, J.P., Tschoeke, S.K., Miller-Graziano, C., Moldawer, L.L., Mindrinos, M.N., Davis, R.W., Tompkins, R.G., Lowry, S.F. A network-based analysis of systemic inflammation in humans. Nature, 437, 1032. Cooper, H., & Hedges, L.V. (1994). The handbook of research synthesis. New York: Russell Sage Foundation. Dogrusoz, U., Erson, E.Z., Giral, E., Demir, E., Babur, O., Cetintas, A., & Colak, R. (2005). PATIKAWeb: A Web interface for analyzing biological pathways through advanced querying and visualization. Bioinformatics, bti776. Fell, D. (1992). Metabolic control analysis: a survey of its theoretical and experimental development, Biochem J, 286, 313. Kauffman, S. (1969). Metabolic stability and epigenesis in randomly constructed genetic nets. Journal of theoretical biology, 22, 437. Kaufman, M., Andris, F., & Leo, O. (1999). A logical analysis of T cell activation and anergy. Proc Nat Acad Sci USA, 96, 3894. Kuffner, R., Zimmer, R., & Lengauer, T. (2000). Pathway analysis in metabolic databases via differential metabolic display. Bioinformatics, 16, 825.



Pathway Biology Approach to Medicine

Funahashi, A., Tanimura, N., Morohashi, M., & Kitano, H. (2003). Cell designer: A process diagram editor for gene-regulatory and biochemical networks. BIOSILICO, 1, 159. Glass, K., & Kauffman, S. (1973). The logical analysis of continuous, non-linear biochemical control networks. Journal of Theoretical Biology, 39, 103. Goss, P., & Peccoud, J. (1998). Quantitative modeling of stochastic systems in molecular biology by using stochastic Petri Nets. Proc Natl Acad Sci USA, 95, 6750 Grimes, G.R., Wen, T.Q., Mewissen, M., Baxter, R.M., Moodie, S., Beattie, J.S., & Ghazal, P. (2006). PDQ Wizard: Automated prioritization and characterization of gene and protein lists using biomedical literature. Bioinformatics, 22, 2055-2057. Hofestadt, R. a& Thelen, S. (1998). Quantitative modeling of biochemical networks. Silico Biology, 1(1), 39. Huang, S., (1999). Gene expression profiling, genetic networks and cellular states: an integrating concept for tumorigenisis and drug discovery. Journal of Molecular Medicine, 77, 469. Hucka, M. (2003). The systems biology markup language (SBML): A medium for representation and exchange of biochemical network models. Bioinformatics, 19, 524. Husmeier, D. (2003). Reverse engineering of genetic networks with Bayesian networks. Biochemical Society Transactions, 31(6), 1516. Husmeier, D. (2003). Sensitivity and specificity of inferring genetic regulatory interactions from microarray experiments with dynamic Bayesian networks. Bioinformatics, 19, 2271. Ideker, T., Ozier, O., Schwikowski, B., & Siegel, A.F. (2002). Discovering regulatory and signalling circuits in molecular interaction networks. Bioinformatic, 18, S233-240. Jeong, H., Tombor, B., Albert, R., Oltvai, Z.N., & Barabasi, A.L. (2000). The large-scale organization of metabolic networks. Nature, 407, 651-4. Joshi-Tope, G., Gillespie, M., Vastrik, I., D’Eustachio, P., Schmidt, E., de Bono, B., Jassal, B., Gopinath, G.R., Wu, G.R., Matthews, L., Lewis, S., Birney, E., & Stein, L. (2005). Reactome: A knowledgebase of biological pathways. Nucl. Acids Res., 33, D428-432. Liang, S., Fuhrman, S., & Somogyi, R. (1998). REVEAL: A general reverse engineering algorithm for inference of genetic network architectures. Pac Symp Biocomput, 3, 18. Kanehisa, M., Goto, S., Hattori, M., Aoki-Kinoshita, K.F., Itoh, M., Kawashima, S., Katayama, T., Araki, M., & Hirakawa, M. (2006). From genomics to chemical genomics: New developments in KEGG. Nucl. Acids Res., 34, D354-357. Kell, D,. (2006). Systems biology, metabolic modelling and metabolomics in drug discovery and development. Drug Discovery Today, 11, 1085. Kirkpatrick, S., Gelatt, C.D., & Vecchi, M.P. (1983). Optimization by simulated annealing. Science, 220, 671-680.



Pathway Biology Approach to Medicine

Kitano, H. (2003). A graphical notation for biochemical networks. Biosilico, 1, 169. Kitano, H., Funahashi, A., Matsuoka, Y., Oda, K. (2005). Using process diagrams for the graphical representation of biological networks. Nat Biotechnol, 23, 961-966. Kohn, K.W. (1999) Molecular interaction map of the mammalian cell cycle control and DNA repair systems. Mol. Biol. Cell, 10, 2703-2734. Kohn, K.W., Aladjem, M.I., Weinstein, J.N., & Pommier, Y. (2006) Molecular interaction maps of bioregulatory networks: A general rubric for systems biology. Mol. Biol. Cell, 17, 1-13. Laubenbacher, R. & Sigler, B. (2004). A computational algebra approach to the reverse engineering of gene regulatory networks. Journal of Theoretical Biology, 229, 523. Lemer, C., Antezana, E., Couche, F., Fays, F., Santolaria, X., Janky, R.S., Deville, Y., Richelle, J., & Wodak, S.J. (2004). The aMAZE LightBench: A Web interface to a relational database of cellular processes. Nucl. Acids Res., 32, D443-448. Matsuno, H., Doi, A., Nagasaki, M., & Miyano, S. (2000). Hybrid Petri Net representation of gene regulatory network. Pacific Symposium on Biocomputing, 5, 341. Singapore: World Scientific Press. Mendoza, L., Thieffry, D., & Alvarez-Buylla, E. (1999). Genetic control of flower morphogenesis in Arabidopsis thaliana: a logical analysis. Bioinformatics, 15, 593. Moodie, S., Sorokin, A., Goryanin, I., & Ghazal, P. (2006). A graphical notion to describe the logical interactions of biological pathways. Journal of Integrative Bioinformatics, 3. Nikitin, A., Egorov, S., Daraselia, N., & Mazo, I. (2003). Pathway studio--The analysis and navigation of molecular networks. Bioinformatics, 19, 2155-2157. Pagel, P., Kovac, S., Oesterheld, M., Brauner, B., Dunger-Kaltenbach, I., Frishman, G., Montrone, C., Mark, P., Stumpflen, V., Mewes, H.-W., Ruepp, A., & Frishman, D. (2005). The MIPS mammalian protein-protein interaction database. Bioinformatics, 21, 832-834. Pal. R., Ivanov, I., Datta, A., Bittner, M., & Dougherty, E. (2005). Generating Boolean networks with a prescribed attractor structure. Bioinformatics, 21, 4021. Pinney, J., Westhead, D., & McConkey, G. (2003). Petri Net representations in systems biology. Biochem Soc Trans, 31, 1513. Regev, A., & Shapiro, E. (2004). The pi-calculus as an abstraction for biomolecular systems. Modelling in Molecular Biology, Springer. Rual, J.-F., Venkatesan, K., Hao, T., Hirozane-Kishikawa, T., Dricot, A., Li, N., Berriz, G.F., Gibbons, F.D., Dreze, M., Ayivi-Guedehoussou, N., Klitgord, N., Simon, C., Boxem, M., Milstein, S., Rosenberg, J., Goldberg, D.S., Zhang, L.V., Wong, S.L., Franklin, G., Li, S., Albala, J.S., Lim, J., Fraughton, C., Llamosas, E., Cevik, S., Bex, C., Lamesch, P., Sikorski, R.S., Vandenhaute, J., Zoghbi, H.Y., Smolyar, A., Bosak, S., Sequerra, R., Doucette-Stamm, L., Cusick, M.E., Hill, D.E., Roth, F.P., & Vidal, M. (2005). Towards a proteome-scale map of the human protein-protein interaction network. Nature, 437, 1173.



Pathway Biology Approach to Medicine

Salwinski, L., Miller, C.S., Smith, A.J., Pettit, F.K., Bowie, J.U., & Eisenberg, D. (2004). The database of interacting proteins: 2004 update. Nucl. Acids Res., 32, D449-451. [SBGN, 2007] Systems Biology Graphical Notation Level 1 Specification, www.sbgn.org Shmulevich I., Dougherty, E., Kim, S., & Zhang, W. (2002). Probabilistic Boolean networks: A rulebased uncertainty model for gene regulatory networks. Bioinformatics, 18, 261. Shmulevich, I., Dougherty, E., & Zhang, W. (2002). From Boolean to probabilistic Boolean networks as models of genetic regulatory networks. Proc IEEE, 90(11), 1778. Smith, C.L., Dickingson, P., Forster, T., Khondoker, M., Craigon, M., Ross, A.J., Storm, P., Burgess, S., Lacaze, P., Stenson, B.J., & Ghazal, P. (2007). Quantitative assessment of human whole blood RNA as a potential biomarker for infectious disease. Analyst, 132, 1200-1209. Soon-Hyung Yook, Z.N.O.A.-L.B. (2004). Functional and topological characterization of protein interaction networks. PROTEOMICS, 4, 928-942. Sorokin, A., Paliy, K., Selkov, A., Demin, O., Dronov, S., Ghazal, P., & Goryanin, I. (2006). The pathway editor: A tool for managing complex biological networks. IBM J. Res. Dev. 50, 561-573. Stelzl, U., Worm, U., Lalowski, M., Haenig, C., Brembeck, F.H., Goehler, H., Stroedicke, M., Zenkner, M., Schoenherr, A., & Koeppen, S. (2005). A human protein-protein interaction network: A resource for annotating the proteome. Cell, 122, 957. Watts, D.J., & Strogatz, S.H. (1998). Collective dynamics of `small-world’ networks. Nature, 393, 440. Watterson, S., Marshall, S., & Ghazal, P. (2008). Logic models of pathway biology. Drug Discovery Today, 13, 447-456. Uetz, P., Dong, Y-A., Zeretzke, C., Atzler, C., Baiker, A., Berger, B., Rajagopala, S.V., Roupelieva, M., Rose, D., Fossum, E., & Haas, J. (2006). Herpesviral protein networks and their interaction with the human proteome. Science, 311, 239-242. Werhli, A. & Husmeier, D. (2007). Reconstructing gene regulatory networks with Bayesian networks by combining expression data with multiple sources of prior knowledge. Statistical Application in Genetics and Molecular Biology, 6, 15

10

11

Chapter II

Systems and Control Theory for Medical Systems Biology Peter Wellstead The Hamilton Institute, National University of Maynooth, Ireland Sree Sreenath Case Systems Biology Initiative, Case Western Reserve University, USA Kwang-Hyun Cho Korea Advanced Institute of Science and Technology (KAIST), Korea Olaf Wolkenhauer University of Rostock, Germany

abstract In this chapter the authors describe systems and control theory concepts for systems biology and the corresponding implications for medicine. The context for a systems approach to the life sciences is outlined, followed by a brief history of systems and control theory. The technical aspects of systems and control theory are then described in a way oriented toward their biological and medical application. This description is then used as a reference base against which to indicate specific areas where systems and control theory aspects of systems biology have strong medical implications. Specifically, two systems biology projects are described as examples of where methods from systems and control theory play an important role.

INTR OD UCTI ON In this chapter the authors give their experiences gained working at the interface between the biological/medical sciences and the physical/engineering systems sciences. In doing so we attempt to convey

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Systems and Control Theory for Medical Systems Biology

the contributions that the physical, mathematical and engineering sciences have made, and will continue to make, to innovations in biology and medicine. In this context we stress the role played by systems and control theory in the development of general principles for biological systems, and in particular the understanding of dynamical phenomena in biology and medicine. According to our experiences, systems methods are influencing the biology research sector through a series of evolutionary scientific steps, as follows: • • •

•

Stage 1: High-throughput biochemical instrumentation was (and continues to be) developed to provide rapid measurement and generation of data. Stage 2: To meet the need to process data generated in stage 1, data processing methods are being developed to extract information from very large data records. Stage 3: The information from stage 2 is used to calibrate mathematical models with which to visualise an underlying biological process. This is the current evolutionary state in systems biology. Stage 4: Control and systems theory are applied to the mathematical models of stage 3 to provide understanding of biological behaviour and underlying principles. In summary, the sequence goes from:

measurement → data → information → visualisation → understanding. The current state of the art is that the value of in-silico simulation of biological phenomena is becoming appreciated. Even so, most biological measurement techniques are designed to collect static data, whereas time course data is required to develop mathematical models for visualising system dynamics by in-silico simulation. It is not always appreciated that, as a result of poor data, the calibration and structural correctness of mathematical models is often suspect. Likewise, there is currently little appreciation of the fundamental importance of control and systems theory in understanding biological and physiological phenomena and principles. On the other hand, the role of systems and control theory is clearly established in the medical community through the understanding that it gives to physiological function. Under the historical influence of Claude Bernard’s ideas, as embodied in Cannon’s concept of homeostasis (Bayliss, 1966, Cannon, 1932), feedback control is central to many aspects of current medical understanding, although this is usually intuitive and non-theoretical in nature (Tortora, 2003). Since Cannon’s work in the 1930’s, other researchers have expanded upon the homeostatic feedback principle (Sterling, 2004) in its specific medical and physiological contexts. In the meantime however, systems and control theory has expanded scientifically and progressed to become a mature scientific discipline with fundamental relevance to all areas of scientific endeavour. Throughout this 70-year period of separate development, the medical concepts of control systems and the mathematical tools of control and systems theory have diverged. The aim of this chapter is to reconnect the medical ideas of feedback with mainstream theory by explaining areas where control and systems theory can contribute. We consider this to be vitally important to our scientific futures. For, as indicated above and documented in the recent report Systems Biology: a vision for engineering and medicine (Royal Academy, 2007), the use of systems theory and control concepts will be essential to our understanding of biological systems for medicine.

12

Systems and Control Theory for Medical Systems Biology

BRIEF

HIST ORY OF C ONTR OL AND SYSTEMS

THE ORY

Control and systems theory have their origins in the 1700’s with practical devices designed to regulate speed in wind, water and steam energy sources. In the hurly burly of the Industrial Revolution, design changes to improve the performance of feedback regulators rapidly outstripped their designer’s ability to predict their dynamical behaviour. However, as the new invention spread to astronomical instruments, scientists such as Airey and Maxwell became interested. In this context, the appearance of Maxwell’s paper ‘On Governors’ (Maxwell 1867) was a pivotal point in control and systems theory. It gave a mathematical basis for understanding the stability of physical systems and made the mathematical analysis of engineering systems respectable. This process of technical and theoretical development expanded rapidly with industrial growth in the 1800’s. This era is ably described in the historical account (Bennett 1979). The need for analysis and design methods for electronic amplifiers, just as mechanical regulators before, led to the next crucial development in control and systems theory – the systematic stability analysis and design in the frequency domain. The 1930’s framework set by Nyquist (1932), Bode (1945) and Shannon (1948), informed theoretical developments for twenty five years until the needs of aerospace led to an alternative time-domain framework for the theory of signals and systems (Bennett, 1993). The 1950’s saw the beginning of a golden age of theoretical and technical advances in control and systems theory. An age during which research became an international endeavour, with theoretical developments emerged rapidly and from numerous independent sources. It resulted in what we have now: control and systems theory as a mature discipline covering: analysis and design of feedback systems, optimal control theory, multivariable systems theory, modelling, systems identification and much more. The following paragraphs will outline these as they relate to systems biology for medicine.

OUT LINE OF C ONTR OL AND SYSTEMS

THE ORY METH ODS

Control and systems theory, together with methods from communication theory, offers a unified structure within which to mathematically represent, analyse, understand and potentially modify the dynamical behaviour of systems and signals. The principle of homeostasis means that control is accepted in physiology and medicine (Tortora, 2003), also there are books upon basic control and systems theory in medicine (Riggs, 1976). However in the years subsequent to Cannon’s work control and systems theory has developed into a complete theoretical and analytical framework for understanding the behaviour of dynamical systems. In the following we outline the components of this framework.

Mathematical Models for C ontrol and S ystems A nalysis The primary purpose of mathematical models is to allow the dynamical behaviour of systems to be analysed for design, performance prediction and control (Crandall, 1968). For linear systems a classical representation of system dynamics is the transfer function model. Such models, developed from the analysis of frequency response systems, have theoretical foundations in Laplace transform methods and complex variables (Smith, 1966). Transfer function methods are not generally used in systems biology applications because they are designed for linear systems. The nonlinear dynamics encountered

13

Systems and Control Theory for Medical Systems Biology

in biochemical reactions is catered for in the alternative form of control and systems model - the state space model (Friedland, 2005). The state space representation is based upon sets of coupled first-order differential equations such as occur naturally in mathematical models of metabolic pathways and cell signalling. Moreover, the state space form accommodates nonlinear dynamical features such as those that appear routinely in biology/physiology. The control and analysis of state space systems is however only fully developed for the case of linear systems. A range of theoretical methods for stability and performance analysis of nonlinear state space equations exists (Freeman and Kokotovic, 1996) and there are methods especially tuned for state space structures found in the life sciences. In the following, and unless stated, we will assume that a state space model form is required or used. (Note that hybrid models that combine continuous dynamics (e.g. reaction kinetics) and logical processes (e.g. in gene regulation), and/or pure time delays (e.g. transport processes) are more complex to analyse.).

Modelling Methods and C omputer B ased S imulation The methods for deriving and developing mathematical models of dynamical systems have been thoroughly developed by the control and systems community, (Wellstead, 1979, MacFarlane, 1970). These physical systems methods, suitably augmented by biochemical reaction methods (Cornish-Bowden, 2004), provide a conceptual basis and practical framework for constructing the differential equation/state space models needed to describe dynamical phenomena in cell biology and physiology. The rapid and easy visualisation of the dynamical behaviour of these models is a basic tool in control and systems analysis and there is a wide range of numerical implementations of dynamical systems simulators for digital computers. A de facto standard for such simulation (and originally developed by control and dynamics experts) is MATLAB (Higham and Higham, 2005). This software has numerous accessories for control and systems analysis and allows the development of specialised toolboxes. One such toolbox is the Systems Biology Toolbox, which is specifically for state space models of signalling and metabolic pathways (Schmidt and Jirstrand, 2006). The ability to easily visualise the behaviour of a complex dynamical system from its mathematical model has had a particular impact in medicine and physiology (Hunter and Borg, 2003). The multiscale methods needed by such areas however require more general modelling software to allow spatial as well as temporal information to model organ and tissue function (Hunter et. al. 2006). In the same spirit, the simulation of metabolic systems and in particular in-silico pharmacokinetics and pharmacodynamics have profited from dynamical modelling methods founded in systems and control theory.

System Identi.cation and Data Analysis Writing down the equations of what describes a metabolic process, signalling pathway, gene regulation system or physiological process is only one aspect of mathematical modelling in systems biology. The more demanding aspects are determining (a) whether the model structure is valid (structure identification) or (b) determining the numerical value of the various model parameters (parameter estimation). These two tasks are part of the area known in control and systems theory as system identification. A good view of basic ideas in systems identification is the classic engineering text (Eykhoff, 1974), while statistical time series approaches are covered in an accessible manner elsewhere (Box and Jenkins, 1970).

14

Systems and Control Theory for Medical Systems Biology

System identification is key to creating good models in systems biology for medicine, since it is commonplace for coefficients of models to be unknown, and in many cases the structure of the pathways is uncertain. Indeed some of the most biologically interesting contributions in systems biology have been where system identification has shown that signalling pathways based on biological deduction were wrong (Swameye, et. al. 2003). Likewise, the use of parameters from the literature is a poor compromise when they can be directly estimated for the experimental situation in hand.

Identi.ability The degree to which a system can be determined from measured data is termed identifiability (Wellstead, 1975) and it is an important concept. Specifically, in some cases it is impossible to uniquely identify a system uniquely from the available measured data. There are two aspects to this. The first relates to the structure of the system, whereby for certain interrelations in the system it is impossible to unambiguously determine particular parameters or distinguish causality. Feedback structures of the kind found in medical physiology are one such form that gives identifiability problems in distinguishing between forward signal transmission and feedback transmission paths. The further aspect concerns whether the system modes are sufficiently excited to allow identification from the measured data. This is of particular relevance to medical systems biology where data is often unsuitable for identification because of limitations on what ‘input’ perturbations are possible. The topic of experiment design is relevant here (Zarrop, 1979).

Random Processes in Control and Systems Theory Of equal importance to the application of systems identification itself is the thorough analysis and validation of the time course data associated with experimental procedures. All measured data is subject to error and the correct treatment of such data from dynamical processes is the aim of random data analysis. A comprehensive and practical reference to these methods is (Bendat and Piersol, 2000). The key issue here is that all measurement processes are subject to distortion (both systematic and random). Likewise the underlying processes that drive the system may themselves be stochastic in nature and require characterisation with the tools of probabilistic data analysis (Papolis and Pillai, 2002).

C ontrol S ystem B asics Feedback Structures Control and systems theory gives us a deep understanding of feedback in its practical and theoretical aspects. From the application of feedback in engineering systems and machines, we have developed a complete theory of feedback in linear dynamical systems. This has been mainly applied to designing and building devices that depend upon closed loop feedback control for their performance. In systems biology, the knowledge won in technological development helps us to understand the role of feedback loops in biological processes. In particular, experience of design of technological control systems allows analogies to be found in living systems for such principles as design for regulation against disturbances (c.f. homeostasis), set-point tracking and feedforward compensation. The better understanding of biological, metabolic and physiological function that this affords allows us to predict consequences of

15

Systems and Control Theory for Medical Systems Biology

interventions that disturb physiological and biological loops. This is particularly true where the system has complex crosstalk between interacting channels in which multi-input, multi-output control system analysis (Skogestad and Postletwaite, 1996) can predict the unusual responses that can occur under feedback conditions.

Stability and Transient Response The analysis of time course (transient) behaviour is basic to control and systems theory, and its transfer to the understanding of biological dynamics is of paramount value. There is a wide range of theoretical tools in this area, but the most immediately relevant are drawn from state space analysis. They offer insights into the possible convergence points (e.g. steady state) of systems, stability properties and transient performance. Stability analysis of nonlinear systems is particular relevant to systems biology (Slotine, 1991), since all but the most basic of mathematical models of biological systems are nonlinear with potentially complex dynamical behaviour. Thus stability methods based upon Lyapunov analysis (Bacciotti and Rosier, 2005) and the special structures that occur in life science systems provide insights into behaviour (Angeli and Sontag, 2003).

S ystem Properties In understanding how to control technological systems, control theorists have formalised a number of mathematical properties that are important to the understanding of systems in general. Key among these properties for systems biology in medicine are observability, controllability, sensitivity and robustness. As follows: •

•

•

•

16

Observability. In broad terms, this property relates to the ability to determine states of a system from measurements at the outputs. In systems biology for medicine, the states are concentrations of chemicals in a metabolic, signalling or physiological network. Concentrations that cannot be measured from the available data are said to be unobservable. Controllability. Similarly in broad terms, controllability is the ability of a control mechanism to manipulate all the states of a system from the inputs. This has implications in therapies that aim to adjust biochemical levels by external controls – an uncontrollable state cannot be adjusted in this way. Likewise, in certain signalling pathways it may not be possible from the inputs (e.g. receptor channels) to modify certain chemical concentrations – they are then said to be uncontrollable. Sensitivity. This property is important in understanding the constraints on performance of a dynamical systems. It relates to the sensitivity of the overall dynamical system to variations in different parts of the system. Thus changes in certain parameters (e.g. kinetic coefficients in a pathway model) may have a big influence on the observable system performance – implying a large sensitivity. Others may have only a small impact – implying insensitivity. Robustness. This property is related to sensitivity, in the sense that one purpose of negative feedback is to make a system robust (that is insensitive) to variations in certain parameters or variables. For example, one purpose of homeostatic loops is to make the metabolism robust against external variations – a side result is that it will be sensitive to others as part of a robustness/sensitivity trade off (Dorato, 1998). Robustness is recognised as an important biological principle, albeit with a slightly less formal definition, (Kitano, 2007).

Systems and Control Theory for Medical Systems Biology

T ypes of C ontrol S ystems Related to the properties exhibited by a control system is the purpose that it is intended to serve and the objective or procedure used in its design. Typically, control systems may have the objective that a system variable might be required to follow some external variation within certain limits of accuracy and speed. This would be what is termed classical servo/reference tracking control. Other control systems are set up to maximise (or minimise) some objective function in some optimal way. This is termed optimal control (Bryson and Ho, 1969). When random disturbances predominate then the controller design objective is focussed upon the disturbances. This is termed stochastic control and is treated as branch of optimal control – but more importantly uses Kalman filtering (Kalman and Bucy, 1961). The Kalman/Bucy framework is of importance to systems biology since it provides a state space framework for understanding and analysing random processes. A further controller type that is relevant to systems biology is coordinating control, where the control mechanism must combine the dual function of regulating local behaviour with coordination, (Mesarovic et al., 2004). Beyond this there are many more specialist control systems that are particular to systems forms and application. The book (Goodwin, Graebe and Salgado, 2001) is a modern text that covers almost all of control design methods and types.

EXAMP LES In this section we give two examples of systems and control theory as they occur in medical systems biology research. The examples are both concerned with the investigation of special control structures within a system, and where the existence of the structure is medically informative. In Example 1, we examine interactions between signalling pathways and the implications for positive feedback to trigger critical state transitions. In Example 2 we examine organisational structures in a complex biological process that may have simplifying implications for investigations of biomarkers and molecular targets.

E xample 1: T he D ynamical R ole of C rosstalk B etween W nt and ERK Pathways in T umorigenesis In this example, we consider the use of a mathematical state space model of two cell signalling pathways (Wnt and ERK) to investigate their interaction and its implication for cancer studies. Specifically, this is an example of how interaction (or crosstalk) between systems can be studied using systems and control theory tools – specifically state space modelling, simulation and structural analysis to identify hidden feedback loops. The Wnt pathway conveys a signal from Wnt to β-catenin such that the βcatenin level increases by inhibiting GSK-3β, which normally induces the ubiquitination of β-catenin. The increased β-catenin translocates into the nucleus and induces the expression of various oncogenes by forming a complex with TCF (the abnormal increase of β-catenin commonly occurs for colorectal cancers) (Behrens J. 2005). On the other hand, ERK pathway conveys a signal from growth factors such as EGF, PDGF to ERK through the Raf-1MEKERK cascade. The finally activated ERK (ERKpp) also induces the expression of various proliferation genes (ERK mutants are commonly observed for about 30% of all human cancers).

17

Systems and Control Theory for Medical Systems Biology

Figure 1. (A) Crosstalks in the Wnt/ERK pathways and the hidden positive feedback loop formed by these crosstalks. (B) The phase diagrams for a normal status with stimulations over 100min and 500 min durations, respectively. (C) The phase diagrams for an abnormal status with stimulations over 100min and 500 min durations, respectively W nt

(B) ERKpp(nM)

(A)

R af -1

TCF ß-catenin

(C) ERKpp(nM)

X

200 150 100

0 8.5

MEK ERK

250

50

G S K -3ß

ß-catenin

t = 100 t = 500

300

9

9.5

10

10.5

11

11.5

12

12.5

13

13.5

300 250 200 150 100 50 0 10

10.5

11

11.5

12

12.5

13

13.5

14

14.5

The Wnt and ERK signalling pathways are usually considered independent, but there are reports of crosstalk between them. These include the direct activation of ERK pathway by Wnt, the activation of Raf-1 through unknown molecule X which is induced by β-catenin /TCF complex (Yun, MS et. al. 2005, Rottinger, E. 2004), and the inhibition of GSK-3β by ERKpp (Almeida M, 2005, Ding Q, 2005). If these crosstalks are taken together, then a positive feedback loop is revealed embedded in the Wnt/ ERK pathways as illustrated in Figure 1(A). The systems biology question then arises about the role of this hidden positive feedback loop (Y-K. Kwon, K-H. Cho. 2007, D. Kim. Y-K Kwan, et. al. 2007). In a normal status, the signalling molecules become activated by external stimulations to respond to environmental changes and then return to their original inactivated states as the stimulation ceases (Figure 1(B)). However, if there are some mutations and the hidden positive feedback gets enhanced by such mutations (abnormal status), then the system can sustain the activated states even after the external stimulation disappeared (Figure 1(C)). In other words, the hidden positive feedback loop in the Wnt/ERK pathways can induce an irreversible state change that leads to an oncogenic status. The state space mathematical model used to produce Figure 1(B) and (C) is shown in Box 1 (D. Kim, O. Rath, et. al. 2007). The symbols Raf, Wnt, MEK, ERK, catenin, TCF, etc are system states corresponding to the concentrations of the corresponding proteins in the signalling pathways and the mathematical model was implemented and simulated in MATLAB.

E xample 2: Using a C omplex S ystems B iology A pproach to Understand C ellular S ignaling B ehavior in A cute Myelogenous Leukemia (AM L) In this example we illustrate a systems framework developed to search for the coordinating control principles mentioned previously (Mesarovic et al., 2004). In a multilevel, hierarchical system, the task of a coordinator in the upper level is to harmonize the lower-level subsystems by influencing their functions

18

Systems and Control Theory for Medical Systems Biology

Box 1. d [ Raf − 1] = Wnt + [ X ] − [ Raf − 1] dt d [ MEK ] = [ Raf − 1] − [ MEK ] dt d [ ERK ] = [ MEK ] − [ ERK ] dt d [GSK − 3 ] = Const − Wnt − [ ERK ] − [GSK − 3 ] dt d [ − catenin] = Const − [GSK − ] − [ − catenin] dt d [ − catenin / TCF ] = [ − catenin] − [ − catenin / TCF ] dt d[ X ] = [ − catenin / TCF ] − [ X ] dt

such that the overall system “goal” is advanced or attained (Sreenath et al., 2007). We demonstrate here a systematic approach to identify a coordinator in a signalling pathway. The identification of a coordinator in a signalling pathway helps in narrowing down molecular targets for further biological study or as biomarkers (for diagnosis). This example examines a conserved pathway, Janus Kinase – Signal Transducer and Activator of Transcription (JAK-STAT), that has been implicated in Acute Myelogenous Leukemia (AML) (Yu & Jove, 2004). The pathway is induced by a small protein, Interleukin-3 (IL3), that effects cell growth and differentiation (Rane & Reddy, 2002). In a healthy cell, IL3 causes transient activation of STAT5 isoform (i.e. STAT5 phosphorylation), whereas in AML, STAT5 is constitutively (continuously) active (Yu & Jove, 2004). Our beginning point is a mathematical model (including numerical values of nominal parameters) described in (Yamada et al., 2003) that has a different receptor complex, but the same downstream mechanism. To better describe the IL3-induced JAK-STAT5 mechanism, the receptor complex was modified to be compatible with the IL3 ligand. The biochemical reactions were transformed into nonlinear differential equations (Sreenath et al., 2007), resulting in a state space model with 49 states, 118 parameters, 2 outputs and IL3 as an input. We estimated 3 receptor complex parameters using semi-quantitative data (Chen et al., 2004) that expresses the relative amount of biochemical in terms of intensity. The biochemical reactions were further modularised using a hybrid method, and represented in the block diagram (Figure 2). A series of in silico experiments were performed to identify a subsystem with the coordinator characteristics (Sreenath et al., 2007). Assuming that each hierarchical system has an overall system objective, a coordinator (at a higher level) should display the following properties: (i) lower level subsystems are functionally independent; (ii) the coordinator can change the lower level subsystems functioning; and (iii) the coordinator can change the lower level subsystem behaviour such that the overall system objective is satisfied.

19

Systems and Control Theory for Medical Systems Biology

Figure 2. Block diagram of the modularized JAK-STAT5 system

Figure 3. In silico simulation results. (A) nominal behavior. (B,C) describes a knockdown (elimination) of the indicated biochemical (SHP2 and SOCS respectively)

A

B

C

Results show that eliminating the negative regulators – SHP2 or SOCS – causes a behaviour category different from the nominal behaviour (Figure 3). This implies that SHP2 or SOCS modules are candidate coordinators since they are capable of changing the system behaviour. If SHP2 subsystem is a coordinator, the first coordination condition is not satisfied because of the dependency of SOCS on STAT subsystem. To test if SOCS subsystem is indeed a coordinator, a pathological condition was simulated and the parameters varied within the SOCS subsystem until the system was within its nominal behaviour category (Figure 4). This confirmed the existence of parameters in the SOCS subsystem that promote the overall pathway behaviour to return to normal physiological conditions (Figure 5). Thus, by

20

Systems and Control Theory for Medical Systems Biology

Figure 4. In silico simulation results with the parameters of example 2 varied within the SOCS subsystem until the system was within its nominal behaviour category

Figure 5. The SOCS subsystem (module) as a coordinator, with the JAK-STAT5 system represented as a multilevel hierarchical system.

identifying SOCS subsystem as a coordinator in-silico experiments the number of the molecular drug targets is potentially reduced to twelve from 118 parameters – a factor of ten reduction.

C ONC LUSI ON Systems and control theory concepts have been crucial to the development of technological systems from the Industrial Revolution to date. Indeed, modern day technology depends completely upon theoretical methods of systems and control for its function. The practical evidence is that living systems also use

21

Systems and Control Theory for Medical Systems Biology

systems and control methods in a structured way to, for example, (a) regulate and organise their performance, (b) achieve certain objectives and (c) resist unwanted external change. Moreover, the systems and control analysis of biological and physiological processes suggests that nature has evolved methods that are remarkably similar to systems and control theory principles used by engineers in technological applications. This in turn means that we can plausibly hope that systems and control theory analysis can be used in biology and to tease out underlying operational principles that can be of use in medicine. The homeostatic principle is the shining of example of such a principle with general application and Example 2 in this chapter presents the essence of another more modern principle with similar potential.

R eferences Academy of Medical Sciences and the Royal Academy of Engineering. (2007). Systems biology: A vision for engineering and medicine. London: Royal Academy of Engineering. Almeida, M., Han, L., Bellido, T., Manolagas, S. C., & Kousteni, S. (2005). Wnt proteins prevent apoptosis of both uncommitted osteoblast progenitors and differentiated osteoblasts by beta-catenin-dependent and -independent signaling cascades involving Src/ERK and phosphatidylinositol 3-kinase/AKT. J Biol Chem, 280, 41342-41351. Angeli, D., & Sontag, E. D. (2003). Monotone control systems. IEEE Trans. Automatic Control, 48, 1684-1698. Bacciotti, A., & Rosier, L. (2005). Liapunov functions and stability in control theory. Berlin: Springer Verlag. Bayliss, L.E. (1966). Living control systems. London: English University Press. Behrens, J. (2005). The role of the Wnt signalling pathway in colorectal tumorigenesis. Biochem Soc Trans. 33, 672-675. Bendat, J. S., & Piersol, A. G. (2000). Random data: Analysis and measurement procedures. New York: John Wiley & Sons. Bennett, S. (1979). A history of control engineering: 1800-1930. London: Peter Peregrinus. Bennett, S. (1993). A history of control engineering: 1930-1955. London: Peter Peregrinus. Bode, H. W. (1945). Network analysis and feedback amplifier design. New York: Van Nostrand. Box, G. E. P., & Jenkins, G. M. (1970). Times series analysis, forecasting and control. New York: Holden Day. Bryson, A., & Ho. YC. (1969). Applied optimal control. London: Taylor Francis Cannon, W.B. (1932). The wisdom of the body. Chicago: W. W. Norton Press. Chen, Y., Yu, W., Bunting, K. D., & Qu, C.-K. (2004). A negative role of SHP2 tyrosine phosphatase in growth factor-dependent hematopoietic cell survival. Oncogene, 23(20), 3659-3669.

22

Systems and Control Theory for Medical Systems Biology

Crandall, S. H., Karnopp, D. C., Kurtz, E. F., & Pridmore Brown, D.C. (1968). Dynamics of mechanical and electromechanical systems. New York: McGraw Hill. Cornish-Bowden, A. (2004). Fundamentals of enzyme kinetics. New York: Portland Press. Ding, Q., Xia, W., Liu, JC., Yang, JY., Lee, DF., Xia, J. et. al. (2005). Erk associates with and primes GSK-3beta for its inactivation resulting in upregulation of beta-catenin. Mol Cell, 19. 159-170. Dorato, P. (1998). Non-fragile controller design: an overview. Proceedings of the American Control Conference, 2829-2831. Eykhoff, P. (1974). System identification. New York: John Wiley & Sons. Freeman, F. A., & Kokotovic, P. V. (1996). Robust nonlinear control design. Berlin: Birkhauser Verlag. Friedland, B. (2003). Control systems design: State space methods. New York: Dover Books. Goodwin, G. C., Graebe, S. F., & Salgado, M. E. (2001). Control system design. New Jersey: Prentice Hall. Higham, D. J., & Higham, N. J. (2005). Matlab Guide. New York: Society for Industrial and Applied Mathematics (SIAM). Hunter, P. J., & Borg, T. K. (2003). Integration from proteins to organs: The physiome project. Nature Reviews Molecular Cell Biology, 4, 237-243 Hunter, P. J., Li, W.W., McCulloch, A. D., & Noble, D. (2006). Multiscale modelling. Computer, 39, 48-54. Kalman, R. E., & Bucy, R. (1961). New results in linear filtering and prediction theory. Trans. ASME J. Basic Engineering, 35, 2-34. Kitano, H. (2007). A robustness-based approach to systems-oriented drug design. Nature Reviews Drug Discovery, advance online publication, 23 February | doi :10.1038/nrd2195. Kim, D., Kwon, Y.-K., & Cho, K-H. (2007). Coupled positive and negative feedback circuits form an essential building block of cellular signaling pathways. BioEssays, 29 (1), 85-90. Kim, D., Rath, O., Kolch, W., Cho. K-H. (2007). A hidden oncogenic positive feedback loop caused by crosstalk between Wnt and ERK Pathways. Oncogene, (online publication 22 January 2007; doi: 10.1038/sj.onc.1210230). Kwon, Y.-K., & Cho, K.-H. (2007). Boolean dynamics of biological networks with multiple coupled feedback loops. Biophysical Journal, 92 (8), 2975-2981. MacFarlane, A. G. J. (1970). Dynamical system models. London: Longman. Maxwell, J. C. (1867). On governors. Proceedings of the Royal Society, 16, 270-283. Mesarovic, M. D., Sreenath, S. N., & Keene, J. (2004). Search for organising principles: Understanding in systems biology. IEE Systems Biology, 1(1), 19-27

23

Systems and Control Theory for Medical Systems Biology

Nyquist, H. (1932), Regeneration theory. Bell Systems Technical Journal, 11, 126-147. Papoulis, A., & Pillai, S. U. (2002). Probability, random variables and stochastic processes. New York: McGraw Hill. Rane, S. G., & Reddy, E. P. (2002). JAKs, STATs, and Src kinases in hematopoiesis. Oncogene, 21, 3334-3358 Riggs, D. S. (1976). Control theory and physiological feedback mechanisms. New York: Robert Krieger Publishing. Rottinger, E., Besnardeau, L., & Lepage, T. (2004). A Raf/MEK/ERK signaling pathwayis required for development of the sea urchin embryo micromere lineage through phosphorylation of the transcription factor Ets. Development, 131, 1075-1087. Schmidt, H., & Jirstrand, M. (2006). Systems biology toolbox for MATLAB: A computational platform for research in Systems Biology. Bioinformatics, 22 \(4), 514-515. Shannon, H. (1932). The mathematical theory of communication. Bell System Technical Journal, 27, 379-623. Skogestad, S., & Postlethwaite, I. (1996). Multivariable feedback control. London: John Wiley and Sons. Slotine, J-J., and Li, W. (1991). Applied nonlinear control. London: Prentice Hall. Smith, M. G. (1966). Laplace transform theory. New York: Van Nostrand Reinhold. Sreenath, S. N., Soebiyanto, R. P., Mesarovic, M. D., & Wolkenhauer, O. (2007). Coordination of crosstalk between MAPK-PKC Pathways: An Exploratory Study. IET Systems Biology, 1(1), 33-40. Sterling, P. (2004). Principles of allostasis: Optimal design, predictive regulation, pathophysiology and rational therapeutics. In J. Schulkin (Ed). Allostasis, Homeostasis, and the Cost of Adaptation, (pp. 3245), Cambrige: Cambridge University Press. Swameye, I., Müller, T.G., Timmer, J., Sandra, O., & Klingmüller, U. (2003). Identification of nucleocytoplasmic cycling as a remote sensor in cellular signaling by data-based modeling. Proc. National Academy of Science, 100, 1028-1033. Tortura, G. J., & Grabowski, S. R. (2003). Principles of anatomy and physiology. New York: John Wiley and Son. Wellstead, P. E., & Edmunds, J. M. (1975). Least squares identification of closed-loop systems. International Journal of Control, 21(4), 689-699. Wellstead, P. E. (1979). Introduction to physical system modelling. Oxford: Academic Press. Yamada, S., Shiono, S., Joo, A., & Yoshimura, A. (2003). Control mechanism of JAK/STAT signal transduction. FEBS Lett., 534, 190-196. Yu, H., & Jove, R. (2004). The STATs of cancer - New molecular targets come of age. Nat. Rev. Cancer, 4, 97-105.

24

Systems and Control Theory for Medical Systems Biology

Yun, MS., Kim, SE., Jeon, SH., Lee, JS., & Choi, KY. (2005). Both ERK and Wnt/beta-catenin pathways are involved in Wnt3a-induced proliferation. J. Cell. Sci., 118, 313–322. Zarrop, M. B. (1979). Optimal experiment design for dynamic system identification. Lecture notes in Control and Inference Science (21). Berlin: Springer.

K ey T erms Closed Loop Feedback Control: This is the process of continuously measuring the output of a system and using a modified version of the measured output at the systems input so as to alter the overall performance of the system. Control Theory: The set of mathematical techniques used to analyse and design control systems. Data Analysis: The analysis of time course data from a system in order to understand the nature of the signal generating mechanisms associated with a system. These are often unwanted noise or errors in the process and are used to modify or correct the mathematical model. Dynamical System: An assembly of components or sequence of reactions whose performance can only be completely described by a study of its behaviour over time. Feedback: The technique of monitoring information from one part of a system and using it to modify a system element at some point prior to the monitoring point. If the monitored information is used to add to the system element it is positive feedback, if it is used to subtract from the system element it is negative feedback. Frequency Domain: The name given to a mathematical space into which mathematical models are transformed for systems and control studies using harmonic analysis of the time course data. This is highly suited for linear systems – in medical systems biology most systems are non-linear. In-silico Simulation: The use of a special computer programme to solve the equations of a mathematical model and produce a set of plots of model parameters over time. Linearity: Is the property of a system where if two inputs sequences Xa and Xb produce responses Ya and Y b, then Xa+Xb will produce the response Ya+Y b . The system is said to be linear – most biological and medical systems do not satisfy this criteria and are said to be non-linear. Mathematical Model: A set of equations, usually ordinary differential equations, the solution of which gives the time course behaviour of a dynamical system. The set of equations for example 1 is an example of a mathematical model. MATLAB: The name of a widely used proprietory software package that is especially suited to the simulation of dynamical system models and their analysis. It is produced by MathWorks Inc. It is adapted from a public domain package of the same name – public domain equivalents are available as Octave and Scilab. Pharmacokinetics: This refers to the dynamical mechanism by which a drug is absorbed, and processed by the body

25

Systems and Control Theory for Medical Systems Biology

Pharmacodynamics: This refers to the analysis of the biochemical and physiological effects of drugs and the mechanisms in which they work. Stability Analysis: That part of systems and control theory which is used to study and predict the stability or instability characteristics of a system from a knowledge of the mathematical model. State Space: The name given to the mathematical space into which mathematical models are put for systems and control studies using temporal analysis of the time course data. State space (or time domain) analysis is suitable for linear or non-linear systems analysis. This is therefore highly suited to medical and systems biological analysis. System Identification: The analysis of time course data from a system in order to deduce the nature of the system and the values of parameters that could be used in a mathematical model to reproduce the time course data in simulation. Systems Theory: The set of mathematical techniques used to analyse and understand the (dynamical) behaviour of systems. Transfer Function: The name given to the frequency domain representation of a functional system module with distinct input and output points.

26

27

Chapter III

Mathematical Description of Time Delays in Pathways Cross Talk S. Nikolov Institute of Mechanics and Biomechanics, Bulgaria V. Petrov Institute of Mechanics and Biomechanics, Bulgaria V. Kotev Institute of Mechanics and Biomechanics, Bulgaria G. Georgiev Institute of Mechanics and Biomechanics, Bulgaria

abstract In this chapter we investigate how the inclusion of time delay alters the dynamic properties of (a) delayed protein cross talk model, (b) time delay model of RNA silencing (also known as RNA interference), and (c) time delay in ERK and STAT interaction. The consequences of a time delay on the dynamics of those systems are analysed using Hopf’s theorem and Lyapunov-Andronov theory. Our analytical calculations predict that time delay acts as a key bifurcation parameter. This is confirmed by numerical simulations.

INTR OD UCTI ON The aim of this review is to give an extended analytical consideration of the role of time delay in the behaviour associated with dynamical models: (i) delayed protein cross talk model; (ii) time delay model of RNA silencing and (iii) time delay in ERK and STAT interaction. Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Mathematical Description of Time Delays in Pathways Cross Talk

Some of the results presented here are obtained and published in the papers (Nikolov, Kotev, Georgiev, & Petrov, 2006; Nikolov, Kotev, & Petrov, 2006a; Nikolov, Kotev, & Petrov, 2006b; Nikolov, Vera, Wolkenhauer, Yankulova, & Petrov, 2007; Nikolov & Petrov, 2007; Nikolov, Vera, Kotev, Wolkenhauer, & Petrov, 2008), but new considerations and improvements are also made. The investigations, conducted on time-delay mathematical models, examine how the time-delay influences the processes of protein synthesis, the RNA silencing and the interaction of the ERK and STAT proteins. Using the LyapunovAndronov theory and the Hopf theorem, the bifurcation values of the time delay are discovered, the zones of stability and instability are determined, and from there – the zones of norm and pathology (cancer) for each process. Thus, the greatest advantage of such an approach is revealed, namely – the theoretical forecast (prediction) of various diseases, including cancer.

D ynamical A spects of Protein C ross T alk and T ime D elay

The notion cross talk is introduced in the intracellular kinetics to denote the mutual interaction between signalling pathways (Wolkenhauer, Ullah, Wellstead, & Cho, 2005; Wolkenhauer, Streenath, Wellstead, Ullah, & Cho, 2005). It is realized by corresponding cross talk of the pathways elements, i.e. proteins. So the study of protein cross talk is necessary step in investigating the nature of pathways cross talk. The last is also necessary to analyze more complex networks of pathways. In some cases authors talk just about protein interactions having in view interaction between at least two proteins (Pircher, Petersen, Gustafsson, & Haldosen, 1999). On the other hand, in terms of systems theory, the protein interaction can be defined as feedback between two proteins. That’s why this type of interaction is also called feedback loop. Let us consider a simple hypothetical interaction between two proteins X and Y presented by the following kinetic equations:

dx = k1 y dt

(1.1.1)

dy = − k2 x − k1 y dt

(1.1.2)

where x and y are the concentrations of the proteins X and Y respectively. The kinetic sense of the system (1.1.1)-(2) consists in the following two processes: (i) The protein Y spontaneously degrades in a protein X with a reaction rate constant k1; (ii) The protein X activates the degradation of protein Y with a proportionality coefficient k2. The system (1.1.1)-(2) can be written in the form of following linear oscillator with attenuation:

d2x dx + k1 + k1k2 x = 0 2 dt dt

(1.1.3)

Here the rate constant k1 plays role of a friction coefficient of the oscillator. Let us further suppose that the protein X needs some time τ to activate the degradation of protein Y. That means the rate of degradation

dy (t ) of Y in the moment t, is proportional to the concentration x(t dt

– τ) of X in a previous moment t – τ. Thus instead of (1.1.1)-(2), we should write:

28

Mathematical Description of Time Delays in Pathways Cross Talk

dx = k1 y dt dy = − k2 x(t − ) − k1 y dt

(1.1.4) (1.1.5)

The equations (1.1.4)-(5) are called differential equations with time delay. If the time delay τ is sufficiently small, we can apply appropriate procedure to analyze the role of τ in the qualitative behavior of the system (1.1.4)-(5). For this purpose we develop the function x(t – τ) in Taylor’s expansion:

x(t − ) = x(t ) −

2  d 2 x(t )  dx(t ) +   + ... dt 2  dt 2 

(1.1.6)

and retain only the first, second and third (i.e. up to quadratic one with respect to τ) terms. It is well known that, replacing x(t – τ) with higher order approximation of a Taylor’s series is not better than applying lower order approximation (Elsgoltz, 1957; Driver, 1977). The reason of this paradoxical phenomenon consists in the circumstance that the higher order terms in (1.1.6) are in principle not small. For example, by applying a step-by-step method (Elsgoltz, 1957; Driver, 1977) to solve a time delay system in Taylor’s presentation with higher order terms, a small parameter at the higher derivatives appears. On the contrary, in lower order terms approximation similar parameter does not appear. How detailed the statement of this circumstance is depends on the order of the system. In the present two-order case, Taylor’s series can be applied only up to quadratic approximation. Certainly, linear approximation is also admissible. Further we replace (1.1.4) in the linear approximation of (1.1.6) and write:

x(t − ) = x(t ) − k1 y

(1.1.7)

After substituting (1.1.7) into (1.1.4)-(5), the system becomes:

dx = k1 y dt

(1.1.8)

dy = − k2 x(t ) + k2 y − k1 y dt

(1.1.9)

We consider the last system is approximately equivalent to (1.1.4)-(5) when τ is sufficiently small. In a form of linear oscillator with attenuation this system looks like:

d2x dx + (k1 − k2 ) + k1k2 x = 0 2 dt dt

(1.1.10)

It is seen that the time delay τ in this case “creates” a negative friction in the oscillator. The corresponding phase plot of (1.1.10) could become of type focus if it was a knot before. That means the

29

Mathematical Description of Time Delays in Pathways Cross Talk

attenuation decreases and oscillator behavior approaches to harmonic one. When τ = k1/k2 the resultant friction disappears and the oscillator is harmonic. For τ > k1/k2 the amplitude of the oscillations amplifies with the time. If there are appropriate nonlinear terms in (1.1.1)-(2), (respectively (1.1.10)), the amplitude amplification could be restricted and stable self-oscillations would be observed.

Mathematical Modelling and C oncept “D ynamical D iseases” It is generally accepted that signalling and cell function are both dynamic processes. Analysis of such systems is primarily a matter of finding the number of steady states, their nature (stable/unstable) and of characterising the transitions between them (structural stability analysis). Pathways, understood as biochemical reaction networks, are complex systems. The complexity arises from both the presence of feedback loops in the cell (Wolkenhauer, Streenath, Wellstead, Ullah, & Cho, 2005), a relatively large number of molecules involved, and the nonlinear nature of interactions between molecules (Swameye, Mueller, Timmer, Sandra, & Klingmueller, 2003). The concept “dynamical diseases” is introduced by (Glass & Mackey, 1988) and it is used to characterize an anomalous temporal organization. The indication of a dynamical disease is the change in the dynamics of a given variable. Three types of qualitative changes in the dynamics are possible: 1) variables (which in norm don’t change) under the impact of weak random fluctuations (disturbances) lead to periodical oscillations with a big amplitude. Thus, in the regulation of a given physiological system (which in norm doesn’t possess rhythmical processes) regular oscillations may appear; 2) new periodicities may appear (occur) in a periodical process; 3) rhythmical processes may disappear and be replaced with a constant or aperiodical (chaotic) dynamics. The construction of theoretical (mathematical) models of physiological systems is a powerful tool of understanding the physiological dynamics. Certainly, the modelling should have a concrete application in the experimental and the clinical systems. The basic advantage of the theoretical models of the dynamical diseases is that they allow for the execution of systematic manipulations that are impossible to be carried out in practice. The shortcoming of these models is the existence of a dynamics (behaviour) similar to that of the clinically observed disease, but due to other factors. The cause is hidden in the limited possible number of the types of bifurcations of the stable equilibrium or the oscillating states, whereupon it is possible to achieve a qualitatively similar dynamics in various ways. Nevertheless, the investigations of the dynamical diseases with the help of theoretical models play a significant role. It consists in the development of practical methods in the diagnostics of pathological diseases and a choice of rational therapeutic strategies for their treatment. With the advance in the technologies and the design of the experiments that generate quantitative data sets, there is an increasing demand for mathematical tools to elucidate the dynamic behavior of cells. For example, (i) the influence of time delays, that are a consequence of transport, in particular – processes between the nucleus and the cytoplasm in a cell are particularly relevant to the cyclic changes observed in experiments (Wang, Zhou, Jing, & Chen, 2004; Chen, Wang, Kobayashi, & Aihara, 2004); (ii) the use of S-systems, that are a wider framework to model complex biochemical interactions with significant computational and analytical advantages (Voit, 2000). Oscillations have long been known in metabolic pathways (Heinrich & Schuster, 1996; Heinrich, Neel, & Rapoport, 2002) and are now also considered an important aspect of cell signalling (Nikolov, Yankulova, Nikolova, & Petrov, 2006; Nikolov, Yankulova, Wolkenhauer, & Petrov, 2007). In further detail, dynamical processes in the cell may play determining role in distinguishing norm and pathology of cell functions. This is due to the fact that the corresponding physiological rhythms of

30

Mathematical Description of Time Delays in Pathways Cross Talk

the cell present a set of various dynamical processes depending on multiple parameters. The normal cell is characterised by complex ensemble of rhythms in the different sub-systems, some time distinguishing by more or less expressed aperiodicity. Against this “pseudo-chaotic” back-ground, some abnormal periodicity could appear, what would be an indication of pathology (in our case – carcinoma). A sign of dynamical carcinoma would appear in the form of an unregulated cell division cycle. If we have a theory for controlling cell cycle dynamics, with this expanding knowledge, it would become increasingly apparent how the carcinoma can be medically treated. In recent years, studies of the Cell Division Cycle (CDC) have uncovered many of the genes and proteins that drive and regulate cell division (Elledge, 1996; King., Deshaies, Peters, & Kirschner, 1996; Murray & Kirschner, 1989; Sherr, 1996; Stillman, 1996). Typically, such manipulations could be achieved by introducing mutations into the genes that regulate the cycle. However, these mutations usually result in uncontrolled cell division or complete suppression of cell division, or cause the cell commit fatal errors during the cell cycle. That is why it is necessary to develop methods for gaining more precise control of the CDC by using our understanding of the dynamics of the CDC oscillator. Specifically, we need to model a mechanism that can stop and restart cell division, modulate the frequency of cell division and control the size of dividing cells (possibly breast ones). This control scheme would require only the expression of a protein that binds to and inhibits any one of the CDC proteins. Because similar control scheme would be general and requiring only the expression of a single protein, it would provide a practical means for tuning the characteristics of the cell cycle in vivo.

Physiological and B iochemical A spects of T ime D elay and F eedback Loops: T ime D elay In the analysis of gene regulatory networks one major difficulty can be often encountered (Bratsun, Volfson, Tsimring, & Hasty, 2005 ). It is the vast separation of time scales between what are typically the fast reactions (dimerisation, protein-DNA binding/unbinding) and the slow reactions (transcription, translation, degradation). In this regards, it is important to note that transcriptional and translational processes are not just slow but also are compound multistage reactions involving the sequential assembly of long molecules. Thus, these processes should be connected with a certain characteristic mean delay time. When delays in biochemical reactions are small compared with other significant time scales characterizing the genetic system, one can safely ignore them in simulations. Furthermore, time delays usually do not affect the quasiequilibrium behavior of gene regulatory networks or the mean values of corresponding observables. However, if indeed the time delays are of the order of other processes or longer, and the feedback loops associated with these delays are strong. Taking the delays into account can be crucial for description of transient processes. The fact that delayed-induced stochastic oscillations can occur during transcriptional regulation is supported by recent studies of circadian oscillations in Neurospora, Drosophila, and others. It is widely accepted now that these oscillations are caused by delays in certain elements of gene regulation networks (Schepper, Klinkenberg, Pennartz, & Van Pelt, 1999; Lema, Golombek, & Echave, 2000; Smolen, Baxter, & Byrne, 2001). It is plausible that the role of time delays in circadian rhythms has come to light because the delays in the corresponding reactions are particularly long (several hours) in comparison with other characteristic times of the system. Hence, the shorter delays present in other systems also can have a significant impact on dynamics but they may be more difficult to detect with currently available experimental methods.

31

Mathematical Description of Time Delays in Pathways Cross Talk

The Influence of Feedbacks The feedback can be defined as a capability of the system to adapt its exit in response to its control. Feedbacks are used in biology at the regulation of cell growth by inhibitor factors, produced by the cell itself, and the representation of theoretical models of the pattern structure (Glass & Mackey, 1988; Turing, 1952; Gierer & Meinhardt, 1972; Meinhardt, 1994; Murray, 2002; Miguez, Izus, & Minuzuri, 2006). They can be of two types: positive and negative. Negative feedback (NFB) occursr when a signal is caused by the expression of its inhibitor, serving for the decay or the limitation of the signal (see Figure 1). Positive feedback (PFB) (or autocatalysis) occurs when more inhibitors, or other molecules, which amplify the initial signal and lead to the stabilization of the amplitude, or the increase in the signal’s duration, cause a signal. The wide use of feedbacks and the change in their succession makes them an important factor in cell signals regulation. The time to complete transcription and translation introduces time delay in the following differential equations: .

x1 = k1 f (x2 )− 1 x1 , .

x 2 = k2 x1 −

x

2 2



(1.3.1)

where k1,k 2 are the production rate constants, γ1,γ2 are the degradation rate constants and x1 (t ) = x1 (t − 1 ), 1 > 0; x2 (t ) = x2 (t − 2 ), 2 > 0 are time delays. It is well known that time delay feedback system (1.3.1) may exhibit oscillatory behaviour and negative feedback is important for homeostasis, maintenance of system near a desired state (Thomas & d’Ari, 1990; de Jong, 2002). Usually, NFB is used for limiting the signal’s time length. The simplest kind is, when the signal excites its regulator, which, in its turn, at the reaching of a definite threshold, interrupts the signal, which, from a dynamical point of view, can be related with the appearance of a bifurcation, or stability of the equilibrium state. An example can be given with the control of the cytokine signalisation in the JAK-STAT signal pathway (Starr & Tracy, 1997; Swameye, Mueller, Timmer, Sandra, & Klingmueller, 2003; Timmer,

Figure 1. Negative feedback system. In this case the gene encodes a protein inhibiting its own expression

1

mRNA 2

protein

32

Mathematical Description of Time Delays in Pathways Cross Talk

Mueller, Swameye, Sandra & Klingmueller, 2004), where the regulator is the erythropoietin (EpoR A). JAK are soluble tyrosine kinases, which bind themselves with the cytokine receptors, transducing the signal to the STAT proteins (Sasaki et al., 2001). Beyond a definite EpoR A concentration (threshold), this pathway becomes unstable (which could be explained with the formation of new structures). After a reverse decrease in its concentration, the pathway becomes stable – related with homeostasis. After 1997, the family of discovered cytokine-inducible proteins (such as SOCS, SSI, JAB and CIS) (Freeman, 2000), which impede the determining of the cytokine signalisation, increases. These proteins take part in NFB. The physiological importance of the negative feedback can be revealed through SOCS1, which causes and inhibits an interferon γ signal. When the gene for SOCS1 is exhausted, a lethal outcome is reached. Other transgenetic experiments related with the exhaustion of a given gene show that SOCS is necessary for the control of erythropoiesis. The control of the erythropoietin reply is accomplished by means of NFB. SOCS3 takes part also in the NFB control of metabolic factors, such as: leptin and the hormone growth. Compared to NFB, PFB is less used in the signal kinetics control. It has to do with the lengthening of the signal time duration. Besides for the signal time length control, feedbacks are also applied for spatial regulation control (Hoffman, Levchenko, Scott, & Baltimore, 2002). An example can be given with the expression of the homeotic genes, controlling the development in live organisms. Their specific expression has to be determined within the organism’s development process. This occurs long after the signal is localized, and is expressed as late as in the death. NFB contributes to it’s determining in many cases. This “antiregulation” of the homeotic genes appears, as they activate their own transcription, causing stability of their initially expressed structure. The including of feedbacks in the cellular molecular structure is related with: 1. 2. 3. 4. 5.

PFB and NFB create a left-right symmetry in the vertebrate embryos. PFB can coordinate separate signals. NFB can limit the arrangement of the connections. NFB generates stability. This homeostatic function of NFB has an important role in the cells’ defence from uncontrolled growth and development, leading to cancer formations. PFB can generate instability, very often expressed in tumours. For instance, the RAS-MAP pathway is activated by an EGF receptor (hyperactive in cancer formations), which is induced in it.

In Figure 2, a more complex feedback system is shown. In this case the genes encodes a protein activating synthesis of another protein inhibiting expression of gene: positive and negative feedback.

A ndronov-H opf B ifurcation C alculations in D elayed S ystems: G eneral T heory Time Delayed Systems Delay differential equations (DDEs) are infinite-dimensional systems which find application in many phenomena of physical and biological interest. It is well known that dynamical systems with distributed delay are more general than those with discrete delay. This is because the distributed delay becomes discrete when the delay kernel is a delta function at a certain time. Dynamical systems with distributed time delay have been found in population dynamics and neural networks (Belair & Dufour, 1996; Go-

33

Mathematical Description of Time Delays in Pathways Cross Talk

Figure 2. More complex feedback system. Now, genes encodes a protein activating synthesis of another protein inhibiting expression of gene, i.e. it is an example for positive and negative feedback. gene b

mRNAb

Protein B

gene a

mRNAa

Protein A

palsamy & Leung, 1997). In both biological and artificial neural networks, time delays arise as a result of the finite processing time of information. Usually, fixed time delays in models of delayed feedback systems can sufficiently approximate simple circuits having only a small number of cells. However, due to the spatial nature of the dynamical system resulting from the parallel pathways of a variety of system states, it is desirable to model them using distributed delays. In dynamical systems with delay the rate of change of the present state depends on the past state of the system (Orosz, 2004). Time development of these systems can be described by the following DDE: .

x (t ) = H (xt ,

)

(1.4.1)

where the overdot denotes the differentiation with respect to time t, the state variable is x : R → R n , while the function xt : R → X R n is defined by the shift xt ( ) = x (t + ), ∈ [− , 0]. Here we note that + the length of the delay ∈ R is assumed to be finite. The nonlinear functional H : X R n × R → R n acts on the function space X R n of R → R n functions. For the sake of simplicity, we consider a scalar bifurcation parameter, that is, ∈ R, and assume that H is a near-zero functional in xt for any λ: H (0,

34

) = 0

(1.4.2)

Mathematical Description of Time Delays in Pathways Cross Talk

Hence, DDE (1.4.1) has the trivial solution: x(t) = 0

(1.4.3)

which exists for all the values of the bifurcation parameter λ. Since the function space X R n is infinitedimensional and the dimension of the DDE (1.4.1) phase space also becomes infinite. Using a particular form for the functional H, we obtain the equation: . 0 x (t ) = h  ∫ d −

( ) (x (t + ));

  

(1.4.4)

n× n n n where h, : R × R → R , h (0, ) = 0, and the n × n matrix : [− , 0] → R is a function of the variation θ. The measure γ can be concentrated on some particular values:



m

( ) =  ( )+ ∑ ( 

+

i =1



i

) I



(1.4.5)

where i ∈ (0, ], i = 1, ..., m, m ∈ N , the non-delayed term is formally separated from the delayed terms, and the n × n identity matrix is indicated by I. Substituting measure (1.4.5) into (1.4.4) results in: .  x (t ) = h  

  

(1.4.6)

), ..., x (t − m ); )

(1.4.7)

m

0

(x (t )), ∑ (x (t − )); i

i =1

i

that is: .

x (t ) = f (x (t ), x (t −

1

where f : R n ×... × R n × R → R n and f (0, 0, ..., 0, m delays. If m = 1, then we have the form: .

x (t ) = f (x (t ), x (t −

) = 0. Thus, (1.4.7) is the general form of DDE with

); )

(1.4.8)

Stability and Bifurcations According to the Riesz Representation Theorem, the linearization of functional H with respect to xt is defined by a Stieltjes integral, that is the variational system of (1.4.1) is given as: .

x (t ) =

0

∫d (

−

;

) x (t + )

Note that (1.4.9) can also be obtained from (1.4.4) by considering part of the function h.

(1.4.9)

(x ) = x and taking the linear

35

Mathematical Description of Time Delays in Pathways Cross Talk

Similarly to the case of linear ODEs, one may substitute the trial solution x(t ) = k c t into Eq. (1.4.9) with a constant vector k ∈ C n characteristic exponent ∈ C. It results in the characteristic equation: L( ,



0

) = det 

I−



∫

d

(

,

−



) = 0 



(1.4.10)

which has infinitely many solutions for the characteristic exponent χ. The trivial solution (1.4.3) of the nonlinear DDE (1.4.1) is asymptotically stable (which in Lyapunov sense is stable, too) for the bifurcation parameter λ if all the infinitely many characteristic exponents are situated on the left hand side of the imaginary axis. Andronov-Hopf bifurcation takes place at the critical parameter value λb if there exists a complex conjugate pair of pure imaginary characteristic exponents: 1,2

( b ) = ±i



(1.4.11)

In the parameter space of the DDE, the corresponding stability boundaries are described by the so-called L-curves: R(

) = Re L (i ),

S(

) = Im L (i )

(1.4.12)

that are parameterised by the frequency ∈ R + referring to the imaginary part of the critical characteristic exponents (1.4.11). Since Eq. (1.4.10) has infinitely many solutions for χ, an infinite-dimensional version of the Routh-Hurwitz criterion is needed to decide on which side of the L-curves the steady state is stable or unstable. According to (Kolnanovskii & Nosov, 1986; Stepan, 1989) these kind of criteria can be determined by calculating complex integrals around the characteristic exponents. Thus, in case when not only one but two pairs of pure imaginary characteristic exponents (with two different frequencies) coexist at λb then a co-dimension two double Andronov-Hopf bifurcation occurs. If, a zero exponent and a pair of pure imaginary exponent coexist at λb then a fold bifurcation occurs together with an Andronov-Hopf bifurcation (Sieber & Krauskopf, 2004). These is another condition for the existence of an Andronov-Hopf bifurcation: the critical characteristic exponents χ 1,2 (1.4.11) have to cross the imaginary axis with a non-zero speed due to the variation of the bifurcation parameter λ:

d ( Re  1,2 d 

b

)

 ∂L ( ;  = Re  − ∂  

b

) /  ∂L (  

∂

;

b

)  ≠ 0   



(1.4.13)

where the first equality can be verified by implicit differentiation of the characteristic function (1.4.10). The above conditions (1.4.11) and (1.4.13) can be checked using the variational system (1.4.9). Contrarily, the super- or subcritical nature of the Andronov-Hopf bifurcation , i.e., the stability and estimated amplitudes of the periodic solutions arising about the stable or unstable trivial solution (1.4.3) can be determined only by the investigation of the third degree power series of the original nonlinear DDE (1.4.1).

36

Mathematical Description of Time Delays in Pathways Cross Talk

TIME DE LAY DYNAMICA L MODE LLING OF PHYSI OLOGICA L SYSTEMS N ORM AND PATH OLOGY

IN

D elayed Protein C ross T alk Model Time delay emerges in some cases as a constitutive property of pathways (Timmer, Mueller, Swameye, Sandra, & Klingmueller, 2004). The nature of time delay in biochemical system models is twofold. In some cases the time delay is related to processes that take an intrinsic discrete time to be accomplished (for instance, the synthesis of mRNA), while in other cases it is a consequence of the modelling approach used, in which complex sequences of events, which are not represented in detail, provoke the emergence of an apparent time delay. The processes related to gene expression induce very often time delays in the biochemical systems. Smolen et al. (2001) describes a time delay associated to the translocation of proteins and mRNAs between 50 and 100 minutes. Rateitschak et al. (2007) describes a time delay for gene transcription between 10 and 40 minutes. Finally, in Swameye et al. (2003) a time delay around seven minutes is defined and estimated for nucleocytoplasmic shuttling, which describes the delay associated with a pool of processes not described in detail in the model. Various authors have previously considered biochemical oscillators with time delay (Fall, Marland, Wagner, & Tyson, 2002; Nikolov, Kotev, Georgiev, & Petrov, 2006; Pircher, Petersen, Gustafsson, & Haldosen, 1999; Rateitschak & Wolkenhauer, 2007). Their analyses show that the introduction of a large enough time delay can sometimes change the unique equilibrium of the system and induce periodic solutions (self-oscillation), which arise from the equilibrium through an Andronov-Hopf bifurcation. The aim of this section is to elucidate how the dynamics of the interaction between pathways via cross talk is affected by the time delay associated with gene expression. The role that cooperativity of the end product repression could play in the stability of the system is also analysed.

Case Study In order to study the role of time delay in the cross talk between enzymes and repressors in protein synthesis, we use the model proposed by Jacob and Monod (Jacob & Monod, 1961) for the activation of the operon lactose in E. coli, which is considered a classical case study of gene regulatory networks. Figure 3 shows the structure of the operon and how the presence or absence of lactose induces different responses of the system. In essence, the system acts as a feedback loop where the lac repressor protein, y3, controls the synthesis of the enzyme b-galactosidase, y2, through the repression of the mRNA, y1, production. At the same time y3 is regulated by the effect of b-galactosidase, y2, in the reduction of lactose concentration. In a simple form, the system can be represented by the following mathematical model in time delayed differential equations (Nikolov, Kotev, Georgiev, & Petrov, 2006; Nikolov, Vera, Kotev, Wolkenhauer, & Petrov, 2008): dy1 k1 = − k4 y1 , dt k2 + k3 y3p1 dy dt dy3 = k7 y2 − k8 y3 . dt

2 = k5 y1 (t − ) − k6 y2 ,

(2.1.1)

37

Mathematical Description of Time Delays in Pathways Cross Talk

Figure 3. Scheme of the lactose operon in E. coli proposed by Jacob and Monod (Jacob & Monod, 1961). The system contains three structural genes (Lac Z, Lac Y and Lac A) and a regulatory gene (Lac I). In absence of lactose (a) the regulatory gene induce the production of a repressor, y3, which blocks the activation of the structural genes, and therefore the synthesis of b-galactosidase, y2. However, in presence of lactose (b), the repressor associates to lactose and changes its configuration; afterwards, the repressor is not able to block the activation of the structural genes, which allows the synthesis of mRNA, y1. After a series of structural processes including translocation to the cytosol and conformational changes, y1 induces the synthesis of b-galactosidase and lactose permease. Finally, these translocation and conformational changes provoke a time delay in the transmission of the signal between the nucleus and cytosol (τ).

(a)

(b)

where ki (i = 1,2,..,8) are the kinetic rate constants and p1 measures the cooperativity of the end product repression. There are several mathematical models available in the literature describing the lac operon (Chen, Wang, Kobayashi, & Aihara, 2004; Thomas, 1998; Yildirim & Mackey, 2003; Yildirim, Santillan, Horike, & Mackey, 2004. We have chosen this particular model because of its structural simplicity and reduced number of equations, which allow the use of analytical tools for our study. In the present work,

38

Mathematical Description of Time Delays in Pathways Cross Talk

we consider two representative values for p1 : a) p1 = 1.0 , which means non-cooperative repression (Nikolov, Kotev, Georgiev, & Petrov, 2006) and b) p1 = 2.0 , which represents cooperative repression. The delayed function k5 y1 (t − ) encodes the assumption that the rate of enzyme synthesis is proportional to the mRNA concentration in the nucleus, y1, in the moment (t – τ). Tau, τ, represents the time that takes the translocation of the mRNA to the cytosol and their configurational changes required to start the synthesis of b-galactosidase, y2. Figure 4 contains a scheme of the model discussed with the feedback loop and mechanism clearly indicated. The fixed points of the system represented by Equation 2.1.1 are defined by the following set of algebraic equations, including the rate constants of the model: _ p1 +1

y3

+

kk k k2 _ y3 − 1 5 7 = 0, k3 k3 k4 k6 k8

_

y1 =

k6 k8 _ y3 , k5 k 7

_

y2 =

k8 _ y3 k7

(2.1.2)

The first equation in (2.1.2) has always only one real positive root, which ensures that the system has only one physiologically feasible fixed point. In case of non-cooperativity, the equation describing the stationary values of y3 is simpler:

Figure 4. Simplified scheme of the lactose operon in E. coli. Legend: y1: mRNA; y2: b-galactosidase; y3: lac repressor protein. Dashed arrows represent activation, while dashed lines with a bar represent inhibition. Solid lines represent synthesis (when starting with a circle and curved line, Ө) or degradation (ø). The “clock” symbol represents a time-delay in the process. In absence of lactose, y3 is accumulated repressing the production of mRNA, y1, and ultimately the synthesis of b-galactosidase, y2. When there is a significant concentration of lactose, the formation of the complex lactose-lac repressor reduces the available free y3. In contrast, an increase in the concentration of b-galactosidase reduces the intracellular concentration of lactose, which provokes an increase in the effective amount of y3.

39

Mathematical Description of Time Delays in Pathways Cross Talk

2  _ k  4k k k 1 k y3 =  − 2 +  2  + 1 5 7 2  k3 k k 3 k 4 k6 k8  3 

   

(2.1.3)

Andronov-Hopf Bifurcation of the Time Delay Model In this section, we consider the system when the cooperativity in the end-product repression, p1 , is

  equal to one and all constants of the model are real positive numbers. Let E =  y1 , y2 , y3  denote the _

_

_



_



equilibrium point of the system. We use Andronov-Hopf bifurcation analysis and consider the time delay τ as a bifurcation parameter. The first step is to obtain the characteristic equation for the linearisation of the system near the equilibrium E. Let us consider a small perturbation about the equilibrium level defined as: _

y1 = y1 + x

_

y2 = y2 + y

_

y3 = y3 + z

In the general case, the function

k1 = k2 + k3 y3p1

(2.1.4)

k1 can be written as a MacLaurin series: k 2 + k 3 y3p1

k1 k1 k  k = = 1 1 − 3  + k3  k3   + 1   

k  + 3   

2 2

k  − 3   

3 3

 + ...   

(2.1.5)

_ p1

where = k2 + k3 y 3 and η is a polynomial of z. If we take only linear, square and cubic terms from (2.1.5) and after substitution of (2.1.4) into differential equations (2.1.1) we have:

kk k k2 k k3 dx = − k4 x − 1 23 z + 1 33 z 2 − 1 43 z 3 , dt dy = k5  − x − k 6 y , dt dz = k7 y − k8 z dt

(2.1.6)

_

where = k2 + k3 y3 when p1=1. If we neglect terms of second and third order, the stability matrix leads to the following characteristic equation: 3

+p

2

+ q + r1 = − A −

(2.1.7)

where p = k4 + k6 + k8 , q = k4 k6 + k4 k8 + k6 k8 , r1 = k4 k6 k8 , A =

40

k1k3 k5 k7 2



(2.1.8)

Mathematical Description of Time Delays in Pathways Cross Talk

This characteristic equation (2.1.7), which is a transcendental equation, cannot be solved analytically and has an indefinite number of roots (Elsgolz & Norkin, 1974; Khan & Greenhagh, 1999). In essence, we have two main tools besides a direct numerical investigation: linear stability analysis, which is valid in case of small time delays, and the Hopf bifurcation theorem (Cai, 2005). In the following section we analyse both cases.

Effects of Small Time Delays Using Linear Stability Analysis For a small time delay (i.e., τ ≈ 1 min) the method of linear stability analysis is a very convenient approach to find the bifurcation point of the system. In this case let  − ≈ 1 − ; then the characteristic equation (2.1.7) becomes: 3

+p

2

+ (q − A

)

+ r = 0

(2.1.9)

where r = r1 + A . By applying the Hopf bifurcation theorem and the Routh-Hurwitz criteria, an Andronov-Hopf bifurcation occurs at a value = b where the following conditions are satisfied:

p > 0, q − A R = p (q − A

b b

> 0, r > 0,

)− r = 0



(2.1.10)

Let us define the function h, which represent the characteristic function in case of small time delays: h( ,

)=

3

+p

2

+ (q − A

)

+ r

(2.1.11)

If we evaluate the roots of h at = b, we obtain the following values that represent the eigenvalues of the system in the approximation of small time delay: 1

= − p = − (k4 + k6 + k8 ) < 0,

2,3

= ±ik = ±i q − A



b

(2.1.12)

where i is the imaginary unit. In order to clarify the properties of the system in the Hopf bifurcation ( = b), we analyse the derivative of the eigenvalues around this value of time delay. If we differentiate implicitly h ( ( ), ) we obtain: ∂h ∂h d =− =− / ∂ ∂ d 3

2

−A + 2 p + q − A

(2.1.13)

Then, we evaluate the required derivatives of h at τb. The two roots χ2 and χ3 are complex complementary and therefore have identical real part. Thus, the result for χ2 is identical to the result for χ3. In the particular case of χ2, we obtain:

41

Mathematical Description of Time Delays in Pathways Cross Talk

d

2

d

( b ) = ikA (−3k 2 + q − A b − 2 pki ) L2 + I 2



(2.1.14)

where L = −3k 2 + q − A b , I = 2 pk . The real part of (2.1.14) has the form:

d ( Re  2  d

b

)  = 2 pk 2 A > 0  

L2 + I 2



(2.1.15)

The inequality stated in (2.1.15) is sufficient to ensure that the real part of the eigenvalue χ2(τ) at τ = τb has a positive slope. In this case, the use of the Hopf bifurcation theorem predicts that the system will have a limit cycle for a time delay with the critic value τ = τb when the approximation for small time delays is used.

Effects of Large Time Delays Using Hopf Bifurcation Analysis For larger time delays τ, the linear stability analysis of the previous section is no longer valid and we need to use an alternative approach. If we define = m + in and rewrite (2.1.7) in terms of its real and imaginary parts we obtain:

m3 − 3mn 2 + pm 2 − pn 2 + qm + r1 + A − m cos n = 0, 3m 2 n − n3 + 2 pmn + qn + A − m sin n = 0



(2.1.16)

In order to find the first bifurcation point, we set m = 0 in the equations. Then, the above two equations reduce to the following:

− pn 2 + r1 + A cos n = 0, − n3 + qn + A sin n = 0

(2.1.17)

These two equations in (2.1.17) can be solved numerically, leading to (nb0 , b0 ), the first bifurcation point. The subsequent bifurcation points (nb, τb ) satisfy the following relation: nb

b

= nb0

0 b

+ 2l , l =1,2,...

(2.1.18)

We can guarantee that (2.1.17) has at least one positive root, that is, there is at least one bifurcation point of the system. By squaring the two equations in (2.1.17), adding them, and using properties of trigonometric functions, it follows that:

n 6 + (p 2 − 2q )n 4 + (q 2 − 2 pr1 )n 2 + r12 − A2 = 0

(2.1.19)

Here we note that this is a cubic equation in n 2 that describes the stability of the system. If the condition r12 < A 2 is satisfied, the left-hand side of the equation is positive for large values of n 2 and negative for n = 0 . This means that (2.1.19) has at least one positive real root. Moreover, when we introduce the

42

Mathematical Description of Time Delays in Pathways Cross Talk

variable z = nb2 (2.1.19) reduces to:

g (z ) = z 3 + (p 2 − 2q )z 2 + (q 2 − 2 pr1 )z + r12 − A2 = 0 The derivative of this equation in z has the following value:

g ' (z ) = 3z 2 + 2 (p 2 − 2q )z + q 2 − 2 pr1 ' The interesting point is that g (z ) = b > 0 if nb is the least positive simple root of the equation (2.1.19). This property will be used in the following demonstration. Let us denote the characteristic equation without linear approximation:

H( ,

)=

3

+p

2

+ q + r1 + A −

Again, in order to clarify the properties of the system in the studied fixed point (τ = τb), we analyse the derivative of the eigenvalues around this value of time delay: A − 2 + 2 p + q − A  −

∂H ∂H d =− = / ∂ ∂ d 3

If we evaluate the real part of this equation at the fixed point τ = τb and set dm d

=

b

d  = Re   d 

=

b

=

(2.1.20)

= inb, we obtain:

nb2 3nb4 + 2 (p 2 − 2q )nb2 − 2 pr1 + q 2  L12 + I12

where L1 = −3nb2 + q − A b cos nb b and I1 = 2 pnb + A b sin nb b. The expression between brackets in the previous equation coincides with g ' (z ) = 3z 2 + 2 (p 2 − 2q )z + q 2 − 2 pr1, and then we can guarantee that g ' (z ) = b > 0. This means that this derivative is positive:

dm d

=

b

d  = Re   d 

=

b

=

nb2 g ' (nb2 ) L12 + I12

>0

(2.1.21)

Under these assumptions and according to the Hopf bifurcation theorem (Marsden & McCracken, 1976), we can guarantee that an Andronov-Hopf bifurcation occurs as τ passes through τb (Cai, 2005). The system presents an Andronov-Hopf bifurcation in the case of long time delay. Under reasonably generic assumptions, we can expect to see a small amplitude limit cycle emerging from the fixed point when the value of the time delay changes, which will provoke oscillations of the concentration of proteins and mRNA of the operon with reduced amplitude around a steady-state solution. Only with the information generated until now, it is not possible to decide whether these oscillations will be a sustained or a transient response of the system in a small area near the boundary of stability. Hence, it is necessary to calculate the so-called first Lyapunov value at the boundary of stability region R=0 of the system (2.1.1) to determine: i) the character (stable or unstable) of equilibrium state at R=0; ii) the stability (or instability) of this limit cycle at transition from R0.

43

Mathematical Description of Time Delays in Pathways Cross Talk

Bifurcation Analysis Using First Lyapunov Value Here, we study the advantages of the use of the first Lyapunov value (Andronov, Witt, & Chaikin, 1966; Bautin, 1984, Nikolov, 2004, Nikolov & Petrov, 2004; Shilnikov, Shilnikov, Turaev, & Chua, 2001) for investigating in detail the qualitative properties of the bifurcation behaviour for the system with respect to a time delay. For the purposes of our analysis, we derive an approximation of the model (2.1.1) (for p1 = 1; 2 ) in which y1(t – τ) is expanded as a Taylor’s series of the time delay:

dy1 k1 = − k4 y1 , dt k2 + k3 y3p1 dy2 = k5 y1 (t − dt



) − k6 y2 ≈ k5  y1 −

dy3 = k7 y2 − k8 y3 dt



⋅

y1 +

 y1  − k6 y2 , 2  2 ..



(2.1.22)

where we have retained only the first, second and third terms (i.e. up to quadratic one with respect to τ). Hence, the role of time delay in the qualitative behaviour of system (2.1.1) can be analysed. It is well known that replacing y1(t – τ) with higher order approximations of a Taylor series is not better than applying lower order approximation (Elsgoltz, 1957; Driver, 1977). The reason for this paradoxical phenomenon consists in the circumstance that the higher order terms in the second equation of (2.1.22) are, in principle, not small. For example, by applying a ‘step by step’ method (Elsgoltz, 1957; Driver, 1977) to solve a time delay system in Taylor’s presentation with higher order terms, a small parameter at the higher derivatives appears. On the contrary, in lower order terms approximation a similar parameter does not appear. The detailed statement of this circumstance depends on the order of system. In the present case, Taylor’s series can be applied only up to quadratic approximation. Certainly, linear approximation is also admissible. Following (Bautin, 1984; Nikolov, 2004; Nikolov, 2005), we calculate the so-called first Lyapunov value L1 (see the appendix in (Nikolov & Petrov, 2004) or for a detailed discussion (Andronov, Witt, & Chaikin, 1966; Shilnikov, Shilnikov, Turaev, & Chua, 2001)) at the boundary of the stability region R=0 of the system (2.1.22). In accordance with the Lyapunov-Andronov theory we have: i) the sign of the Lyapunov’s value determines the character (stable or unstable) of the equilibrium state at R = 0; ii) the character of the equilibrium state, at R = 0, qualitatively determines the reconstruction of the phase portrait (including the stability or instability of the limit cycle) at the transition from R < 0 to R > 0 (Andronov, Witt, & Chaikin, 1966; Bautin, 1984). When the system without cooperativity is considered, it is not difficult to obtain that the approximate canonical form of (2.1.22):

dx = −k4 x − c1 z + c2 z 2 − c3 z 3 , dt dy = c4 x − k6 y + c5 z − c6 z 2 + c7 z 3 , dt dz1 = k7 y − k8 z dt

44

(2.1.23)

Mathematical Description of Time Delays in Pathways Cross Talk

where:

c1 = c5 =

k1k3

, c2 =

2

k1k3 k5

k1k32 3

, c6 =

2

, c3 =

k1k32 k5 3

k1k33 4

, c4 = k5 (1 + k4 ),

, c7 =

k1k33 k5 4



(2.1.24)

Hence, the Routh-Hurwitz conditions for stability of the steady state, defined by (2.1.2), are:

p = k4 + k6 + k8 > 0

(2.1.25)

q = k4 k6 + k4 k8 + k6 k8 − c5 k7 > 0

(2.1.26)

r = k4 k6 k8 + c1c4 k7 − c5 k4 k7 > 0

(2.1.27)

R = pq − r = (k6 + k8 )(k42 + k6 k8 + k4 (k6 + k8 ) − c5 k7 )− c1c4 k7 > 0

(2.1.28)

When conditions (2.1.27) or (2.1.28) are not valid, the steady state (2.1.3) becomes unstable. This means that there are several different values for some of the rate constants, k i (i = 1, 2, 3, ..., 8), and time delay, τ, that make the coefficients R and r pass through bifurcation boundaries in the parametric space (p > 0, q > 0, r ), (p > 0, q > 0, R ) or (k1 , k 2 , ..., k8 ) where the steady state (2.1.3) could change its character (stable or unstable): R = pq – r = 0

(2.1.29)

r = 0

(2.1.30)

Following (Bautin, 1984), we call L1 the first Lyapunov value at boundary R = 0 and l1 at the boundary r = 0 . After accomplishing some algebraic operations we calculate the first Lyapunov value at the boundary R = 0 . Thus, we obtain:

L1 (

0 )=

31

4q∆

4 32 2 0

 ∆0   q ( pB1 + B3 ) + (3 p 2 + 8q )B2  − B1 B2      32 

(2.1.31)

where:

B1 = 2 ( ∆ 0 = det

' 31 2

c ), B2 =

c −

' 32 6

11

12

21

22

23

31

32

33

c −

31 6

c , B3 = 3 (

23 2

c −

23 3

c

13 7

)

13



(2.1.32)

45

Mathematical Description of Time Delays in Pathways Cross Talk

Here we note that: 11

= c1 (k4 + k8 ),

31

= (k6 + k8 )(k4 + k8 ),

12

22

= c4 k8 ,

= − (k6 + k8 ) q ,

23

= −c4 q ,

32

21

= − c1c4 + c5 (k6 + k8 ) ,

= c4 k7 , 33

13

= − k4 (k6 + k8 ),

=0



(2.1.33)



(2.1.34)

Consequently, (2.1.32) follows from: ' 31

=

11

22

−

12

21

,

' 32

=

11

32

−

12

31

From (2.1.31) it is easy to see that in this case the first Lyapunov value can be positive or negative, i.e. hard and soft loss stability can take place. Therefore, time delay is a key factor in the bifurcation behaviour of the model (2.1.22). In other words, in the case of safe boundaries, L1 < 0 , a slow drift of the parameters back into the stability region brings a system back into the original response, whereas in the dangerous case, L1 > 0 , this is generally impossible. Obviously, safe and dangerous boundaries are distinguished mainly by the stability or instability of the corresponding equilibrium state, or periodic trajectory, on the boundary (Shilnikov, Shilnikov, Turaev, & Chua, 2001). Here we could note that at the boundary of stability r = 0 (positive feedback loop), two cases occur (Bautin, 1984; Shilnikov, Shilnikov, Turaev, & Chua, 2001): If l1 is different to zero, then in case of a transition from negative values to positive ones the equilibrium state becomes unstable double point, the system has irreversible behaviour and the boundary r = 0 is dangerous. Also, from the sign of the added condition:

∆* = − p 2 q 2 + 4q 3

(2.1.35)

We can have two cases: (i.1) if ∆* < 0 , then the equilibrium state becomes saddle-knot; (i.2) if ∆* > 0 , then the equilibrium state becomes saddle-focus. If the first Lyapunov’s value l1 is zero, then the equilibrium state is stable. In the terms of model (2.1.22), using (2.1.29), we obtain the bifurcation value of time delay, τb: b

=

(k4 k6 + k4 k8 + k6 k8 ) k1k3 k5 k7

2

−

 k4 k6 k8 2  1 1 +  k4 + k6 + k8  k1k3 k5 k7 

(2.1.36)

As a consequence of our analysis, we can predict that a limit cycle will emerge if the time delay is higher than τb, while the cycle limit will vanish if the time delay is smaller. In other words, as a result of the evidence obtained through (2.1.25)-(2.1.28) and (2.1.36) we may conclude that in this case the time delay has a destabilizing role because it changes drastically the properties of the system when pass through the bifurcation point provoking the emergence of a cycle limit. For time delays longer than the bifurcation value τb, the lactose operon would present sustained oscillations with coupled periodic variations on the concentration of both proteins and the mRNA. In contrast, a time delay smaller than τb will provoke only transient oscillations of the species integrating the operon around a stable steady-state.

46

Mathematical Description of Time Delays in Pathways Cross Talk

Numerical Analysis The values chosen for the parameters and used in the numerical analysis were selected according to (Jacob & Monod, 1961; Bliss, Painter, & Marr, 1982; Pircher, Petersen, Gustafsson, & Haldosen, 1999; Fall, Marland, Wagner, & Tyson, 2002; Timmer, Mueller, Swameye, Sandra, & Klingmueller U., 2004). The analytical results stated in previous sections permit us to predict how the properties of the system vary when the parameters in the model are modified. In Figure 5 we show the dependence on k3 and k5 of the critic value of time delay in which the system suffers the transition to a stable limit cycle, τb. The value of τb is quite sensitive to changes in both parameters, especially k3. For example, a change of 50% in the value of k3 multiplies by three the value of the critical time delay, and a change of 100% in k3 increases the value of the critical time delay up to 27 minutes. This means that for very high values on k3, the transition to stable limit cycles will not appear in the system because it requires too long, biologically unfeasible, time delays (much longer than half an hour). In order to compare the predictions with numerical results, the governing equations of the model, represented by (1), were solved numerically using MATLAB (Mathworks, 2007). The use of (2.1.36) permitted us to compute a predicted value for the critic time delay of τb = 4.17 minwhen we fixed the parameters k1 to k8. In Figure 6 we illustrate the dependence of the model behaviour on the value for the time delay (around this predicted critic value τb ). Figure 6a shows a simulation of the dynamics for y1, y2 and y3 when time delay is lower than the critic value τb (τ = 2.5). After several physiologically acceptable fluctuations, the variables describing mRNA, y1, enzyme, y2 and repressor, y3 approach to constant values that describe a steady-state of the system. In other words, in this case the Routh-Hurwitz condition for stability is valid and the system (2.1.1) lies in a stable zone of its parametric space. Notice that in this case R = 0.5168 > 0 . On the other hand, Figure 6b depicts the dynamics for the case of time delays higher than the critic value (τ = 6.5) where R is negative ( R = −0.2397 ). Mathematically, this

Figure 5. Prediction of values of τb (as function of k 3 and k 5 ) using analytical formula (2.1.36)

0 

Taub

0  0  0 

 .

0.

. 0. K5

. 0.



K3

47

Mathematical Description of Time Delays in Pathways Cross Talk

state corresponds to loss of stability. According to the analytical results we can conclude that a stable limit cycle (self-oscillations) occurs. Unfortunately, the information supplied by Figure 6b cannot fully illustrate the self-oscillation behaviour of the dynamical model (2.1.1). Hence, in Figures 7a and 7b we show the self-oscillation solutions for y1 and y3. Although the stable limit cycle occurs, which coincides with the predictions of our qualitative analysis, we can see that the amplitudes of the oscillations for τ = 6.5 min are very small for the different variables (approximately 1% of the total values in the analysed state). These results shown in Figure 7 need additional discussion. The existence of cooperativity in protein-gene interactions results in large changes in activation with small changes in protein concentration (Wolkenhauer, Sreenath, Wellstead, Ullah, & Cho, 2005. On the other hand, the minimum cooperativity required for oscillations becomes small when the length of the feedback loop increases. Since in the case analysed we supposed low cooperativity and a short length feedback loop, the limit cycle has small amplitude (Fall, Marland, Wagner, & Tyson, 2002; Agnati, Tarakanov, & Guidolin, 2005). On the other Figure 6. Stable (a) and unstable (b) solution of the system (1) (p1=1) at τ = 2.5 min and τ = 6.5 min y1

(a)

y1

y3

(b)

y3

Figure 7. Periodic solutions for mRNA (a) and repressor (b) at τ = 6.5. The amplitude of the oscillation is much reduced and it represents only 1% of the values of both variables in the analysed state

y1

y3

(a)

48

(b)

Mathematical Description of Time Delays in Pathways Cross Talk

hand, the case when cooperativity is considered (p1 = 2) is shown in Figure 8. For the same values of the rate constants from k1 to k8 and time delay τ (see (2.1.37)) the stable limit cycle also occurs but now the system (1) has a periodic solution with amplitude much larger than the previous case (amplitude of the oscillation around 100% of the average value in different variables). In Figures 9a and 9b L1(λ0) (calculated on the boundary of stability R = 0 in (2.1.31)) is shown for different values of the bifurcation parameters τ, k5 and k3 (which are respectively, the rate of synthesis of b-galactosidase, y2, and the rate of repression of mRNA, y1, by lac repressor protein, y3). In Figure 9a (k1 = 248, k2 = 0.05, k3 = 1.1, k4 = 0.3, k6 = k7 = 0.2 and k8 = 1.1) both τ and k5 are considered bifurcation parameters. In this case, L1(λ0) is only negative, which ensures soft stability loss. In Figure 9b (k1 = 248, k2 = 0.05, k4 = 0.3, k5 = 0.1, k6 = k7 = 0.2 and k8 = 1.1) k3 and τ are the bifurcation parameters considered. The first Lyapunov value is also negative, and soft stability loss also takes place. This

Figure 8. Periodic (self-oscillation) solutions (a), (b) (c) and phase portrait (d) of the system (2.1.1) (p1=2) at k1 = 250, k2 = 0.05; k3 = 1.1, k4 = 0.3, k5 = 0.4, k6 = 0.62, k7 = 0.2, k8 = 0.65, = 6.5

y2

y1

(a)

(b)

y3

(c)

(d)

49

Mathematical Description of Time Delays in Pathways Cross Talk

behaviour is shown in Figures 9c-g. A stable limit cycle with small amplitude occurs, which is in accordance with the assumption of no cooperativity (p1 = 1). However, the system (2.1.22) has a very long transient regime (Figures 9d-e). Figure 10 demonstrates the dependence of the oscillation magnitude on the cooperativity p1 (considering the same numerical values of rate constants and the time delay than in case represented in Figure 9). Comparing Figure 9d-g and Figures 10a-b, we conclude that for a larger value of cooperativity (p1 = 2) the oscillation magnitudes are also larger and their frequency (during 400 min the system makes 5 spikes) is smaller than the value obtained at p1 = 1.

Figure 9. Analysis of the graphs of L1 versus the bifurcation parameters k5 ∈ [0.001,15], ∈ [8.,8.4897] (a) and k3 ∈ [1,10], ∈ [8.01, 8.05] (b). Stable solutions for k5 = 0.1 and τ = 2, small time-delay (figure 9c), and a sustained oscillation with reduced amplitude at k5 = 0.1 and τ = 8.5 (Figures 9d-g)

(a)

y1 y2 y3

y1 y2 y3

(c)

50

(b)

(d)

Mathematical Description of Time Delays in Pathways Cross Talk

Figure 9. (continued)

y1 y2 y3

y1

(e)

(f)

y2

(g)

Time Delay Model of RNA Silencing Some previous results about numerical investigations of time delay model of RNA silencing were presented in Paper D5.2 of project COSBICS. Also, in the Paper D4.3 of same project a retroviral based expression system for the effective delivery of shRNAs (small hairpin RNAs) which can induce RNAi response in BaF3 cells is established. There, it is proposed design of optimal RNA hairpin construct by employing the web application E-RNAi (Alziman, Horn, & Bourtos, 2004). As a result silencing efficiencies up to 37% of CIS protein levels are achieved. Here, we give the final form of this theoretical investigation. RNA interference (RNAi) is a relatively new mechanism for selectively silencing of genes in a variety of organisms, including plants, fungi and worms (Boese, Scaringe, & Marshall, 2003; Berezhna,

51

Mathematical Description of Time Delays in Pathways Cross Talk

Figure 10. Periodic solution (a) and phase portrait (b) of the system (2.1.28) when: p1 = 2, = 8.5, k1 = 248, k2 = 0.05, k3 = 1.1, k4 = 0.3, k6 = k7 = 0.2 and k8 = 1.1

y1 y2 y3

(a)

(b)

Supekova, Supek, Schultz, & Deniz, 2006; Hannon, 2002). It is rapidly advancing as both a target tool of validation in drug discovery and as a potential therapeutic one. As systematic or therapeutic application RNAi can be triggered by the delivery of double-stranded RNA (dsRNA), small hairpin RNA (shRNA) or micro RNA (miRNA) (Storz, 2002; Hobert, 2004). The specificity of siRNA consists in the fact that together with the corresponding proteins it forms the RNA-induced silencing complex (RISC). The last is capable of recognizing the target mRNA by hibridization and induces endocleolytic cleavage (Figure 11). As it is known, genes provide cells with instructions for making specific proteins that are “encoded” by that gene. By silencing a gene we can refer to stopping or reducing significantly the production of the specified protein encoded by the target gene (Rozema & Lewis, 2003). The cell makes a copy of the gene that encodes for the particular protein in order to initiate the protein production. It is important to note that this copy is not made of DNA, but rather of ribonucleic acid, or RNA. Moreover, it is referred to as “messenger” RNA, or mRNA. It is precisely this mRNA, manufactured in the cell nucleus that travels into the cytoplasm of a cell to the organelles responsible for protein synthesis. There, it directs the production of a protein based on the DNA sequence carried by the mRNA. When this process works uninterrupted and the protein is produced, the gene is said to be expressed. The duration of gene silencing lasted for ~1 week in rapidly dividing cells but longer than 3 weeks in nondividing cells both in vitro and in vivo, supporting the hypothesis that dilution due to cell division is the major factor controlling the duration of luciferase knockdown in rapidly dividing cells. The gene silencing duration by siRNA can be longer than that achieved with other nucleic acid-based gene inhibition strategies, whose knockdown as a rule lasts only in the order of 1-2 days. Modeling in this area (gene expression and RNA silencing) is occurring at a rapid pace (Munroe & Zhu, 2006). In the last decades the different mathematical models of a RNA silencing have been proposed with the goal to understand biological processes that are regulated by the dynamical properties of mRNA (Bergstrom, McKittrick, & Antia, 2003; Bartlett & Davis, 2006; Gafney & Monk, 2006). Generally speaking, the advantages of mathematical modeling are as follows: (i) the development of

52

Mathematical Description of Time Delays in Pathways Cross Talk

Figure 11. Schematic diagram of the basic RNA interference (taken from www.calandopharma.com)

mathematical models leads to a decrease in the number of experiments using expensive biological material, and makes it possible to predict the results of many experiments with a great precision (Edissonov & Nikolov, 2001); (ii) the use of the theory of dynamical systems leads to the creation of base models of the complex biological processes, such as: gene regulation (transcription), gene expression, protein synthesis, interaction between various molecules, etc., and allows investigation of new mechanisms of the RNA interference in qualitative ways; (iii) the results of the modeling can be presented visually and used by biologists, biochemists and immunologists in clinical practice and therapy. To our knowledge, there are only a few published mathematical models of studies regarding the kinetics of the intracellular RNAi process (Bergstrom, McKittrick, & Antia, 2003; Arciero, Jackson, & Kirschner, 2004; Raab & Stephanopoulos, 2004; Groenenboom, Maree, Hogeweg, 2005; Bartlett & Davis, 2006). Of these models, none has combined the delivery process and the interaction with the RNAi machinery in mammalian cells. For example, in (Groenenboom, Maree, Hogeweg, 2005), Groenenboom and co-authors proposed a mathematical model that contained several extensions to the core RNAi pathway, providing for siRNA degradation by Dicer (RNase III family of endonucleases) as well as primed amplification.

Models A Basic Model of RNA Silencing In (Bergstrom, McKittrick, & Antia, 2003), a mathematical description of a conceptual model of RNA silencing process is presented. In Figure 12 a schematic outline of the basic elements comprising this model is provided. We can model the steps denoted in Figure 12 by using the following autonomous system of ordinary differential equations solved with respect to the derivatives:

53

Mathematical Description of Time Delays in Pathways Cross Talk

Figure 12. Schematic diagram of the basic RNA-silencing model according to (Bergstrom, McKittrick, & Antia, 2003)

Degradation

Synthesis

Complex

dsRNA Cleavage and Association

mRNA RISC

dD = − a.D + g .C , dt dR = an.D − d R .R − b.RM , dt dC = − (g + dC ).C + b.RM , dt dM = h − d M M − b.RM dt

(2.2.1)

In this dynamical system, the state variables D,R,C,M represent the concentrations of the dsRNA, RISC, RISC-mRNA complex, and mRNA at time t. Here, we present an initial analysis of the system (2.2.1), which differs from the results presented in Bergstrom, McKittrick, and Amtia (2003). The nonzero steady state values of D,R,C,M in analytical form are: D=

_ ( g + dC )d R d d g h C ,R = C ,C = − M R ,M = a dR g+dC b b

where

(2.2.2)

= [g (n − 1) − d c ]. For parameter values:

a = 10; b = 0.1; h = 2; g = 0.1; d M = 0.5; d R = 0.1; d C = 0.05; n = 5

(2.2.3)

The steady state values (2.2.3) are positive and have physical sense. Then their stability can be analysed by linearizing the system (2.2.1) around the steady state (2.2.2) and computing the corresponding Routh-Hurwitz coefficients. In this case they all are positive and have the form:

54

Mathematical Description of Time Delays in Pathways Cross Talk

p = a + d R + bM + g + d C + bR + d M

(2.2.4)

q = a (d R + bM + g + dC + d M + bR ) + (d R + bM )( g + d C ) + + (d R + bM )(d M + bR ) − b 2 MR + ( g + d C )(d M + bR )

(2.2.5)

r = a (d R + bM )( g + d C ) − abgnM + a (d R + bM )(d M + bR ) − − ab 2 MR + a (d M + bR )( g + dC ) + bRM ( g + dC ) + bRM ( g + dC )

(2.2.6)

s = a ( g + dC )  d R (d M + bR )  − abgnd M M

(2.2.7)

l = pqr − sp 2 − r 2

(2.2.8)

It can be shown that when the steady state values C , D, M , R are positive, then the Routh-Hurwitz coefficients are positive, too. Thus, all physically meaningful steady state values are stable (in accordance with the corresponding Routh-Hurwitz criterion of stability) (Bautin, 1984), and the model (2.2.1) can be considered as realistic at least in qualitative sense.

Model with Time Delay In this section, we investigate the following system:

dD = − a.D + g .C (t − ) , dt dR = an.D − d R .R − b.RM , dt dC = b.RM − (g + d C ).C (t − dt dM = h − d M M − b.RM . dt

),

(2.2.9)

where the delay function C(t – τ) expresses the assumption that the net rate of degradation of dsRNA by Dicer and background process, and the net rate of loss of dsRNA are proportional to the triggers process of binding of mRNA to form the RISC-mRNA complex in the moment (t – τ). This is in view of the consideration that the regeneration (or degradation) of the RISC-mRNA complex needs a finite time τ. Of course, the finite time τ of regeneration can be different from this of degeneration. Because, here, in order to make the analytical investigation of system (2.2.9) easier, we shall assume that_ the two _ _ _ h ) times are equal. Hence, the system (2.2.9) has also two steady states- the trivial ( D = C = R = 0, M = dM and see (2.2.2). Further, we investigate the bifurcation structure, particularly the Andronov-Hopf bifurcation for the system (2.2.9), using time delay as the bifurcation parameter. Firstly, we obtain the characteristic equa_ _ _ _ _  tion for the linearization of the system (2.2.9) near the equilibrium E  D > 0, R > 0, C > 0, M > 0  (i.e.   all are positive and the silencing reaction controls the level of mRNA below its normal level). Next, we _ _ _ _ consider a small perturbation about the equilibrium level, i.e., D = D + x, R = R + y, C = C + z , M = M + w.

55

Mathematical Description of Time Delays in Pathways Cross Talk

Substituting these into the differential equations (2.2.9) we have:

dx = − ax + g  − z , dt dy = anx − a1 y − a2 w − byw, dt dz = a3 y − a4  − z + a2 w + byw, dt dw = − a3 y − a5 w − byw dt

(2.2.10)

where _

_

_

_

a2 = b R, a3 = b M , a4 = g + d C , a5 = d M + b R

a1 = d R + b M ,

(2.2.11)

Hence, we obtain the stability matrix in the form:  −a 0   an − a1 0 a3  0 − a3 

g−

0 − a2

0 − a4  −

a2 − a5

0

      

(2.2.12)

The stability matrix (2.2.12) leads to the following characteristic equation: 4

+ K1

3

+ K2

2

+ K3 = −

(T

1

3

+ T2

2

+ T3 + T4 )

(2.2.13)

where K1 = a + a1 + a5 , K 2 = a (a1 + a5 ) + a1a5 − a2 a3 , K 3 = a (a1a5 − a2 a3 ), T1 = − a4 , T2 = − K1a4 , T3 = −  a (a1a4 − nga3 + a4 a5 ) + a4 (a1a5 − a2 a3 ) , T4 = − a  a4 (a1a5 − a2 a3 ) + gna3 (a2 − a5 )

(2.2.14)

Generally speaking, the transcendental equation (2.2.13) cannot be solved analytically and has an indefinite number of roots. In essence, we have two main tools besides direct numerical investigation; firstly, the linear stability analysis, especially in the case of small time delay (i.e. t < 1 ), and secondly, the Hopf bifurcation theorem for larger time delay.

Andronov-Hopf Bifurcation of the Time Delay Model: Linear Stability Analysis For a small delay τ(τ < 1), the method of linear stability analysis is much convenient to find the bifurcation point. Thus, let  − ≈ 1 − , then the eigenvalue equation becomes:

56

Mathematical Description of Time Delays in Pathways Cross Talk

4

3

+p

2

+q

+ r + s = 0

(2.2.15)

By the Hopf bifurcation theorem and the Routh-Hurwitz criteria, an Andronov-Hopf bifurcation occurs at a value τ = τb where: p=

a4 + (1 − a4 1 − a4

s=−

T4 1 − a4

b

)K1 > 0,

b

)=

K 2 + K1a4 − K 4 1 − a4 b

b

> 0, r =

K 3 − T3 + T4 1 − a4 b

> 0, l = pqr − sp 2 − r 2 = 0

4

+p

3

+q

b

> 0,



(2.2.16)

+ r + s

(2.2.17)

b

where the condition a4 h( ,

q=

≠ 1 is valid. Let:

b 2

Evaluating h at τ = τb yields:

h( ,

b

)=

where k 2 = 1,2

4

+p

3

+q

2

+ k 2 p + k 2 (q − k 2 )

(2.2.18)

r . The eigenvalues of (2.2.15) at τb are: p

r p

= ±ik = ±

(2.2.19)

sp p and the type of the other pair roots depend on the sign of the equality ∆1 = − . Here we note that i r 4 is imaginary unit. If (i) ∆1 > 0 then: 3,4

=−

p ± ∆ 2i 2

2 where ∆ 2 =

3,4

=−

(2.2.20)

sp p 2 − (∆ 2 > 0 ); (ii) ∆1 < 0 then: r 4

p ± ∆2 2

where now ∆ 2 = −∆1 . Differentiating implicitly h (

(2.2.21)

( ), ) yields:

d p' 3 + q' 2 + r ' + s' ∂h ∂h =− =− 3 / ∂ ∂ d 4 + 3 p 2 + 2q + k 2 p

(2.2.22)

where: a (K − T ) + T  a4  a42 K1 + a4 K 2 + T3 a4T4 ' p = , r ' = 4 3 3 2 4 , s' = −  , q = 2 (1 − a4 ) (1 − a4 (1 − a4 )  1 − a4  2

'

) 2

(2.2.23)

57

Mathematical Description of Time Delays in Pathways Cross Talk

Evaluating the required derivatives of h at τb, we obtain:

d

1

d

( b ) = −  s

'

(

)

− q ' k 2 + (− p ' k 2 + r ' )ki  −2 pk 2 − 2k (q − 2 k2 ) i 2

L +I

2



(2.2.24)



(2.2.25)

or:

d

1

d

( b ) = 2k

2

N + 2k  pk 2 (r ' − p ' k 2 )+ (q − 2k 2 )(s ' − q ' k 2 ) i L2 + I 2

where L = −2 pk 2 , I = 2k (q − 2k 2 )i and N = p (s ' − q ' k 2 )+ (q − 2k 2 )(p ' k 2 − r ' ). The real part of (2.2.25) has the form:

d ( Re  1  d

b

) =  

2k 2 N L2 + I 2

(2.2.26)

The real part (see (2.2.26)) is always positive if N > 0, i.e., if the following conditions are valid:

s' > q'k 2 , q > 2k 2 , p ' k 2 > r ' or

q < 2k 2 , p ' k 2 < r '

(2.2.27)

So inequalities (2.2.27) are sufficient to have positive slope of the real part of the eigenvalue χ1(τ). This fact (according to the Hopf bifurcation theorem (Marsden & McCracken, 1976)) guarantees the bifurcation to a limit cycle for τ = τb.

Hopf Bifurcation Analysis It is well known that for a larger time delay τ, the linear stability analysis of the previous section is no longer effective and we need to use another approach (Marsden & McCracken, 1976; Galach, 2003; Cai, 2005; Kavasseri, 2005). The stability of (2.2.2) depends on the sign of the real parts of the roots of Eq. (2.2.15). We let χ = m + in (m,n ∈ R) and rewrite Eq. (2.2.15) in terms of its real and imaginary parts as:

m 4 + n 4 − 6m 2 n 2 + K1 (m3 − 3mn 2 )+ K 2 (m 2 − n 2 )+ K 3 m =

{

=  − m T1 (m3 − 3mn 2 )cos n + (3m 2 n − n3 )sin n  + + T2 (m 2 − n 2 )cos n + 2mn sin n  + T3 [m cos n + n sin n ]+T4 cos n },

4mn (m 2 − n 2 )+ K1 (3m 2 n − n3 )+ K 2 (2mn ) + K 3 n =

{

=  − m T1 (3mn 2 − m3 )sin n + (3m 2 n − n3 )cos n  + + T2 (n 2 − m 2 )sin n + 2mn cos n  + T3 [n cos n − m sin n ]−T4 sin n

58

}

(2.2.28)

Mathematical Description of Time Delays in Pathways Cross Talk

To find the first bifurcation point, we set m = 0. Then the above two equations reduce to: n 4 − K 2 n 2 = (−T2 n 2 + T4 )cos n + (−T1n3 + T3 n )sin n ,

− K1n3 + K 3 n = (−T1n3 + T3 n )cos n + (T2 n 2 − T4 )sin n

(2.2.29)

These two equations into (2.2.29) can be solved numerically. If the first bifurcation point is (nb , then the other bifurcation points (nb , b ) satisfy: 0

nb

b

= nb0

0 b

v = 1, 2, ...

+ 2v ,

0 b

),

(2.2.30)

By squaring the two equations into (2.2.29) and then adding them, it follows that:

n8 + (K12 − 2 K 2 − T12 )n 6 + (K 22 − 2 K1 K 3 + 2T1T3 − T22 )n 4 + (K 32 − T32 + 2T2T4 )n 2 − T42 = 0

(2.2.31)

Here we note that this is a quartic equation about n2 and the left side is positive for large values of 2 n2 and negative for n = 0 because −T4 is always negative, i.e., (2.2.31) has at least one positive real root. Moreover, to apply the Hopf bifurcation theorem, according (Khan & Greenhagh, 1999), the following theorem in this situation applies. Theorem 1. Suppose that nb is the last positive simple root of Eq. (2.2.31). Then in ( b ) = inb is a simple root of Eq.(2.2.13) and m ( ) + in ( ) is differentiable with respect to τ in a neighbourhood of τ = τb. To establish Andronov-Hopf bifurcation at τ = τb, we need to show that:

dm d

=

b

≠0

Hence, if we denote H ( ,

)=

4

d ∂H ∂H / =− = d ∂ ∂ =

− − 3

4

+ 3K1

2

+ 2 K 2 + K3 + 

−

3

+ K1

(T (T

1 1

3

+ K2

+ T2

2

+ T2

2

3

2

+ K3 − −

+ T3 + T4 )

=

=

b

d  = Re   d 

{

=

b

1

+ T3 + T4 )−  −

Evaluating the real part of this equation at τ = τb and setting

dm dt

(T

3

+ T2

(3T

1

2

2

+ T3 + T4 ), then:

+ 2T2 + T3 ) (2.2.33)

= inb yield:

n 4n + 3n (K − 2 K 2 − T12 )+ 2nb2 (K 22 − 2 K1 K 3 + 2T1T3 − T22 )+ K 32 − T32 + 2T2T4 2 b

6 b

4 b

2 1

2 1

(2.2.32)

}

2 1

L +I

59

Mathematical Description of Time Delays in Pathways Cross Talk

where:

L1 = K 3 − 3K1nb2 +

b

(n

2 b

− K 2 )nb2 + (3T1nb2 − T3 )cos nb

b

− 2T2 nb sin nb

b

and

I1 = −2 K 2 nb + 4nb3 − Let

g(

=

=

b

3

=4

3 b

− K1nb3 )+ 2T2 nb cos nb

+ (K12 − 2 K 2 − T12 )

4

Then for g

)

(K n

b

+ (3T1nb2 − T3 )sin nb

b

= nb2, then (2.2.31) reduces to:

)=

g' (

b

'

dg d

3

+ (K 22 − 2 K1 K 3 + 2T1T3 − T22 )

2

+ (K 32 − T32 + 2T2T4 ) − T42 = 0

( ) we have: = =

b

+ 3 (K12 − 2 K 2 − T12 )

2

+ 2 (K 22 − 2 K1 K 3 + 2T1T3 − T22 ) + K 32 − T32 + 2T2T4

If nb is the least positive simple root of the Eq. (2.2.31) then:

dg d

= nb2

>0

(2.2.34)

Hence: dm d

=

b

d  = Re   d 

= =

b

nb2 g ' (nb2 ) L12 + I12

>0

(2.2.35)

According to the Hopf bifurcation theorem (Marsden & McCracken, 1976) we define the following main result in this section. Theorem 2. If nb is the least positive root of Eq.(2.2.31), then an Andronov-Hopf bifurcation occurs as τ passes through τb. Here we note that a similar phenomenon appeared in the epidemic model with a time delay in vaccination for nonsexually transmitted diseases (Marsden & McCracken, 1976).

N umerical A nalysis of the T ime D elay Model In this section, we analyze numerically the time delay model constituted by Eq. (2.2.9) for the concentrations of the double-stranded RNA (dsRNA)-D(t), the RNA-induced silencing complex (RISC)-R(t), RISC-mRNA complex-C(t), and mRNA at time t, respectively. The corresponding numerical values of the model parameters are those in (2.2.3). However, we do not know the exact time point at which the RISC-mRNA complex begins to regenerate (or degrade) and assume that it takes a little bit longer;

60

Mathematical Description of Time Delays in Pathways Cross Talk

hence we set τ = 10 or 13 hours. The governing equations of the model, represented by Eq.(2.2.9), were solved numerically using MATLAB (Mathworks, 2007). The following Figures 13 and 14 demonstrate the dependence of the model behavior on the parameter τ. We fix the model parameters (see (2.2.3)) and vary the time delay τ, which from the point of view of qualitative theory plays the role of a bifurcation parameter. In Figure 13, the stable solutions for dsRNA, RISC, RISC-mRNA complex and mRNA are shown for τ = 10. It is evident that after several physiologically acceptable fluctuations, the concentrations of the dsRNA, RISC, RISC-mRNA complex and the mRNA approach constant values (equilibrium states). In other words, in this case the system (2.2.9) lies in a stable zone of its parametric space. In Figure 14 the case when τ = 13 is shown. It is seen that for the same values of the rate constants, after the Andronov-Hopf bifurcation, the stable limit cycle with period one occurs and the system (2.2.9) has periodic solutions. Thus, it means that time delay amplifies the instability of the steady state. In other words, as a result of the evidence obtained in Figures 13 and 14, we may conclude that the time delay has destabilization role in the RNA silencing process.

Figure 13. Stable solutions of the system (2.2.9) at τ = 10. The time is in hours

61

Mathematical Description of Time Delays in Pathways Cross Talk

Figure 14. Unstable periodic solutions of the system (9) at τ = 13 after introduction of large (high) dose of dsRNA

Figure 15 depicts the case when the initial dose of dsRNA is small. Many experimental studies as (Parrish, Fleenor, Xu, Mello, & Fire, 2000; Lipardi, Wei, & Paterson, 2001; Giordano, Rendina, Peluso, & Furia, 2002) suggest that larger initial doses of dsRNA engender larger silencing reactions or induce silencing more effectively. For example, in Ref. 81, the authors suggest that effective gene silencing by RNAi depends on a number of important parameters, including the dynamics of gene expression and the RNA dose. Their experiments demonstrate that different levels of silencing can be attained by modulating the dose level of RNA and the time of transfection and illustrate the importance of a dynamic analysis in designing robust silencing protocols. Thus, we expect dosage dependence to be useful in avoiding self-directed reactions. Comparing Figure 14 and Figure 15, we conclude that the time for formation of stable limit cycle in case with a small dose is larger than this with a high dose. But, on the other hand the amplitude of oscillations of dsRNA (for small initial dsRNA concentration) is longer. Note that frequency is also higher. Because greater quantities of dsRNA typically are a more reliable indicator of the presence of non-self, dosage reduces the impact of mistaken reactions to selfderived genetic material.

62

Mathematical Description of Time Delays in Pathways Cross Talk

Figure 15. Unstable periodic solutions of the system (9) at τ = 13 after introduction of a small dose of dsRNA. The time is in hours

Time Delay in ERK and STAT Interaction From the results described in the work (Pircher, Petersen, Gustafsson, & Haldosen, 1999), a model for interaction between ERK and STAT5a in CHOA cells can be derived. As it is proved in (Pircher, Petersen, Gustafsson, & Haldosen, 1999), in unstimulated cells STAT5a is complexed with inactive ERK that binds to STAT5a via its C-terminal substrate recognition domain to an unknown region on STAT5a. Then via its active site it binds to the C-terminal ERK recognition sequence in STAT5a. On the other hand, upon GH stimulation, MEK activates ERK through phosphorilation of specific threonine and tyrosine residues in ER K. The active ERK phosphorilates serine 780 in STAT5a, resulting in decreased affinity between the two proteins and dissociation of the complex. From the biochemical diagram in (Pircher, Petersen, Gustafsson, & Haldosen, 1999), we can write the following system of ordinary differential equations for the kinetics of STAT5a/S phosphorylation and ERK activation,

63

Mathematical Description of Time Delays in Pathways Cross Talk

described by concentration variables e1,e2,s1,s2 denoting concentrations of ERK-inactive, ERK-active, STAT- and STAT-phosphorylated respectively. It has the form: de 1 = − k0 e1s1 + k2 e2 − I , dt de 2 = k0 e1 (t − ) s1 (t − ) − k2 e2 + I , dt ds 1 = − k1e1 s1 + k3 s2 + A, dt ds 2 = k1e1 (t − ) s1 (t − ) − k3 s2 − A dt

(2.3.1)

where k1 is proportional to the frequency of collisions of ERK and STAT protein molecules and present rate constant of reactions of associations; k2 and k3 are constants of exponential growths and disintegrations; I > 0 and A > 0 are inhibitor and activator sources respectively, τ is time delay of ERK and STAT interaction (i.e. ERK activation and STAT phosphorylation). The source I inhibits the inactivation of active ERK, and A activates the dephosphorylation of phosphorylated STAT5a. The terms I and A can be also considered as some effective (apparent) inhibitor and activator, under condition that they present really some in-flux and out-flux of the active ERK and phosphorylated STAT5a respectively. Generally said, by introducing I and A we take into account the natural circumstance that ERK and STAT interaction is not isolated but open process in the intracellular space. We can consider I and A as algebraic values having different signs (plus or minus) and determining one or another type of behavior of the system (2.3.1). In this way (2.3.1) can be used as dynamical model of ERK and STAT interaction. A more concrete interpretation of the inhibitor I and activator A can be given in connection with the role of the SOCS proteins in linking JAK/STAT and MEK/ERK pathways. Biological responses elicited by the JAK/STAT pathway are modulated by inhibition of JAK (and respective attenuation of STAT) by a member of the Suppressors of Cytokine Signalling (SOCS) proteins. On the other hand over-expression of some SOCS family members induces activation of ERK, which can phosphorylate STATs. Further we apply the linear time delay approximation explained in one from the previous sections. As a result the relations:

e1 + e2 = e0 − k0 e1s1

(2.3.2)

s1 + s2 = s0 − k1 e1s1 (here it follows s1 – s1 > 0)

(2.3.3)

can be obtained. By replacing them in the second and fourth equation of (2.3.1-2), the last is reduced to the following two-dimensional system of ordinary differential equations (without time delays):

de1 = − k0 (1 + k2 )e1s1 − k2 e1 + k2 e0 − I dt

(2.3.4)

ds1 = − k1 (1 + k3 )e1s1 − k3 s1 + k3 s0 + A dt

(2.3.5)

64

Mathematical Description of Time Delays in Pathways Cross Talk

The system (2.3.4-5) (together with the formulas (2.3.2-3)) is considered to be equivalent to the time delay system (2.3.1) when τ is sufficiently small. Certainly, the behavior of the variables e1 and s1 (inactive ERK and non-phosphorylated STAT respectively) is leading one with respect to that of e2 (active ERK) and s2 (phosphorylated STAT). Thus we can qualify the system (2.3.4-5) as a driver of ERK and STAT cross talk and the variables e1 and s1 can be called driving variables. This is the first conclusion from the qualitative analysis of the time delay system (2.3.1) in linear approximation. The steady state value of e1 is e10 = e0 −

k (1 + k2 ) I k0 k3 (1 + k2 ) A − ( s0 − s10 ) − 0 k2 k1k2 (1 + k3 ) k1k2 (1 + k3 )

(2.3.6)

0

where s1 is determined as a positive root of quadratic equation we obtain after substituting (2.3.6) in the steady state equations of (2.3.4-5), i.e. the right hand sides of (2.3.4-5) equated to zero. To study the nature (stable or not) of the steady state we introduce in (2.3.4-5) the substitutions: e1 = e10 + x , s1 = s10 + y

(2.3.7)

where x and y are variations (small disturbances, perturbations). After corresponding linearization the variation system for x and y takes the form: dx = −  k2 + k0 s10 (1 + k2 )  x − k0 (1 + k2 )e10 y − k0 (1 + k2 ) xy, dt dy = − k1 (1 + k3 ) s10 x −  k3 + k1e10 (1 + k3 )  y − k1 (1 + k3 ) xy dt

(2.3.8)

The Routh-Hurwitz conditions for stability of the steady state (2.3.6-7) are: k2 + k3 + k0 s10 (1 + k2 ) + k1e10 (1 + k3 ) > 0

(2.3.9)

k2 k3 + k1k2 e10 (1 + k3 ) + k0 k3 s10 (1 + k2 ) > 0

(2.3.10)

It is evident from (2.3.9-10) that in the presence of time delay τ the inequalities are stronger than in the absence of τ. That means the time delay amplifies the stability of the steady state of the driver system (2.3.4-5) as well as of the whole time delay model (2.3.1) of ERK and STAT cross talk, at the condition of sufficiently small τ, i.e. in linear approximation.

Co nc lusi on In this chapter we present some results obtained from us in (Nikolov, Kotev, Georgiev, & Petrov, 2006; Nikolov, Kotev, & Petrov, 2006a; Nikolov, Kotev, & Petrov, 2006b; Nikolov, Vera, Wolkenhauer, Yankulova, & Petrov, 2007; Nikolov & Petrov, 2007; Nikolov, Vera, Kotev, Wolkenhauer, & Petrov, 2008). The main conclusions from section 2.1, where we investigate whether the inclusion of time delays alters the

65

Mathematical Description of Time Delays in Pathways Cross Talk

dynamical properties of the Jacob-Monod model (which describes the control of the b-galactosidase synthesis by the lac repressor protein in E.coli), are: •

•

•

The basic view that the time delay τ is a key factor in the dynamical behaviour of the system has been confirmed by the analytical calculations and numerical simulations. From the qualitative theory of DDE and ODE viewpoint, time delay appears as a bifurcation parameter on whose values depend the altered (stable or unstable) behaviour of the model. When no delay is considered in the synthesis of b-galactosidase, only a soft loss of stability take place, and changes of time delay through the critic value τb has reversible behaviour. This means that at the transition of R through the boundary R = 0 from positive values to negative ones a stable limit cycle emerges, i.e., selfoscillations of the system appear. Inversely, at the transition of R from negative values to positive ones the stable limit cycle disappears, i.e., the self-oscillations cease. However, when a time delay is considered the properties of the system changes drastically, and hard loss of stability emerges. For time delays longer than τb, the lactose operon would present sustained oscillations with coupled periodic variations on the concentration of both proteins and the mRNA. In contrast, a time delay smaller than τb will provoke only transient oscillations of the species integrating the operon around a stable steady-state. We can say that in this situation time delay has a destabilizing role. When simple (non-cooperative) inhibition of mRNA production by the lac repressor protein is considered (p1=1.0), oscillations in values of concentrations for proteins and mRNA appear but the amplitude of such oscillations is much reduced (around 1% of the average concentration in the cases shown in Figures 7 and 9). If the system is not able to distinguish these fine-tuning oscillations, the lac operon would act as if an effective quasi steady-state exists. From a biological perspective, it could be reasonable to think that the system presents at least local robustness with respect the concentration of lactose (which is a primary carbon source of the system), and then this reduced amplitude oscillations would not provoke a differentiated response of the system during the different phases of the oscillation. In contrast, when cooperativity in the repression of mRNA synthesis is considered (p1=2.0), the oscillations also occurs but the magnitude of this oscillations in the concentration of proteins and mRNA is actually significant. In some cases (Figures 8 and 10) the cooperativity provokes oscillations with changes all-nothing for the concentration of the proteins during the period of the oscillations. Therefore, the oscillations induced for time delays higher than the critic value τb in a system with cooperavity could provoke clearly differentiated responses of the system during the period of the oscillations. The conclusion of our analysis is that in the case of the lac operon analysed, not only time delay in galactosidase synthesis but also cooperativity in the end product repression is necessary to induce a regime of effective sustained oscillations. From a physiological viewpoint, the hard (irreversible) loss of stability might be related to the emergence of new configurations in the regulatory gene circuit that could lead the system into a pathologic state. Similar behaviour has been already detected and discussed in other biological systems with different nature such as cardiac pulsations and ocular system (Petrov & Nikolov, 1998; Petrov & Nikolov, 1999), but this conclusion that we point here for hard stability loss is suggested here by the first time for protein synthesis systems.

The main conclusions from investigations in section 2.2 of time delay model of RNA silencing are as follows.

66

Mathematical Description of Time Delays in Pathways Cross Talk

Besides the stability, the original model (2.2.1) captures the following features of RNA-silencing dynamics from empirical studies (As it is argued in paper (Bergstrom, McKittrick, Antia, 2003)): • • •

The model detects and degradates the initial dose of dsRNA by essential initial drop in dsRNA concentration. It demonstrates a rapid generation of sequence-specific siRNA by rapid rise of RISC in the early stages of reaction. It shows an amplification of the response, producing “secondary” dsRNA and siRNA molecules by the increase in dsRNA concentration.

In other words, if the system possesses a stable equilibrium state, then this corresponds to a normal silencing process. On the other hand, the existence of unstable equilibrium states, stable limit cycles (self-oscillations) or chaotic attractors in this case corresponds to a pathology, i.e. an abnormal RNA silencing process. To our knowledge, in the literature up until now, time delay models describing gene silencing have not been suggested or investigated. Therefore, this investigation of ours is a new outlook on the problems and the factors influencing silencing. From the accomplished analytical and numerical calculations it becomes clear that time delay τ is a key factor in the behavior of model (2.2.9). In this case it has a destabilizing role on the silencing process. In terms of dynamical systems τ plays the role of a bifurcation parameter. If τ (i.e. the time necessary for the regeneration (or degradation) of the RISC-mRNA complex)) is greater than a certain (bifurcation) value in model (2.2.9), through Andronrov-Hopf bifurcation appears a self-oscillation related with an abnormal silencing mechanism. A possible cause is that the longer time brings about a production of a longer dsRNA, different from the one necessary for silencing. The appearance of periodical solutions in the time delay model (2.2.9) makes its behavior much richer compared to the original model proposed by Bergstrom and co-workers in (Bergstrom, McKittrick, Antia, 2003). This allows for investigating more properties and regimes of the silencing mechanism. From the simulations made in Figure 15 it is seen that at smaller initial doses of dsRNA the time for establishing of the stable limit cycle is longer, i.e. we have a longer transition period. On the other hand, however, the appearing self-oscillations are with a greater amplitude and frequency than those at a bigger initial dose of dsRNA. In particular, only the amplitude of D (dsRNA) is altered. It is held in the literature (Bergstrom, McKittrick, & Antia, 2003; Raab & Stephanopoulos, 2004; Groenenboom, Maree, Hogeweg, 2005; Bartlett & Davis, 2006), that bigger initial doses of dsRNA cause stronger silencing reactions or make silencing more effective. Moreover, it may be expected that the dependence on dosing is useful for avoiding self-directed reactions. In conclusion it may be noted that in practice time delay for generation can be different from this for degeneration. This in its turn makes the analytical investigation harder. For that reason it is assumed here that the two times are equal. From the numerical simulations (which are not shown) it became clear that the two times are very similar. For some of our conclusions an empirical verification is needed. The last section 2.3 of this chapter presents original elaboration of the ERK and STAT interaction model in the form of time delay of ERK activation and STAT phosphorylation has essential dynamical role. The basic view is that time delay τ in the RNA silencing is a key factor in the dynamical behaviour of model (2.3.1) confirmed by appropriate analytical calculations. From the qualitative theory of DDE viewpoint, time delay in this case has stabilization role.

67

Mathematical Description of Time Delays in Pathways Cross Talk

R eferences Agnati, L., Tarakanov, A., & Guidolin, D. (2005). A simple mathematical model of cooperativeness in receptor mosaics based on the “symmetry rule”. Biosystems, 80(2), 165-177. Andronov, A., Witt, A., & Chaikin, S. (1966). Theory of oscillations. Reading, MA: Addison-Wesley. Arciero, J., Jackson, T., & Kirschner, D. (2004). A mathematical model of tumor-immune evasion and siRNA treatment. Discrete and Continuous Dynamical Systems, 4, 39-58. Arziman, Z., Horn, T., & Bourtos, M. (2004). E-RNAi: A Web application to design optimized RNAi constructs. Nucleic Acids Res., 33, W582-W588. Bartlett, D., & Davis, M. (2006). Insights into the kinetics of siRNA-mediated gene silencing from livecell and live-animal bioluminescent imaging. Nucleic Acids Research, 34, 322-333. Bautin, N. (1984). Behavior of dynamical systems near the boundary of stability. Moscow: Nauka Belair, J., & Dufour, S. (1996). Stability in a three-dimensional system of delay-differential equations. Canadian Applied Mathematics Quarterly, 4, 135-156. Berezhna, S, Supekova, L, Supek, F, Schultz, P, & Deniz, A. (2006). siRNA in human selectively localizes to target RNA sites. Proc. Natl. Acad. Sci. USA, 103(20), 7682-7687. Bergstrom, C., McKittrick, E., & Antia, R. (2003). Mathematical models of RNA silencing: Unidirectional amplification limits accidental self-directed reactions. Proc. Natl. Acad. Sci. USA, 100, 11511-11516. Bliss, R., Painter, P., & Marr, A. (1982). Role of feedback inhibition in stabilizing the classical operon. J. Theor. Biol., 97, 177-193. Boese, Q, Scaringe, S., & Marshall, W. (2003). siRNA as a tool for streamlining functional genomic studies. Targets, 2(3), 93-99. Bratsun, D., Volfson, D., Tsimring, L., & Hasty, J. (2005). Delay-induced stochastic oscillations in gene regulation. Proc. Natl. Acad. Sci. USA, 102, 14593-14598. Cai, H. (2005). Hopf bifurcation in the IS-LM business cycle model with time delay. Electronic Journal of Differential Equations, 15, 1-6. Chen, L., Wang, R., Kobayashi, T., & Aihara, R. (2004). Dynamics of gene regulatory networks with cell division cycle. Phys Rev E, 70, 011909. de Jong, H. (2002). Modelling and simulation of genetic regulatory systems: A literature review. J. Comput Biol., 9(1), 69-105. Driver, R. (1977). Ordinary and delay differential equations. New York: Springer-Verlag. Edissonov, I., & Nikolov, S. (2001). Mathematical modelling and phase analysis of HIV infection. Systems Analysis Modelling Simulation, 40, 87-98. Elledge, S.J. (1996). Mathematical models of protein kinase signal transduction. Science, 274, 16641672.

68

Mathematical Description of Time Delays in Pathways Cross Talk

Elsgoltz, L. E. (1957). Differential equations. Moscow: Gosizdat (in Russian) Elsgolz, L., & Norkin, S. (1974). Introduction in time delay equations. Moscow: Nauka (in Russian). Fall, C., Marland, E., Wagner, J., & Tyson, J. (2002). Computational cell biology. New York: Springer. Freeman, M. (2000). Feedback control of intercellular signalling in development. Nature, 408, 313319. Galach, M. (2003).Dynamics of the tumor-immune system competition-the effectof time delay. Int J Appl Math Comput Sci, 13(3), 395-406. Gafney, E., & Monk, N. (2006). Gene expression time delay and Turing pattern formation systems. Bulletin of Math Biology, 68, 99-130. Glass, L., & Mackey, M. (1988). From clocks to chaos. The rhythms of life. Princeton University Press. Gierer, A., & Meinhardt, H. (1972). A theory of biological pattern formation. Kybernetik, 12, 30-39. Giordano, E., Rendina, R., Peluso, I., & Furia, M. (2002). RNAi triggered by symmetrically transcribed transgenes in Dros. melanogaster. Genetics, 160, 637-648. Gopalsamy, K., & Leung, I. (1997). Convergence under dynamical thresholds with delays. IEEE Transactions on Neural Networks, 8, 341-348. Groenenboom, M., Maree, A., & Hogeweg, P. (2005). The RNA silencing pathway: The bits and pieces that matter. PLoS Comput. Biol., 1, 155-165. Hannon, G. (2002). RNA interference. Nature, 418, 244-251. Heinrich, R., & Schuster, S. (1996). The regulation of cellular systems. New York: Chapman and Hall. Heinrich, R, Neel, B, & Rapoport, T. (2002). Mathematical models of protein kinase signal transduction. Molecullar Cell, 9, 957-970. Hobert, O. (2004). Common logic of transcription factor and microRNA action. Trends in Bioch Sci, 29(9), 462-468. Hoffman, A., Levchenko, A., Scott, M., & Baltimore, D. (2002). The IkB-NFkB signalling module: Temporal control and selective gene activation. Science, 298, 1241-1245. Jacob, F., & Monod, F. (1961). Genetic regulatory mechanisms in the synthesis of proteins. J. Molecular Biology, 3, 318-356. Kavasseri, R. (2005). Delay induced oscillations in a fundamental power model Nonlinear Phenomena and Complex Systems, 8(1), 62-67. King, R.W., Deshaies, R.J., Peters, J., & Kirschner, M. (1996). How proteolysis drives the cell cycle. Science, 274, 1652-1659.

69

Mathematical Description of Time Delays in Pathways Cross Talk

Khan, Q., & Greenhagh, D. (1999). Hopf bifurcation in epidemic models with a time delay in vaccination. IMA Journal of Mathematics Applied in Medicine and Biology, 16, 113-142. Kolnanovskii, V., & Nosov, V. (1986). Stability of functional differential equations. Mathmatics in Science and Engineering, 180. London: Academic Press, INC. Lema, M., Golombek, D., & Echave, J. (2000). Delay model of the circadian pacemaker. J. Theor. Biol., 204, 565-573. Lipardi, C., Wei, Q., & Paterson, B. (2001). RNAi as random degradative PCR: siRNA primers convert mRNA into dsRNA that are degraded to generate new siRNAs. Cell, 107, 297-307. Marsden, J., & McCracken, M. (1976). The Hopf bifurcation and its applications. New York: SpringerVerlag. Matlab, (2007). The MathWorks, Inc. Natick, MA, USA www.mathworks.com. Meinhardt, H. (1994). Biological pattern formation: New observations provide support for theoretical predictions. Bioessays, 16, 627-632. Miguez, D., Izus, G., & Minuzuri, A. (2006). Robustness and stability of flow and diffusion structures. Phys. Rev. E, 73, 016207-13. Munroe, S., & Zhu J. (2006). Overlapping transcripts, double stranded RNA and antisense regulation: A genomic perspective. Cellular and Molecular Life Science, 63, 2102-2118. Murray, A.W., & Kirschner, M.W. (1989). Dominoes and clocks: The union of two views of the cell cycle. Science, 246, 614-621. Murray, J. (2002). Mathematical biology, I. An introduction. Third Edition, New York: Springer-Verlag. Nikolov, S., & Petrov, V. (2004). New results about route to chaos in Rossler system. Int. J. of Bifurcation and Chaos, 14(1), 293-308. Nikolov, S. (2004). First Lyapunov value and bifurcation behaviour of specific class three-dimensional systems. Int. J. of Bifurcation and Chaos, 14(8), 2811-2823. Nikolov, S. (2005). An alternative bifurcation analysis of the Rose-Hindmarsh model. Chaos, Solitons & Fractals, 23(5), 1643-1649. Nikolov, S., Kotev, V., Georgiev, G., & Petrov, V. (2006). The dynamical roles of time delays in protein cross talk models, Comptes rendus de l’Academie bulgare des Sciences, 59(3), 261-268. Nikolov, S., Kotev, V., & Petrov V. (2006a, October 24-25). Influence of time delay on bifurcation behavior in the protein synthesis model: BioPS’06, Sofia, III.37-III.46. Nikolov, S., Kotev, V., & Petrov, V. (2006b, October 24-25). Bifurcation behavior of a time delay model of enzyme and repressor cross talk: BioPS’06, Sofia, III.47-III.56. Nikolov, S., Yankulova, E., Nikolova, A., & Petrov, V. (2006). Stability and structural stability (robustness) in computational systems biology. Journal of the Bulgarian Academy of Sciences, 69(6), 21-29.

70

Mathematical Description of Time Delays in Pathways Cross Talk

Nikolov, S., Yankulova, E., Wolkenhauer, O., & Petrov, V. (2007). Principal difference between stability and structural stability (robustness) as used in Systems Biology. Nonlinear Dynamics, Psychology, and Life Sciences, 11(4), 413-433. Nikolov, S., Vera, J., Wolkenhauer, O., Yankulova, E., & Petrov, V. (2007). Chaos in a delayed protein cross talk model with periodic forcing. Comptes rendus de l’Academie bulgare des Sciences, 60(2), 127-132. Nikolov, S., & Petrov, V. (2007). Time delay model of RNA silencing. Journal of Mechanics in Medicine and Biology, 7(3), 297-314. Nikolov, S., Vera, J., Kotev, V., Wolkenhauer, O., & Petrov, V. (2008). Dynamic properties of a delayed protein cross talk model. BioSystems, 91, 51-68. Orosz, G., (2004). Hopf bifurcation calculations in delayed systems. Periodica Polytechnica Ser. Mech, Eng., 48(2), 189-200. Raab, R., & Stephanopoulos, G. (2004). Dynamics of gene silencing by RNA interference. Biotechnol. Bioeng. 88(1), 121-132. Rateitschak, K., & Wolkenhouer, O. (2007). Intracellular delay limits cyclic changes in gene expression. Mathematical Biosciences, 205, 163-179. Rozema, D., & Lewis, D. (2003). siRNA delivery technologies for mammalian systems. Targets, 2, 253-259. Parrish, S., Fleenor, J., Xu, S., Mello, C., & Fire, A. (2000). Functional anatomy of a dsRNA trigger: Differential requirement for the two trigger strands in RNA interference. Moll Cell, 6, 1077-1087. Petrov, V., & Nikolov, S. (1998). Valuation of the extraocular effective elastance on the base of dynamical model. Nonlinear Dynamics, Psychology, and Life Sciences, 2(1), 1-20. Petrov V., & Nikolov, S. (1999). Rheodynamic model of cardiac pressure pulsations. Mathematical Biosciences, 157(1-2), 237-252. Pircher, T.J., Petersen, H., Gustafsson, J.A., & Haldosen, L.A. (1999). ERK interacts with STAT5a. Molecular Endocrinology, 13, 555-565. Sasaki, J., Sasaki, T., Matsumoto, W., Opavsky, A., Cheng, M., et. al. (2001). CD45 is a JAK phosphatase and negative regulates cytokine receptor signaling. Nature, 409, 349-354. Schepper, T., Klinkenberg, D., Pennartz, C., & Van Pelt, J. (1999). A mathematical model for the intracellular circadian rhythm generator. J. Neurosci., 19(1), 40-47. Sieber, J., & Krauskopf, B. (2004). Bifurcation analysis of an inverted pendulum with delayed feedback control near a triple-zero eigenvalue. Nonlinearity, 17, 85-104. Sherr, C.J. (1996). Cancer cell cycles. Science, 274, 1672-1677. Shilnikov, L., Shilnikov, A., Turaev, D., & Chua, L. (2001). Methods of qualitative theory in nonlinear dynamics, Part II. World Scientific.

71

Mathematical Description of Time Delays in Pathways Cross Talk

Smolen, P., Baxter, D., & Byrne, J. (2001). Modeling circadian oscillations with interlocking positive and negative feedback loops. J. Neorosci., 21, C6644-C6656. Starr, R., Willson, T., Viney, E., Murray, L., Rayner, J., et al. (1997). A family of cytokine inducible inhibitors of signalling. Nature, 387, 917-921. Stepan, G. (1989). Retarded dynamical systems: Stability and characteristic functions. Pitman research Notes in Mathematics, 210. Longman, Essex. Stillman, B. (1996). Cell cycle control of DNA replication. Science, 274, 1659-1677. Storz, G. (2002). An expending universe of noncoding RNAs. Science, 296, 1260-1262. Swameye, I., Mueller, T., Timmer, J., Sandra, O., & Klingmueller, U. (2003). Proc. Natl. Acad. Sci. USA, 100, 1028-1033. Thomas, R., & d’Ari, R. (1990). Biological feedback. CRC Press. Thomas, R. (1998). Laws for the dynamics of regulatory networks. Int. J. Dev. Biol., 42, 479-485. Timmer, J., Mueller, T, Swameye, I., Sandra, O., & Klingmueller U. (2004). Modeling the nonlinear dynamics of cellular signal transduction. Int. J. of Bifurcation and Chaos, 14, 2069-2079. Turing, A. (1952). The chemical basis of morphogenesis. Philos. Trans. R. Soc. Lond., B237, 37-72. Voit, E. (2000). Computational analysis of biochemical systems. A practical guide for biochemists and molecular biologists. Cambridge: Cambridge University Press, UK. Wang, R., Zhou, L., Jing, T., Chen, L. (2004). Modelling periodic oscillation of biological systems with multiple time scale networks. Systems Biology, 1(1), 71-84. Wolkenhauer, O., Sreenath, S, Wellstead, P., Ullah, M., & Cho, K. (2005). A systems and signal oriented approach to intracellular dynamics. Biochemical Society Transactions, 33(3), 507-515. Wolkenhauer, O., Ullah, M., Wellstead, P., & Cho, K. (2005). The dynamic systems approach to control and regulation of intracellular networks. FEBS Letters, 579, 1846-1853. Yildirim, N., & Mackey, M. (2003). Feedback regulation in the Lactose operon: A mathematical modelling study and comparison with experimental data. Biophysical Journal, 84, 2841-2851. Yildirim, N., Santillan, M., Horike, D., & Mackey, M. (2004). Dynamics and bistability in a reduced model of lac operon. Chaos, 14(2), 279-292.

K ey T erms Andronov-Hopf Bifurcation: From a mathematical point of view, the onset of sustained oscillations generally correspond to the passage through an Andronov-Hopf bifurcation point. Obviously, for a critical value of a control parameter (named bifurcation), the system displays damped oscillations and eventually reaches the steady state- stable focus. Beyond the bifurcation point, a stable solution

72

Mathematical Description of Time Delays in Pathways Cross Talk

arises in the form of a small-amplitude limit cycle surrounding the unstable steady state [Golbeter, A., Nature, 420:238-245, 2002]. This bifurcation is very typical for biological systems. Chaotic Dynamics: Chaotic motions are based on homoclinic (heteroclinic) structures which instability accompanied by local divergence and global contraction. Meanwhile, the transition from stability to instability requires the vanishing of stable equilibrium states and of stable periodic motions or sufficiently large increase in the periodic ones. DDEs: Delay differential equations. Those equations contain in addition derivatives which depend on the solution at previous times. Also they are infinite-dimensional systems which find application in control systems, biology, chemical kinetics, and other areas. ERK: Extracelullar Signal-Regulated Kinase. Cell signalling protein activated STAT through serine phosporilation. NFB: Negative feedback. In this case a signal is caused by the expression of its inhibitor. PFB: Positive feedback (or autocatalysis). Now, more inhibitors, or other molecules amplify the initial signal and lead to the stabilization of the amplitude, or the increase in the signal’s duration. RNA Silencing: Or also known as RNA interference similar to immune system guards against exploitive parasitic elements by (i) identifying non-self-elements; (ii) generating target-specific responses against these foreign elements, and (iii) rapidly amplifying these responses to clear or otherwise inactive the threat. STAT: Signal Transducer and Activator of Transcription is a family of latent cytoplasmic proteins that are activated to participate in gene control when cells encounter various extracellular polypeptides. Time Delay: Past memory (history).

73

74

Chapter IV

Deterministic Modeling in Medicine Elisabeth Maschke-Dutz Max Planck Institute for Molecular Genetics, Germany

abstract In this chapter basic mathematical methods for the deterministic kinetic modeling of biochemical systems are described. Mathematical analysis methods, the respective algorithms, and appropriate tools and resources, as well as established standards for data exchange, model representations and definitions are presented. The methods comprise time-course simulations, steady state search, parameter scanning, and metabolic control analysis among others. An application is demonstrated using a test case model that describes parts of the extrinsic apoptosis pathway and a small example network demonstrates an implementation of metabolic control analysis.

INTR OD UCTI ON We can observe the molecular background of complex disease processes with systems biology. Today, drug development plays a central role in the interdisciplinary area of systems biology. Scientists from various disciplines, such as biology, bioinformatics, medical research, chemistry, physics, computer science and mathematics, work together to analyze complex disease processes by studying molecular interaction networks. The aim is to understand and analyze the complex behavior of human diseases. Through this collaborative research we can obtain specific methods and results that can lead to new predictions and assumptions about the observed diseases and processes. Metabolic pathways like the citric acid cycle and glycolysis, for example, are important processes that may be used to analyze the complex mechanism in living biological systems. The modeling of these pathways provides appropriate structures for observing the behavior of metabolic diseases, i.e. diabetes. Gene regulatory networks describe protein-DNA interactions or indirectly as the interaction Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Deterministic Modeling in Medicine

between DNA and DNA. Here, we can also examine the regulation of the activity of single genes and the behavior of single molecules, as well as observe the interaction and regulation between different genes and proteins in complex structures. The normal function of single genes is affected in several diseases. A lot of information is available about the functionality of single genes in different diseases and also the roles of mutations in these genes are comprehensively described (Weinberg 1994). Many project studies about this topic are currently underway, and we expect more interesting results in the future (Futreal et al. 2004). Multiprotein complexes are the result of numerous protein-protein interactions. These interactions are essential for physiological processes. In biological networks, diffusion and the molecular transport across cell membranes are also important physiological processes. In different compartments of the cell the function of a protein can change, because the functionality of a protein depends also on the existing targets in the appropriate compartments. For example the p53 protein acts in the nucleus as a transcription factor of apoptosis. The protein Mdm2 in turn can bind to p53 and initiates its ubiquitination and subsequent degradation in the cytoplasm. In the cytoplasm p53 can not act as a transcription factor and instead the degradation of p53 is initialized in this compartment. Signaling pathways play an important role in many diseases. For example the cell signaling mechanism regulates cell proliferation and cell differentiation. The main structures that are responsible for the progression of cancer are interferences in signaling pathways (Cui et al. 2007). The reasons for these inferences in turn are founded in mutated proteins. Using mathematical models we can describe complex cellular processes. This chapter gives an overview of the possibilities available to analyze these molecular, cellular and physiological processes with mathematical modeling, and outlines how we can integrate experimental data. We demonstrate the utilization of the mathematical model analysis in two examples. Time-course simulation and parameter scanning are applied to a model for the extrinsic apoptosis pathways and metabolic control analysis is applied to a small sample network.

MATHEMATICA L MODE LING We can describe biological systems with Boolean models, stochastic models and deterministic models. Boolean networks are based on the Boolean logic (Kaufmann 1993) and can be used to describe gene regulatory interactions. There are two Boolean states: expressed and not expressed. The expression level of a gene is represented in one of the two binary states, ‘0’ and ‘1’. In 1977 Gillespie introduced the exact stochastic simulation algorithms called direct method and first reaction method (Gillespie 1977). The stochastic modeling process deals with discrete variables that are numbers of molecules. Up to now, the stochastic modeling methods are improved and extended (Gibson & Bruck 2000).This chapter will point out the deterministic, kinetic modeling of biochemical reaction networks. This kind of modeling uses continuous variables and allows the representation of the structure and behavior of the modeling system in a very detailed and arbitrarily complex way. The knowledge of complex diseases according to their molecular background, and the use of drugs and predictions resulting from the interpretation of experimental data, provides information about the constitution of the mathematical model. We can include this information into the model structure in analogous mathematical terms and equations. The introduced deterministic approach is based on a system of ordinary differential equations (ODE system).

75

Deterministic Modeling in Medicine

Many useful analysis methods exist. The presented methods analyze model behavior in different states and under different conditions.

T opology and S toichiometry In this paragraph we describe the techniques used to build reactions between the specific components of the model. A simple stoichiometric equation has the form:

n1 A + n2 B ⇒ n3C

(1)

In this equation A and B are called the reactants and C is called the product of the reaction. The ni with i=1,2,3 are the stoichiometric coefficients. A reaction can either be reversible A ⇔ B or irreversible A ⇒ B. In the reversible form equation (1) is denoted by:

n1 A + n2 B ⇔ n3C

(2)

All stoichiometric coefficients in the mathematical model can be represented in a so called stoichiometric matrix. We can represent the reactions vj j=1,..,m and the functions of the concentrations Si i= 1,..,n of the participating substances in vector form. The stoichiometric matrix has this form:

 n11  n1m  S1        N=   nn1  nnm  S n v  v 1

m

(3)

Note: there is no unique mapping from a stoichiometric matrix to a reaction system. More than one system can be consistent with a single stoichiometrie.

B alance E quation The rate equation of a reaction is also called kinetic law and is the mathematical formula for the velocity of the reaction. Depending on a local point p, the time t and Si i=1,..,n as a function, that describes the concentration of a substance, the rate equation v has the formula: v ( p, t ) = v S ( p, t ), t 

(4)

S is the vector of the function Si i=1,..,n and v describes the vector of the reaction rates. The velocity vj j=1,..,m also denotes the flux of the reaction. In the following paragraph, we introduce different well known mathematical formulations of kinetic laws. The change in concentration of a single substance can be described by the balance equation. For the function Si i=1,..,n the balance equation reads: m ∂Si = ∑ nij v j ∂t j =1

76

(5)

Deterministic Modeling in Medicine

where vj j=1,..,m are the reaction rates and nij i=1,..,n and j=1,..,m are the stoichiometric coefficients. The according matrix notation is:

∂S = Nv ∂t

(6)

If the system only depends on time, we call the system autonomous, in this case equation (4) shows the formula: v(t) = v(S(t))

(7)

Equation (5) can then be formulated by: dS (t ) dt

= Nv (S (t )) = f (S (t ))

(8)

Here f(S(t)) is a vector of functions f i i=1,..,n that depend on the time-dependent concentrations Si i=1,..,n. In this way, a system of ordinary differential equations which represent the deterministic mathematical model of the according network is built. It is called an ODE system.

R eaction K inetics The rate equation of a reaction is described in detail with mathematical terms using kinetic laws. The calculation rule of the reaction velocities depends on real-value kinetic parameters and the concentration of several components. These components can be the reactants themselves and also the products of the reactions. The concentration of other components in the model can also be part of the calculation rule. These components are called the modifiers of the reactions and their concentration can also control the fluxes , however, there is no mass flow of these components in the reaction. An example for a modifier in a reaction can be an enzyme that catalyzes a reaction, but is neither a reactant nor a product of the reaction. In a general formulation, the kinetic law can be written thus: v = v(k,R,P,M)

(9)

In this equation k = (k1,...,kl ) are the real-value kinetic parameters, R = (R1,...,Rr ) and P = (P1,...,Ps ) are the concentrations of the reactants and products, respectively. In respect to this context, the complexity and the variety of the reaction inhibitions and activations can be involved in the calculation rule by the modifiers M = (M1,...,Mt ) and so the calculation rule of the kinetic reaction could also be a very sizable formula. Well known kinetic laws are for example the Law of Mass Action or the Michaelis Menten kinetics. In the 19th century Cato Maximilian Guldberg and Peter Waage introduced the Law of Mass Action (Guldberg and Waage 1879). This law defines a rate equation for elementary reactions and also presents an equilibrium constant that is derived by using kinetic data and the proposed rate equation.

77

Deterministic Modeling in Medicine

For the simple reaction: A + B ⇔ AB

(10)

According to the Law of Mass Action, the two kinetic constants k1 and k–1 are established and equation (10) can be written as:

A+ B

k1  → AB ← k−1

(11)

Now the reaction rate is defined by: v = v1 − v−1 = k1 * [A]* [B ]− k−1 * [AB ]

(12)

The equilibrium constant of this reaction is defined by:

keq =

[AB ] k1 = k−1 [A][B ]

(13)

Note: the directionality of equation (11) defines the association equilibrium constant in equation (13). We can define the dissociation equilibrium constant from the reciprocal value of the association equilibrium constant. The changes in the concentrations by the reaction rate defined in (12) are characterized by the following ODEs: d [A] d [B ] = = −v1 + v−1 = −v dt dt

and

d [AB ] dt

= v1 − v−1 = v

(14)

Using the information given by the Mass Action Law, we can describe the decay of a reactant: A ⇒

(15)

with the reaction rate: v = k*[A]

(16)

Brown (1902) was the first to propose the control an enzyme has on a reaction. The considered reaction is an irreversible reaction and has one reactant and one product. No other effectors take part in this reaction. In the according reaction scheme the enzyme E is included, S denotes the reactant and P denotes the product: k1  → k2 →E + P E+S ES  ← k−1

78

(17)

Deterministic Modeling in Medicine

The formation of the enzyme-reactant complex is reversible but the release of the product from this complex is an irreversible reaction. Now the changes in the concentrations of the components over time are: d [ES ] dt d [S ] dt

=−

d [E ] dt

= k1 * [E ]* [S ]− (k−1 + k2 )* [ES ] ,

d [P ] dt

= k2 * [ES ] ,

= − k1 * [E ]* [S ]+ k−1 * [ES ]

(18)

A rate law for enzymatic reactions, based on this principle but using more complex reaction structures is given by the Michaelis-Menten kinetics (Michaelis and Menten 1913). This and various other enzyme kinetic rate laws are described in Klipp et al. (2005). In particular various forms of interactions: for example, different types of inhibition can be included in these calculation rules.

MODE LING OF AP OPT OSIS Apoptosis, the programmed death of a cell, has different causes. During embryonic development, apoptosis can be initiated from immune system reactions or DNA damage, for example. Apoptosis plays an important role in cancer disease. Abnormal cells divide and grow without control and these cells lose the ability to regulate apoptosis. The (signaling) pathway of apoptosis in general is well known (Hanahan and Weinberg, 2000; MacFarlane and Williams, 2004) and allows us to analyze the characteristics of apoptotic mechanism in mathematical models. There are two principal pathways of apoptosis. The intrinsic (Bcl-2 inhabitable or mitochondrial) pathway of apoptosis is induced by various forms of intercellular stress, developmental cues or external stimuli and the extrinsic or Caspase 8/10 dependent pathway of apoptosis is initiated by the engagement of death receptors. A very detailed description of cancer relevant pathways including the extrinsic and intrinsic apoptosis pathways, with all the important processes is described in Weinberg (2006). To illustrate the possibilities and structures of this kind of modeling in a medical context, two previously published apoptosis models are briefly described in the following sections.

A n E xtrinsic A poptosis Model The first model is published and characterized in Eissing et al. (2004). This model is also used in this chapter to explain and demonstrate graphically the results of mathematical calculations and analysis methods. A part of the extrinsic apoptosis pathway in a caspase activation model for receptor-induced apoptosis is shown. In this model the functionalities of Caspase 8 and Caspase 3 are integrated. Caspases belong to the enzyme family of the proteases. They are very important enzymes in apoptosis and they cleave other proteins. Two different types of caspases exist. Caspase 8 is an initiator (apical) caspase. These caspases are activated to trigger apoptosis and they activate (cleave) inactive pro-caspases of effector caspases. The effector caspases in turn cleave other proteins. This process finally results in cell death. Caspase 8 activates the inactive pro-form of the effector Caspase 3. BAR, a bifunctional apopto-

79

Deterministic Modeling in Medicine

sis regulator, binds itself to activated caspase proteins and plays an important role in the regulation of apoptotic mechanism. When an activated caspase protein binds to the regulator, the caspase protein can not perform its function and does not induce and support the apoptotic process. The Caspase 8 – BAR complex (C8a-BAR) represents this compound. The family of the IAP (inhibitor of apoptosis proteins) has the functionality to inhibit and to avoid cell death. In the considered model the IAP protein binds activated Caspase 3 to an IAP-Caspase 3 complex (C3a-IAP). Activated Caspase 3 creates a positive feedback loop in the activation of Caspase 8, and Caspase 8 in turn, provides a positive feedback in the activation of Caspase 3. Another positive feedback loop of activated Caspase 3 acts upon the degradation of IAP. The activation of Caspase 3 finally results in the controlled cell death. Figure 1 illustrates and displays the components of the model and the reactions.

A n Intrinsic A poptosis Model The rapid kinetics of effector caspase activation in the intrinsic apoptosis pathway and the role of the formation of the apoptosome, the activations of effector Caspases 3, initiator Caspase 9 and the behaviour of XIAP are the main studies of the model published and presented in Rehm et al. (2006). The release of cytochrome c triggers the formation of a multi-protein complex, the aptosome, that also comprises the apoptotic protease-activation factor 1 (Apaf-1) and Procaspase 9. Thus, Procaspase 9 passes into the activated Caspase 9 and activates effector Caspase 3. Positive feedback loops of both the activated Caspase 3 and the activated Caspase 9 in the activation of Caspase 3 and the activation of Caspase 9, are part of the modelled signalling network. The X-linked-inhibitor-of-apoptosis-protein (XIAP), a member

Figure 1. Caspase activation model for receptor-induced apoptosis. The reactions and components of extrinsic apoptosis are graphically shown. Red, dashed arrows indicate a modifier influence and not a mass flow. This model is published and presented in Eissing et al. (2004)

80

Deterministic Modeling in Medicine

of IAP family proteins, acts as an inhibitor of Caspase 3 and Caspase 9. Smac counteracts XIAP and displaces the caspases from their XIAP interaction sides. Bir1-2 and Bir3-RING fragments result from the Caspase 3 dependent cleavage of XIAP. The bindings of Caspase 9 to Bir3-RING and Caspase 3 to Bir1-2 are also part of the model. A special mathematical feature of this model is the Smac release and the cytochrome c initiated apoptosome formation through time and half-time dependent kinetics, which are reflected by the accordingly defined analytic functions. The computational model of this process is based on 53 reactions and the main aim of this model is to verify effector caspase activation and the control of this activation by XIAP. In addition to the results and predictions that are made in the analysis of these models, there is one aspect that we observe in the results of both models. If enough activated caspase 3 is in the system apoptosis is initialized and the cell starts to die. Both models show this switch or breakpoint, the so called point of no return.

A LG ORITHMS

AND MODE L ANA LYSIS METH ODS

T ime-C ourse S imulation Quantitative time-course simulation describes the changes over time in the concentrations of the model components. In addition to the time-course concentration time-course fluxes can also be calculated. Both courses give a good general overview, the time-course concentration indicates the quantitative behavior of the substances in the network, and the reaction rates clarify the flux through the according network system. The calculations can be performed by using appropriate numerical solvers for ODE systems. LSODA (Hindmarch 1983, Petzold 1983) a variant of the LSODE package (Hindmarch 1980) can be used. The algorithm switches automatically between stiff and non-stiff methods and offers a good opportunity for solving systems with different problem definitions. The algorithm is available in different programming languages, in easy to use software packages. For example, SciPy the Scientific Tools for Python (Jones et al. 2001 -) offers an implementation of this algorithm. An alternative choice is Limex (Deuflhard and Nowak 1987), a solver that uses an extrapolation method to solve linearly-implicit differential-algebraic systems (DAEs). An implicit one step method is combined with stepped extrapolation, offering adaptive control of step size and order. This algorithm is written in the programming language Fortran and the source code is available at the CodeLib library of the the Zuse Institute Berlin via the URL http://www.zib.de/Numerik/numsoft/CodeLib/ivpode.en.html. The possibility to transform the source code to another programming language or to embed the source code in another programming language is offered. Several graphical tools provide interfaces for the currently used programming languages and they can easily provide a graphical representation of the simulated time-course output. For example, the powerful graphical tool Gnuplot is freely available at http://www. gnuplot.info/ and runs on commonly used computer platforms. A Gnuplot application interface for the programming language C++ is available at http://www.suiri.tsukuba.ac.jp/~asanuma/gnuplot++/ and a Python package that interfaces with Gnuplot (Gnuplot.py) also exists and is available at http://gnuplotpy.sourceforge.net/. Time-course simulations can also be performed with modeling tools, outlined in this chapter under the sub-title Modeling Tools and Model Repositories.

81

Deterministic Modeling in Medicine

E xample of T ime-C ourse S imulations The apoptosis model published in Eissing et al. (2004) exemplifies this method. Figure 2 shows a graphical representation of the calculated time-course results. The time-course calculations and the graphical output results are generated by the tool PyBioS (Wierling et al. 2007, Klipp et al. 2005), a Web-based modeling and simulation system. The curves represent the changes in concentration for the duration of the model components. The abbreviation C3 refers to Caspase 3, C3a refers to the activated Caspase 3, C8 to Caspase 8 and C8a to Caspase 8 in the activated form. It is quite obvious that there is a switch from the life state to the death state of the cell. Figure 2 illustrates the behavior of the Caspase 3 – IAP - complex. Initially, the inhibitor protein IAP binds the activated Caspase3 and avoids the initialization of the apoptosis process. After some time there is a peak in the curve that indicates the point of no return and subsequently the concentration of this complex doesn’t change with time. When the concentration of the activated Caspase 3 has reached a significant level, the apoptosis inhibitor protein IAP has no chance to stop the apoptotic process.

Parameter S canning Parameter Scanning gives us information about the influence of the kinetic parameters defined in the kinetic rules on systems behavior. Under the assumption that the system reaches a stable steady state we can perform this sensitivity analysis. The system reaches a steady state or stationary state, when the quantitative values like the concentration and the fluxes no longer change with time. This characteristic is equivalent to reaching the root of the ODE system and fulfilled by the balance equation (5):

dSi =0 dt

i=1,... ,n

(19)

In a nonlinear system this equation can have several solutions. An important precondition to make predictions about a systems behavior in the steady state is the stability of the steady state. In this case, stability means that the system stays in this state and each system that starts in a neighborhood arbitrary close to this state, also results in this steady state. A detailed theory about the stability of a steady state is described in Walter (1998) and also in Klipp et al. (2005). Through linearization of the autonomous system, we can perform a linear stability analysis to gain information about the stability of the system. Thus the steady state S 0 = (S10 , , S n0 ) can be called stable if all eigenvalues of the Jacobian matrix of the system of functions in equation (8) are negative at this point. The Jacobian matrix of this function in the state S0 is defined by:

M

82

 ∂f1 (S 0 ) ∂f1 (S 0 ) ∂f1 (S 0 )     ∂S 2 ∂S n   ∂S1   0 0 ∂f 2 (S 0 )  ∂f 2 (S ) ∂f 2 (S )  0  ∂S 2 ∂S n  f (S )=  ∂S1    : : : :   0 0 0 ∂f n (S )  ∂f n (S ) ∂f n (S )    ∂S 2 ∂S n   ∂S1

(20)

Deterministic Modeling in Medicine

Figure 2. Time-course simulation of different components of the apoptosis model in (Eissing et al. 2004). The switch between the life state and the death state of the cell is explicitly visible

The roots of the ODE system (19) can be calculated using the MINPACK subroutine HYBRID1, available at Netlib Library, a collection of mathematical software, papers, and databases. For more details see http://www.netlib.org/. This numerical algorithm is a modification of the method described in Powell (1970). The Jacobian matrix can be determined by the forward difference formulas:

83

Deterministic Modeling in Medicine

∂f j (S 0 ) ∂Si

=

f j (S 0 (i ))− f j (S 0 )

i =1,..,n , j=1,..,n

(21)

with a sufficiently small real value ε > 0. The vector S 0 (i ) in this equation is defined through:  S10    0 S (i ):=  Si0 +     S0  n

       

(22)

We can compute the eigenvalues of the system by using an appropriate routine from the LAPACK package included in the Netlib Library. If the Jacobian matrix (20) of the system is singular, the numerical root finding method cannot find a unique solution and fails. In this case we can determine the steady state of the system with a time-course simulation. We perform time-course simulation until the changes in the values of the concentrations in S (t ) = (S1 (t ), , S n (t )) are under a given threshold and stay under this threshold. For two vectors of the concentration values S1 and S2 this condition can be proved by: || S1 − S 2 ||2 <

(23)

In this equation || . ||2 denotes the Euclidian vector norm and ε is a sufficiently small positive real value. In the case of a stable steady state, a determined kinetic parameter scans a predefined interval and the according values of the regarded components of the model in the steady state are calculated. This enables us to analyze the influence of the scanning kinetic parameter against the behavior of the model. Controlled quantities are in general the concentration of the substances and the values of the reaction rates. Furthermore, we can analyze the sensitivity of the concentration of a model component against a single reaction, and analyze the influence of an enzyme on a reaction rate. In this manner we can apply several analysis approaches.

E xample of a Parameter S can In this paragraph we apply a parameter scan to analyze the behavior of the apoptosis model described in Eissing et al. (2004). The activation of the effector Caspase 3 plays an important role in this extrinsic apoptosis pathway. The parameter k1 controls this activation in the reaction model. The according kinetic reaction is: v1 = k1 *[Caspase8a]*[Caspase3]

(24)

The concentration of activated Caspase 8 serves as a modifier and Caspase 3 serves as a reactant in this reaction. 84

Deterministic Modeling in Medicine

Figure 3 illustrates the surprisingly fast influence of this reaction on the components of the model. A minor amount of the parameter k1 in the range of 10 -5 is enough to start apoptosis. We implemented parameter scanning and the according graphical results with PyBioS. The green horizontal bar at the top of the figures denotes that the found steady states are stable. In the shortcuts of the implemented mode C3 represents Caspase 3, C3a represents the activated form of Caspase 3, abbreviation C8 stands for Caspase 8 and C8a for the activated form of Caspase 8.

Metabolic C ontrol A nalysis Metabolic Control Analysis (MCA) defines a quantitative framework for characterizing the interactions between particular reactions, kinetic constants and values of fluxes and concentrations. The local and global behavior of the network system under the influence of small (infinitesimal) changes is described. Controlled variables could be the rate laws or the concentrations of substances. Controlling parameters can be kinetic constants or the concentration of an enzyme, for example. More detailed comprehensive theories of stationary control states are presented in numerous instances e. g. (Fell 1992; Schuster & Heinrich 1992; Cornish-Bowden 1995). There are two local control coefficients that can always be calculated, because there is no need for a steady state. The local control coefficients are the elasticity coefficients. These coefficients can be v calculated at a certain time point or at a steady-state. The ε-elasticity = S describes the sensitivity of the rate vk of a reaction to the change of the concentration Si. The π-elasticity = vp describes the sensitivity of the rate vk against a small change in a kinetic parameter pl : v

:=

S

Si ∂vk vk ∂Si i=1,..,n; k=1,..,m.

v p

:=

pl ∂vk vk ∂pl l=1,..,r; k=1,..,m.

(25)

Under the assumption that the system reaches a stable steady state we can also calculate global control and response coefficients. The control coefficients show the influence of a small disturbance in the rate of the steady state fluxes or the steady state concentrations. These control coefficients are the flux-control coefficient Ckj for the control of the rate vk over the steady state flux Jj and the concentration-control coefficient Cki that describes the impact of the rate vk on the steady state concentration Si :

C

j

:= k

vk ∂J j J j ∂vk j=1,..,m; k=1,..,m.

C

i k

:=

vk ∂Si Si ∂vk i=1,..,n; k=1,..,m.

(26)

The response coefficients show the resonance of the steady state fluxes and the steady state concentrations against small changes in a certain parameter. These coefficients do not only clarify direct influence of controlled quantities but also show indirect influences. This is useful to understand system coherences which are not obviously visible. Rmj shows the response of the steady-state flux to a small change in the parameter pm and Rmi expresses the response of the steady-state concentration Si to a small modification in the parameter pm:

R

j l

:=

pl ∂J j J j ∂pl j=1,..,m; l=1,..,r.

pl ∂Si i=1,..,n; l=1,..,r. i ∂pl

R := S i l

(27)

85

Deterministic Modeling in Medicine

Figure 3. The influence of Caspase 3 activation is represented in this model by the kinetic constant k1. The graphics illustrate the strong influence of this activation on all components of the model. Above: The described influence on the concentration of Caspase 3, cleaved Caspase 3, IAP and the activated Caspase3-IAP complex. Below: The steady state behavior of the concentration of Caspase 8, activated Caspase 8, BAR and the activated Caspase8-BAR complex, depending on changes in the parameter k1.

86

Deterministic Modeling in Medicine

In the definitions (25), (26) and (27) all coefficients are normalized. For an elaborate derivation and description of the calculation rules for the coefficients see (Hofmeyr 2001). v v The calculation of the non-normalized local coefficients S = Sik and p = pkm can be performed by the forward difference formulas:

( )

vk Si

=

∂vk vk (S (i ))− vk (S ) = ∂Si

vk pm

=

( )

∂vk vk (p (m ))− vk (p ) = ∂pm

(28)

In the equations we use a sufficiently small ε > 0. S (i ) and pε (m) are defined through:

 S1    S (i ) =  Si +     S  n

  p1       p (m ) =  pm +        p r  and 

       

(29)

The decomposition of the stoichiometric matrix N defined in (3) to reduced row echelon form (Strang 1980) by Gauss elimination: N = LNR

(30)

provides the reduced stoichiometric matrix NR with r linear independent rows and the link matrix L. If rank(N) =n (r=n), then L is the identity matrix I and N = NR. The Jacobian matrix M of NR and so the S Jaciobian matrix of the independent components of the system can be determined by M = N R L. We can calculate the none-normalized control coefficients arranged in matrices with: CS = −LM −1N R

CJ =

S

CS + I

(31)

The matrix representation of the response coefficients are determined through R S = CS εp

R J = CJ εp

(32)

We can normalize the coefficients through the multiplication with the according normalization factors. They are included in the equations (25), (26) and (27). In complex model structures it could be helpful to analyze the dependencies and influences of the components of the system with these methods. A necessary precondition is a stable steady state. Calculating these coefficients for a given model is straight forward. First we determine the ε-matrices with the forward differences formulas. Then the other coefficients can be calculated using common matrix operations. The standard linear algebra algorithms are implemented in several software packages and for example available at the Netlib library as components of the LAPACK package. Some modeling tools also provide this analysis method, as described in the section Modeling Tools and Model Repositories.

87

Deterministic Modeling in Medicine

E xample for Metabolic C ontrol A nalysis The following reactions and kinetics demonstrate a simple network example:

v0 : ES ⇒ E + S1 v1 : S1 ⇒ S 2 v2 : S 2 + E ⇒ ES

v0 = k0 * ES k * S1 v1 = 1 k3 + S1

(33)

v2 = k2 * S2

Figure 4 shows colored box plots of the normalized concentration control coefficients and the normalized ε-elasticity coefficients, in matrix form. Even though the example model is very small and consists of only three reactions, the according matrix plots show more than ten values per coefficient matrix. The example demonstrates, that metabolic control analysis describes complex relations according to certain values. The control coefficients box plot describes an indirect negative influence of v0 on the steady state concentration of S2 and the influence of v1 upon the concentration of S1 is significantly less than the influence of v2 on S2.

E xperimental D ata and D rug D evelopment Experimental data is already available for various diseases in different states. Data that includes medical drug treatment also provides information that could be used for modeling. In Lamb et al. (2006) the authors describe the connection between diseases, genetic perturbations and the influence of drugs. In Karaman et al. (2008) we find an interaction map for kinase inhibitors in a quantitative analysis. There are several options for including the knowledge provided from literature and experimental data in according model structures. Because the information about the considered studies is often very specific, the applied methods depend on different conditions and are individual. Here, we describe general possibilities and instructions.

Figure 4. A simple example network illustrates the implementation of metabolic control analysis. This figure illustrates the reaction network, the normalized concentration control coefficients and normalized ε-elasticity coefficients in colored box plots

88

Deterministic Modeling in Medicine

One possibility to include experimental data in a model is to initialize the start values of the according ODE system with corresponding values. These values can be obtained directly from the experimental data or they can be determined by mathematical equations. The corresponding equations result from an existing functional situation in the model. Another possibility for including information from experimental data, is to integrate this knowledge into the kinetic laws. The given information can be used to determine the kinetic parameters directly, or to fit the kinetic data using specifically adapted algorithms. There are also several methods for integrating the influence of drugs in kinetic law formulae. For instance, we can determine the value of a kinetic constant using knowledge about the dose rate and the concrete function of the impact of a drug. A lot of comprehensive, active research already exits in this area.

AVAI LAB LE T OOLS AND DATA Several user-friendly software tools are available. These tools offer the possibility to perform time-course simulations and different analysis methods. An established data exchange format allows for flexible usage, and model repositories provide particular models for different problems. These possibilities allow us to look at the given problem from different perspectives. Many databases are available in this research area. They provide both essential and specialist resources which can be used for modeling.

Modeling T ools and Model R epositories This section introduces the useful tools available for developing and analyzing biological and biomedical models. Systems biology standards and two model repositories are presented. A short overview and the according URLs are listed in Table 1. Mathematica, a mathematical software system, provides a large amount of computational methods and necessary tools for these kind of kinetic modeling, simulation and analysis methods. The software is developed by Wolfram Research. Another mathematical commercial software package that is capable of the computations and representations is Matlab, developed by MathWorks. This software package is often used in scientific research, provides good documentation and is suitable to use for the calculations and graphical representations. For more details about using Mathematica and Matlab in this context see Klipp et al. (2005). COPASI (Hoops et al. 2006) a complex pathway simulator tool is also available as Freeware. This tool is user-friendly and offers the possibility to build models, run simulations and apply various analysis methods. MCA, steady state calculations, linear stability analysis, parameter scanning and parameter estimation using experimental data are the main features of this modeling tool. A graphical representation of the results is easy to follow and can be configured in various ways. The import and export of models in SBML, the Systems biology Markup Language, is also available. The E-Cell System (Tomita et al. 1999, Takahashi et al. 2003) is a software platform that provides modeling, simulations and analysis methods of cell simulations at the molecular level. A graphical userinterface clearly arranges the various functions of the object-oriented tool. Further information about this tool, its functions and underlying theory is available on the E-Cell System Web site. Cell-Designer (Funahashi et al. 2003) is a tool for modeling biochemical networks. The tool provides a diagram editor and also supports time-course simulations and parameter scanning. Systems Biology

89

Deterministic Modeling in Medicine

Table 1. This table lists the Web sites of modeling tools, systems biology standards and model repositories Modeling Tools PyBios

http://pybios.molgen.mpg.de/Pybios

Mathematica

http://www.wolfram.com/

Matlab

http://www.mathworks.com/

Copasi

http://www.copasi.org

E-Cell

http://www.e-cell.org

Cell-Designer

http://www.systems-biology.org/cd/

JDesigner

http://jdesigner.org/

Jarnac

http://www.sys-bio.org/software/jarnac.htm

Systems biology Standards and Workbench SBML, Systems Biology Markup Language

http://sbml.org/

SBGN, Systems Biology Graphical Notation

http://sbgn.org/

SBW, Systems Biology Workbench

http://sbw.sourceforge.net/

Model Repositories BioModels database

http://www.ebi.ac.uk/biomodels/

JWS Online repository

http://jjj.biochem.sun.ac.za/index.html

Markup Language, SBML the standard for representing models of biochemical and gene-regulatory networks is also supported. Parts of the new notation SBGN, Systems Biology Graphical Notation are implemented in the new release CellDesigner 4.0 beta. SBGN is developed as a standard for graphical representations of computational models in systems biology. The Systems Biology Workbench SBW (Hucka et al. 2002) includes several software packages for modeling, analysis and visualization in systems biology. The applications communicate via a simple network protocol. A detailed description of the software package can be found in Sauro et al. (2003). JDesigner is a graphical network designer for biochemical networks and part of the SBW. Simulations can be performed in JDesigner by Jaranc, a tool that offers a simulation service within the SBW. JDesigner and Jarnac are described in more detail in Hucka et al. (2002). PyBioS supports modeling, time-course simulations, various analysis methods and the dynamic population of models by using information provided by databases interfaces to pathway databases. PyBioS is a Web-based environment and provides a model repository. The export and import of models is enabled via an SBML interface. Figure 5 gives an overview of the appearance and functions of PyBioS.

D ata R esources and D atabases A large amount of data resources and various databases are accessible via the Internet. Table 2 comprises the information about some databases which provide information and data that we can use for modeling. Most of the databases are described in Wierling et al.(2007).

90

Deterministic Modeling in Medicine

Figure 5. The Web-based PyBioS simulation environment. The model repository (A) offers models to be selected. The search interface (B) enables the automatic population, with access to several databases. The graphic shows some hits that are actually found. Graphically represented time-course simulations can be found in (C). The result of metabolic control analysis is represented in colored box plots (D) and a network graph (E) visualizes the network structures of the corresponding reactions.

C ONC LUSI ON Within biomedical science, mathematical modeling is becoming more and more important. With the help of several mathematical means, the modeling ability can be extended to encompass biomedical systems and to analyze system behavior and structures in an arbitrarily detailed manner. From single genes to proteins and protein complexes that can act, for instance, as transcription factors the expression of other genes can subsequently be inhibited or activated and with this positive or negative feedback loops can be established. Based on such information of intra- and extracellular biological network structures, we can create models of varying complexity. The deterministic, kinetic modeling introduced here supports the essential and useful possibilities available for understanding and analyzing the functionality of diseases in living systems. The integra-

91

Deterministic Modeling in Medicine

Table 2. Useful databases freely available on the WWW Pathway databases KEGG , the Kyoto Encyclopedia http://www.genome.jp/kegg/ of Genes and Genomes Reactome, a compendium of biological pathways

http://www.reactome.org

HumanCyc, HumanGenes and Metabolism

http://humancyc.org/

Pathway Interaction Database

http://pid.nci.nih.gov/

BioCarta, pathway database

http://www.biocarta.com/

NetPath, signal transduction pathways

http://www.netpath.org/

The Cancer Cell Map

http://cancer.cellmap.org/cellmap/home.do

IntAct, protein interaction data

http://www.ebi.ac.uk/intact/site/index.jsf

MINT, protein interactions

http://mint.bio.uniroma2.it/mint/Welcome.do

HPRD, human protein reference database

http://www.hprd.org

BioGRID, set of physical and genetic interactions

http://www.thebiogrid.org/

Spike, biological signaling networks

http://www.cs.tau.ac.il/~spike/

Genetic Inheritance OMIM, human genes and genetic disorders

http://www.ncbi.nlm.nih.gov/sites/entrez?db=omim

Expression data GEO, Gene Expression Omnibus http://www.ncbi.nlm.nih.gov/projects/geo/ Array Express, micro array data

http://www.ebi.ac.uk/microarray-as/aer/

Kinetic data BRENDA, Enzyme information system

http://www.brenda-enzymes.info/

SABIO-RK, reaction kinetics database

http://sabio.villa-bosch.de/SABIORK/

tion of drug interactions can help us to identify important influences and adverse effects on the according biomedical processes. The presented analysis methods are useful instruments for studying the relationships and interactions between the components in the observed processes. We can also ascertain the influence of individual model components on global model behavior. In this way, we can identify important, previously unrecognized coherences. Furthermore, the cooperation of exact and applied science in the biomedical research area, provided by mathematical modeling will continue to develop new methods for understanding the complex interaction mechanisms of various diseases.

92

Deterministic Modeling in Medicine

A ckn ow ledgment The author thanks Christoph Wierling and Hendrik Hache for proof-reading of this chapter and their constructive feedback and Andriani Daskalaki for her good ideas and assistance. The author address special thanks to Jane Conway for her excellent proof-reading. This work was supported by the EU grants AnEUploidy and EMI-CD within the Framework 6 funding, and the Max Planck Society.

R eferences Brown, A. J. (1902). Enzyme action. Chem. Soc., 81, 373-386. Cornish-Bowden, A. (1995). Metabolic control analysis in theory and practice. Adv. Mol. Cell Biol., 11, 21-64. Cui, Q., Ma, Y., Jaramillo, M., Bari, H., Awan, A., Yang, S., et al. (2007). A map of human cancer signalling. Molecular Systems Biology, 3, 152. Deuflhard, P., & Nowak, U. (1987). Extrapolation integrators for quasilinear implicit ODE’s. In P.Deuflhard, B. Engquist (eds.) Large Scale Scientific Computing. Series ‘Progress in Scientific Computing’, Birkhäuser, 37-50. Eissing, T., Conzelmann, H., Gilles, E. D., Allgöwer, F., Bullinger, E., & Scheurich, P. (2004). Bistability analyses of a caspase activation model for receptor-induced apoptosis. J. Biol. Chem., 279, 3689236897. Fell, D. A. (1992). Metabolic control analysis: A survey of its theoretical and experimental development. Biochem. J., 286, 313-330. Funahashi, A., Morohashi, M., Kitano, H., & Tanimura, N. (2003). CellDesigner: A process diagram editor for genregulatory and biochemical networks. BIOSILICIO, 1, 159-162. Futreal, P. A., Coin, L., Marshall, M., Down, T., Hubbard, T., Wooster, R. et al. (2004). A census of human cancer genes. Nature Reviews Cancer, 4, 177-183. Gibson, M. A., & Bruck, J. (2000). Efficient exact stochastic simulation of chemical systems with many species and many channels. J. Phys. Chem., 104, 1876-1889. Gillespie, D. T. (1977). Exact stochastic simulation of coupled chemical reactions. J. Phys. Chem, 81, 2340-2361. Guldberg, C. M., & Waage, P. (1879). Concerning chemical affinity. Erdmann’s Journal für Practische Chemie, 127, 69-114. Hanahan, D., & Weinberg, R. A. (2000). The hallmarks of cancer. Cell, 100, 57-70. Hindmarch, A. C. (1980). LSODE and LSODI, two new initial value ordinary differential equation solvers. ACM-SIGNUM Newsletter, 15, 10-11.

93

Deterministic Modeling in Medicine

Hindmarch, A. C. (1983). Odepack, a systematized collection of ode solvers. In R. Stepleman et al. (eds.), IMACS Transactions on Scientific Computation, 1, 55-64. Hofmeyr, J. H. S. (2001). Metabolic control analysis in a nutshell. In Yi, T. M., Hucka, M., Morohashi, M., Kitano, H. (eds.), Proceedings of the 2nd International Conference on Systems Biology, (pp. 291300). Madison, WI: Omnipress. Hoops, S., Sahle, S., Gauges, R., Lee, C., Pahle, J., Simus, N., et al. (2006). COPASI – a COmplex PAthway SImulator. Bioinformatics, 22, 3067-3074. Hucka, M., Finney, A., Sauro, H. M., Bolouri, H., Doyle, J., & Kintano, H. (2002). The ERATO systems biology workbench: Enabling interaction and exchange between software tools for computational biology. Procedings of the Pacific Symposium on Biocomputing, 7, 450-461. Jones, E., Oliphant, T., Peterson, P., & others. (2001). SciPy: Open source scientific tools for Python. http://www.scipy.org Karaman, M. W., Herrgard, S., Treiber, D. K., Gallant, P., Atteridge, C. E., Campbell, B. T., et al. (2008). A quantitative analysis of kinase inhibitor selectivity. Nature Biotechnology, 26, 127-132. Kaufmann, S. A. (1993). The origins of order: Self-organization and selection in evolution. New York: Oxford University Press. Klipp, E., Herwig, R., Kowald, A., Wierling, C., & Lehrach, H. (2005). Systems biology in practice: Concepts, implementation and application. WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim. Lamb, J., Crawford, E. D., Peck, D., Modell, J. W., Blat, I. C., Wrobel, M. J., et al. (2006). The connectivity map: Using gene-expression signatures to connect small molecules, genes and disease. Science 313, 1929-1935. Le Novére N., Bornstein, B., Broicher, A., Courtot, M., Donizelli, M., Dharuri, H. et al. (2006). BioModels database: A free, centralized database of curated, published, quantitative kinetic models of biochemical and cellular systems. Nucleic Acids Research, 34, 689-691. MacFarlane, M., & Williams, A. C. (2004). Apoptosis and disease: A life or death decision. EMBO Rep, 5, 674-678. Michaelis, L., & Menten, M. L. (1913). Kinetic der Invertinwirkung. Biochem. Z., 49, 333-369. Petzold, L. (1983). Automatic selection of methods for solving stiff and nonstiff systems of ordinary differential equations. Siam J. Sci. Stat. Comput., 4, 136-148. Powell, M. J. D. (1970). A hybrid method for nonlinear equations. In P. Rabinowitz. Gorden & Breach, (eds.), Numerical methods for nonlinear algebraic equations (pp. 84-114). Rehm, M., Huber, H. J. , Dussmann, H., Prehn, J. H. M. (2006). Systems analysis of effector caspase activation and its control by X-linked inhibitor of apoptosis protein. The EMBO Journal, 25, 4338–4349. Sauro, H. M., Hucka, M., Finney, A., Wellhock, C., Bolouri, H., Doyle, J., et al. (2003). Next generation simulation tools: The systems biology workbench and bioSPICE integration. Omics, 7, 355-372.

94

Deterministic Modeling in Medicine

Schuster, S., & Heinrich, R. (1992). The definitions of metabolic control analysis revisited. BioSystems, 27, 1-15. Strang, G. (1980). Linear algebra and its applications, 2nd Edition. New York: Academic Press. Takahashi, K., Ishikawa, N., Sadamoto, Y., Sasamoto, H., Otha, S., Shiozawa, A., et al. (2003). E-Cell 2: Multi-platform E-Cell simulation system. Bioinformatics, 19, 1727-1729. Tomita, M., Hashimoto, K., Takahashi, K., Shimizu, T. S., Matsuzaki, Y., Miyoshi F., et al. (1999). E-CELL: Software environment for whole-cell simulations. Bioinformatics, 15, 72-84. Walter, W. (1998). Ordinary Differential Equations. New York: Springer Verlag. Weinberg, R. A. (1994). Oncogenes and tumor suppressor genes. CA: A Cancer Journal for Clinicians, 44, 160-170. Weinberg, R. A. (2006). The biology of cancer. Garland Science, Taylor & Francis Group, LLC. Wierling, C., Herwig, R., & Lehrrach, H. (2007). Resources, standards and tools for systems biology. Briefings in functional genomics and proteosomics, 6, 240-251.

K ey T erms Bcl2: Is the prototype for a protein family of mammalian genes and the proteins coded by these genes. The name is derived from B-cell lymphoma 2. C++: The programming language C++ was developed in 1979 by Bjane Stroustrup. It supports object-oriented programming and is an enhancement to the programming language C. DAE: A differential-algebraic equation (DAE) is a special kind of differential equation and expressed by means of differential algebra. This equation does not necessarily include all dependent variables, and their derivates must not be expressed explicitly. Deterministic: An algorithm is called deterministic when the same results are always obtained under identical conditions. In this respect, deterministic mathematical modeling describes systems without any random possibility function. Identical starting conditions always provide the same output. Eigenvalues: In linear algebra the equation Av = v defines the eigenvalues λ and the corresponding eigenvectors v of a linear transformation represented by a quadratic matrix A. λ is a complex value and v is a complex valued vector. The eigenvalues describe essential characteristics of the linear map. Enzyme: Protein molecules that catalyze chemical reactions. They play an important role in most metabolic processes and are responsible for activation and control of biochemical reactions in living systems. Euclidean Norm: The Euclidean space denotes an n-dimensional space that can be characterized through Euclidean geometry. An n-dimensional vector describes a point in this space. The Euclidean norm defines the length of a vector and the distance function between two vectors is called an Euclidean metric.

95

Deterministic Modeling in Medicine

Experimental Data: Gene expression profiles derived from micro array based experiments with different study foci, i.e. prostate cancer, compound testing or diabetes. Fortran: The name of a programming language derived from FORmula TRANSlation. Fortran was developed in the 1950s and was especially used for numerical programming. The programming language directly supports numerical operations and because of this, optimized compiler calculations can be performed. Up to now, various numerical programming libraries are available and used in mathematical, physical and chemical science. Kinetics: In this chapter the term kinetic is used in a chemical sense and describes the principles of reaction velocities. Linearization: In mathematics, linearization describes the linear approximation of a function at a given point. Object-Oriented: Object-oriented programming uses abstract objects and their interactions to describe the contents and the functionalities of the program, according to its design. ODE: An ordinary differential equation is an equation that contains a function and the derivates of this function. It differs from partial differential equations in that, in an ordinary differential equation, the included function depends on only one variable. Protein Complex: A group of two or more chemically bound proteins formed by stable proteinprotein interactions. Python: The high-level programming script language Python supports functional, object-oriented and imperative programming paradigms. Stoichiometry: The quantitative relationship between the reactant and the product in a chemical reaction is described by the stoichiometry. It can be used to calculate the quantitative amount of the product or the educt of a reaction, where one of both measurable quantities is known. Topology: The topology defines the properties of spaces and maps. Dependent on the described space arbitrary complex structures used.

96

97

Chapter V

Synthetic Biology as a Proof of Systems Biology Andrew Kuznetsov Freiburg University, Germany

abstract Biologists have used a reductionist approach to investigate the essence of life. In the last years, scientific disciplines have merged with the aim of studying life on a global scale in terms of molecules and their interactions. Based on high-throughput measurements, Systems Biology adopts mathematical modeling and computational simulation to reconstruct natural biological systems. Synthetic Biology seeks to engineer artificial biological systems starting from standard molecular compounds coding in DNA. Can Systems and Synthetic Biology be combined with the idea of creating a new science—‘SYS Biology’ that will not demarcate natural and artificial realities? What will this approach bring to medicine?

“We live in a society exquisitely dependent on science and technology, in which hardly anyone knows anything about science and technology.” - Carl Sagan

Intr od ucti on Sometimes, we are like the three blind Indian philosophers who tried to guess what kind of animal the elephant was by touching various parts of it. One blind man while touching the side of elephant announced the animal was like a wall. The second philosopher hugged its leg and declared that the animal was like a tree and the third blind man, while holding on to its tail said the animal was a snake. All three were correct, but all three had a distorted perspective of an elephant. This allegory captures a weakness of the analytical reductionist approach to biological science and illustrates a paradigm that the whole is greater Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Synthetic Biology as a Proof of Systems Biology

than the sum of its parts. A system, holistic approach to Biology means the synthesis of knowledge from various sources and by different methods of data extraction. This approach starts with data collection and modeling to understand how components of the system interact, continues with experimentation and then returns to modeling to refine our understanding of interactions and to identify new questions to be addressed. This system of thinking emphasizes relationships rather than isolated entities. The idea of a system-level understanding of Biology is not new. In 1943, Erwin Schrödinger published the book ‘What is Life’, a seminal work on scientific thought that examined the relationship between the laws of Physics and the mechanisms of life. In particular, it provoked the development of Molecular Biology and led to the research we know as Systems Biology. Norbert Wiener (1948) and Ludwig von Bertalanffy (1969) described a systems approach to living organisms i.e. the holistic view that ‘mysterious’ properties of life arise at the system level from dynamical interactions and diversity of system components. Breakthroughs in Molecular Biology during the last decades have enabled an analysis of dynamical interactions inside living cells and between them. Systems Biology appeared as a result of the Human Genome Project as well as from a growing understanding of how genes and their proteins give rise to biological forms and functions. Recent studies have involved high-throughput experiments in Genomics, Transcriptomics, Proteomics and Metabolomics. These ‘-omics’ should be fused together to reach an understanding of Biology at a top system-level (Kitano, 2002a). The new field has attracted biologists, engineers, mathematicians, physicists and chemists who are tackling complex biological problems. The Internet allows researchers to distribute massive amounts of data. In particular, the theory of dynamical systems, agent-based approach and systems engineering methods provide the opportunity to study the collective behavior of biological entities. The challenge is to connect genetic circuits with physiological behavior. Following Systems Biology, the goal of Synthetic Biology is both to improve our quantitative understanding of natural phenomenon and to establish an engineering discipline to design artificial biological systems. It will strongly depend on what possibilities there will be in the multi-scale modeling of whole organisms. Biological models often have numerous unknown parameters such as kinetic constants, decay rates and drift terms. A big problem for Systems/Synthetic Biology (‘SYS Biology’ for short) is that these parameters are often very difficult to measure. However, Systems Biology researchers believe that methods of dynamic analysis, modeling and simulation can provide a deeper understanding of life (Kitano, 2002b). Synthetic Biology, with the goal of synthesizing life from scratch, gives us other modern hype-and-hope, namely the ‘understanding by building’. Regarding complex dynamical systems, Richard Feynman wrote: “What I cannot create I do not understand.” By creating artificial life, we are beginning to answer Schrödinger’s question: “What is Life?” This will give us new opportunities to distinguish the health and pathology for treating for example, schizophrenia, cancer and diabetes.

Co nnecti on between

gen otype and phen otype

A current front of ‘-omics’ research has moved from metabolic pathway analysis to the reconstruction of regulatory networks, identification of protein/DNA, protein/RNA and protein/protein interactions, simulations of signal transduction reactions, validation of experimental data available from highthroughput measurements and to studies on the correlation between gene expressions and phenotype. The relation between genotype and phenotype is a central question. Do selective forces which act on the phenotype affect individual genes? Or, is there an epigenetic influence arising from the complex interac-

98

Synthetic Biology as a Proof of Systems Biology

tion between many gene products? (Wagner, 1996) The latest finding demonstrated that the metabolic pathway assignment is useful in verifying genomic annotations. But, there are many gaps in genetic and epigenetic events, e.g. the effects of posttranscriptional and posttranslational regulation. What is missing is a relation between high-level functional states and genetic networks. The global organization and its effects are mostly ignored. Life has been a great secret so far! How can an adapting and developing dynamics emerge from information hidden in the genome? Still in the case of very simple circuits that are carefully designed, the phenotype can often not be predicted. Goldstein (1999) defined emergence as “the arising of novel and coherent structures, patterns and properties during the process of self-organization in complex systems.” An emergent structure is more than a sum of its parts because the interactions between these parts play a significant role. Life is an example of emergent properties by combinations of individual atoms that form molecules such as DNA, RNA, proteins, carbohydrates and lipids, which in turn create organelles, cells, tissues, organs, organisms and communities. An understanding of such emergent events requires system-level perspectives. In fact, a transition from molecules to physiology occurred in Biology and it is generally believed that multi-scale and nonlinear feedback mechanisms can be understood through mathematical and computational models. A problem is that the theory of dynamical systems used in Physics and Chemistry might be not enough for biological entities. Living cells are super complex agents containing a vast amount of information that cannot be reduced to simple rules or sophisticated mathematical functions.

D at a acq uisiti on and system- le ve l underst anding Because biological systems are not just an assembly of genes and proteins, their properties cannot be fully understood by drawing a plain connection graph. Modeling results contain many false outputs that need to be verified by wet lab experiments. Historically, Biology has dealt with vast experimental data as well as spatial and temporal phenomena that are more complex than in other natural sciences. These large data sets often bring more confusion than understanding— “… our ability to generate data now outstrips our ability to analyze it” (Patterson, 2003). On the other hand, Proteomics is substrate limited and currently available experimental data on gene expression are usually not sufficient to reconstruct the structure of pathways and regulatory networks. Furthermore, the system approach is based on information in public databases that are often incomplete, not standardized and properly annotated and the quality of the data is often uncertain. A Systems Biology community needs information standards. Systems Biology Markup Language (SBML) is an XML-based language for representing models of biochemical reaction networks which has evolved since 2000. Today, SBML is supported by over 100 software packages, such as Cell Designer, Systems Biology Workbench (SBW), including JDesigner/Jarnac and SBML toolbox for MATLAB users (Keating et al, 2006). SBML website provides information and the tools needed to understand Systems Biology (http://sbml.org/index.psp). One of difficult problems that scientists deal with is how to transform a natural phenomenon into a set of equations. It is usually impossible to describe a phenomenon totally, so one looks for a set of equations which describes the system approximately. In general, after we have built a set of equations, we compare the data generated by equations with real data collected by measurement. If the two sets of data ‘close’, then the equations will result in a good description of the real-world system. If not, then the underlying equations have to be modified. The set of equations is called a model for the system. The problem of stating clear assumptions and describing parameters and variables on which the model will

99

Synthetic Biology as a Proof of Systems Biology

be based is not a trivial task. One could build a so-called white box model based on first principles, but in many cases such models would be complex and it would be impossible to obtain the nature of biological systems. A more common approach is therefore to start from measurements of the behavior of system and then to determine a mathematical model of data without going into details. This approach is called system identification. There are two types of models: the grey box model and the black box model. In the grey box model, the structure is typically chosen by the user. The model contains unknown parameters which can be estimated using algorithms of system identification to agree with experimental data. In the black box model, no prior model is available. Most system identification algorithms are of this type. The idea is to fit linear and nonlinear models to data. This data-driven approach helps to describe systems with a complex dynamics and structural uncertainty that are not easily modeled from first principles. A complexity of models is associated with the number of parameters in the model and the polynomials of higher degrees. Modern computers often appear to have an infinite capacity for calculation. However, to solve certain simple problems computing devices show their limits. Natural biological systems are a product of more than 3500 million years of evolution and molecular computation; they are not optimized to be modeled easily. Furthermore, several genome projects have shown that most genes have not yet been characterized, especially in multicellular organisms. Hopefully, network structures of a large set of gene interactions and biochemical pathways are well known and a behavior of those systems can be understood through metabolic, sensitivity and dynamic analysis methods including the phase portrait and bifurcation analysis.

Itera ti ve refinement : management bi ologica l kn ow ledge

of kn own and unkn own

Because SYS Biology—reverse and direct engineering of genetic networks—is extremely complex; the most reasonable way to study and manage this complexity is the iterative refinement which combines experimental and computational methods. A source of knowledge for Systems Biology is the high-throughput experimental methods such as microarray and mass spectrometry. An extraction of patterns and correlations from the vast measurements and large databases is difficult e.g. techniques to test multiple hypotheses include the cluster analysis, data mining and machine learning (Kell, 2005; Bosl, 2007). There are several approaches to the reverse engineering of genetic regulatory networks from gene expression data. The traditional one is a mathematical description of the biochemical processes in terms of differential equations however, it is restricted by small systems. The other one is cluster analysis from the theory of experiment. Although, clustering provides a simple way to extract qualitative information about genes co-expression from large data sets, it does not lead to a distinction between individual genes. A compromise between these two extremes is Bayesian networks. The Bayesian learning paradigm is suitable for representing conditional relations between multiple interacting quantities; their probabilistic nature is capable of handling a noise inherent in biological processes and microarray experiments. However, an inference problem is hard if the interactions between hundreds of genes learned from small data sets. Quantitative studies of complex biological networks are not easy to perceive (Friedman et al, 2000; Husmeier, 2003; Bansal et al, 2007).

100

Synthetic Biology as a Proof of Systems Biology

Modeling via D ifferential E quations In some cases, interactions among system components can be described by classical ordinary differential equations (ODE). When spatial effects (e.g. diffusion) play a significant role in a system, partial differential equations (PDE) can be applied. This approach has been used to explain the existence of morphogens by Alan Turing (1952). Both ODE and PDE models are deterministic, i.e. given the same initial conditions for each model, repeated simulations will produce the same results. Both models can be analyzed by parametric sensitivity analysis and bifurcation analysis. Parametric sensitivity analysis can be carried out to characterize quantitative changes of model dynamics in response to perturbations of model parameters (Varma et al, 1999). Bifurcation analysis is used to determine how qualitative properties of a system depend on its parameters, in particular, to find the steady-state solutions of a system and their stability (Guckenheimer, Holmes, 2002). The differential equations may be not adequate if the number of molecules is low because there will be fluctuations in the cellular processes. When molecular noise affects a cellular function, it has to be captured by mathematical analysis. This can be carried out by chemical master equations (CME). CME model can be solved by using the Gillespie’s fist reaction method (Gillespie, 1976). This algorithm chooses the fastest individual reaction and then transitions to the next state. Gibson modified Gillespie’s method to execute only the logarithm of a number of reactions by simulation (Gibson, Bruck, 2000). “One can now use a Gibson-modified Gillespie algorithm to execute 1010 reaction events per day on 800-MHz Pentium III Processor.” A hypothetical simulation of E. coli will need 1014-1016 reaction events per cell and seems quite tractable (Endy, Brent, 2001). Similar to the spatial extension of ODE to PDE, the same spatial effects can be included into stochastic models. Examples of deterministic/stochastic and non-spatial/spatial simulators given by Lok and Brent (2005) are summarized in Table 1.

D ata-D riven Modeling A pproaches Data-driven modeling approaches such as clustering (data organization), principal components (data compression) and partial least squares (data prediction) help users to analyze large amounts of data by specific data representation. Because cellular events are dynamic, time courses are the most typical. However, time-course plots are limiting for applications that track many variables together. An alternative view of the same data is to consider each variable on its own axis as a dimension. In this case, the state of a system will be described as a vector. In addition, it is possible to identify a small number of more important dimensions by reorganizing the data space. The goal of data-driven modeling is to extract the more informative dimensions from a whole data space. The aim of clustering is to define a distance between either the vectors themselves (Euclidean distance) or the parameters that are derived from the vectors (Pearson distance) in a way that reveals potential biological sense. Principal components analysis reduces the dimensionality by finding new axes, called principal components, as a result of the linear combination of axes that are the most tightly connected with one another. This method allows the user to view the data in 3D or 2D space and record the most important biological information. Partial least squares analysis allows user to pose hypotheses and predictions. Rather than performing the regression in the original data space, this approach reduces the dimension to a principal component space and finds the regression between independent and dependent principal components (Janes, Yaffe, 2006).

101

Synthetic Biology as a Proof of Systems Biology

Table 1. Molecular dynamics and simulation of biochemical networks Deterministic

Stochastic

Non-spatial

ODE Gepasi1

Gillespie’s first reaction algorithm Stochastirator3

Spatial

PDE Virtual Cell2 • exact • approximate • hybrid approach special-purpose hardware – Field Programmable Gate Arrays (FPGAs)

reaction events occur during collision MCell4 ray-tracing algorithms ChemCell5 Moleculizer6 for protein complexes; the program automatically generates the network of reactions BioNetGen7 signaling pathways

- http://www.gepasi.org/ - http://www.nrcam.uchc.edu/login/login.html 3 - http://opnsrcbio.molsci.org/stochastirator/stoch-main.html 4 - http://www.mcell.cnl.salk.edu/ 5 - http://www.cs.sandia.gov/~sjplimp/cell.html 6 - http://www.molsci.org/~lok/moleculizer/ 7 - http://cellsignaling.lanl.gov/bionetgen 1 2

A gent-B ased A pproach: D ata Mining and S imulation in a S ingle Platform According to science, the world is a stratified structure with many levels. Entities on each level interact with other entities at the same level and generate new selective qualities for a next higher level. Because these adaptive interactions are too complex to be captured by analytical methods, computer simulation is used. The basic idea of such simulation is to specify the rules of behavior of individual entities as well as the rules of their interactions. Simulated entities are called agents, the simulation of their behavior is known as agent-based simulation. Properties of individual agents describing their behavior and interactions are specified as elementary properties, and properties emerging on the higher, collective level are defined as emergent properties. In this respect, an agent is like a computing system with a well defined interface capable of adaptive problem-solving actions without user intervention. Agent-oriented engineering has much in common with object-oriented programming and was used to develop software for assistants for bioinformaticians and as problem solvers for biologists. Agents have been exploited in Systems Biology for the management of primary databases, genome analysis and annotation, for identification of spots on a microarray and 2D gels, in mass spectrometry and in biological systems simulation such as the molecular self-organization (Troisi et al, 2005), bacterial chemotaxis (Emonet et al, 2005) and T-cell recognition (Casal et al, 2005). An agent paradigm of distributed computing can be considered as a generalization of cellular automata; each agent acts like a finite state machine. Agent-to-agent interactions and messages passing between agents are essential for collective behavior. The agent-based simulation increases the biological intuition and is more suitable than other modeling methods because the ‘cell as agent’ is a natural metaphor for biologists. “A biological process can be described by a graphical semi-formal model, validated by a formal model, simulated by a multi-agent system and finally tested with experimental results” (Merelli et al, 2007).

102

Synthetic Biology as a Proof of Systems Biology

S ynthetic B iology

B iology is an engineering

appr oach t o S ystems

The term Synthetic Biology was originally used to describe efforts merging different disciplines in order to reach a holistic understanding of life. This term also has been applied to the combination of science and technology in their attempt to design novel biological functions. In 1978, Waclaw Szybalski wrote that “The work on restriction nucleases … has led us into the new era of synthetic biology.” Along this line, a straightforward tactic to test our understanding of a natural system is to make a version of the system; the similarity between observation and expectation is the highlight of a ‘constructive paradigm’. The potential of gene synthesis was demonstrated in 1964 by the team of Gobind Korana as a part of their work on the elucidation of genetic code. Synthetic Biology means an expansion of biotechnology to an engineering formalism, with “the ultimate goal of designing and building engineered biological systems that process information, manipulate chemicals, fabricate materials and structures, produce energy, provide food, maintain and enhance human health and our environment.” An important aspect of Synthetic Biology, which distinguishes it from conventional genetic engineering, is a strong emphasis on foundational technologies that make the engineering of Biology easier and more reliable (Endy, 2005). Such examples are the common systems engineering doctrines, which has been accepted by biologists, including step-by-step modeling and experimentation trials, sharing models, but not raw data, and microarray-based DNA synthesis (Tian et al, 2004; Stähler et al, 2006). Synthetic Biology has two branches. The first one, ‘reconstruction of life’, is a dissection of biological systems into minimal modules. This approach includes experiments to obtain information on isolated parts, the simulation of systems from these parts and future experimental verification. The second one is the ‘construction of life’. In this case, the goal is to build systems inspired by biological knowledge. The general idea here is to combine modular, robust and reusable artificial components to reach even more interesting properties about life that are yet unknown. Because natural biological systems are extremely complex, it makes sense to ‘rewrite’ them according to our view and deal with the artificial systems. This notion draws its inspiration from refactoring, a process used to improve the computer software. DNA synthesis, as expected, will replace a traditional recombinant technology and will allow ‘DNA programming’, for instance, the large-scale genome synthesis, change of codons to improve gene expression, and the incorporation of novel amino acids into polypeptides. The construction of synthetic metabolic pathways would prevent a complexity of life created by evolution. Through the synthesis, we could escape ‘cross talks’ and reduce the entanglement of signaling pathways. More remarkable is that Synthetic Biology has naturally accepted the agent and amorphous computing paradigms (Abelson et al, 2000). “It is a way of thinking about existing biological machines and of constructing new ones” (Baker et al, 2006). The latest success in the modification of cellular processes and improvements in DNA synthesis technology led to the recognition of living cells as a ‘programmable matter’. Through genetic engineering and principles of abstraction, composition and specification, it is now possible to program bacterial cells with sensors, logics and actuators like computers or robots (Voigt, 2006). Information propagates in cells through synthetic transcriptional cascades. The artificial cell-to-cell communication was programmed to reach a coordinated bacterial behavior and pattern formation that allowed observing how global behavior emerges from local interactions between cells. There are attempts to exploit synthetic gene networks representing analog and digital logic circuitry

103

Synthetic Biology as a Proof of Systems Biology

that regulate gene expression, differentiation and cell communication in higher organisms (Andrianantoandro et al, 2006).

S ynthetic bi ologist’s genetic circ uits

t oolkit : the plug-and-p lay design

of

A design of de novo genetic circuits starts by the identification of suitable genetic elements (building blocks) including promoter regions, ribosome binding sites, structural genes, attenuators of transcription and so on. There are active efforts to collect genetic elements as Biobricks—pieces of DNA flanked by idempotent restriction sites. A registry of Standard Biological Parts (http://parts.mit.edu/) includes the catalog of standard DNA components that can be distributed and shared among students. One idea behind the registry is that these genetic parts can be recombined to produce many types of devices in an abstract hierarchical manner. At the next level, devices with a matching interface can be assembled into more complex systems. This aim could be achieved by the idempotent vector that recreates exactly the same restriction site and contains DNA parts with the desired functions. The strategy includes genetic transformation by the designed genetic construct and observation of the actual result compared with the desired output. Well characterized Biobricks will not only serve as building blocks but will provide kinetic parameters for simulation. In the future, as DNA synthesis becomes less expensive, the registry will be replaced by specifications of in silico building blocks—‘LEGO set of life’ for the computer added design (CAD). Many kinds of circuits like transcriptional cascades with feedback and feedforward motifs may be constructed by combinations of existing genetic parts. These networks, for example, can serve as memory elements, perform digital computation, send and receive chemical signals, attenuate gene expression noise, or generate oscillations and single pulses (Guido et al, 2006; Heinemann, Panke, 2006). However, many questions remain (Drubin et al, 2007). How would higher levels of complexity for synthetic biological systems be designed? What kind of standards do we need? Who will contribute subsystems? Modern cloning technique was not restricted by the MIT Biobricks assembly method (Knight, 2003). Typically, PCR with extended primers keeps any flanking restriction site for the cloning DNA which can be inserted into a desirable vector. There are many other cloning strategies each with advantages and disadvantages e.g. the NOMAD technology (Rebatchouk et al, 1996), Gateway recombination cloning system (Brasch et al, 2004), and Topo cloning (Invitrogen). Many commercial firms like Invitrogen and Stratagene have advanced their own schemes for cloning including equipments and competent cells for easy transformation. A real problem for cloning techniques is the small capacity of cloning vectors which is about 10-12 kb for E. coli system. Using an artificial chromosome may be necessary in order to exceed this limit. In addition to Biobricks registry, there is significant interest in filling the databases for aptamers and protein domains. Perhaps Synthetic Biology will not be restricted by one catalogue of known biological parts but will include the tools needed to supplement custom-made parts and to utilize natural sequences from NCBI (http://www.ncbi.nlm.nih.gov/). When a circuit is built, it can be evaluated by quantitative analyses including assays for the reporter gene expression, cell growth, light microscopy, flow cytometry and microfluidics. Single cell measurement has been used to study binding constants, degradation rates, noises in gene expression and variations of chemotaxis activity. Such observations help to explain how a biological system acts and provide the basis for modeling. Differences between predicted and measured behavior can give details why a

104

Synthetic Biology as a Proof of Systems Biology

synthetic system does not work as anticipated. In some cases, engineered cells have to be characterized under specific conditions for a long time scale. Such tasks will benefit from microfluidics focusing on miniaturization of cell environment in order to make possible the single cell assessment. Technologies that allow the study of cells in microfabricated devices and perform parallel ‘postgenomic’ data collection will be especially useful in Synthetic Biology. Standardization of measurements will ultimately enable CAD applications (Marguet et al, 2007).

Evolu ti on as a techn ology f or S ynthetic life’

B iology : an ‘ersa tz

A manufacture of biological parts and devices can be achieved through either rational design or laboratory evolution. Usually preliminary design includes the modeling, testing, and modification of basic circuit components such as promoters and ribosomal binding sites. The rational design requires prior information about the parts, which is sometimes unavailable. Opposite of the laboratory evolution is the method of debugging synthetic biological systems (Yokobayashi et al, 2002). The process launches with the generation of a huge library of diverse DNA molecules by error-prone PCR and DNA shuffling or combinatorial synthesis. The library is then subjected to a selection that provides a connection between genotype and phenotype in order to reach the preferred function. Laboratory evolution requires highthroughput measurements covering a large search space. It should be mentioned that the fitness function is not evident in many applications and the selection pressure can be applied only in simple cases as for antibiotic resistance. An evolution of complex behavior may not be straightforward. It is not clear at the moment how such laboratory evolution can easily be tailored to screen for a content dependent design of complex genetic networks. There are questions that should be addressed about the evolutionary stability of artificial networks. Both methods could be considered as different modes to optimization and should be used in combination; an example of the ‘intermediate’ method is the modular recombination or compositional evolution (Hiraga, Arnold, 2003). The next step in Synthetic Biology research would be a ‘computational evolution’ where a set of parts can evolve in silico into networks that demonstrate desired behaviors. Whether such molecular evolution is tractable for digital computers is an open question. As an alternative, the cellular computation could be designed to take advantage of the vast parallelism of cell agents. In the context of cellular computing, a heterogeneous population of cells is able to investigate a very large search space (Kuznetsov et al, 2006; Tan et al, 2007). Basically, Systems Biology might contribute in producing artificial cells demonstrating behaviors which we associate with life (Barrett et al, 2006). In modern terms, DNA can be considered as software and the rest of the cell as hardware. Technically, it will soon be possible to synthesize a whole bacterial genome de novo and introduce it into a ‘lipid sack’ to generate a protocell. This life-like biological agent will encapsulate macromolecules, capture energy, maintain ion gradients and divide (Forster, Church, 2007). However, the modern approach to artificial life is more pragmatic with the intention of cleaning genomes. Recent achievements in Comparative Genomics have revealed the essential genes that maintain the replication, transcription, translation, reparation, protein processing and metabolism. It is possible to cut out mobile elements and unknown genes with insufficient functions to make the genome easier to customize. Progress has been made towards the identification of non-essential genes in the genome of Escherichia coli. Kang et al (2004) removed by knockout redundant genes to be close

105

Synthetic Biology as a Proof of Systems Biology

to a core genome. It was observed that E. coli strains with a reduced genome were genetically more stable, increased protein synthesis and even improved electroporation efficiency. A resulting bacterium with the minimal genome may serve as a vessel for synthetic genetic networks. Mesoplasma florum L1 with very attractive cultivation properties has the genome size of 793 kb comprising only 517 genes. The genomic sequence has become available and molecular biology methods are developed. A similar approach is being followed with Mycoplasma genitalium G-37 (580 kb, 482 genes), for which comprehensive data are available (Glass et al, 2006). These findings show that a redesign of an entire synthetic microorganism is not far off in the future.

Minima l synthetic

organism

as therape

utic nan ob ot

Artificial bacterial robots are expected to appear in the coming years. “Applied to medicine, nanorobots would be programmed for specific biological task and injected into the blood … to work at the cellular level … attacking cancer cells” (Patel et al, 2006). To effectively fight cancer, therapeutic nanobots should recognize malignant cells and destroy them. Anticancer agents should avoid immunological surveillance; demonstrate decentralized and distributed swarm intelligence and emergent cooperative behavior. It means that they will have to obtain sensors, computational resources to make decisions and actuators to act on target tumor cells. Nearly 150 years ago, live bacteria were used in the treatment of cancer. Today there is revived interest in using bacteria as anti-tumor agents. Bifidobacterium, Clostridium and Salmonella have been shown to preferentially reproduce within solid tumors and have been used to transport DNA encoded toxins, prodrug-activating enzymes, cytokines and angiogenesis inhibitors (Pawelek et al, 2003). Bacteria can feel their environment and distinguish between cell types. The sensors, logics and actuators could be embodied in genetic circuits of bacteria to perform coordinated tasks for therapy. Anderson et al. (2006) engineered the non-pathogenic bacteria E. coli able to invade mammalian cells selectively at high cell density or anaerobic conditions (Figure 1). Previous microarray analysis identified several genes in E. coli,

Figure 1. Condition dependent invasion. At a low cell density or normal aerobic growth conditions, the engineered bacteria are noninvasive. Above a critical cell density or in a hypoxic environment, sensors are activated resulting in the synthesis of invasin from Y. pseudotuberculosis that leads to the invasion of HeLa cells (Anderson et al, 2006)

106

Synthetic Biology as a Proof of Systems Biology

whose expression is strongly induced after the shift from aerobic to anaerobic growth. The formate dehydrogenase ( fdhF) is one of the most strongly induced genes. Therefore, fdhF promoter was chosen to activate the invasion after the transition to an anaerobic environment. The inv gene encoding invasin from Yersinia pseudotuberculosis was cloned in E. coli under fdhF promoter (Figure 2a). Typically, the invasin binds to β1-integrins presented on the surface of eukaryotic cells and induces bacterial uptake by mammalian cells. If fdhF promoter is active, then invasin is expressed in E. coli initiating adhesion and invasion (Figure 2b). The inv gene provoked invasion of the cervical carcinoma, hepatocarcinoma and osteosarcoma. The engineered bacteria invaded tumor cells either under anaerobic conditions or when their density was high (mechanism is not shown). Modification of gene circuits by the coupling of hypoxia-sensing and quorum-sensing into AND gate may improve the specificity of bacterial invasion of tumor cells. The authors wrote that “Genetic logic circuits or response regulatory networks could integrate multiple inputs to achieve more accurate environmental sensing.” In general, cancer research has focused on the identification of molecular differences between malignant and healthy cells. Although, there have been attempts to summarize experimental results through mathematical models, the gaps between in vitro cell lines, animal tumor models, and human in vivo tumors are still very large. The picture is very complex and will continue to be so; about 300 genes have been identified in tumorgenesis. Molecules from many parallel signal transduction pathways are involved. Their activities appear to be controlled by multiple factors (Khalil, Hill, 2005; Hornberg et al, 2006). However, there is great hope that the measured in vivo data can be used for ‘personalized medicine’. Vectors on the basis of retroviruses, adenoviruses and lentiviruses have been attempted to deliver genes into human cells. Still numerous problems exist such as ensuring those viruses will infect the correct target cells. Under a new light of collective artificial intelligence and bacterial programming, it seems that the viruses are too primitive to be applied as smart therapeutic agents to perform a swarm algorithm. They simply do not have enough computing power to make ‘intelligent decisions’ about cell type invasion. However, the experiences of viruses in Molecular Biology can be extremely useful in the construction of a ‘bug’ with diagnostic and therapeutic modules in one device. A genome synthesis will make it possible to fabricate this minimal cell. This way of managing a cancer system Figure 2. Design and results of anaerobic invasion. (a) fdhF promoter was fused with inv gene. (b) Bacteria, recovered from cells after invasion with no plasmid (wt) and with the FdhInv gene, grown with no induction in white and anaerobic induction in black. Assays in which no bacteria were recovered are indicated by an asterisk (Anderson et al, 2006)

107

Synthetic Biology as a Proof of Systems Biology

phenomenon has one advantage. Synthetic genomes will be supplied with manuals and documentation. ‘Cell chassis’ will create a context for installing new genetic modules and become an ideal therapeutic nanobot. These autonomous agents will perform logic operations to make a collective verdict. “The complex biological system engineered to perform a task should be the cell, and in fact not just one cell, but a population of cells” (Weiss, 2007).

Co nstr ucti on of multice llular systems, organisms (GM O)

genetica

lly modified

A human body is a complex multi-agent system of 1014 highly specialized cells organized in tissues and organs. Individual cells take their origin from a single fertilized egg. This process of differentiation and morphogenesis is organized by an accompaniment of chemical gradients, cellular receptors, differential gene expression and cell migration (Gilbert, 2000). Typically, coordinated cell behavior Figure 3. E. coli receiver cell can shine in green only at an intermediate distance from the sender cell Circuit operation for a sender and three receivers, exposed to high, medium, and low AHL concentrations, showing the relevant protein activities in cells at different distances from the sender as mediated through transcriptional regulation (orange, constitutively expressed response proteins; blue/green, expression of regulated proteins; green and red arrows, transcriptional induction and repression respectively). High levels of LacI or LacIM1 are required to repress GFP (Basu et al, 2005)

108

Synthetic Biology as a Proof of Systems Biology

involves cell-to-cell communication and intracellular signal processing. Synthetic Biology has been used to exploit and improve by design the pattern formation mechanisms found in Nature. To address this question, Basu et al (2005) created artificial patterns from bacterial cells. Authors demonstrated “a synthetic multicellular system in which genetically engineered ‘receiver’ cells are programmed to form ring-like patterns of differentiation based on chemical gradients of an acyl-homoserine lactone (AHL) signal that is synthesized by ‘sender’ cells” (Figures 3, 4). An AHL communication signal from sender cells is initiated by expression of the LuxI enzyme. “LuxI catalyses the synthesis of AHL which diffuses through the cell membrane and forms a chemical gradient around the senders. AHL diffuses into nearby receiver cells and binds to LuxR, an AHL-dependent transcriptional regulator which activates the expression of lambda repressor (CI) and Lac repressor (LacIM1, a product of a codon-modified lacI). Receiver cells in close proximity to the senders receive high concentrations of AHL resulting in high cytoplasmic levels of CI and LacIM1 and repression of the green fluorescent protein (GFP). Receivers that are far from the senders have low AHL concentrations, and accordingly LacIM1 and CI are expressed only at basal levels. This enables the expression of a wildtype LacI, again resulting in GFP repression. At intermediate distances from the senders, intermediate AHL concentrations result in moderate levels of CI and LacIM1. However, because the repression efficiency of CI is significantly higher than that of LacIM1, CI effectively shuts off LacI expression while the LacIM1 concentration is below the threshold required to repress GFP production. This difference between the CI and LacIM1 repression efficiencies, in combination with a feed-forward loop that begins with LuxR and culminates in GFP, affords the circuit the desired non-monotonic response to AHL dosages” (Basu et al, 2005). The authors have shown how a population of bacterial cells can sense a chemical gradient and form three distinct regions. The space design parameters were determined by modeling and experimentation. Ron Wiess expects it will be possible to extend the artificial rules of pattern formation within bacteria to

Figure 4. Formation of various patterns. (a) Simulation with two senders that results in the formation of an ellipse. (b–d) Experiments showing various GFP patterns formed as a result of the placement and initial concentrations of sender cells: b, ellipse, two sender disks; c, heart, three sender disks; and d, clover, four sender disks (Basu et al, 2005)

109

Synthetic Biology as a Proof of Systems Biology

coordinate a collective behavior of eukaryotic cells. “The integration of such systems into higher-level organisms … will have practical applications in three-dimensional tissue engineering, biosensing and biomaterial fabrication.” The cell behavior during development of multicellular organisms correlates with the spatiotemporal pattern of gene expression. Synthetic gene networks, artificial cell-to-cell communication, and spatiotemporal dynamics of yeast and mouse embryonic stem cells are under active investigation with the ultimate goal of organ engineering (Weiss, 2007). The most interesting objectives are not just genetic circuits but circuits embedded into host cells. Natural genetic circuits are not optimized for the operation within a foreign cellular context. In fact, the same genetic circuit can have various behaviors in different strains. Theoretically, genetic circuits should be disconnected from the cellular context. This is exactly the same old problem that Genetic Engineering had with GMOs. Transgenesis has been used for decades to study molecular mechanisms of basic cellular processes as well as to create organisms that produce therapeutic proteins. But these efforts were mostly unsuccessful because of the extreme complexity of biological systems. The uncertainty and context dependence of installed genetic programs as well as mutations and long-term instability are well known obstacles to Genetic Engineering (Kuznetsov, 1995; Cases, de Lorenzo, 2005). It is now apparent: “genetic circuits function best if the number of interactions between the circuits and the host cell are minimized.” For Synthetic Biology, this minimization means engineering a simple organism with a minimal set of genes by synthesizing its genome. But the critical question of whether a synthetic minimal genome would be a comfortable niche for selfish genetic elements presented in the natural environment is open. To avoid this problem, the development of a completely artificial genetic code as well as the search for alternative energy sources and unusual substrates totally separating the therapeutic agents—an ‘orthogonal life’ would be a wiser decision.

Co nc lusi on At the same time that high-throughput technologies have accelerated Genome Analysis and Proteomics, the Functional Genomics have remained a bottleneck since it has been based on the slow cloning of recombinant DNA. Paradoxically, a complexity of Biology was the basis for the development of Systems and Synthetic Biology. One important goal of SYS Biology is to understand life processes in detail in order to predict their behavior. If we wish to create a biological system that behaves in a predictable way, how could that system be organized? If we want to get a bacterium producing artemisinic acid to combat malaria, how should the metabolic network of the bacterium be rewritten? Or, if our dream is to produce a smart drug against HIV, what is the best swarm algorithm in vivo? SYS Biology is becoming a top field with a great potential to revolutionize Biotechnology. Nevertheless, Systems and Synthetic Biology are in they initial stages and attempting to define themselves and we are at the singular point in our understanding of what these new technologies will contribute to Biology and Medicine. In addition to numerous scientific challenges, there are also questions regarding strict safety and health regulations. Attention has only been given to ‘dual-use’ technologies. Recent efforts have focused on the relations of scientists and the media. Eethical issues have just started to be explored. Many questions have arisen (Rai, Boyle, 2007), e.g. what is the best financial mechanism to support this research? what is more suitable, open source or copyright? is academic freedom important? Similarly, the basic philosophical ideas of ‘constructive biology’ have been formulated (Zoloth, 2005): 1) Genes are selfish. 2) Dignity is the intactness of being. 3) Nature is fixed. 4) Nature is normative. 5) Suffering is what

110

Synthetic Biology as a Proof of Systems Biology

defines the human condition. 6) Slopes are slippery. 7) Dual-use is inevitable. 8) Mistakes are inevitable. 9) We will be like gods. 10) The marketplace will distort science. 11) An unfair world (inequity). 12) A ‘synthetic’ world, i.e. could we call it carefree Biology? The paradigm shift to a systems/synthetic science and technology can only be done through the collaboration of different disciplines: Mathematics, Information Science, Physics, Chemistry, Biology, Medicine, Micro- and Nano-Engineering. The Genetics, Nanotechnology, Robotics and their fusion (GNR) are considered the key technologies for the 21st century. Radical discoveries and novel applications, such as the alteration of biomolecules and programming molecular interactions leading to an assembly into sophisticated artificial systems are expected from this new union.

A ckn ow ledgment The author is very grateful to Systems Biology and Synthetic Biology scientific communities for materials that have been taken from the open sources like PubMed, SBML portal, OpenWetWare and Wikipedia. Thanks also to Bert Schnell for his help with the manuscript and for which he declares no financial interest.

R eferences Abelson, H., Allen, D., Coore, D., Hanson, C., Homsy, G., Knight, T.F., Jr., Nagpal, R., Rauch, E., Sussman, G.J., & Weiss, R. (2000). Amorphous Computing. Communications of the ACM, 43,(5), 74-82. Anderson, J.C., Clarke, E.J., Arkin, A.P., & Voigt, C.A. (2006). Environmentally controlled invasion of cancer cells by engineered bacteria. Journal of Molecular Biology, 355(4), 619-627. Andrianantoandro, E., Basu, S., Karig, D.K., & Weiss, R. (2006). Synthetic biology: New engineering rules for an emerging discipline. Molecular Systems Biology, 2(28), 1-14. Baker, D., Church, G., Collins, J., Endy, D., Jacobson, J., Keasling, J., Modrich, P., Smolke, C., & Weiss, R. (2006). Engineering life: Building a fab for biology. Scientific American, 294(6), 44-51. Bansal, M., Belcastro, V., Ambesi-Impiombato, A., di Bernardo, D. (2007). How to infer gene networks from expression profiles. Molecular Systems Biology, 3(78), 1-10. Barrett, C.L., Kim, T.Y., Kim, H.U., Palsson, B.O., Lee, S.Y. (2006). Systems biology as a foundation for genome-scale synthetic biology. Current Opinion in Biotechnology, 17(5) 488-492. Basu, S., Gerchman, Y., Collins, C.H., Arnold, F.H., & Weiss, R. (2005). A synthetic multicellular system for programmed pattern formation. Nature, 434, 1130-1134. Bertalanffy, L. (1969). General system theory: Foundations, development, applications. New York: George Braziller Inc. Bosl, W.J. (2007). Systems biology by the rules: Hybrid intelligent systems for pathway modeling and discovery. BMC Systems Biology, 1(13), 1-25.

111

Synthetic Biology as a Proof of Systems Biology

Brasch, M.A., Hartley, J.L., Vidal, M. (2004). ORFeome cloning and systems biology: Standardized mass production of the parts from the parts-list. Genome Research, 14(10B), 2001-2009. Casal, A., Sumen, C., Reddy, T.E., Alber, M.S., & Lee, P.P. (2005). Agent-based modeling of the context dependency in T cell recognition. Journal of Theoretical Biology, 236(4), 376-391. Cases, I., & de Lorenzo, V. (2005). Genetically modified organisms for the environment: Stories of success and failure and what we have learned from them. International Microbiology, 8, 213-222. Drubin, D.A., Way, J.C., & Silver, P.A. (2007). Designing biological systems. Genes & Development, 21(3), 242-254. Emonet, T., Macal, C.M., North, M.J., Wickersham, C.E., & Cluzel, P. (2005). AgentCell: A digital single-cell assay for bacterial chemotaxis. Bioinformatics, 21(11), 2714-2721. Endy, D. (2005). Foundations for engineering biology. Nature, 438, 449-453. Endy, D., & Brent, R. (2001). Modelling cellular behaviour. Nature, 409, 391-395. Forster, A.C., & Church, G.M. (2007). Synthetic biology projects in vitro. Genome Research, 17(1), 1-6. Friedman, N., Linial, M., Nachman, I., & Pe’er, D. (2000). Using Bayesian networks to analyze expression data. Journal of Computational Biology, 7(3-4), 601-620. Gibson, M.A., Bruck, J. (2000). Efficient exact stochastic simulation of chemical systems with many species and many channels. Journal of Physical Chemistry, 104, 9, 1876-1889. Gilbert, S.F. (2003). Developmental biology. Sunderland, MA: Sinauer Associates, Inc. Gillespie, D.T. (1976). A general method for numerically simulating the stochastic time evolution of coupled chemical reactions. Journal of Computational Physics, 22, 403-434. Glass, J.I., Assad-Garcia, N., Alperovich, N., Yooseph, S., Lewis, M.R., Maruf, M., Hutchison, C.A. 3rd, Smith, H.O., Venter, J.C. (2006). Essential genes of a minimal bacterium. Proceedings of the National Academy of Sciences of the United States of America, 103(2), 425-430. Goldstein, J. (1999). Emergence as a construct: History and issues. Emergence: A Journal of Complexity Issues in Organization and Management, 1, 49-72. Guckenheimer, J., & Holmes, P. (2002). Nonlinear oscillations, dynamical systems, and bifurcations of vector fields, 7th Edition. New York: Springer. Guido, N.J., Wang, X., Adalsteinsson, D., McMillen, D., Hasty, J., Cantor, C.R., Elston, T.C., & Collins, J.J. (2006). A bottom-up approach to gene regulation. Nature, 439, 856-860. Heinemann, M., Panke, S. (2006). Synthetic biology—Putting engineering into biology. Bioinformatics, 22(22), 2790-2799. Hiraga, K., & Arnold, F.H. (2003). General method for sequence-independent site-directed chimeragenesis. Journal of Molecular Biology, 330(2), 287-296.

112

Synthetic Biology as a Proof of Systems Biology

Hornberg, J.J., Bruggeman, F.J., Westerhoff, H.V., & Lankelma, J. (2006). Cancer: A Systems Biology disease. Biosystems, 83(2-3), 81-90. Husmeier, D. (2003). Reverse engineering of genetic networks with Bayesian networks. Biochemical Society Transactions, 31(6), 1516-1518. Janes, K.A., & Yaffe, M.B. (2006). Data-driven modelling of signal-transduction networks. Nature Reviews Molecular Cell Biology, 11, 820-828. Kang, Y., Durfee, T., Glasner, J.D., Qiu, Y., Frisch, D., Winterberg, K.M., & Blattner, F.R. (2004). Systematic mutagenesis of the Escherichia coli genome. Journal of Bacteriology, 186, 15, 4921-4930. Keating, S.M., Bornstein, B.J., Finney, A., & Hucka, M. (2006). SBML Toolbox: An SBML toolbox for MATLAB users. Bioinformatics, 22(10), 1275-1277. Kell, D. (2005). Metabolomics, machine learning and modelling: towards an understanding of the language of cells. Biochemical Society Transactions, 33(3), 520-524. Khalil, I.G., & Hill, C. (2005). Systems biology for cancer. Current Opinion in Oncology, 17(1), 4448. Kitano, H. (2002a). Systems Biology: A brief overview. Science, 295, 1662-1664. Kitano, H. (2002b). Computational Systems Biology. Nature, 420, 206-210. Knight, T. (2003). Idempotent vector design for standard assembly of biobricks. MIT Artificial Intelligence Laboratory, MIT Synthetic Biology Working Group. Retrieved from http://dspace.mit.edu/ bitstream/1721.1/21168/1/biobricks.pdf Kuznetsov, A., Schmitz, M., & Mueller, K. (2006, July 26-28). On Bio-Design of Argo-Machine. Presented at 7th German Workshop on Artificial Life (GWAL-7 (pp. 125-133). Jena, Germany. Kuznetsov, A.V. (1995). Transgenic animals: The methods of construction. Russian Biotechnology, 3-4, 3-6. Lok, L., & Brent, R. (2005). Automatic generation of cellular reaction networks with Moleculizer 1.0. Nature Biotechnology, 23(1), 131-136. Marguet, P., Balagadde, F., Tan, C., & You, L. (2007). Biology by design: Reduction and synthesis of cellular components and behaviour. Journal of Royal Society Interface, 4(15), 607-623. Merelli, E., Armano, G., Cannata, N., Corradini, F., d’Inverno, M., Doms, A., Lord, P., Martin, A., Milanesi, L., Moller, S., Schroeder, M., & Luck, M. (2007). Agents in bioinformatics, computational and systems biology. Briefings in Bioinformatics, 8(1), 45-59. Patel, G.M., Patel, G.C., Patel, R.B., Patel, J.K., & Patel, M. (2006). Nanorobot: a versatile tool in nanomedicine. Journal of Drug Targeting, 14(2), 63-67. Patterson, S.D. (2003). Data analysis—the Achilles heel of proteomics. Nature Biotechnology, 21(3), 221-222.

113

Synthetic Biology as a Proof of Systems Biology

Pawelek, J.M., Low, K.B., & Bermudes, D. (2003). Bacteria as tumour-targeting vectors. The Lancet Oncology, 4, 548-556. Rai, A., & Boyle, J. (2007). Synthetic Biology: Caught between Property Rights, the Public Domain, and the Commons. PLoS Biology, 5(3) e58, 389-393. Rebatchouk, D., Daraselia, N., & Narita, J.O. (1996). NOMAD: a versatile strategy for in vitro DNA manipulation applied to promoter analysis and vector design. Proceedings of the National Academy of Sciences of the United States of America, 93(20), 10891-10896. Schrödinger, E. (1944). What is Life? Available as a Canto Edition from Cambridge University Press. 1992. Stähler, P., Beier, M., Gao, X., & Hoheisel, J.D. (2006). Another side of genomics: Synthetic biology as a means for the exploitation of whole-genome sequence information. Journal of Biotechnology, 124(1), 206-212. Tan, C., Song, H., Niemi, J., & You, L. (2007). A synthetic biology challenge: making cells compute. Molecular Biosystems, 3(5), 343-353. Tian, J., Gong, H., Sheng, N., Zhou, X., Gulari, E., Gao, X., & Church, G. (2004). Accurate multiplex gene synthesis from programmable DNA microchips. Nature, 432, 1050-1054. Troisi, A., Wong, V., & Ratner, M.A. (2005). An agent-based approach for modeling molecular self-organization. Proceedings of the National Academy of Sciences of the United States of America, 102(2), 255-260. Turing, A. (1952). The chemical basis of morphogenesis. Philosophical Transactions of the Royal Society of London, 237(641), 37-72. Varma. A., Morbidelli, M., & Wu, H. (1999). Parametric sensitivity in chemical systems. Cambridge, New York: Cambridge University Press. Voigt, C.A. (2006). Genetic parts to program bacteria. Current Opinion in Biotechnology, 17(5), 548557. Wagner, A. (1996). Can nonlinear epigenetic interactions obscure causal relations between genotype and phenotype? Nonlinearity, 9, 607-629. Weiss, R. (2007, January 11-13). Developments in synthetic biology. In the lecture presented at Systems Biology, Bioinformatics and Synthetic Biology Workshop (BioSysBio 2007), Manchester, UK. Wiener, N. (1948). Cybernetics or control and communication in the animal and the machine. Cambridge, MA: MIT Press. Yokobayashi, Y., Weiss, R., & Arnold, F.H. (2002). Directed evolution of a genetic circuit. Proceedings of the National Academy of Sciences of the United States of America, 99(26), 16587-16591. Zoloth, L. (2006, May 20-22). Ethical challenges in Synthetic Biology. The lecture presented at Second International Conference on Synthetic Biology (Synthetic Biology 2.0). University of California, Berkeley, CA.

114

Synthetic Biology as a Proof of Systems Biology

K ey T erms Agent: A computing system with a well defined interface capable of adaptive problem-solving actions without user intervention. Amorphous Computing: The action of generating a coherent behavior from a group of unreliable agents such as living cells. Competent Cell: A cell that can accept foreign DNA. Emergence: Refers to new unexpected behaviors and patterns that arise out of a multiplicity of relatively simple interactions. An emergent behavior can appear when a number of simple entities (agents) operate in an environment while forming more complex behaviors as a community. Minimal (or core) Genome: The minimum set of genes necessary for a cell to propagate under specific environmental conditions. Nanorobot (or nanobot): Can be defined as the artificially fabricated object able to freely move in a human body and interact with specific cells at the molecular level itself e.g. seeking out cancer cells and destroying them. Orthogonal Life: A term stressing the complete isolation of artificial life-like creatures from natural processes by using the alternative genetic code and the reliable interface. Chen’s rules should be taken in an account: 1) nanomachines should only be specialized, not general purpose, 2) nanomachines should not be self-replicating, 3) nanomachines should not be made to use an abundant natural compound as fuel, 4) nanomachines should be tagged so they can be tracked. Refactoring: Any modification of a computer program which improves its readability or simplifies its structure without changing its results. Synthetic Biology: An engineering discipline concerning synthesis of novel biological systems that are not found in nature. It has involved a paradigm enabling scientists to create ‘life from scratch’ that will help to understand principles of Biology. Synthetic Biology holds promise for programming bacteria to seek and destroy tumors. However, the complexity of Biology and emergent effects have provoked many technical and ethical challenges. SYS Biology: A speculative merge of Systems Biology and Synthetic Biology that can be defined as an approach to the biological reality, where natural and artificial processes should be described in terms of their components and their interactions in a framework of mathematical models towards a reconstruction of biological systems. Systems Biology: The study of an organism, viewed as an interacting network of genes, proteins, and biochemical reactions which give rise to life. Instead of analyzing individual aspects of the organism, systems biologists focus on all the components and the interactions among them. Systems Biology is the discipline that specifically addresses the fundamental properties of biological complexity. Transgenensis: The introduction of foreign genes into a living organism that confers upon the organism a new property that will be transmitted to a progeny.

115

Section II

Advanced Computational Methods for Systems Biology

117

Chapter VI

Computational Models for the Analysis of Modern Biological Data Tuan D. Pham James Cook University, Australia

abstract Computational models have been playing a significant role for the computer-based analysis of biological and biomedical data. Given the recent availability of genomic sequences and microarray gene expression, and proteomic data, there is an increasing demand for developing and applying advanced computational techniques for exploring these types of data such as: functional interpretation of gene expression data, deciphering of how genes, and proteins work together in pathways and networks, extracting and analysing phenotypic features of mitotic cells for high throughput screening of novel anti-mitotic drugs. Successful applications of advanced computational algorithms to solving modern life-science problems will make significant impacts on several important and promising issues related to genomic medicine, molecular imaging, and the scientific knowledge of the genetic basis of diseases. This chapter reviews the fusion of engineering, computer science, and information sciences with biology and medicine to address some latest technical developments in the computational analyses of modern biological data: microarray gene expression data, mass spectrometry data, and bioimaging.

Micr oarra y G ene E xpressi on D at a Microarrays are a relatively new biotechnology that provides novel insights into gene expression and gene regulation (Brazma and Vilo, 2000; Whitchurch, 2002; Zhang at al, 2002; Pham et al, 2006a). Microarray technology has been applied in diverse areas ranging from genetics and drug discovery to disciplines such as virology, microbiology, immunology, endocrinology, and neurobiology. Microarraybased methods are the most widely used technology for large-scale analysis of gene expression because Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Computational Models for the Analysis of Modern Biological Data

they allow simultaneous study of mRNA abundance for thousands of genes in a single experiment (Kellum and Liu, 2003). The generation of DNA microarray image spots involves the hybridization of two probes labelled with a fluorescent red dye or a fluorescent green dye. The relative image intensity values of the red dye and the green dye on a particular spot of the arrays indicate the expression ratio for the corresponding gene of the two samples from which the mRNAs have been extracted. Thus, robust image processing of microarray spots plays an important role in microarray technology (Nagarajan, 2003; Liew at al, 2003; Lukac et al, 2004). DNA microarray data consists of a large number of genes and a relatively small number of experimental samples. The number of genes on an array is in the order of thousands, and because this far exceeds the number of samples, dimension reduction is needed to allow efficient analysis of data classification techniques. Many statistical and machine-learning techniques based different computational methodologies have been applied for cancer classification in microarray experiments. These techniques include linear discriminant analysis, k-nearest neighbor algorithms, Bayes classifiers, decision trees, neural networks, and support vector machines (Dudoit and Fridlyand, 2003; Golub et al, 1999; Guyon et al, 2002). Nevertheless, common tasks of most classifiers are to perform feature selection and decision logic. Based on the motivation that conventional statistical methods for pattern classification break down when there are more variables (genes) than there are samples, Nguyen and Rocke (2002) proposed a partial least-squares method for classifying human tumor samples using microarray gene expression data. Zhou et al. (2004) proposed a Bayesian approach for selecting the strongest genes based on microarray gene expression data and the logistic regression model for classifying and predicting cancer genes. Yeung et al. (2005) reported that conventional methods for gene selection and classification do not take into account model uncertainty and use a single set of selected genes for prediction, and introduced a Bayesian model averaging method, which considers the uncertainty by averaging over multiple sets of overlapping relevant genes. Furey et al. (2000) applied support vector machines for the classification of cancer tissue samples or cell types using microarrays. Lee et al. (2003) proposed a Bayesian model for gene selection for cancer classification using microarray data. Statnikov et al. (2005) carried out a comprehensive evaluation of classification methods for cancer diagnosis based on microarray gene expression data. Recently Pham et al. (2006b) carried out cancer classification by transforming microarray data into spectral vectors. The same authors used the spectral difference or spectral distortion between the pair of spectra for pattern comparison, which appears to be a potential approach for the cancer classification using microarray gene expression data.

Mass spectr

ometr y da t a

Current best practice for reducing human mortality rates caused by complex diseases is to detect their symptoms at early stages. By early recognition of symptoms, one can get the most effective clinical treatment for the best outcome. Recent advances in biotechnology open doors to fascinating opportunities for the better understanding of the biology of many complex human diseases at molecular levels. These advances will hopefully lead to the early detection and treatment of such diseases (Petricoin and Liotta, 2003; Wulfkuhle et al, 2003).

118

Computational Models for the Analysis of Modern Biological Data

Besides the availability of genomic data, life-science researchers study proteomics in order to gain insight into the functions of cells by learning how proteins are expressed, processed, recycled, and their localization in cells. Proteomics is defined as the study of proteome which refers to the entire set of expressed protein in a cell. Major research areas of proteomics include structural, functional, and interaction studies (Holmes et al, 2005). Structural proteomics uses X-ray crystallography, nuclear magnetic resonance, or even both to study the final three dimensional shape of proteins. Functional proteomics involves the use of mass spectrometry (MS) to study the regulation, timing, and location of protein expression. Interaction studies seek to understand how protein pair between themselves and other cellular components interacts to constitute to more complex models of the molecular machines. In particular, protein expression profiles or expression proteomics can be used for large-scale protein characterization or differential expression analysis that has many applications such as disease classification and prediction, new drug treatment and development, virulence factors, and polymorphisms for genetic mapping, and species determinants (Adam et al, 2001; Griffin et al, 2002; Aebersold and Mann, 2003; Weir et al, 2003). In comparison with transcriptional profiling in functional genomics, proteomics has some obvious advantages in that it provides a more direct approach to studying cellular functions because most gene functions are characterized by proteins (Xiong, 2006). The identities of expressed proteins in a proteome can be determined by protein separation, identification, and quantification. One of many approaches for separating proteins involves two-dimensional gel electrophoresis followed by gel image processing. Once proteins are separated, protein differential expression can be characterized using mass spectrometry, which is a high-resolution technique for determining molecular masses and provides rapid and accurate measurement of protein profiling in complex biological and chemical mixture. Protein profiling of plasma and serum can be prepared with a matrix-assisted laser desorption ionization (MALDI) ion source or the surface-enhanced laser desorption ionization (SELDI) ion source coupled to a time-of-flight (TOF) mass analyzer with a chevron micochannel plate detector. Detailed descriptions on mass spectrometry and its advanced developments can be found in the review by Shin and Markey (2006). In regards to recent applications of proteomic technology, proteomic patterns have recently been utilized for early detection of cancer progressions (Sauter et al, 2002; Petricoin et al, 2002; Conrads et al, 2003). Furthermore, methods for classification of normal and cancerous states using mass spectrometry data have been recently developed. Petricoin et al. (2002) applied cluster analysis and genetic algorithms to detect early stage ovarian cancer using proteomic spectra. Ball et al. (2002) applied integrated approach based on neural networks to study SELDI-MS data for classification of human tumors and identification of biomarkers. Lilien et al. (2003) applied principal component analysis and a linear discriminant function to classify ovarian and prostate cancers. Sorace and Zhan (2003) used mass spectrometry serum profiles to detect early ovarian cancer. Wu et al. (2003) compared the performance of several methods for the classification of mass spectrometry data. Tibshirani et al. (2004) proposed a probabilistic approach for sample classification from protein mass spectrometry data. Morris et al. (2005) applied wavelet transforms and peak detection for feature extraction of MS data. Yu et al. (2005) developed a method for dimensionality reduction for high-throughput MS data. Levner (2005) used feature selection methods and then applied the nearest centroid technique to classify MS-based ovarian and prostate cancer datasets. Zhou et al (2006) applied genetic algorithms for protein biomarker discovery for risk stratification of cardiovascular events. Pham et al. (2006c) have applied the linear predictive coding method for the

119

Computational Models for the Analysis of Modern Biological Data

prediction of the risk of major adverse cardiac events using mass spectral data. The motivation of this research was initiated from the original work presented in Brennan et al. (2003), who studied 604 patients who presented in emergency room with chest pain. The blood samples were collected at the presentation of the emergency room and the protein level of MPO (myloperoxidase) and other known cardiovascular biomarkers were measured. The patient’s outcome (any cardiovascular event) was monitored for 6 months. The study showed the MPO to be a new biomarker for the prediction of MACE (major adverse cardiac events) risk in 30 days after the presentation of chest pain in emergency room with accuracy about 60%. Recently, the FDA (U.S. Food and Drug Administration) approved the CardioMPO kit for measurement of MPO level (http://www.fda.gov/cdrh/reviews/K050029.pdf). In particular, Pham et al. (2006b) computed the prediction coefficients as a spectral feature of the MS data and used the minimum distortion rule to classify control and disease samples. The experimental results appeared to be promising and feasible for protein peak-detection strategy. Given the promising integration of several machine-learning methods and mass spectrometry data in high-throughput proteomics (Shin and Markey, 2006), this new biotechnology still encounters several challenges in order to become a mature platform for clinical diagnostics and protein-based biomarker profiling. Some of major challenges include noise filtering of MS data, selection of computational methods for MS-based classification, feature extraction and feature reduction of MS datasets (Anderle et al, 2004; Salmi et al, 2006).

B io-imaging da t a By the use of fluorescence-based reagents, high content screening (HCS) studies cell functions by extracting the temporal and spatial information about target activities within cells (Giuliano et al., 1997). Particularly due to the huge volumes of acquired images, the automation of HCS systems has become necessary to help life-science researchers understand the complex process of cell division or mitosis at a rapid speed (Debeir et al., 2005; Fox, 2003). Its power comes from the sensitivity and resolution of automated light microscopy with multi-well plates, combined with the availability of fluorescent probes that are attached to specific subcellular components, such as chromosomes and microtubules, for visualization of cell division or mitosis using standard epi-fluorescence microscopy techniques (Yarrow et al., 2003). By employing a carefully selected reporter probes and filters, fluorescence microscopy allows specific imaging of phenotypes of essentially any cell component (Murphy, 2001). With these probes we can determine both the amount of a cell component, and most critically, its distribution within the cell relative to other components. Typically, 3-4 different components are localized in the same cell using probes that excite at different wavelengths. Any change in cell physiology would cause a redistribution of one or more cellular components, and this redistribution provides a certain cytological marker that allows for scoring of the physiological change. In time-lapse microcopy images are usually captured in a time interval of more than 10 minutes. During this period dividing nuclei may move far away from each other and daughter cell nuclei may not overlap with their parents. An essential task for high content screening is to measure cell cycle progression (inter phase, prophase, metaphase, and telophase) in individual cells as a function of time. Cell cycle progress can be identified by measuring nuclear changes. Thus, automated time-lapse fluorescence microscopy imaging provides an important method for the observation and study of cellular nuclei in a dynamic fashion (Hiraoka and Haraguchi, 1996; Kanda et al., 1998). Stages of an automated cellular

120

Computational Models for the Analysis of Modern Biological Data

imaging analysis consist of segmentation, feature extraction, classification, and tracking of individual cells in a dynamic cellular population; and the classification of cell phases is considered the most difficult task of such analysis (Chen et at., 2006). Given the advanced fluorescent imaging technology, there still remain technical challenges in processing and analyzing large volumes of images generated by time-lapse microscopy. The increasing quantity and complexity of image data from dynamic microscopy renders manual analysis unreasonably time-consuming. Therefore, automatic techniques for analyzing cell-cycle progress are of considerable interest in the drug discovery process. Steps for automatic analysis of cell images include image segmentation, feature extraction and classification; whereas the solution for image segmentation plays an important role in providing accurate information for feature extraction and object classification. Wählby et al. (2004) combined intensity, edge and shape information for 2D and 3D segmentation of cell nuclei in tissue section. Pham et al. (2006c) have developed several classification models for identifying individual cell phase changes during a period of time. The same authors extracted the information of image spatial-continuity as a novel feature using the concept of geostatistics (Isaaks and Srivastava, 1989) and the theory of linear predictive coding (LPC) (Makhoul, 1975); and also presented another scheme for extracting two-dimensional image feature known as the spatial linear predictive coding (SLPC) coefficients. Classification of cell phases was then carried out by the vector quantization based templates for pattern matching.

R eferences Aebersold, R., & Mann, M. (2003). Mass spectrometry-based proteomics. Nature, 422, 198-207. Anderle, M., Roy, S., Lin, H., Becker, C., Joho, K. (2004). Quantifying reproducibility for differential proteomics: noise analysis for protein liquid chromatography-mass spectrometry of human serum. Bioinformatics, 20, 3575-3582. Adam, B.L., Vlahou, A., Semmes, O.J., Wright Jr., G.L. (2001). Proteomic approaches to biomarker discovery in prostate and bladder cancers. Proteomics, 1, 1264-1270. Ball, G., Mian, S., Holding, F., Allibone, R.O., Lowe, J., Ali, S., Li, G., McCardle, S., Ellis, I.O., Creaser, C., & Rees, R.C. (2002). An integrated approach utilizing artificial neural networks and SELDI mass spectrometry for the classification of human tumours and rapid identification of potential biomarkers. Bioinformatics, 18, 395-404. Brazma, A., & Vilo J. (2000). Gene expression data analysis. FEBS Letters, 480, 17-24. Brennan, M-L., Penn, M.S., Van Lente, V., Nambi, M.H., Shishehbor, R.J., Aviles, M., Goormastic, M.L., Pepoy, E.S., McErlean, E.J., Topol, S.E., Nissen, S.L., Hazen (2003). Prognostic value of myeloperoxidase in patients with chest pain. The New England Journal of Medicine, 13, 1595-1604. Chen, X., Zhou, X., & Wong, S.T.C. (2006). Automated segmentation, classification, and tracking cancer cell nuclei in time-lapse microscopy. IEEE Trans. Biomedical Engineering, 53, 762-766. Conrads, T.P., Zhou, M., Petricoin III, E.F., Liotta L., Veenstra, T.D. (2003). Cancer diagnosis using proteomic patterns. Expert Rev. Mol. Diagn., 3, 411-420.

121

Computational Models for the Analysis of Modern Biological Data

Debeir, O., Ham, P.V., Kiss, R., & Decaestecker, C. (2005) Tracking of migrating cellsunder phase-contrast video microscopy with combined mean-shift processes. IEEE Trans. Medical Imaging, 24, 697-711. Dudoit, S., & Fridlyand, J. (2003). Classification in microarray experiments. Statistical Analysis of Gene Expression Microarray Data, 3, 93-158, T. Speed, (ed.)Boca Raton, FL: Chapman & Hall,. Fox, S. (2003). Accommodating cells in HTS. Drug Discovery World, 5, 21-30. Furey, T.S., Cristianini, N., Duffy, N., Bednarski, D.W., Schummer, M., & Haussler, D. (2000). Support vector machine classification and validation of cancer tissue samples using microarray expression data. Bioinformatics, 16, 906-914. Golub, T.R., Slonim, D.K., Tamayo, P., Huard, C., Gaasenbeek, M., Mesirov, J.P., Coller, H., Loh Jr. M.L., Downing, M.A., Caligiuri, C.D., BloomÞeld, E., & Lander, S. (1999). Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science, 286, 531-537. Griffin, T., Goodlett, T., & Aebersold, R. (2002). Advances in proteomic analysis by mass spectrometry. Curr. Opin. Biotechnol., 12, 607-612. Giuliano et al. (1997). High-content screening: A new approach to easing key bottlenecks in the drug discovery process. J. Biomolecular Screening, 2, 249-259. Guyon, I., Weston, J., Barnhill, S., & Vapnik, V. (2002). Gene selection for cancer classification using support vector machines. Machine Learning, 46, 389-422. Hiraoka, Y., & Haraguchi, T. (1996). Fluoresence imaging of mammalian living cells. Chromosome Res, 4, 173-176. Holmes, M.R., Ramkissoon, K.R., Giddings, M.C. (2005). Proteomics and protein identification. In Baxevanis AD, Ouellette BFF, (eds.), Bioinformatics: A practical guide to the analysis of genes and proteins (pp. 445-472). New Jersey: John Wiley & Sons. Isaaks, E.H., & Srivastava, R.M. (1989). An introduction to applied geostatistics. New York: Oxford University Press. Kanda, T., Sullivan, K.F., & Wahl, G.M. (1998). Histone-GFP fusion protein enables sensitive analysis of chromosome dynamics in living mammalian cells. Current Biology, 8, 377-385. Kellam P., & Liu, X. (2003). Experimental use of DNA arrays. Orengo, C.A., Jones, D.T., & Thornton, J.M. (eds.). Bioinformatics: Genes, Proteins & Structures, Bios. Oxford. Lee, K.E., Sha, N., Dougherty, E.R., Vannucci, M., & Mallick, B.K. (2003). Gene selection: A Bayesian variable selection approach. Bioinformatics, 19, 90-97. Levner, I. (2005). Feature selection and nearest centroid classification for protein mass spectrometry. BMC Bioinformatics, 6(68). Liew, AW-C, Yan, H., & Yang, M. (2003). Robust adaptive spot segmentation of DNA microarray images. Pattern Recognition, 36, 1251-1254. Lilien, R.H., Farid, H., & Donald, B.R. (2003). Probabilistic disease classification of expression-dependent proteomic data from mass spectrometry of human serum. J. Computational Biology, 10, 925-946.

122

Computational Models for the Analysis of Modern Biological Data

Lukac, R., Plataniotis, K.N., Smolka B., & Venetsanopoulos, A.N. (2004). A multichannel order-statistic technique for cDNA microarray image processing. IEEE Trans. Nanobioscience, 3,272-285. Makhoul, J. (1975). Linear prediction: a tutorial review. Proceedings of the IEEE, 63, 561-580. Morris, J.S., Coombes, K.R., Koomen, J., Baggerly, K.A., Kobayashi, R. (2005). Feature extraction and quantification for mass spectrometry in biomedical applications using the mean spectrum. Bioinformatics, 21, 1764-1775. Murphy, D.B. (2001). Fundamentals of light microscopy and electronic imaging. Wiley-Liss. Nagarajan, R. (2003). Intensity-based segmentation of microarrays images. IEEE Trans. Medical Imaging, 22, 882-889. Nguyen, D.V., & Rocke, D.M. (2002). Tumor classification by partial least squares using microarray gene expression data. Bioinformatics, 18, 39-50. Petricoin, E.F., et al. (2002). Use of proteomic patterns in serum to identify ovarian cancer. Lancet, 359, 572-577. Petricoin, E.F., & Liotta, L.A. (2003). Mass spectrometry-based diagnostics: The upcoming revolution in disease detection. Clinical Chemistry, 49, 533-534. Pham, T.D., Wells, C., & Crane, D.I. (2006a). Analysis of microarray gene expression data. Current Bioinformatics, 1(1), 37-53. Pham, T.D., Beck, D., & Yan, H. (2006b). Spectral pattern comparison methods for cancer classification based on microarray gene expression data. IEEE Trans. Circuits and Systems I: Fundamental Theory and Applications, special issue on Advances on Life Science Systems, 53(11), 2425-2430. Pham, T.D., Tran, D.T., Zhou, X., & Wong, S.T.C. (2006c). Integrated algorithms for image analysis and identification of nuclear division for high-content cell-cycle screening. Int. J. Computational Intelligence and Applications, 6, 21-43. Salmi, J., Moulder, R., Filen, J-J., Nevalainen, O.S., Nyman, T.A., Lahesmaa, R., & Aittokallio, T. (2006). Quality classification of tandem mass spectrometry data. Bioinformatics, 22, 400-406. Shin, H., Markey, M.K. (2006). A machine learning perspective on the development of clinical decision support systems utilizing mass spectra of blood samples. J. Biomedical Informatics, 39, 227-248. Sorace, J.M., & Zhan M. (2003). A data review and re-assessment of ovarian cencer serum proteomic profiling. BMC Bioinformatics, 4(24). Statnikov, A., Aliferis, C.F., Tsamardinos, I., Hardin, D., & Levy S. (2005). A comprehensive evaluation of multicategory classification methods for microarray gene expression cancer diagnosis. Bioinforamtics, 21, 631-643. Tibshirani, R., Hastie, T., Narasimhan, B., Soltys, S., Shi, G., Koong, A., Le, Q-T. (2004). Sample classification from protein mass spectrometry, by peak probability contrasts. Bioinformatics, 20, 3034-3044. Verma, D., & Meila, M. (2003). A comparison of spectral clustering algorithms. Technical Report, UWCSE-03-05-01. University of Washington.

123

Computational Models for the Analysis of Modern Biological Data

Wählby, C., Sintor, I.-M., Erlandsson, F., Borgefors, G., & Bengtsson, E. (2004). Combining intensity, edge and shape information for 2D and 3D segmentation of cell nuclei in tissue sections. Journal of Microscopy, 215, 67–76. Weir, M.P., Blackstock, W.P., Twyman, M. (2003). Proteomics, Bioinformatics: Genes, Proteins & Computers. C.A. Orengo, D.T. Jones, J.M. Thornton, (eds.). BIOS Scientific Publishers, 245-257. Whitchurch, A.K. (2002). Gene expression microarrays. IEEE Potentials, 21, 30-34. Wu, B., Abbott, T., Fishman, D., McMurray, W., Mor, G., Stone, K., Ward, D., Williams, K., & Zhao, H. (2003). Comparison of statistical methods for classification of ovarian cancer using mass spectrometry data. Bioinformatics, 19, 1636-1643. Wulfkuhle, J.D., Liotta, L.A., & Petricoin, E.F. (2003). Proteomic applications for the early detection of cancer. Nature, 3, 267-275. Xiong, J. (2006). Essential Bioinformatics. New York: Cambridge University Press. Yarrow, J.C., Feng, Y., Perlman, Z.E., Kirchhausen, T., & Mitchison, T.J. (2003). Phenotypic screening of small molecule libraries by high throughput cell imaging. Comb Chem High Throughput Screen, 6, 279-286. Yeung, K.Y., Bumgarner, R.E., & Raftery, A.E. (2005). Bayesian model averaging: Development of an improved multi-class, gene selection and classification tool for microarray data. Bioinformatics, 21, 2394-2402. Yu, J.S., Ongarello, S., Fiedler, R., Chen, X.W., Toffolo, G., Cobelli, C., & Trajanoski, Z. (2005). Ovarian cancer identification based on dimensionality reduction for high-throughput mass spectrometry data. Bioinformatics, 21, 2200-2209. Zhang, X.Y., Chen, F., Zhang, Y.T., Agner, S.G., Akay, M., Lu, Z.H., Waye, M.M.Y., & Tsui, S.K.W. (2002). Signal processing techniques in genomic engineering. Proceedings of the IEEE, 90, 1822-1833. Zhou, X., Liu, K-Y., & Wong, S.T.C. (2004). Cancer classification and prediction using logistic regression with Bayesian gene selection. J. Biomedical Informatics, 37, 249-259. Zhou, X., Wang, H., Wang, J., Hoehn, G., Azok, J., Brennan, M.L., Hazen, S.L., Li, K., & Wong, S.T.C. (2006). Biomarker discovery for risk stratification of cardiovascular events using an improved genetic algorithm. Proc. IEEE/NLM Int. Symposium on Life Science and Multimodality, 42-44.

K ey terms Artificial Neural Networks: Machine learning methods consisting of interconnecting artificial neurons that simulate the properties of biological neural networks. Biomarker Discovery: Discovery of molecular parameters associated with the presence and severity of specific disease states.

124

Computational Models for the Analysis of Modern Biological Data

Cluster Analysis: Methods for grouping objects of similar kind into respective categories. Decision Trees: Predictive models that map the observations about an event to infer about its target value. Discriminant Analysis: Statistical analysis to discriminate between two or more groups of samples. Feature Extraction: Extraction of representative properties of an object for the purpose of classification. Feature Reduction: Compression of the feature space of an object. Genetic Algorithms: Biologically inspired optimization methods. Geostatistics: Applied statistics of spatially correlated data High Content Screening: A high throughput platform for understanding the functions of genes, RNA, proteins, and other cellular constituents at the level of the living cell. k-Nearest Neighbor Algorithms: Methods for classifying objects based on closest training samples in the feature space. Linear Predictive Coding: An encoding method that allows the prediction of the value of the signal at each sample as a linear combination of the past values of the signal. Mass Spectrometry Data: A dataset that consists of relative intensities a chromatographic retention time and the ratios of molecular mass over charge. The mass spectrum for a sample is a function of the molecules and used to test for presence or absence of one or more molecules which may relate to a diseased state or a cell type. Microarray Gene Expression Data: Modern biotechnological data generated for studying the interaction of large numbers of genes and how a cell’s regulatory networks control genes simultaneously. Naive Bayes Classifier: A classification technique that is based on the so-called Bayesian theorem. Proteomics: The study of the structure and function of proteins, Spectral Distortion: A measure of mismatch between two signals based on their spectral properties. Support Vector Machines: machine learning algorithms that map input vectors to a higher dimensional space where a maximal separating hyperplane is constructed. Time-Lapse Microcopy Imaging: Microscopy imaging that captures images of dynamic events at predetermined time intervals. Vector Quantization: A technique that compresses k dimensional vectors to a finite set of n dimensional vectors, where n is smaller than k. Wavelet Transform: The representation of a signal in terms of scaled and translated copies of a finite length or fast decaying oscillating waveform.

125

126

Chapter VII

Computer Aided Knowledge Discovery in Biomedicine Vanathi Gopalakrishnan University of Pittsburgh, USA

abstract This chapter provides a perspective on 3 important collaborative areas in systems biology research. These areas represent biological problems of clinical significance. The first area deals with macromolecular crystallization, which is a crucial step in protein structure determination. The second area deals with proteomic biomarker discovery from high-throughput mass spectral technologies; while the third area is protein structure prediction and complex fold recognition from sequence and prior knowledge of structure properties. For each area, successful case studies are revisited from the perspective of computer-aided knowledge discovery using machine learning and statistical methods. Information about protein sequence, structure, and function is slowly accumulating in standardized forms within databases. Methods are needed to maximize the use of this prior information for prediction and analysis purposes. This chapter provides insights into such methods by which available information in existing databases can be processed and combined with systems biology expertise to expedite biomedical discoveries.

INTR OD UCTI ON The mission of this chapter is to introduce concepts and terms that form the core of methods devised for important problems in bioinformatics and systems biology applications. Successful case studies are presented that utilize prior knowledge to aid in novel biomedical discoveries. Machine learning techniques are applied to various important biological problems, namely macromolecular crystallization, biomarker discovery from proteomic mass spectra and protein structure prediction via fold recognition. A common theme is the utilization of protein sequence properties and known task-specific information that serve as prior knowledge for guiding knowledge discovery. Much of the task-specific information Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Computer Aided Knowledge Discovery in Biomedicine

is obtained through direct interactions between the bioinformatician and the domain expert in biomedical science. Systematization of the processes by which biomedical discoveries are made can uncover useful information that can help the bench scientist prioritize and focus efforts. A major goal of this chapter is to describe efforts made toward such systematization in some critical research areas. Recent novel machine learning algorithms have demonstrated some success in identifying and characterizing “interesting relationships” among domain concepts resulting in discovery of explanations for well-known observed scientific phenomena. The domain expert plays a very important role in studying output generated by computer programs and providing input to bioinformaticians on how to focus their subsequent efforts. Thus, communication between multi-disciplines is crucial to successful computer-aided biomedical discovery. For example, modeling protein sequence-structure relationships is a challenging bioinformatics task. Prior knowledge about protein fold can be used to better model protein families containing remote homologs that have very few sequence characters in common between members of the same family. Such knowledge is obtained typically from study of the literature combined with communication with a domain expert.

BACKGR

OUND

Knowledge discovery in biomedicine in the current world is very often the result of computational analyses combined with interpretation by domain experts. Langley (1998) states that artificial intelligence researchers have tried to develop intelligent artifacts that replicate the act of discovery. There are distinct steps in the scientific discovery process discussed therein (Langley, 1998) during which developers or users can influence the behavior of a computational discovery system. Furthermore, Langley (1998) suggests that such intervention is the preferred approach for using discovery software. In this chapter, we present an approach to data modeling and discovery that is consistent with this viewpoint. Jurisica and Wigle (2006) define knowledge discovery (KD) as the process of extracting novel, useful, understandable and usable information from large data sets. The authors review knowledge discovery in proteomics and present examples of such algorithms in the literature that aid protein crystallization. The case studies presented in this chapter reflect state-of-the-art challenges in proteomics along with computer-aided solutions. Quantitative and qualitative discoveries are described along with the methods by which they are arrived at. The KD process in complex real-world domains requires multi-disciplinary methods involving both artificial intelligence and statistics applied to databases (Jurisica & Wigle, 2006). Proteomics can be defined simply as the study of protein composition in a protein complex, organelle, cell or entire organism (Russell, Old, Resing, & Hunter, 2004). Current high-throughput proteomic technologies require robotics and computational techniques to decipher signals within multitudes of data. It is becoming clear that the high dimensionality poses a serious challenge to existing artificial intelligence tools for knowledge discovery and reasoning (Jurisica & Wigle, 2006). The unavailability of large numbers of samples combined with the high dimensionality of the feature space limits the usefulness of models obtained from such data. Moreover, uncertain and missing values in the data combined with evolving knowledge of the underlying mechanisms requires an intelligent information system to be flexible and scalable (Jurisica & Wigle, 2006).

127

Computer Aided Knowledge Discovery in Biomedicine

KN OW LEDGE DISC OVERY IN BI OMEDICA L APP LICATI ONS We believe that systematization of belief systems is useful for knowledge discovery in biomedical applications. This involves collaborative input to create useful representations of prior knowledge of the domain and task, in order to facilitate knowledge discovery. To support this, we present case studies for three problem areas in computational systems biology: (1) Protein Crystallization Screen Design; (2) Proteomic Biomarker Discovery from Mass Spectra and (3) Protein sequence-to-structure prediction.

Protein C rystallization S creen D esign Proteins are macromolecules along with nucleic acids, protein and DNA complexes. Protein crystallization is the major bottleneck in structure determination of proteins because of the large number of variables that affect the formation of a protein crystal suitable for X-ray diffraction. The relationships between these variables and the propensity of a macromolecule to crystallize are still not fully understood. Hence, macromolecule crystallization is largely considered an art rather than a science (Ducruix & Giege, 1992). Past experience has been utilized to guide experimenters toward initial conditions that favor crystal growth (for example, agents proposed by Jancarik and Kim (Jancarik & Kim, 1991); and the Hampton Research Crystal Screen). The idiosyncratic nature of individual proteins requires optimization of conditions obtained from the first screening step. Conceptually, protein crystal growth can be divided into two phases: (a) screening a subset of possible experimental conditions to determine promising areas to search further and (b) optimization of the initial search conditions to yield crystals of good quality (resolution limit of diffraction < 3.5 Å). The Biological Macromolecular Crystallization Database (BMCD) is a repository for experimental data from successful crystallization studies (Gilliland, Tung, & Ladner, 2002). These positive examples of successful crystallization plans have been subjected to various statistical and machine learning analyses staring with inductive learning to extract useful associations between crystallization conditions and obtaining good quality crystals (Hennessy, Gopalakrishnan, Buchanan, Rosenberg, & Subramanian, 1994). Even though the BMCD is a useful resource, the lack of information about failed experimental setups for each protein that had been successfully crystallized hinders the predictive ability of models gleaned from this data. Even though protein crystallization is generally regarded as an art, there exists prior knowledge about the process by which protein crystals nucleate, grow and stop growing. Figure 1 depicts a hanging drop vapor diffusion experiment as part of a typical 6 x 4 setup tray. This method is commonly utilized for protein crystallization, with a droplet of purified protein in solution hanging from the cover slip over well containing mother liquor which is a cocktail of buffer, precipitant and possibly salts at various concentrations. The drop solution contains the protein along with the same cocktail reagents of the mother liquor except at lower concentrations. A protein crystal is formed when water evaporates from the drop at a slow rate in an attempt to reach system equilibrium. Initially, the precipitant concentration in the drop is at lower concentration insufficient for crystallization. As the water evaporates from the drop, precipitant concentration increases driving the protein from a liquid to a solid state. A phase diagram plot of protein concentration versus precipitant concentration in the hanging drop reveals three regions - undersaturation, saturation and supersaturation. It has been observed that proteins nucleate at a supersaturation close to the boundary between saturation and supersaturation regions; whereas growth of the crystal takes place only within the saturated region. Hence, a model that takes

128

Computer Aided Knowledge Discovery in Biomedicine

this prior knowledge into account can help novice crystallographers better understand how to get the protein in the liquid phase into an appropriate solid phase to obtain good crystals of diffractible quality. If the precipitant was too concentrated in the drop solution, it is likely that only a solid amorphous precipitate would result, since the solid phase would occur in a region of supersaturation far from the boundary between saturation and supersaturation regions. This empirical observation however is still a useful partial result in honing onto appropriate initial crystallization conditions. Gopalakrishnan et al. (2002) present a simple simulator of protein crystallization. Novice crystallographers can utilize commonly used laboratory reagents virtually to set up experiments for different hypothetical proteins. The simulator allows the user to observe experiments from time to time by requesting this as another input. Subjective testing showed that the underlying simple model was a reasonable approximation of the overall behavior of the system by which protein crystals nucleate, grow and stop growing(Gopalakrishnan, Buchanan, & Rosenberg, 2000; Gopalakrishnan, Buchanan, & Rosenberg, 2002). However the simulation though numerical in nature is meant to only convey qualitative behavior patterns. The quantitative outputs are not to be taken as what one would observe in the laboratory. Further refinement of the input functions and their parameters based on actual experimental information would be necessary to utilize the quantitative outputs (such as the resolution limit of diffraction of a crystal obtained over a particular time interval of simulation).

Figure 1. Illustration of a typical crystallization tray. Each well has a mother liquor solution containing buffer and precipitant at a higher concentration than in the hanging drop. The drop contains protein at a particular concentration initially in the liquid phase. Vapor diffusion drives the protein in the drop into a solid phase (such as amorphous precipitate or crystal). The rate of vapor diffusion determines the outcome of an experiment (such as whether or not a solid phase appears, and the quality of crystal if applicable).

A T ra y

A well (a n experiment)

B u ffe r = 0 .1 M Tris -H C l p H 8 .5 P re cipita nt = 30 % w /v P E G 4 0 0 0 S a lt = 0 .2 M M g C l 2

S evera l E xperiments in P a rallel

129

Computer Aided Knowledge Discovery in Biomedicine

A systematization of macromolecular classes is presented in Hennessy et al. (2000) and utilized toward objective screen design using statistical techniques (Hennessy, Buchanan, Subramanian, Wilcosz, & Rosenberg, 2000). Further systematization of belief systems in crystallization is attempted through the development and characterization of various chemical hierarchies and relationships within the domain (Gopalakrishnan, Livingston, Hennessy, Buchanan, & Rosenberg, 2004). Such representations are utilized within a novel autonomous discovery system for uncovering relationships among parameters influencing macromolecular crystallization. This system called Heuristic Autonomous Model Builder (HAMB) (Livingston, Rosenberg, & Buchanan, 2003) is a task-based agenda system built on top of a rule-based machine learning algorithm, Rule Learner (RL) (Clearwater & Provost, 1990). HAMB utilizes prior knowledge to annotate rule sets that are generated by RL - these represent models of the data from the BMCD. The annotations are obtained through interactions with the domain expert to characterize “interestingness” of features and relationships within the domain. Thus, HAMB is able to autonomously prioritize learning tasks for RL, and provide appropriate data and target classes based on interestingness categories. Though “interestingness” again is captured numerically, the categorization overall is qualitative. HAMB’s analysis of augmented BMCD data results in some novel suggestions such as: (a) different crystallization methods should be used for specific types of macromolecules; and (b) different ionic strengths may be required when crystallizing enzymes, ‘heme’-containing proteins and small proteins (Gopalakrishnan et al., 2004). An important variable that influences protein crystallization is the pH of the experimental setup, and hence values of this variable is more abundantly reported in the protein data bank (PDB) (Berman et al., 2002). The entries in the PDB were analyzed by Dougall (2007) in an effort to understand the relationships between protein sequence properties and the reported pH of crystallization (Dougall, 2007). Since the pH is more abundantly reported than other variables of protein crystallization, Dougall (2007) was able to parse the PDB to create substantial training and test datasets (3000 to 5360 examples from different versions of the database) for statistical and machine learning analyses. This analysis verified that there is indeed no correlation between the pH at which a protein crystallizes; and its isoelectric point (pI) where the net charge is zero agreeing with previous work (Kantardjieff & Rupp, 2004). Furthermore, upon examination of net charge per kDa (kilodalton), which is the specific charge of the protein and can be estimated from the sequence; it was found that most of proteins in the training set crystallized at a pH that resulted in low specific charge. This trend was also observed in the test datasets. This discovery that most globular proteins in a nonredundant set of the PDB crystallize at a pH that results in a low specific charge seems to be consistent with well-known facts relating to structural stability of proteins.

Proteomic B iomarker D iscovery from Mass S pectra Biomarkers are biological molecules that are indicators of physiologic state and also of change during a disease process (Srinivas, Srivastava, Hanash, & Wright, 2001). Biomarkers can be utilized to provide early detection of disease and monitor its progression. Proteomic technologies allow us to detect abundances of various proteins present in clinical samples, thereby providing us with a map of protein-related changes caused by disease. Proteomics is the study of the entire set of proteins in a cell, and proteomic biomarker panels that represent states of protein abundances or representations within the cell are useful indicators of patient health within the clinical context. Screening using a panel of biomarkers can enhance the positive predictive value of a test while minimizing false positives or false negatives. Protein markers can be used in detection, diagnosis, monitoring of therapy, and ultimately, prevention and risk

130

Computer Aided Knowledge Discovery in Biomedicine

Figure 2. Generic mass spectrometry (MS)-based proteomics experiment. Figure redrawn from review in Nature by Aebersold and Mann, 2003. (1) Sample fractionation

(2) Tryptic digestion

SDSPAGE

Peptide mixture

Excised proteins

Relative Abundance

(3) Peptide chromatography and ESI (5) MS/MS

(4) MS

500

600 0 400

0 m/z

1000

m/z

assessment (Srinivas, Verma, Zhao, & Srivastava, 2002). Commonly used technologies for proteomic screening are based on mass spectral (MS) analyses of clinical samples and complex mixtures of proteins obtained through chromatographic separation. MS measurements are carried out in the gas phase on ionized analytes. By definition, a mass spectrometer consists of an ion source, a mass analyzer that measures the mass-to-charge ratio (m/z) of the ionized analytes, and a detector that registers the number of ions at each m/z value (Aebersold & Mann, 2003). The two most common techniques used to volatize and ionize proteins or peptides for MS analysis are electrospay ionization (ESI) (Fenn, Mann, Meng, Wong, & Whitehouse, 1989) and matrix-assisted laser desorption/ionization (MALDI) (Karas & Hillenkamp, 1988). ESI desolvates and ionizes the analytes out of a solution and can be coupled with liquid-based separation tools such as liquid -chromatography (LC). MALDI sublimates and ionizes samples out of a dry, crystalline matrix via laser pulses and is normally used to analyze relatively simple peptide mixtures. A recent related technology is called surface-enhanced laser desorption/ionization (SELDI), where protein chip arrays are used to provide a variety of surface chemistries for researchers to optimize protein/peptide segregation, capture and analysis. The chemistries on these chips include classical chromatographic surfaces such as hydrophobic for reversed-phase capture, cation-and anion exchange surfaces, and immobilized metal affinity capture (IMAC) for capturing metal-binding (e.g., phosphorylated) proteins. Bound proteins are liberated by ionization (Jr et al., 1999). Figure 2 is adapted from Aebersold and Mann’s review in Nature (Aebersold & Mann, 2003), and shows a generic MS-based proteomics experiment. The five stages of a typical proteomics experiment are depicted, wherein proteins to be analyzed are first extracted from cells (stage 1) and then digested into peptides (stage 2) in order to enhance sensitivity of detection by mass alone. In stage 3, peptides elute from high-pressure liquid chromatography (HPLC) column ordered by hydrophobicity, making the mixture simpler for analysis. In stage 4, a mass spectrometer samples this mixture every few seconds,

131

Computer Aided Knowledge Discovery in Biomedicine

producing a mass spectrum of peptides eluting at each time point. In stage 5, peptides of selected masses are fragmented into sub-peptides; and a series of tandem mass spectrometric or MS/MS experiments ensue, producing MS/MS spectrums. Peptides are identified based on their MS and MS/MS spectra. Four basic types of mass analyzers are used in current proteome research (Aebersold & Mann, 2003) namely - the ion trap, time-of-flight (TOF), quadrupole and Fourier transform ion cyclotron (FT-MS) analyzers. Each can be used alone or in tandem in order to exploit the strengths of the approaches. MALDI is usually coupled to TOF analyzers that measure the mass of intact peptides, whereas ESI has mostly been coupled to ion traps and triple quadrupole instruments and used to generate fragmentation or collision-induced dissociation (CID) spectra of selected precursor ions (Aebersold & Goodlett, 2001). Due to its simplicity, excellent mass accuracy, high resolution and sensitivity, MALDI-TOF is a generally used technique to identify proteins by peptide-mass mapping or fingerprinting. Recently introduced MALDI-TOF/TOF-MS/MS instruments can also be used to generate CID spectra. Identification and quantification of the components of a complex protein sample is a multi-step operation. While instruments and methods are needed for separating, identifying and quantifying the polypeptides, tools are also required to integrate and analyze all of the produced data. Proteomics studies necessarily result in large amounts of data. Analysis of complete proteomes for biomarkers is therefore time-consuming and poses computational challenges, as the problem can be likened to search of a “needle in a haystack”. Quality of the high-throughput proteomic data, like that of high-throughput genomics data, can also be highly suspect. Biomarker discovery from clinical proteomic mass spectra requires computational techniques to select features that are relevant with respect to disease classification. The problem is particularly difficult due to the small number of available clinical samples, and the large number of features or analytes (m/z values) whose abundances are traced via mass spectral technologies such as MALDI and SELDI-TOF. In the machine learning and data-mining field, this problem is basically one of feature selection. Feature selection methods are divided into three typical groups: Filter, Wrapper and Embedded methods (Hauskrecht, Pelikan, Valko, & Lyons-Weiler, 2007). Filter methods rank each feature according to some univariate metric, and utilize only the highest ranked features. Wrapper algorithms (Kohavi & John, 1997) search for the best subset of features using all available features and a classification algorithm. Embedded methods incorporate feature selection as part of the model building process, for example the CART method (Breiman, Friedman, Olshen, & Stone, 1984). Gopalakrishnan et. al. (2006) describe the process by which biomarkers are discovered and validated for Amyotrophic Lateral Sclerosis (ALS), a rare but rapidly neurodegenerative disease for which there is currently no cure (Gopalakrishnan, Ganchev, Ranganathan, & Bowser, 2006). Proteomic mass spectral analyses of cerebrospinal fluid samples (CSF) from control and patient cohorts is performed using SELDI-TOF (Ranganathan et al., 2005). Statistical techniques and a wrapper-based rule learning (RL-Wrap) approach are applied to select putative biomarker panels that enable early detection of ALS. Three biomarkers are identified using peptide mass fingerprinting and tandem MS/MS, that are either decreased (transthyretin, cystatin C) or increased (carboxy-terminal fragment of neuroendocrine protein 7B2) in ALS CSF (Ranganathan et al., 2005). The latter was discovered only by the use of the rule learner. More details on the biomarker discovery and validation processes follow. Ranganathan et al. (2005) utilize Ciphergen ProteinChips (Ciphergen Biosystems, Inc. Palo Alto, CA, USA) to collect mass spectra from CSF samples. The SAX2 and IMAC binding surfaces yielded quality spectra with reasonable reproducibility. Total number of subjects used for mass spectrometry analyses was 23 ALS and 31 controls. Of these, 15 ALS and 21 controls formed the initial training group for pre-

132

Computer Aided Knowledge Discovery in Biomedicine

liminary data analyses, keeping 8 ALS and 10 controls blinded as a test set. For subsequent analyses, all the data was pooled and test sets were generated at random keeping a fairly even distribution of disease to control cases. Total ion current of all profiles was used to normalize each of the spectrograms. The Ciphergen 3.1 Biomarker Wizard application auto detected mass peaks by clustering. This output was analyzed using non-parametric Mann-Whitney analysis to yield 30 mass ion peaks with statistically significant (p < 0.01) differences between control and ALS subjects. Apart from the univariate analysis, non-linear modeling was performed using an inductive rule-learning algorithm, RL (Clearwater & Provost, 1990). This evolved from Meta-DENDRAL (Feigenbaum & Buchanan, 1993) which was used for predicting mass spectra of complex organic molecules. RL primarily searches a space of possible rules (IF-THEN statements) by successive specialization, guided by data in the training set and by prior knowledge. It learns a disjunctive set of weighted conjunctive rules. One of the distinguishing features of RL is its knowledge-based approach to learning. Prior knowledge can be used to guide the process by which its rule-based models are constructed. This may include the legal semantics and syntax for the rules plus additional bias about plausible and implausible relationships that are well agreed upon by the domain experts. RL models are easily understood by domain experts. This has been crucial to the successful application of RL to knowledge discovery in the various biomedical domains discussed herein. For this study, both raw and normalized spectral data were analysed. Due to the large space of features, a wrapper algorithm was developed which selected features and ran RL for each subset, until all features had been seen at least once by RL. Then, the rule-based models obtained from each subset are parsed to pool together only those features that appeared in the models. Then, RL was again applied to this final subset of features using the training data as input. The final model is then used to predict the class labels for the test data. A three-fold or five-fold cross-validation is utilized to tune the RL input parameters during the training. These parameters are then utilized for obtaining the final set of rules. To apply the rules to predict test data, the inference engine applies evidence gathering using ‘weighted voting’. Each rule in the model has a certain weight associated with it that reflects its degree of certainty as gathered from the training data. The degree of certainty is based on the proportion of correct class labels assigned by that rule to the total number of matches to the rules antecedents. A sample rule produced from RL applied to proteomic mass spectra (Gopalakrishnan et al., 2006) is shown below: ((zn3010.6341 in 0.302..0.481)) ==> (GROUP = ALS) CF=0.873, TP=10, FP=0,Pos=18,Neg=22 This rule states that if the normalized abundance of m/z value (or mass value) 3010.6341 produced from a Zn-IMAC SELDI chip is in the range of 0.302 to 0.481, the sample is classified as ALS with a certainty factor of 0.873. There are several functions available within RL for calculating the certainty factor for each rule. The number of true positives covered by that rule is 10 out a total of 18 positive examples. The total number of controls and ALS cases analyzed in this particular RL run is 40. Several models were obtained from the RL analyses. One best model was chosen that performed very well on a randomly chosen test set containing 7 ALS and 5 Control cases. The twelve features in this model were chosen for further experimental analyses – namely, peptide mass fingerprinting and tandem MS/ MS analyses. One novel peptide biomarker was identified directly via tandem MS/MS sequencing that

133

Computer Aided Knowledge Discovery in Biomedicine

yielded a 100% sequence match with the carboxy-terminal fragment of neuroendocrine protein 7B2. This finding presents a clue to the metabolic pathways of ALS and is both interesting and significant from a biomedical standpoint. Understanding and systematization of this process by which biomarkers are discovered from proteomic mass spectra will facilitate biomedical knowledge discovery as illustrated in the above case study. This would include obtaining and encoding prior knowledge of task-specific and domain-specific information. For example, knowledge about the type of clinical sample (e.g., blood, urine, CSF, tears, saliva) and known abundances of proteins found in that source would enable better feature selection for disease-specific biomarker discovery. Other types of prior knowledge would include: (a) relationships between proteins found in pathways and (b) the encoding of specific domain knowledge such as bond fragmentation patterns in MS data. Machine learning algorithms that can utilize such prior knowledge to help constrain the hypothesis space will be immensely useful in such tasks.

Protein S equence to S tructure Prediction and C omplex F old R ecognition Protein sequence to structure prediction is a fundamental problem in bioinformatics. Protein structure is described hierarchically starting with primary sequence represented by the polypeptide chain of amino acids, followed by secondary structure classified mainly into helix, sheet and coil. Tertiary structure represents the entire three-dimensional structure of a protein described by the location and spacing between atoms of one polypeptide chain. Quaternary structure refers to the three dimensional structure of more than one polypeptide chain, for example the hemoglobin macromolecule contains four polypeptide chains. Protein sequence databases such as the Swiss-Prot are much more populated than the structure database (PDB) due to the various difficulties associated with protein structure determination as discussed earlier. Hence, prediction of protein structure from sequence information is commonly performed as an attempt to model aspects of actual structure. It is believed that such models might provide clues to protein function. Protein secondary structure prediction has been extensively studied (Cuff and Barton, 1999; Rost, 2001). Since protein secondary structure refers to repetitive structural components based only on the backbone of a polypeptide chain without consideration of the individual amino acid side-chains and their interactions, there is an inherent information loss. Secondary structure prediction algorithms typically assign a prediction per residue along the sequence. Invariably, this results in loss of predictive accuracy per residue at the global sequence level of the polypeptide chain. The most difficult predictions are at the boundaries of helices, sheets and coils. Recent improvements have been made to structure prediction algorithms by incorporating evolutionary information, and also by combining the results of multiple independent prediction methods into a consensus prediction (Rost, 2001). Liu et al. (2004) compare probabilistic score combination methods for secondary structure prediction. Herein, the combination problem for protein sequences is formulated to take into account both short and long-range interactions so as to be able to consider the protein sequence as a whole as opposed to window-based methods which may not be able to capture constraints and dependencies of long-range interactions (Liu, Carbonell, Klein-Seetharaman, & Gopalakrishnan, 2004). Traditional window-based combination methods are compared with graphical models such as Hidden Markov Models (HMMs), Maximum Entropy Markov Models (MEMMs) (McCallum, Freitag, & Pereira, 2000) and chain-structured Conditional Random Fields (CRFs) (Lafferty, McCallum, & Pereira, 2001). Using the CB513 dataset by Cuff and Barton (1999) that contains 513 non-homologous proteins that have an SD score of

134

Computer Aided Knowledge Discovery in Biomedicine

Figure 3. (A) Representative structure for the parallel beta-helix fold from the PDB; (B) prior knowledge example: one rung of the repetitive beta-helix fold containing the conserved B2-T2-B3 segment (figure adapted from(Cowen, Bradley, Menke, King, & Berger, 2002) and (C) representative triple-beta spiral structure from the PDB.

less than five, a gold standard protein secondary structure assignment is made using the DSSP definition (Kabsch & Sander, 1983). This definition is based on hydrogen bonding patterns and geometrical constraints. DSSP assign one of eight labels to each amino acid – these labels are reduced to a standard set of three based on discussion by Cuff and Barton (1999): H and G to Helix (H), E and B to Sheets (E) and all others to Coil (C). The state-of-art performance achieved by window-based methods is by using PSI-BLAST profiles (Jones, 1999). Liu et al. (2004) tried four graphical models and discovered that CRFs perform the best. Overall, the graphical models for score combination yielded better accuracies for secondary structure prediction on this dataset compared to window-based methods. Standard prediction accuracy measures were utilized such as Q3 score for overall per-residue accuracy, Matthew’s correlation coefficients per structure type (CH, CC, CE) and segment of overlap (SOV) (Rost, Sander, & Schneider, 1994; Zemla, Venclovas, Fidelis, & Rost, 1999). Having discovered that CRFs performed very well for modeling protein secondary structure prediction particularly beta sheets that involve long-range interactions, Liu et al. (2006) proposed a variant named Segmentation Conditional Random Fields for modeling complex protein folds. Protein fold refers to frequent arrangement pattern of several secondary structure elements, such as the β−α−β structural motif. In contrast to traditional graphical models such as the Hidden Markov Model (HMM), SCRFs follow a discriminative approach allowing any set of features to be included. Globally optimal solutions are obtained for the model parameters using a convex optimization function. Potential long-range interactions are modeled within a special kind of graph, called the protein structural graph (Liu, Carbonell, Weigele, & Gopalakrishnan, 2006). This graph has an additional set of edges between nodes that represent segments of a protein sequence, classified into secondary structure elements that are within and outside the fold of interest. Given a protein sequence and a structural graph representing the repetitive elements of that fold, the SCRF models the conditional probability of a segmentation of the protein sequence given that graph. The parameters of the model are estimated from the training data, based on features extracted from sequences belonging to the fold family. The right-handed parallel beta helix fold (Figure 3 A&B) is mod-

135

Computer Aided Knowledge Discovery in Biomedicine

eled successfully using SCRFs. Only 14 structures with this fold have been resolved. These belong to nine beta-helix families of closely related proteins in the SCOP database (Murzin, Brenner, Hubbard, & Chothia, 1995). Cross-family validation shows that the SCRF model performs comparably to that of the heuristic BetaWrap algorithm (Bradley, Cowen, Menke, King, & Berger, 2001) developed for modeling the parallel beta helix fold. The generality of the SCRF model makes it useful for protein fold recognition. Potential members of the beta-helix fold family are identified from the UniProt reference databases (Leinonen et al., 2004). A few of these predictions were subsequently confirmed as beta-helices from recently crystallized proteins whose structures were resolved by X-ray crystallography (Liu, 2006). Quaternary structural folds consist of multiple protein chains that form chemical bonds among side chains to reach a structurally stable domain. The complexity associated with modeling the quaternary fold is handled in Liu et al. (2007) using a segmentation conditional graphical model (SCGM) along with efficient inference and learning algorithms for training and testing. This complexity arises because the labels of all chains have to be considered jointly since every chain contributes to the stability of the overall structure (Liu, Carbonell, Gopalakrishnan, & Weigele, 2007). While the SCGM model provides a flexible and scalable framework for utilizing structural properties of a protein fold, the choice of feature functions that represent segment-based features is key to accurate prediction. Two types of features are discussed in Liu et al. (2007). The node feature covers properties of an individual segment, such as “average hydophobicity” or, “length of the segment”. The pairwise feature captures dependencies between segments whose corresponding subsequences form chemical bonds in the three-dimensional structures (Liu et al., 2007). Liu et al. (2007) model two complex protein folds, the triple-β-spiral (van Raaij, Mitraki, Lavigne, & Cusack, 1999) and the double-barrel trimer.(Benson, Bamford, Bamford, & Burnett, 2004). The protein structure graph for the triple-β-spiral (TBS) is constructed based on observed characteristics of members of that fold family whose structures had been resolved and deposited in the PDB. Weigele et al. (2003) study members of the TBS fold family (Figure 3C) and make several observations about the structural characteristics (Weigele, Scanlon, & King, 2003). Such constraints constitute an example of prior biological knowledge constraining the model space (Liu et al., 2007). In this subsection the problem of complex fold recognition is studied and novel methods that utilize probabilistic graphical modeling are discussed. The methods are variants of conditional graphical models and can use prior information available about structural folds in order to model complex folds such as the Triple Beta Spiral. The prior information encoded is based on known partial sequencestructure information and sequence alignment of the protein families. The methods are significant in that they comprise general models for the particular complex fold being recognized and perform well even though the members of the fold family have very little sequence homology, and there exists only a sparse representation of resolved structures for the fold in the PDB.

F UT URE TRENDS Systems biology applications are of great importance to the future of biomedicine. The case studies described in this chapter represent significant research areas that challenge computational biology. Systematization of prior knowledge will enable efficient solutions to these challenges. Ontologies are beginning to gain popularity in sub-domains of bioinformatics. Enriching the information space provided by such ontologies will enable rapid retrieval for analysis purposes. Integration of ‘omic’ data with

136

Computer Aided Knowledge Discovery in Biomedicine

clinical and health records is an essential aspect of biomedical knowledge discovery. Furthermore, the discovery of more protein sequence-structure-function relationships that are core to systems biology will enhance the quality of bioinformatic databases.

C ONC LUSI ON This chapter presents a perspective on successful use of intelligent computational aids for knowledge discovery in three collaborative areas of biomedicine. The case studies represent different applications of machine learning techniques to various important biological problems, namely macromolecular crystallization, biomarker discovery from proteomic mass spectra and protein structure prediction via fold recognition. A common theme is the utilization of protein sequence information to derive proteinspecific properties that can serve as prior knowledge for guiding knowledge discovery. The learning algorithms are unique in that they can represent prior knowledge and use this to constrain the search space of possible models that can fit the data. Rule-based machine learning systems can facilitate biomedical knowledge discovery since these models are easily understood. Graphical models enable effective representation of prior knowledge that captures structure within the data.

REFERENCES Aebersold, R., & Goodlett, D. R. (2001). Mass spectrometry in proteomics. Chem Rev, 101(2), 269295. Aebersold, R., & Mann, M. (2003). Mass spectrometry-based proteomics. Nature, 422(6928), 198207. Benson, S. D., Bamford, J. K., Bamford, D. H., & Burnett, R. M. (2004). Does common architecture reveal a viral lineage spanning all three domains of life? Mol Cell, 16(5), 673-685. Berman, H. M., Battistuz, T., Bhat, T. N., Bluhm, W. F., Bourne, P. E., Burkhardt, K., et al. (2002). The protein data bank. Acta Crystallogr D Biol Crystallogr, 58(6, 1), 899-907. Bradley, P., Cowen, L., Menke, M., King, J., & Berger, B. (2001). BETAWRAP: Successful prediction of parallel beta -helices from primary sequence reveals an association with many microbial pathogens. Proc Natl Acad Sci U S A, 98(26), 14819-14824. Breiman, L., Friedman, J. H., Olshen, R. A., & Stone, C. J. (1984). Classification and regression trees. Belmont, CA: Wadsworth International Group. Clearwater, S., & Provost, F. (1990). RL4: A tool for knowledge-based induction. Paper presented at the Second International IEEE Conference on Tools for Artificial Intelligence (TAI-90). Cowen, L., Bradley, P., Menke, M., King, J., & Berger, B. (2002). Predicting the beta-helix fold from protein sequence data. J Comput Biol, 9(2), 261-276. Dougall, D. (2007). A protein sequence-properties evaluation framework for crystallization screen design. Unpublished Doctoral Dissertation, University of Pittsburgh.

137

Computer Aided Knowledge Discovery in Biomedicine

Ducruix, A., & Giege, R. (1992). Crystallization of nucleic acids and proteins: A practical approach. New York: Oxford University Press. Feigenbaum, E. A., & Buchanan, B. G. (1993). Dendral and meta-dendral - Roots of knowledge systems and expert system applications. Artificial Intelligence, 59(1-2), 233-240. Fenn, J. B., Mann, M., Meng, C. K., Wong, S. F., & Whitehouse, C. M. (1989). Electrospray ionization for mass spectrometry of large biomolecules. Science, 246(4926), 64-71. Gilliland, G. L., Tung, M., & Ladner, J. E. (2002). The biological macromolecule crystallization database: Crystallization procedures and strategies. Acta Crystallogr D Biol Crystallogr, 58(6, 1), 916-920. Gopalakrishnan, V., Buchanan, B. G., & Rosenberg, J. M. (2000). Intelligent aids for parallel experiment planning and macromolecular crystallization. Proc Int Conf Intell Syst Mol Biol, 8, 171-182, California. Gopalakrishnan, V., Buchanan, B. G., & Rosenberg, J. M. (2002). A simple simulator of protein crystallization. Journal of Applied Crystallography, 35(6), 727-733. Gopalakrishnan, V., Ganchev, P., Ranganathan, S., & Bowser, R. (2006). Rule learning for disease-specific biomarker discovery from clinical proteomic mass spectra. Springer Lecture Notes in Computer Science, 3916, 93-105. Gopalakrishnan, V., Livingston, G., Hennessy, D., Buchanan, B., & Rosenberg, J. M. (2004). Machinelearning techniques for macromolecular crystallization data. Acta Crystallogr D Biol Crystallogr, 60(Pt 10), 1705-1716. Hauskrecht, M., Pelikan, R., Valko, M., & Lyons-Weiler, J. (2007). Feature selection and dimensionality reduction in genomics and proteomics. In W. Dubitzky, M. Granzow & D. P. Berrar (eds.), Fundamentals of data mining in genomics and proteomics. Springer. Hennessy, D., Buchanan, B., Subramanian, D., Wilcosz, P. A., & Rosenberg, J. M. (2000). Statistical methods for the objective design of screening procedures for macromolecular crystallization. Acta Crystallographica D, 56, 817-827. Hennessy, D., Gopalakrishnan, V., Buchanan, B. G., Rosenberg, J. M., & Subramanian, D. (1994). Induction of rules for biological macromolecule crystallization. Proc Int Conf Intell Syst Mol Biol, 2, 179-187. Jancarik, J., & Kim, S. H. (1991). Sparse matrix sampling: A screening method for crystallization of proteins. Journal of Applied Crystallography, 24(409). Jones, D. T. (1999). Protein secondary structure prediction based on position-specific scoring matrices. J Mol Biol, 292(2), 195-202. Jr, G. W., Cazares, L. H., Leung, S. M., Nasim, S., Adam, B. L., Yip, T. T., et al. (1999). Proteinchip(R) surface enhanced laser desorption/ionization (SELDI) mass spectrometry: A novel protein biochip technology for detection of prostate cancer biomarkers in complex protein mixtures. Prostate Cancer Prostatic Dis, 2(5/6), 264-276.

138

Computer Aided Knowledge Discovery in Biomedicine

Jurisica, I., & Wigle, D. (2006). Knowledge discovery in proteomics. Chapman & Hall/CRC. Kabsch, W., & Sander, C. (1983). Dictionary of protein secondary structure: Pattern recognition of hydrogen-bonded and geometrical features. Biopolymers, 22(12), 2577-2637. Kantardjieff, K. A., & Rupp, B. (2004). Protein isoelectric point as a predictor for increased crystallization screening efficiency. Bioinformatics, 20(14), 2162-2168. Karas, M., & Hillenkamp, F. (1988). Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem, 60(20), 2299-2301. Kohavi, R., & John, G. (1997). Wrappers for feature subset selection. Artificial Intelligence, 97(1-2), 273-324. Lafferty, J., McCallum, A., & Pereira, F. (2001). Conditional random fields: Probablistic models for segmenting and labeling sequence data. Paper presented at the Eighteenth International Conference on Machine Learning (ICML’01), Williamstown, MA. Langley, P. (1998). The computer-aided discovery of scientific knowledge. Paper presented at the First International Conference on Discovery Science. Fukuoka, Japan. Leinonen, R., Diez, F. G., Binns, D., Fleischmann, W., Lopez, R., & Apweiler, R. (2004). UniProt archive. Bioinformatics, 20(17), 3236-3237. Liu, Y. (2006). Conditional graphical models for protein structure prediction. Unpublished Doctoral Dissertation, Carnegie Mellon University, Pittsburgh. Liu, Y., Carbonell, J., Gopalakrishnan, V., & Weigele, P. (2007). Protein quaternary fold recognition using conditional graphical models. Paper presented at the International Joint Conference on Artificial Intelligence - IJCAI’07. Liu, Y., Carbonell, J., Klein-Seetharaman, J., & Gopalakrishnan, V. (2004). Comparison of probabilistic combination methods for protein secondary structure prediction. Bioinformatics, 20(17), 3099-3107. Liu, Y., Carbonell, J., Weigele, P., & Gopalakrishnan, V. (2006). Protein fold recognition using segmentation conditional random fields (SCRFs). Journal of Computational Biology, 13(2), 394-406. Livingston, G., Rosenberg, J. M., & Buchanan, B. G. (2003). An agenda- and justification-based framework for discovery systems. Journal of Knowledge and Information Systems, 5(2), 133-161. McCallum, A., Freitag, D., & Pereira, F. (2000). Maximum entropy Markov models for information extraction and segmentation. Paper presented at the Seventeenth International Conference on Machine Learning (ICML’00), Stanford, CA, USA. Murzin, A. G., Brenner, S. E., Hubbard, T., & Chothia, C. (1995). SCOP: A structural classification of proteins database for the investigation of sequences and structures. J Mol Biol, 247(4), 536-540. Ranganathan, S., Williams, E., Ganchev, P., Gopalakrishnan, V., Lacomis, D., Urbinelli, L., et al. (2005). Proteomic profiling of cerebrospinal fluid identifies biomarkers for amyotrophic lateral sclerosis. J Neurochem, 95(5), 1461-1471.

139

Computer Aided Knowledge Discovery in Biomedicine

Rost, B., Sander, C., & Schneider, R. (1994). Redefining the goals of protein secondary structure prediction. J Mol Biol, 235(1), 13-26. Russell, S. A., Old, W., Resing, K. A., & Hunter, L. (2004). Proteomic informatics. Int Rev Neurobiol, 61, 127-157. Srinivas, P. R., Srivastava, S., Hanash, S., & Wright, G. L., Jr. (2001). Proteomics in early detection of cancer. Clin Chem, 47(10), 1901-1911. Srinivas, P. R., Verma, M., Zhao, Y., & Srivastava, S. (2002). Proteomics for cancer biomarker discovery. Clin Chem, 48(8), 1160-1169. van Raaij, M. J., Mitraki, A., Lavigne, G., & Cusack, S. (1999). A triple beta-spiral in the adenovirus fibre shaft reveals a new structural motif for a fibrous protein. Nature, 401(6756), 935-938. Weigele, P. R., Scanlon, E., & King, J. (2003). Homotrimeric, beta-stranded viral adhesins and tail proteins. J Bacteriol, 185(14), 4022-4030. Zemla, A., Venclovas, C., Fidelis, K., & Rost, B. (1999). A modified definition of Sov, a segment-based measure for protein secondary structure prediction assessment. Proteins, 34(2), 220-223.

KEY TERMS Clustering: The unsupervised grouping of data items in the absence of class labels. Conditional Random Fields (CRFs): These are undirected discriminative graphical models that directly compute the conditional likelihood of a hidden state sequence (y) given the observation sequence (x). This P(y|x) is proportional to the product of the potential functions over all the cliques in the graph. CRFs define the clique potential as an exponential function and guarantee finding of the global optimum since the optimization function is convex (Lafferty et al., 2001). Forward and backward probability calculations are derived similar to HMMs. Unlike HMMs, no assumptions are made about independence of the observed features. The feature definition can also be arbitrary, including overlapping features and long-range interactions (Liu et al., 2006). Feature Extraction: The process of extracting and building features from raw data such as the amino acid sequence of a protein. Feature functions are utilized to extract and process informative features that are useful for prediction. Hidden Markov Models (HMMs): These are directed chain-structured probabilistic graphical models that are generative in nature. They assume that the data are generated by a particular model and compute the joint distribution, P(x, y) of the observation sequence x, and the hidden state sequence y. Inductive Rule Learning: The development of IF-proposition-THEN-concept rule-based models from feature vectors, which are (attribute, value) pairs that describe the training examples. The rulebased models are expected to generalize to classify test examples accurately.

140

Computer Aided Knowledge Discovery in Biomedicine

Metabolomics: The study of small molecule metabolites and their expression within a system or organism. Supervised Machine Learning: The use of class labels as prior knowledge to learn discriminative models from training examples consisting of feature vectors descriptive of the target class. X-Ray Crystallography: The most general method for experimental determination of protein and other macromolecule three-dimensional structure. A good quality crystal is obtained first from a purified sample and then subjected to X-ray diffraction.

141

Section III

Genomics and Bioinformatics for Systems Biology

143

Chapter VIII

Function and Homology of Proteins Similar in Sequence: Phylogenetic Pro.ling

Thomas Meinel Max Planck Institute for Molecular Genetics, Germany

abstract The function of proteins is a main subject of research in systems biology. Inference of function is now, more than ever, required by the upcoming of novel protein sequences in consequence of the discovery of new proteomes. The calculation of sequence similarity is an easily feasible way to compute protein comparisons. The comparison of complete proteomes touches one of the earliest topics in bioinformatics; the biologically meaningful organization of proteins in protein families. Several approaches that interpret function or evolutionary aspects of proteins from sequence similarity are reviewed, which in particular reflects the arsenal of techniques introduced until now. Phylogenetic profiling, a method that compares a set of genes or proteins by their presence or absence across a given set of organisms, is also presented in this chapter. Proteins in a functional context, for example, a pathway or a protein complex, are represented by identical or similar phylogenetic profiles. The detection of functional contexts by phylogenetic profiling is also playing a prospective role as an analytic tool in systems biology. Already established tools for phylogenetic profiling as well as particular biological examples based on the SYSTERS protein family data set are presented.

INTR OD UCTI ON Protein sequence similarity is a feature that plays a central role in comparative proteomics for the inference of protein function or analysis of protein evolution. To study the complexity of functional cellular units like proteins, basic research can often only be conducted on animal models with the completely available experimental design. These studies are expected to play a significant role in medical research. Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Function and Homology of Proteins Similar In Sequence

Results are considered to be comparable with results from clinical diagnostics. It must be confirmed that results are transferable to human proteins if such experiments are not possible. Therefore, the determination of proteins with identical function in animal models and in human is essential. Evolution of life can be characterized by the development of species as well as by the divergence of protein sequences, and it is notable that also the development of protein function is an evolutionary process. Several more or less independent biological research fields are introduced to elucidate the backgrounds of a particular evolution event - often only under constraints of the temporary availability of appropriate methods. The development of techniques for a rapid and voluminous sequencing of DNA continues to lead to complete gene sets, genomes, for an increasing list of organisms. Computational techniques calculate the translation of genomic information to proteins including processes like alternative splicing or translation start site variation. The generation of all electronically inferred proteomes is based on such specific algorithms. In parallel to the development of those tools, new evolutionary events were detected and investigated. Some of them are evolutionary events like gene duplication, gene fusion or fission, protein domain rearrangements, horizontal gene transfer, multiple copy number of genes. In its first part, this book chapter emphasizes the reasons for distinguishing between sequence similarity and homology and function of proteins. Sequence similarity is a parameter that can be computed from a simple biophysical trait of a protein, the sequence, i.e., the primary protein structure. However, it is more complex to determine protein homology, even if it is plausible that proteins with common evolutionary history are similar in sequence. The other way around, in the context of bioinformatics, inference of homology is the interpretation of an observation - namely sequence similarity. The goal here is to determine similar proteins in recent organisms as descendants from a gene with common ancestry and thereby as homologs. The matter of inference of protein function can be discussed in the same way: Similar proteins possess with high probability a common ancestry and therefore similar function. But proteins can adopt function or are specialized during their evolutionary history. Proteins of similar function not necessarily possess similar sequence, therefore. Consequently, it is necessary to know existing protein sequence comparison methods and underlying methods for the partitioning of proteins into protein families. In fact, a scientist works with more or less closely related members of protein families when using an expression like ‘two homologous genes’. Methodological backgrounds of established data sets are therefore briefly reviewed by this book chapter. It is observed that proteins in a common functional context are evolutionary conserved in most of the organisms that own such a functional context. A phylogenetic profile is a pattern of presence or absence of a gene or protein across a given set of organisms. Phylogenetic profiling is a method that compares proteins by their phylogenetic profiles. Because proteins are different in organisms, a grouping of proteins is essential for the generation of a phylogenetic profile. Phylogenetic profiling is therefore depending on the method for partitioning of the protein space into protein families. This book chapter in its second part reviews the backgrounds of established phylogenetic profiling tools, restrictions to subsets of organisms on super-kingdom level, general limitations for the detection of functional contexts, and provides particular biological examples of phylogenetic profiles. Phylogenetic profiling as a method to infer unknown protein contexts or to elucidate contexts of proteins unknown in function becomes prospectively relevant in systems biology, and more so with the increasing number of complete eukaryotic proteomes. Function of proteins is a central issue of this review, as subject of detection for unknown proteins using sequence similarity and as subject of inference of functional contexts in phylogenetic profiling.

144

Function and Homology of Proteins Similar In Sequence

F UNCTI ON OF PR OTEINS Predicting and analyzing the function of novel proteins presents one of the main challenges in computational biology, more than ever since the number of proteins continuously explodes with the increasing number of completely sequenced organisms. Functionality models revealed from the analysis of particular chemical parameters, e.g., enzyme kinetics, and led to sketches of selective pathway maps. Nowadays, this knowledge provides the basis for comparative methods of protein function detection, as one of the main research topics in the field of systems biology.

A nnotating F unction of Proteins Only three percent of proteins in databases that are annotated with substantive information and annotations other than ‘unknown’ or ‘hypothetical’ are supported by experiments (Brown & Sjölander, 2006). For most of protein sequences, the annotation according function is acquired electronically from other similar sequences. This crucial point is well known and leads to a pretended reliability of sequence annotation for proteins (Valencia, 2005). Systematic errors in databases can hereby be propagated and are, if seldom detected, not necessarily corrected. Some approaches take this into account and claim for categorization only using physical parameters like structural properties or similarity of sequence. They do not take responsibility for functional classification. The SYSTERS protein family approach (Krause, Stoye, & Vingron, 2005), e.g., relies only on sequence similarity, the respective data set references annotations of protein sequence entries by extracting most common keywords. It is more advantageous to deduce protein function from structural or phylogenomic properties (Krishnamurthy, Brown, Kirshner, & Sjölander, 2006; Brown & Sjölander, 2006. Relying on phylogenomic trees includes the evolutionary aspect more than using purely sequence parameters. For instance, genome duplications or domain shuffling are hereby better regarded, spatial specialization or neofunctionalization of paralogous genes can be better detected. Excluding the so called in-paralogs, groups of orthologs can be more precisely classified by phylogenomics, but this is always difficult because evolutionary distances can extremely vary for particular orthologous groups (Luz & Vingron, 2006). Even if the three-dimensional protein structure stays conserved, a single exchange of amino acid residues at substrate-specific reaction centers can critically lead to a change in function. But it is very difficult to define general rules for the inference of a genomic-scale orthology data set. A performance assessment of orthology detection (Chen, Mackey, Vermunt, & Roos, 2007) used statistical techniques for a pairwise comparison of several methods, some of them are explained in the data sets section. Shift of function in protein subfamilies presents a special aspect in function prediction (Brown, Krishnamurthy, & Sjölander, 2007). Such conversions of protein function are analyzed and collected in the FunShift database (Abhiman & Sonnhammer, 2005a; 2005b). Subfamilies that are derived from Pfam families are analyzed (Mistry, Bateman, & Finn, 2007). They can possess conservation shifting sites, i.e., different amino acid residues at conserved sites with probable functional evidence, as well as rate shifting sites, i.e., sites of different evolutionary rates in two subfamilies.

Categorization According Predefined Functional Classes Enzymes or pathways include per se information on identified function. Experimental results comprised in enzyme data collections like IntEnz (Fleischmann et al., 2004) or Brenda (Barthelmes, Ebeling,

145

Function and Homology of Proteins Similar In Sequence

Chang, Schomburg, & Schomburg, 2007) have been developed. Functional enzymes in a pathway context are manually curated and analyzed in the KEGG database (Kanehisa et al., 2008) or Reactome (Vastrik et al., 2007). The GO annotation is a collection of structural or functional terms intended by the Gene Ontology Consortium (Ashburner et al., 2000). It attempts to annotate each gene or protein with GO terms, i.e., characterizing descriptions, and GO identifiers for standardization. Three categories (biological process, molecular function, cellular component) facilitate the structure, GO terms are organized in sublevels. Special attempts, GO tools and non-consortium tools, are available for searching and browsing, annotation, microarray analysis support and verify annotations through statistical support.

Ubiquitary and Organism Group-Specific Protein Function Housekeeping and information transduction genes are essential for a living organism and exist therefore as ubiquitary proteins in almost all organisms. Using those functional genes reveals advantageous phylogenetic or orthology analyses. Attempts that focus on the inference of the tree of life are frequently compared by the phylogeny of the ubiquitary 16S rRNAs that serves for a reference tree. In contrast, loss of essential genes that participate in pathways of the host organism is observed in parasitic or symbiotic organisms. There exist also many highly specialized proteins uniquely in small groups of organisms. They contribute, beyond gene regulation phenomena, to the individuality of those species.

SEQ UENCE SIMILARITY

AND H OMOLOGY

A sequence comparison procedure analyzes the primary protein structure of two proteins, the sequence. This is an observation and can be interpreted in an evolutionary sense as homology. In this section, the basics for sequence similarity and homology are described.

S imilarity of S equences The basis of most protein categorization approaches is a sequence comparison, well-known are routines like BLAST (Altschul et al., 1997) or the Smith-Waterman algorithm (Smith & Waterman, 1981). These widespread tools are known as applications that support fast access to biological data resources and prove their strengths in, for instance, the general task to confirm if a newly detected protein as similar to an already known protein. They are working with differences on the levels of technical background, algorithm assumption and time efficiency, but they generally consider local sequence similarity. Therefore, conserved protein substructures, mostly found as protein domains, govern a sequence comparison. The most frequently used comparison parameter is the expectation value, e-value, for the probability that two protein sequences are not randomly found in a sequence database. The e-value depends on the sequence length as well as the database size. Thus, querying two sequences obtained from two organisms against the proteome of the respective other organism, e-values differ from each other if, even identical, sequences are queried against proteomes of different sizes. This leads to the insight that an e-value is not only a parameter exclusively for relative considerations but also has to be determined in reciprocal directions.

146

Function and Homology of Proteins Similar In Sequence

Orthology, Paralogy Orthology and paralogy are key concepts of evolutionary genomics and are therefore discussed in depth (Koonin, 2005; Fitch, 2000; Sonnhammer & Koonin, 2002). Homology includes the terms orthology and paralogy. Two independent evolutionary processes towards two recent genes revealed, when diverged after a last speciation event, as two physically distinguishable protein sequences in both organisms, as homologs. Underlying processes are mutations, insertions, deletions, or events in higher dimensions like domain shuffling or changes in the gene order. These events, always infecting the information level - the DNA -, reveal in substantial changes of the result of translation, the protein (with the exception of synonymous mutations according to the ambiguity of the genetic code). Out of all proteins in both proteomes under consideration, it is therefore mostly probable and plausible that a close evolutionary relationship of proteins is reflected by higher sequence similarity compared to all other proteins in the proteome. Orthologs are per definition genes in two different species that have vertically descended from a single gene in the last common ancestor. Orthologs are considered to be detectable by sequence similarity. The best pairwise hit, as result of the similarity search of two proteomes against the other, is the central criterion in the InParanoid method (Remm, Storm, & Sonnhammer, 2001): Two so-called main orthologs, a term originally defined in the field of evolution, form the seed for an orthologous group, and other closely similar sequences of both organisms are successively added to the seed. Hence, the central step for this fully automatic approach is the all-against-all sequence comparison that can only indicate the underlying evolutionary process and can be used for such an interpretation. The analysis of homology is more complex because the number of paralogs, which resulted from a split and remained as similar proteins in a single organism, is often very large: Paralogs occur as results of genome duplications. Alternative splicing isoforms can technically not easily separated from duplication products by similarity measurements. All paralogous genes together are orthologs from the point of view of a closely similar gene in a second organism. The time points of both incidences, of speciation and of divergence start, are important and have to be distinguished: out-paralogs predate a species split, in-paralogs arose after a split into two species. The latter are, by definition and in the prevailing terminology, properly paralogs. Out-paralogs should be more precisely distinguished in the group of all orthologs. The nature of those definitions rules some basic computational approaches and the underlying methods. All-against-all comparisons by sequence similarity searches are the initial step in most of the methods described in this section. For analyses of hundreds of proteomes, any methodology is limited by the complexity of homology.

B est H its, S um of H its One widely used method for determining pairwise orthologs is the calculation of the reciprocal best hit. This one-to-one combination of sequences of two organisms can be expanded to a proteome-wide comparison. Much more frequent is the occurrence of multiple best hits. One-to-many or many-to-many sets are built by sum-of-hits approaches. In this case, high-scoring sequence pairs with distance measures smaller than the arbitrary distance threshold participate additionally to the core set of orthologs. A difficulty occurs if the reciprocal best hit concept is applied and more than two organisms are considered. Then, for three organisms {A; B; C}, for instance, the pairwise comparisons {A-B; A-C;

147

Function and Homology of Proteins Similar In Sequence

B-C} are to be calculated. Frequently, pairwise best reciprocal hits appear to sequence pairs as {a1-b1; a1-c1; b1-c2}. In this case, the individuals of A and B point at different sequences of proteome C (c1 and c2). It is obvious that this problem is increased with the number of proteomes. The categorization of proteins can be successful in the sum-of-hits manner, regarding the implications of orthology and paralogy. Methods that facilitate this goal are the focus of the next section.

SEQ UENCE SIMILARITY OF PR OTEIN FAMI LIES

IS A CAPAB LE PARAMETER

F OR THE INFERENCE

The common evolutionary background of proteins can, under the constraints discussed, be successfully determined by computational calculations that utilize sequence similarity. The presentation of methods that perform all-against-all comparisons of full-length proteins (mainly measuring local similarities) with the strategy of finding reciprocal best hits is the focus of this section. The publication by Krause (2006) reviews the history of protein family forming as well as backgrounds and descriptions of established approaches and data sets.

D ata Origin Types of data sets are either focused on the complete protein space, i.e., the set of known and available proteins, or a data set consists of a closed protein space, for instance by restriction to taxonomic groups like bacteria, eukaryotes, plants, animals. In each case, however, all available data reflect only a snapshot of the available knowledge of proteins. In public protein sequence databases, several tenthousands of organisms are represented by at least one protein sequence. Currently round about 600 complete proteomes, with sizes between 500 and 25,000 proteins, are known. The number is steadily increasing. Also refined methods that determine proteins from genomic information via new alternative splicing isoforms or alternative start site transcripts enhance the space of (putative) homologous proteins in sequence databases. To categorize sequences from a global organism set regards the evolutionary aspect more than a sequence set that is reduced regarding only a subgroup of organisms. However, a reduction of the sequence space is often necessary.

Preprocessing of D ata Taking into account the high variability and the large amount of proteins is one of the challenging tasks in optimizing algorithms, the available technical background, software, or computing time. An answer for limited capacity can be the reduction of the sequence space. This is frequently the reason for a pre-selection by a similarity criterion, e.g., 97, 80, or 50 percent. Universal protein sequence databases like UniProt (The UniProt Consortium, 2008) serve for sequence subsets and can be utilized for such restrictions, UniRef50 is a set with a similarity level of 50 percent. To achieve the complete sequence space, an replenishing step is required that follows the protein family inference processing.

Measures of S equence S imilarity and D istance Most frequently used distance measures are calculated from similarity scores. These distance measures and subsequently calculated e-values, which serve as essential decision parameters, are required in the 148

Function and Homology of Proteins Similar In Sequence

categorization phase. They are calculated by prominent alignment-dependent approaches like BLAST or the Smith-Waterman algorithm. A similarity score sub-summarizes the validation result of a comparison in each single letter position within two character strings of protein sequences. Hereby, a pre-calculation of average ratios is used which examined the mutation from each single amino acid towards another. Such a mutation probability matrix, known as a scoring matrix, implicates models of evolution (Dayhoff, Schwartz, & Orcutt, 1978; Henikoff & Henikoff, 1992). The basis for computing similarity scores are pairwise alignments including gaps that indicate deletions or inventions and gap penalties that have influence on the scoring. The character string comparison is performed on a pairwise protein sequence alignment. Such a significance test on often not clearly similar sequences utilizes local alignments, and e-values are calculated from local similarity scores. The BLAST algorithm is a heuristic search method and is used for approximate local sequence similarity. Newer concepts also consider alignment-free distant measures (Kelil, Wang, Brzezinski, & Fleury, 2007).

C ategorization Methods aimed at the partitioning of data to subsets wherein common traits are shared are clusterings. Variations of clusterings are adapted for special tasks. A concept of a categorization is smart if it relies solely on information within the data. Clusterings satisfy this requirement. Single linkage clustering is a common, computationally cheap and well-studied categorization method in sequence comparison analyses that use distances. Hierarchical clusterings, as one application option, organize sub-clusters and further sub-levels in a tree structure. Applying a hierarchical clustering on protein sequences, the result is a protein sequence tree. Herein, edge lengths correspond to the distance measure. The choice of a suitable threshold to separate biologically meaningful sub-clusters is the crucial point of hierarchical clusterings. Sophisticated attempts with dynamical distance measure cutoffs, more widely than fixed cutoffs, are introduced to separate clusters of coherent proteins. Other methods of protein sequence partitioning utilize techniques like Markov clustering (confer next section) or spectral clustering (Paccanaro, Casbon, & Saqi, 2006). Automated phylogenetic trees based on a particular similarity measure and followed by subsequent partitioning (Kelil, Wang et al. 2007) are reported to serve for a successful categorization as well as layout based heuristics for weighted cluster editing (Wittkop, Baumbach, Lobo, & Rahmann, 2007).

SEQ UENCE -BASED

PR OTEIN FAMI LY DATA SETS

Pre-selection of data and applied methods that are aimed at to infer protein families from sequence information stand in a close connection to the resulting data set. In this book chapter, some approaches that claim for the inference or detection of orthology are included under the umbrella term protein family. Established protein family inferring approaches and underlying methods that utilize whole sequence information are explained in this section.

SYSTERS SYSTERS (systematic re-search) is initially introduced as a set-theoretical approach. In the current version, a hierarchical clustering (Krause, Stoye, & Vingron, 2005) utilizes the whole protein space 149

Function and Homology of Proteins Similar In Sequence

from publicly accessible protein sequence resources. Starting with an all-against-all Smith-Waterman comparison on the basis of a pre-calculated non-redundant protein sequence set (80 percent criterion), a single linkage tree of the non-redundant set is constructed from pairwise sequence distances. The internal structure of the tree, i.e., the data itself, separate SYSTERS superfamilies using a specific characteristic, the subtree size, to determine dynamical e-value cutoffs. In a second step a graph-based approach, the minimal cut algorithm, subdivides superfamily graphs into clusters. These so called SYSTERS protein families are formed fully automatically and are the working entities of the SYSTERS data set. Sequences closely related to sequences of the non-redundant set are added to respective families. Hence, they are completing the redundant protein sequence set as it was achieved from the data resources. SYSTERS restrictively stands for the clustering of similar sequences and references terms of homology or function from annotations of the single sequence entries. However, additional information - posterior calculated phylogenetic trees and multiple alignments - is achievable in the web server (Meinel, Krause, Luz, Vingron, & Staub, 2005) and supports the clustering of sequences towards SYSTERS protein families.

C OG : C lusters of Orthologs Completely sequenced archaeal and bacterial proteomes were compared by an all-against-all BLAST search (Tatusov, Koonin, & Lipman, 1997). The formation of a cluster of orthologous groups, COGs, initially succeeds for closely similar genes of three organisms, a triangle represents the similarity measures of the pairwise best hits as edges. If this triangle is detected to comprise a common edge to further triangles, these mutually consistent genome-specific best hits were merged to that COG. The core domain architecture of a protein drives the construction of a COG using position-specific scoring matrices for individual domains. Multi-domain proteins that artificially bridge a COG were manually split into individual domains and support the assignment of COGs in accordance with their distinct evolutionary affinities. Examinations and visual inspections follow the intermediate classification. In a later update version of the COG database, few eukaryotic genomes were added to the data set, now called as KOG (Tatusov et al., 2003), by a special software, the COGNITOR program.

T ribeMC L: T ribes, E nsembl F amilies The TribeMCL algorithm compares protein sequences in an all-against-all manner using BLAST, and pairwise asymmetric results are cutoff-restricted. Expectation values enter into a so called MarkovMatrix that can be represented as connection graph (Enright, Van Dongen, & Ouzounis, 2002). The Markov Clustering (MCL) procedure simulates a random walk through this graph by iterative rounds by alternating decision parameters until the result is robust. This bootstrapping-like procedure allows protein families hidden in the graph to become visible by gradually stripping the graph down to its basic components. For the Tribes database (Enright, Kunin, & Ouzounis, 2003), protein sequences of 83 complete genomes of all three super-kingdoms of life entered into the procedure; for the Ensembl database, TribeMCL is used to infer Ensembl families only for currently more than 25 eukaryotic organisms into the Ensembl database (Flicek et al., 2008), wherein some of them are still incomplete as draft genomes. Ensembl provides an alternative orthology and paralogy prediction method in contrast to Ensembl Families. Advanced sequence-based and phylogeny-based approaches are combined in Ensembl Orthologies. The method can be conferred by http://www.ensembl.org/info/about/docs/compara/homology_method.html.

150

Function and Homology of Proteins Similar In Sequence

InParanoid Proteins of currently 35 eukaryotic organisms are taken into the calculation of similarity scores, for the detection of two so-called main orthologs as well as of adequate in-paralogs. The main orthologs are the seed sequences of an orthologous group and is passed by a best hit similarity score. Closest related sequences of each of the two organisms, in-paralogs, are successively added to the seed if the similarity to their organism-specific correspondent is within the score. Out-paralogs are more distant from the main orthologs and form an own group. Each group is restricted to a pair of organisms, and orthologs from other organisms will not be respected in the group (Remm, Storm, & Sonnhammer, 2001; O’Brien, Remm, & Sonnhammer, 2005). Results are available in the InParaniod database (Berglund, Sjölund, Ostlund, & Sonnhammer, 2008). For extension of this approach on multiple proteomes and circumvent the restriction by pairwise considerations, a subsequent clustering using the InParanoid output was introduced. The algorithm called MultiParanoid (Alexeyenko, Tamas, Liu, & Sonnhammer, 2006) merges multiple pairwise ortholog groups into ortholog groups of multiple proteomes.

OrthoMC L OrthoMCL is a graph clustering algorithm that identifies homologous proteins based on sequence similarity (Li, Stoeckert, & Roos, 2003; Chen, Mackey, Stoeckert, & Roos, 2006). Species are compared in order to detect putative orthologs by the reciprocal best hit. In-paralogs are identified within the same genome that are more similar to each other compared to any sequence from other genomes. OrthoMCL, as a fully automated method, combines the homology definitions of the InParanoid approach with the technique of the Markov clustering (that is also used for TribeMCL) to resolve the many-to-many orthologous relationships inherent in comparisons across multiple genomes.

P-POD The Princeton Protein Orthology Database, P-POD (Heinicke et al., 2007), results from the idea to compare automatically derived orthology with knowledge from literature. OrthoMCL is the underlying automatic algorithm. P-POD claims to be a comparative genomics analysis tool that combines phylogenetic relationships and information from curated literature or other resources oriented in issues like diseases. It appeals particularly to experimentally working biologists who are achieving information from or about genes in well-studied model organisms.

OTHER

ATTEMPTS

THAT DETECT

PR OTEIN FAMI LIES

Protein domains as well as phylogenies, that are based on multiple sequence alignments are used to categorize proteins into protein families beyond pure whole sequence-oriented methods.

Pfam Protein domains are conserved functional substructures and therefore possess an evolutionary background. The Pfam database (Finn et al., 2006)) comprehends round about 8,000 manually curated

151

Function and Homology of Proteins Similar In Sequence

protein families. They are generated using Hidden Markov Models (HMMs; a statistically supported method) for protein domains. Therefore, Pfam families are domain driven. To respect evolutionary relationships, Pfam families are organized in so called clans, respecting the fact that artificially high thresholds frequently separate two related families or divergent members of families which cannot be regarded in a HMM.

PhIG s The Phylogenetically Inferred Groups (PhIGs) database introduces known evolutionary relationships in addition to protein sequence distances from a BLAST all-against-all comparison to an iterative hierarchical clustering (Dehal & Boore, 2006). In contrast to the prior presented attempts, multiple sequence alignments of proteins are used to derive orthology from sequence information. A complete phylogenetic gene tree is created using widely accepted analytic methods of molecular evolution.

T reeF am For the TreeFam database (Li et al., 2006; Ruan et al., 2008), orthology of genes is declined from phylogenetic trees of all animal gene families considering that the analysis of phylogenetic trees is an established and very accurate way of determining orthology. 25 animal genomes are regarded in phylogenetic trees. The TreeFam database provides in its major part, TreeFam-B, phylogenetic trees that are automatically generated using clusters of PhIGs as seed. A second part consists of manually curated trees (TreeFam-A; which comprises less than 10 % of all trees).

TAX ON OMY AND THE N UMBER OF C OMPLETE LY SEQ UENCED ORGANISMS The overwhelming number of bioinformatics approaches relies on a taxonomy that is provided by the NCBI (Wheeler et al., 2004). NCBI collects expert knowledge and provides references for the included organisms. The data set is maintained daily. The NCBI taxonomy serves for universally used digital taxonomic identifiers, the TaxIDs. Lineages to each organism are provided as well as the universal taxonomic tree including internal nodes like super-kingdom, class, order, family and species or sublevels like subspecies as leaves. In phylogenetic analyses, species as well as subspecies as well as strains are often considered as operational taxonomic units, a synonym to the notation organisms. In addition to TaxIDs, a second taxonomic nomenclature is provided by the taxonomic division of the ExPASy server (ExPASy Proteomics Server, 2008) and is used in the UniProt and Swiss-Prot databases. It is characterized by the usage of mnemonics that abbreviate organism names most frequently by five letters. Respective organisms are a subset of the NCBI taxonomy, corresponding organisms are linked via standard NCBI TaxIDs. In practice, Swiss-Prot combines those mnemonics with gene names in protein sequence identifiers (e.g., SYFA_HUMAN, human phenylalanyl tRNA-synthetase alpha chain). Currently, round about 25 eukaryotic genomes are completely analyzed. Due to the easier sequencing according to smaller genome sizes and the importance under biotechnological or disease aspects, the number of bacterial and archaeal genomes is much larger, above 550 and round about 50, respectively.

152

Function and Homology of Proteins Similar In Sequence

Completed and ongoing genome projects are recorded in the GOLD database (Liolios, Mavromatis, Tavernarakis, & Kyrpides, 2008).

PHY LOGENETIC

PR OFI LING

Phylogenetic Profiles Combine Gene Presence Information with Taxonomic Information; Phylogenetic Profiling A phylogenetic profile is a presence or absence pattern of a discrete gene or protein across a given set of organisms. The array of organisms can be organized with respect to their taxonomy. Then, phylogenetic profiles (or phyletic patterns, synonymously) visualize the presence of a gene or protein in a systematic and easily readable way. Proteins of organisms, that are represented in the phylogenetic profile, are usually not identical by sequence. Therefore, a phylogenetic profile has generally to be associated to an instance that categorizes proteins, e.g., to protein families as presented in a prior section. Hence, the population of a phylogenetic profile depends on the protein family inferring method. It is remarkable that a phylogenetic profile generally represents a protein family that contains at least one member protein of each of organisms represented. A phylogenetic profile serves for a taxonomic overview about a protein family. Vice versa, a protein family can be identified by a phylogenetic profile. Phylogenetic profiling achieves a comparison of several phylogenetic profiles. Similar or identical profiles possess a special importance with biological background.

C onservation of Proteins in a F unctional C ontext Leads to a C onservation of Phylogenetic Profiles If a functional context of proteins is evolutionary conserved and is occurring in a set of organisms, affiliated proteins possess also a common evolutionary history. Each of the essential proteins must survive against any evolutionary pressure. Then, this group of organisms contributes co-inherited members to respective protein families and therefore to identical presence indications in each single phylogenetic profile. Hence, the idea was emphasized that similar phylogenetic profiles could be used to predict functional relationships between proteins of unknown function (Pellegrini, Marcotte, Thompson, Eisenberg, & Yeates, 1999). A functional context concerns proteins that are in a physical contact (e.g., interactions among proteins or domains of proteins) or enzymes in a shared pathway. However, similar or identical profiles do not necessarily indicate common functional context. Ubiquitary families of essential proteins, that are merely present in two organisms are not necessarily functionally related or co-evolved, but are represented by phylogenetic profiles with presence indications for all organisms. Analogously, there might also exist organism-specific protein families that are not involved in a common functional background but are characterized by similar phylogenetic profiles. It could be shown (Jothi, Przytycka, & Aravind, 2007) that the correlation is weak between profile similarity measured by mutual information and membership in a KEGG pathway measured by scoring similarities albeit only informative organisms were careful filtered out for the analysis. A hierarchical

153

Function and Homology of Proteins Similar In Sequence

clustering of phylogenetic patterns of COGs (Glazko & Mushegian, 2004) analyzed the pattern distance, graphs producing methods, the partitioning into subgraphs, and the estimation of error rates for the prediction of functional linkage. Several measures for phylogenetic patters were introduced (Wu, Kasif, & DeLisi, 2003), the simplest is the Hamming distance that counts the differences of each position in a profile. Other measures successfully applied are the Pearson correlation coefficient and mutual information. This assessment revealed that similar as well as complementary profiles possess similarities to common KEGG pathways. The calculation of the overlap of gene pairs to Gene Ontologies was used to benchmark methods and metrices that compare phylogenetic profiles (Cokus, Mizutani, & Pellegrini, 2007). The organism set of the most phylogenetic profiling approaches is dominated by the bacterial and the archaeal super-kingdom. More interesting in the context of clinical studies is the inclusion of eukaryotic organisms. The Ensembl database serves for sequence and protein family information of several eukaryotes. PhyloPat (Hulsen, de Vlieg, & Groenen, 2006) is initiated to summarize all Ensembl orthologs into phylogenetic patterns. However, assessments on phylogenetic profiles excluding prokaryotic proteins revealed poor results (Snitkin, Gustafson, Mellor, Wu, & DeLisi, 2006; Jothi, Przytycka, & Aravind, 2007). Convergence events, non-orthologous gene displacements, can lead to a complementary profile combination. This means that all presence states in the first profile are absence state in the second and vice versa. However, two complementary profiles with proteins of identical functional background do not necessarily indicate convergence. If the family inferring approach separates two divergent groups of proteins with common history into two protein families like in the SYSTERS data set, both respective phylogenetic profiles are complementary, too.

Phylogenetic Profiles on the Basis of the SYSTERS Data Set Phylogenetic profiling basing on the SYSTERS data set is introduced in regard to several boundaries. E.g., at least three completely sequenced organisms must contribute proteins to a protein family and therefore to the set of phylogenetic profiles. The SYSTERS subset with protein families of that quality is called PhyloMatrix (Meinel, Krause, Luz, Vingron, & Staub, 2005). 106 organisms of all three super-kingdoms are included to the profile set, the current release from 2003 consists of 78 bacterial, 12 eukaryotic, and 16 archaeal proteomes (organisms in taxonomic order are available upon web request). 7,563 unique phylogenetic profiles represent 19,374 SYSTERS protein families, 1,933 families are characterized by a single profile that comprises the three organisms human, mouse, and pufferfish. This might plausibilize the correlation of unspecific profiles in eukaryotic phylogenetic profiling as assessed by several authors. A specificity of the PhyloMatrix profile set is, according to the original SYSTERS clustering procedure, the partitioning of obviously orthologous sequences into separate protein families that are not quenched together by a post-processed manual curation. Therefore, phylogenetic profiling in SYSTERS can additionally be used for evolutionary studies of divergence phenomena. A special group of ubiquitary proteins with a central role in the information transduction chain shall demonstrate this SYSTERS specificity as well as serve for an example for phylogenetic profiling basing on PhyloMatrix. It is also traceable in the SYSTERS web interface. Figure 1(a) presents an example that illustrates the classical profiling approach - two proteins in a functional context comprise a similar phylogenetic profile - and the specificity of the SYSTERS clustering

154

Function and Homology of Proteins Similar In Sequence

Figure 1. (a) Phylogenetic profiles (o/-; presence/absence) of three SYSTERS protein families in superfamily 115499 (profiles A to C) and four families in SYSTERS superfamily 113736 (profiles D to G). All seven families comprise phenylalanyl tRNA-synthetases. A functional context, here given by two protein subunits, is observed for protein families in profile combinations A-D and B-E. Confer the PhyloMatrix web service for details. (b) Protein domain composition (colored; Pfam code) in α-subunits, β-subunits and compartment-specific isoforms of phenylalanyl tRNA-synthetases, clustered in two SYSTERS superfamilies (SF) and seven SYSTERS protein families (PF), confer Figure 1. Eukaryotic isoforms are distinguished according to the respective cellular compartmentalization. SYSTERS superfamily 115499 SYSTERS protein family 141095 - Phenylalanyl-tRNA synthetase alpha subunit A ------------------------------------------------------------------oo---------- oooooooooo-o oooooooooooooooo SYSTERS protein family 141096 - Phenylalanyl-tRNA synthetase alpha subunit B oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo--oooooooooo ------------ ---------------SYSTERS protein family 141094 - mitochondrial Phenylalanyl-tRNA synthetase C ------------------------------------------------------------------------------ ooooooooo--o ----------------

||||

SYSTERS superfamily 113736 SYSTERS protein family 139353 - Phenylalanyl-tRNA synthetase beta subunit D ------------------------------------------------------------------oo---------- oooooooooo-o oooooooooooooooo SYSTERS protein family 139351 - Phenylalanyl-tRNA synthetase beta subunit E oooooooo-ooooooooooooooooooooooooooooooooooooooooooooooooooooooooo--oooooooooo ----o------- ---------------SYSTERS protein family 139354 - hypothetical protein F ------------------------------------------------------------------------------ ooo-ooo----- ---------------SYSTERS protein family 139352 - Phenylalanyl-tRNA synthetase beta subunit G ---------------------------------------ooooooooooooooooo---------------------- ------------ ----------------

(a)

(b)

to separate more divergent groups of proteins from each other. Aminoacyl tRNA-synthetases, aaRSs, link highly specifically amino acids to the cognate tRNAs as key components in the protein translation machinery. Sequence similarities and distances for protein sequences of aaRSs are well-studied in prokaryotes (Woese, Olsen, Ibba, & Söll, 2000). Phenylalanyl tRNA-synthetases, PheRSs, comprise, in bacteria as well as in archaea, both alpha and beta subunits. These two groups of interacting proteins

155

Function and Homology of Proteins Similar In Sequence

are clustered separately from each other in two SYSTERS superfamilies; respective profile pairs are similar: A-D and B-E. However, each superfamily is split in, at least, two main protein families. Figure 1(b) illustrates slightly different protein domain compositions observable in both bacterial subunits. The generalized sketch for the respective SYSTERS protein families 141096 (alpha subunits) and 139351 (beta subunits) reveals one or two additional domains in comparison to archaeal and eukaryotic proteins (Wolf, Aravind, Grishin, & Koonin, 1999). This difference forces the separation of the sequences into the two SYSTERS protein families PF 141095 and PF 139353 indicated by complementary phylogenetic profiles presented in Figure 1(a) by the profile pairs A-B and D-E. Here, the evolutionary history can be verified as divergence. In addition, the endosymbiotic history seems to be reflected by a third family albeit the annotation in the respective entries is poor (confer the SYSTERS web server for more information). While cytosolic proteins in eukaryotes are combined with archaeal proteins, mitochondrial proteins are clustered additionally in their own family PF 141094. Figure 1(b) discloses that two functions, one of a single domain of the bacterial alpha subunit and one of a single domain in the beta subunit, are comprised towards a single mitochondrial protein consisting of two concatenated domains with an obviously preceding history. The given example of phenylalanyl tRNA-synthetases very insistently demonstrates those influences of several evolutionary events that can be observed by phylogenetic profiles: The early separation towards archaea and bacteria is reflected by complementary pattern pairs, the endosymbiosis event by co-occurrence of two alpha-like subunits in eukaryotes, and the similarity (or identity) of profiles base on the functional context of alpha and beta subunits. Aminoacyl tRNA-synthetases, aaRSs, are equally key components of the information transduction chain generally ubiquitary proteins. In Figure 2, phylogenetic profiles demonstrate this for at least fourteen aaRSs by the presence in all organisms, some of them are comprised in a single protein family. At least two protein families exist for each of the six other aminoacyl tRNA-synthetases separating archaeal from bacterial proteins. Eukaryotic proteins are exclusively clustered together with archaeal proteins - GlyRSs and, as explained previously, both PheRS subunits -, or exclusively clustered together with bacterial proteins, LysRSs. This is supported by (nearly perfect) complementary phylogenetic profiles. A separate mitochondrial protein family is known at least for PheRSs. According to the endosymbiont theory, whereby mitochondrial proteins are recruited from an invasive bacterium, mitochondrial aaRSs in eukaryotes are more similar to bacterial than to archaeal proteins. This is visible in profiles for LysRSs, but also for ProRSs, TrpRSs and TyrRSs. Eukaryotes possess additionally archaea-like, cytosolic proteins for the latter three aminoacyl tRNA-synthetases. In the protein family pairs of aaRSs complementary patterns base on divergence even if an affiliation to common SYSTERS superfamilies is not always given (data available in the web server). For both GlyRS families, for instance, the common structural superclass is evident (data not shown). Locally complementary profiles are found for GlyRSs, LysRSs, and ProRSs within the bacterial super-kingdom, for LysRSs and SerRSs within the archaeal super-kingdom. Proteins can be specific for a group of organisms. Horizontal gene transfer can frequently be observed in the bacterial super-kingdom and is detectable by phylogenetic profiles. Spirochaetes, a separate bacterial taxonomic class, are known for an individual behavior in profiles. Also the two single bacterial presence indicators in the given example, profile A and D in Figure 1(a), belong to this effect. Horizontal gene transfer leads to single presence states outside of an organism group in the profile of an organism-specific protein family.

156

Function and Homology of Proteins Similar In Sequence

Figure 2. Significant phylogenetic profiles for all twenty aminoacyl tRNA-synthetases (o/-, presence/ absence): ubiquitary SYSTERS protein families for Ala, Cys, His, {Ile, Leu, Val}, Met, Arg, Ser, Thr, {Asp, Asn, Glu, Gln} specificity, and organism-specific SYSTERS protein families for Phe, Gly, Lys, Pro, Trp, Tyr specificity. IUPAC-IUB three-letter codes for amino acids stands for the aminoacyl specificity of respective tRNA-synthetases. A facultative minor letter indicates subunits of a protein complex, a, alpha; b, beta; e, epsilon; m, mitochondrial. Curly brackets indicate that groups of aminoacyl tRNAsynthetases are unified in a single SYSTERS Protein Family (e.g., PF 139203 for Ile, Leu, Val) due to high sequence similarities. |||| oooooooo-ooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo oooooooooo-o oooooooooooooooo PF 143119 Ala oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo oooooooooo-o ooooooo-ooo-oo-o PF 143743 Cys ------------------------------------------------------------------oo---------- oooooooooo-o oooooooooooooooo PF 141095 Phe-a oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo--oooooooooo ------------ ---------------- PF 141096 Phe-a ------------------------------------------------------------------------------ ooooooooo--o ---------------- PF 141094 Phe-m ------------------------------------------------------------------oo---------- oooooooooo-o oooooooooooooooo PF 139353 Phe-b oooooooo-ooooooooooooooooooooooooooooooooooooooooooooooooooooooooo--oooooooooo ----o------- ---------------- PF 139351 Phe-b oooooo--------------------------------------------oooo--oooooooo-oooo---o----- oooooooooo-o oooooooooooooooo PF 141159 Gly ------oooooooooooooooooooooooooooooooooooooooooooo----oo--------o----ooo-ooooo ----o------o ---------------- PF 152193 Gly oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo oooooooooo-o oooooooooooooooo PF 138672 His oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo oooooooooo-o oooooooooooooooo PF 139203 {Ile,Leu,Val} ----o-------------------------------------------------------------oo---------- ------------ o---oooooooooooo PF 149724 Lys ooooooooooooooooooooooooo--ooo--oooooooooooooooooooooooooooooooooo--oooooooooo oooooooooo-o -ooo-oo--------- PF 138269 Lys ------------------------ooo--ooo---------------------------------------------- ------------ ---------------- PF 149725 Lys ooooo-oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo oooooooooo-o oooooooooooooooo PF 137021 Met o-----oooooooooooooooooo-----------ooo-----------o-------o-ooooo--o-o---o----- oooooooooo-o oooooooooooooooo PF 138344 Pro -oooooooooooooooooooooooooooooooooooooooooooooooo-ooooooooo-----oo-o-ooo-ooooo ooooooooo--- ---------------- PF 127052 Pro oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo oooooooooo-o oooooooooooooooo PF 150167 Arg oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo oooooooooooo ooooooo-ooo-oo-o PF 146233 Ser ----------------------------o------------------------------------------------- ------------ -------o---o--o- PF 129876 Ser oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo oooooooooo-o oooooooooooooooo PF 143907 Thr ------------------------------------------------------------------------------ oooooooooo-o oooooooooooooooo PF 143128 Trp oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo oo-oooooo--o ---------------- PF 143124 Trp ------------------------------------------------------------------------------ oooooooooo-o oooooooooooooooo PF 137023 Tyr oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo ooooooooo--o ---------------- PF 139117 Tyr

oooooooooooooooooooooooooo-ooooooooooooooooooooooooooooooooooooooooooooooooooo oooooooooo-o oooooooooooooooo PF 138346 {Asp,Asn} ------------------------------------------------------------------------------ ------------ oooooooooooooooo PF 142105 Gln-e oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo ooooooooo--o ---------------- PF 138345 {Glu,Gln} ooooooooooooo--ooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo ooooooooo--o oooooooooooo--oo PF 140465 {Asp-a,Asn-a, Gln-a,Glu-a} oooooo---------o--------oo-oooooooooooooooooooooooooooooo-oooooooooooooooooooo oo-oooooo--o ooo-oooo---o--oo PF 142104 {Asp-b,Asn-b, Gln-b,Glu-b} ||||

Analyses Using Phylogenetic Profiles Co-inheritance was predicted by functional annotations using pairs of phylogenetic profiles as well as genome-wide proteins network linkages in baker’s yeast or the bacterium Escherichia coli (Date & Marcotte, 2003; Wu, Hu, & DeLisi, 2006; Zheng, Roberts, & Kasif, 2002). The modularity in the evolution of functional modules, sets of orthologous groups expressed in blocks of phylogenetic patterns, was analyzed and quantified (Snel & Huynen, 2004). It was shown that the interspecies flexibility depends on functional differentiation within orthologous groups. In other words, it cannot be expected that the

157

Function and Homology of Proteins Similar In Sequence

functional basis of a phylogenetic pattern is perfectly respected by all members of a protein family as well as the organism composition of the pattern is perfect. In the study of Snel and Huynen (2004), several data types of origin were acquired: metabolic pathways, protein complexes, transcriptional modules. This gives an impression of the universality of using phylogenetic profiling. Other reference sets use homologous proteins with reference proteins (Pellegrini, Marcotte, Thompson, Eisenberg, & Yeates, 1999; Marcotte, Pellegrini, Thompson, Yeates, & Eisenberg, 1999), in-detail-studies within a protein group of interest like tRNA-synthetases (Dohm, Vingron, & Staub, 2006), clusters of orthologs (Tatusov, Koonin, & Lipman, 1997), Pfam protein domains (Ye & Godzik, 2004; Pagel, Wong, & Frishman, 2004; Yang, Doolittle, & Bourne, 2005), proteins associated to distinct pathways (Dandekar, Schuster, Snel, Huynen, & Bork, 1999) or analyze keywords (Liberles, Thoren, von Heijne, & Eloffson, 2002). Phylogenetic profiles were helpful for the subcellular localization of protein groups (Marcotte, Xenarios, van Der Bliek, & Eisenberg, 2000). Very effective is the simultaneous visualization for phylogenetic profiles and networks restricted to respective compounds (Doerks, von Mering, & Bork, 2004).

Phylogenetic Profiling Approaches Most of prominent phylogenetic profiling approaches are established in the world wide web. URLs of exemplary internet services are provided: •

•

•

• •

• •

•

158

The COG data set (http://www.ncbi.nlm.nih.gov/COG/) can be directly accessed by browsing phylogenetic profiles. COGs are the basis for many studies on phylogenetic profiles referenced in this review. PhyloMatrix (http://systers.molgen.mpg.de/PhyloMatrix/): SYSTERS is a fundamental data resource for protein families. The underlying method is an automated approach that strictly bases on sequence similarity. In the PhyloMatrix web service, various query options provide access to phylogenetic profiles of SYSTERS protein families as well as an outlink from each protein family serves for access to the PhyloMatrix tool. PhyloPat (http://www.cmbi.ru.nl/phylopat/) is based on Ensembl families and comprises more than 25 genomes. This service possesses a high-quality web functionality and allows for access by profiles to respective gene families. OrthoMCL (http://www.orthomcl.org) provides phyletic patterns for orthologous groups of protein sequences from multiple eukaryotic genomes. The STRING database (http://string.embl.de) provides simultaneously information about the taxonomic distribution for proteins and respective networks of gene neighborhood, (von Mering et al., 2007). ProLinks (http://dip.doe-mbi.ucla.edu/pronav/) is integrated in the Database of Interacting Proteins and contains a phylogenetic pattern search option with text display output (Bowers et al., 2004). PLEX (http://bioinformatics.icmb.utexas.edu/plex/), the Protein Link EXplorer (Date & Marcotte, 2005), provides phylogenetic profiles accompanied by quantitative estimates of linkage confidence. PhylProM (http://www.sbc.su.se/~anna/PhylProM/index.html) is one of the first services that introduced keyword-based phylogenetic profiling (Liberles, Thoren, von Heijne, & Eloffson, 2002).

Function and Homology of Proteins Similar In Sequence

DISC USSI ON This book chapter reviews the sequence-based origin of information for methods that determine functional properties and evolution of proteins. Evolutionary events can be observed in three dimensions: divergence of sequences, speciation, and divergence of protein function. The arrows in Figure 3 illustrate the evolution of these three dimensions. Techniques for determining sequence similarity are considered as well as subsequent clustering procedures including several attempts of categorization towards orthology or similarity. Here, sequence-based or appropriate phylogeny-inferring methods are utilized for the respective approaches. As illustrated in Figure 3, the sequence-information-based term ‘protein family’ or, alternatively, the evolutionary term ‘ortholog’ can be deemed to be the link between sequence grouping information and taxonomic information. Many computational attempts combine the

Figure 3. There are three dimensions of evolution covered by computational molecular biology: divergence of sequences, speciation towards organisms, and invention or divergence of function. A protein sequences distance, which is a measure for the divergence of two sequences, is suggested by the interspace of two dots; protein sequences as grayish dots; two different methodological approaches, dotted or solid circles, are assumed. Speciation is visualized as a symbolic taxonomic tree with organisms as leaves, dark squares. Family proteins (or orthologs; corresponding to the inferring method) combine information about clustering and species but not regarding function. To comprise proteins in enzymes, respectively pathways, is a categorization of protein function across organisms without sequence information. In paralogs, function can be slightly shifted for sequences within a single organism and with common evolutionary history. Phylogenetic profiling (PP) can be applied on both family proteins or enzymes.

P ro te in S e q u e n c es

O rg a n is m s PP

pa

e or nzy pa me th w s ay s PP

fam ily p roteins or o rthologs

ra lo g s

P ro te in F u n c tion

159

Function and Homology of Proteins Similar In Sequence

term ‘function’ with the result from inference of orthology. However, function more often possesses own evolutionary aspects: there can exist functional shifts caused by mutations, or function differences between isoforms. Therefore, protein function cannot be directly determined from orthology, it can be, at most, deduced from it. Each protein family definition depends on the methodology of protein comparisons and categorization. One aspect that rules the partitioning of proteins is the extremely different speed of evolution for different proteins. Induced problems often can only be attempted by manual curation. In approaches that are induced to detect homology function, a motivation for manual curation can preferentially occur. The SYSTERS method clusters similar proteins without possible limitation by manual curation. In contrast to this, it is remarkable that some approaches rely often only on sequence similarity while claiming to infer orthology. Therefore, similarly like in already established in phylogeny-based approaches, it is an advantage to cumulate information and include phylogeny methods to a purely family-forming approach than to claim for orthology. At this point, it is suggested to generally add assured information on function to the knowledge about sequence similarity. A concept of ‘functional orthology’ would reduce the number of respective ortholog candidates, as for instance existing in alternative splicing isoforms, and give a more exact picture of comparable proteins in different organisms. Orthologous connections between organisms also would hereby raise from the current information level, the gene level, to the transcript/protein level towards the operational biological unit that currently is not the case. This would also support the portability of information on function from animal models to other organisms like human and could be achieved by including additional experimental evidence to cluster information, for instance by data from microarray-based experiments. Phylogenetic profiles in general provide visualized information about the taxonomic distribution of a single protein family. As illustrated in Figure 3, phylogenetic profiling works in parallel to a clustering of sequences with origin from different organisms and combines several protein families. It can be used to indicate functional contexts by pattern similarity because it works independent from the knowledge on function or functional contexts of respective protein families. A refinement of phylogenetic profiling can be achieved either with extension of the organism number in the profile or with a refined definition of the biological entity. In comparison to the current number of prokaryotic organisms, currently a few hundred, the number of eukaryotic proteomes (twenty to thirty) are very sparse for phylogenetic profiling. Specific bacterial protein contexts are well to observe within the broad bacterial sub-pattern, for instance flagellar proteins. Many prokaryotes of the bacterial superkingdom are pathogens and therefore of interest for research on pathogenic-induced diseases. Here, phylogenetic profiling can help to understand protein functionality within the bacterial super-kingdom. Parasites, a special group of prokaryotes, are observable by special presence or absence indications in phylogenetic profiles and related protein families are directly detectable. Eukaryotic proteomes support significantly the endosymbiont hypothesis for mitochondria in combination with respective complete prokaryotic sub-patterns. Many eukaryotic protein families show unresolved all-presence indications in phylogenetic profiles. The currently sparse resolution within the eukaryotic sub-pattern would be increased with an exhaustive increase in research on proteomes of eukaryotes. Currently more than 25 Ensembl organisms are available in the PhyloPat approach. Here, however, phylogenetic profiling of eukaryotes is not supported with prokaryotic sequence information of evolutionary relevance. The information content of the biological entity, i.e., the protein family or cluster of orthologous genes, varies with the underlying methodological approach. Modulating or extending the approach,

160

Function and Homology of Proteins Similar In Sequence

the definition of a biological entity can be refined towards increased information content in terms of function or evolution. Any biological entity can be the instance that is assigned with a phylogenetic profile, whereas a change of the definition background not necessarily induces changes in the profile. Phylogenetic profiling using SYSTERS protein families, for instance, extends the original functional context approach wherein a particular pattern represented a singular gene (family): The evolutionary complexity can be resolved in a SYSTERS superfamily by differentiation into separate SYSTERS protein. Here, additional divergence information can be detected. In general, there exists a competition regarding divergence and convergence within complementary profiles. A general observation in SYSTERS is that the detection of divergence is more frequent than the detection of convergence. However, in the case when many similar sequences of a particular organism occur in a single protein family, additional discrimination between orthology and paralogy or the usage of the functional orthology concept would increase the accuracy of this method. Phylogenetic profiles are generated for many established data sets or are initiated for separate purposes of assessments. Most of them are BLAST-based attempts, many validations are using the COG data set. Phylogenetic profiling on other prominent protein classification systems, in particular phylogeny-based attempts, consequently would refine insights into the efforts that the phylogenetic profiling method gives. Phylogenetic profiling currently only combines two scientific fields, taxonomy with function or taxonomy with sequence information. In the latter case, function verified by experiments as the third evolutionary field should be introduced to improve the tagging or even solidify the inference of functional contexts. A restriction to experimental confirmed function information, for instance by the functional orthologs concept, would give a higher information quality, not only for the protein family but also for phylogenetic profiling. Phylogenetic profiling offers the opportunity to gain insight into large-scale data by an intuitive, easily readable and fast visualization.

ACKN OW LEDGMENT TM hereby wants to thank Antje Krause for a fundamental introduction into the field of computational molecular biology in its particular view on protein families. Valuable hints for the concept of this review are adopted from her thesis.

REFERENCES Abhiman, S., & Sonnhammer, E. L. (2005a). Large-scale prediction of function shift in protein families with a focus on enzymatic function. Proteins, 60(4), 758-768. Abhiman, S., & Sonnhammer, E. L. (2005b). FunShift: A database of function shift analysis on protein subfamilies. Nucleic Acids Research, 33(Database issue), 197-200. Alexeyenko, A., Tamas, I., Liu, G., & Sonnhammer, E. L. (2006). Automatic clustering of orthologs and inparalogs shared by multiple proteomes. Bioinformatics, 22(14), 9-15.

161

Function and Homology of Proteins Similar In Sequence

Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., et al. (1997). Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Research, 25(17), 3389-3402. Ashburner, M., Ball, C. A., Blake, J. A., Botstein, D., Butler, H., Cherry, J. M., et al. (2000). Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nature Genetics, 25(1), 25-29. Barthelmes, J., Ebeling, C., Chang, A., Schomburg, I., & Schomburg, D. (2007). BRENDA, AMENDA and FRENDA: The enzyme information system in 2007. Nucleic Acids Research, 35(Database issue), 511-514. Berglund, A. C., Sjölund, E., Ostlund, G., & Sonnhammer, E. L. (2008). InParanoid 6: eukaryotic ortholog clusters with inparalogs. Nucleic Acids Research, 36(Database issue), 263-266. Bowers, P. M., Pellegrini, M., Thompson, M. J., Fierro, J., Yeates, T. O., & Eisenberg, D. (2004). Prolinks: A database of protein functional linkages derived from coevolution. Genome Biology, 5(5), R35. Brown, D. P., Krishnamurthy, N., & Sjölander, K. (2007). Automated protein subfamily identification and classification. PLoS Computational Biology, 3(8), e160. Brown, D., & Sjölander, K. (2006). Functional classification using phylogenomic inference. PLoS Computational Biology, 2(6), e77. Chen, F., Mackey, A. J., Stoeckert, C. J., & Roos, D. S. (2006). OrthoMCL-DB: querying a comprehensive multi-species collection of ortholog groups. Nucleic Acids Research, 34(Database issue), 363-368. Chen, F., Mackey, A. J., Vermunt, J. K., & Roos, D. S. (2007). Assessing performance of orthology detection strategies applied to eukaryotic genomes. PLoS ONE, 2(4), e383. Cokus, S., Mizutani, S., & Pellegrini, M. (2007). An improved method for identifying functionally linked proteins using phylogenetic profiles. BMC Bioinformatics, 8 Suppl 4, S7. Dandekar, T., Schuster, S., Snel, B., Huynen, M., & Bork, P. (1999). Pathway alignment: application to the comparative analysis of glycolytic enzymes. The Biochemical Journal, 343, 115-124. Date, S. V., & Marcotte, E. M. (2003). Discovery of uncharacterized cellular systems by genome-wide analysis of functional linkages. Nature Biotechnology, 21(9), 1055-1062. Date, S. V., & Marcotte, E. M. (2005). Protein function prediction using the Protein Link EXplorer (PLEX). Bioinformatics, 21(10), 2558-2559. Dayhoff, M., Schwartz, R., & Orcutt, B. (1978). Atlas of protein sequence and structure (Vol. 5). Silver Spring: National Biomedical Research Foundation. Dehal, P. S., & Boore, J. L. (2006). A phylogenomic gene cluster resource: The Phylogenetically Inferred Groups (PhIGs) database. BMC Bioinformatics, 7, 201. Doerks, T., von Mering, C., & Bork, P. (2004). Functional clues for hypothetical proteins based on genomic context analysis in prokaryotes. Nucleic Acids Research, 32(21), 6321-6326. Dohm, J. C., Vingron, M., & Staub, E. (2006). Horizontal gene transfer in aminoacyl-tRNA synthetases including leucine-specific subtypes. Journal of Molecular Evolution, 63(4), 437-447.

162

Function and Homology of Proteins Similar In Sequence

Enright, A. J., Kunin, V., & Ouzounis, C. A. (2003). Protein families and TRIBES in genome sequence space. Nucleic Acids Research, 31(15), 4632-4638. Enright, A. J., Van Dongen, S., & Ouzounis, C. A. (2002). An efficient algorithm for large-scale detection of protein families. Nucleic Acids Research, 30(7), 1575-1584. ExPASy Proteomics Server. (2008). UniProt Knowledgebase: Controlled vocabulary of species. Retrieved March 13, 2003, from ftp://ftp.expasy.org/databases/uniprot/knowledgebase/docs/speclist.txt Finn, R. D., Mistry, J., Schuster-Bockler, B., Griffiths-Jones, S., Hollich, V., Lassmann, T., et al. (2006). Pfam: Clans, Web tools and services. Nucleic Acids Research, 34(Database issue), 247-251. Fitch, W. M. (2000). Homology a personal view on some of the problems. Trends in Genetics, 16(5), 227-231. Fleischmann, A., Darsow, M., Degtyarenko, K., Fleischmann, W., Boyce, S., Axelsen, K. B., et al. (2004). IntEnz, the integrated relational enzyme database. Nucleic Acids Research, 32(Database issue), 434-437. Flicek, P., Aken, B. L., Beal, K., Ballester, B., Caccamo, M., Chen, Y., et al. (2008). Ensembl 2008. Nucleic Acids Research, 36(Database issue), 707-714. Glazko, G. V., & Mushegian, A. R. (2004). Detection of evolutionarily stable fragments of cellular pathways by hierarchical clustering of phyletic patterns. Genome Biology, 5(5), R32. Heinicke, S., Livstone, M. S., Lu, C., Oughtred, R., Kang, F., Angiuoli, S. V., et al. (2007). The Princeton Protein Orthology Database (P-POD): a comparative genomics analysis tool for biologists. PLoS ONE, 2(1), e766. Henikoff, S., & Henikoff, J. G. (1992). Amino acid substitution matrices from protein blocks. Proceedings of the National Academy of Sciences of the United States of America, 89(22), 10915-10919. Hulsen, T., de Vlieg, J., & Groenen, P. M. (2006). PhyloPat: Phylogenetic pattern analysis of eukaryotic genes. BMC Bioinformatics, 7, 398. Jothi, R., Przytycka, T. M., & Aravind, L. (2007). Discovering functional linkages and uncharacterized cellular pathways using phylogenetic profile comparisons: a comprehensive assessment. BMC Bioinformatics, 8, 173. Kanehisa, M., Araki, M., Goto, S., Hattori, M., Hirakawa, M., Itoh, M., et al. (2008). KEGG for linking genomes to life and the environment. Nucleic Acids Research, 36(Database issue), 480-484. Kelil, A., Wang, S., Brzezinski, R., & Fleury, A. (2007). CLUSS: Clustering of protein sequences based on a new similarity measure. BMC Bioinformatics, 8, 286. Koonin, E. V. (2005). Orthologs, paralogs, and evolutionary genomics. Annual Review of Genetics, 39, 309-338. Krause, A. (2006). Large scale protein sequence clustering - not solved but solvable. Current Bioinformatics, 1(2), 247-254.

163

Function and Homology of Proteins Similar In Sequence

Krause, A., Stoye, J., & Vingron, M. (2005). Large scale hierarchical clustering of protein sequences. BMC Bioinformatics, 6, 15. Krishnamurthy, N., Brown, D. P., Kirshner, D., & Sjölander, K. (2006). PhyloFacts: An online structural phylogenomic encyclopedia for protein functional and structural classification. Genome Biology, 7(9), R83. Li, H., Coghlan, A., Ruan, J., Coin, L. J., Hériché, J. K., Osmotherly, L., et al. (2006). TreeFam: A curated database of phylogenetic trees of animal gene families. Nucleic Acids Research, 34(Database issue), 572-580. Li, L., Stoeckert, C. J., & Roos, D. S. (2003). OrthoMCL: identification of ortholog groups for eukaryotic genomes. Genome Research, 13(9), 2178-2189. Liberles, D. A., Thoren, A., von Heijne, G., & Eloffson, A. (2002). The use of phylogenetic profiles for gene predictions. Current Genomics, 3, 131-137. Liolios, K., Mavromatis, K., Tavernarakis, N., & Kyrpides, N. C. (2008). The genomes on line database (GOLD) in 2007: Status of genomic and metagenomic projects and their associated metadata. Nucleic Acids Research, 36(Database issue), 475-479. Luz, H., & Vingron, M. (2006). Family specific rates of protein evolution. Bioinformatics, 22(10), 11661171. Marcotte, E. M., Pellegrini, M., Thompson, M. J., Yeates, T. O., & Eisenberg, D. (1999). A combined algorithm for genome-wide prediction of protein function. Nature, 402(6757), 83-86. Marcotte, E. M., Xenarios, I., van Der Bliek, A. M., & Eisenberg, D. (2000). Localizing proteins in the cell from their phylogenetic profiles. Proceedings of the National Academy of Sciences of the United States of America, 97(22), 12115-12120. Meinel, T., Krause, A., Luz, H., Vingron, M., & Staub, E. (2005). The SYSTERS Protein Family Database in 2005. Nucleic Acids Research, 33(Database issue), 226-229. Mistry, J., Bateman, A., & Finn, R. D. (2007). Predicting active site residue annotations in the Pfam database. BMC Bioinformatics, 8, 298. O‘Brien, K. P., Remm, M., & Sonnhammer, E. L. (2005). Inparanoid: a comprehensive database of eukaryotic orthologs. Nucleic Acids Research, 33(Database issue), 476-480. Paccanaro, A., Casbon, J. A., & Saqi, M. A. (2006). Spectral clustering of protein sequences. Nucleic Acids Research, 34(5), 1571-1580. Pagel, P., Wong, P., & Frishman, D. (2004). A domain interaction map based on phylogenetic profiling. Journal of Molecular Biology, 344(5), 1331-1346. Pellegrini, M., Marcotte, E. M., Thompson, M. J., Eisenberg, D., & Yeates, T. O. (1999). Assigning protein functions by comparative genome analysis: Protein phylogenetic profiles. Proceedings of the National Academy of Sciences of the United States of America, 96(8), 4285-4288. Remm, M., Storm, C. E., & Sonnhammer, E. L. (2001). Automatic clustering of orthologs and in-paralogs from pairwise species comparisons. Journal of Molecular Biology, 314(5), 1041-1052. 164

Function and Homology of Proteins Similar In Sequence

Ruan, J., Li, H., Chen, Z., Coghlan, A., Coin, L. J., Guo, Y., et al. (2008). TreeFam: 2008 Update. Nucleic Acids Research, 36(Database issue), 735-740. Smith, T. F., & Waterman, M. S. (1981). Identification of common molecular subsequences. Journal of Molecular Biology, 147(1), 195-197. Snel, B., & Huynen, M. A. (2004). Quantifying modularity in the evolution of biomolecular systems. Genome Research, 14(3), 391-397. Snitkin, E. S., Gustafson, A. M., Mellor, J., Wu, J., & DeLisi, C. (2006). Comparative assessment of performance and genome dependence among phylogenetic profiling methods. BMC Bioinformatics, 7, 420. Sonnhammer, E. L., & Koonin, E. V. (2002). Orthology, paralogy and proposed classification for paralog subtypes. Trends in Genetics, 18(12), 619-620. Tatusov, R. L., Fedorova, N. D., Jackson, J. D., Jacobs, A. R., Kiryutin, B., Koonin, E. V., et al. (2003). The COG database: An updated version includes eukaryotes. BMC Bioinformatics, 4, 41. Tatusov, R. L., Koonin, E. V., & Lipman, D. J. (1997). A genomic perspective on protein families. Science, 278(5338), 631-637. The UniProt Consortium. (2008). The universal protein resource (UniProt). Nucleic Acids Research, 36(Database issue), 190-195. Valencia, A. (2005). Automatic annotation of protein function. Current Opinion in Structural Biology, 15(3), 267-274. Vastrik, I., D’Eustachio, P., Schmidt, E., Joshi-Tope, G., Gopinath, G., Croft, D., et al. (2007). Reactome: A knowledge base of biologic pathways and processes. Genome Biology, 8(3). von Mering, C., Jensen, L. J., Kuhn, M., Chaffron, S., Doerks, T., Kruger, B., et al. (2007). STRING 7-recent developments in the integration and prediction of protein interactions. Nucleic Acids Research, 35(Database issue), 358-362. Wheeler, D. L., Church, D. M., Edgar, R., Federhen, S., Helmberg, W., Madden, T. L., et al. (2004). Database resources of the National Center for Biotechnology Information: update. Nucleic Acids Research, 32(Database issue), 35-40. Wittkop, T., Baumbach, J., Lobo, F. P., & Rahmann, S. (2007). Large scale clustering of protein sequences with FORCE -A layout based heuristic for weighted cluster editing. BMC Bioinformatics, 8, 396. Woese, C. R., Olsen, G. J., Ibba, M., & Söll, D. (2000). Aminoacyl-tRNA synthetases, the genetic code, and the evolutionary process. Microbiology and Molecular Biology Reviews, 64(1), 202-236. Wolf, Y. I., Aravind, L., Grishin, N. V., & Koonin, E. V. (1999). Evolution of aminoacyl-tRNA synthetases--analysis of unique domain architectures and phylogenetic trees reveals a complex history of horizontal gene transfer events. Genome Research, 9(8), 689-710. Wu, J., Hu, Z., & DeLisi, C. (2006). Gene annotation and network inference by phylogenetic profiling. BMC Bioinformatics, 7, 80.

165

Function and Homology of Proteins Similar In Sequence

Wu, J., Kasif, S., & DeLisi, C. (2003). Identification of functional links between genes using phylogenetic profiles. Bioinformatics, 19(12), 1524-1530. Yang, S., Doolittle, R. F., & Bourne, P. E. (2005). Phylogeny determined by protein domain content. Proceedings of the National Academy of Sciences of the United States of America, 102(2), 373-378. Ye, Y., & Godzik, A. (2004). Comparative analysis of protein domain organization. Genome Research, 14(3), 343-353. Zheng, Y., Roberts, R. J., & Kasif, S. (2002). Genomic functional annotation using co-evolution profiles of gene clusters. Genome Biology, 3(11).

K ey terms BLAST: Basic Local Alignment Search Tool. A heuristic algorithm for searching of similar words or sequences in databases. Distance Measure: Measure to compare protein sequences by their amino acid composition. Subsumming validations of two character states (amino acids on an identical position) in a similarity measure leads to the similarity score. The distance is the difference of the relative similarity to 1. E-Value: Parameter that describes the probability that a protein or nucleotide sequence is not randomly found in a sequence database. Local Sequence Similarity: Similarity of two sequences is often found only on a local sequence level by a sequence comparison algorithm (e.g., BLAST). Identical partial subsequences are found in protein domains, for instance, and induce local sequence similarity. Multiple Sequence Alignment: Three ore more sequences are displayed in a picture with comparable characters in a column (for proteins: amino acid residues). Pairwise Sequence Alignment: Two sequences are displayed in two rows with comparable characters, amino acid residues for protein sequences, in columns. Phylogenetic Profile: Presence/absence indication for a family of genes or proteins across a given set of organisms. A phylogenetic profile represents a gene or protein family by serving for a taxonomic overview. Phylogenetic Profiling: Comparison of two or more phylogenetic profiles. Protein families of functional contexts possess similar phylogenetic profiles. Similarity Of Sequences: Two protein sequences can be compared in each amino acids position. Identical residues or similar biophysical behavior of compared amino acids determines sequence similarity. Necessary is an alignment of at least two protein sequences. Similarity Score: Measure of exchange of each of all twenty amino acids towards each of the remaining nineteen others with organization in a scoring matrix.

166

167

Chapter IX

Computational Methods for the Prediction of GPCRs Coupling Selectivity Nikolaos G. Sgourakis Rensselaer Polytechnic Institute, USA Pantelis G. Bagos University of Central Greece, and University of Athens, Greece Stavros J. Hamodrakas University of Athens, Greece

abstract GPCRs comprise a wide and diverse class of eukaryotic transmembrane proteins with well-established pharmacological significance. As a consequence of recent genome projects, there is a wealth of information at the sequence level that lacks any functional annotation. These receptors, often quoted as orphan GPCRs, could potentially lead to novel drug targets. However, typical experiments that aim at elucidating their function are hampered by the lack of knowledge on their selective coupling partners at the interior of the cell, the G-proteins. Up-to-date, computational efforts to predict properties of GPCRs have been focused mainly on the ligand-binding specificity, while the aspect of coupling has been less studied. Here, we present the main motivations, drawbacks, and results from the application of bioinformatics techniques to predict the coupling specificity of GPCRs to G-proteins, and discuss the application of the most successful methods in both experimental works that focus on a single receptor and large-scale genome annotation studies.

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Computational Methods for the Prediction of GPCRs Coupling Selectivity

INTR OD UCTI ON / BACKGR

OUND

G-protein coupled receptors (GPCRs) comprise a very important family of eukaryotic cell-surface membrane proteins. They are characterized by the structural hallmark of seven transmembrane helices, as exemplified by the crystal structure of rhodopsin (Palczewski et al. 2000), that has been extensively used as a homology modeling template for many receptor sequences (Nikiforovich et al. 2001; Becker et al. 2003). GPCRs play a pivotal role in signal transduction of eukaryotic cells, acting as the major sensors at the boundary between a cell and the outside world. Depending on their ligand-binding specificity, GPCRs can be activated by a broad range of external stimuli, from ions and small molecules to larger peptides and proteins, including light (Gether 2000). To perform these functions, GPCRs have evolved to a diversity of sequences that are traditionally classified in six major families, based mainly on shared homology (Horn et al. 2003). GPCRs have known representatives in most eukaryotic organisms, including yeast and plants, such as the recently discovered Arabidopsis thaliana seven-transmembrane (7TM) domain receptor GCR1 (Jones and Assmann 2004). As signified by their name, upon binding to a ligand, GPCRs exert their role through the specific interaction with a more limited repertoire of intracellular proteins that hydrolyze GTP, namely the G-proteins (Neer and Clapham 1988). G-proteins are heterotrimeric complexes composed of three subunits Gα, Gβ and Gγ. They are classified into four main families, according to the type of their αsubunit, which also possesses Ras-like GTPase activity (Benjamin et al. 1995). These include Gs and Gi/o, which stimulate and inhibit adenylate cyclase, respectively (Johnston and Watts 2003), Gq/11, that activates phospholipase C (Exton 1993) and the less characterized G12/13 family that activates the Na+/H+ exchange pathway (Kurose 2003). At least 16 different subtypes of Gα subunits have been identified and classified in these four families (Downes and Gautam 1999; Kristiansen 2004). Interaction of the G-protein trimer with the activated receptor triggers the exchange of the bound GDP with GTP, and subsequently the dissociation of the complex to Gα and Gβγ moieties, that activate downstream effector molecules. Hydrolysis of GTP to GDP by the α subunit renders the complex to its original, inactive state (Neer 1995). As a result, depending on the selectivity of the GPCR - G-protein interaction, a specific downstream pathway may be activated. Despite extensive experimental and computational studies, the structural basis of this specificity is not well characterized, while the mechanisms that determine the function of the activated GPCR/G-protein complex are yet to be uncovered (Muramatsu and Suwa 2006). Furthermore, the diversity of GPCR-G-protein interactions is enriched by several receptors that may alternatively interact with more than one family of G-proteins, known as promiscuous GPCRs. For instance, the human thyrotropin receptor can couple to all four G-protein families (Laugwitz et al. 1996). In general, promiscuity seems to be a rule rather than an exception for interactions between GPCRs and G-proteins (Wess 1998; Oliveira et al. 1999; Horn et al. 2000). Several lines of evidence indicate the importance of the GPCR intracellular regions, as well as the intracellular boundaries of the transmembrane helices (Gether 2000). It is also established that the regions of interaction on the G-protein are mainly the N-terminus of the Gα and the N- and C-termini of Gγ subunit. However, up to date, these findings have not been incorporated to a high-resolution, systematic model of GPCR – G-protein interactions, while the nature of the underlying mechanism is believed to be specific to the interacting partners (Wess 1998). Due to their function as input nodes in the signaling pathways of eukaryotic cells, GPCRs play a very important role in health and disease (Muller 2000). GPCRs are involved in a variety of pathological conditions including cystic fibrosis, cancer and HIV-mediated infection of host cells. The ability

168

Computational Methods for the Prediction of GPCRs Coupling Selectivity

to rationally modulate the cell’s signaling pathways through these ‘target’ molecules has introduced a new era in pharmacology. In fact, the significance of G-Protein coupled receptors (GPCRs) as major pharmacological targets can be compared with no other single family of proteins. This is further illustrated by the fact that more than 50% of all known drugs act on GPCRs, a family that is represented by less than 1% of open reading frames (ORFs) identified in the human genome. Taking into account the growing number of novel GPCRs, that could be used as potential drug candidates (Chalmers and Behan 2002; Dechering 2005), the variety of signaling pathways that start or can be regulated by GPCRs and the rate of expansion of biological sequence databases, the wealth of pharmacological targets available within this versatile family of proteins is evident. Furthermore, recent genomics initiatives have resulted in a plethora of newly discovered GPCR sequences. These receptors are often characterized as orphan GPCRs (oGPCRS), in the sense that they lack any annotation regarding their function. Most importantly, the endogenous ligands of oGPCRs are yet to be identified. The lack of knowledge on the ligand repertoire that can activate these receptors limits their utility as drug candidates for traditional ligand-based assays. One approach to overcome this limitation involves the use of constitutively active GPCRs (reviewed in (Chalmers and Behan 2002)), that stimulate cellular signaling in the absence of a bound ligand. Constitutively Active Receptor Technology (CART) is based on the ability to genetically engineer receptors by modifying the conformation of a ‘latch’ region of the core seven-transmembrane domain. However, high-throughput screening involves detection of a cellular response, such as cAMP production in the case of receptors that couple to Gi/o or Gs and calcium flux or inositol phosphate production for Gq/11-coupled receptors. Therefore, the knowledge of the interacting G-protein is essential in designing these assays. Prediction methods, based on the available genomic information, offer an attractive alternative in deciphering the coupling specificity experimentally, a procedure that consumes time and laboratory resources. Although several computational methods have been developed to provide information on the ligandbinding properties of GPCRs (reviewed in (Lu et al. 2006)), as well as on their phylogeny (Papasaikas et al. 2003; Shigeta et al. 2003; Papasaikas et al. 2004), the aspect of selective coupling to the G-proteins has been less studied. In particular, the application of standard bioinformatics tools to develop prediction methods of the immediate interacting partners of GPCRs was hampered for many years by the lack of a systematic database of interactions, and more importantly by the lack of experimental data on the mechanism of selective binding, activation and signal transduction through their G-protein partners. Recently, the range of G-proteins and their interaction with GPCRs has been extensively annotated in the G-protein Database (Elefsinioti et al. 2004). Such knowledge is essential in designing experiments for screening orphan receptors against libraries of potential ligands by providing the missing link between GPCRs and cellular responses. In this review we focus to briefly describe the main motivations, drawbacks and results from the application of computational methods for the prediction of GPCRs coupling selectivity.

C OMPUTATI ONA L METH ODS F OR C OUPLING PREDICTI

ON

Several methods have been developed for the prediction of GPCR’s coupling selectivity to G-proteins and their properties are summarized in Table 1. Their training philosophy, performance and caveats are discussed herein in further detail. An attractive feature of some of these methods is their availability online through web-based servers, for non-commercial users. Such methods can be widely used as

169

Computational Methods for the Prediction of GPCRs Coupling Selectivity

online prediction tools by both experimentalists, targeted at the characterization and study of specific receptors or bioinformaticians, for large scale genome annotation projects and the development of new, more efficient computational tools.

Pattern and N aïve B ayes Models-B ased Methods The increasing biochemical evidence that GPCR–G-protein recognition takes place within the intracellular loops of the receptor (Wess 1998; Wong 2003) motivated the application of pattern discovery techniques aimed at identifying the functionally important segments of residues for the interaction with G-proteins, and using these patterns to classify GPCRs according to their coupling specificity (Möller et al. 2001). This was the first extensive pattern discovery study applied for the prediction of GPCRs’ coupling selectivity. The authors used a non-redundant dataset of 103 human GPCRs with experimentally determined coupling selectivity (Alexander 2000). However, this approach was limited by the low degree of accuracy of regular expressions as classifiers of biological sequences, as well as the need for prediction of the transmembrane segments of GPCRs in a preceding step, as discussed later. In specific, the use of regular expressions limits the extent of sequence variability that can be incorporated to the prediction model. Furthermore, this choice of model leads to a redundancy of patterns that describe the same coupling group, as exemplified in figure 1 of reference (Sgourakis et al. 2005). Thus, the common experimental observation of different coupling to G-proteins for receptors from the same subfamily cannot be reproduced by such a prediction scheme. This also adheres to the low sensitivity of the method (30-40% as reported by the authors). In general, it appears that the coupling of GPCRs to G-proteins is a late event in molecular evolution that has been achieved by the mutation of key residues of the receptor’s intracellular domains to fine-tune interaction with certain families of G-proteins, while excluding others (Wess 1998; Sgourakis et al. 2005). This is the basis of the coupling prediction problem, and the reason that traditional sequence alignment methods produce predictions with little accuracy that cannot be generalized to the entire repertoire of receptors (Horn et al. 2000). More advanced statistical recursion methods such as Naïve Bayes models (Cao et al. 2003) were also applied for the same task. The authors used a training dataset of 91 receptors (Alexander 2001). This approach introduced a new method in GPCR coupling prediction that however did not lead to a significant increase in accuracy (72%, validated in an independent dataset of 55 GPCRs). Furthermore, their method seemed to over-predict interactions for most GPCRs in their dataset, by assigning multiple interacting partners (i.e. the number of promiscuous receptors was more that the experimentally observed). The authors justified this observation by arguing that promiscuous coupling is a common attribute of GPCRs (Oliveira et al. 1999), although not always experimentally determined. However, this raises issues regarding the specificity of their model.

Profile Hidden Markov Models–Based Methods Profile Hidden Markov Models (pHMMs) (reviewed in (Eddy 1998)) have been widely used as a statistical recursion tool for the classification of biological sequences (Krogh et al. 1994). The first application of Hidden Markov Models as predictors of GPCR’s coupling specificity was carried out by Goldstein’s group (Qian et al. 2003). This was also the first information-intensive computational approach to classify GPCRs according to their coupling specificity. The authors used the intracellular domains of GPCRs with known coupling specificity to train tree-based Hidden Markov Models (Mitchison and Durbin 1995) that

170

94% 93%

103 GPCRs

91 GPCRs

102 GPCRs

132 GPCRs

282 GPCRs**

188 GPCRs

282 GPCRs**

153 GPCRs

“Vilo et al.”

“Cao et al.”

“Sreekumar et al.”

GRIFFIN

PREDCOUPLE

PREDCOUPLE2

“Guo et al.”

“Ono et al.”

yes

yes yes

no

Gi/o, Gs, Gq/11 Gi/o, Gs, Gq/11, G12/13 Gi/o, Gs, Gq/11 Gi/o, Gs, Gq/11

no

Gi/o, Gs, Gq/11

no

Gi/o, Gs, Gq/11 no

no

Gi/o, Gs, Gq/11

Gi/o, Gs, Gq/11

no

Promiscuous

Gi/o, Gs, Gq/11

G-protein classes

None required  Biological functions

ACC and SVMs pHMMS, NLP and Decission Trees

None required

None required

Refined pHMMs / QFAST algorithm Refined pHMMs and ANNs

Ligand Properties

Transmembrane topology

knowledgerestricted pHMMs SVMs and pHMMs

Transmembrane topology

Transmembrane topology

Transmembrane topology

Additional inputs

Naïve Bayes Models

Regular expressions

tree-based HMMs

Method

** Several non-human receptors were included

* A significant drop in accuracy is expected for this method for full-length GPCR sequences

92%

90%

85%

>95%*

72%*

N/R

83%*

95 GPCRs

“Qian et al.”

Accuracy

Trainning set

Tool

not available

program download

web server

web server

web server

personal communication

personal communication

web server

personal communication

Availablity

 -

-

http://bioinformatics. biol.uoa.gr

http://bioinformatics. biol.uoa.gr

http://griffin.cbrc.jp/

[email protected]

jack.cao@astrazeneca. com

http://ep.ebi.ac.uk/ GPCR/

richard.goldstein@ nimr.mrc.ac.uk

URL / email

Computational Methods for the Prediction of GPCRs Coupling Selectivity

Table 1. Prediction methods of GPCRs coupling selectivity. The training dataset, applied technique and performance of each method are presented, in addition to its online availability. Out of 9 published methods, 4 can predict efficiently promiscuous coupling, 3 are available through an online server for non-commercial users and only 1 can predict coupling to G-proteins of the G12/13 family. N/R: Not reported.

171

Computational Methods for the Prediction of GPCRs Coupling Selectivity

could act as classifiers when aligned against a GPCR sequence of unknown selectivity. Their method was found to perform quite well, given the small size of the training dataset (95 receptor sequences). In a following study, Sreekumar and coworkers used all the intracellular domains of GPCRs with known coupling selectivity concatenated in a single sequence to train their models (Sreekumar et al. 2004). For this reason, these profiles were described as knowledge-restricted HMMs. This strategy leaded to a high degree of correct classification rate (~95%), when tested against receptors with known location of the transmembrane segments. However their approach, and also the previously mentioned methods, was limited by the requirement of known transmembrane topology of the receptor under query. Despite the high-efficiency in predicting the coupling specificity of GPCRs with known transmembrane topology, this limitation rendered these methods practically inapplicable in the case of oGPCRs, where no information other than the sequence is available. At this point we should notice the relative low accuracy of transmembrane segment prediction algorithms, despite the development of methods targeted specifically at GPCRs (Rayan et al. 2000). Even the most accurate methods predict the correct topology with a rate that does not exceed 75% on a residue level (Viklund and Elofsson 2004). In a previous bioinformatics work (Sgourakis et al. 2005), we have addressed the problem of GPCR coupling specificity despite the lack of transmembrane topology information with a high degree of efficiency. This was made possible through the implementation of a selection process to generate refined Hidden Markov Models of high discriminative power that model the intracellular domains of receptors that couple to the three main families of G-proteins. Results from individual profiles that corresponded to different intracellular domains were combined by the QFAST algorithm (Bailey and Gribskov 1998), to produce the final score for each coupling group, while ROC-curve analysis was used to optimize the cutoff that is applied to produce a final prediction. This strategy allowed for the first time the prediction of interaction for promiscuous receptors, although with a rather small accuracy that did not exceed 30%. Another novelty of our approach was the inclusion of the membrane-proximal segments of the transmembrane domains extending from the intracellular face of the membrane to train the highly refined, discriminative models. This was motivated by the fact that the location of the membrane boundaries is not precisely determined, even in high-resolution crystal structures. Furthermore, according to the general model of receptor activation, the intracellular face of a receptor “opens up” during the binding of the ligand, rendering residues at the interior of the receptor towards the membrane accessible to interaction with the G-protein (Gether 2000). In addition, this method offers the advantage of high specificity against non-GPCR sequences through the implementation of GPCR-specific profiles from the PFAM database (Sonnhammer et al. 1998; Bateman et al. 2004). Therefore, for the first time we provided a high-throughput genome annotation pipeline that could be used independently of transmembrane prediction schemes to guide experiments that aim to decipher the role of oGPCRs.

Methods that C ombine a Variety of T echniques In a following study (Sgourakis et al. 2005), we expanded the range of GPCRs recognized by our models, by including the less characterized group of G12/13-coupled receptors in addition to the Gi/o, Gq/11 and Gs families. A very important aspect of GPCR signaling (as reviewed in (Riobo and Manning 2005)), G12/13 coupling was ignored by previous methods and, to the best of our knowledge, by all methods published to date due to the lack of experimentally determined interaction data (Moller et al. 2001; Cao et al. 2003; Yabuki et al. 2005; Guo et al. 2006). To overcome this limitation, we performed

172

Computational Methods for the Prediction of GPCRs Coupling Selectivity

an extensive literature search and were able to construct an extensive, non-redundant dataset of 188 GPCR sequences, annotated according to their coupling specificity that includes 35 sequences of receptors that couple to G12/13. A very important feature of this method is the incorporation of sequences belonging to promiscuous receptors (65 in total) that were also retrieved from the literature. By using an intuitive method to train our models, and the aforementioned optimization procedure, we were able to construct a refined library of pHMMs that could efficiently model promiscuous coupling (with an accuracy of 85%, exceeding all published methods), as well as interactions with G12/13 proteins (with an accuracy of 95%), as evaluated in a five-fold cross-validation procedure. In addition, we introduced an Artificial Neural Network algorithm to combine the results of independent models in producing the final prediction of the method. This methodology was later adapted for the identification of promoters in large-scale genomic data from prokaryotic genomes (Mann et al. 2007). Furthermore, the specificity of this improved method against non-GPCR sequences was enhanced by the use of the results from querying an unknown sequence against all refined models in our database, combined with the QFAST algorithm. This addition to the already implemented highly specific GPRC profiles from the PFAM database (Bateman et al. 2004), was proven to a very efficient filter in screening non-GPCR sequences, by effectively identifying all non-GPCRs in two independent datasets consisting of 1113 globular and 1356 transmembrane non-GPCR sequences (adopted from (Papasaikas et al. 2003)). Support Vector Machines have also been applied to the same task, in numerous studies (Yabuki et al. 2005; Guo et al. 2006). In the first published method, Yabuki and coworkers used a hierarchical approach to train a method that besides the receptor’s sequence also uses properties of the ligand as inputs, to produce a prediction on its coupling sensitivity. They rationalize the use of ligand information by considering the activated receptor as an entity that is composed of the ligand, the GPCR and the Gprotein. Indeed, several lines of evidence indicate that the same receptor can signal through a variety of pathways, depending on its bound agonist, a phenomenon known as agonist trafficking (Hermans 2003). Their method, that is available for online use through a web-based server, uses both profile Hidden Markov Models and Support Vector Machines (SVMs) (reviewed in (Yang 2004)). The pHMMs are used in a first step to separate class A, that includes the majority of known receptors, from all the others. Thus, pHMMs generated for the opsins and olfactory receptors subfamilies and the class B, class C, frizzled and smoothened, families are used to classify GPCRs not belonging to class A. The authors claim that the coupling specificity for these receptors is ubiquitously determined by their family type, although there are several reported examples in the literature where this is not the case (Wess 1998). In a next step, a series of SVM classifiers is used to predict coupling of the remaining GPCRs into the three main coupling groups. Several parameters are used as inputs to the SVM at this step, including scores from pHMMs that were trained from GPCRs that bind peptide or amide ligands. The final, integrated system produces predictions with an accuracy of >85%, as evaluated in 4-fold cross validation procedure. However, the observables used as inputs to the method are derived from the sequence of the intracellular loops, and also from the aminoacid composition of very specific positions with respect to the sequence of bovine rhodopsin, that is used as an alignment template. Therefore, the entire prediction is expected to be very sensitive to the performance of the alignment algorithm, which will produce the position of the transmembrane segments. Given the variability in the output of such algorithms that is not guaranteed to have seven transmembrane segments, we can assess the amount of error that resides in this strategy: Qian and coworkers repot that of a total of 470 GPCR sequences submitted to the TMHMM server (Krogh et al. 2001) for prediction of transmembrane topology only

173

Computational Methods for the Prediction of GPCRs Coupling Selectivity

417 were predicted as having seven transmembrane segments (Qian et al. 2003). However, the method of Yabuki and coworkers predicts seven transmembrane segments even for sequences not belonging to GPCRs. We can thus conclude that this method is not suitable for application in large-scale genomic data for high-throughput genome annotation purposes. Recently, a second method that uses SVMs was published (Guo et al. 2006). The main motivation of this method is to avoid the use of membrane topology information both at the prediction and training steps. It uses the Autocross Covariance Transform method (Wold et al. 1993) to generate the input vectors for the SVM classifier, based on the physicochemical properties of the entire GPCR sequence as described by the projections on the first three eigenvectors of a 29-dimensional space that includes features such as bulk, hydrophobicity and electrostatics (Hellberg et al. 1987). The authors adopted a dataset from a previously published work from our group (Sgourakis et al. 2005) to train their method. In addition, to enhance the specificity of their method against non-GPCR sequences, they used a dataset of 1090 non-GPCR transmembrane proteins, adopted from an earlier work on GPCR classification (Guo et al. 2006). Given the low degree of sequence similarity between the intracellular domains of different receptors, and the heuristic nature of most alignment algorithms, the advantage of this strategy is that it does not rely on the accuracy of sequence profiles. Furthermore, the construction of GPCR-specific models results in a high degree of accuracy (>95%) in discriminating GPCRs from non-GPCR sequences. Thus, this method can also be used as a stand-alone tool. The authors report an accuracy of 91.3% for non-promiscuous GPCRs, as evaluated in a jackknife test with a non-redundant training dataset, and an accuracy of 80% for promiscuous receptors. In general, this approach yields reliable predictions from GPCR sequence alone, for all GPCR coupling types, including promiscuous receptors, without the requirement of any transmembrane topology information or filtering of non-GPCR sequences in a preceding step. However, it does not provide predictions for G12/13–coupled receptors, since, as the authors claim, a dataset could not be established due to the deficiency of data. On the contrary, as shown in our preceding study (Sgourakis et al. 2005), this problem can be solved through a careful and extensive retrieval set of data from the literature. In fact, we freely provide the required dataset in our web-based server: (http://bioinformatics.biol.uoa.gr/PRED-COUPLE2/training).

T ext Mining Methods In another study (Ono and Hishigaki 2006), the information included as input for the prediction is mined from the literature using Natural Language Processing (NLP) techniques. In this approach, text mining was used to extract features of biological functions as keywords from various databases. The authors claim a correct classification rate of 92.2%, when tested against a dataset of 152 GPCRs with known coupling specificity. However, this method is also depended on the availability of the known biological functions used as input to the predictor. In case of a novel sequenced orphan GPCR, such knowledge is missing and thus the method could not be benefited by the inclusion of the biological function. Following a similar rationale, the method cannot be applied for searching whole genomes in order to characterize orphan GPCRs. When the biological functions are not included in the prediction, the methods accuracy drops significantly below 90%, and thus is comparable to earlier methods.

174

Computational Methods for the Prediction of GPCRs Coupling Selectivity

INSIGHTS

FR OM THE APP LICATI ON OF C OMPUTATI ONA L T OOLS

The utility of these methods was confirmed by their use in combination with experimental data to decipher the coupling specificity of important receptors. In a recent study that focused on the differential activation of the Cockroach species Periplaneta Americana Adipokinetic Hormone Receptor (AKHR), the effects of two different types of hormones were studied (Wicher et al. 2006). In order to have a starting point for characterizing the pathways activated by this receptor, the authors used both GRIFFIN (Yabuki et al. 2005) and PRED-COUPLE (Sgourakis et al. 2005) to obtain a prediction of the coupling specificity of AKHRs. Both tools predicted coupling with Gs, however our method also predicted a further coupling specificity for Gq. The experiments carried out by Wicher and coworkers confirmed coupling with Gq in addition to Gs, through the depletion of ion currents, as a result of Gq-mediated inhibition of K+ channels. Furthermore, they were able to detect differences in the coupling specificity of the receptor, based on the type of bound hormone: both hormones induce coupling to Gq with the same efficiency, while AKH I has a higher potential to induce coupling to Gs. This example indicates the high accuracy level of current prediction tools, since AKHR was not included in the training datasets of either GRIFFIN or PRED-COUPLE. Computational prediction tools have also been very useful in characterizing the function of light receptors in photoreceptive retinal ganglion cells (pRGCs). These receptors belong to the Melanopsin gene family Opn4 and comprise alternate light sensors that are responsible for the perception of environmental brightness (Peirson and Foster 2006). Their function is independent of the typical Vitamin A–based photopigments, such as rhodopsin. Melanopsins are believed to resemble intervertebrate photopigments, however, the signaling pathways in vertebrate cells are not known. Peirson and Foster applied the prediction methods developed by our group to obtain an estimate of the variability in coupling specificity within the Melanopsin gene family (figure 2 in (Peirson and Foster 2006)). First, they confirm the validity of our method through a variety of correct predictions. Furthermore, for the melanopsins, this analysis predicts an extensive range of interactions with the G-protein families. Although not proven to be true in vivo, this is a striking difference of the Melanopsin receptors from the visual pigment opsins that is supported by several lines of experimental evidence (Newman et al. 2003; Melyan et al. 2005). The sequence variability in the third intracellular loop of the Melanopsin GPCRs was proposed to be the basis of this variability. In a recently published study (Muramatsu and Suwa 2006), Muramatsu and coworkers provided insight into the structural basis for GPCR-G-protein coupling selectivity, focusing on class A receptors from the GPCRDB 7.0 database (Horn et al. 2003), through the identification of key residues located mainly in the intracellular loops of the receptors. To perform this task, they used the solved crystal structure of rhodopsin (Palczewski et al. 2000) as a reference frame for the mapping of multiple sequence alignments of selected loop sequences. A Hidden Markov Model–based alignment procedure was used, and states in the model were assigned according to the position of transmembrane helices of rhodopsin. Based on the statistics of the occurrence of different residues at various positions in the alignment, the authors were able to infer a set of rules that correlate clusters of residues with the coupling specificity of GPCRs. Furthermore, they were able to identify mutation data from the literature in support of their observations. This study confirms the importance of the membrane-proximal boundaries of the transmembrane helices in establishing the coupling selectivity of GPCRs. Another interesting observation was that residues responsible for coupling to Gi/o and Gq/11 can be also found at the transmembrane and extracellular domains of GPCRs. Mutation studies on selected receptors corroborate this finding.

175

Computational Methods for the Prediction of GPCRs Coupling Selectivity

Allosteric changes transmitted across the plasma membrane to the G-protein binding interface upon ligand binding could account for these observations. Also, this analysis suggests, that a few residues along the sequences of receptors that couple to Gq/11 are responsible for their selectivity, a fact that perhaps explains the lower accuracy of some prediction methods for this class of receptors (Cao et al. 2003; Guo et al. 2006). However, these results are very sensitive to the choice of the alignment template of rhodopsin, a structure that may not cover the entire spectrum of class-A receptors. In the absence of a solved structure of the activated complex of GPCR with bound G-protein, more mutation data are needed to confirm these findings.

F UT URE TRENDS

/ C ONC LUSI ON

The field of GPCR computational biology has shown many advances in the post-genomic era; however the mechanism of selective binding to G-proteins is yet to be uncovered, mainly due to the lack of high-resolution structural data. The structure of complexes of GPCRs with different G-proteins and in different activation states would undoubtedly provide insight into the series of molecular events required for G-protein activation, and explain the basis of the coupling selectivity of GPCRs, at the atomic level. Prediction methods could provide important information in designing experiments, and facilitate the structure generation process by suggesting the “active interface” between GPCRs and G-proteins. Immediate advances in the field of computational prediction of the coupling selectivity of GPCRs could result from the application of consensus methods that utilize a variety of machine learning techniques, a strategy that has been proven successful for a variety of problems in bioinformatics (Cuff et al. 1998; Arai et al. 2004; Bagos et al. 2005; Tjalsma and van Dijl 2005; Hamodrakas et al. 2007). Finally, the incorporation of high-throughput coupling data from biochemical experiments would iteratively improve the efficiency of prediction algorithms and provide additional clues to the structural basis of GPCRs coupling specificity to G-proteins.

REFERENCES Alexander (2000). Receptor & ion channel nomenclature supplement. TiPS. Alexander (2001). Nomenclature supplement. TiPS. Arai, M., Mitsuke, H., Ikeda, M., Xia, J. X., Kikuchi, T., Satake, M., & Shimizu, T. (2004). ConPred II: A consensus prediction method for obtaining transmembrane topology models with high reliability. Nucleic Acids Res, 32(Web Server issue), W390-3. Bagos, P. Liakopoulos, G., T. D., & Hamodrakas, S. J. (2005). Evaluation of methods for predicting the topology of beta-barrel outer membrane proteins and a consensus prediction method. BMC Bioinformatics, 6, 7. Bailey, T. L. & Gribskov, M. (1998). Combining evidence using p-values: Application to sequence homology searches. Bioinformatics, 14(1), 48-54.

176

Computational Methods for the Prediction of GPCRs Coupling Selectivity

Bateman, A., Coin, L., Durbin, R., Finn, R. D., Hollich, V., Griffiths-Jones, S., Khanna, A., Marshall, M., Moxon, S., Sonnhammer, E. L., Studholme, D. J., Yeats, C., & Eddy, S. R. (2004). The Pfam protein families database. Nucleic Acids Res, 32(Database issue), D138-41. Becker, O. M., Shacham, S., Marantz, Y., & Noiman, S. (2003). Modeling the 3-D structure of GPCRs: Advances and application to drug discovery. Curr Opin Drug Discov Devel, 6(3), 353-61. Benjamin, D. R., Markby, D. W., Bourne, H. R., & Kuntz, I. D. (1995). Solution structure of the GTPase activating domain of alpha s. J Mol Biol, 254(4), 681-91. Cao, J., Panetta, R., Yue, S., Steyaert, A., Young-Bellido, M., & Ahmad, S. (2003). A naive Bayes model to predict coupling between seven transmembrane domain receptors and G-proteins. Bioinformatics, 19(2), 234-40. Chalmers, D. T. & Behan, D. P. (2002). The use of constitutively active GPCRs in drug discovery and functional genomics. Nat Rev Drug Discov, 1(8), 599-608. Cuff, J. Clamp, A., M. E., Siddiqui, A. S., Finlay, M., & Barton, G. J. (1998). JPred: A consensus secondary structure prediction server. Bioinformatics, 14(10), 892-3. Dechering, K. J. (2005). The transcriptome’s drugable frequenters. Drug Discov Today, 10(12), 85764. Downes, G. B., & Gautam, N. (1999). The G protein subunit gene families. Genomics, 62(3), 544-52. Eddy, S. R. (1998). Profile hidden Markov models. Bioinformatics, 14(9), 755-63. Elefsinioti, A. L., Bagos, P. G., Spyropoulos, I. C., & Hamodrakas, S. J. (2004). A database for G proteins and their interaction with GPCRs. BMC Bioinformatics, 5, 208. Exton, J. H. (1993). Role of G proteins in activation of phosphoinositide phospholipase C. Adv Second Messenger Phosphoprotein Res, 28, 65-72. Gether, U. (2000). Uncovering molecular mechanisms involved in activation of G protein-coupled receptors. Endocr Rev, 21(1), 90-113. Guo, Y., Li, M., Lu, M., Wen, Z., & Huang, Z. (2006). Predicting G-protein coupled receptors-G-protein coupling specificity based on autocross-covariance transform. Proteins, 65(1), 55-60. Guo, Y. Z., Li, M., Lu, M., Wen, Z., Wang, K., Li, G., & Wu, J. (2006). Classifying G protein-coupled receptors and nuclear receptors on the basis of protein power spectrum from fast Fourier transform. Amino Acids, 30(4), 397-402. Hamodrakas, S. J., Liappa, C., & Iconomidou, V. A. (2007). Consensus prediction of amyloidogenic determinants in amyloid fibril-forming proteins. Int J Biol Macromol, 41(3), 295-300. Hellberg, S., Sjostrom, M., Skagerberg, B., & Wold, S. (1987). Peptide quantitative structure-activity relationships, a multivariate approach. J Med Chem, 30(7), 1126-35. Hermans, E. (2003). Biochemical and pharmacological control of the multiplicity of coupling at G-protein-coupled receptors. Pharmacol Ther, 99(1), 25-44.

177

Computational Methods for the Prediction of GPCRs Coupling Selectivity

Horn, F., Bettler, E., Oliveira, L., Campagne, F., Cohen, F. E., & Vriend, G. (2003). GPCRDB information system for G protein-coupled receptors. Nucleic Acids Res, 31(1), 294-7. Horn, F., van der Wenden, E. M., Oliveira, L., AP, I. J. & Vriend, G. (2000). Receptors coupling to G proteins: Is there a signal behind the sequence? Proteins, 41(4), 448-59. Johnston, C. A. & Watts, V. J. (2003). Sensitization of adenylate cyclase: A general mechanism of neuroadaptation to persistent activation of Galpha(i/o)-coupled receptors? Life Sci, 73(23), 2913-25. Jones, A. M. & Assmann, S. M. (2004). Plants: The latest model system for G-protein research. EMBO Rep, 5(6), 572-8. Kristiansen, K. (2004). Molecular mechanisms of ligand binding, signaling, and regulation within the superfamily of G-protein-coupled receptors: Molecular modeling and mutagenesis approaches to receptor structure and function. Pharmacol Ther, 103(1), 21-80. Krogh, A., Brown, M., Mian, I. S., Sjolander, K. & Haussler, D. (1994). Hidden Markov models in computational biology. Applications to protein modeling. J Mol Biol, 235(5), 1501-31. Krogh, A., Larsson, B., von Heijne, G. & Sonnhammer, E. L. (2001). Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J Mol Biol, 305(3), 567-80. Kurose, H. (2003). Galpha12 and Galpha13 as key regulatory mediator in signal transduction. Life Sci, 74(2-3), 155-61. Laugwitz, K. L., Allgeier, A., Offermanns, S., Spicher, K., Van Sande, J., Dumont, J. E. & Schultz, G. (1996). The human thyrotropin receptor: A heptahelical receptor capable of stimulating members of all four G protein families. Proc Natl Acad Sci USA, 93(1), 116-20. Lu, F., Li, J. & Jiang, Z. (2006). Computational identification and analysis of G protein-coupled receptor targets. Drug Development Research, 67, 771-780. Mann, S., Li, J., & Chen, Y. P. (2007). A pHMM-ANN based discriminative approach to promoter identification in prokaryote genomic contexts. Nucleic Acids Res, 35(2), e12. Melyan, Z., Tarttelin, E. E., Bellingham, J., Lucas, R. J., & Hankins, M. W. (2005). Addition of human melanopsin renders mammalian cells photoresponsive. Nature, 433(7027), 741-5. Mitchison, G. & Durbin, R. (1995). Tree-based maximal likelihood substitution matrices and hidden Markov models. Journal of Molecular Evolution, 41, 1139-1151. Möller, S., Vilo, J. & Croning, M. D. (2001). Prediction of the coupling specificity of G protein coupled receptors to their G proteins. Bioinformatics, 17(Suppl 1), S174-81. Muller, G. (2000). Towards 3D structures of G protein-coupled receptors: A multidisciplinary approach. Curr Med Chem, 7(9), 861-88. Muramatsu, T. & Suwa, M. (2006). Statistical analysis and prediction of functional residues effective for GPCR-G-protein coupling selectivity. Protein Eng Des Sel, 19(6), 277-83. Neer, E. J. (1995). Heterotrimeric G proteins: Organizers of transmembrane signals. Cell, 80(2), 24957.

178

Computational Methods for the Prediction of GPCRs Coupling Selectivity

Neer, E. J. & Clapham, D. E. (1988). Roles of G protein subunits in transmembrane signalling. Nature, 333(6169), 129-34. Newman, L. A., Walker, M. T., Brown, R. L., Cronin, T. W., & Robinson, P. R. (2003). Melanopsin forms a functional short-wavelength photopigment. Biochemistry, 42(44), 12734-8. Nikiforovich, G. V., Galaktionov, S., Balodis, J., & Marshall, G. R. (2001). Novel approach to computer modeling of seven-helical transmembrane proteins: Current progress in the test case of bacteriorhodopsin. Acta Biochim Pol, 48(1), 53-64. Oliveira, L., Paiva A. C., & Vriend, G. (1999). A low resolution model for the interaction of G proteins with G protein-coupled receptors. Protein Eng, 12(12), 1087-95. Ono, T., & Hishigaki, H. (2006). Prediction of GPCR-G protein coupling specificity using features of sequences and biological functions. Genomics Proteomics Bioinformatics, 4(4), 238-244. Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A., Le, I., Trong, Teller, D. C., Okada,T., Stenkamp, R. E., Yamamoto, M., & Miyano, M. (2000). Crystal structure of rhodopsin: A G protein-coupled receptor. Science 289(5480), 739-45. Papasaikas, P. K., Bagos, P. G., Litou, Z. I., & Hamodrakas, S. J. (2003). A novel method for GPCR recognition and family classification from sequence alone using signatures derived from profile hidden Markov models. SAR QSAR Environ Res, 14(5-6), 413-20. Papasaikas, P. K., Bagos, P. G., Litou, Z. I., Promponas, V. J., & Hamodrakas, S. J. (2004). PRED-GPCR: GPCR recognition and family classification server. Nucleic Acids Res, 32(Web Server issue), W380-2. Peirson, S. & Foster, R. G. (2006). Melanopsin: Another way of signaling light. Neuron, 49(3), 331-9. Qian, B., Soyer, O. S., Neubig, R. R., & Goldstein, R. A. (2003). Depicting a protein’s two faces: GPCR classification by phylogenetic tree-based HMMs. FEBS Lett, 554(1-2), 95-9. Rayan, A., Siew, N., Cherno-Schwartz, S., Matzner, Y., Bautsch, W. & Goldblum, A. (2000). A novel computational method for predicting the transmembrane structure of G-protein coupled receptors: application to human C5aR and C3aR. Receptors Channels 7(2), 121-37. Riobo, N. A., & Manning, D. R., (2005). Receptors coupled to heterotrimeric G proteins of the G12 family. Trends Pharmacol Sci, 26(3), 146-54. Sgourakis, N. G., Bagos, P. G., & Hamodrakas, S. J. (2005). Prediction of the coupling specificity of GPCRs to four families of G-proteins using hidden Markov models and artificial neural networks. Bioinformatics, 21(22), 4101-6. Sgourakis, N. G., Bagos, P. G., Papasaikas, P. K., & Hamodrakas, S. J. (2005). A method for the prediction of GPCRs coupling specificity to G-proteins using refined profile Hidden Markov Models. BMC Bioinformatics, 6,104. Shigeta, R., Cline, M., Liu, G., & Siani-Rose, M. A. (2003). GPCR-GRAPA-LIB--A refined library of hidden Markov Models for annotating GPCRs. Bioinformatics, 19(5), 667-8.

179

Computational Methods for the Prediction of GPCRs Coupling Selectivity

Sonnhammer, E. L., Eddy, S. R., Birney, E., Bateman, A., & Durbin, R. (1998). Pfam, multiple sequence alignments and HMM-profiles of protein domains. Nucleic Acids Res, 26(1), 320-2. Sreekumar, K. R., Huang, Y., Pausch, M. H., & Gulukota, K. (2004). Predicting GPCR-G-protein coupling using hidden Markov models. Bioinformatics, 20(18), 3490-9. Tjalsma, H. & van Dijl, J. M. (2005). Proteomics-based consensus prediction of protein retention in a bacterial membrane. Proteomics, 5(17), 4472-82. Viklund, H. & Elofsson, A. (2004). Best alpha-helical transmembrane protein topology predictions are achieved using hidden Markov models and evolutionary information. Protein Sci, 13(7), 1908-17. Wess, J. (1998). Molecular basis of receptor/G-protein-coupling selectivity. Pharmacol Ther, 80(3), 231-64. Wicher, D., Agricola, H. J., Sohler, S., Gundel, M., Heinemann, S. H., Wollweber, L., Stengl, M., & Derst, C. (2006). Differential receptor activation by cockroach adipokinetic hormones produces differential effects on ion currents, neuronal activity, and locomotion. J Neurophysiol, 95(4), 2314-25. Wold, S., Jonsson, J., Sjostrom, M., Sandberg, M., & Rannar, S. (1993). DNA and peptide sequences and chemical processes multivariately modeled by principal component analysis and partial least-squares projections to latent structures. Analytica Chimica Acta, 277(2), 239-253. Wong, S. K. (2003). G protein selectivity is regulated by multiple intracellular regions of GPCRs. Neurosignals, 12(1), 1-12. Yabuki, Y., Muramatsu, T., Hirokawa, T., Mukai, H., & Suwa, M. (2005). GRIFFIN, A system for predicting GPCR-G-protein coupling selectivity using a support vector machine and a hidden Markov model. Nucleic Acids Res, 33(Web Server issue), W148-53. Yang, Z. R. (2004). Biological applications of support vector machines. Brief Bioinform, 5(4), 328-38.

key T erms Coupling Selectivity: G protein trimers are named after their α-subunits, which on the basis of their amino acid similarity and, most importantly by their cellular function, are grouped into four families. These include, Gαs and Gαi/o, which stimulate and inhibit respectively adenylate cyclase, Gαq/11 which stimulates phospholipase C, and the less characterized Gα12/13 family that activates the Na+/ H+ exchanger pathway. The specificity of the interaction of a given GPCR with the pool of available intracellular G-proteins is termed coupling selectivity or specificity. The ability of certain GPCRs to interact with more that one types of G-proteins (i.e. Gαs and Gαi/o) is known as promiscuous coupling selectivity. GPCRs coupled to members of the Gα12/13 family are all exhibiting promiscuous coupling preferences. Genome Annotation: The functional characterization (by means of biochemical experiments or computational prediction algorithms) of novel genes in newly sequenced and assembled genomes.

180

Computational Methods for the Prediction of GPCRs Coupling Selectivity

G-Protein Coupled Receptors (GPCRs): Also known as seven transmembrane (heptahelical) receptors, due to their characteristic membrane topology (seven transmembrane helices, extracellular N-terminus and intracellular C-terminus). They are transmembrane proteins acting as the sensory component of cellular signalling pathways. GPCRs, are a key class of eukaryotic membrane receptors and roughly 50% of all small molecule therapeutics target GPCRs. Vision, smell and some of taste uses GPCRs. Ligands for GPCRs cover a wide range of organic chemical space, including proteins, peptides, sugars, amines and amino-acids, nucleotides, lipids and more. They transduce signals from extracellular space into the cell, through their interaction with G proteins, which act as switches forming hetero-trimers composed of different subunits (α,β,γ). Two GPCRs’ crystal structures are currently available, the structure of Rhodopsin and the recently solved three-dimensional structure of beta-2 Adrenergic Receptor. G-Proteins: The term is used to describe GTP-binding proteins. There are two classes of G-proteins, the small cytoplasmic G-proteins (Gh) and the hetero-trimeric G-proteins composed of different subunits (α,β,γ) that mediate the signal of heptahelical receptors (GPCRs). Agonist binding to GPCRs leads to association of the hetero-trimeric G protein with the receptor, GDP-GTP exchange in the G protein α subunit followed by dissociation of the G protein into α-GTP and βγ complexes. The dissociated subunits can activate or inhibit several effectors such as adenylyl cyclase, PLCβ, tyrosine kinases, phosphodiesterases, phosphoinositide 3-kinase, GPCR kinases, ion channels, and molecules of the mitogen-activated protein kinase pathway, resulting in a variety of cellular functions. However, there is evidence that some GPCRs transduce their signal through in a way that is not G protein-dependent, and also that hetero-trimeric G proteins are involved in mediating the action of single-spanning membrane receptors. Hidden Markov Models (used herein): Probabilistic models widely used for describing features of a protein sequence. Hidden Markov Models introduce a “regular grammar” that characterizes a set of biological sequences. These are generative models, which renders them highly applicable in biological sequence analysis. In general, a HMM is composed of a set of states that form a first order Markovian process, connected by means of the transition probabilities. Each state, has a unique probability distribution for generating (emitting) the symbols of the finite alphabet (nucleotides or amino-acids). The most widely used variant of Hidden Markov Model (HMM) is the profile HMM which models in a probabilistic manner the matches, inserts and deletions occurring in every column of a multiple sequence alignment. However, other variations are also common (i.e. the circular HMM). Orphan Receptors: GPCRs for which no information on their ligand or coupling specificity is available. These are usually identified as a result of genome sequencing projects and large efforts are undertaken to functionally characterize them.

181

182

Chapter X

Bacterial β-Barrel Outer Membrane Proteins:

A Common Structural Theme Implicated in a Wide Variety of Functional Roles Pantelis G. Bagos University of Central Greece, and University of Athens, Greece Stavros J. Hamodrakas University of Athens, Greece

abstract β-barrel outer membrane proteins constitute the second and less well-studied class of transmembrane proteins. They are present exclusively in the outer membrane of Gram-negative bacteria and presumably in the outer membrane of mitochondria and chloroplasts. During the last few years, remarkable advances have been made towards an understanding of their functional and structural features. It is now wellknown that β-barrels are performing a large variety of biologically important functions for the bacterial cell. Such functions include acting as specific or non-specific channels, receptors for various compounds, enzymes, translocation channels, structural proteins, and adhesion proteins. All these functional roles are of great importance for the survival of the bacterial cell under various environmental conditions or for the pathogenic properties expressed by these organisms. This chapter reviews the currently available literature regarding the structure and function of bacterial outer membrane proteins. We emphasize the functional diversity expressed by a common structural motif such as the β-barrel, and we provide evidence from the current literature for dozens of newly discovered families of transmembrane β-barrels.

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Bacterial β-Barrel Outer Membrane Proteins

INTR OD UCTI ON Integral membrane proteins are divided into two distinct structural classes, the α-helical membrane proteins and the β-barrel membrane proteins. α-helical membrane proteins class is the more abundant and well studied, since such proteins are located mostly in the cell membranes of both prokaryotic and eukaryotic organisms, performing a variety of biologically important functions. Proteins of this class have their membrane spanning regions forming α-helices consisting mainly of hydrophobic residues (von Heijne 1999). These proteins have been studied extensively in a computational manner during the last few years and a variety of prediction algorithms have been proposed (Möller, Croning et al. 2001). Members of the latter class (β-barrel membrane proteins) are located in the outer membrane of Gram-negative bacteria, and presumably in the outer membrane of chloroplasts and mitochondria, a fact explained by the theory of endosymbiosis. The members of this class are having their membrane spanning segments formed by antiparallel amphipathic β-strands, creating a channel in a form of barrel that spans the outer membrane (Schulz 2002). A continuously increasing number of β-barrel proteins located in the bacterial outer membrane are characterized, and a number of structures have been solved at atomic resolution (Schulz 2002). These proteins have been shown to perform a wide variety of functions such as active ion transport, passive nutrient uptake, membrane anchoring, adhesion, and catalytic activity. Considering the fact that a large number of pathogens are actually bacteria belonging to the Gram-negative bacteria class and the important biological functions in which outer membrane proteins are involved in, it is not a surprise that these proteins attract an increased medical interest. In the following sections we will fist try to describe briefly the structural features observed so far in the β-barrel outer membrane proteins with known three dimensional structure. Then, we will discuss the available computational methods used for the prediction of the transmembrane strands of β-barrel outer membrane proteins as well as for the discrimination of such proteins from water-soluble and alpha-helical membrane proteins. Afterwards, we will discuss in detail the functional roles in which β-barrel outer membrane proteins are implicated into. Emphasis will be given in newly characterized families of β-barrel outer membrane proteins that are involved in a series of crucial for the survival of the bacterial cell functions and in the implications for the pathogenicity of these organisms.

STR UCT URA L FEAT URES OF β-BARRE

LS

The β-barrel is a protein fold occurring in soluble proteins as well in transmembrane ones. A β-barrel may be considered as a β-sheet that twists and coils to form a closed barrel-shaped structure, which is stabilized by the hydrogen bonds formed by the sheet edges (first and last strands). The observed so far transmembrane β-barrels preferentially lay their axis along the membrane normal and are exclusively composed of meandering all-next-neighbor antiparallel β-strands, suggesting a repeating β-hairpin structural motif. It has been shown that any type of β-barrel can accurately be described solely by two parameters, namely the number of β-strands n and the shear number S. S is a measure of the stagger of the strands in the sheet. Theoretical analysis combined with available three dimensional structures proved that these two parameters determine all other features of the β-barrel (Murzin, Lesk et al. 1994; Murzin, Lesk et al. 1994). Currently, available high-resolution structures of transmembrane β-barrel proteins include β-barrels of varying features, with 8 ≤ n ≤ 22 and 8 ≤ S ≤ 24 (Table 1). Furthermore,

183

Bacterial β-Barrel Outer Membrane Proteins

it is worth mentioning that all transmembrane β-barrels observed so far consist of an even number of strands. Remarkable advances have recently been made towards the understanding of bacterial β-barrel forming transmembrane protein structure and function. Their functional roles and the biological processes they are involved in are diverse and may differ between organisms. X-ray crystallography has revealed a number of unique 3-dimensional protein structures representatives of large functionally related families. Long mobile loops resistant to proteolysis (OmpA) or rigid extensions of the barrel-forming β-strands (OmpX) in the extracellular space, are known to provide molecular recognition sites. Porins of various families are known to mediate the passive transport of small molecules under different environmental conditions (OmpF, PhoE, OmpW, OmpG, OprP) or active translocation of larger molecules (TonB-dependent receptors, FhuA, FepA, FecA, FptA, FpvA). Known examples of proteins promoting virulence through adhesion to host cells are the Neisserial OpcA and NspA. In the type V secretion pathway (autotransporters, NalP), a C-terminal β-barrel domain is necessary to form the pore in the outer membrane, in order to allow the translocation of the secreted mature protein, which is called the passenger domain. Other outer membrane proteins with known 3-dimensional structures constitute examples of active transport of long-chain fatty acids (FadL), and specific receptors for nucleosides (TsX), whereas specific porins are mediating the intake of various carbohydrates (maltose-Maltoporin, sucrose-Sucroporin). Furthermore, β-barrel transmembrane proteins have been reported to exhibit key enzymatic activities, either as extracellular proteases (OmpT), phospholipases (OmpLA) or enzymes implicated in the acylation of lipid A (PagP, PagL). Several of these proteins have been shown to function as monomers, but there are known cases where oligomerisation is required for their proper function. In Table 1, we list some representative members of the available β-barrel outer membrane proteins whose structure has been determined at atomic resolution, along with a brief description of their structural and functional properties. Among the available three-dimensional structures, some could be considered as unusual cases of transmembrane β-barrel forming proteins. In these proteins, the transmembrane β-barrels are formed by more than one aminoacid chains. In the type I secretion pathway (Sec-independent), outer membrane proteins (TolC, VceC) are functioning in conjunction with cytoplasmic membrane transporters to promote the export of various solutes such as metals, drugs, secreted proteins, across the two envelopes of the Gram-negative bacterial cell envelope. A protein belonging to this class is Escherichia coli TolC (Koronakis, Sharff et al. 2000). TolC is a mixed β-barrel and α-helical protein, which spans both the outer membrane and the periplasmic space of gram-negative bacteria. Three TolC protomers assemble to form a continuous, solvent accessible conduit, a channel-tunnel over 140 Å long. Each monomer of the trimer contributes 4 β-strands to the 12-strand β-barrel. Another protein belonging to this class is the subtle case of α-haemolysin from Staphylococcus aureus and other microbial toxins such as aerolysin and the anthrax-protective antigen. Regarding the case of α-haemolysin it has been shown (Song, Hobaugh et al. 1996) that is active as a transmembrane heptamer, where the transmembrane domain is a 14-strand antiparallel β-barrel, in which two strands are contributed by each monomer. This endotoxin causes disease by forming pores on the infected cell membrane leading to cell lysis or to the destruction of small molecule concentration gradients. Recently, the structure of a Mycobacterial (Gram-positive) outer membrane channel (MspA) has been determined at atomic resolution (Faller, Niederweis et al. 2004). The Mycobacterial outer membranes are the thickest biological membranes known to date, and present a decreased fluidity toward the periplasmic side of the membrane as opposed to the outer membrane of Gram-negative bacteria (Liu, Rosenberg et al. 1995). More recently, the structure of the HiA

184

Bacterial β-Barrel Outer Membrane Proteins

Table 1. A list of representative outer membrane proteins with structures determined at atomic resolution. Note that, although some proteins seem to be related based on their structural features (i.e. OmpX and NspA) they exhibit no significant sequence similarity and thus are listed separately. Other families (general porins, TonB-dependent Receptors) are over-represented in PDB with members showing weak or modest sequence similarity (i.e. OmpF with Omp32, OmpC and OmpK36) and thus we list only one representative. Each protein in the table is a representative of a single PFAM family. Note though, that PFAM-B codes (marked with an asterisk) are subject to change from version to version. Protein name

function

Number of βstrands

PDB code (Berman, Battistuz et al. 2002)

PFAM code (Finn, Mistry et al. 2006)

Organism

OmpA

Structural protein

8

1QJP

PF01389

Escherichia coli

OmpX

Adhesion

8

1QJ8

PF06316

Escherichia coli

NspA

Adhesion

8

1P4T

PF02462

Neisseria Meningitidis

PagP

Enzyme

8

1MM4

PF07017

Escherichia coli

PagL

Enzyme

8

2ERV

PB038312 *

Pseudomonas aeruginosa

OmpW

General Porin

8

2F1T

PF03922

Escherichia coli

OmpT

Enzyme

10

1I78

PF01278

Escherichia coli

OpcA

Adhesion

10

1K24

PF07239

Neisseria Meningitidis

OmpLA

Enzyme

12

1QD5

PF02253

Escherichia coli

NalP

Autotransporter

12

1UYN

PF03797

Neisseria Meningitidis

Tsx

Transporter

12

1TLY

PF03502

Escherichia coli

OmpG

General Porin

14

2F1C

PB051875 *

Escherichia coli

FadL

Transporter

14

1T1L

PF03349

Escherichia coli

OprP

General Porin

16

2O4V

PF07396

Pseudomonas aeruginosa

OmpF

General Porin

16

2OMF

PF00267

Escherichia coli

Porin

General Porin

16

2POR

PB028487 *

Rhodobacter capsulatus

Maltoporin

Specific Porin

18

2MPR

PF02264

Salmonella typhimurium

FepA

TonB-dependent Receptor

22

1FEP

PF00593

Escherichia coli

autotransporter of Haemophilus influenzae has been solved revealing a β-barrel with 12 transmembrane β-strands, comprised by four strands from each subunit (Meng, Surana et al. 2006). The central channel has a pore of 1.8 nm in diameter that is traversed by three N-terminal alpha-helices, one from each subunit. This structure is considered to be representative of the Autotransporter-2 family. The analysis of observed three-dimensional structures of β-barrel outer membrane proteins has provided us with a set of rules describing the structural features of this class of proteins. These are: 1.

2.

The transmembrane β-strands are mainly amphipathic showing an alternation of hydrophobic and (mostly) polar residues. The hydrophobic residues interact with the hydrophobic lipid chains, whereas the polar residues are facing toward the barrel interior, and hence interact with the aqueous environment of the pore. The aromatic residues have a greater tendency to be located in the interfaces with the polar heads of the lipids, forming the so-called aromatic belts around the perimeter of the barrel.

185

Bacterial β-Barrel Outer Membrane Proteins

3.

4.

5.

6.

7.

Both the N-terminal and the C-terminal of the proteins are located in the periplasmic space (inside with respect to the outer membrane). In some cases, the N-, and C-terminal tails of the protein, may be formed by more than 100 residues-long stretches. The segments connecting the transmembrane β-strands that are located in the periplasmic space (inside loops) are generally shorter, from those of the extracellular space (outside loops). The periplasmic loops are having a length no longer than twelve residues, whereas the extracellular loops may be significantly longer, with lengths exceeding thirty residues, occasionally. This observation is possible due to the meander arrangement observed in currently available structures. The length of the transmembrane strands varies according to the inclination of the strand with respect to the lipid bilayer, and ranges between six and twenty-two residues. However, in some cases only a small portion of the strand is embedded in the lipid bilayer, and the rest of it protrudes far away from the membrane, to the extra-cellular space, forming flexible hairpins. β-barrel outer membrane proteins show great sequence variability in their amino acid sequences. This, in general, is larger than that of the globular proteins, and it is even larger when referring to the extracellular loops, which are often used as antigenic epitopes. Adjacent strands are connected by a network of hydrogen bonds, stabilizing the barrel.

Computational prediction and discrimination of transmembrane β-barrel proteins is in principle harder than the prediction of α-helical transmembrane segments. Despite the fact that transmembrane β-strands in available high-resolution structures are placed with relatively large angles with respect to the normal to the lipid bilayer, they are significantly shorter than transmembrane α-helices due to their extended conformation, their lengths being typically between six and twenty-two residues. A β-strand of between seven and nine residues might be sufficiently long to span the hydrophobic core of the membrane. Additionally, transmembrane β-strands face different environments (the hydrophobic exterior of the β-barrel opposed to the aqueous pore interior), often resulting in alternating hydrophobic-hydrophilic residues. This alternation is not always exact, since residues on the outer surface of the barrel (facing the apolar lipidic environement) tend to be hydrophobic, whereas residues pointing to the barrel interior are not always polar. Even though hydrophobicity peaks in a classical hydropathy plot are well correlated with the location of transmembrane β-strands (Zhai and Saier 2002) their average hydrophobicity is significantly lower than those of transmembrane α-helical segments. This fact should be related with the underlying translocation mechanism, since in the opposite case outer membrane proteins might be trapped in the inner membrane during the translocation process. Additionally, oligomerisation of β-barrel domains inside the lipid bilayer weakens the necessity for a hydrophobic barrel exterior, since polar side-chains may provide favourable interactions in the interaction interface. Summarising the above factors, the sequence signal to be detected is rather weak. Furthermore, common structural features with globular water-soluble proteins with a β-barrel in their three dimensional structures might result in a big number of undesired false positives. Nevertheless, if a protein sequence of such a protein is carefully examined, several structural characteristics, for example the predomination of aromatic residues at the interfacial positions, might accurately reveal the location of transmembrane β-strands (for excellent reviews see (Schulz 2002; Schulz 2003; Wimley 2003)).

186

Bacterial β-Barrel Outer Membrane Proteins

C OMPUTATI ONA L PREDICTI

ON METH ODS

During the last few years, several prediction algorithms have been developed aiming specifically at the outer membrane proteins. The prediction algorithms all utilize the rules that we mentioned in the previous paragraphs. However, there is a large variation on the algorithmic techniques used for this purpose. Furthermore, there are two major classes of prediction methods, the methods aiming at predicting the location of the transmembrane β-strands and the methods aiming at discriminating β-barrel outer membrane proteins from other classes of proteins such as globular and alpha-helical membrane ones. From a historical perspective, the prediction algorithms are divided in three categories. The first consists of methods that were using hydrophobicity plots and the alteration of hydrophobic and polar residues. Such methods with various modifications were proposed by Vogel an Jahning (Vogel and Jahnig 1986), Schirmer and Cowan (Schirmer and Cowan 1993), Gromiha and Ponnuswamy (Gromiha and Ponnuswamy 1993) and Zhai and Saier (Zhai and Saier 2002). Another important class of methods consists of predictors that use statistical properties of the amino-acids occurring in the β-barrel outer membrane proteins. Such algorithms are the rule-based algorithm of Gromiha and coworkers (Gromiha, Majumdar et al. 1997), methods using the Gibbs sampler (Neuwald, Liu et al. 1995; Mannella, Neuwald et al. 1996), the window-based method of Wimley (Wimley 2002) and various methods using the amino-acid and dipeptide composition of the proteins (Liu, Zhu et al. 2003; Bagos, Liakopoulos et al. 2004; Gromiha, Ahmad et al. 2005; Gromiha and Suwa 2005). More advanced such methods are the BOMP program that uses a combination of regular expression patterns, the β-barrel score of Wimley, and Principal Component Analysis (Berven, Flikka et al. 2004), and the TMB-Hunt (Garrow, Agnew et al. 2005) program that uses evolutionary information and a K-NN classifier. However, various machine learning methods such Hidden Markov Models (HMMs) and Neural Networks (NNs) have been shown to achieve higher accuracy especially for locating the transmembrane strands. The first application of a NN for predicting the location of transmembrane strands was performed by Diederichs and coworkers (Diederichs, Freigang et al. 1998), followed by the development of the B2TMPRED (Jacoboni, Martelli et al. 2001) and TMBETA-NET methods (Gromiha, Ahmad et al. 2004), whereas the TBBPred method (Natt, Kaur et al. 2004) uses a combination of NNs and Support Vector Machines. The highest scoring algorithms however have been shown to be the Hidden Markov Models (HMMs). The first such method was the HMM-2BTMR (Martelli, Fariselli et al. 2002), followed by the method of Liu and coworkers (Liu, Zhu et al. 2003), the PRED-TMBB method (Bagos, Liakopoulos et al. 2004; Bagos, Liakopoulos et al. 2004) and the Prof-TMB method (Bigelow, Petrey et al. 2004; Bigelow and Rost 2006). Finally we have to mention the consensus algorithms that combine the results of various individual predictors. Such an algorithm is ConBBPRED (Bagos, Liakopoulos et al. 2005) that specifically aims to locate the transmembrane strands and the TMB-Hunt2 (Garrow and Westhead 2007) and PSORT-B (Gardy, Spencer et al. 2003) algorithms that are oriented towards a better accuracy in discrimination of β-barrels. However, not all algorithms cited here are available to the scientific community. In Table 2, we list the available prediction servers along with a short description.

F UNCTI ONA L DI VERSITY

OF β-BARRE

LS

Besides the relative few observed 3-dimensional structures of β-barrel membrane proteins, there is additionally a plentiful of examples of proteins representatives of large families, whose structure has not 187

Bacterial β-Barrel Outer Membrane Proteins

Table 2. The currently available methods for predicting the transmembrane strands of beta-barrel outer membrane proteins as well as discriminating them form globular ones. For explanation of the methods see at the text and in a recent evaluation (Bagos, Liakopoulos et al. 2005). Method

Reference

TM Strands

TM Strands + Orientation

Discrimination

URL

B2TMPRED

(Jacoboni, Martelli et al. 2001)

x

-

-

http,//gpcr.biocomp.unibo.it/cgi/predictors/ outer/pred_outercgi.cgi

BOMP

(Berven, Flikka et al. 2004)

-

-

x

http,//www.bioinfo.no/tools/bomp

ConBBPRED

(Bagos, Liakopoulos et al. 2005)

x

x

-

http,//bioinformatics.biol.uoa.gr/ ConBBPRED/

HMM-B2TMR

(Martelli, Fariselli et al. 2002)

x

x

-

http,//gpcr.biocomp.unibo.it/biodec/

MCMBB

(Bagos, Liakopoulos et al. 2004)

-

-

x

http,//bioinformatics.biol.uoa.gr/mcmbb

OM_Topo_predict

(Diederichs, Freigang et al. 1998)

x

x

-

http,//strucbio.biologie.uni-konstanz. de/~kay/om_topo_predict2.html

PRED-TMBB

(Bagos, Liakopoulos et al. 2004; Bagos, Liakopoulos et al. 2004)

x

x

x

http,//bioinformatics.biol.uoa.gr/PREDTMBB/

ProfTMB

(Bigelow, Petrey et al. 2004)

x

x

x

http,//cubic.bioc.columbia.edu/services/ proftmb/

PSORT-B

(Gardy, Spencer et al. 2003))

-

-

x

http,//www.psort.org

TMB-Hunt

(Garrow, Agnew et al. 2005)

-

-

x

http,//www.bioinformatics.leeds.ac.uk/ betaBarrel/

TMB-Hunt2

(Garrow and Westhead 2007)

x

x

x

http,//www.bioinformatics.leeds.ac.uk/TMBWeb/TMB-Hunt2

TBBpred

(Natt, Kaur et al. 2004)

x

-

x

http,//www.imtech.res.in/raghava/tbbpred/

TMBETA-NET

(Gromiha, Ahmad et al. 2004)

x

-

x

http,//psfs.cbrc.jp/tmbeta-net/

been determined yet but there is enough experimental evidence to suggest their localization to the outer membrane forming β-barrels. The experimental techniques used, range from subcellular fractionation to determine the localization to the outer membrane, liposome swelling activity to determine channel properties, circular dichroism to determine the secondary structure content, low-resolution electron microscopy and antibodies experiments, deletion constructs and protease protection activities to locate surface exposed loops. During the last few years dozens of such families have been characterized experimentally even though the protein databases have not incorporated yet the available information concerning the functional annotation. In the following sections we describe the currently available information reported in the literature concerning the functional diversity of β-barrel transmembrane proteins. We classify the functional roles of such proteins as general porins, specific porins, structural proteins, translocation channels, and various uncharacterized or unclassified proteins. Although the classification is based on functional properties, the sequence and structure characteristics of such proteins are also diverse even within each class.

188

Bacterial β-Barrel Outer Membrane Proteins

G eneral Porins A large portion of such proteins constitutes various non-specific porins, having however no detectable sequence similarity to the already well-known families. In Chlamydia, MomP constitutes the largest portion of the OM mass, and it is speculated that this protein possesses 16 transmembrane strands (Hughes, Shaw et al. 2001; Rodriguez-Maranon, Bush et al. 2002; Findlay, McClafferty et al. 2005; Yen, Pal et al. 2005), whereas PorB (Kubo and Stephens 2000; Kawa and Stephens 2002; Kawa, Schachter et al. 2004) shows also pore-forming activity although with different properties compared to MomP. In Campylobacter, MomP besides acting as a porin, it is involved in the structural organization of the outer membrane, and acts as an adhesin (Moser, Schroeder et al. 1997; De, Jullien et al. 2000; Zhang, Meitzler et al. 2000; Bolla, Saint et al. 2004), whereas Omp50 shows a pore forming activity with cationselective channel properties (Bolla, De et al. 2000; Dedieu, Pages et al. 2004). In Borellia, omp66 and its homologues are large MW (66-kDa) outer membrane proteins that exhibit porin activity. The average single-channel conductance predicts a rather large pore diameter of 2.6 nm and prediction methods suggest a large number (perhaps larger than 22) of transmembrane strands (Skare, Mirzabekov et al. 1997; Bunikis, Luke et al. 1998; Exner, Wu et al. 2000). In Fusobacterium, FomA is a trimeric porin, which exhibits channel properties similar to that of the other general porins. Results obtained from limited proteolysis of purified FomA protein, indicate that the N-terminal part of the FomA protein is not an integral part of the β-barrel, but forms instead a periplasmic domain (Kleivdal, Puntervoll et al. 2001; Puntervoll, Ruud et al. 2002). In Leptospira, OmpL1 and its homologues, are heat modifiable porins that form trimeric structures. OmpL1 has been reconstituted in planar lipid bilayers showing an average single channel conductance similar to those of the major porin activity of native leptospiral membranes. OmpL1, is expressed during infection and thus it has a role in the induction and persistence of leptospiral interstitial nephritis. Sequence analysis suggests that the protein has 10-12 transmembrane strands (Shang, Exner et al. 1995; Barnett, Barnett et al. 1999; Haake, Mazel et al. 1999). The 37-kDa outer membrane porin OmpH of the deep-sea marine bacterium Photobacterium profundum strain SS9 is been synthesized in response to elevated hydrostatic pressure and it seems that is responsive to changes in the pressure regime of the deep-sea bacterium The results from reconstitution of OmpH in liposome bilayers as well as mutational studies are consistent with the hypothesis that OmpH functions as a relatively large, nonspecific diffusion channel. Prediction methods suggest that OmpH possesses a 16-stranded transmembrane β-barrel, similar to other general porins (Bartlett, Chi et al. 1993; Bartlett and Chi 1994; Macdonald, Martinac et al. 2003).

Specific Porins Another important class of outer membrane proteins includes the specific channels, either those that are responsible for resistance to various antibiotics, or those needed for intake of metabolites. In the first case we encounter the CarO OMP which is responsible for carbapenem and imipenem resistance in the Moraxellaceae family of gamma-proteobacteria (Mussi, Limansky et al. 2005) and the distantly related family of 33-36 kDa OMPs members of which are implicated in the resistance against Imipenem (Clark 1996; Limansky, Mussi et al. 2002; Siroy, Molle et al. 2005; Siroy, Cosette et al. 2006). Other examples are members of the Pseudomonas OprH family, which are small outer membrane proteins (21-kDa), when overexpressed under Mg2+ starvation conditions cause resistance to polymyxin B, gentamicin, and EDTA. There is experimental evidence (Circular Dichroism, PCR-based site-directed deletion and

189

Bacterial β-Barrel Outer Membrane Proteins

epitope insertion mutagenesis) suggesting a β-barrel structure consisting of 8 transmembrane strands (Bell, Bains et al. 1991; Rehm and Hancock 1996). We also have to mention the bacterial copper resistance proteins. Copper is essential as it serves as cofactor for a variety of enzymes. However, excess of copper is toxic and leads to radical formation and oxidation of biomolecules. CopB serves to extrude copper when it approaches toxic levels. The protein CopB is located in the outer membrane, and seems to form a β-barrel with 10-12 transmembrane strands. The N-terminal, domain (~100 residues) is predicted to be periplasmic, suggesting a structural resemblance with TonB dependent Receptors however, no sequence homology is apparent (Cha and Cooksey 1991; Lim and Cooksey 1993; Bissig, Voegelin et al. 2001). In Pseudomonas, OprD facilitates the diffusion of basic amino acids as well as the structurally analogous β-lactam antibiotics such as imipenem. Mutational inactivation of the OprD gene is associated with carbapenem resistance in Pseudomonas aeruginosa, whereas the C-terminal portion of OprD, and in particular, the hypothetical loop L7, was responsible for the unusual meropenem hyper-susceptibility. Various members of the family have shown different specificities in the uptake of metabolites including glycine-glutamate, histidine, proline, tyrosine, cis-aconitate and pyroglutamate (Yoshihara, Yoneyama et al. 1998; Ochs, Lu et al. 1999; Epp, Kohler et al. 2001; Hancock and Brinkman 2002; Pirnay, De Vos et al. 2002; Tamber, Ochs et al. 2006). The Pseudomonas aeruginosa porin B (OprB), is another substrate-selective channel for a variety of different sugars (Wylie and Worobec 1994). This protein may facilitate diffusion of a variety of diverse compounds, but is probably restricted to carbohydrates and does facilitate glucose fusion across the outer membrane (Wylie and Worobec 1995). The high-affinity glucose transport system is primarily specific for glucose and well conserved although the outer membrane components may differ in channel architecture and specificity for other carbohydrates (Adewoye, Tschetter et al. 1998; Adewoye and Worobec 1999). Similarly to other porins, these proteins are predicted to have 16 transmembrane strands. Homologues are also found Pseudomonas chlororaphis, Burkholderia cepacia, Pseudomonas fluorescens, Acinetobacter calcoaceticus and Xanthomonas campestris. KdgM is an oligogalacturonate-specific porin protein found in Erwinia chrysanthemi (Blot, Berrier et al. 2002). This phytopathogenic Gram-negative bacterium, secretes pectinases, which are able to degrade the pectic polymers of plant cell walls, and uses the degradation products as a carbon source for growth. KdgM is a major outer membrane protein, whose synthesis is induced in the presence of the pectic derivatives. KdgM behaves like a voltage-dependent porin that is slightly selective for anions and that exhibits fast block in the presence of trigalacturonate (Condemine, Berrier et al. 2005). KdgM seems to be monomeric, and topological models suggest that possesses a 14-stranded β-barrel, with six rather short extracellular loops and a larger one that restricts the size of the pore (Pellinen, Ahlfors et al. 2003). CymA of Klebsiella oxytoca, is another specific porin essential for growth on cyclodextrins. However, it can also complement the deficiency of a LamB mutant of Escherichia coli for growth on linear maltodextrins, indicating that both cyclic and linear oligosaccharides are accepted as substrates. CymAinduced membrane conductance decreased considerably upon addition of alpha-cyclodextrin, whereas the affinity was lower for β-cyclodextrin and even lower for gamma-cyclodextrin. Unlike most bacterial porins, CymA does not form trimeric complexes in lipid membranes and shows no tendency to trimerize in solution. However, it seems to form homotetramers with a central pore, and therefore lacks the typical trimeric structure of most porins (Pajatsch, Andersen et al. 1999; Orlik, Andersen et al. 2003) In E. coli, RafY is part of an operon that includes also a permease and the enzymes required for raffinose utilization. RafY forms an ion-permeable channel with a single-channel, which is approximately twice of that of the general diffusion pores OmpF and OmpC. Since RafY is able to accomodate the

190

Bacterial β-Barrel Outer Membrane Proteins

diffusion of other oligo-sacharides, it seems that it is a general diffusion pore with a diameter, larger than that of the general diffusion porins, allowing the diffusion of high-molecular-mass carbohydrates through the outer membrane (Ulmke, Lengeler et al. 1997; Andersen, Krones et al. 1998). Lastly, we have to mention FmdC, which is a porin involved in the transport of short-chain amides and urea through the outer membrane of Methylophilus methylotrophus under conditions where these nitrogen sources are present at very low concentration. Its synthesis is inducible by short chain amides and urea, and the protein is thought to transport these molecules across the outer membrane (Mills, Wyborn et al. 1997).

S tructural Proteins There are also several structural proteins conferring to the stability of the outer membrane through the interaction with peptidoglycans, having though no sequence similarity to the OmpA family of proteins in their transmembrane domain (Porphyromonas and Acinetobacter MomPs, Pseudomonas OprF). MomP of Porphyromonas gingivalis resembles the members of the OmpA family in their C-terminal domain that protrudes to the periplasmic space. The N-terminal membrane anchoring domain though, does not show any significant sequence similarity. Two-dimensional, diagonal electrophoresis and chemical cross-linking experiments with or without a reducing agent clearly showed that this protein mainly forms stable heterotrimers via intermolecular disulfide bonds. It has been suggested that they play an important role in outer membrane integrity, and similarly to members of the OmpA family, are likely to function as a stabilizer of the cell wall rather than as a major porin in this organism (Ross, Czajkowski et al. 2004; Nagano, Read et al. 2005) In Acinetobacter radioresistens KA53 the OmpA (MomP) was shown to constitute most of the emulsifying activity. The transmembrane β-barrel is likely to possess 8 membrane spanning β-strands, whereas the C-terminal domain is probably acting in interactions with the peptidoglycan layer (OforiDarko, Zavros et al. 2000; Toren, Orr et al. 2002; Gribun, Nitzan et al. 2003; Pessione, Giuffrida et al. 2003; Vashist and Rajeswari 2006; Akimana and Lafontaine 2007). A third, structurally similar, family of proteins includes homologues of the OprF of P. aeruginosa. It has been shown that members of this family (similar to members of the OmpA family), are showing a modular architecture, composed of two distinct structural domains. A N -terminal β-barrel domain formed by 8 β-strands with short turns at the periplasmic ends, and long flexible loops at the external ends, that anchors the protein to the outer membrane, and a C-terminal domain that protrudes into the periplasmic space interacting with peptidoglycans. There is also evidence for a pore-forming activity of the β-barrel domain, possibly larger than that of the OmpA of E. coli (Brinkman, Bains et al. 2000; El Hamel, Freulet et al. 2000; Saint, El Hamel et al. 2000). In Geobacter sulfurreducens, OmpJ is the most abundant protein isolated from the outer membrane. Deletion of the ompJ gene results in a strain that grew in fumarate, but could not grow with metals, such as soluble or insoluble Fe(III) and insoluble Mn(IV) oxide. The presumed effect of OmpJ in extracellular electron transfer is indirect, as OmpJ is required to keep the integrity of the periplasmic space necessary for proper folding and functioning of periplasmic and outer membrane electron transport components (Afkar, Reguera et al. 2005). Prediction methods indicate that OmpJ possess 20 transmembrane β-strands and homologues are found only in bacteria members of the Geobacteraceae family. In cyanobacteria, the tandemly lying genes somA and somB that were initially identified in Synechococcus PCC 6301 encode two functionally characterized outer membrane porins, that are predicted to form probably a 16-stranded β-barrel. Homologues that were also identified in other cyanobacteria,

191

Bacterial β-Barrel Outer Membrane Proteins

share an N-terminal motif, with similarity to S-layer homology (SLH) domains, that probably form periplasmic extensions connecting the outer membrane to the peptidoglycan layer. The C-terminal part, forms a β-barrel and it has been shown to form pores in lipid bilayers with single-channel conductances (Umeda, Aiba et al. 1996; Hansel, Pattus et al. 1998; Hansel and Tadros 1998).

S ecretion and Protein T ranslocation C hannels Secretins form large pores in the outer membrane, participating in protein secretion during the type II, and type III terminal branch of the General Secretion Pathway (GSP) of Gram-negative bacteria (Koster, Bitter et al. 2000; Thanassi 2002). The type II secretion pathway is dependent on the Sec system, since the secreted proteins must carry a signal peptide sufficient for the translocation through the inner membrane, and responsible for the secretion of toxins and exoenzymes. Type III secretion pathway is Sec-independent and allows the translocation of effector proteins from bacteria to the eukaryotic target cells. Members of the family, include PilQ of N. meningitidis, PulD of K. oxytoca, GspD of E. coli, the pIV protein playing a role in the assembly of the filamentus bacteriophage, and other proteins of Gram-negative bacteria. Electron microscopy, suggests that secretins form large channels in the outer membrane with an internal diameter of approximately 7 nm. The structure of PilQ, has been determined to 12 Å resolution, suggesting a 12-meric structure (Collins, Frye et al. 2004). It is believed that the C-terminal part of secretins forms the transmembrane β-barrel domain; however there is a lack of a high-resolution three-dimensional model, and thus the true folding state of the channel is ambiguous. There is also evidence that secretins, play an active role in the assembly of the pili, besides acting solely as channels. Ushers are another family of integral outer membrane proteins participating in the chaperone/usher secretion pathway, a terminal branch of the General Secretion Pathway (GSP) dedicated to the biogenesis of adhesive surface structures associated with pathogenesis (Thanassi 2002). As the name of the pathway implies, the Ushers work in conjuction with a periplasmic chaperone in order to assemble and secrete more than 30 different surface molecules in a broad range of gram-negative bacteria. The most studied example of the chaperone/usher pathway is the assembly and biogenesis of the type 1 and P pili, expressed by the uropathogenic E. coli. The members of the Usher family (PapC, FasD, FaeD, FimD etc), display properties of the β-barrel proteins, and are predicted to form channels consisting of 24-32 β-strands. Recently, it has been proposed that the Ushers form twin dimeric pores in the outer membrane, and the C-terminal parts of the sequences are responsible for the dimerisation (Henderson, So et al. 2004). In addition, the N-terminal 100-120 aminoacids are believed to be involved in the recognition of the periplasmic chaperone (Ng, Akman et al. 2004). The Neisserial Omp85 and their homologues in other species constitute a family of proteins involved in protein translocation through the outer membrane. Transmembrane β-barrels are synthesized in the cytoplasm and transferred through the inner membrane using the Sec system. In the periplasmic space, chaperones such as SurA and Skp, are binding the OMP and target it to the outer membrane (Bos and Tommassen 2004). It is believed that the highly conserved Omp85 acts in vivo, in a way that facilitates the correct folding and the insertion of other β-barrels in the outer membrane (Gentle, Gabriel et al. 2004; Voulhoux and Tommassen 2004). Homologues of Omp85 (which is sometimes referred as Bacterial Surface Antigen D15) are also found in mitochondria (Sam50/Tob55) and chloroplasts (OEP75) (Paschen, Waizenegger et al. 2003). The transmembrane domain (probably having 14 β-strands), is located in the C-terminus, whereas in the N-terminus, Omp85 possesses 5 conserved POTRA (Polypeptide Transport)

192

Bacterial β-Barrel Outer Membrane Proteins

domains. These domains are believed to interact with the transferred β-barrel, and the final insertion into the OM is performed with lateral diffusion (Moslavac, Mirus et al. 2005). Another distantly related family of proteins constitutes the transporters of the two-partner secretion system. The two-partner secretion (TPS) system (which along with autotransporters comprises the type V secretion pathway in bacteria) is composed of two separate proteins, with TpsA being the secreted protein and TpsB its specific transporter (Newman and Stathopoulos 2004). The secreted proteins are exported in a Sec-dependent manner across the inner membrane, after which they cross the outer membrane with the help of their cognate transporters. Translocation appears to be folding-sensitive, indicating that TpsA proteins cross the periplasm and the outer membrane in non-native conformations and fold progressively at the cell surface. A major difference of the TPS pathways compared to the AT arises from the manner by which specificity is established between the secreted protein and its transporter. The TPS pathway has solved the question of specific recognition between the TpsA proteins and their transporters by the addition to the TpsA proteins of an N-proximal module, the conserved TPS domain, which represents a hallmark of the TPS pathway. The exoproteins of the TPS system have been reported to be adhesins, haem-binding proteins, antigenic factors and haemolysins/cytolysins (Jacob-Dubuisson, Fernandez et al. 2004). The structure of the TPS domain has been solved and it is seen to fold as a β-helix, but currently there is no available structure for the transmembrane domain of the TpsB proteins (Clantin, Hodak et al. 2004). The latter is predicted to have approximately 16-18 transmembrane strands. A third, also distantly related, family is the Haemophilus influenza (hmw1B) Outer Membrane Translocator Family. The members of this family are proteins distantly related to the proteins of the Omp85 family as well as to the TpsB family. There is evidence suggesting that these proteins are involved in the translocation of proteins through the outer membrane. The C-terminal part of the sequence is speculated, based on experimental evidence, to possess a β-barrel structure that forms a pore, whereas the N-terminal part forms a periplasmic chaperone which in the most of the cases consists of a single POTRA domain (Surana, Grass et al. 2004; Surana, Buscher et al. 2006). The first characterized member of the family was found in Haemophilus influenzae, but homologues are found in other Proteobacteria such as Escherichia, Yiersinia, Pseudomonas, Caulobacter and Railstonia. In Porphyromonas gingivalis the PorT outer membrane protein is implicated in the leaderless secretion of various virulence factors (Gingipains/adhesins). PorT seems to be membrane-associated and exposed to the periplasmic space, as revealed by subcellular fractionation and immunoblot analysis using anti-PorT antiserum (Sato, Sakai et al. 2005). Prediction methods suggest that the proteins possess nearly 8-10 transmembrane β-strands. In E.coli, Wzi was found to be involved in the surface assembly of the Escherichia coli K30 group 1 capsule, participating in the translocation of group 1 capsular polysaccharide in co-operation with the Wza complex (Nesper, Hill et al. 2003). Wzi is an outer membrane monomeric β-barrel protein (Rahn, Beis et al. 2003), predicted to possess 16 transmembrane strands. Homologues are also found in Klebsiella pneumoniae, Acinetobacter, Psychrobacter, Shewanella oneidensis, Rhodobacter sphaeroides, Idiomarina loihiensis and Microbulbifer degradans. In Gram-negative bacteria, the components of the outer membrane are synthesized in the cytoplasm or the inner membrane and must thus traverse the inner membrane and the periplasm on the way to their final destination (Bos and Tommassen 2004). LPS (Lipopolysacharide) is an essential component of the bacterial outer membrane and consists of a hydrophobic membrane anchor, lipid A, substituted with an oligosaccharide core region that can be extended in some bacteria by a repeating oligosaccharide, the O-antigen. An OMP is required for the appearance of LPS at the bacterial cell surface (Braun and Silhavy 2002). This protein is known as Imp (increased membrane permeability) or OstA (organic solvent

193

Bacterial β-Barrel Outer Membrane Proteins

tolerance) because E. coli strains expressing mutant versions of this protein showed altered membrane permeability (Bos, Tefsen et al. 2004). It forms probably a β-barrel and it is predicted to have 22 transmembrane strands. Lastly, we have to mention AlgE from P. aeruginosa and AlgJ from Azotobacter vinelandii that are believed to export alginate (an acidic polysaccharide), across the outer membrane of these Gram-negative bacteria (Rehm, Boheim et al. 1994; Rehm 1996). These proteins are predicted to have 18 transmembrane β-strands spanning the outer membrane, thus forming a β-barrel. However the channel properties are different from those of the general porins.

A dhesion Outer Membrane Proteins There are also a large and diverse collection of newly discovered examples of various types of adhesion proteins implicated in pathogenesis. These outer membrane adhesions however, do not show any significant similarity to the already known examples of OmpX, NspA and OpcA of which we know the 3-dimensional structure. One such example is the Moraxella OmpJ (Hays, van Selm et al. 2005), a protein that has been shown to be implicated in the bacterial clearance from the lungs. The members of this family possess a distant similarity with members of the OmpA family and predictions indicate that their membrane spanning β-barrel is formed by 8 transmembrane strands. Intimins are adhesins found mainly in Enterohemorrhagic E. coli (EHEC) and Enteropathogenic E. coli (EPEC), whereas invasins are adhesins found in Yersinia pseudotuberculosis (Niemann, Schubert et al. 2004). Intimins and Invasins, share homology in their N-terminal (500 aminoacids length) segment that probably forms a β-barrel anchoring the protein to the outer membrane (Touze, Hayward et al. 2004). At the C-terminal, these proteins have some Ig-like domains and a C-type lectin domain. Invasin, binds to Integrin, whereas Intimin binds to the Translocated Intimin receptor (Tir) (Luo, Frey et al. 2000). The intracellular bacteria Surface antigen family, includes a number of antigens expressed on the surface of intracellular endosymbiotic pathogens belonging to various species members of the Rickettsiales, such as Anaplasma, Wolbachia and Ehrlichia. It is a diverse family, believed to consist of adhesins having no more than 8 transmembrane strands. The WSP protein of Wolbachia (Braig, Zhou et al. 1998; Baldo, Lo et al. 2005), the P28 antigen of Ehrlichia (Zhang, Guo et al. 2004) and the P44 antigen of Anaplasma (Oberle and Barbet 1993; Huang, Wang et al. 2007) are well-studied examples of such proteins. The Treponema Major Surface Protein is a rather large (474 amino-acids) protein acting as a surface antigen in the outer sheath of Treponema denticola. It is mainly an adhesin, but additionally it has been shown to exhibit channel activity. The channel is estimated to have a pore diameter of 3.4 nm, and prediction methods suggest that the protein possess a transmembrane domain composed of 22 β-strands. Homologues are found also in other pathogenic species of Treponema. However, the β-barrel domain may be considerably shorter since a large portion of the N-terminal is shown to be surface exposed and associated with antigenicity (Egli, Leung et al. 1993; Park, Heuner et al. 2002; Batista da Silva, Lee et al. 2004; Edwards, Jenkinson et al. 2005). The Legionella MomP and its homologues also serve as adhesive molecules for host cells, suggesting and that these proteins play a major role in the virulence of the particular bacterium (Hoffman, Seyer et al. 1992; High, Torosian et al. 1993; Krinos, High et al. 1999). Finally, in Helicobacter pylori which is the causative agent of gastritis and peptic ulceration in humans, there have been identified several outer membrane proteins that are not present in any other Gram-negative bacteria. These OMPs of H. pylori are characterized mainly as adhesins and porins and extensive C-terminal sequence similarity between

194

Bacterial β-Barrel Outer Membrane Proteins

these proteins has been used to define two different families (Doig, Exner et al. 1995; Exner, Doig et al. 1995; Tomb, White et al. 1997; Peck, Ortkamp et al. 2001; Hofreuter, Karnholz et al. 2003)

Uncharacterized Outer Membrane Proteins In this last section we list briefly some examples of probable β-barrel outer membrane proteins that are not yet functionally characterized but there is enough convincing experimental evidence suggesting that they are truly outer membrane proteins. In Acetobacter xylinus BcsC is member of a cellulose synthase operon composed also by bcsA, bcsB and bcsD genes (Wong, Fear et al. 1990). Mutants in the bcsC and bcsD genes were impaired in cellulose production in vivo, even though they had the capacity to make all the necessary metabolic precursors and cyclic diguanylic acid, the activator of cellulose synthase, and exhibit cellulose synthase activity in vitro. S. Typhimurium and E. coli have also cellulose as component of the extracellular matrix (Zogaj, Nimtz et al. 2001), and BcsC is also present in these organisms. Recently, a proteomic analysis of E. crysanthemi (Babujee, Venkatesh et al. 2007), revealed that BcsC is located in the outer membrane. The postulated β-barrel domain is located in the C-terminal of the large protein and probably serves as a membrane anchoring region or a channel for cellulose export. Other domains were also found in the protein, including several tetratricopeptide repeat (TPR) domains, responsible for protein-protein-interactions, and various domains of unknown function. Prediction methods suggest that the C-terminal β-barrel is formed by 16 transmembrane strands. NfrA of E. coli was found to be one of the two genes whose products are required for bacteriophage N4 adsorption (Kiino, Singer et al. 1993). The nfrA gene encodes a 990-residue long outer membrane protein which presumably serves as the phage receptor, whereas the nfrB gene encodes an inner membrane protein and may be a component of the receptor. Besides acting as receptor for N4 bacteriophage the physiological role of nrfA is unknown (Molloy, Herbert et al. 2000). The transmembrane domain of the large protein is located in the C-terminus and prediction methods suggest a barrel of 12 strands. A large N-terminal periplasmic domain of unknown function is also present also as a tetratricopeptide repeat (TPR) domain, which is known to be implicated in protein-protein-interactions. Lastly, we have to mention some examples of newly discovered outer membrane β-barrels with yet unknown function. Such proteins are the Serpulina variable surface protein (McCaman, Auer et al. 1999; McCaman, Auer et al. 2003), the E. coli YfaZ and YaiO outer membrane proteins (Marani, Wagner et al. 2006), and the Salt-stress induced outer membrane protein from Rhodobacter sphaeroides (Xu, Abo et al. 2001; Xu, Kadokura et al. 2001; Tsuzuki, Xu et al. 2005).

C ONC LUSI ON It is now evident that β-barrel outer membrane proteins even though share some remarkable structural features, constitute a large and highly diverse (in terms of functional roles) superfamily of membrane proteins. By reviewing the recent literature we have presented evidence for dozens of previously uncharacterized families of outer membrane proteins implicated in almost any functional role of the bacterial outer membrane. Thus, there are general and specific porins of various families, specific transporters and receptors, translocation channels, enzymes, and adhesion proteins. The importance of identifying such proteins in the completely sequenced genomes is clearly illustrated since such proteins could be

195

Bacterial β-Barrel Outer Membrane Proteins

responsible for the pathogenicity of some medically important Gram-negative bacteria, whereas other proteins could serve as potential targets for drugs or vaccines. One issue that has to be pursued in the near future is the incorporation of such a detailed annotation of the various families, in the publicly available databases. Given that outer membrane proteins are continuously been characterized and the available knowledge is accumulated, we anticipate that such a level of functional annotation should be incorporated soon. Genome-wide computational studies are also needed in order to fully address the issues regarding the distribution of the various families of βbarrel outer membrane proteins in the bacteria with completely sequenced genomes. Concerning prediction methods, the emergence of newly characterized β-barrel outer membrane proteins should be used in addition to the progress of algorithmic techniques used for prediction. Here, two things are of particular interest. First, the coupling of experimentally derived information regarding the topology and the development of prediction algorithms that directly incorporate experimentally derived information in the prediction, similar to the methods implemented for prediction of alpha-helical membrane proteins. Secondly, the development of methods that can locate accurately the transmembrane domain in multidomain proteins. It is worth noting that most of the currently available prediction algorithms fail to correctly predict the transmembrane topology in case of a protein with large periplasmic N- and C-terminal parts. Such prediction methods could be used in turn to identify novel outer membrane proteins that share no sequence similarity with the known families and these proteins could be further submitted as potential targets to experimentalists.

REFERENCES Adewoye, L. O., Tschetter, L., et al. (1998). Channel specificity and secondary structure of the glucoseinducible porins of Pseudomonas spp. J Bioenerg Biomembr, 30(3), 257-67. Adewoye, L. O., & Worobec, E. A. (1999). Multiple environmental factors regulate the expression of the carbohydrate-selective OprB porin of Pseudomonas aeruginosa. Can J Microbiol, 45(12), 1033-42. Afkar, E., Reguera, G., et al. (2005). A novel Geobacteraceae-specific outer membrane protein J (OmpJ) is essential for electron transport to Fe(III) and Mn(IV) oxides in Geobacter sulfurreducens. BMC Microbiol, 5, 41. Akimana, C., & Lafontaine, E. R. (2007). The Moraxella catarrhalis outer membrane protein CD contains two distinct domains specifying adherence to human lung cells. FEMS Microbiol Lett, 271(1), 12-9. Andersen, C., Krones, D., et al. (1998). The porin RafY encoded by the raffinose plasmid pRSD2 of Escherichia coli forms a general diffusion pore and not a carbohydrate-specific porin. Eur J Biochem, 254(3), 679-84. Babujee, L., Venkatesh, B., et al. (2007). Proteomic analysis of the carbonate insoluble outer membrane fraction of the soft-rot pathogen Dickeya dadantii (syn. Erwinia chrysanthemi) strain 3937. J Proteome Res, 6(1), 62-9. Bagos, P. G., Liakopoulos, T. D., et al. (2004). Finding beta-barrel outer membrane proteins with a Markov Chain model. WSEAS Transactions on Biology and Biomedicine, 2(1), 186-189.

196

Bacterial β-Barrel Outer Membrane Proteins

Bagos, P. G., Liakopoulos, T. D., et al. (2005). Evaluation of methods for predicting the topology of beta-barrel outer membrane proteins and a consensus prediction method. BMC Bioinformatics, 6, 7. Bagos, P. G., Liakopoulos, T. D., et al. (2004). A Hidden Markov Model method, capable of predicting and discriminating beta-barrel outer membrane proteins. BMC Bioinformatics, 5(29). Bagos, P. G., Liakopoulos, T. D., et al. (2004). PRED-TMBB, a web server for predicting the topology of beta-barrel outer membrane proteins. Nucleic Acids Res, 32(Web Server Issue), W400-W404. Baldo, L., Lo, N., et al. (2005). Mosaic nature of the wolbachia surface protein. J Bacteriol, 187(15), 5406-18. Barnett, J. K., Barnett, D., et al. (1999). Expression and distribution of leptospiral outer membrane components during renal infection of hamsters. Infect Immun, 67(2), 853-61. Bartlett, D., & Chi, E. (1994). Genetic characterization of ompH mutants in the deep-sea bacterium Photobacterium sp. strain SS9. Arch Microbiol, 162(5), 323-8. Bartlett, D. H., Chi, E., et al. (1993). Sequence of the ompH gene from the deep-sea bacterium Photobacterium SS9. Gene, 131(1), 125-8. Batista da Silva, A. P., Lee, W., et al. (2004). The major outer sheath protein of Treponema denticola inhibits the binding step of collagen phagocytosis in fibroblasts. Cell Microbiol, 6(5), 485-98. Bell, A., Bains, M., et al. (1991). Pseudomonas aeruginosa outer membrane protein OprH, expression from the cloned gene and function in EDTA and gentamicin resistance. J Bacteriol, 173(21), 6657-64. Berman, H. M., Battistuz, T., et al. (2002). The Protein Data Bank. Acta Crystallogr D Biol Crystallogr, 58(Pt 6 No 1), 899-907. Berven, F. S., Flikka, K., et al. (2004). BOMP, a program to predict integral b-barrel outer membrane proteins encoded within genomes of Gram-negative bacteria. Nucleic Acids Res, 32(Web Server Issue), W394-W399. Bigelow, H., & Rost, B. (2006). PROFtmb, a Web server for predicting bacterial transmembrane beta barrel proteins. Nucleic Acids Res, 34(Web Server issue), W186-8. Bigelow, H. R., Petrey, D. S., et al. (2004). Predicting transmembrane beta-barrels in proteomes. Nucleic Acids Res, 32(8), 2566-77. Bissig, K. D., Voegelin, T. C., et al. (2001). Tetrathiomolybdate inhibition of the Enterococcus hirae CopB copper ATPase. FEBS Lett, 507(3), 367-70. Blot, N., Berrier, C., et al. (2002). The oligogalacturonate-specific porin KdgM of Erwinia chrysanthemi belongs to a new porin family. J Biol Chem, 277(10), 7936-44. Bolla, J. M., De, E., et al. (2000). Purification, characterization and sequence analysis of Omp50,a new porin isolated from Campylobacter jejuni. Biochem J, 352 Pt 3, 637-43. Bolla, J. M., Saint, N., et al. (2004). Crystallization and preliminary crystallographic studies of MOMP (major outer membrane protein) from Campylobacter jejuni. Acta Crystallogr D Biol Crystallogr, 60(Pt 12 Pt 2), 2349-51.

197

Bacterial β-Barrel Outer Membrane Proteins

Bos, M. P., Tefsen, B., et al. (2004). Identification of an outer membrane protein required for the transport of lipopolysaccharide to the bacterial cell surface. Proc Natl Acad Sci U S A, 101(25), 9417-22. Bos, M. P., & Tommassen, J. (2004). Biogenesis of the Gram-negative bacterial outer membrane. Curr Opin Microbiol, 7(6), 610-6. Braig, H. R., Zhou, W., et al. (1998). Cloning and characterization of a gene encoding the major surface protein of the bacterial endosymbiont Wolbachia pipientis. J Bacteriol, 180(9), 2373-8. Braun, M., & Silhavy, T. J. (2002). Imp/OstA is required for cell envelope biogenesis in Escherichia coli. Mol Microbiol, 45(5), 1289-302. Brinkman, F. S., Bains, M., et al. (2000). The amino terminus of Pseudomonas aeruginosa outer membrane protein OprF forms channels in lipid bilayer membranes, correlation with a three-dimensional model. J Bacteriol, 182(18), 5251-5. Bunikis, J., Luke, C. J., et al. (1998). A surface-exposed region of a novel outer membrane protein (P66) of Borrelia spp. is variable in size and sequence. J Bacteriol, 180(7), 1618-23. Cha, J. S., & Cooksey, D. A. (1991). Copper resistance in Pseudomonas syringae mediated by periplasmic and outer membrane proteins. Proc Natl Acad Sci USA, 88(20), 8915-9. Clantin, B., Hodak, H., et al. (2004). The crystal structure of filamentous hemagglutinin secretion domain and its implications for the two-partner secretion pathway. Proc Natl Acad Sci USA, 101(16), 6194-9. Clark, R. B. (1996). Imipenem resistance among Acinetobacter baumannii, association with reduced expression of a 33-36 kDa outer membrane protein. J Antimicrob Chemother, 38(2), 245-51. Collins, R. F., Frye, S. A., et al. (2004). Structure of the Neisseria meningitidis outer membrane PilQ secretin complex at 12 Å resolution. J Biol Chem, 279(38), 39750-6. Condemine, G., Berrier, C., et al. (2005). Function and expression of an N-acetylneuraminic acid-inducible outer membrane channel in Escherichia coli. J Bacteriol, 187(6), 1959-65. De, E., Jullien, M., et al. (2000). MOMP (major outer membrane protein) of Campylobacter jejuni; a versatile pore-forming protein. FEBS Lett, 469(1), 93-7. Dedieu, L., Pages, J. M., et al. (2004). Use of the omp50 gene for identification of Campylobacter species by PCR. J Clin Microbiol, 42(5), 2301-5. Diederichs, K., Freigang, J., et al. (1998). Prediction by a neural network of outer membrane beta-strand protein topology. Protein Sci, 7(11), 2413-20. Doig, P., Exner, M. M., et al. (1995). Isolation and characterization of a conserved porin protein from Helicobacter pylori. J Bacteriol, 177(19), 5447-52. Edwards, A. M., Jenkinson, H. F., et al. (2005). Binding properties and adhesion-mediating regions of the major sheath protein of Treponema denticola ATCC 35405. Infect Immun, 73(5), 2891-8. Egli, C., Leung, W. K., et al. (1993). Pore-forming properties of the major 53-kilodalton surface antigen from the outer sheath of Treponema denticola. Infect Immun, 61(5), 1694-9.

198

Bacterial β-Barrel Outer Membrane Proteins

El Hamel, C., Freulet, M. A., et al. (2000). Involvement of the C-terminal part of Pseudomonas fluorescens OprF in the modulation of its pore-forming properties. Biochim Biophys Acta, 1509(1-2), 237-44. Epp, S. F., Kohler, T., et al. (2001). C-terminal region of Pseudomonas aeruginosa outer membrane porin OprD modulates susceptibility to meropenem. Antimicrob Agents Chemother, 45(6), 1780-7. Exner, M. M., Doig, P., et al. (1995). Isolation and characterization of a family of porin proteins from Helicobacter pylori. Infect Immun, 63(4), 1567-72. Exner, M. M., Wu, X., et al. (2000). Protection elicited by native outer membrane protein Oms66 (p66) against host-adapted Borrelia burgdorferi, conformational nature of bactericidal epitopes. Infect Immun, 68(5), 2647-54. Faller, M., Niederweis, M., et al. (2004). The structure of a mycobacterial outer-membrane channel. Science, 303(5661), 1189-92. Findlay, H. E., McClafferty, H., et al. (2005). Surface expression, single-channel analysis and membrane topology of recombinant Chlamydia trachomatis Major Outer Membrane Protein. BMC Microbiol, 5(1), 5. Finn, R. D., Mistry, J., et al. (2006). Pfam, clans, web tools and services. Nucleic Acids Res, 34(Database issue), D247-51. Gardy, J. L., Spencer, C., et al. (2003). PSORT-B, Improving protein subcellular localization prediction for Gram-negative bacteria. Nucleic Acids Res, 31(13), 3613-7. Garrow, A. G., Agnew, A., et al. (2005). TMB-Hunt, an amino acid composition based method to screen proteomes for beta-barrel transmembrane proteins. BMC Bioinformatics, 6, 56. Garrow, A. G., & Westhead, D. R., (2007). A consensus algorithm to screen genomes for novel families of transmembrane beta barrel proteins. Proteins. Gentle, I., Gabriel, K., et al. (2004). The Omp85 family of proteins is essential for outer membrane biogenesis in mitochondria and bacteria. J Cell Biol, 164(1), 19-24. Gribun, A., Nitzan, Y., et al. (2003). Molecular and structural characterization of the HMP-AB gene encoding a pore-forming protein from a clinical isolate of Acinetobacter baumannii. Curr Microbiol, 47(5), 434-43. Gromiha, M. M., Ahmad, S., et al. (2004). Neural network-based prediction of transmembrane betastrand segments in outer membrane proteins. J Comput Chem, 25(5), 762-7. Gromiha, M. M., Ahmad, S., et al. (2005). Application of residue distribution along the sequence for discriminating outer membrane proteins. Comput Biol Chem, 29(2), 135-42. Gromiha, M. M., Majumdar, R., et al. (1997). Identification of membrane spanning beta strands in bacterial porins. Protein Eng, 10(5), 497-500. Gromiha, M. M., & Ponnuswamy, P. K. (1993). Prediction of transmembrane beta-strands from hydrophobic characteristics of proteins. Int J Pept Protein Res, 42(5), 420-31.

199

Bacterial β-Barrel Outer Membrane Proteins

Gromiha, M. M., & Suwa, M. (2005). A simple statistical method for discriminating outer membrane proteins with better accuracy. Bioinformatics, 21(7), 961-8. Haake, D. A., Mazel, M. K., et al. (1999). Leptospiral outer membrane proteins OmpL1 and LipL41 exhibit synergistic immunoprotection. Infect Immun, 67(12), 6572-82. Hancock, R. E., & Brinkman, F. S. (2002). Function of pseudomonas porins in uptake and efflux. Annu Rev Microbiol, 56, 17-38. Hansel, A., Pattus, F., et al. (1998). Cloning and characterization of the genes coding for two porins in the unicellular cyanobacterium Synechococcus PCC 6301. Biochim Biophys Acta, 1399(1), 31-9. Hansel, A., & Tadros, M. H. (1998). Characterization of two pore-forming proteins isolated from the outer membrane of Synechococcus PCC 6301. Curr Microbiol, 36(6), 321-6. Hays, J. P., van Selm, S., et al. (2005). Identification and characterization of a novel outer membrane protein (OMP J) of Moraxella catarrhalis that exists in two major forms. J Bacteriol, 187(23), 7977-84. Henderson, N. S., So, S. S., et al. (2004). Topology of the outer membrane usher PapC determined by site-directed fluorescence labeling. J Biol Chem, 279(51), 53747-54. High, A. S., Torosian, S. D., et al. (1993). Cloning, nucleotide sequence and expression in Escherichia coli of a gene (ompM) encoding a 25 kDa major outer-membrane protein (MOMP) of legionella pneumophila. J Gen Microbiol, 139(8), 1715-21. Hoffman, P. S., Seyer, J. H., et al. (1992). Molecular characterization of the 28- and 31-kilodalton subunits of the Legionella pneumophila major outer membrane protein. J Bacteriol, 174(3), 908-13. Hofreuter, D., Karnholz, A., et al. (2003). Topology and membrane interaction of Helicobacter pylori ComB proteins involved in natural transformation competence. Int J Med Microbiol, 293(2-3), 153-65. Huang, H., Wang, X., et al. (2007). Porin activity of Anaplasma phagocytophilum outer membrane fraction and purified P44. J Bacteriol, 189(5), 1998-2006. Hughes, E. S., Shaw, K. M., et al. (2001). Mutagenesis and functional reconstitution of chlamydial major outer membrane proteins, VS4 domains are not required for pore formation but modify channel function. Infect Immun, 69(3), 1671-8. Jacob-Dubuisson, F., Fernandez, R., et al. (2004). Protein secretion through autotransporter and twopartner pathways. Biochim Biophys Acta, 1694(1-3), 235-57. Jacoboni, I., Martelli, P. L., et al. (2001). Prediction of the transmembrane regions of beta-barrel membrane proteins with a neural network-based predictor. Protein Sci, 10(4), 779-87. Kawa, D. E., Schachter, J., et al. (2004). Immune response to the Chlamydia trachomatis outer membrane protein PorB. Vaccine, 22(31-32), 4282-6. Kawa, D. E., & Stephens, R. S. (2002). Antigenic topology of chlamydial PorB protein and identification of targets for immune neutralization of infectivity. J Immunol, 168(10), 5184-91. Kiino, D. R., Singer, M. S., et al. (1993). Two overlapping genes encoding membrane proteins required for bacteriophage N4 adsorption. J Bacteriol, 175(21), 7081-5.

200

Bacterial β-Barrel Outer Membrane Proteins

Kleivdal, H., Puntervoll, P., et al. (2001). Topological investigations of the FomA porin from Fusobacterium nucleatum and identification of the constriction loop L6. Microbiology, 147(Pt 4), 1059-67. Koronakis, V., Sharff, A., et al. (2000). Crystal structure of the bacterial membrane protein TolC central to multidrug efflux and protein export. Nature, 405(6789), 914-9. Koster, M., Bitter, W., et al. (2000). Protein secretion mechanisms in Gram-negative bacteria. Int J Med Microbiol, 290(4-5), 325-31. Krinos, C., High, A. S., et al. (1999). Role of the 25 kDa major outer membrane protein of Legionella pneumophila in attachment to U-937 cells and its potential as a virulence factor for chick embryos. J Appl Microbiol, 86(2), 237-44. Kubo, A., & Stephens, R. S. (2000). Characterization and functional analysis of PorB, a Chlamydia porin and neutralizing target. Mol Microbiol, 38(4), 772-80. Lim, C. K., & Cooksey, D. A. (1993). Characterization of chromosomal homologs of the plasmid-borne copper resistance operon of Pseudomonas syringae. J Bacteriol, 175(14), 4492-8. Limansky, A. S., Mussi, M. A., et al. (2002). Loss of a 29-kilodalton outer membrane protein in Acinetobacter baumannii is associated with imipenem resistance. J Clin Microbiol, 40(12), 4776-8. Liu, J., Rosenberg, E., et al. (1995). Fluidity of the Lipid Domain of Cell Wall From Mycobacterium chelonae. PNAS, 92(24), 11254-11258. Liu, Q., Zhu, Y., et al. (2003). Identification of beta-barrel membrane proteins based on amino acid composition properties and predicted secondary structure. Comput Biol Chem, 27(3), 355-61. Liu, Q., Zhu, Y. S., et al. (2003). A HMM-based method to predict the transmembrane regions of betabarrel membrane proteins. Comput Biol Chem, 27(1), 69-76. Luo, Y., Frey, E. A., et al. (2000). Crystal structure of enteropathogenic Escherichia coli intimin-receptor complex. Nature, 405(6790), 1073-7. Macdonald, A. G., Martinac, B., et al. (2003). Patch-clamp experiments with porins extracted from a marine bacterium (Photobacterium profundum strain SS9) and reconstituted in liposomes. Cell Biochem Biophys, 37(3), 157-67. Mannella, C. A., Neuwald, A. F., et al. (1996). Detection of likely transmembrane beta strand regions in sequences of mitochondrial pore proteins using the Gibbs sampler. J Bioenerg Biomembr, 28(2), 163-9. Marani, P., Wagner, S., et al. (2006). New Escherichia coli outer membrane proteins identified through prediction and experimental verification. Protein Sci, 15(4), 884-9. Martelli, P. L., Fariselli, P., et al. (2002). A sequence-profile-based HMM for predicting and discriminating beta barrel membrane proteins. Bioinformatics, 18 Suppl 1, S46-53. McCaman, M. T., Auer, K., et al. (1999). Sequence characterization of two new members of a multi-gene family in Serpulina hyodysenteriae (B204) with homology to a 39 kDa surface exposed protein, vspC and D. Vet Microbiol, 68(3-4), 273-83.

201

Bacterial β-Barrel Outer Membrane Proteins

McCaman, M. T., Auer, K., et al. (2003). Brachyspira hyodysenteriae contains eight linked gene copies related to an expressed 39-kDa surface protein. Microbes Infect, 5(1), 1-6. Meng, G., N. Surana, K., et al. (2006). Structure of the outer membrane translocator domain of the Haemophilus influenzae Hia trimeric autotransporter. EMBO J, 25(11), 2297-304. Mills, J., N. Wyborn, R., et al. (1997). An outer-membrane porin inducible by short-chain amides and urea in the methylotrophic bacterium Methylophilus methylotrophus. Microbiology, 143(7), 2373-9. Möller, S., Croning, M. D., et al. (2001). Evaluation of methods for the prediction of membrane spanning regions. Bioinformatics, 17(7), 646-53. Molloy, M. P., Herbert, B. R., et al. (2000). Proteomic analysis of the Escherichia coli outer membrane. Eur J Biochem, 267(10), 2871-81. Moser, I., Schroeder, W., et al. (1997). Campylobacter jejuni major outer membrane protein and a 59kDa protein are involved in binding to fibronectin and INT 407 cell membranes. FEMS Microbiol Lett, 157(2), 233-8. Moslavac, S., Mirus, O., et al. (2005). Conserved pore-forming regions in polypeptide-transporting proteins. FEBS J, 272(6), 1367-78. Murzin, A. G., Lesk, A. M., et al. (1994). Principles determining the structure of beta-sheet barrels in proteins. I. A theoretical analysis. J Mol Biol, 236(5), 1369-81. Murzin, A. G., Lesk, A. M., et al. (1994). Principles determining the structure of beta-sheet barrels in proteins. II. The observed structures. J Mol Biol, 236(5), 1382-400. Mussi, M. A., Limansky, A. S., et al. (2005). Acquisition of resistance to carbapenems in multidrug-resistant clinical strains of Acinetobacter baumannii, natural insertional inactivation of a gene encoding a member of a novel family of beta-barrel outer membrane proteins. Antimicrob Agents Chemother, 49(4), 1432-40. Nagano, K., Read, E. K., et al. (2005). Trimeric structure of major outer membrane proteins homologous to OmpA in Porphyromonas gingivalis. J Bacteriol, 187(3), 902-11. Natt, N. K., Kaur, H., et al. (2004). Prediction of transmembrane regions of beta-barrel proteins using ANN- and SVM-based methods. Proteins, 56(1), 11-8. Nesper, J., Hill, C. M., et al. (2003). Translocation of group 1 capsular polysaccharide in Escherichia coli serotype K30. Structural and functional analysis of the outer membrane lipoprotein Wza. J Biol Chem, 278(50), 49763-72. Neuwald, A. F., Liu, J. S., et al. (1995). Gibbs motif sampling, detection of bacterial outer membrane protein repeats. Protein Sci, 4(8), 1618-32. Newman, C. L., & Stathopoulos, C. (2004). Autotransporter and two-partner secretion, delivery of large-size virulence factors by gram-negative bacterial pathogens. Crit Rev Microbiol, 30(4), 275-86. Ng, T. W., Akman, L., et al. (2004). The usher N terminus is the initial targeting site for chaperone-subunit complexes and participates in subsequent pilus biogenesis events. J Bacteriol, 186(16), 5321-31.

202

Bacterial β-Barrel Outer Membrane Proteins

Niemann, H. H., Schubert, W. D., et al. (2004). Adhesins and invasins of pathogenic bacteria, a structural view. Microbes Infect, 6(1), 101-12. Oberle, S. M., & Barbet, A. F. (1993). Derivation of the complete msp4 gene sequence of Anaplasma marginale without cloning. Gene, 136(1-2), 291-4. Ochs, M. M., Lu, C. D., et al. (1999). Amino acid-mediated induction of the basic amino acid-specific outer membrane porin OprD from Pseudomonas aeruginosa. J Bacteriol, 181(17), 5426-32. Ofori-Darko, E., Zavros, Y., et al. (2000). An OmpA-like protein from Acinetobacter spp. stimulates gastrin and interleukin-8 promoters. Infect Immun, 68(6), 3657-66. Orlik, F., Andersen, C., et al. (2003). CymA of Klebsiella oxytoca outer membrane, binding of cyclodextrins and study of the current noise of the open channel. Biophys J, 85(2), 876-85. Pajatsch, M., Andersen, C., et al. (1999). Properties of a cyclodextrin-specific, unusual porin from Klebsiella oxytoca. J Biol Chem, 274(35), 25159-66. Park, K. K., Heuner, K., et al. (2002). Cloning and characterization of a major surface protein (MspTL) of Treponema lecithinolyticum associated with rapidly progressive periodontitis. FEMS Microbiol Lett, 207(2), 185-92. Paschen, S. A., Waizenegger, T., et al. (2003). Evolutionary conservation of biogenesis of beta-barrel membrane proteins. Nature, 426(6968), 862-6. Peck, B., Ortkamp, M., et al. (2001). Characterization of four members of a multigene family encoding outer membrane proteins of Helicobacter pylori and their potential for vaccination. Microbes Infect, 3(3), 171-9. Pellinen, T., Ahlfors, H., et al. (2003). Topology of the Erwinia chrysanthemi oligogalacturonate porin KdgM. Biochem J, 372(Pt 2), 329-34. Pessione, E., Giuffrida, M. G., et al. (2003). Membrane proteome of Acinetobacter radioresistens S13 during aromatic exposure. Proteomics, 3(6), 1070-6. Pirnay, J. P., De Vos, D., et al. (2002). Analysis of the Pseudomonas aeruginosa oprD gene from clinical and environmental isolates. Environ Microbiol, 4(12), 872-82. Puntervoll, P., Ruud, M., et al. (2002). Structural characterization of the fusobacterial non-specific porin FomA suggests a 14-stranded topology, unlike the classical porins. Microbiology, 148(Pt 11), 3395-403. Rahn, A., Beis, K., et al. (2003). A novel outer membrane protein, Wzi, is involved in surface assembly of the Escherichia coli K30 group 1 capsule. J Bacteriol, 185(19), 5882-90. Rehm, B. H. (1996). The Azotobacter vinelandii gene algJ encodes an outer-membrane protein presumably involved in export of alginate. Microbiology, 142(4), 873-80. Rehm, B. H., Boheim, G., et al. (1994). Overexpression of algE in Escherichia coli, subcellular localization, purification, and ion channel properties. J Bacteriol, 176(18), 5639-47.

203

Bacterial β-Barrel Outer Membrane Proteins

Rehm, B. H., & Hancock, R. E. (1996). Membrane topology of the outer membrane protein OprH from Pseudomonas aeruginosa, PCR-mediated site-directed insertion and deletion mutagenesis. J Bacteriol, 178(11), 3346-9. Rodriguez-Maranon, M. J., Bush, R. M., et al. (2002). Prediction of the membrane-spanning beta-strands of the major outer membrane protein of Chlamydia. Protein Sci, 11(7), 1854-61. Ross, B. C., Czajkowski, L., et al. (2004). Characterization of two outer membrane protein antigens of Porphyromonas gingivalis that are protective in a murine lesion model. Oral Microbiol Immunol, 19(1), 6-15. Saint, N., El Hamel, C., et al. (2000). Ion channel formation by N-terminal domain, a common feature of OprFs of Pseudomonas and OmpA of Escherichia coli. FEMS Microbiol Lett, 190(2), 261-5. Sato, K., Sakai, E., et al. (2005). Identification of a new membrane-associated protein that influences transport/maturation of gingipains and adhesins of Porphyromonas gingivalis. J Biol Chem, 280(10), 8668-77. Schirmer, T., & Cowan, S. W. (1993). Prediction of membrane-spanning beta-strands and its application to maltoporin. Protein Sci, 2(8), 1361-3. Schulz, G. E. (2002). The structure of bacterial outer membrane proteins. Biochim Biophys Acta, 1565(2), 308-17. Schulz, G. E. (2003). Transmembrane beta-barrel proteins. Adv Protein Chem, 63, 47-70. Shang, E. S., Exner, M. M., et al. (1995). The rare outer membrane protein, OmpL1, of pathogenic Leptospira species is a heat-modifiable porin. Infect Immun, 63(8), 3174-81. Siroy, A., Cosette, P., et al. (2006). Global comparison of the membrane subproteomes between a multidrug-resistant Acinetobacter baumannii strain and a reference strain. J Proteome Res, 5(12), 3385-98. Siroy, A., Molle, V., et al. (2005). Channel formation by CarO, the carbapenem resistance-associated outer membrane protein of Acinetobacter baumannii. Antimicrob Agents Chemother, 49(12), 4876-83. Skare, J. T., Mirzabekov, T. A., et al. (1997). The Oms66 (p66) protein is a Borrelia burgdorferi porin. Infect Immun, 65(9), 3654-61. Song, L., Hobaugh, M. R., et al. (1996). Structure of Staphylococcal alpha -Hemolysin, a Heptameric Transmembrane Pore. Science, 274(5294), 1859-1865. Surana, N. K., Buscher, A. Z., et al. (2006). Translocator proteins in the two-partner secretion family have multiple domains. J Biol Chem, 281(26), 18051-8. Surana, N. K., Grass, S., et al. (2004). Evidence for conservation of architecture and physical properties of Omp85-like proteins throughout evolution. Proc Natl Acad Sci U S A, 101(40), 14497-502. Tamber, S., Ochs, M. M., et al. (2006). Role of the novel OprD family of porins in nutrient uptake in Pseudomonas aeruginosa. J Bacteriol, 188(1), 45-54. Thanassi, D. G. (2002). Ushers and secretins, channels for the secretion of folded proteins across the bacterial outer membrane. J Mol Microbiol Biotechnol, 4(1), 11-20.

204

Bacterial β-Barrel Outer Membrane Proteins

Tomb, J. F., White, O., et al. (1997). The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature, 388(6642), 539-47. Toren, A., Orr, E., et al. (2002). The active component of the bioemulsifier alasan from Acinetobacter radioresistens KA53 is an OmpA-like protein. J Bacteriol, 184(1), 165-70. Touze, T., Hayward, R. D., et al. (2004). Self-association of EPEC intimin mediated by the beta-barrelcontaining anchor domain, a role in clustering of the Tir receptor. Mol Microbiol, 51(1), 73-87. Tsuzuki, M., Xu, X. Y., et al. (2005). SspA, an outer membrane protein, is highly induced under saltstressed conditions and is essential for growth under salt-stressed aerobic conditions in Rhodobacter sphaeroides f. sp. denitrificans. Appl Microbiol Biotechnol, 68(2), 242-50. Ulmke, C., Lengeler, J. W., et al. (1997). Identification of a new porin, RafY, encoded by raffinose plasmid pRSD2 of Escherichia coli. J Bacteriol, 179(18), 5783-8. Umeda, H., Aiba, H., et al. (1996). SomA, a novel gene that encodes a major outer-membrane protein of Synechococcus sp. PCC 7942. Microbiology, 142(8), 2121-8. Vashist, J., & Rajeswari, M. R. (2006). Structural investigations on novel porin, OmpAb from Acinetobacter baumannii. J Biomol Struct Dyn, 24(3), 243-53. Vogel, H., & Jahnig, F. (1986). Models for the structure of outer-membrane proteins of Escherichia coli derived from raman spectroscopy and prediction methods. J Mol Biol, 190(2), 191-9. von Heijne, G. (1999). Recent advances in the understanding of membrane protein assembly and structure. Q Rev Biophys, 32(4), 285-307. Voulhoux, R., & Tommassen, J. (2004). Omp85, an evolutionarily conserved bacterial protein involved in outer-membrane-protein assembly. Res Microbiol, 155(3), 129-35. Wimley, W. C. (2002). Toward genomic identification of beta-barrel membrane proteins, composition and architecture of known structures. Protein Sci, 11(2), 301-12. Wimley, W. C. (2003). The versatile beta-barrel membrane protein. Curr Opin Struct Biol, 13(4), 40411. Wong, H. C., Fear, A. L., et al. (1990). Genetic organization of the cellulose synthase operon in Acetobacter xylinum.Proc Natl Acad Sci USA, 87(20), 8130-4. Wylie, J. L., & Worobec, E. A. (1994). Cloning and nucleotide sequence of the Pseudomonas aeruginosa glucose-selective OprB porin gene and distribution of OprB within the family Pseudomonadaceae. Eur J Biochem, 220(2), 505-12. Wylie, J. L., & Worobec, E. A. (1995). The OprB porin plays a central role in carbohydrate uptake in Pseudomonas aeruginosa. J Bacteriol, 177(11), 3021-6. Xu, X., Abo, M., et al. (2001). Salt-stress-responsive membrane proteins in Rhodobacter sphaeroides f. sp. denitrificans IL 106. J Biosci Bioeng, 91(2), 228-30.

205

Bacterial β-Barrel Outer Membrane Proteins

Xu, X. Y., Kadokura, H., et al. (2001). Cloning and sequencing of a gene encoding a novel salt stressinduced membrane protein from Rhodobacter sphaeroides f. sp. dentrificans. Appl Microbiol Biotechnol, 56(3-4), 442-7. Yen, T. Y., Pal, S., et al. (2005). Characterization of the disulfide bonds and free cysteine residues of the Chlamydia trachomatis mouse pneumonitis major outer membrane protein. Biochemistry, 44(16), 6250-6. Yoshihara, E., Yoneyama, H., et al. (1998). Identification of the catalytic triad of the protein D2 protease in Pseudomonas aeruginosa. Biochem Biophys Res Commun, 247(1), 142-5. Zhai, Y., & Saier Jr., M. H. (2002). The beta-barrel finder (BBF) program, allowing identification of outer membrane beta-barrel proteins encoded within prokaryotic genomes. Protein Sci, 11(9), 2196-207. Zhang, J. Z., Guo, H., et al. (2004). Expression of members of the 28-kilodalton major outer membrane protein family of Ehrlichia chaffeensis during persistent infection. Infect Immun, 72(8), 4336-43. Zhang, Q., Meitzler, J. C., et al. (2000). Sequence polymorphism, predicted secondary structures, and surface-exposed conformational epitopes of Campylobacter major outer membrane protein. Infect Immun, 68(10), 5679-89. Zogaj, X., Nimtz, M., et al. (2001). The multicellular morphotypes of Salmonella typhimurium and Escherichia coli produce cellulose as the second component of the extracellular matrix. Mol Microbiol, 39(6), 1452-63.

K ey T erms Beta-Barrel Outer Membrane Proteins: They constitute one of the two major structural classes of transmembrane proteins (the other being the alpha-helical membrane proteins). They have their membrane-spanning segments entirely composed of short amphipathic beta-strands that twist and coil in order to form a barrel (beta-barrel). They have been found up to now only in the outer membranes of Gram-negative Bacteria and presumably (based on low resolution experimental data) on the outer surfaces of mitochondria and chloroplasts. They perform a series of very important biological functions such as membrane transport, receptor activity, and enzyme function or have a structural role. The smallest known transmembrane beta-barrels are composed of 8 beta-strands, whereas the largest are composed of 24 beta-strands even though it is possible that barrels with a larger number exist. Gram-Negative Bacteria: Traditionally, Bacteria are divided according to their behaviour to the Gram staining. Bacteria that are stained by the Gram’s method are commonly referred to as Grampositive, whereas others (that are not stained) are referred to as Gram negative. Gram-negative Bacteria include a number of important classes such as proteobacteria, cyanobacteria, spirochaetes, green sulfur and green non-sulfur bacteria. They all share a common structure in their surface which is composed of a cytoplasmic membrane, a periplasmic space and an outer membrane. Outer Membrane: The term refers to the external (outside) membranes of Gram-negative bacteria, chloroplasts and mitochondria. The outer membrane of Gram-negative bacteria has a unique and un-

206

Bacterial β-Barrel Outer Membrane Proteins

usual structure. The outer leaflet of the membrane is composed of a complex lipopolysaccharide (LPS) whose lipid portion acts as an endotoxin. Another noticeable difference of the outer membrane (at least in Bacteria) is the fact that proteins that are embedded in it (integral membrane proteins), are having their membrane-spanning segments entirely composed of beta-strands (beta-barrel outer membrane proteins), as opposed to integral membrane proteins in any other membrane which have their membrane spanning segments formed by hydrophobic alpha-helices (alpha-helical membrane proteins). Porins: This is the oldest known and well-studied super-family of transmembrane beta-barrels. Porins are large enough to allow passive diffusion i.e., they act as channels that are specific to different types of molecules. They are found in the outer membranes of Gram-negative bacteria, mitochondria and chloroplasts. The amino acid composition of the transmembrane beta strands is unique since polar and non-polar residues alternate along them. This way, the non-polar residues face outwards in order to interact with the non-polar lipid bilayer, while the polar residues face the barrel interior in order to interact with the aqueous channel. Porins typically control the diffusion of small metabolites like sugars, ions, and amino acids. The archetypical general diffusion porins of Gram-negative Bacteria are composed of 16-stranded beta-barrels and are active only as homo-trimers (trimeric porins). However, other families have been found deviating from this motif such as the sugar porins which are trimeric porins composed of 18-stranded beta-barrels or the monomeric porins composed of 14-stranded beta-barrels.

207

Section IV

Experimental Techniques for Systems Biology

209

Chapter XI

Clustering Methods for GeneExpression Data L.K. Flack University of Queensland, Australia G.J. McLachlan University of Queensland, Australia

abstract Clustering methods are used to place items in natural patterns or convenient groups. They can be used to place genes into clusters to have similar expression patterns across the tissue samples of interest. They can also be used to cluster tissues into groups on the basis of their gene profiles. Examples of the methods used are hierarchical agglomerative clustering, k-means clustering, self organizing maps, and model-based methods. The focus of this chapter is on using mixtures of multivariate normal distributions to provide model-based clusterings of tissue samples and of genes.

INTR OD UCTI ON DNA microarrays are collections of microscopic DNA spots arrayed on a solid surface. Each of these DNA spots will hybridize with a particular target RNA or DNA sequence. Optical measurements are made of fluorophores attached to the target RNA or DNA. DNA microarrays allow us to simultaneously read expression levels of expression levels on thousands of genes. They and other high throughput measurement methods bring many new opportunities in data analysis, but they also create difficulties in taking advantage of this amount of data. A variety of multivariate methods have been used to look for relationships among the genes and tissue samples. Cluster analysis has been one of the most frequently used of these methods. It has been useful in the discovery of gene function and of groups of interconnected biological processes; see Eisen et al. (1998) for examples. Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Clustering Methods for Gene-Expression Data

In medical applications, we are usually interested in the supervised and unsupervised grouping of tissue samples on the basis of the genes expressed. In the latter context, the intent is to identify what subtypes of cancer or other diseases exist, with the aim of assigning patients to these subgroups in order to aid their prognosis and therapy. In biological studies, we are usually interested in partitioning the genes into clusters in which the genes display similar patterns of gene expression across the relevant tissue samples (or cell lines). Genes in the same cluster are perhaps likely to be part of the same biological pathway or otherwise related. It can be seen there are two distinct but related clustering problems with microarray data. One problem concerns the clustering of the tissues on the basis of the genes; the other concerns the clustering of the genes on the basis of the tissues. This duality in cluster analysis is quite common. The aim of clustering is to put items into groups so that they are more similar to each other than they are to members of other clusters. One of the difficulties of clustering is that the notion of clustering is vague. A useful way to think about the different clustering procedures is in terms of the shape of the clusters. The majority of the existing clustering methods assume that a similarity or distance measure or metric is known a priori; often the Euclidean metric is used. But clearly, it would be more appropriate to use a metric that depends on the shape of the clusters. As pointed out by Coleman et al. (1999), the difficulty is that the shape of the clusters is not known until the clusters have been found, and the clusters cannot be effectively identified unless the shapes are known. We will give a brief overview of clustering before we describe its application to microarray data. More detailed accounts of clustering can be found in the many books on this topic; for example, Everitt (1993), Hartigan (1975), and Kaufman and Rousseeuw (1990).

So me H e uristic

Clu stering

Meth ods

In cluster analysis, we wish to group a number (n) of entities into a smaller number (g) of groups on the basis of measurements of some variables associated with each entity. We let yj = (y1j, …, ypj)T be the observation or feature vector of p measurements y1j, …, ypj made on the jth entity ( j = 1, …, n) to be clustered. In discriminant analysis the data belong to g known classes and we wish to create an allocation rule to allow us to assign an unclassified entity to one of these classes on the basis of its feature vector. In cluster analysis, we have no prior knowledge of group membership or structure, except possibly the number of classes. Clustering can have either or both of two aims. We might wish to split the data into several groups with no implication that these groups are a natural division of the data. We might do this for the sake of convenience or mathematical tractability. In this case intergroup boundaries do not necessarily have to be in regions of the feature space with a relatively low density of points. The feature space will be divided into contiguous and at least in some sense compact regions. This is sometimes called dissection or segmentation. Alternatively, we might wish to find a natural subdivision of the entities into groups. In this case the clusters will be regions of the feature space with a relatively high density of points separated by regions with relatively low densities of points. Sometimes the distinction between the two aims is stressed. But often it is not made, particularly as most methods for finding natural clusters are also useful for segmenting the data. Clustering methods can be categorized as hierarchical or nonhierarchical. With a hierarchical clustering method every cluster obtained is a split or merger of clusters obtained at the previous stage. Hierarchical clustering methods can be agglomerative, starting with g = n clusters or divisive starting

210

Clustering Methods for Gene-Expression Data

with a single cluster. In practice with hierarchical clustering we usually use agglomerative methods since hierarchical divisive methods can computationally prohibitive unless the sample size n is very small. (There are 2(n--1) – 1 ways of making the first split.) There are methods of carrying out hierarchical divisive clustering that are less computationally intensive, but they will usually not give the optimal partition (Hastie et al., 2001). To apply a hierarchical agglomerative clustering, procedure we first calculate a matrix of distances or of similarities between pairs of observations. We need to choose an appropriate distance metric. Pearson correlation coefficients are common choice for genetic data. They are equivalent to the squared Euclidean distances on data normalized to have zero means and unit variances. We next choose a linkage metric for the between cluster distance. Some examples are single linkage, average linkage, and complete linkage. Single linkage uses the shortest distance between any two objects (one from each cluster). Complete linkage uses the longest distance between any two objects (one from each cluster). Average linkage uses the average distance between pairs of objects (one from each cluster). For agglomerative clustering, we join the two closest clusters, update the intercluster distances and repeat until we have only one cluster. These clusterings can be represented as a tree. We cut the tree at a level that gives a clustering with which we are satisfied; ideally, one which gives well separated coherent clusters. Another approach is Ward’s procedure where we join clusters so as to minimize withincluster variance. With hierarchical clustering poor choices of a join or a split early in the clustering process cannot be corrected by later splits or joins. With single linkage clustering there is a tendency for neighbouring clusters to join into chains. These are often not a natural division of the feature space and the resulting clusters are not compact. Complete linkage tends to create compact groups and seems to perform better than single or average linkage for gene expression data. One of the most popular nonhierarchical clustering algorithms is k-means. It seeks to find k = g clusters that minimize the sum of the squared Euclidean distances between the observations yj and their cluster means; that is, it seeks to minimize the trace of W, trW, where: g

n

W = ∑∑ zij (y j − yi )(y j − yi )

T

i =1 j =1



(1)

is the pooled within-cluster sums of squares and products matrix, and: n

yi = ∑ zij y j j =1

n

∑z j =1

ij



(2)

is the sample mean of the ith cluster. Here zij is a zero-one indicator variable which takes the value one if yj belongs to the ith cluster and zero if it does not. It is impractical to consider all partitions of the observations into g clusters unless n is very small since the number of such partitions is approximately gn /g!; see Kaufman and Rousseeuw (1990). We usually implement k-means by iteratively moving points between clusters so as to minimize trW. One method is to assign each observation yj to the cluster with the nearest centre (sample mean) and then update the cluster centre before repeating the process with the next observation. The initial centre estimates are often a random subsample of k points from the data set to be clustered. A related clustering method is k-medioids (Kaufman and Rousseeuw, 1990) which is similar to kmeans, but which only allows observations yj as cluster centres. Another related method is the self-or-

211

Clustering Methods for Gene-Expression Data

ganizing map which constrains the cluster centres to lie on a smooth two-dimensional surface. Another possibility is to seek to minimize the determinant of W, |W|, rather than its trace (Friedman and Rubin, 1967). This will tend to divide the data into ellipsoidal clusters rather than the spherical clusters that k-means tends to create. A difficulty with all the heuristic clustering methods described so far is that they have no objective means of choosing the number of clusters.

C lustering Using Mixture Models We will be focussing on model-based clustering via mixtures of normal densities. In this approach, each observation vector yj is assumed to have a g-component normal mixture density: g

f (y j ; Ψ )= ∑ i =1

i

(y ; j

i

, Σi )

(3)

where φ(yj ;μi , Σi ) denotes the p-variate normal density function with mean μi and covariance matrix Σi and the πi denote the mixing proportions which are nonnegative and sum to one. The vector of unknown parameters, Ψ consists of the mixing proportions πi, the elements of the component means μi, and the elements of the component-covariance matrices Σi. This vector can be estimated by its maximum likeliˆ calculated via the EM algorithm; see McLachlan and Basford (1988) and McLachlan hood estimate Ψ and Peel (2000). This gives a probabilistic clustering defined in terms of the estimated posterior probˆ ), where the latter is the estimated probability that the feature abilities of component membership τi(yj ;Ψ vector with observed value yj belongs to the ith component of the mixture. An outright clustering can be obtained by assigning yj to the component to which it has the greatest estimated posterior probability of belonging. Since clustering methods based on mixture models have an explicit statistical model underpinning them, the clustering obtained is more easily described and interpreted than one not derived from a parametric model. We can perform tests of significance on the results in order to determine whether we have a natural clustering or just a segmentation of the data. We can compare different clusterings (Aitkin et al., 1981; McLachlan, 1987). The clusters can overlap as we would expect some gene and tissue clusters to do. The assumption of normality for the cluster distributions is a potential limitation. However, if an appropriate normalization is done this would appear to be a reasonable assumption for microarray data. We can also use the likelihood ratio to test for the number of components in the mixture, although regularity conditions do not hold for -2logλ to have its usual null distribution of chi-squared with degrees of freedom equal to the difference in the number of parameters between the null and alternative hypotheses, For normal mixture models the most useful of the closed form likelihood based criteria is the BIC. This is equal to -2logλ + d log n where d is the number of fitted parameters. We choose the value of g which maximizes this statistic. While this depends on regularity conditions that do not hold, it often works reasonably well in practice. We can also use a resampling approach (McLachlan, 1987). An advantage of mixture models with elliptically symmetrical distributions such as the normal or more robust models using the t distribution (McLachlan and Peel, 2000) is that the clustering obtained is not affected by changes of location, scale, or by rotation. Proposals have been made for approaches that allow both genes and tissues to be simultaneously clustered (Pollard and van der Laan, 2002; Getz et al., 2000). 212

Clustering Methods for Gene-Expression Data

If the number of elements per vector p is large we might not be able to fit the mixture model described above. This is because the component-covariance matrices Σi are highly parameterized with p(p+1) distinct elements each. Hence if we wish to fit normal mixture models to high-dimensional data we need to use some form of dimension reduction or regularization. A common method of reducing dimensionality is to perform a principal component analysis and use only the first few principal components if they account for a large proportion of the variance. However, the principal components are based on a global model and so they do not necessarily give the directions in the feature space best for revealing the underlying group structure. A global nonlinear method of dimension reduction can be obtained by using mixtures of linear submodels, such as with mixtures of factor analysers. This model provides local dimensionality reduction by imposing on the component-covariance matrices the constraint: Σi = Bi Bi + Di (0 = 1,...,g)

(4)

where Bi is a p x q matrix of factor loadings and Di is a diagonal matrix (i = 1, …, g). Within the ith component of the mixture, it effectively approximates the correlations between the variables by their linear dependence on a small number of (unobservable) latent variables (factors). Model-based methods allow us to perform tests to determine whether the number of clusters g allows a satisfactory division of the data set. If we are using a mixture of factor analysers model we can also test for the number of factors per cluster required for an adequate representation of the variance structure of the clusters For a given number of components g we can make a test for the number of factors using the likelihood ratio λ, where λ = L(Ψ0) / L(Ψ1) where L(Ψ1) and L(Ψ0) are the likelihoods under the alternative and null hypotheses respectively. Regularity conditions do hold for this test for a fixed number of components For the null hypothesis that H0 : q = q0 versus the alternative H1 : q = q + 1, the statistic -2logλ is asymptotically chi-squared with d = g(p-q0) degrees of freedom. However where n is not large relative to the number of unknown parameters we prefer to use the BIC (Bayesian information criterion). In this context, it means that twice the increase in the log likelihood (-2logλ) has to be greater than dlogn for the hypothesis to be rejected.

D ata T ype We now proceed to consider the application of the methods described above to the clustering of microarray data. Normalized expression data from microarray or other genetic experiments can be written as a matrix with M columns and N rows. The M columns correspond to the tissue samples and the N rows correspond to the N genes in the experiment. The expression signature of a tissue sample is the level of the N genes. The expression profile of a gene is the M expression levels across different tissue samples.

T issue C lustering The observation vectors yj used in tissue clustering are the expression signatures of the tissue samples, where yj contains the expression levels of the N Genes. For hierarchical clustering the distance matrix is quite tractable for tissue data as it requires only O(M2N) calculations and storage of a matrix with

213

Clustering Methods for Gene-Expression Data

O(M2) values. The number of tissue samples M is usually less than 100; N could be tens of thousands. A problem with these methods is how to choose the number of clusters. Another, especially with single linkage clustering, is that they can put most of the observations into a single large cluster with several singletons. The best performance appears to be from complete linkage (Gibbons and Roth, 2002). We see no reason why we should expect genomic data to form hierarchical groupings. Nonhierarchical methods such as k-means and self-organizing maps typically do better than hierarchical methods, but do tend to divide the data into spherical clusters even when this is a suboptimal representation of the data. Model based methods have recently become a focus of attention (McLachlan et al., 2002). They offer soundly based tests and can reflect the fuzzy nature of some groups. The chief problem with applying them directly to clustering of tissues is that they cannot be directly fitted if the number of genes is large. This is because we have more parameters to be estimated than we have observations to estimate them with. Some form of dimension reduction is necessary, such as with mixtures of factor analysers as described above. The EMMIX-GENE program of McLachlan et al (2002) is designed for the clustering of gene samples using mixtures of factor analysers. However, since the number of tissue samples is usually quite small relative to the number of genes, it might not be practical to fit mixtures of factor analysers to the tissue samples on the basis of all the genes as it would involve a considerable amount of computation time. Thus initially some of the genes may have to be removed. Indeed, the simultaneous use of too many genes in the cluster analysis may only serve to create noise that masks the effect of a smaller number of genes. Using different subsets of the genes can lead to different clusterings of the tissues (Pollard and van der Laan, 2002; Friedman and Meulman, 2004). For example, we might be able to cluster samples by tissue type (cancerous or healthy) and also create a different clustering for the same tissues based for example on progression through the cell cycle (Belitskaya-Levy, 2006). Thus EMMIX-GENE has two optional preliminary steps. The first is to individually screen the genes to eliminate ones which are expected to be of little use in clustering. This is done by testing each gene for the hypotheses that it has a single component t distribution over the tissue samples. After this is done there may still be too many variables. Hence there is a second step available in which the selected genes are clustered into groups on the basis of Euclidean distance. This is done by fitting a mixture of normal distributions with the covariance matrices restricted to being equal to a multiple of the identity matrix. We now cluster the tissue samples on the basis of all or some of the genes in a chosen cluster. Alternatively, we can replace the gene clusters by their means and base our clustering on some or all of these means. The clustering of the genes in this step is more a segmentation for computational convenience than an attempt to seek an informative natural clustering of the genes.

G ene C lustering The data used in gene clustering are the expression profiles of the genes. While hierarchical methods can be used for the clustering of gene profiles, they are less computationally tractable than they are for tissues. This is because the distance matrix is usually much larger, O(N2), and takes more calculations to create, O(N2M), since N is so much larger than M. Difficulties for hierarchical methods with choosing the appropriate number of groups and with chain formation apply to gene clustering as well as to tissue clustering.

214

Clustering Methods for Gene-Expression Data

Gene shaving (Hastie et al., 2000) is an example of a nonhierarchical method. This method creates tight clusters of genes with large variation between nonreplicated samples. Replicated samples need to be replaced by their means. It does not necessarily put all the genes into clusters, only the ones with significant differences between samples. The same gene can occur in more than one cluster. Mixtures of normal distributions are again a useful clustering approach. However, up until now, we have clustered the data under two assumptions; namely: a. b.

There are no replications on any particular entity. All the observations on the entities are independent of one another.

The difficulty here is that condition (b) will not hold for the clustering of gene profiles, since not all the genes are independently distributed, and condition (a) will often not hold as there are likely to be replicates of tissues or multiple measurements over time on a tissue. These could be handled by appropriately specifying the component-covariance matrices, but the models created this way may be hard to fit. For example, the M-step may not exist in closed form leading to computational difficulties. The relaxation of assumptions (a) and (b) above can be overcome by using mixtures of linear mixed models, as proposed by Ng et al. (2006). They have developed the program EMMIX-WIRE for the fitting of these models. To describe their approach, suppose that in a gene microarray experiment, we have for T T T the jth gene a feature vector (the gene profile) y j = (y1Tj ,..., ymj ) , where ytj = y1tj ,..., yrttj (t = 1,...m ), and where rt is the number of replicates of the tth distinct tissue. Conditional on its membership of the ith component of the mixture, we assume that the distribution of yj can be modelled by a linear mixedeffects model:

(

yj = X

i

+ Ubij + Vci + ij

)

(5)

In (5), the elements of βi are fixed effects, and bij (a qb -dimensional vector) and cj (a qc -dimensional vector) are the unobservable gene- and tissue-specific random effects, respectively. These random effects T represent the variation due to the heterogeneity of genes and samples, (corresponding to bi = biT1 ,...,Tin and ci, respectively. The random effects bj and ci and the measurement error vector εij are assumed to be mutually independent, and X, U, and V are the design matrices for the fixed and random effects. The distributions of bi and ci are assumed to be multivariate normal, N qb (0, H i ) and N qc 0, ci I qc , respectively, where Hi is a qb x qb covariance matrix and I qc is the qc x qc identity matrix. The measureNM(0,Ai ), where Ai is a diagonal matrix ment error vector εij is also taken to be multivariate normal T constructed from the vector Wξi, where i = i21 ,..., iq2 e and W is a M x qe zero-one design matrix. That is, we allow the ith component-variance to be different among the M microarray experiments. The vector of unknown parameters Ψ can be obtained by the maximum likelihood approach via the EM algorithm, proceeding conditionally on the tissue specific random effects ci as formulated in Ng et al. (2006). The gene-profile vectors yi are not independently distributed due to the presence of the cluster random effects terms ci in the likelihood function. Hence there is difficulty in calculating the latter. It is not needed in the application of the EM-algorithm, but is needed in an assessment of the number of components. In our application of BIC for the number of components, we

(

(

)

(

)

)

215

Clustering Methods for Gene-Expression Data

E xamp les As an illustration of the use of the EMMIX-GENE procedure, we applied it to the colon cancer data set of Alon et al. (1999). This consists of n = 2000 genes and p=62 tissue samples. The samples came from 40 tumours and 22 normal tissues. After select-genes was applied to this set, there were 446 genes remaining in the set. These genes were then clustered into 20 groups. These groups were ranked on the basis of -2 log λ, where λ is the likelihood ratio statistic for testing g = 1 versus g = 2 components in the mixture model. If the tumours are clustered on the basis of the second ranked group G2 we have a partition of the tissues in which one cluster contains 37 tumours and 3 normal samples and the other cluster contains 3 tumours and 19 normal samples. This gives an error rate of 6 out of 62 tissues. We have displayed this as heat map where the colour of a square indicates the expression level for a particular gene in a specified tissue. To illustrate the EMMIX-WIRE procedure, we use an example from Ng et al. (2006) who used it to cluster time-course data from the yeast cell-cycle study of Spellman et al. (1998). The data consist of the expression levels of 612 genes at M =18 time points. The design matrix, X used was an 18 x 2 matrix with the (l + 1)th row (l = 0, …, 17)

Figure 1. Heat map of gene expressions from data in Alon et al. (1999)

216

Clustering Methods for Gene-Expression Data

(cos 2π (7l/(ω+Φ) sin 2π (7l/(ω+Φ)) where the period of the cell cycle ω was taken to be 53 and the phase offset Ф was set to zero. The design matrices for the random effects parts were specified as U = 118 and V = I18. That is, it was assumed there were random gene effects bij with qb = 1 and cluster random effects, ci1 ,..., ciqc with qc = m = 18. The cluster random effects reflect possible dependence among expression levels within the same cluster at the same time. In the specification of the error matrix, we took W = 118 and φi = σ2i (qe = 1), so that the component variances are common among the m = 19 experiments. The number of components g was determined by using BIC for model selection. It indicated that there were twelve clusters. For each cluster we have plotted the expression level against time for its constituent genes.

Fu t ure T rends With the ever increasing emergence of high-throughput data in biology, there will be increasing use of cluster analysis to reduce the dimensionality of such data to aid in the biological inferences to be drawn. Clustering methods will also be used to study specific problems in genomics, such as the analysis of time-course experiments.

Figure 2. Gene-expression level against time for 12 clusters of genes

217

Clustering Methods for Gene-Expression Data

Characterizing the dynamic regulation of gene expression by time is becoming more and more important. Standard methods of cluster analysis are not really applicable to such data as they would give the same clusterings regardless of the order in which the expressions have been observed. Also, they assume the data (the gene profiles) to be clustered are independently distributed. Hence increasing attention is being given to model-based methods, such as mixtures of linear mixed models, that allow the expression levels in the same gene profile to be correlated. They also allow for nonzero correlations between gene profiles in the same cluster (Ng et al., 2006). Model-based methods such as mixtures of normal distributions have already been widely adopted in the clustering of the tissue samples on the basis of the genes. Given that the latter can be present in very large numbers, attention has been given to variable (gene) selection methods in order for the normal components in the mixture model to be fitted without restrictions such as those that take the component covariances to be diagonal (McLachlan et al., 2002).

Co nc lusi on As more high throughput data sets become available, cluster analysis will become more important as part of their analysis. The most commonly used clustering methods have been hierarchical algorithms, but these have problems when they are used to cluster gene-array data. There is no reason to expect clusters of genes or tissues to form a hierarchy and the overlapping nature of likely groupings can lead to poor performance from hierarchical clustering algorithms. Also, these methods provide no criterion for determining the number of clusters. Nonhierarchical heuristic methods do not force a hierarchy on the clustering and can correct a misclassification made at an early stage in the algorithm. However, they often impose other restrictions on the clusters found, such as a tendency towards sphericity. Again they do not provide criteria to decide how many clusters the observations should be partitioned amongst. Mixture model based clustering allows tests of the number of clusters and can reflect differences in dispersion and orientation between clusters. Used in conjunction with some form of variable selection, mixtures of factor analysers provide a good method for clustering tissues, used with some form of variable selection. When clustering genes, correlations between genes and samples should be taken into account. This can be done by fitting mixtures of as linear mixed models. The authors wish to thank Dr. Ian Wood for his comments on this chapter.

R eferences Aitkin, M., Anderson, D., & Hinde, J. (1981). Statistical modelling of data on teaching styles (with discussion). Journal of the Royal Statistical Society A, 144, 419-461. Alon, U., Barkai, N., Notterman, D.A., Gish, K., Ybarra, S., Mack, D., and Levine, A. J. (1999). Broad pat­terns of gene expression revealed by clustering analysis of tumor and normal colon tissues probed by oligonucleotide arrays, Proceedings of the National Academy of Sciences USA, 96, 6745-6750.

218

Clustering Methods for Gene-Expression Data

Belitskaya-Levy, I. (2006). A generalized clustering problem, with application to DNA microarrays. Statistical Applications in Genetics and Molecular Biology, 5, Article 2. Coleman, D., Dong, X.P., Hardin, J., Rocke, D.M., Woodruff, D.L. (1999). Some computational issues in cluster analysis with no a priori metric. Computational Statistics and Data Analysis, 31, 1-11. Eisen, M.B., Spellman, P.T., Brown, P.O., & Botstein, D. (1998). Cluster analysis and display of genomewide expression patterns. Proceedings of the National Academy of Sciences USA, 95, 14863-14868. Everitt, B.S. (1993). Cluster analysis, 3rd edition. London: Edward Arnold. Friedman, H.P., & Rubin, J. (1967). On some invariant criteria for grouping data. Journal of the American Statistical Association, 62, 1159-1178. Friedman, J.H., & Meulman, T.J. (2004). Clustering objects on subsets of at­tributes (with discussion). Journal of the Royal Statistical Society B, 66, 815-849. Getz, G., Levine, E., & Domany, E. (2000). Coupled two-way clustering anal­ysis of gene microarray data. Cell Biology, 97, 12079-12084. Gibbons, F.D., & Roth, F.P. (2002). Judging the quality of gene expression-based clustering methods using gene annotation. Genome Research, 12, 1574-1581. Hartigan, J.A. (1975). Clustering algorithms. New York: Wiley. Hastie, T., Tibshirani, R., Eisen, M. B., Alizadeh, A., Levy, R., Staudt, L., Chan, W.C., & Botstein, D. (2000). Gene shaving as a method for identifying distinct sets of genes with similar expression patterns. Genome Biology, 1, research 003.1-003.21. Hastie, T., Tibshirani, R., & Friedman, J. (2001). The elements of statistical learning. New York: Springer-Verlag. Kaufman, L., & Rousseeuw, P. (1990). Finding groups in data: An introduction to cluster analysis. New York: Wiley. McLachlan, G.J. (1987). On bootstrapping the likelihood ratio test statistic for the number of components in a normal mixture. Applied Statistics, 36, 318-324. McLachlan, G.J., & Basford, K.E. (1988). Mixture models: Inference and ap­plications to clustering. New York: Marcel Dekker. McLachlan, G.J., Bean, R.W., & Peel, D. (2002). A mixture model-based approach to the clustering of microarray expression data. Bioinformatics, 18, 413-422. McLachlan, G. J., & Peel, D. (2000). Finite mixture models. New York: Wiley. Ng, S.K., McLachlan G.J., Wang, K., Ben-Tovim Jones, L., & Ng, S-W. (2006). A mixture model with random-effects components for clustering correlated gene-expression profiles. Bioinformatics, 22, 1745-1752. Pollard, K.S., & van der Laan, M.J. (2002). Statistical inference for simultane­ous clustering of gene expression data. Mathematical Biosciences, 176, 99-121.

219

Clustering Methods for Gene-Expression Data

Spellman, P., Sherlock, G., Zhang, M.Q., Iyer, V.I., Anders, K., Eisen, M.B., Brown, P.O., Botstein, D., & Futcher, B. (1998) Comprehensive identifi­cation of cell cycle-regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization. Molecular Biology of the Cell, 9, 3273-3297.

K ey terms EM Algorithm: A method for calculating maximum likelihood estimates of parameters in statistical models in situations where the observed data can be usefully viewed as being incomplete. It proceeds by consideration of the complete data log likelihood, which is formed on the basis of the complete data. The latter comprises the observed data and the ‘missing data’. It is implemented iteratively by alternating two steps known as the expectation (E) step and the maximization (M) step. On the E-step the Q-function is calculated by averaging the complete data log likelihood over the conditional distribution of the complete data given the observed data, using the current value for the parameter vector. This is followed by the M-step in which the current estimate of the parameter vector is updated to that value which globally maximizes the Q-function. Euclidean Distance: A measure of distance between two points. It is the square root of the sum of the squares of the differences between the coordinates of the two points. Factor Analysis: Factor analysis is a statistical technique in which the correlation between the variables is approximated by the linear dependence of the latter on a set of unobservable (latent) variables. Heuristic: An empirical method of solving a problem which does not necessarily reflect the underlying nature of the problem. Likelihood: The likelihood function is found by evaluating the joint density of the random variables in the model defining the random phenomenon under study at their observed values. Maximum Likelihood: The maximum likelihood estimate of a parameter is obtained by consideration of the likelihood (equivalently the log likelihood) function. Typically in the case of a bounded likelihood function it is given by the values of the parameters which globally maximize the likelihood function. Microarray: A slide which contains a grid consisting of a large number of microscopic spots of different DNAs, each of which will hybridize with a particular target RNA or DNA sequence. The target RNA or DNA is generally attached to a fluorescent marker. When the target RNA or DNA binds to the complementary DNA on the slide this binds the fluorescent marker to the slide. The measurements taken are of the intensity of the fluorescence from these markers. Multivariate: A multivariate problem one has more than one response variables. Principal Components: The principal components of data set are the projections of the data vectors onto new coordinate axes that result from a rotation of the centered data set. This rotation is done in such a way that the first principal component (the projection onto the first coordinate axis) has the largest possible variance, the second principal component has the next largest, and so on.

220

221

Chapter XII

Uncovering Fine Structure in Gene Expression Profile by Maximum Entropy Modeling of cDNA Microarray Images and Kernel Density Methods George Sakellaropoulos University of Patras, Greece Antonis Daskalakis University of Patras, Greece George Nikiforidis University of Patras, Greece Christos Argyropoulos University of Pittsburgh Medical Center, USA

abstract The presentation and interpretation of microarray-based genome-wide gene expression profiles as complex biological entities are considered to be problematic due to their featureless, dense nature. Furthermore microarray images are characterized by significant background noise, but the effects of the latter on the holistic interpretation of gene expression profiles remains under-explored. We hypothesize that a framework combining (a) Bayesian methodology for background adjustment in microarray images with (b) model-free modeling tools, may serve the dual purpose of data and model reduction, exposing hitherto hidden features of gene expression profiles. Within the proposed framework, microarray image restoration and noise adjustment is facilitated by a class of prior Maximum Entropy distributions. The resulting gene expression profiles are non-parametrically modeled by kernel density methods, which not only normalize the data, but facilitate the generation of reduced mathematical descriptions of biological variability as mixture models. Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Uncovering Fine Structure in Gene Expression Profile

INTR OD UCTI ON The advent of complementary DNA (cDNA) microarray technologies enabled the simultaneous and specific assessment of the expression levels of thousands of genes (Southern, Mir, & Shchepinov, 1999). The conventional approach to analyze such datasets is to explore quantitative co-expression relations across a variety of experimental conditions prior to invoking putative similarities in gene regulation or function (DeRisi, Iyer, & Brown, 1997; Eisen, Spellman, Brown, & Botstein, 1998). The alternative viewpoint considers gene expression profiles from specific conditions to be informative of distinct molecular signatures that characterize cellular states. Such genome wide, transcriptional signatures have been used to distinguish normal from abnormal samples in benign developmental conditions (Barnes et al., 2005), solid tumors and hematologic malignancies (Febbo et al., 2005; Valentini, 2002) and differentiate distinct disease states of renal allografts (Sarwal et al., 2003). It has been suggested that the thousands of expression values in a microarray experiment are too dense and irregular to be directly interpreted in a holistic manner and that alternative transformations of the normalized gene profiles should be sought after (Guo, Eichler, Feng, Ingber, & Huang, 2006). Nevertheless one could justifiably argue that the irregularity of the gene profiles is due to incomplete modeling and adjustment for the presence of measurement noise. However this alternative hypothesis has not been adequately addressed in the current literature. These considerations underline the impetus for the present work, which aims to: 1. 2.

Establish the role of microarray image background in the irregularity and “featureless” appearance of gene expression profiles (GEP) from individual experimental states. Propose a data and model reduction framework for the analysis of GEP consisting of: a. A probabilistic Bayesian algorithm for background adjustment of microarray images based on Maximum Entropy distributions. b. Non-parametric kernel density estimation methods for the mathematical representation and exploration of the resultant gene expression profiles.

BACKGR

OUND

The basic microarray procedure involves hybridization of complementary nucleic acid molecules, one of which (target) has been immobilized in a solid substrate (e.g. glass) using a robotically controlled device (arrayer). Such targets form spots at the vertices of a rectangular lattice on the solid substrate surface; each spot then serves as a highly specific and sensitive detector of the corresponding gene. Technical factors operating at different stages of the microarray pipeline impart the final microarray image with uneven and non-negligible background. Background correction has been considered a necessary step in the microarray pipeline (L. Qin, Rueda, Ali, & Ngom, 2005), which may in fact have a significantly higher bearing on the final results than normalization. This viewpoint is supported by a number of empirical studies showing that conventional approaches to background correction may lead to nonsensical results (e.g. negative gene expression measures) and hinder the ability to detect differential gene expression (L. X. Qin & Kerr, 2004). In spite of the nodal role of background adjustment methods upon the quantification of single gene expression, the effects of de-noising upon the totality of the gene profile remains unexplored. A notable exception is the study by (Kooperberg, Fazzio, Delrow, & Tsukiyama, 2002); the authors argued that incomplete background adjustment is expected to predominantly affect

222

Uncovering Fine Structure in Gene Expression Profile

the quantification of weakly expressed genes, leading to a reduction in the dynamic range of the GEP. This in turn will result in a “compression” of the left tail of the GEP, which could very well account for its featureless nature of the latter in that signal range. Consequently, proper noise reduction and dynamic range expansion could uncover hidden structure in GEPs and aid the discovery of hitherto unknown elements of transcriptional regulation. In order to facilitate such a discovery process though, it is imperative to supplement the noise reduction algorithms with mathematical model reduction methodologies so as to generate a discrete number of experimentally testable hypotheses about the biological system under investigation. Before addressing this mathematical modeling problem though it is important to properly define the meaning of the phrase “Gene Expression Profile”. The definition we adopt herein is an operational one i.e. we identify the GEP as the output of any step in the microarray pipeline (Figure 1) after the image operations stage. Consequently the GEP is a set of possibly noisy measurements, one for each target printed on the surface of the microarray. Inference about the members of the set, which constitutes the gene expression profile, proceeds in different stages that involve the normalization of the measurements prior to exploratory and formal statistical/machine learning methods. One challenging aspect of the process is how to best represent the GEPs emanating from replicate experiments in a manner that captures the global features of the system under study but also preserve the specific expression pattern within each sample. The issue is further complicated by the fact that a large number of experimental noise sources remain poorly defined or are very difficult to model explicitly.

Figure 1. Microarray pipeline starting from individual cell population to machine learning and inference C e ll S a m p le

C C D c a me ra s C o n fo c a l sca n n e rs P h o s p h o Im a g e r

m R N A I s o la tio n

P32

L a b e lin g

F lu o r e s c e n t D y e s

H y b r id iz a tio n

C h r o m o g e n ic D yes

Im a g e a c q u is itio n

Im a g e o p e r a tio n s ( d e - n o is in g , g r id d in g , s p o t s e g m e n ta tio n ) N o r m a lis a tio n o f m e a s u r e m e n ts

E x p lo r a to r y D a ta A n a ly s is

M a c h in e L e a r n in g

S ta tis tic a l M o d e ls

C lu s te r in g

223

Uncovering Fine Structure in Gene Expression Profile

Conventional approaches usually address the effects of residual noise by compressing the GEP from individual samples into a single numerical summary (Guo, Eichler, Feng, Ingber, & Huang, 2006), often after a normalization procedure such as “lowess” has reduced the variability of the dataset in a more or less ad hoc fashion (L. X. Qin & Kerr, 2004). It is important to note that both approaches amount to a considerable degree of data falsification since they operate by discarding “possibly relevant information immanent in the complex, higher-order genome-wide expression pattern”(Guo, Eichler, Feng, Ingber, & Huang, 2006). On the other hand, verbatim use of the GEP is likely to lead to erroneous inferences as sources of noise other than the background of microarray images are not taken into account. Even if it were possible to measure the GEP by a “perfect” noiseless experiment, intrinsic biological variability would carry over to the final results and manifest as “jitter” in a, possibly multidimensional, representation of the latter. It follows that unless one can faithfully control or model all sources of variability (experimental and biological), the best that one can hope for is a probabilistic representation that is based on the gene expression measures obtained in each experiment. However unless one specifies the space that such probabilistic descriptions occupy and the objects that they concern, one has an undefined problem with multiple possible and even conflicting solutions. We postulate that a data driven, bottom-up methodology abstracting the most general features of microarray technology and genome wide transcript abundance quantification is the optimal approach to microarray data and model reduction. The main focus of the present work is the presentation of a bottomup bi-partite quantitative inference approach to address the issues identified in the previous paragraphs. The two pillars of the proposed methodology are a) a probabilistic methodology that utilizes Bayesian methods with the Maximum Entropy prior (Jaynes, 2003), and b) function approximation methods in general and non-parametric kernel density estimation algorithms in particular (Silverman, 1986). The two elements of this framework are used to handle microarray image noise (de-noising) and model residual variability in the global expression profiles respectively. The operational characteristics of this approach are illustrated by applying it on publicly available microarray set (DeRisi, Iyer, & Brown, 1997). We demonstrate that when used in combination, these two different methodologies may facilitate the detection of weak, albeit reproducible, signals, decrease the variability of measures of gene expression and facilitate the detection of global features in the corresponding profiles.

AN OVER VIEW OF BAYESIAN AND MAXIM UM ENTR OPY METH ODS From an epistemological viewpoint, noise reduction in microarray experiments is a problem of quantitative inductive inference that involves the update from a prior probability distribution to posterior probability distribution when new information becomes available. This approach is contingent upon the interpretation of the relevant probabilities in a Bayesian context i.e. as real valued measures of the degree of belief in the truth of a proposition. Two methods to effect the updating of probabilities in a consistent manner have been mathematically established: Bayes’ theorem (Cox, 1946) and Edwin T. Jaynes method of Maximum Entropy (Jaynes, 2003). The choice between the two methods is dictated by the nature of the information at hand (Caticha & Preuss, 2004). When the available information is given by conditional probability distribution between observable quantities and unobserved parameters we should use the Bayes theorem. If however the information at hand concerns expectations about aspects of the general case, the method of Maximum Entropy (MaxEnt) is applicable. The two methods complement each other as evident from the general process of quantitative (Bayesian) inductive inference. In

224

Uncovering Fine Structure in Gene Expression Profile

order to carry out the latter and reach plausible conclusions in the presence of uncertainty, one ought to proceed in three discrete steps: 1. 2. 3.

Clearly state what the models are, along with all the background information and data. Assign prior (pre-data) probabilities to the different models-hypotheses investigated. Use probability calculus in order to arrive to numerical values for the posterior probability of the hypotheses in light of the available data (inference process).

The tool for updating one’s beliefs about the plausibility of a hypothesis (H) given available evidence (E) and background information (i.e. context I) is given by Bayes theorem:

P( H | E , I ) =

P( H | I ) P( E | H , I ) P( E | I )

(1)

The left-hand term, P(H|E,I) is called the posterior probability, and it gives the probability of the hypothesis H after considering the effect of evidence E in context I. The term P(H|E,I) is just the prior probability of H given I alone; that is, the belief in H before the evidence E is considered. The term P(E|H,I) is called the likelihood, and it gives the probability of the evidence assuming the hypothesis H and background information I are true. The denominator is independent of H, and can be regarded as a normalizing or scaling constant. The information I is a conjunction of all of the other statements (background knowledge) relevant to determining P(H|I) and P(H|I). Within such a framework, Jaynes maximum entropy method corresponds to a formal deterministic, variational algorithm that transforms pre-data constraints into prior probability assignments. The resulting distributions are least informative or “objective” ones in the sense that they are most compatible with the “pre-data” constraints, while being maximally noncommittal about the missing information. The maximum entropy algorithm, proceeds by maximization of the entropy H[p] functional of the prior distribution subject to q pre-data constraints about the numerical values of expectations of functions f k (〈 f k 〉) that depend on the hypothesis H; each such constraint contributes a parameter λk into the final solution thus fixing the functional form of the prior distribution. If the hypothesis H concerns the numerical value of a random variable x taking discrete values {x1,x2,...,xn}, the MaxEnt algorithm generates the following Maximum Entropy prior distribution:  max  H [ p ] = −  fk = −

∑

∂ log Z , ∂ k

i

q   1 pi log( pi )  ⇒  pi = exp(− Z j =1  

∑

fk ≡

n

j

f j ( xi )), Z =

n

 q exp  −  i =1  j =1 n

∑

∑

j

  f j ( xi )     

∑ f ( x) p( x ) = ∑ f ( x ) p i =1

k

i

i =1

k

i

i

(2) (3)

Entropy maximization is a convex optimization problem, and thus the distribution given in Equation 2, is unique. Conceptually the algorithm identifies the distribution that has the maximum uncertainty subject to the constraints in a manner that avoids bias in the process. This can be traced to a mathematical property of MaxEnt distributions i.e. that they assign positive weight to every situation that is not excluded by the given information. Hence by utilizing such distributions to encode the pre-data constraints we are guaranteed not to miss any potential solutions that are compatible with the former.

225

Uncovering Fine Structure in Gene Expression Profile

A PR OBABI LISTIC DE -N OISING A LG ORITHM

F OR MICR OARRAY IMAGES

As a stepping stone for the proposed algorithm, we invoke a very simple additive noise model. This model notes that in any given finite area of the microarray surface there a) may exist both specific and non-specific hybridization sources of fluorescence, and b) fluorescent signals combine additively, and c) there are no quenchers in the hybridization (i.e. the noise is positive). Hence, the “true” signal intensity of a pixel in a microarray image (S), is related to the background noise (B) and the observed pixel value (D) through the relation: D = S + B, {S,B ≥ 0} The Maximum Entropy algorithm takes into account pre-data constraints about the raw microarray images in a formal manner in order to derive the distribution of the background generation process (B) and the signal (S). Subsequently these distributions are utilized in Bayes theorem to derive the posterior distribution for S; this process is repeated for all pixels in the microarray image, leading to a restored version which is then subjected to further processing (spot identification, normalization etc). From an operational standpoint, the proposed algorithm takes into account what is known about the microarray pipeline (“general case”), as well as the data observed in a given experiment (“particular case”) to render a denoised version of the microarray image. The constraints that are built into the algorithm stem from the discrete nature of the microarray measurement scale as well as the different scales of specific vs non-specific and cross hybridization phenomena on microarrays. Qualitatively these constraints correspond to the following discrete predata pieces of information: 1.

2. 3.

Each microarray image can be segmented into two general classes of pixels i.e. Signal (S) and background (B) generated by independent separate, distinct processes. This is nothing more than a consequence of the fact that the arrayed spots occupy only a fraction of the microarray surface; the corresponding pixels are classified as signal and all other ones are designated as background. For the case of the S class the process is one of specific hybridization between labeled mRNA species and spotted target molecules; for the background pixels, non-specific hybridization, noncDNA fluorescent molecules, lateral diffusion of labeled particles, dust etc are responsible. The expected intensity value of the background process is small compared to the dynamic range of the microarray image. The intensity values for both signal and background are expressed in a discrete, bounded, positive, arbitrary scale with M+1 elements e.g. M=65535 for a 16-bit image.

In spite of their crudeness these pre-experimental facts are surprisingly powerful enough to generate useful analytic forms for the prior probability density and likelihood functions of a microarray experiment. For example due to the independence property, one can factorize the probability of observing a particular image (Im) as product density, that is: P(Im) = P(S,B) = P(S)P(B)

226

(4)

Uncovering Fine Structure in Gene Expression Profile

In the absence of any specific information regarding S, the maximum entropy assignment for S considers all possible values equally likely leading to the uniform prior, that is: P(S) = 1/(M + 1)

(5)

The analytic form of the maximum entropy background distribution PME (Bm) can be established on the basis of the general MaxEnt algorithm by setting q = 1, f1(x) = x, F1 = m in the system of equations 2-3. Stated in other terms the conditional distribution of the background is simply the discrete (maximum entropy) density obeying the two constraints of a given expectation and proper normalization (to unity). The resulting distribution is a function of a single Lagrangian λ given by: m=−

M d 1 M +1 + =m⇒ (log( e − b )) ⇒ − − − d e 1 1 e M ( +1) b =0

∑

≅ log (1 + 1/ m )



(6)

The approximate relation between m, λ in the latter equation is a consequence of the second constraint discussed previously. As long as m ≤ M/5, the error between the approximate value log(1+1/m) and the “exact” value for λ obtained by numerically solving Equation 6 is less than 4%. Furthermore, by the change of variables 1+1/m → θ(m), PME (Bm) is identified as a member of the family of modified power series distributions (MPSD) (Johnson, Kotz, & Kemp, 1992):

PME ( B | m) = MPSD( B | M , (m)) =

B

M

∑ x =0

x



(7)

With the prior distributions for signal and background now established (equations 5-7), straightforward application of the Bayes theorem leads to the posterior distribution for S: P ( S | D, m) =

P ( D | S , m) P ( S | m) MPSD( D − S | M , (m)) = = * ( m) S ( | , ) ( | ) ( − | , ( )) P D S m P S m MPSD D S M m ∑ ∑ S

S

D

∑ s =0

*

( m) s ,

*

( m) =

1 ( m)

(8)

Derivation of Equation (8) makes explicit use of the positivity constraint on the values of D, S and the independence of S from B and thus m. Comparison of equations 7 and 8, shows that the posterior distribution for S is also a modified power series one, albeit with a different parameter θ* and support D. In order to restore a microarray image using this distribution, one has to select a numerical summary from the latter. The posterior conditional expectation, is such a summary which can be recovered in a closed and particularly simple form: D

E[ S | D, m] = ∑ S ⋅ P( S | D, m) = D − m + S =0

D +1 (m) D +1 − 1

(9)

One desirable feature of MPSD based models is that they are amenable to numerically tractable, and even analytic procedures for estimation and learning. Specifically in order to estimate m from a sample of “noisy” pixels B = {B1,B2,...,Bn} one has to solve the likelihood equation: (mˆ ) = B

(10)

227

Uncovering Fine Structure in Gene Expression Profile

The aforementioned equation is a functional relationship among the support of the MPSD (M), its first moment (μ), the value of the maximum likelihood estimator (mˆ ) and the sample mean (B ).The value of mˆ is in general close to B , which could thus be used (as we do here) as a convenient first order approximation. For example, the relative error in approximating B with mˆ is less than 3.5% when B ~20-25% of M and drops to 0.0002% for B = M/10. Obtaining such a sample from the microarray image, is facilitated by the deployment of standard clustering algorithms (e.g. Expectation Maximization) that classify image pixels into two classes on the basis of their intensity values. The class with the lower average intensity then corresponds to the background, and its mean sample value is used to estimate the unobserved background intensity m. Having classified each pixel into signal and background classes, one then uses Equation 9 to restore the value of the former, while setting the value of the latter to zero. The end result is a de-noised microarray image which enters the microarray pipeline without any further background adjustment in order to generate a gene expression profile (Figure 1). It is precisely at this point that further open issues of representation and processing arise that we now seek to formally address.

THE RATI ONA LE OF GENE EXPRESSI ON PR OFI LE REPRESENTATI ON BY F UNCTI ON APPR OXIMATI ON METH ODS Gene activity modeling in systems biology ultimately depends on a quantitative description of the amount of transcripts in particular cellular states (Gibson & Jehoshua, 2001). Since cellular identity, judged by both form and function, is determined by biophysical processes that involve bio-molecules interacting in specific stoichiometries, it follows that control of the latter within certain limits is paramount if cellular phenotype is to be preserved. Biological and experimental variability may result in failure to detect the expression of individual genes, but global features such as the relative ordering of gene expression measures should be preserved for the majority of the assayed genes. Without detailed physicochemical modeling one is forced to treat the measurement scale of microarray experiments as a relative one; normalization and representation of replicated profiles of individual states should be limited to a sliding scale approach that seeks to align replicated profiles against each other. To do otherwise would be equivalent to introducing particularly strong hypotheses about the behaviour of the system under examination which may neither be supported by biology nor warranted in light of the available data. In mathematical terms the task is to find a description for the multivariate global expression profile G of an experiment that has quantified the abundance of n genes i.e. G={g1,g2,…,gn} of a particular cellular state. Each individual gene expression measure g j is restricted to lie in the interval [0, M] that is fixed by the microarray apparatus used in the experiment. Since the gene expression measures reported by the image segmentation software are usually moment statistics of a large number of pixels, the discrete nature of the microarray measurement scale is blunted at this stage. Consequently one could treat each g j or better yet log(g j) as real-valued entities; such treatment is facilitated by the positivity constraints enforced by the Bayesian/MaxEnt background adjustment algorithm which ensures that there are no genes with negative expression value. The finite bounded measurement scale of microarray experiments then implies that replicate profiling experiments of the same cellular state C={G1,G2 ,…,Gk} cannot be naively characterized by their coordinates in a n-dimensional space spanned by the log expression measures of individual genes. Firstly, note that as a result of gene silencing, random target failures and/or insufficient signal amplification,

228

Uncovering Fine Structure in Gene Expression Profile

there will be a finite number of genes whose expression is below the detection limit of the experimental apparatus. Such genes will have g j values equal to zero and thus are censored from subsequent analyses carried out in log-spaces. We remark that a similar effect will also be observed if one uses microarrays with different target complements arrayed on their surface. Even if one profiles the same cellular state, the fact that certain targets are missing from one or more array platforms means that the corresponding genes will have a gene expression measure of zero. Secondly, one cannot a-priori rule out the possibility that the expression of certain genes will saturate the dynamic range of the apparatus. By a simple re-ordering of the discrete increments in the digital intensity scale of microarray images, the expression values of the latter genes can be set to zero in this new scale. Therefore symmetry considerations imply that such “saturated” genes should also be disregarded from further analytic and inferential steps. As a result of all these factors, the set of vectors {G1,G2 ,…,Gk} that correspond to replicated experiments of the same cellular state will be of different dimensionality, and thus are not directly comparable. Even though it is relative easy to handle the issue of unequal dimensionalities i.e. by introducing special symbols for the log-expression of zero and M, this solution is not without its own unique problems since the resultant space will be a disconnected one, in need of considerably complicated analytic machinery for further processing. A way out of the conundrum of the previous paragraph is to completely forego multi-dimensional descriptions, and treat each non-zero/non-saturated observation interchangeably. Rather than interpreting each experiment as a point in a multi-dimensional space, one interprets the non-censored observations g1,i , g 2,i ,..., g ni ,i in the ith gene expression profile as repeated measures of a univariate variable Gi. We should point out that this interpretation is strictly epistemological, expressing the modeler’s perception rather than ontological in nature. The latter would imply or -even worse- assert the physical existence of a global transcriptional control mechanism that assigns genes to particular expression levels, which constitutes a particularly strong and possibly unfounded statement about the biology of gene regulation. By limiting ourselves to an epistemological interpretation of the gene expression profile though we are free to handle Gi in any fashion that we deem admissible. For example, one could view Gi as a function to be approximated by almost any statistical learning algorithms, e.g., neural networks, support vector machines, parametric mixture models, Self-Organizing Maps, non-parametric kernel density estimators. To illustrate the potential of function approximation techniques for such a purpose, we opted to use the latter “model-free” technique as an instrument for data and model reduction of gene expression profiles.

{

}

DATA AND MODE L RED UCTI ON OF GENE EXPRESSI ON PR OFI LES BY N ON -PARAMETRIC KERNE L DENSITY ESTIMATI ON METH ODS Non-parametric kernel density estimation methods (also known as Parzen windows) are model-free techniques for the estimation of an empiric distribution from experimental data. Formally such estimators smooth out the contribution of each observed data point over a local neighborhood. In order to apply this estimator to gene expression profile analysis, we assume that the data are of the form discussed in the previous section i.e. g1,i , g 2,i ,..., g ni ,i : g j ,i ~ Gi. Stated in other terms, each gene expression profile is modeled as an independent, identically distributed finite random sample from a random variable Gi. The kernel density approximation ( fˆci ( g )) to the unknown distribution of the latter variable ( f (g)) at each point g is given by the following equation:

{

}

229

Uncovering Fine Structure in Gene Expression Profile

fˆci ( g ) = fˆci (Gi = g ) ≡

1 ni ⋅ ci

ni

 g − g j ,i  ci

∑K j =1

  

(11)

In the latter expression, the function K is known as the kernel and is specified by the analyst while the tunable parameter c is the bandwidth of the estimator and is learned from the actual data. The kernel is usually taken to be a Gaussian function with zero mean and finite variance, although in principle any smooth unimodal function may be utilized. In order for the estimator to be a proper density, an added constraint is imposed on K, i.e. its integral over the space of possible values for Gi should be equal to c. The magnitude of the bandwidth and the shape of the kernel control the contribution of each experimental data point g j,i to the final estimate at point g. Conceptually small values of c make the estimate “rough” and demonstrate spurious features, while large values of c lead to over-smoothed, featureless representations. There exist many criteria for the selection of the optimal size of the bandwidth parameter from data; the criterion most commonly employed is that of minimization of the Asymptotic Mean Square Integrated Error (AMISE) i.e. the second order Taylor series approximation to the Mean Square Integrated Error (MISE): MISE (c) = ∫ E  fˆc ( g ) − f ( g )  dg   G

(12)

A cross-validation strategy is commonly adopted to estimate the value of c that minimizes AMISE but is computationally expensive for datasets with thousands of data points as is typical of microarray based gene profiles. Approximate plug-in or heuristic estimators come then into play, offering a very favorable trade-off between ease and accuracy of computation. For example the normal reference rule (Wasserman, 2006) is an approximate estimate of the optimal bandwidth of the Gaussian Kernel: cGauss = 1.06 ˆ ni −1/ 5 ,

ˆ = min {s, Q75− 25 1.34}

(13)

where s is the sample standard deviation and Q75-25 is the sample interquartile range, i.e., the difference between the first and third quartiles of the sample data. Since the Gaussian kernel is not optimal when derivatives of the density estimator are sought after (Hardle, Marron, & Wand, 1990), the tri-weight kernel and bandwidth estimator were used instead: KTW ( x) = 35(1 − x 2 )3 / 32, x < 1, cTW = 2.978cGauss

(14)

In any case, the kernel estimator of Equation 11 may then be used as a tool for normalization (data reduction), visual exploration and generation of discrete, possibly parametric hypotheses to further reduce the complexity of representation (meta-modeling, model reduction). These roles are facilitated by the closed form of the estimator which is amenable to hybrid symbolic – numerical operations. The least restrictive way to normalize individual replicate gene expression profiles amounts to an alignment operation as discussed in the previous section. During that operation it is assumed that the individual profiles are translated among each other as a result of residual experimental variation, and that estimation of a single constant suffices to bring them in line. In microarray research it is customary to affect such a translation by setting the mean or the median of the sample of intensity values equal to zero but this is not robust with respect to outliers or departures from symmetry. Hence we propose using the mode

230

Uncovering Fine Structure in Gene Expression Profile

of the gene profile derived distribution for such a purpose, whose value is obtained by maximization of the estimator of Equation 11 by repeated evaluation of derivatives of the latter equation by numeric optimization libraries.

UNC OVERING ST UDY

STR UCT URA L FEAT URES IN GENE PR OFI LES : A CASE

As a case study of the proposed methodology we reanalyzed the DeRisi et al dataset concerning the diauxic shift of Saccharomyces cerevisiae (DeRisi, Iyer, & Brown, 1997). The particular dataset was selected for the degree of replication (seven replicates) of its “common reference channel” i.e. a messenger RNA pool prepared from a single cell state. This degree of replication allowed us to explore the effects of the noise correction and profile representation algorithms in adjusting for the technical variability of the data and identifying fine structural features respectively. The impact of the maximum entropy based background correction image upon the seven replicate gene expression profiles is shown in Figure 2 for three alternate background correction methods: a) no correction (NONE), b) the conventional method of subtracting the mean background from the mean intensity for each spot in the image (SBC) and c) the conditional expectation method (COND, Equation 9) In order to generate the data of Figure 2, the seven images were restored with the COND method before or after (SBC, NONE) segmentation with the software SPOT. After segmentation, the three gene profiles were subjected to global mean normalization and the non-parametric density estimators were Figure 2. Effect of different background correction methods upon non parametric density estimates of the gene expression profile. Solid lines: replicate experiments, dashed line: standard normal distribution. PDF: probability density function

231

Uncovering Fine Structure in Gene Expression Profile

generated using Equation 14. For the purpose of comparison, we also graph the probability density function of the standard normal distribution. As compared to the SBC and NONE methods, the maximum entropy corrected images generated more “normal” looking datasets at least around the mode of the distribution (central part of the density estimate). Two important conclusions may be drawn from this figure: a) background correction tends to increase the dynamic range of the microarray measurement scale irrespective of the method used b) the inter-array variation in the dynamic range effected by background adjustment varies for the different methods. With respect to the first point, we note that for the data of Figure 2 NONE is associated with the narrowest dynamic range i.e. 5.71 bits. In contrast, method COND increased the dynamic range (maximum – minimum value in the x – axis) by 210.83-5.71≈35 and the SBC by 214.86-5.71≈568 times. However this performance advantage for the latter method is misleading as it leads to dynamic range increases that are considerably higher than the range of the (12-bit) analogto-digital converter, used to scan the original microarrays. For such an unrealistic increase in the range of a bounded quantity to occur, it is as if SBC “injects” noise in the dataset. Such an effect, which was also noted in different datasets (L. X. Qin & Kerr, 2004) argues against further use of this method. Subsequently we examined the effects of global mode normalization (GMoN) applied to background un-corrected, and conditionally corrected images (upper row Figure 3). When compared to global mean normalization, translation by the global mode rule leads to profiles that are effectively centered on zero. Background adjustment by the MaxEnt based algorithm (Equation 9) has the added benefit of normalizing the profiles. This effect is readily appreciated in the graphs of the average gene expression profile of the experimental cellular state (lower row Figure 3). These graphs result from computing the average of the non-parametric estimate of each replicate experiment: n n ˆf ( g ) = 1 ˆf ( g ) = 1  1 ∑ c ∑ n i =1 i n i =1  ni ⋅ ci

ni

 g − g j ,i  ci

∑K j =1

     

(15)

The average graph of the global-mode-normalized, MaxEnt restored profiles closely parallels the standard normal distribution at its central part that reflects the quantitative behaviour of the majority of the expressed genes. On the other hand, the profiles from the unrestored images exhibit a far from normal behaviour for the majority of the genes (except the ones with a normalized expression of 1 log2). At the far edge of the centre both profiles exhibit a minor peak (around +3 log2), which is a consistent feature in all replications of the experiment (upper row Figure 3).Mode normalization of the profiles generated from the MaxEnt restored images uncovers two additional peaks at intensities -3.54 and -2.34 log2. The latter two peaks are present in all individual profiles (upper right graph of Figure 3), and are also evident in the averaged profiles (lower right graph of Figure 3). It is possible to gather evidence for the presence of these peaks from all experiments by averaging the derivatives of the non-parametric kernel density estimators of the individual experiments, and thus obtain a symbolic data-driven peak detector. For the GEP shown in Figure 3, the values of the derivative of Equation 15 at the points {-3.54,2.34, 0, 3.} is within absolute numerical tolerance of 10 -3 equal to zero (data not shown). Consequently one could model the average profile with a five component Gaussian mixture (the additional component used to represent residual variability); this reduced model is shown in Equation 16 and is graphed along the average profile of Equation 15 in Figure 4):

232

Uncovering Fine Structure in Gene Expression Profile

Figure 3. Effect of global mode normalization upon non parametric density estimates of the gene expression profile. Solid lines: replicate experiments, dashed line: standard normal distribution. Upper row: replicate profiles, lower row: average profile.

2 2 fˆ ( g ) ≅ f approx ( g ) = 0.024e −14.3( g +3.54) + 0.046e −0.32( g + 2.34) + 2

2

2

0.18e −3.11g + 0.24e −0.45( g −0.43) + 0.024e −1.74( g −3)

(16)

In order to estimate the numerical parameters that appear in Equation 16, one regresses a sample from Equation 15 against the finite Gaussian Mixture Model: K +1

GMM ( x | p, , ) = ∑ i =1

2

i

pi e −0.5

i ( x− i )

2



(17)

with K=4 and μ, i.e., the centers of the Gaussians, fixed to values obtained from numerical evaluation of the derivative of Equation 15, while all other parameters are allowed to vary. Once the (epistemological) clusters have been defined, one may invoke ontological models that correspond to experimentally verifiable hypotheses. With respect to the ontological nature of the clusters in Figure 4 the following should be noted: •

•

The “central” massive peak corresponds to (thousands of) genes with “average” expression and thus it is highly unlikely that there is a single mechanism that accounts for their expression. This central peak likely reflects the modulating effect (positive or negative) of multiple transcriptional regulators upon the basal transcriptional rate. The right-most peak includes genes of a limited functional repertoire (e.g. ribosomal genes, translational elongation factors) and thus it is very likely that a small number of transcriptional

233

Uncovering Fine Structure in Gene Expression Profile

Figure 4. Finite Mixture Estimation of average gene expression profile. Solid line: approximation of Equation 16, dashed line: average profile of Equation 15).

•

mechanisms are responsible for its generation and maintenance (Table 1). Furthermore probes of genes with similar function (e.g. the retrotransponson gag/pol genes) that are co-regulated are correctly clustered together adding further weight to the hypothesis that such a peak is the product of actual biological mechanisms i.e. it has an ontological substance. The left most peaks include genes with unknown function and regulation; the nature of the corresponding clusters is purely epistemological at this point. To convert such an epistemic statement into ontology would require targeted experiments that search for common transcriptional mechanisms that explain the common quantitative behaviour.

C ONC LUSI ON In the present work, we propose a novel theoretical framework for data and model reduction of gene expression profiles generated by microarray experiments. In order to avoid inconsistencies we adopted a bottom-up statistical framework approach to the problem of background adjustment. This framework operates on the raw microarray images and utilizes the maximum entropy priors in order to encode testable pre-data information about the background features and the measurement scale of microarray images. Under certain fairly generic conditions on the expected intensity of the background (m) relative to the signal, one can approximate these priors with modified power series distributions paving the way for efficient estimating algorithms for the single parameter of interest (m). Subsequently we formulate the operation of background adjustment as a traditional additive noise inverse problem whose unique solution is obtained by means of the Bayes theorem but which is properly constrained by the prior distributions. An empiric evaluation of the proposed image de-noising algorithm on a real world dataset demonstrates the “uncompressing” effects that the method has upon the gene expression profile which allows one to detect the existence of fine and reproducible structure in the latter.

234

Uncovering Fine Structure in Gene Expression Profile

Table 1. Accession number and function of genes corresponding to the rightmost peak in the profile of Figure 4. Rows with multiple gene identifier entries correspond to probes with similar gene function. Gene Identifier

Gene Function

YCR012W

3-phosphoglycerate kinase

YLR340W

Conserved ribosomal protein P0 similar to rat P0

YNL209W

Cytoplasmic ATPase that is a ribosome-associated molecular chaperone

YDR385W, YOR133W

Elongation factor 2 (EF-2)

YHR174W

Enolase II

YLR167W

Fusion protein that is cleaved to yield a ribosomal protein of the small (40S) subunit and ubiquitin

YPL220W, YKL006W

N-terminally acetylated protein component of the large (60S) ribosomal subunit

YLR075W, YDR012W, YDR418W, YNL067W, YPL131W,

Protein component of the large (60S) ribosomal subunit

YJR123W, YGL123W

Protein component of the small (40S) ribosomal subunit

YNL119W

Protein with a role in urmylation and in invasive and pseudohyphal growth

YML045W, YBR012W-B, YCL019W, YJR027W, BL005W-A, YBR012W-A, YJR026W, YJR028W

Retrotransposon TYA Gag and TYB Pol genes

YDL130W

Ribosomal protein P1 beta

YOL039W

Ribosomal protein P2 alpha

YDR382W

Ribosomal protein P2 beta

YLR109W

Thiol-specific peroxiredoxin

YIL078W

Threonyl-tRNA synthetase

YBL005W

Transcriptional activator of the pleiotropic drug resistance network

YAL003W

Translation elongation factor 1 beta

YKL081W

Translation elongation factor EF-1 gamma

YLR249W

Translational elongation factor

YBR118W, YPR080W

Translational elongation factor EF-1 alpha

In the absence of detailed knowledge about the specific biological mechanisms that control the gene expression profile, one has to forego ontological models of such structure and settle for epistemological ones. By considering the discrete, bounded scale of microarray experimental setups and the potential for over and under-saturation we employed function approximation methods in general, and non parametric kernel density estimators in particular, for the representation of gene expression profiles. Such a representation enables the use of quantitative frequency information about the relative abundance of different transcripts within the same experiment in order to a) normalize the measurements and b) suppress residual noise by averaging (“inverse square root” rule) and thus serve the role of data reduction. The latter underlies the detection (“uncovering”) of subtle structural features in the gene profile which pivot the simplification of the descriptions of the biological system under examination (“meta modeling”, “modeling reduction”). Whereas the non-parametric description uses n+1 parameters (the actual data points and the bandwidth of the kernel, i.e. in excess of 6000 variables in our case), the reduced model utilizes only a handful (i.e. fifteen in the case study of the DeRisi dataset).

235

Uncovering Fine Structure in Gene Expression Profile

It is tempting to justify the use of Gaussian Mixtures parametric descriptions in other situations as a result of their “derivation” as accurate reductions in one typical dataset. Whether normality is an emergent property of our ontological bottom – up (and top down as in Do, Muller, & Tang, 2005) descriptions, or a property of the biological systems grounded in tangible experimentally verifiable mechanisms of transcriptional control remains an open question.

A ckn ow ledgment We thank the European Social Fund (ESF), Operational Program for Educational and Vocational Training II (EPEAEK II), and particularly the Program PYTHAGORAS ΙΙ, for funding the above work.

REFERENCES Barnes, C. M., Huang, S., Kaipainen, A., Sanoudou, D., Chen, E. J., Eichler, G. S., et al. (2005). Evidence by molecular profiling for a placental origin of infantile hemangioma. Proc Natl Acad Sci USA, 102(52), 19097-19102. Caticha, A., & Preuss, R. (2004). Maximum entropy and Bayesian data analysis: Entropic prior distributions. Physical Review E, 70(42), 046127-046121. Cox, R. T. (1946). Probability, frequency and reasonable expectation. American Journal of Physics, 14(1), 1-13. DeRisi, J. L., Iyer, V. R., & Brown, P. O. (1997). Exploring the metabolic and genetic control of gene expression on a genomic scale. Science, 278(5338), 680-686. Do, K.-A., Muller, P., & Tang, F. (2005). A Bayesian mixture model for differential gene expression. Journal of the Royal Statistical Society: Series C (Applied Statistics), 54(3), 627-644. Eisen, M. B., Spellman, P. T., Brown, P. O., & Botstein, D. (1998). Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA, 95(25), 14863-14868. Febbo, P. G., Richie, J. P., George, D. J., Loda, M., Manola, J., Shankar, S., et al. (2005). Neoadjuvant docetaxel before radical prostatectomy in patients with high-risk localized prostate cancer. Clin Cancer Res, 11(14), 5233-5240. Gibson, M. A., & Jehoshua, B. (2001). Modeling the activity of single genes. In J. M. Bower & H. Bolouri (eds.), Computational Modeling of Genetic and Biochemical Networks (pp. 3-48). Cambridge, MA: MIT Press. Guo, Y., Eichler, G. S., Feng, Y., Ingber, D. E., & Huang, S. (2006). Towards a holistic, yet gene-centered analysis of gene expression profiles: A case study of human lung cancers. Journal of Biomedicine and Biotechnology, 2006, 69141. Hardle, W., Marron, J. S., & Wand, M. P. (1990). Bandwidth choice for density derivatives. Journal of the Royal Statistical Society. Series B (Methodological), 52(1), 223-232.

236

Uncovering Fine Structure in Gene Expression Profile

Jaynes, E. T. (2003). Discrete prior probabilities: The entropy principle. In G. L. Bretthorst (ed.), Probability theory: The logic of science (pp. 343-371). Cambridge University Press. Johnson, N. L., Kotz, S., & Kemp, A. W. (1992). Power series distributions. In Univariate Discrete Distributions (Second ed., pp. 70-76). John Wiley & Sons. Kooperberg, C., Fazzio, T. G., Delrow, J. J., & Tsukiyama, T. (2002). Improved background correction for spotted DNA microarrays. J Comput Biol, 9(1), 55-66. Qin, L., Rueda, L., Ali, A., & Ngom, A. (2005). Spot detection and image segmentation in DNA microarray data. Appl Bioinformatics, 4(1), 1-11. Qin, L. X., & Kerr, K. F. (2004). Empirical evaluation of data transformations and ranking statistics for microarray analysis. Nucleic Acids Res, 32(18), 5471-5479. Sarwal, M., Chua, M. S., Kambham, N., Hsieh, S. C., Satterwhite, T., Masek, M., et al. (2003). Molecular heterogeneity in acute renal allograft rejection identified by DNA microarray profiling. N Engl J Med, 349(2), 125-138. Silverman, B. W. (1986). Density estimation for statistics and data analysis. CRC Press. Southern, E., Mir, K., & Shchepinov, M. (1999). Molecular interactions on microarrays. Nat Genet, 21(1 Suppl), 5-9. Valentini, G. (2002). Gene expression data analysis of human lymphoma using support vector machines and output coding ensembles. Artif Intell Med, 26(3), 281-304. Wasserman, L. (2006). Density estimation. In All of nonparametric statistics (pp. 125-144). Springer.

K ey TERMS Bayesian Probability: An interpretation of the colloquial term probability, which identifies the latter with the degree of belief of a proposition about the world. This interpretation is firmly grounded in the rules of Aristotelian logic and in fact extends the latter in situations of uncertainty i.e. when the truth or falsity of propositions cannot be ascertained completely. Stated in other terms, the construct of Bayesian Probability and the supporting theory is nothing more than “common sense reduced to numbers”. The major instrument for updating one’s prior beliefs to posterior inferences in light of new information is the computational machinery of the Bayes’ theorem. Epistemological Modeling: Modeling that quantifies one’s perception about the world rather than the world per se. The object of such modeling is to generate coherent descriptions of one’s knowledge usually in the face of uncertainty. Gene Expression Profile: Defined operationally as the output of any step in the microarray pipeline after the image operations stage. Hence the global gene expression profile is a set of possibly noisy measurements, one for each target printed on the surface of the microarray. Inference about the members of the set, which constitutes the gene expression profile, proceeds in different stages that involve the normalization of the measurements prior to exploratory and formal statistical/machine learning methods.

237

Uncovering Fine Structure in Gene Expression Profile

Maximum Entropy Prior: The distribution that results from application of the variational maximum entropy algorithm. The latter uniquely determines the least biased epistemic (Bayesian probability distribution) that encodes certain testable information is by maximizing the convex functional that information negative entropy defines. The resulting distributions are least informative or “objective” ones in the sense that they are most compatible with the “pre-data” constraints, while being maximally noncommittal about the missing information. Non–Parametric Kernel Density Estimation: Non-parametric kernel density estimation methods are model free techniques for the estimation of an empiric distribution from experimental data. Formally such estimators smooth out the contribution of each observed data point over a local neighborhood. Normalization: The process in which mathematical transformations of the microarray data are undertaken to reduce variability in the expression levels and make data from different experiments directly comparable. Ontological Modeling: Modeling that implies the existence of certain objects in the physical natural world. The distinction between ontological and epistemological modeling is a subtle one; whereas the former is an investigation about natural objects and properties, the latter concerns the analysis of (usually) subjective statements about models of the world. Power Series Distribution: Discrete probability distributions with probability mass function given by: P( y | ) = a y

y

∞

∑a x =0

y

y

1, y ≤ M ay =  . Modified power series distribution (MPSD) are more general 0, y > M

distributions which arise when θ is a function of another (simple) parameter. In such a case we define ∞

the power parameter θ(m) and series function η(θ) by: ( ) ≡ ∑ a y x =0

y

=

M

∑ x =0

y

.Particular choices of the

power parameter render power distributions that are analytic approximations to Maximum Entropy priors over finite domains.

238

239

Chapter XIII

Gene Expression Profiling with the BeadArrayTM Platform Wasco Wruck Max Planck Institute for Molecular Genetics, Germany

abstract This chapter describes the application of the BeadArrayTM technology for gene expression profiling. It introduces the BeadArrayTM technology, shows possible approaches for data analysis, and demonstrates to the reader how the technology performs in comparison to alternative microarray platforms. With this technique, high quality results can be achieved so that many researchers consider employing it for their projects. It can be expected that the technology will gain much importance in the future. The author hopes that this résumé will introduce researchers to this novel way of performing gene expression experiments, thus giving them a profound base for judging which technology to employ.

INTR OD UCTI ON Microarrays have emerged as the most popular technology for performing gene expression profiling. They provide researchers with the means to screen all genes of an organism simultaneously thus alleviating the investigation of complex diseases like cancer or diabetes. Closely coupled with the development of the technology are the reliability issues culminating in the publication of contradictory results achieved on different microarray platforms. While in the starting phase of the microarray technology reliability issues arose from the imperfect technique, e.g. distorted spotting needles, thus requiring a compensation by a sophisticated image analysis (Steinfath,M. et al., 2001, Kamberova, G., 2002) a continuous process of improvement using proved industrial methods gives better but far from perfect results. The BeadArrayTM technology described in this chapter proves that an industrial production process facilitates reliable experiments of high quality. The rest of this chapter is organized as follows. We motivate the BeadArrayTM technology. Subsequently, we describe viable approaches for analyzing data produced with this technology, introducing Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Gene Expression Profiling with the BeadArrayTM Platform

the proprietary software BeadStudio and freely available solutions from the R Bioconductor environment. We introduce our pipeline design for the analysis of bead-summary data. Then we demonstrate the position of the BeadArrayTM technology in comparison to other microarray platforms. Finally, we summarize our experiences with the new technique.

T he B ead A rra y TM techn ology In the first phase of microarray technology probes were spotted by robots at known locations onto a dedicated substrate. Probes were then hybridized with a radioactive or fluorescent labeled target. Thus, the abundance of hybridized material was transformed into a signal which could be read by a scanner. Many error sources influenced the results achieved by this technique: twisted spotting needles, needles transferring different DNA volumes, labelling differences for, e.g. red and green channel, dust on the substrates, systematic local background changes, bad signal-to-noise rates in the scanned image, etc. . A great improvement in quality was achieved by synthesizing oligonucleotides using photolithographic processes known from the semiconductor industry. As a logical consequence the product was called “chip” as a reference to the origin of its manufacturing technique. An alternative approach claiming to reach similar quality benchmarks as the chips is the BeadArTM ray technology. It takes advantage from the ability of beads to be randomly assembled at very high densities. In the literature it has been described that beads of 300nm have been randomly assembled into 500nm wells (Michael et al., 1998). For the BeadArrayTM technology at present a size of 3μm is used for the silica beads. The beads are generated by joining oligonucleotides to their surfaces and are pooled in libraries. They are self-assembled into etched substrates. With the beads randomly distributed over the array the problem of decoding each bead’s information content arises. The solution of this problem is described in (Gunderson, K. et al., 2004) and is an essential precondition for the employment of the technique. The probes consist of a gene-specific 50-mer oligonucleotide and a 23-mer oligonucleotide “address” (see Figure 1). They are immobilized to the beads and decoded by a minimized amount of hybridization steps in the manufacturing process. The number of hybridization stages s is given by: s = logbn where n is the number of different beads and b is the number of different states that can be detected after the image analysis, e.g. b=2 if only red and green can be detected or b=4 if red, green, yellow and black can be detected Thus, every chip is unique and is delivered bundled with media containing the information of the bead locations. (Gunderson,K. et al., 2004) claim to have a misclassification rate of the beads of 1.2 x 10-5 in the mean and 1.4 x 10-4 in the worst case in a random sampling of 100 manufactured array matrices. The misclassification problem can be tackled by using a sufficiently high number of replicates of beads. It is guaranteed that – in average – there are more than thirty replicates and – in minimum – there are more than five. In a random sample of twenty chips the author calculated a median number of 42 replicates of beads. The address oligonucleotides are designed to have low similarity to genetic sequences, minimal complementary sequences versus each other and similar GC content. The probe oligonucleotides, on

240

Gene Expression Profiling with the BeadArrayTM Platform

Figure 1. Address and gene-specific part of the more than 100000 oligonucleotides joined to a bead

the other hand, are designed to be specific - also taking into account single nucleotide polymorphisms (SNPs) and alternative splicing. Depending on the spacing between the beads scanners with different resolutions are needed. Two formats exist, one containing 96 samples using a spacing of 6μm works with a scanner resolution of 1μm while the other format containing eight samples using a spacing of 20 works with a scanner resolution of 5μm. For our investigations we used the latter resolution allowing to scan images containing about 1 million x 8 beads.

DATA ANA LYSIS In principle, data analysis can be performed in two different ways: a. b.

Data analysis using the proprietary software solution BeadStudio. Bead-level and bead-summary-level data analysis using manufacturer-independent software, e.g. The R/Bioconductor (Ihaka et al. 1996, Gentleman et al. 2004).

D ata A nalysis with the B eadS tudio The BeadStudio offers a vast variety of functions of which only the main topics will be described here. The software operates on the summarized bead-level-data generated as output from the image analysis modules of the scanner software. Usually this data is in binary format so that it is not readable by the user. By changing the settings in a configuration file also human readable bead-level data can be generated. The BeadStudio enables the access to the data on a per chip-section-basis and the interactive grouping of the data per drag and drop or via a predefined sample sheet. Two types of analysis can be performed: 1.

The gene expression analysis delivers minimum, maximum and mean intensities, standard deviations/errors of samples and of beads, the number of samples, the number of beads and the detection p-values. The detection p-value gives the significance level at which a probe can be distinguished from the background.

241

Gene Expression Profiling with the BeadArrayTM Platform

2.

The differential expression analysis delivers the same results as gene expression analysis plus a so-called DiffScore as well as the Concordance value. The DiffScore tells if the probe in the group of interest - usually the treatment group - is significantly higher or lower expressed than in the reference group. The Concordance value compares the number of probes with upregulated signal to the number of probes with downregulated signal.

The analysis results are presented and saved in a spread sheet that can be easily imported into external table calculation software. For further analysis and quality control linear and logarithmic scatter plots can be generated which provide several functionalities for managing the visualization of the data, e.g. filtering by the detection call or displaying fold change lines. Another feature for follow up analysis is the clustering functionality. Data can be clustered by samples or probes. Thus, it can be evaluated which genes have similar patterns of expression. The same holds for the samples: similar samples regarding the expression patterns are grouped together and displayed in a dendrogram indicating the distances between the samples. For the similarity metrics four different methods are provided: Correlation measures the similarity in terms of the Pearson correlation. Absolute correlation uses also the Pearson correlation, but the absolute value of it – thus, giving good values also for reciprocal dependencies. The Manhattan distance measures the distance as the sum of the edges in a rectangular grid. The Euclidean distance uses the shortest distance between two points which is the square root of the sum of the squares of the components. Quality control information gained from dedicated beads can be displayed in a summarized view but it can be also refined down to the single section. In the summarized view mean and standard deviation of all sections are displayed as bar charts with error bars. The quality control view gives information about hybridization controls, background and noise, Biotin versus high stringency controls, housekeeping genes versus all genes and low stringency controls for perfect matches and mismatches.

D ata A nalysis with the R /B ioconductor Data can be analysed with the R/Bioconductor on bead-summary-level and on bead-level. While the bead-summary-level analysis can be performed on the conventional output of the BeadStudio – the gene profiles – the bead-level-analysis is based upon information about single beads which can be generated by the scanner software changing dedicated configuration parameters in a XML configuration file.

B ead-S ummary-A nalysis with the R /B ioconductor The R/Bioconductor packages beadarray (Dunning,M. et al. submitted), lumi (Lin,S.M. et al. 2007) and BeadExplorer are developed with the purpose of data analysis for the BeadArrayTM technology. The authors suggest to save the bead-summary-data without background correction and normalization via the BeadStudio. The background correction of the BeadStudio produces a higher variance for the lower intensities. This can be examined in a logarithmic scatter-plot of two background-corrected replicates (see Figure 2). The BeadExplorer package offers a GUI (graphical user interface) dialog to specify the bead-summary files while the beadarray and the lumi package are driven by the command line. The lumi package provides the normalization method RSN (Robust Spline Normalization) which combines the quantile (Bolstad, B et al. 2003) normalization and the Loess (Cleveland, W. 1979) normaliza-

242

Gene Expression Profiling with the BeadArrayTM Platform

Figure 2. Logarithmic scatter plots of two biological replicates. In the plot to the left the background correction of the BeadStudio was performed, in the plot to the right the correction was omitted. The left plot clearly shows the higher variance in the area of the lower values.

tion methods. However, besides the two packages data can be simply imported into the R/Bioconductor via basic R reading functions for tabulator- or comma-delimited files. Once the data is imported the comprehensive fund of normalization, statistical and plotting functions of R/Bioconductor can be applied. For gene expression analysis the limma package (Smyth, 2005) including several normalization methods as well as the VSN normalization (Huber, 2002) are a good base.

B ead-Level-A nalysis with the R /B ioconductor The bead-level-analysis is only implemented in the beadarray package. For this type of analysis the files containing bead-level data are required. They are generated by the scanner software with dedicated settings in the XML configuration file. It can be considered as an disadvantage that these files cannot be generated “a posteriori” - after the scanning software finished its work. The bead-level analysis provides further facilities like quality control and normalization on a bead-level base. The beadarray package can be used to find local problems on the chips by examining images with the spatial bead distributions. Outlier beads can be removed – a feature also integrated in the standard platform software. On the other hand, the bead-level-data uses large amounts of disk space and a standard analysis without the presence of many bead outliers will yield nearly the same results as the platform software by averaging the bead intensities. Thus, unless the bead-level-data is used for normalization one can stick to the bead-summary-data. Nevertheless bead-level-data should be stored for potential further investigations when disk space is not an issue.

A Pipeline D esign for B ead-S ummary-A nalysis The author established a pipeline for the evaluation of a large series of Illumina bead arrays which is illustrated by Figure 3.

243

Gene Expression Profiling with the BeadArrayTM Platform

Figure 3. Pipeline design for the evaluation of BeadArray™ experiments. The first steps from the experiment to the image analysis are under control of Illumina™. The summarized bead data can be generated optionally by a Bioconductor package if the bead-level data is available. Results of the pipeline are on the one hand quality control features like correlation tables and plots and on the other hand tables containing significant genes and pathways as well as statistical and biological descriptive parameters associated with them.

The first steps of the pipeline – from the experiments to the image analysis – are carried out on the Illumina BeadArray™ platform. The standard procedure includes the bead summarization in the BeadStudio but it is also possible to execute this step via the Bioconductor package beadarray as long as the bead-level data is available. In the next step the data is annotated. Here, one could rely on the lookup tables provided by Illumina including RefSeq ids, mouse symbols, descriptions, gene ontolo-

244

Gene Expression Profiling with the BeadArrayTM Platform

gies, etc. However, further annotation is required when more complex evaluations are planned, e.g. mapping of chromosomal locations. Furthermore a BLAST (Basic Local Alignment Search Tool) of the oligonucleotide sequences from Illumina against the newest versions of sequence databases keeps track of recent changes whose influences should not be underestimated. After the annotation process the categories of the experiments are determined and integrated into a naming scheme for the bead summary data, e.g. collecting information about tissue, sex and strain in a project comparing differences between strains. These categories again are used to specify data sets from the bead summary data which are incorporated in the dedicated test. The test set itself is usually built up from a control group and a treatment group – more generally speaking - it is built up from two conditions to be compared versus each other. Quality control is regarded as a very important step in the evaluation of the genrerated large data sets. Therefore the evaluation pipeline incorporates multiple quality control methods: • • • •

Inter-array correlation plots and tables Intra-array correlation plots (section correlation, replicates) and tables Heat maps Cluster dendrograms

Sections containing biological or technical replicates are assumed to yield very high correlations. Thus, the average of a section’s correlations to all other sections can be used as quality criterion. This criterion is used to filter bad quality sections applying a dedicated threshold for the correlation coefficient. An automated quality control is enabled this way. However, a visual inspection should complement the automated process at least for some random samples. The quality control phase is followed by the normalization process. The normalization operates on the test sets containing all quality-checked replicates of the control and treatment set. Thus, only the data of interest for the dedicated comparison is considered and external influences are minimized. This would be the drawback of combined normalization of the total data set consisting of all single data sets. By default, we use the quantile normalization algorithm (Bolstad, B et al. 2003) which ranks the values of the data sets, calculates the median values afterwards and finally copies back the median values to the original data sets in the original order. This method brings the data sets’ intensity distributions into line so that the run of the curve is the same for all data sets. The median normalization is a more simple method multiplying each single experiment with a constant factor calculated via the median of the data set so that the median of all data sets is the same. Several statistical tests are performed on the normalized data including Student’s t-test (Press,W et al. 1992), the Welch test, the Wilcoxon test (Wilcoxon, 1945) and a permutation test. The statistical tests result in a p-value addressing the probability that control and treatment have the same mean. Thus, a low p-value indicates a high significance that the dedicated gene is differentially expressed. A threshold of 0.05 – or more strictly – 0.01 is usually applied. The permutation test arbitrarily permutes the samples of the control and the treatment set and determines the percentage of test results less than the Wilcoxon test’s p-value. This percentage itself delivers the p-value of the permutation test. By choosing the equality of control and treatment as null hypothesis the false-positive-rate can be controlled, i.e. the amount of genes yielding a positive test result while in reality they are not differentially expressed. For a series of multiple simultaneous tests the significance is decreased by the multiplicity. This problem can be managed by the false discovery rate adjustment which is calculated by the qvalue method (Storey, 2002).

245

Gene Expression Profiling with the BeadArrayTM Platform

In a pathway analysis the significance of the disregulation of pathways is tested. This is achieved by a hypergeometric test comparing the number of significant genes in the dedicated pathway to the total number of significant genes. The pipeline can be parametrized by the threshold for p-value, ratio and detection value. The detection value is delivered by the image analysis telling how good the dedicated beads separate from the background and thus giving a quality criterion of the reliability of the probe. In general, a good detection value corresponds to high intensities. The threshold parameters are used for generating lists of significant genes.

B eadA rrayTM T echnology in C omparison to other Microarray Platforms Ever since microarray technology has been developed reliability has been the crucial factor. Concerning the reliability it can be postulated that experiments should be reproducible on different technology platforms and within one platform a perfect reproducibility is expected. The MicroArray Quality Control (MAQC) project was initiated to investigate reliability issues of microarrays. The project participants tested several microarray and alternative technology platforms – including the BeadArrayTM platform – each at three laboratories selected by the microarray platform provider. They evaluated the intra-platform consistency and the inter-platform comparability across multiple test sites. The tested samples were universal human reference RNA and human brain reference RNA and two predefined mixtures containing 75% universal human reference RNA : 25% human brain reference RNA and 25% universal human reference RNA : 75% human brain reference RNA. The goal of this experimental design was not to perform a representative genetic experiment but to investigate the characteristics and limits of the technologies. The four sample types were tested using five replicate assays. A common subset from all platforms included 12091 Entrez genes extracted from 15615 RefSeq probes contained in the union of all platforms. Genes were matched to probes via a simplifying oneprobe-to-one-gene lookup list. The data for each platform was evaluated with the proprietary software. Therefore the resulting number of probes differed between the platforms depending on the total number of probes provided and the detection calls. Each software solution handles the calculation of the detection calls and the filtering via a threshold in its own way following deviating philosophies regarding the reliability of data. For the study only genes that were detected in at least three of five replicate assays were used for most analyses. The number of genes detected lay in the range of 8000 to 12000 depending on the platform. Within one platform there was only a very small variation in the number of detected genes Different numbers of probes certainly have an impact on the data analysis. In a rough overview the results can be summarized as being measures for the reproducibility within platforms and in between platforms and the accuracy in comparison to a reference technique. As a measure or the reproducibility the coefficients of variation (cv) are calculated telling how much results vary between different platforms and test sites. Here, the values for BeadArrayTM are in the lower range of all platforms at about 0.1 . Another measure is the amount of overlapping genes detected as differentially expressed under predefined conditions in terms of p-value and ratio in different platforms or test sites. Here, the BeadArrayTM platform performed quite well with some overlaps to other platforms and all overlaps within the platform greater than 80%.

246

Gene Expression Profiling with the BeadArrayTM Platform

Furthermore, the reproducibility can be measured in terms of the correlation coefficient. Here, the Spearman rank correlation of the log ratios was used. It is calculated by ranking the logarithmic ratios of treatment samples (human brain reference) versus control samples (universal human reference) before calculating the correlation coefficient.. The correlation coefficient ranges between –1 and 1. Good values are close to one, values near zero represent a random dependency and negative values a reciprocal dependency. In this discipline the BeadArrayTM platform performed best for the median to all other platforms. However, the correlation coefficients where only slightly better than those from other competitors and in the intra-platform comparison there were better results from another platform but both were ranging on an excellent level. For these results from the MAQC project see Figure 4.

C ONC LUSI ON The BeadArrayTM platform is a novel promising technology for gene expression profiling. It provides high-throughput data screening and high-quality experiments at a relatively low cost. For data analysis a quite comfortable interactive software solution is bundled with the platform. Furthermore, free software packages from the R/Bioconductor environment can be applied to evaluate the data in combination with the proprietary solution or in a stand-alone fashion. However, since the platform is young of age the software development is in the starting phase and further improvements can be expected, e.g. a state-of-the-art normalization method taking into account GC-content and avoiding negative values, like GCRMA (Wu et al., 2004) for the Affymetrix1™ platform. For the advancement of alternative software

Figure 4. Spearman rank correlations of log ratio values from dedicated platforms compared in the MAQC project. Only genes expressed in both test sites and both sample types were used. ILM_1, ILM2 and ILM_3 are three different test sites for the BeadArrayTM platform. Correlation coefficients less than 0.8 (worst) are the darkest, between 0.8 and 0.9 are the lightest and greater than 0.9 (best) are mid-range. The last row shows the median of the rows above yielding best values for the BeadArrayTM test sites.

247

Gene Expression Profiling with the BeadArrayTM Platform

packages the open accessibility of technical specifications, e.g. detailed descriptions of bead-level-data and control probes would be profitable. Nevertheless the existing tools allow for gene expression profiling delivering results of high quality. The data quality as assessed by the MAQC project is located on a high level. In terms of coefficient of variation, overlap of significant genes and correlation coefficient between platforms and within the same platform it always ranges in the upper region of all competitors and sometimes is best. Since the MAQC consortium wanted to investigate the characteristics and limits of the technologies it can be expected that in dedicated biological experiments the quality will not reach the high level of this project. The results of the experiments evaluated by the author confirm this hypothesis. Correlation coefficients of data from technical replicates could reach 0.99. However, when some parameters were changed like the labeling or the batch of chips the quality could be slightly inferior.

ackn ow ledgment Part of this work was funded by the EU project METASTEM.

REFERENCES Bolstad, B., Irizarry, R., Strand, M., & Speed, T. (2003). A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics, 19(2), 185-93. Cleveland, W.S. (1979). Robust locally weighted regression and smoothing scatterplots. Journal of the American Statistical Association, 74(368), 829-836 Dunning, M. J., Smith, M. L., Ritchie, M. E., & Tavaré, S. (2007). Beadarray: R classes and methods for Illumina bead-based data. Bioinformatics, June 22. Gentleman, R., Carey, V. J., Bates, D. M., et al. (2004), Bioconductor: Open software development for computational biology and bioinformatics. Genome Biology, 5, R80. Gunderson, K.L., et al. (2004). Decoding randomly ordered DNA arrays. Genome Res, 14, 870-877 Huber, W., von Heydebreck, A., Sueltmann, H., Poustka, A., & Vingron, M. (2002). Variance stabilization applied to microarray data calibration and to the quantification of differential expression. Bioinformatics, 18, 96-S104. Ihaka, R. & Gentleman, R. (1996). R: A language for data analysis and graphics. J. Comput. Graph. Stat, 5(3), 299-314. Kamberova, G., & Shah, S. (2002). DNA array image analysis. Nuts & Bolts. DNA Press Lewin, B. (2002), Molekularbiologie der gene. Spektrum Akademischer Verlag. (p. 985). Lin, S.M., Du, P., Kibbe, W.A. (2007), Model-based variance-stabilizing transformation for Illumina microarray data. Accepted by Nucleic Acid Research.

248

Gene Expression Profiling with the BeadArrayTM Platform

MAQC Consortium (2006). The microarray quality control (MAQC) project shows inter and intraplatform reproducibility of gene expression measurements. Nature Biotechnology, 24(9), 1151-1161. Michael, K.L., Taylor, L.C., Schultz, S.L., & Walt, D.R.(1998). Randomly ordered addressable highdensity optical sensor arrays. Anal.Chem, 70, 1242-1248. Press, W. H., Teukolsky, S.A., Vetterling, W.T., & Flannery, B.P. (1992). Numerical recipes in C: The art of scientific computing. Cambridge University Press. Smyth, G. K. (2005). Limma: Linear models for microarray data. In R. Gentleman, V. Carey, S. Dudoit, R. Irizarry, W. Huber (eds), Bioinformatics and computational biology solutions using R and bioconducto (pp. 397-420). New York: Springer. Steinfath, M., Wruck, W., Seidel, H., Lehrach, H., Radelof, U., &. O’Brien, J. (2001) Automated image analysis for array hybridization experiments. Bioinformatics, 17, 634-641. Storey, J.D. (2002). A direct approach to false discovery rates. J R Stat Soc B, 65, 479-498. Wilcoxon, F. (1945). Individual comparisons by ranking methods. Biometrics Bulletin, 1, 80-83. Wu, Z., Irizarry, R. A., Gentleman, R., Martinez Murillo, F., & Spencer, F. A. (2004). Model-based background adjustment for oligonucleotide expression arrays. Johns Hopkins University, Dept. of Biostatistics Working Papers.

K ey T erms Affymetrix: Affymetrix is a trademark of Affymetrix, Inc. . Bead Array: A bead array is an array of randomly assembled beads covered with oligonucleotides representative for an organism’s genome. BeadArray: BeadArray is a trademark of Illumina, Inc. . BLAST: (Basic Local Alignment Search Tool) is an bioinformatics algorithm applied to align sequences versus each other. Clustering: Clustering is an analysis method for grouping of probes and samples by similarity. Similar data sets fall into the same cluster while dissimlar data sets fall into different clusters. For the hierarchical clustering a hierarchy of clusters is determined. Thus, one large cluster comprising all data sets is stepwise subdivided into smaller clusters down to singletons which are clusters containing a single data set. Coefficient of Variation (cv): The coefficient of variation is the standard deviation divided by the mean. It is a measure for the reproducibility. For a low cv data has a good reproducibility, for a high coefficient of variation data contains much variation and thus measured values can only be reproduced very inprecisely. Correlation Coefficient: The correlation coefficient tells how good two data sets correlate. The correlation coefficient ranges between –1 and 1. Good values are close to one, values near zero represent

249

Gene Expression Profiling with the BeadArrayTM Platform

a random dependency, negative values a reciprocal dependency. The correlation coefficient calculated directly from the data is called Pearson correlation coefficient. The Spearman correlation coefficient first ranks the data before calculating the (Pearson) correlation coefficient. Thus, it is more robust against outliers than the Pearson correlation coefficient. Gene Chip: A gene chip contains a matrix of photolithographically assembled oligonucleotides representative for an organism’s genome on a dedicated substrate. Gene Expression: Gene expression is the transformation of a gene’s information by transcription and translation (Lewin, 2002) Microarray: A microarray is a collection of genetic substances, - mostly DNA(Deoxyribonucleic acid) - integrated at a large scale..Microarrays can be generated in high-throughput using robots transferring minimal amounts of probes onto substrates. The sample being tested is radioactively or fluorescently labelled and hybridizeded to the probes. A scanner scans the microarrays delivering signals for the labelled and hybrized substance. “Chips” (see Chips) and “bead arrays” (see bead array) can be regarded as subsets of microarrays. VSN (Variance Stabilizing Normalization): The VSN (Variance stabilizing normalization) transforms the data in such a way that the variance remains nearly constant over the whole intensity spectrum. Without this (or another) normalization a dependency between intensity and variance can be observed in may cases which deteriorates the analysis results. XML: XML is the extended markup language. It is a more general version of the Internet description language HTML (hypertext markup language) allowing the detailed description of documents.

endn ote

1

250

Affymetrix is a trademark of Affymetrix Inc.

251

Chapter XIV

The Affymetrix GeneChip® Microarray Platform Djork-Arné Clevert Charité Universitaetsmedizin Berlin, Germany and Johannes Kepler University Linz, Austria Axel Rasche Max-Planck-Institute for Molecular Genetics, Germany

abstract Readers shall find a quick introduction with recommendations into the preprocessing of Affymetrix GeneChip® microarrays. In the rapidly growing field of microarrays, gene expression, especially the Affymetrix GeneChip arrays, is an established technology present on the market for over ten years. Used in biomedical research, the mass of information demands statistics for its analysis. Here we present the particular design of GeneChip arrays, where much research has already been invested and some validation resources for the comparison of the methods are available. For a basic understanding of the preprocessing, we emphasize the steps, namely: background correction, normalization, perfect match correction, summarization, and couple these with alternative probe-gene assignments. Combined with a recommendation of successful methods a first use of the new technology becomes possible.

Intr od ucti on Microarrays are the state of the art tool for high-throughput analysis of gene expression. Microarrays allow one to monitor the expression of several thousand genes in parallel in a single experiment facilitating a broad view of the expression state. The genome-wide investigation is basis of the systems biology modeling concept.

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

The Affymetrix GeneChip® Microarray Platform

The Affymetrix GeneChip® platform was one of the first commercial techniques available on the market. It comes up with a sophisticated design measuring expression of a single gene by several probes on the same chip and providing control sequences for every feature. Chips are available for many species, including popular model species and especially in the biomedical research, where the platform is established. Due to the design and the dissemination of the platform much research has been performed on the analysis of the generated data. It is the main leads and successful results that we wish to describe here. The vast amount of digital and noisy data generated by microarrays requires statistics for its evaluation. Affymetrix provides basic applications for processing the data and collaborates with companies providing Affymetrix recommended software. On the other hand most of the independent research has been carried out on the R software environment with the BioConductor package collection for statistical computing (Gentleman et al., 2004; R Development Core Team, 2005). In an attempt to be concise we shall focus on R/BioC.

D esign of the Platf orm In the GeneChip approach the expression of a gene is measured by several probes. The probes are selected from the transcript sequence of the respective gene. The UniGene database is the reference for the gene sequence. To avoid cross hybridization between several genes, the sequence of the probes has to be chosen unique to the gene. The length of the probes is always 25 nucleotides. A number of such probes collected in probe sets stands for independent measurements of the number of transcripts for the gene. The number of probes in a probe set varies between chip platforms. For example in the popular Human Genome U133 Plus 2.0 array there are eleven probes in each probe set. With the advancement of the human genome sequence and transcript libraries the choice of probe sequences has to be updated from one chip platform to the next. The assignment of the probe sets to genes is updated quarterly and can be retrieved from the NetAffx service on the Affymetrix homepage. In the classic chip designs, each probe is spotted with its perfect match (PM) sequence and the socalled mismatch (MM) sequence. In the mismatch sequence the 13th nucleotide is altered. The idea is, that the mismatch sequence measures the background expression. The perfect match signal then contains the background expression plus the gene expression. In the newer chips Affymetrix spares the space for additional probes and replaces the mismatches with GC-bins. For a given number of G or C nucleotides (between 0 and 25) the GC-bin contains 25mers unrelated to any gene sequence. The assumption is, that sequences with the same GC content show similar expression behaviour. To make the hybridization

Figure 1. Probe sequences are selected from the transcribed regions of the gene sequence

252

The Affymetrix GeneChip® Microarray Platform

results independent from the degradation of the transcripts in the cell the probe sequences are selected near the 3’ end of the gene sequence. In the production of the chips, the probes are spotted on slides using a photolitographic method. In the experiment, labeled RNA from the sample under study is injected on the chip. The hybridization result depends non-linearly on the amount of transcripts in the sample. In the analysis of the measurement results this has to be considered by calculating with the logarithm of the hybridization value. The Affymetrix chips are single channel chips. The RNA is labeled using the same dye. The comparison between different samples is done by using several chips. The chip with the hybridized solution is then scanned on the wavelength of the dye. Analysis starts by exploiting the scanner image. An approximate level of hybridization for every probe is inferred from this image.

Prepr ocessing

S teps

In order to analyze and evaluate GeneChip data from an experiment with multiple arrays, the data preprocessing at probe-level is a crucial step. All of the methods have to account for two major disturbing factors, the background signal and the variance of the measurements resulting in noisy data. The composition of the gene signal is not yet completely understood, although several groups develop mathematical models. The use of the models is two-fold, on the one hand the signal can be understood with its disturbance factors and on the other hand the model is applied to correct the measured signal. One effect of the missing understanding is the underestimation of the fold change between two samples. An expression level value is calculated using a four-step procedure, as shown in Figure 2. (1) ‘Background correction’, which removes the unspecific background intensities of the scanner images; (2) ‘normalization’, which reduces the undesired non-biological differences between chips and corrects the signal intensity of the arrays; (3) ‘PM correction’, which removes non-specific signal contributions such as unspecific binding or cross-hybridization from the PM probes by the use of the MM and (4) ‘summarization’, which combines the multiple preprocessed probe intensities into a single gene expression value.

Figure 2. Preprocessing pipeline for Affymetrix GeneChip in BioConductor. Back­ground correction, normalization and PM correction are optional, whereas summarization is a mandatory processing step.

253

The Affymetrix GeneChip® Microarray Platform

Errors introduced in one of these steps may corrupt further processing, e.g. spurious correlation with target conditions may appear especially in few tissue samples (arrays) and large number of genes. Most of the methods focus on perfect matches and ignore the mismatch information. Various methods are proposed for preprocessing probe-level data and are the subject of the following sections.

B ackgr ound c orrecti

on Meth ods

The background signal consists of an optical background and a chemical background. The optical background introduced by the scanning of the chip derives from the technical range of the scanning device eventually supplemented by the overshining of the neighboring spots not corrected by the image analysis. The chemical background is explained by the gene signal consisting of gene specific binding and non-specific binding. The gene specific binding is the goal of all the models and normalization methods. The non-specific binding, also called cross-hybridization, is the RNA from other genes and different RNA snippets. Non-specific binding has shorter binding times at the probes and is fortunately much lower than gene specific binding. The background signal differs from probe to probe and thus general estimates for all of the probes have had little success. Recent developments hint at the content of the probe sequence as the main disturbing factor. A higher GC content is associated with a higher binding affinity due to three instead of two covalent bindings for a single nucleotide. The higher affinity leads to higher hybridization values and bigger variance. In ideal circumstances a probe detects the amount of a probe-specific labeled RNA sequence, but actually the measured probe intensity is a mixture of two signals: a probe-specific signal that contains the abundance of hybridized RNA and a non-specific background signal that obscures the observation. To separate these signals one can choose from two methods: 1.

2.

The RMA convolution model, which models the observed probe intensity as the sum of an exponentially distributed signal and a Gaussian distributed background component (Bolstad, Irizarry, Astrand, & Speed, 2003; Irizarry, Hobbs et al., 2003). It is worth noting, that RMA background correction can be improved through correcting probe values for the GC content in the probe sequence. This improvement leads to a method called GCRMA (Wu, Irizarry, Gentleman, Murillo, & Spencer, 2004). The Affymetrix’s MAS 5.0 algorithm, where the chip is partitioned into 16 equally sized segments. For each segment a background is estimated using the lowest 2% probe intensities of each segment. Then each probe value is adjusted based upon a weighted average of each of the background values. Here, the weights depend on the Euclidean distances from a particular probe to the centers of all segments (Affymetrix, 2002).

No rma liza ti on Meth ods Normalization is the process of removing unwanted chip effects that might bias all measured raw probe level data in the similar matter. This bias is introduced during RNA extraction, pipetting, temperature fluctuations, hybridization efficiency and many other sources of variation. (Hochreiter, Clevert, & Obermayer, 2006) discussed these possible sources in more detail. In the following sections we shall

254

The Affymetrix GeneChip® Microarray Platform

distinguish between model-based and baseline-based approaches. Model-based methods have made use of information from across all arrays to normalize the probe level data whilst baseline-methods select only one array in the batch as reference, and then normalize all array to that particular one. Affymetrix for instance, proposed to normalize arrays by choosing one baseline array and then to scale all the other arrays to have the same mean intensity as this array. For model-based methods cyclic loess and quantile normalization both serve as examples. The cyclic loess normalization (Yang et al., 2002) is derived from the basic principle behind the MvA-plot, where M is the difference in log expression and A is the average of the log expression values. Ideally, the points of an MvA-plot for normalized data should be centered on M = 0 i.e. the loess curve of that points should be a straight line lying on the A-axis. The rationale of the loess normalization is to project the loess curve onto the A-axis. Given two arrays with probe intensities xi, Mi = log2(xi1/xi2) and Ai = 12 log 2 ( xi1 xi 2 ) are determinated, and then a normalization curve is fitted to the resulting MvAplot using a local regression method called loess. These fits are Mˆ i and M i′ = M i − Mˆ i thus obtain the A +M ′ /2 A +M ′ /2 normalization adjustment. Transforming x1′i = 2 i1 i1 and x2′ i = 2 i 2 i 2 back to linear scale leads to normalized probes intensities of both arrays. (Bolstad, Irizarry, Astrand, & Speed, 2003) proposed to align the distribution of the arrays with an empirical distribution. To determine the empirical distribution, quantile normalization first sorts the intensities for each array and then computes the mean over the arrays for each sorted intensity position. The intensities of each array are then set to the mean value of the according position in the unsorted array. This leads to the fact that all arrays possess the intensity values but for different genes and different positions within a probe set.

Perfect

Match Co rrecti

on Meth ods

Affymetrix GeneChip arrays are so dense, that any non-specific signal contribution such as unspecific binding or cross-hybridization has to be estimated from the probe level data. Therefore, Affymetrix originally adjusted the signal intensity of a PM probe by subtracting the intensity value of the corresponding MM probe. But in (Naef, Hacker, Patil, & Magnasco, 2002) replicate experiments on different arrays were made and the PM values as well as the PM – MM values were analyzed. The authors found that the PM values (PM) have lower noise at low intensity than PM minus MM (PM – MM) whereas for intermediate and high intensities the noise levels for PM and PM – MM were similar. Therefore, recent approaches made use only of PM probes. Affymetrix indirectly supports this aspect due to the retirement of the MM probes in many products. Therefore we shall not address that issue in further detail.

Su mmariza ti on Meth ods In order to establish a single expression value for a gene that is assessed on the array, it is necessary to combine together all intensity values of each of the probes in the corresponding probe set to one value. To tackle this problem several methods have been proposed. In principle it is important to distinguish between single- and multi-array approaches: Single-array methods only use probe level information on an individual array to calculate the expression value (Li & Wong, 2001). Therefore, the calculations are carried out individually chip-by-

255

The Affymetrix GeneChip® Microarray Platform

chip, one consequence is that no information from other chips is available to robustify the expression value. For instance Affymetrix suggested in their Microarray Suite 5.0 (MAS 5.0) to apply a one-step Tukey’s Bi-Weight, on the log2 transformed probe level data, to give an expression value. In particular, the algorithm computes a distance measure: dij =

log 2 (PM ij )− M cS +



(1)

where M is the calculated median of the probe level data and S is the median absolute deviation. In addition, c is a constant defaulting to 5 and ε > 0 prevents division by zero. In consideration of dij weight for every data point is calculated from:

(1 − d 2 ) 2 , d ≤ 1 w(d ) =  , d > 1 0

(1.1)

In contrast to the preceding approach, multi-array methods combine the multiple preprocessed probe intensities into a single expression by taking probe information across arrays into account. This is motivated by examining probe patterns across the arrays; Which commonly show that the variability of a single probe across multiple arrays is smaller than the variability between probes of the same probe set. Therefore (Irizarry, Bolstad et al., 2003) proposed to fit a linear additive model through a median polish. This summarization approach is the part of the RMA preprocessing pipeline. As mentioned above, perfect match intensities were modelled by: log 2 ( PM ij ) =

+

i

+

j

+ ij

(2)

where PMij is the intensity matrix of a particular probe set such that j subscripts the probes and i indicates the arrays. Moreover βj descript the probe affinity effect and μ + αi provide an estimation of the log2 expression level. To estimate the parameters, the median polish algorithm is applied. The lack of a standard error estimate is one drawback to this approach. The core of the FARMS algorithm is a factor analysis – a multivariate technique to detect a common structure in the data of multiple probes that measure the same target. The assumption is that the probe intensity measurements of the perfect matches x depend on the true RNA concentration z via: x = λz + ε

(3)

with λ being the loadings for the factor analysis (Hochreiter et al., 2006). In equation (3), a N(0, 1)-distributed z models the common factor in the data x, while the N(0, ψ)-distributed ε models the independent noise in each probe of each array. In essence, model (3) is explaining the observed covariance structure of the data x by representing the data as being N(0, λλT + ψ)-distributed with an individual noise variance ψ and signal variance λλT and is optimized by Bayesian maximum a posteriori estimation. In contrast to other summarization techniques, FARMS provides an unsupervised feature selection criterion that is based on the reliability of the extracted factor. Here, only such probe sets are considered where the model can reliably detect a variation of the latent variable z. (Talloen et al., 2007) discussed the concept and applicability of informative/non-informative calls (I/NI-calls) approach in more detail.

256

The Affymetrix GeneChip® Microarray Platform

Va lida ti on R es ources The lack of objective criteria to assess competing preprocessing methods motivated (Cope, Irizarry, Jaffee, Wu, & Speed, 2004; Irizarry, Wu, & Jaffee, 2006) to develop a collection of assessment criteria called ‘Affycomp II’ for the evaluation and comparison of expression measures on the Affymetrix GeneChip platform. Furthermore a web-tool made available at http://affycomp.biostat.jhsph.edu for developers to benchmark their procedures and to help users identify the best method for their application. Here, the benchmark data is crucial. Therefore (Cope et al., 2004) used three well-known evaluation datasets, which were produced by controlled experiments with known target expression values or known mutual relations. The control of input in spike-in and dilution experiments makes it possible to identify features of the data for which the expected outcome is known in advance. Based on this knowledge 17 assessment criteria and several related plots were developed. Nevertheless, we think that from all benchmark criteria the area under the curve (AUC) criterion is best suited to measure the quality of a preprocessing method. The AUC criterion is the area under the receiver operating characteristics (ROC) curve, which plots the true positive rate (sensitivity) against the false positive rate (1–specificity) and serves as a quality measure for classification methods. The AUC criterion can be applied here by defining gene classes: for a pair of arrays class 1 genes are the genes for which expression value differences exceed a certain relative factor (fold change). Now the output of a summarization method can be interpreted as classification by computing the class membership of genes based on the predicted expression values. We prefer the AUC criterion over other measures provided by ‘Affycomp II’ evaluation because it is independent of scaling of the results (log-expression values) and trades sensitivity against specificity. Other quality measures from the ‘Affycomp II’ evaluation, like slope parameter estimation, are often not scaling independent.

Alterna ti ve Pr obe- G ene A ssignments Affymetrix delivers an assignment of probe sequences to probe sets. The number of probes in a probe set is fixed for all probe sets on the chip. Quarterly the probe sets are reannotated to genes and transcripts. In recent time it has come up, that the probe sets do not have to be fixed but the probes themselves can be reattached to probe sets and new assignments have been published (Dai et al., 2005). The alternative assignments have several advantages. The advancement of the sequence databases leads to altered gene sequence. If the probe sequence is not contained in the gene sequence anymore, the probe does not need to be processed. Its signal introduces noise. Also extensive libraries for single nucleotide polymorphisms (SNPs) are meanwhile available. The probe is skipped also if a single nucleotide polymorphism hits the probe sequence. The assignment can be done with a specific sequence database in mind. This eases the path of analysis as the probe sets provide another abstract level between the hybridization values and the gene expression. A drawback of the reassignment is, that there is no fixed number of probes in the probe set anymore. The idea of reassignment leads us to the issue of evaluating its use. On a set of chips from the Human Genome U133 Plus 2.0 arrays we compared two assignments. The Affymetrix assignment and the assignment to Ensembl genes (Birney et al., 2006; Dai et al., 2005). The first discovery is, that one fourth of the probes on the chip is skipped for the reasons given above. For the same set of chips the preprocessing has been executed using two assignments. The two results refer mostly the same genes to be expressed. But one fourth of the genes can be seen to be differentially expressed between the two assignments! The different number of probes in probe set does not lead to 257

The Affymetrix GeneChip® Microarray Platform

a dependency between variation and probe set size. The Kendall correlation between the coefficient of variation and probe set size is –0.06. The mean shows a tendency to high expression for small probe set size. We also processed a set of treatment and control chips with the two assignments and compared the resulting list of differentially expressed genes. The two lists overlap to about 50%. This again shows a major influence of the assignment on the analysis results. From the above considerations we conclude, that the use of alternative probe-gene assignments is recommendable. The new assignments lead to reduced variation and thus reduced noise in the expression values, likewise they improve the sensitivity and specificity of the algorithms and results.

Medica l Use The research or scientific use of microarrays is mostly the comparison of diseased and normal tissue to identify differentially expressed genes. In cases with sufficient disease samples clustering and classification methods can be used to dissect different disease traits. The dissection facilitates the distinction of research results and identifies different causes and developments. Defining expression signatures for the subtraits of an affliction leads into diagnosis of the respective disease traits. Currently there is no chip for diagnostics on the market. But projects are running to push first products towards an admission. With the exact disease trait diagnosed the treatment is optimised using the best possible medicine administered in an adequate dose. Systems biology uses microarrays at several stages of model building (Klipp, Herwig, Kowald, Wierling, & Lehrach, 2005). Genes with altered expression are the basis to develop physiological models. Hybridization results estimate the model parameters and verify model predictions.

Figure 3. On the left hand side are the expression of probe sets for the same target gene for two different assignments compared. On the right hand side we see the variation versus the probe set size.

258

The Affymetrix GeneChip® Microarray Platform

E xperiment a l set up Due to the noisy data microarray results always have to be verified. In the lab this is done with complementary RT-PCR experiments for selected genes. In the office, look at the consistency with other published data, although this consistency is often low. The amount of verification is alleviated by the use of statistics in the analysis of the hybridization results. But a solid statistical analysis requires replicates. Normally this is not an issue in industries but in academic laboratories. In technical replicates the same sample is used on several chips and in biological replicates samples from different patients or animals are hybridized each on a single chip. The use of biological replicates is strongly recommended. The following numbers have established by experience: • • • •

Cell culture: 2-3 replicates Animal system: 4-5 replicates Human system: 5-6 replicates Time courses: 4-6 time points with 2 replicates each time point

These numbers imply that it is wise to consult a statistician at the early stage of experiment planning to ensure a reasonable statistical set-up. In the US the MicroArray Quality Control (MAQC) project has started to check for inter- and intraplatform reproducibility of gene expression measurements (Shi et al., 2006). The preprocessing problems raised concerns about the reliability of this technology. The MAQC was initiated to address these among other issues. The study is an important first step pushing microarrays towards clinical and regulatory settings. The experimental setup is described in (Shi et al., 2006). Microarray products from different manufacturers are compared. Affymetrix is presented with a very high reproducibility in- and across test sites with low variance in measurements.

Out look on T echn ologica l A d vances In this chapter we described the established series of gene expression chips from Affymetrix. New chip designs are ahead. A direct enhancement of gene expression chips are exon arrays. They comprise probe sets for every exon. Thus the expression can be dissected into the single transcripts and identify alternative splicing. By collecting the probe sets in so called meta probe sets the gene expression is still included. SNP chips are useful in the help of genotyping with microarrays, avoiding expensive sequencing approaches. On tiling arrays the probes are equidistantly distributed on the genome sequence identifying expression of sequences independent from the gene structure. Because of the equidistant selection of probe sequences not all probe sequences are unique introducing new analysis challenges. Most of the genome is never expressed thus most probes on a tiling array do not return a signal. By now no tiling array is large enough to cover the whole genome. Presenting the different chip designs it must be remarked, that the methods and analysis approaches presented in this chapter are not directly transferable to the new designs. Different biological questions and use of the chips need different processing.

259

The Affymetrix GeneChip® Microarray Platform

R eferences Affymetrix. (2002). Algorithms description document. Birney, E., Andrews, D., Caccamo, M., Chen, Y., Clarke, L., Coates, G., et al. (2006). Ensembl 2006. Nucleic Acids Res, 34(Database issue), D556-561. Bolstad, B. M., Irizarry, R. A., Astrand, M., & Speed, T. P. (2003). A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics, 19(2), 185-193. Cope, L. M., Irizarry, R. A., Jaffee, H. A., Wu, Z., & Speed, T. P. (2004). A benchmark for Affymetrix GeneChip expression measures. Bioinformatics, 20(3), 323-331. Dai, M., Wang, P., Boyd, A. D., Kostov, G., Athey, B., Jones, E. G., et al. (2005). Evolving gene/transcript definitions significantly alter the interpretation of GeneChip data. Nucleic Acids Res, 33(20), e175. Gentleman, R. C., Carey, V. J., Bates, D. M., Bolstad, B., Dettling, M., Dudoit, S., et al. (2004). Bioconductor: Open software development for computational biology and bioinformatics. Genome Biology, 5, R80. Hochreiter, S., Clevert, D. A., & Obermayer, K. (2006). A new summarization method for Affymetrix probe level data. Bioinformatics, 22(8), 943-949. Irizarry, R. A., Bolstad, B. M., Collin, F., Cope, L. M., Hobbs, B., & Speed, T. P. (2003). Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Research, 31(4), e15. Irizarry, R. A., Hobbs, B., Collin, F., Beazer-Barclay, Y. D., Antonellis, K. J., Scherf, U., et al. (2003). Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics, 4(2), 249-264. Irizarry, R. A., Wu, Z., & Jaffee, H. A. (2006). Comparison of Affymetrix GeneChip expression measures. Bioinformatics, 22(7), 789-794. Klipp, E., Herwig, R., Kowald, A., Wierling, C., & Lehrach, H. (2005). Systems Biology in Practice. Wiley-VCH. Li, C., & Wong, W. H. (2001). Model-based analysis of oligonucleotide arrays: expression index computation and outlier detection. Proc Natl Acad Sci USA, 98(1), 31-36. Naef, F., Hacker, C. R., Patil, N., & Magnasco, M. (2002). Empirical characterization of the expression ratio noise structure in high-density oligonucleotide arrays. Genome Biol, 3(4), RESEARCH0018. R Development Core Team. (2005). R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing. Shi, L., Reid, L. H., Jones, W. D., Shippy, R., Warrington, J. A., Baker, S. C., et al. (2006). The MicroArray quality control (MAQC) project shows inter and intraplatform reproducibility of gene expression measurements. Nat Biotechnol, 24(9), 1151-1161.

260

The Affymetrix GeneChip® Microarray Platform

Talloen, W., Clevert, D. A., Hochreiter, S., Amaratunga, D., Bijnens, L., Kass, S., et al. (2007). I/NIcalls for the exclusion of non-informative genes: A highly effective filtering tool for microarray data. Bioinformatics, 23(21), 2897-2902. Wu, Z., Irizarry, R. A., Gentleman, R., Murillo, F. M., & Spencer, F. (2004). A model-based background adjustment for oligonucleotide expression arrays. Journal of the American Statistical Association, 99(468), 909-917(909). Yang, Y. H., Dudoit, S., Luu, P., Lin, D. M., Peng, V., Ngai, J., et al. (2002). Normalization for cDNA microarray data: A robust composite method addressing single and multiple slide systematic variation. Nucleic Acids Research, 30(4), e15.

K ey T erms FARMS: Factor Analysis for Robust Microarray Summarization, a probabilistic latent variable model for summarizing high-density oligonucleotide Affymetrix GeneChip array data at probe level. Gene Expression: Gene expression is the process by which the inheritable information in a gene, such as the DNA sequence, is made into a functional gene product, such as protein or RNA. Microarray: A microarray (also known as gene chip or DNA chip) is a collection of microscopic DNA spots, commonly representing sequence extracts of single genes, arrayed on a solid surface by covalent attachment to a chemical matrix. DNA arrays are commonly used for expression profiling, i.e., monitoring expression levels of thousands of genes simultaneously, or for comparative genomic hybridization. MM: Mismatch, a probe accompanying a PM, where the 13th nucleotide is changed to its complement (A to T, T to A, G to C, C to G). In the Affymetrix GeneChip design MM are spotted along with the PM aiming to measure the non-specific hybridization to the PM. PM: Perfect match, a probe with the true sequence complement of the targeted sequence. Probe: A probe is a fragment of DNA of 25 nucleotides/basepairs length, which is used to detect in RNA samples the presence of nucleotide sequences (the DNA target) that are complementary to the sequence in the probe. The probe thereby hybridizes to single-stranded nucleic acid (DNA or RNA) the base sequence of which allows probe-target base pairing due to complementarity between the probe and target. Probe Set: a set consisting of all probes addressing the transcripts from the same gene. In the Affymetrix GeneChip design the expression level of a gene shall be measured with several probes.

261

262

Chapter XV

Alternative Isoform Detection Using Exon Arrays Jacek Majewski McGill University and Genome Québec Innovation Centre, Canada David Benovoy McGill University and Genome Québec Innovation Centre, Canada Tony Kwan McGill University and Genome Québec Innovation Centre, Canada

abstract Eukaryotic genes have the ability to produce several distinct products from a single genomic locus. Recent developments in microarray technology allow monitoring of such isoform variation at a genome-wide scale. In our research, we have used Affymetrix Exon Arrays to detect variation in alternative splicing, initiation of transcription, and polyadenylation among humans. We demonstrated that such variation is common in human populations and has an underlying genetic component. Here, we use our study to illustrate the use of Exon Arrays to detect alternative isoforms, to outline the analysis involved, and to point out potential problems that may be encountered by researchers using this technology.

INTR OD UCTI ON Alternative pre-mRNA splicing is a process allowing the production of several distinct gene isoforms from a single genomic locus. The most common type of alternative splicing events in mammals results in cassette exons, where each such exon can be either included or excluded from the mature mRNA. Other events include alternative use of donor or acceptor splice sites, and intron retention. In addition, processes such as alternative promoter usage and alternative polyadenylation, resulting in differences in initiation and termination of the transcript, respectively, further diversify eukaryotic transcriptomes and proteomes. Such processes have been suggested to be at least partly responsible for mammalian Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Alternative Isoform Detection Using Exon Arrays

complexity, which is otherwise difficult to explain in view of our relatively low number of genomic loci - less than 25,000 genes in humans, versus approximately 20,000 in the nematode worm C. elegans (Claverie, 2001). It is estimated that a high percentage of mammalian genes is alternatively spliced, and this frequency is highest in specialized and complex tissues, such as the brain and the liver. Differences in splicing patterns have been shown to exist across species, and within populations of the same species. In humans, splicing defects are known to result in numerous genetic disorders (Faustino & Cooper, 2003) and may confer susceptibility to complex genetic diseases. Thus, the process of alternative splicing attracts the interest of researchers across the entire biomedical sciences spectrum, ranging from evolutionary biology, through development, to medicine. In recent years, alternative transcript investigation in a genome-wide context has been carried out using expressed sequence tag libraries (ESTs). Generally, ESTs (short cDNA sequence reads) are mapped to the genomic sequence, and different isoforms can be inferred from incongruence of splicing patterns (Modrek, Resch, Grasso, & Lee, 2001). However, EST library analyses are prone to sequencing errors, biased towards highly expressed genes, and influenced by cancer-derived ESTs, which may not generally be present in healthy tissues. More recently, microarray platforms have been proposed as a tool for studying gene expression at the isoform level (Black & Graveley, 2006; Lee & Roy, 2004; Zhang et al., 2006). Splicing sensitive microarrays employ a number of exon body oligonucleotide probes, or exon junction probes, or a combination of the two designs, to determine mRNA levels at the resolution of a single exon or splice site. The Affymetrix GeneChip® Human Exon 1.0 ST Array is the first commercially available microarray product designed for genome-wide, exon level expression analysis. The array relies on targeting multiple probes to individual exons and allows simultaneous, exon-level detection of expression intensity for 1.4 million probesets covering over 1 million known and predicted human exons. The Exon Array is a flexible tool, which can be used to perform the function of classical expression arrays and concurrently provide supplementary information on isoform changes. However, because of the complexity of the design, statistical analysis of the data becomes much more intensive, both at the theoretical and computational level. The simplest illustration is the multiple testing problem; whereas in classical expression arrays the number of tests is of the order of the number of genes, in an exon array, the number of tests is over ten-fold higher – and can vary between a few hundred thousand to over 1 million (if computationally predicted exons are included). The statistical approaches need to be able to distinguish between whole gene expression differences and isoform differences, which introduces a new level of complexity. The robustness of measurement is also an issue, since the exon array has on average four probes per probeset, whereas Affymetrix expression arrays relied on more than 10 probes per probeset to estimate expression. In our lab, we have used the Exon Arrays, to investigate differences in splicing patterns among humans. We were able to demonstrate the existence of common variation in splicing, polyadenylation sites, transcription initiation. We also demonstrated genetic linkage and allelic association of the isoform variation to common genetic single nucleotide polymorphisms (SNPs). Our results show that the effects of genetic variants on gene expression are much more complex than previously believed, and constitute an important step towards understanding the functional consequences of such variation. In this chapter, we will use our experiments as a case study, in order to outline the flow of the analysis required to process Exon Arrays. We will also outline problems which may be encountered by potential users of the chips, and describe solutions which we have developed to overcome such problems. We will discuss current advances in statistical analysis and propose future improvements to optimize both the array design and statistical solutions. 263

Alternative Isoform Detection Using Exon Arrays

MICR OARRAY DESIGN The Exon Array relies on patented Affymetrix technology to provide 5.4 million 25-mer oligonucleotide probes on a single chip. Probes target individual exons, or portions of an exon when prior evidence of alternative splicing exists. Each such potential “splicing unit” is represented by at least one probeset, and each probeset consists, on average, of four individual probes (Figure 1). It should be noted that because of the small size of some exons and limitations in probe placements, many probes within a probeset are overlapping and thus not independent. The array annotation consists of 3 levels: core, extended, and full. The core probesets represent the highest level of annotation confidence; they are supported by RefSeq and GenBank evidence. There are 284,000 core probesets on the array. The extended and full annotations represent less confidently annotated exons, with support from ESTs and comparative genomics, but also de novo gene prediction algorithms. In total there are over 1.4 million probesets interrogating approximately 1 million known and predicted exons. While the extended and full gene annotations have the potential to identify novel exons and transcript variants (Siepel et al., 2007), we expect that most studies will concentrate on the high confidence core annotations. This will greatly limit false positive discovery rates and allow labs to fine-tune their analysis techniques. We recommend that the non-core probesets only be considered by more experienced researchers or in case of follow up analyses targeted to specific transcripts. One significant departure from earlier Affymetrix designs is the absence of mismatch probes. Mismatch probes have previously been used to estimate background hybridization noise levels. Instead, the Exon Array uses a large number of “antigenomic” probes, which do not have a match anywhere in the genome and ideally represent a null signal. Antigenomic probes are grouped by their GC content and used to produce a Detection Above Background (DABG) p-value. A p-value below 0.05 may be used as an indication that a given probe, probeset, or metaprobeset is expressed. It is important to note that, while the Exon Array design targets the entire genome, certain splicing changes are virtually impossible to detect using a purely exon-targeted approach. As an example, if a minor (rare) isoform of a transcript skips a certain exon, even large (several fold) increases in the level of that isoform may not significantly impact the overall mRNA levels of the exon. Such splicing variants would be much more efficiently detected using “junction-arrays” which target their probes to specific exon-exon junctions. However, junction arrays can only target a limited number of junctions (because of the high number of possible combinations) and cannot monitor every hypothetical alternative splicing event. Thus, in order to target every known or predicted exon in the genome, the Exon Array sacrifices sensitivity to certain types of rare isoform changes.

ST UDY DESIGN Genetically controlled variation in gene expression has recently been shown to be common in human populations, and it is believed to be responsible for phenotypic variability and susceptibility to complex diseases (Cheung et al., 2005; Spielman et al., 2007; Stranger et al., 2005). We have a much poorer understanding of the variability at the level of specific transcript isoforms, such as differences in transcription initiation, splicing, and polyadenylation. Despite isolated examples of such differences, to date, no genome-wide studies have been carried out to determine their prevalence and potential impact. We designed a pilot experiment, to investigate the effectiveness of the Exon Array in detecting splicing

264

Alternative Isoform Detection Using Exon Arrays

Figure 1. A. Schematic for coverage of probesets across the entire length of the transcript. Light regions correspond to exons, whereas dark regions represent introns. The short dashes underneath the exon regions indicate individual probes of 25 nucleotides in length representing the probeset. B. Flow chart for processing and analysis of chips to validation of alternative splicing events. Total RNA is extracted from the two cell lines (n=15 replicates per individual) and is transcribed to cDNA and labelled with biotin. The total cDNA is then hybridized to the exon chip, followed by washing and staining with an anti-streptavidin antibody. Chips are then scanned and hybridization data is processed and analyzed by the Affymetrix Power Tools software package. A splicing index is calculated and candidate statistically significant differential splicing events are selected using an unpaired t-test. A subset of alternative splicing events predicted between the two are then validated by: 1) reverse transcriptase-polymerase chain reaction (RT-PCR) using exon body primers flanking the probeset of interest; and 2) sequencing of the RT-PCR products (reprinted from Kwan et al., 2007).

265

Alternative Isoform Detection Using Exon Arrays

differences among humans by comparing RNA extracted from lymphoblastoid cell lines of two different individuals, and further observing inheritance of the splicing patterns within their families. For the continuation of this study, we used cell lines from 60 unrelated individuals of Northern European descent that have been earlier genotyped for approximately 4 million SNPs by the International HapMap Project (Altshuler et al., 2005). Each cell line was grown in triplicate, in order to minimize stochastic effects of cell growth conditions. RNA was isolated from the cells using standard protocols, and the three “biological replicates” for each individual were used for hybridization. Since all genotypes were already known, we were then able to use the resulting exon-level expression measurement as a quantitative phenotype, and carry out allelic association analysis. Briefly, at each genetic marker the genotypes were coded as 0, 1 or 2, with the heterozygous genotype always given the value of 1. The quantitative phenotype was then regressed on the genotype, and statistical significance and magnitude of the genetic effect were estimated from the regression analysis (Figure 4).

ANA LYSIS All of our microarrays were hybridized and scanned at the Micorarray Platform at McGill University and Genome Quebec Innovation Centre. We used standard protocols, with an enhanced RiboMinus treatment step to improve the reduction of ribosomal RNA. The raw hybridization intensity data was obtained in the form of .cel files. These files can be analyzed using most available microarray software. In our study, we used the Affymetrix Power Tools software package (Affymetrix). The general quality control procedures, such as visual inspection and multivariate analyses aimed at outlier detection (e.g. PCA plots), are common to all microarray analyses and will not be described in detail. Any defective or suspected outlier arrays should be removed from further analyses. The first step of subsequent statistical analysis consists of “normalization”. This step attempts to control for the “chip effect”, which may be caused by slight differences in RNA hybridized to each array or differences across production batches of arrays (if possible, these should be avoided before setting up the experiment). We use the quantile normalization method (Irizarry et al., 2003), which assumes that the distribution of signal intensities across all arrays should be identical. Normalized probe intensities are then “summarized” into a single measurement. Again, this can be carried out using established techniques developed for general microarray use, such as RMA (Irizarry et al., 2003) or PLIER (Affymetrix). However, it is at this stage that the analysis of Exon Arrays acquires its own flavour. The exon array data is summarized at two levels: the probeset level (roughly corresponding to the expression of each exon), and the metaprobeset level (corresponding to an entire transcript). The probeset level signal is obtained by combining an average of four probes per exon. Hence, this signal may be quite noisy. The metaprobeset signal combines the data from all exons within a gene and is thus more robust. However, alternative splicing within a gene may affect the metaprobeset summary and result in erroneous differences in transcription level estimates. This is particularly true for genes with few exons. Both PLIER and RMA claim robustness with respect to rare aberrant signal – e.g. caused by unresponsive of cross-hybridizing probes, or rare alternative exons – and currently we do not filter out such probes. However, to further improve the analysis, algorithms have been suggested to pre-filter inconsistent probes before the summarization step (Xing, Kapur, & Wong, 2006). As a principle, we recommend log-transforming all summary expression levels in order to stabilize the variance.

266

Alternative Isoform Detection Using Exon Arrays

One of the biggest challenges in detection of alternative splicing using Exon Arrays is the deconvolution of splicing and transcription. A simple comparison of probeset intensities across samples is not sufficient; if an exon belongs to a transcript that is differentially expressed, the examination of a single exon out of its genomic context will lead to an incorrect conclusion. A very simple and intuitive solution to this problem is the use of the Splicing Index (SI), which is calculated by simply dividing the probeset intensity by the metaprobeset intensity (i.e. exon expression/gene expression), after the addition of a stabilization constant to both the probeset and metaprobeset scores. This simple procedure normalizes the expression level of each exon and accounts for any possible gene expression differences between samples. However, we find that the splicing index has some undesirable statistical properties (arising from large errors in the estimates in both the numerator and the denominator) as well as being prone to methodological artefacts, and should be used with caution. Thus, we have also used a simpler, but more labour intensive method, of carrying out the entire analysis at the probeset level, and relying on visualization and manual curation of the results in order to distinguish splicing and expression differences between samples. While more robust statistical approaches are being developed, we strongly advocate visualization of results in the context of genome annotation and EST evidence in order to filter out false positive signals. We have relied on custom scripts and modifications of the UCSC and ENSEMBL genome browsers, but commercial packages for the Exon Arrays are also available (e.g. Partek Genomics Suite).

RES ULTS T wo S ample C omparison This is the simplest microarray study design. Generally, the two samples may correspond to two different tissues, healthy and affected, or treated and untreated material. In our pilot study, we used RNA extracted from two cell lines originating from two different individuals (Kwan et al., 2007). To analyze splicing differences between the two samples, an unpaired Student’s t-test was performed using the logtransformed SI values of each probeset for 15 replicates (3 biological replicates x 5 technical replicates) of each individual (R statistical package, version 2.3.0). Probesets showing significantly different SI scores were ranked by p-value or fold-change. During the course of the data analysis, we discovered that many pre-processing steps needed to be performed on the SI results, in order to limit false positive rates.

Effect of SNPs We found the primary source of false positives to be the effect of SNPs on probe hybridization levels (Figure 2). A single mismatch in a cDNA sequence can totally prevent the hybridization of the cDNA to its probe (Alberts et al., 2007). Since each probeset consists of only four probes, and a SNP can affect all four overlapping probes in some of the probesets, the final effect of SNPs on genetically heterogeneous samples is substantial. We discovered that the most statistically significant candidate exons were highly enriched in SNP-containing, overlapping probes. A vast majority of those candidates could not be validated using RT-PCR. This effect was easy to verify in our dataset, since the HapMap samples have been thoroughly genotyped and in most cases the mismatch substrate is known before hand, but this may not be the case in many other studies. In our analysis, we conservatively masked (removed

267

Alternative Isoform Detection Using Exon Arrays

Sample A

Sample B

t = -1.057, p-value = 3.0e-0

Probeset_id: 2748252 (mask)

Sample A

Sample B

t = ., p-value = 3.0e-0

.

Sample A Sample B

ATTTGGGCTTCGGGATCACGTGGAC CTTCGGGATCACGTGGACGAGGTGT

Sample A Sample B

Probe_id: 00

.

Probe_id: 000

SNP

Sample A Sample B

Probe_id: 0

t = ., p-value = .1e-0

.

t = -1., p-value = .e-02

Probeset_id: 2748252 (unmask)

b.

log2(probeset intensities)

GAAACACCACGTCTTGGGCAGGAGA CAGGAGAACCGGCCAGAGGAACGTC

.

. .

.

.

0.0

Sample A Sample B

.

.

Probe_id: 

0.

.

t = -0.0, p-value = .e-01

.

.

0.0

.

.

0.0

0.

0.

log2(probe intensities)

a.

.

.

268

.

t = ., p-value = .3e-08

Figure 2. The effect of SNPs of probe hybridization leads to false positive results. A. The box plots show differences in expression between 4 probes belonging to probeset 2748252. The probe sequences and relative positions are shown under the plots. Two overlapping probes are affected by a single SNP, rs11549015, and show highly statistically significant reduction in intensity in the individual carrying the mismatch allele. B. The probeset 2748252 appears as differentially included in the transcripts of the two individuals (left panel). However, this effect disappears after masking the probes overlapping the SNP (right panel).

Alternative Isoform Detection Using Exon Arrays

from the analysis) all probes containing known SNPs. While this procedure led to a slight reduction of the available data, it drastically reduced false positive rates. We recommend that this procedure should be followed in experimental setups where samples are genetically heterogeneous (e.g. cancer patients). However, the presence of SNPs should not be a problem in cases where different tissues from the same patient or pooled RNA samples are being studied.

Dataset Reduction In order to reduce the amount of random noise, and decrease the number of tests being carried out, it is useful to exclude all genes which are either not expressed in all of the samples, or more than one of the samples being compared. Such genes, by definition cannot be alternatively spliced across samples. There is currently no reliable procedure on deciding whether a gene is expressed or not, and Affymetrix recommends using an ad hoc expression value of 15, and some additional filters using DABG values of individual exons.

Effect of “Dead” Probesets A probeset which is not expressed – e.g. an exon which is skipped – in all samples under investigation may produce a false positive signal in the splicing index, in the presence of transcript-level variation. All non-responsibe probesets should be removed from the analysis. A DABG-based criterion may be used here, e.g. DABG p-value < 0.05 in at least 50% of the samples.

Additional Filtering Steps Based on the experience of our group and many other researchers using the Exon Arrays, Affymetrix now recommends a number of data filtering steps, which can be found at the company website (www. affymetrix.com).

Splicing Differences We applied three different methods for multiple testing correction. The Bonferroni correction, obtained by dividing the nominal p=0.05 threshold by the total number of probesets yields the most conservative cut-off (p-value=3.159e-7), yielding 1892 candidate probesets (1.2% of expressed ‘core’ probesets) showing differential splicing between the two samples. The false discovery rate (FDR) (Storey & Tibshirani, 2003) at a 0.01 significance level provided the least conservative estimate (p-value=8.915e-4) with 8771 (5.7%) potential splicing events. We also used an empirical null distribution of p-values from the observed data, by shuffling the SI scores for all samples of each probeset (Churchill & Doerge, 1994). At the p=0.05 level, this method estimates 4020 (2.6%) differentially spliced probesets between the two individuals. A small subset of 20 candidates was subjected to validation by RT-PCR using a pair of primers in distinct exons flanking the predicted differential splicing events. We were able to confirm alternative isoforms for 9 of the transcripts, which translates into a 45% validation rate. However, our study evaluates the ability of this microarray technology to identify alternative AS events de novo in genetically diverse populations. Restricting our candidates to those showing EST and cDNA evidence of alterna-

269

Alternative Isoform Detection Using Exon Arrays

tive splicing in sequence databases reduces the number of cases from 20 to 12, thereby increasing our success rate to 60% (7 out of 12). As noted earlier, the Exon Array can be used as a de novo discovery platform for alternative splicing, or it can be targeted to the more confident, previously observed events, either by using only the core exons or further limiting the analysis to EST-supported alternative exons. If used as a discovery tool, the false discovery rates will invariably increase, but the benefit of detecting novel events may sometimes outweigh the cost. Judging by our experience, and the experience of other groups, the false positive rates of this platform will generally be non-negligible and may be of the order of 50%. We recommend thorough independent (PCR, Northern blot) validation of the most interesting results.

Heritability of Splicing Differences One of our hypotheses was that differences in splicing between individuals may be heritable, i.e. they have a genetic component. Hence, we carried out genetic linkage analysis within the family of the two tested individuals, using the SI of the 9 validated exons as a quantitative trait. We confirmed linkage to cis-acting SNPs (heritability) for three of the nine exons (Figure 3), and for two of them we were able to identify the SNPs affecting their extended splice-site consensus sequences.

Multiple S ample A nalysis Following the above pilot study, we carried out a full-scale investigation of splicing and isoform level variation in a human population, using cell lines from 60 unrelated CEU HapMap individuals (Kwan et al., 2008). This setup is illustrative of other designs often encountered in microarray experiments, where data subdivided into multiple classes is analyzed simultaneously. In contrast to the two-sample design, ANOVA or regression analysis is used instead of a t-test to detect differences among samples. In our case, we assumed an underlying co-dominant genetic model, where each SNP allele is associated with preferential expression of a distinct isoform. Hence, the heterozygous SNP genotype has an effect intermediate to the two homozygotes, and a linear regression approach is the logical choice (Figure 4). In this part of the study, we decided not to use the splicing index, but rather carry out the entire analysis at the probeset (exon) level. After the filtering steps outlined above, we identified all probesets exhibiting significant association between expression levels and cis-acting SNP genotype. The statistical cut-offs were established using permutation testing and a 0.05 FDR level. Cis-acting SNPs were defined by their proximity within 50kb of the probeset tested. We used a semi-automated classification method, to decide whether a significant association represented an alternative splicing, alternative transcription start, alternative polyadenylation, or whole transcript expression change. This was performed using a simple script which grouped all significant probesets together (in cases where they belonged to a single transcript), determined their location within the transcript (internal, 5’ or 3’) and tested whether the whole gene or just individual exons were significantly associated with the SNP genotype (expression or isoform difference). In addition, we examined all the candidate events by eye, in relation to their genomic context, EST, and mRNA evidence, in order to determine the final classification of isoform differences. Although this may seem like an ad hoc and laborious process, thorough visualization of 324 candidate genes obtained from this analysis was carried out in our lab in a matter of days. It is a relatively minor effort compared to the cost and labour required to set up most microarray studies, and we believe that

270

Alternative Isoform Detection Using Exon Arrays

Figure 3. Inheritance of alternative splicing for genes A. OAS1, B. CRTAP, and C. CAST. Left panel shows pedigree structure of CEPH/UTAH family 1444 with the autosomal dominant inherited splice pattern as blue symbols. Haplotypes for each of the eight founder chromosomes are labelled A, B, C, D, E, F, G, and H, and the two inherited haplotypes of each family member are indicated within the symbol. The regulatory haplotype is shown as bold white text. Squares represent males and circles represent females. The right panel shows the two transcript isoforms of the genes. Exon-body primers are shown above the flanking exons of the predicted alternatively spliced exons. Shown below the transcript isoforms are the RT-PCR results. Lanes are numbered from 1-14 according to the pedigree on the left (reprinted from Kwan et al., 2007).

it’s the most effective approach currently available to create a highly confident result set. Some examples of the observed variants are shown in Figure 5. Complete results of this study may be retrieved from our website (www.regulatorygenomics.org). In order to further limit false positives, we also sequenced in multiple individuals 83 candidate events which were supported by a single probeset, and where all

271

Alternative Isoform Detection Using Exon Arrays

Figure 4. Analysis steps from identification of a significant probeset in the PARP2 gene to validation. A. Linear regression analysis of expression scores for probeset 3527423 with genotypes of SNP rs4981998, giving a p-value of 2.81x10-30. B. Visualization of probeset 3527423 in the context of all other probesets belonging to the same transcript (metaprobeset 3527418). For each probeset, the significance level (p-value) is indicated by the grey line, along with fold change expression between the mean scores of the two homozygous genotypes (meanTT / meanCC) shown as vertical bars. The solid horizontal grey and black lines represent the significance and fold change expression for the regression analysis at the metaprobeset level against SNP rs4981998. Probeset 3527423 is indicated by an arrow. C. RT-PCR validation of probeset 3527423 using flanking exon-body primers. D. Schematic of 5’ end of two isoforms of PARP2 with Exon Array probesets shown below the exons. The significant probeset 3527423 corresponds to alternative 5’ splice site usage resulting in a larger 2nd exon for NM_005484 (reprinted from Kwan et al., 2008).

probes overlapped and could potentially be affected by a single SNP. As a result of this re-sequencing and discovery of previously un-annotated SNPs, we excluded 27 probesets from further analysis. Again, we proceeded to validate a subset (32) of our candidate events. Putative alternative splicing events were validated using a simple end-point RT-PCR, while promoter and poly-adenylation changes were tested using real time SYBR® Green PCR (Applied Biosystems, Foster City, CA, USA) RT-PCR. We successfully validated 25 of the 32 events. We consider the resulting validation rate (78%) to be extremely high for this type of study. However, this reflects the large amount of processing: statistical (filtering etc.), manual (visualization), and laboratory work (additional sequencing), which contributed to the final dataset.

272

Alternative Isoform Detection Using Exon Arrays

Figure 5. Examples of different types of transcript isoform events observed. Each plot corresponds to a transcript, and each data point to an individual probeset. A. Gene expression level changes of LRAP, including alternative splicing of a cassette exon. B. Differential 3’ UTR change of ARTS-1 resulting in long and short isoforms with alternative stop codon usage. C. Expression of two TCL6 transcript isoforms that contain different 5’ and 3’ ends. D. Increasing significance and fold change expression levels towards the 3’ end of the CCT2 gene, suggesting genetic variation associated with mRNA stability (reprinted from Kwan et al., 2008).

C ONC LUSI ON B iology Alternative splicing is rapidly being recognized as an important mechanism regulating numerous biological processes. Identification of alternative splicing and alternative isoform expression provides us with a new venue in understanding the diversity and the complexity of the human genome. Several recent studies have demonstrated the presence of variation in gene expression levels among humans. Furthermore, such variation has been shown to have a genetic basis. It is believed that these expression differences among individuals may be responsible for downstream phenotypic differences, including susceptibility to genetic disorders. In our research, we show that, in addition to gene expression level differences, a significant amount of variation affects the types of isoforms being expressed. This variation also has a strong genetic component, and hence, the effect of common genetic variation in humans is much more complex than previously believed. In fact, we show that the effect of SNPs on isoform expression (initiation, splicing, and termination), is at least as common as the effect on overall levels

273

Alternative Isoform Detection Using Exon Arrays

of gene expression. The downstream phenotypic effects are likely to be substantial; some associations with genetic disorders already exist, e.g. a 3’UTR variant of the IRF5 gene has recently been associated with susceptibility to lupus (Reddy et al., 2007). The full extent of the effects of isoform variants will be revealed in the near future.

T echnology Historically, our understanding of alternative splicing has been limited to individual laboratory experiments. Analysis of EST libraries provided the first glimpse into the genome-wide extent of this phenomenon. Splicing-sensitive micorarrays now place the genome-wide analysis into the hands of individual researchers. The Exon Array is the first commercially available tool offering whole-genome coverage, in theory targeting all possible alternative splicing events. Our research, and studies from several other groups (Clark et al., 2007; Yeo et al., 2007) prove that the Exon Array can indeed be used to detect alternative splicing and isoform differences in a variety of systems. We are very excited by this technology and are currently applying it in several experimental settings. However, several words of caution should be given. This is not yet an “out of the box” product. A large number of pre- and postprocessing steps are necessary. Data should be filtered to remove systematic artefacts, such as the effect of SNPs, unresponsive, cross-hybridizing, or saturated probes. Final results must be carefully inspected to determine the type of splicing or isoform event represented by the signal, and whether the signal makes sense in the context of the gene structure or is likely to be a false positive. No automated methods currently exist to perform those steps, and it is unlikely that such a process can be fully automated. Even given specialized visualization tools, such as custom versions of genome browsers or commercial software, the researcher must expect to spend a large amount of time pouring over the final data, rather than simply obtaining a list of genes. Given the massive amount of data produced, false positive results will remain a problem. This may be partially alleviated by development of more appropriate statistics and optimizing array design, but the basic multiple testing problem cannot be avoided. If limiting false positives is a priority, researchers may like to narrow their analysis to a subset of the data by focusing on events only supported by prior data (ESTs) or genes involved in certain biological processes.

F UT URE DIRECTI ONS Whole-genome analysis of alternative splicing has been made possible largely due to recent technological advances, allowing cost-effective manufacture of oligonucleotide microarrays able to interrogate millions of probe sequences. The Exon 1.0 ST Array is the first generation comprehensive splicing array. The current design reveals enormous potential, but also some limitations of the design. The next generation splicing microarrays are likely to combine exon body probes with junction probes. This step should improve the sensitivity and allow of detection of additional types of isoform changes. We foresee that in parallel with the development of appropriate statistical and visualization methods, splicing-sensitive microarrays will facilitate major breakthroughs in investigations of splicing and isoform variations in the coming years. Looking ahead to a more distant future, we expect that high-throughput parallel sequencing will soon become competitive with microarray technology, and may eventually surpass it as a genomewide transcriptome profiling tool. Several groups are currently optimizing parallel sequencing based

274

Alternative Isoform Detection Using Exon Arrays

gene expression analyses. With coverage currently reaching 2 billion bases per sequencing run, these methods are likely to produce first results within one or two years. However, in order to simultaneously monitor all splice junctions in a quantitative manner, sequencing coverage will have to reach levels at least 10-fold higher than those necessary for gene expression level analysis. Sequencing-based analysis of alternative splicing will ultimately resemble prior EST-based techniques, where short sequence reads will be aligned to the genome, and the presence and frequency of alternative splicing will be determined by counting the splice variants.

REFERENCES Alberts, R., Terpstra, P., Li, Y., Breitling, R., Nap, J. P., & Jansen, R. C. (2007). Sequence polymorphisms cause many false cis eQTLs. PLoS ONE, 2, e622. Altshuler, D., Brooks, L. D., Chakravarti, A., Collins, F. S., Daly, M. J., Donnelly, P., et al. (2005). A haplotype map of the human genome. Nature, 437(7063), 1299-1320. Black, D. L., & Graveley, B. R. (2006). Splicing bioinformatics to biology. Genome Biol, 7(5), 317. Cheung, V. G., Spielman, R. S., Ewens, K. G., Weber, T. M., Morley, M., & Burdick, J. T. (2005). Mapping determinants of human gene expression by regional and genome-wide association. Nature, 437(7063), 1365-1369. Churchill, G. A., & Doerge, R. W. (1994). Empirical threshold values for quantitative trait mapping. Genetics, 138(3), 963-971. Clark, T. A., Schweitzer, A. C., Chen, T. X., Staples, M. K., Lu, G., Wang, H., et al. (2007). Discovery of tissue-specific exons using comprehensive human exon microarrays. Genome Biol, 8(4), R64. Claverie, J. M. (2001). Gene number. What if there are only 30,000 human genes? Science, 291(5507), 1255-1257. Faustino, N. A., & Cooper, T. A. (2003). Pre-mRNA splicing and human disease. Genes Dev, 17(4), 419-437. Irizarry, R. A., Hobbs, B., Collin, F., Beazer-Barclay, Y. D., Antonellis, K. J., Scherf, U., et al. (2003). Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics, 4(2), 249-264. Kwan, T., Benovoy, D., Dias, C., Gurd, S., Provencher, C., Beaulieu, P., et al. (2008). Genome-wide analysis of transcript isoform variation in humans. Nature genetics, Published online: 13 January 2008 Kwan, T., Benovoy, D., Dias, C., Gurd, S., Serre, D., Zuzan, H., et al. (2007). Heritability of alternative splicing in the human genome. Genome Res, 17(8), 1210-1218. Lee, C., & Roy, M. (2004). Analysis of alternative splicing with microarrays: successes and challenges. Genome Biol, 5(7), 231. Modrek, B., Resch, A., Grasso, C., & Lee, C. (2001). Genome-wide detection of alternative splicing in expressed sequences of human genes. Nucleic Acids Res, 29(13), 2850-2859.

275

Alternative Isoform Detection Using Exon Arrays

Reddy, M. V., Velazquez-Cruz, R., Baca, V., Lima, G., Granados, J., Orozco, L., et al. (2007). Genetic association of IRF5 with SLE in Mexicans: higher frequency of the risk haplotype and its homozygozity than Europeans. Hum Genet. Siepel, A., Diekhans, M., Brejova, B., Langton, L., Stevens, M., Comstock, C. L., et al. (2007). Targeted discovery of novel human exons by comparative genomics. Genome Res, 17(12), 1763-1773. Spielman, R. S., Bastone, L. A., Burdick, J. T., Morley, M., Ewens, W. J., & Cheung, V. G. (2007). Common genetic variants account for differences in gene expression among ethnic groups. Nat Genet, 39(2), 226-231. Storey, J. D., & Tibshirani, R. (2003). Statistical significance for genomewide studies. Proc Natl Acad Sci USA, 100(16), 9440-9445. Stranger, B. E., Forrest, M. S., Clark, A. G., Minichiello, M. J., Deutsch, S., Lyle, R., et al. (2005). Genome-wide associations of gene expression variation in humans. PLoS Genet, 1(6), e78. Xing, Y., Kapur, K., & Wong, W. H. (2006). Probe selection and expression index computation of Affymetrix Exon Arrays. PLoS ONE, 1, e88. Yeo, G. W., Xu, X., Liang, T. Y., Muotri, A. R., Carson, C. T., Coufal, N. G., et al. (2007). Alternative splicing events identified in human embryonic stem cells and neural progenitors. PLoS Comput Biol, 3(10), 1951-1967. Zhang, C., Li, H. R., Fan, J. B., Wang-Rodriguez, J., Downs, T., Fu, X. D., et al. (2006). Profiling alternatively spliced mRNA isoforms for prostate cancer classification. BMC Bioinformatics, 7, 202.

K ey T erms Allelic Association: A statistical association of a genetic marker allele with a phenotypic trait. Here, we use association analysis to detect SNPs statistically correlated with changes in isoform-level expression. While association does not directly imply causation, it is highly likely that a causative genetic variant is in linkage disequilibrium with the significant SNP marker. Alternative Splicing: A mechanism which results in the production of several mRNA variants from a single genomic locus, by preferential inclusion or exclusion of certain splice sites or exons. EST: Expressed sequence tag. Short sequence reads are produced on large scale from cDNA libraries. EST sequencing allowed quantification of known transcripts, detection of novel genes, and novel isoforms. Exon Array: A type of microarray using probes targeted to individual exons within each gene. Exon Arrays may be used to measure the expression of an entire transcript, but also detect higher level changes, such as alternative splicing and other transcript isoform differences. Pre-mRNA Splicing: A process which removes intronic sequences from the precursor messenger RNA of eukaryotic genes, to produce mature messenger (m)RNA.

276

Alternative Isoform Detection Using Exon Arrays

Isoform: In the context presented here, an isoform is one of the transcript variants produced by each locus. A gene isoform can result from alternative splicing, alternative transcription initiation, or polyadenylation. SNP: Single nucleotide polymorphism. SNPs are single base pair mutations which have been driven to detectable frequencies in human populations. On average, two human individuals will differ at 1 polymorphic site for each 1000 bp of DNA. Vast majority of the SNPs are likely to be neutral, but some may affect phenotypic traits.

277

278

Chapter XVI

Gene Expression in Microbial Systems for Growth and Metabolism Prerak Desai Utah State University, USA Bart Weimer Utah State University, USA

abstract The use of systems biology to study complex biological questions is gaining ground due to the ever-increasing amount of genetic tools and genome sequences available. As such, systems biology concepts and approaches are increasingly underpinning our concept of microbial physiology. Three tools for use in functional genomics are gene expression, proteomics, and metabolomics. However, these tools produce such large data sets that we sometimes become paralyzed trying to merge the data and link it to form a consistent biological interpretation. Use of functional groupings has relieved some of the issues in merging data for biological meaning. Statistical analysis and visualization of these multi-dimension data sets are needed to aid the microbiologist, which brings additional methods that are often not familiar. Progress is being made to bring these diverse data types together to understand fundamental metabolic processes and pathways. These efforts are paying tremendous dividends in our understanding of how microbes live, grow, survive, and metabolize nutrients. These insights allow metabolic engineering to progress and allow scientists to further define the mechanisms of metabolism.

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Gene Expression in Microbial Systems for Growth and Metabolism

Intr od ucti on Systems biology brought a great challenge to the microbial world – produce genome-scale data that is integrated into a complete biological picture using specific genes. In spite of this challenge, systems biology is increasingly underpinning our concept of microbial physiology based on genome sequence. Initially, production of a genome sequence limited implementation of this paradigm. However, the rate at which new genome content is accumulating is staggering and is the basis of new avenues for discovery. Publicly available genome sequence now exceeds 700 finished genomes with an additional 1,700 genomes in process of sequencing that provides access to at least 3,600 individual microbial genomes with an additional 116 metagenome projects underway (GOLD, 2008; www.genomeonline.org). These projects are challenging scientists’ ability to collect, process, and overlay a biologically meaningful interpretation of the data. Application of that information to make biologically informed decisions is also a daunting challenge that requires a fresh perspective and new skill sets that leverage genomic-based tools to answer specific biological questions. The heart of the systems biology discovery lies in the new fields of comparative and functional genomics, along with proteomic and metabolite profiles (Fields, 2000). Comparison of genomes to assess the link between structural similarity and functional expression is fully enabled with access to genome content. Comparative analyses of bacterial genomes provide new information about the dynamic interchange of DNA between microbes (Hughes, 2000). Comparing sequenced genomes is an excellent approach to explore genome plasticity and how it impacts the metabolism of microbes. Approaching microbial metabolism from a systems biology perspective is a new position that requires scientists to think of systems of activities that is composed of multiple individuals to carry out those activities. Use of gene ontologies and (GO) and clusters of orthologous groups (COG’s) are very helpful for this aspect of comparison since specific and common terms are used in a hierarchical classification system, and are essential when using functional genomic tools to drill down to individual conversations (i.e. activities). These tools include gene expression profiling, protein expression profiling, metabolomics profiles, and new statistical methods. Functional genomics must incorporate data from each set of tools to examine how organisms utilize the genome potential (via gene expression initially). Since most genomes have thousands of genes that are monitored the task is like trying to monitor all the individual conversations in a crowded stadium at one moment in time. In essence, functional genomics documents a cell’s many “conversations” as they occur simultaneously. The conversations are defined by genes expression (gene arrays), protein interactions (proteomics), and small molecule biochemistry (metabolomics) that create a multi-dimensional view of the cell. Deciphering these conversations in turn outlines the web of actors in the metabolic networks, providing an unprecedented view of how a living cell carries out the many functions of growth, survival, pathogenicity, and metabolism. Production of multi-dimensional data using these techniques produce very different types of data that need a common thread that links the data types. Such large data sets lead to an interpretational paralysis that limits the linkage between the functional genomics data and biological relevance or meaning. Therefore, the analytical phase must seek to fully integrate all of these tools using new statistical tools that are also unfamiliar to most microbiologists, which often exacerbates interpretation difficulties when the genotype and the phenotype are at odds. Taken together, it is clear that the use of bioinformatics is essential for mining genome content, but also essential to provide bring new scientific abilities that truly bring biologically meaningful insights via systems biology.

279

Gene Expression in Microbial Systems for Growth and Metabolism

S ystems

B iology and Micr obes

Systems biology brings a new perspective to the life sciences generally, but has specific impact on microbiology due to the nature of the rapid evolution and small genome that is the essence of a microbe. Due to the small genomes in microbes, they lend themselves well to rapid, short-term sequencing efforts because they have limited complexity. Often only a single small circular chromosome with limited extrachromosomal DNA (i.e. plasmids) is found microbes, as compared to eukaryotic organisms that contain multiple chromosomes that are very complex and significantly larger than microbes. Due to the general ease of sequencing microbes the number of microbes projects around the world exploded with isolates coming from various ecologies, including unique environmental organisms and human pathogens (see NCBI-www.ncbi.nlm.nih.gov/genomes/lproks.cgi for a complete listing). This in part is driving the doubling of NCBI’s database every 18 months (Pennisi, 2003). The genome sizes range from 13.03 Mb from the myxobacterium Sorangium cellulosum to 0.16 Mb from the obligate endosymbiont Candidatus Carsonella ruddii PV. While the accumulation of genomes enables more and more fields within microbiology to participate in systems biology shifting from generating more genome sequence to the more difficult aim of comprehending the impact of specific functional genomic patterns is an important and substantial transition that faces microbiology today. Direct comparison of genome alignments enables assessment of organization between strains, species, and genera to give a picture of structural conservation (Figure 1) that is beyond the use of 16S DNA sequence. However, genome structure does not predict phenotype, even among closely related subspecies. For example, the genome structure between Lactococcus lactis ssp. lactis IL1403 compared to Lactococcus lactis ssp. cremoris SK11 is conserved, except for a small inversion. However, the strains behave very differently in the same growth conditions for growth and gene expression (Yie et al., 2004). With the extensive amount of genome information available it is possible to redefine the classification of microbes based on their genome similarity (known as phylogenomics) rather than the 16s DNA or phenotype (Anderssen and Fuxelius, 2005). Gene duplication, translocation, inversion, deletion, and horizontal transfer facilitate genome rearrangement, which is becoming an increasingly common observation in new genomes from environments that have high selective pressure. Presumably, such rearrangements mediate rapid strain evolution allowing adaptation of the strain to the selective pressure (Hughes, 2000). Use of phylogenomics to classify microbes is a complex and emerging area of classification that will produce new phylogeny methods to represent evolution and relatedness between microbes in the near future. Koonin and Galperin (1997) examined this approach with relatively few genomes to inform their conclusions that structure is not conserved, but rather gene exchange in distantly related microbes is common for the conservation of function via many different genome organizational structures. Tools to probe conservation of function are clearly needed to bring focus to the conundrum of the lack of structure conservation with the common phenotypes noticed among genera or species. To aid comparative genomics a technique called comparative genomic hybridization (CGH) is becoming increasingly popular. This is based on use of gene expression arrays that have genomic DNA hybridized to the array rather than labeled cDNA. This allows one to determine genomic similarity without sequencing every strain of interest. Protocols for this approach are being standardized and completely depend on the genome that was used to create the array (Guinane and Fitzgerald, 2008). If genes are missing in the reference genome then no data will be available for the CGH comparison. However, this method is inexpensive, fast, and provides a very rich data set to compare closely related organisms for the conservation of functionally related genes independent of the location on the genome.

280

Gene Expression in Microbial Systems for Growth and Metabolism

Figure 1. Synteny plots of specific microbes to demonstrate conservation of genome structure

G ene E xpressi on Pr ofi les With a genome in hand creation of a whole genome gene expression array is the next logical step for functional analysis of genome sequence and gene regulation. Construction of gene expression arrays is a critical step to enable creation of reliable and estimates of gene expression profiles (Table 1). This is done by placing probes to various locations in a gene to assess the expression of that gene during growth and environmental treatment. Cellular RNA is isolated from an organism and converted to cDNA (made from RNA using reverse transcription PCR) as a tag is incorporated. Often the tag is fluorescent but other options are available. The tagged cDNA is hybridized to the genome array to produce a signal. Two main types of arrays are in use – spotted arrays and photolithography to deposit the probe on the solid medium for use. Variability in spotting leads to variability in expression data, which has limited use of spotted arrays, except in carefully controlled conditions. Gene expression arrays produce an enormous amount of data for each experiment that requires immense data-handling capacity. For example, an experiment with a DNA array of an entire genome, even a small one with 2,500 genes requires approximately 27,500 individual probes (considering 11 probes per gene) for a single genome. A single experiment done using two treatments (e.g. a single vari-

281

Gene Expression in Microbial Systems for Growth and Metabolism

Table 1. Options to produce gene arrays for expression and CGH Medium

Probe

Spotting method

Signal

Bead

>50mer oligonucleotide

Ink jet

Dual color

Membrane (nylon)

cDNA

Pin – solid or slotted

Single color

Slide

T), exon 14 (c.1956C>T, c.1957A>G, and c.1957A>C); complete exon skipping due to damage of an exonic splicing enhancer sequence

Familial adenomatous Polyposis (FAP)

Aretz et al. (2004)

ATM

IVS10-6T>G at the 3’ splice site of intron 10; incorrect splicing of exon 11 and exon skipping, resulting in a frame-shift starting at codon 355 and premature stop codon 371.

Breast cancer

Broeks et al. (2003)

BRCA2

Missense mutation in exon 13 (c.7235G>A), results in skipping of this exon, causing a frame shift and generating a premature stop codon in exon 14; mutation site has low homology to an known exonic splicing enhancer sequence.

Breast cancer

Thomassen et al. (2006)

BRCA2

BRCA2 variant 8204G>A is a splicing mutation. The acceptor site of exon 17 is damaged which implies skipping of this exon.

Breast cancer

Hofmann et al. (2003)

BRCA1

IVS10-2A–>C produces an aberrant RNA splicing transcript with missing exon 11.

Breast cancer

Keaton et al. (2003)

BRCA1

G to T mutation at position 5199 of exon 18 implies exon skipping due to changing an ESE sequence. Exon 18 is essential for the DNA repair, transcriptional control and tumour supresssion.

Breast cancer

Liu et al. (2001)

CDKN2A

Two different mutations D153spl (c.457G>T) and IVS2+1G>T imply a 74 bp deletion in exon 2 or complete loss of exon 2, respectively.

Cutaneous malignant melanoma (CMM)

Rutter et al. (2003)

HRPT2

IVS2-1G>A of the AG dinucleotide of the 3’splice site of intron 2 leads to deletion of exon 3 or a by 23 bp shorter exon.

Parathyroid tumors

Moon et al. (2005)

KAI1

Deletion of exon 7causes weaker interaction with integrin α1 leading to increased motility and metastasis of the cells.

Gastric cancer

Lee et al. (2003)

KLF6

IVS1-27G>A: generates a novel SRp40 DNA binding site leading to three alternatively spliced isoforms, antagonizing the wtKLF6 function.

Prostate cancer

Narla et al. (2005)

KIT

Deletion of 30 or 34nt in intron10 and exon 11, respectively, leads to a mis-spliced constitutively activated onkoprotein (KIT).

Gastrointestinal stromal tumors

Chen et al. (2005)

LI-cadherin

Mutation at a putative branch point at IVS6 + 35 A>G in intron 6 leads to loss of exon 7

Hepatocellular carcinoma

Wang et al. (2005)

LKB1

The IVS2+1A>G mutation alters the 5’ splice site of intron 2 (U12-type AT-AC intron)

Peutz-Jeghers Syndrome with increased cancer risk

Hastings et al. (2005)

WT1

Use of an alternative promoter located within intron 1 leads to 147 missing amino acids at the N terminus required for transcriptional repression of sWT1.

Leukemia

Hossain et al. (2006)

This was observed by Cory et al. (2003), Cory and Adams (2002) and Xerri et al. (1996). Hence, changing the balance of these isoforms to increase production of BCL-xS, could make cancer cells more sensitive to chemotherapy.

299

Alternative Splicing and Disease

Till now unfortunately little is known if cancer causes mis-spliced isoforms or if these isoforms cause cancer. Therefore Hayes et al. (2006) and Pilch et al. (2001) suggest targeting the general RNA splicing machinery as novel strategy for cancer treatment.

Alterna ti ve S plicing and Cl inica l T herapy The growing knowledge about the molecular mechanisms of alternative splicing and how it causes diseases leads to new concepts for clinical therapies. Here we will mention the potential of antisence oligoribonucleotides and modified splicing factors as first strategies to intervene in splicing defects. Kole et al. (2004) and Sazani and Kole (2003) have written excellent reviews about this emerging field. Antisense oligonucleotides (AON) can be used to block splice sites and other signals like splicing enhancers and silencers in order to change the final transcript. Binding of AON to the mRNA creates a short double strand piece of RNA and makes the considered site invisible to splicing factors. However, RNase H, localized in the cell, is able to recognize and destroy double stranded RNA. Therefore the AON has to be chemically modified not to be recognized and degraded by RNase H. The resulting small interference RNA technique has become a widely used tool for down-regulating gene expression and is described by Mercatante et al. (2001), Dallas et al. (2006) and Kurreck (2003 and 2006). Duchenne muscular dystrophy (DMD) is a degenerative muscle disease. Dystrophin is the largest human gene with 2.2 million base pairs and 79 exons. The resulting protein is 3685 amino acids long. Of the 696 mutations reported in the Human Gene Mutation Database 68 lead to loss of exons, shifts of reading frame and non-functional proteins often due to premature stop codons and nonsense-mediated decay as described by Lareau et al. (2007) and Ni et al. (2007). The milder case of DMD is BMD (Becker Kiener disease) in which mutations cause the deletion of less important parts of the dystrophin protein leading to a shorter but more or less functional protein. The most abundant form of DMD is the loss of exon 45 resulting in a frame shift. However, using bioinformatics revealed that an additional skipping of exon 46 re-establishes the reading frame and produces a shortened but probably functional protein. In vitro experiments by Aartsma-Rus and coworkers (Aartsma-Rus et al. 2002; 2003; 2004) with muscle cells from DMD patients having the deletion of exon 45 proved that anti sense oligonucleotides blocking of the splice sites of exon 46 successfully generates functional transcripts which lack both exons 45 and 46. Using the same in vitro method as illustrated in Figure 6 it was possible to skip 11 other exons damaged by DMD. Many cancer cells over express the BCL-xL (long) splice form of the BCL-x gene, which codes for an anti-apoptotically acting protein. Small interfering RNA against the downstream 5’ splice site of its exon 5 leads to a reduced level of BCL-xL and a higher level of its antagonist BCL-xS (short). Experiments by Xie et al. (2006) and Lei et al. (2006) showed that the implied change of balance between these two proteins makes cancer cells more sensitive to chemotherapy and radiation. A similar effect has been shown for another member of the BCL-2 gene family. The expression of the BCL-α isoform is increased in many cancer cells as reported by Real et al. (2002). In vivo experiments by Dias and Stein (2002) and using anitsense oligonucleotides blocking could demonstrate that suppression of the BCL-α isoform inhibits the expansion and progression of tumors. Mutations of the β-globin gene IVS2 within intron 2 create a novel aberrant 5’ splice site and activate a cryptic 3’ splice site finally leading to a premature stop codon. Using AON technique these mutations could be corrected in a culture system reported by Suwanmanee et al. (2002a/b)

300

Alternative Splicing and Disease

Figure 6. Antisense oligonucleotides blocking induces skipping of exon 46 to re-establish the correct reading frame of the damaged dystrophin gene found in DMD patients lacking exon 45.

A mutation within intron 19 of the CFTR (cystic fibrosis transmembrane conductance regulator) gene creates a novel 5’ splice site and activates an additional otherwise un-present exon. Like in the previous case Friedman et al. (1999) re-established correct splicing by AON. Another example is the correction of the tau gene associated with frontotemporal dementia and parkinsonism linked to chromosome 17. One of the major mRNA changes in this disease is the inclusion of exon 10. Within a tau minigene system and neuronal pheochromocytoma cells, Kalbfuss et al. (2001) was able to stop inclusion of exon 10 using AON against its splice sites. The success of future practical therapy of the discussed diseases by AON naturally depends on the stability of RNA blocking over a certain time. Therefore improved so called locked nucleic acid (LNA) oligonucleotides were proposed by Roberts et al. (2006). These oligonucleotides were observed to bind up to 3 weeks. Oligonucleotide induced recruitment of splicing factors is another approach to control splicing patterns. For example, in the cases of SMA, the SMN1 gene is lost or mutated. The replacement gene SMN2 is less effective since its transcript often lacks the important exon 7. To overcome this problem Cartegni et al. (2006) invented a chimeric protein. With its N terminus it binds to the less functional exonic splicing enhancer located in the skipped exon 7 of SMN2 and on its C terminus it carries a peptide structure similar to other SR proteins which control interaction with the splicing machinery as described by Cartegni and Krainer (2003) and illustrated in Figure 7. In fact, the mimicked SR-protein was observed to work, attracting the splicing machinery and increasing the production of SMN2 mRNA including exon 7 in a dose dependent manner. This technique perhaps opens a general way to restore normal splicing patterns for genes with damaged control signals.

301

Alternative Splicing and Disease

Figure 7. Inclusion of exon7 into the SMN2 transcript facilitated by a chimeric protein SF** induces recognition of the acceptor site of exon 7.

Co nc lusi on Alternative RNA splicing is the prevailing mechanism of gene expression to generate the great diversity of proteins which is typical for complex forms of life. It is strictly controlled by a complex system of about hundred known splicing factors and a number of complex sequence signals like splice sites, the branch point signal, splicing enhancers and silencers. It is therefore no surprise that sequence mutations and damaged splicing factors can have pathological effects. Our review presented different examples for erroneously spliced gene products which cause severe diseases. The complex process of normal and aberrant splicing offers a number of targets for possible therapies which differ from gene therapy by not repairing genes but making improved use of damaged genes as already known for Duchenne muscular dystrophy. One technology described in this review is the application of complementary oligonucleotides like siRNA in order to suppress unfavourable splice sites, splicing enhancers or silencers (Aartsma-Rus et al.2006). Oligonucleotide induced recruitment of splicing factors is another approach. More research in this direction and focussed on a single important disease like cystic fibrosis (CF) can perhaps soon provide a successful therapy. CF is one of the best studied hereditary diseases and much is known about the process of alternative splicing and other molecular mechanisms related with this disease. The described siRNA technique could soon allow restoring of correct splicing. Another target is increasing the stability and the half-life of correctly or favourably spliced mRNAs in order to produce more functional proteins from each single mRNA template. It could lead to successful treatments of spinal muscular atrophy, myotonic dystrophy and other diseases which are caused by insufficient production of known proteins.

A ckn ow ledgment This work was supported by the BMBF Germany under contract number 0312705A.

302

Alternative Splicing and Disease

R eferences Aartsma-Rus, A., Bremmer-Bout, M., Janson, A. A., den Dunnen, J. T., van Ommen G. J., & van Deutekom, J. C. (2002). Targeted exon skipping as a potential gene correction therapy for Duchenne muscular dystrophy. Neuromuscul Disord, 12(Suppl 1), S71-77. Aartsma-Rus, A., Janson, A. A., Kaman, W. E., Bremmer-Bout, M., den Dunnen, J. T., Baas, F., van Ommen, G. J., & van Deutekom, J. C. (2003). Therapeutic antisense-induced exon skipping in cultured muscle cells from six different DMD patients. Hum Mol Genet, 12(8), 907-914. Aartsma-Rus, A., Janson, A. A., Kaman, W.E., Bremmer-Bout, M., van Ommen, G.J., den Dunnen, J. T., & van Deutekom, J. C. (2004). Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet, 74(1), 83-92. Aartsma-Rus, A., Janson, A. A., Heemskerk, J. A., D. E. Winter, C. L., VAN Ommen, G. J., VAN Deutekom, J. C. (2006). Therapeutic modulation of DMD splicing by blocking exonic splicing enhancer sites with antisense oligonucleotides. Ann N Y Acad Sci, 1082, 74-76. Akgul, C., Moulding, D. A., & Edwards, S. W. (2004). Alternative splicing of Bcl-2-related genes: Functional consequences and potential therapeutic applications. Cell Mol Life Sci., 61(17), 2189-2199. Aretz, S., Uhlhaas, S., Sun, Y., Pagenstecher, C., Mangold, E., Caspari, R., Möslein, G., Schulmann, K., Propping, P., & Friedl, W. (2004). Familial adenomatous polyposis: Aberrant splicing due to missense or silent mutations in the APC gene. Hum Mutat., 24(5), 370-380. Ars, E., Serra, E., Garcia, J., Kruyer, H., Gaona, A., Lazaro, C., & Estivill, X. (2000). Mutations affecting mRNA splicing are the most common molecular defects in patients with neurofibromatosis type 1. Hum Mol Genet. 9(2), 237-247. Ban, J., Eckhart, L., Weninger, W., Mildner, M., & Tschachler, E. (1998). Identification of a human cDNA encoding a novel Bclx isoform. Biochem. Biophys. Res. Commun, 248, 147-152 Beadle, G. W., Tatum, E. L. (1941). Genetic control of biochemical reactions in neurospora. Proc Natl Acad Sci U S A., 27(11), 499-506. Boeckmann, B., Blatter, MC., Famiglietti, L., Hinz, U., Lane, L., Roechert, B., & Bairoch, A. (2005). Protein variety and functional diversity: Swiss-Prot annotation in its biological context. C R Biol., 328(10-11), 882-899. Boise, L. H., Gonzalez-Garcia, M., Postema, C. E., Ding, L., Lindsten, T., & Turka, L. A. et al. (1993). bcl-x, a bcl-2-related gene that functions as a dominant regulator of apoptotic cell death. Cell, 74, 597608 Bono, F., Ebert, J., Lorentzen, E., & Conti, E.. (2006). The crystal structure of the exon junction complex reveals how it maintains a stable grip on mRNA. Cel,.126(4), 713-725. Brinkman, B. M. (2004). Splice variants as cancer biomarkers. Clin Biochem., 37(7), 584-594. Broeks, A., Urbanus, J. H., de Knijff, P., Devilee, P., Nicke, M., Klöpper, K., Dörk, T., Floore, A. N., van’t Veer, L. J. (2003). IVS10-6T>G, An ancient ATM germline mutation linked with breast cancer. Hum Mutat., 21(5), 521-528. 303

Alternative Splicing and Disease

Broeks, A., van ‚t Veer, L. J., Ottenheim, C., Hiel, J. A., Kleijer, W. J., & Weemaes, C. (2003). From gene to disease; ataxia telangiectasia. Ned Tijdschr Geneeskd, 147(9), 386-389. Cartegni, L., & Krainer, A. R. (2003). Correction of disease-associated exon skipping by synthetic exon-specific activators. Nat Struct Biol., 10(2), 120-125. Cartegni, L., Hastings, M. L., Calarco, J. A., de Stanchina, E., & Krainer, A. R. (2006). Determinants of exon 7 splicing in the spinal muscular atrophy genes, SMN1 and SMN2. Am J Hum Genet., 78(1), 63-77. Charlet, B. N., Savkur, R. S., Singh, G., Philips, A. V., Grice, E. A., & Cooper, T. A. (2002). Loss of the muscle-specific chloride channel in type 1 myotonic dystrophy due to misregulated alternative splicing. Mol Cell., 10(1), 45-53. Chen, L. L., Sabripour, M., Wu, E. F., Prieto, V. G., Fuller, G. N., & Frazier, M. L. (2005). A mutation-created novel intra-exonic pre-mRNA splice site causes constitutive activation of KIT in human gastrointestinal stromal tumors. Oncogene, 24(26), 4271-4280. Cheng, C., & Sharp, P. A. (2006). Regulation of CD44 alternative splicing by SRm160 and its potential role in tumor cell invasion. Mol Cell Biol., 26(1), 362-370 Cory, S., & Adams, J. M. (2002). The Bcl2 family: Regulators of the cellular life-or-death switch. Nat Rev Cancer, 2(9), 647-656. Cory, S., Huang, D. C., & Adams, J. M. (2003). The Bcl-2 family: Roles in cell survival and oncogenesis. Oncogene, 22(53), 8590-8607. Dallas, A., & Vlassov, A. V. (2006). RNAi: A novel antisense technology and its therapeutic potential. Med Sci. Monit., 12, RA67-74 Dansithong, W., Paul, S., Comai, L., & Reddy, S. (2005). MBNL1 is the primary determinant of focus formation and aberrant insulin receptor splicing in DM1. J Biol Chem., 280(7), 5773-5780. Day, J. W., & Ranum, L. P. (2005). RNA pathogenesis of the myotonic dystrophies. Neuromuscul Disord., 15(1), 5-16. Dias, N.,& Stein, C. A. (2002). Potential roles of antisense oligonucleotides in cancer therapy: the example of Bcl-2 antisense oligonucleotides. Eur. J. Pharm. Biopharm., 54, 263-269 Eggert, C., Chari, A., Laggerbauer, B., & Fischer, U. (2006). Spinal muscular atrophy: The RNP connection. Trends Mol Med., 12(3), 113-121. Fischer, D. C., Noack, K., Runnebaum, I. B., Watermann, D. O., & Kieback, D. G., et al. (2004). Expression of splicing factors in human ovarian cancer. Oncol Rep, 11, 1085-1090 Fokstuen, S., Myring, J., Evans, C., & Harper, P. S. (2001). Presymptomatic testing in myotonic dystrophy: Genetic counselling approaches. J Med Genet., 38(12), 846-850. Friedman, K. J., Kole, J., Cohn, J. A., Knowles, M. R., Silverman, L. M., & Kole, R. (1999). Correction of aberrant splicing of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by antisense oligonucleotides. J Biol Chem., 274(51), 36193-3619.

304

Alternative Splicing and Disease

Frugier, T., Nicole, S., Cifuentes-Diaz, C., & Melki, J. (2002). The molecular bases of spinal muscular atrophy. Curr Opin Genet Dev., 12(3), 294-298. Gallinaro, L., Sartorello, F., Pontara, E., Cattini, M. G., Bertomoro, A., Bartoloni, L., Pagnan, A., & Casonato, A. (2006). Combined partial exon skipping and cryptic splice site activation as a new molecular mechanism for recessive type 1 von Willebrand disease. Thromb Haemost., 96(6), 711-716 Garcia-Blanco, M. A., Baraniak, A. P., & Lasda, E. L. (2004). Alternative splicing in disease and therapy. Nat. Biotechnol, 22, 535-546 Gupta, S., Zink, D., Korn, B., Vingron, M., & Haas, S. A. (2004). Genome wide identification and classification of alternative splicing based on EST data. Bioinformatics., 20, 2579-2585. Hastings, M. L., Resta, N., Traum, D., Stella, A., Guanti, G., & Krainer, A. R. (2005). An LKB1 AT-AC intron mutation causes Peutz-Jeghers syndrome via splicing at noncanonical cryptic splice sites. Nat Struct Mol Biol., 12(1), 54-59. Hayes, G. M., Carrigan, P. E., Beck, A. M., Miller, L. J. (2006). Targeting the RNA splicing machinery as a novel treatment strategy for pancreatic carcinoma. Cancer Res, 66, 3819-3827 Hofmann, W., Horn, D., Hattner, C., Classen, E., & Scherneck, S. (2003). The BRCA2 variant 8204G>A is a splicing mutation and results in an in frame deletion of the gene. J Med Genet., 40(3), e23. Hossain, A., Nixon, M., Kuo, M. T., & Saunders, G. F. (2006). N-terminally truncated WT1 protein with oncogenic properties overexpressed in leukemia. J Biol Chem., 281(38), 28122-28130. Johnson, J. M., Castle, J., Garrett-Engele, P., Kan, Z., Loerch, P. M., Armour, C. D., Santos, R., Schadt, E. E., Stoughton, R., & Shoemaker, D. D.(2003). Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays. Science, 302(5653), 2141-2144 Kalbfuss, B., Mabon, S. A., & Misteli, T. (2001). Correction of alternative splicing of tau in frontotemporal dementia and parkinsonism linked to chromosome 17. J Biol Chem., 16, 276(46), 42986-42993 Karni, R., de Stanchina, E., Lowe, S. W., Sinha, R., & Mu, D., et al. (2007). The gene encoding the splicing factor SF2/ASF is a proto-oncogene. Nat Struct. Mol. Biol, 14, 185-193 Keaton, J. C., Nielsen, D. R., Hendrickson, B. C., Pyne, M. T., Scheuer, L., Ward, B. E., Brothman, A. R., & Scholl, T. (2003). A biochemical analysis demonstrates that the BRCA1 intronic variant IVS102A--> C is a mutation. J Hum Genet., 48(8), 399-403. Kerem, B., Rommens, J. M., Buchanan, J. A., Markiewicz, D., Cox, T. K., Chakravarti, A., Buchwald, M., & Tsui, L. C.. (1989). Identification of the cystic fibrosis gene: genetic analysis. Science. 245(4922), 1073-1080. Kole, R., Vacek, M., & Williams, T. (2004). Modification of alternative splicing by antisense therapeutics. Oligonucleotides,. 14(1), 65-74. Korsmeyer, S. J., Shutter, J. R., Veis, D. J., Merry, D. E., & Oltvai, Z. N.(1993). Bcl-2/Bax: A rheostat that regulates an anti-oxidant pathway and cell death. Semin. Cancer Biol., 4, 327-332

305

Alternative Splicing and Disease

Krawczak, M., Reiss, J., & Cooper, D. N. (1092). The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: Causes and consequences. Hum Genet., 90(1-2), 41-54. Kurreck, J. (2006). siRNA Efficiency: Structure or Sequence-That Is the Question. J Biomed Biotechnol., (4), 83757. Kurreck, J. (2003). Antisense technologies. Improvement through novel chemical modifications. Eur J Biochem., 270(8), 1628-1644. Ladd, A. N., Stenberg, M. G., Swanson, M. S., & Cooper, T. A. (2005). Dynamic balance between activation and repression regulates pre-mRNA alternative splicing during heart development. Dev Dyn., 233(3), 783-793. Lareau, L. F., Inada, M., Green, R. E., Wengrod, J. C, & Brenner, S. E. (2007). Unproductive splicing of SR genes assoziated with highly conserved and ultraconserved DNA elements. Nature, 446, 926-929 Lefebvre, S., Burglen, L., Reboullet, S., Clermont, O., Burlet, P., Viollet, L., Benichou, B., Cruaud, C., Millasseau, P., & Zeviani, M., et al. (1995). Identification and characterization of a spinal muscular atrophy-determining gene. Cell., 80(1), 155-165 Lee, H. S., Lee, H. K., Kim, H. S., Yang, H. K., & Kim, W. H. (2003). Tumour suppressor gene expression correlates with gastric cancer prognosis. J Pathol., 200(1), 39-46. Le Hir, H., Izaurralde, E., Maquat, L. E., & Moore, M. J. (2000). The spliceosome deposits multiple proteins 20-24 nucleotides upstream of mRNA exon-exon junctions. EMBO J., 19(24), 6860-6869. Lei, X. Y., Zhong, M., Feng, L. F., Zhu, B. Y., Tang, S. S., & Liao, D.F. (2006). Bcl-XL small interfering RNA enhances sensitivity of Hepg2 hepatocellular carcinoma cells to 5-fluorouracil and hydroxycamptothecin. Acta Biochim Biophys Sin (Shanghai,. 38(10), 704-710. Liu, H. X., Cartegni, L., Zhang, M. Q., & Krainer, A. R. (2001). A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes. Nat Genet., 27(1), 55-58. Liu, Q., Zhou, J., Daiger, S. P., Farber, D. B., Heckenlively, J. R., Smith, J. E., Sullivan, L. S., Zuo, J., Milam, A. H., & Pierce, E. A. (2002). Identification and subcellular localization of the RP1 protein in human and mouse photoreceptors. Invest Ophthalmol Vis Sci., 43(1), 22-32. Lorson, C. L., & Androphy, E. J. (2000). An exonic enhancer is required for inclusion of an essential exon in the SMA-determining gene SMN. Hum Mol Genet., 9(2), 259-265. Machuca-Tzili, L., Brook, D., & Hilton-Jones, D. (2005). Clinical and molecular aspects of the myotonic dystrophies: a review. Muscle Nerve., 32(1), 1-18. Maeda, T., Hiranuma, H., & Jikko, A. (1999). Differential expression of the splicing regulatory factor genes during two-step chemical transformation in a BALB/3T3-derived cell line, MT-5 (1999). Carcionogenesis, 20, 2341-2344 Matter, N., Herrlich, P., & Kanig, H. (2002). Signal-dependent regulation of splicing via phosphorylation of Sam68. Nature, 420(6916), 691-695.

306

Alternative Splicing and Disease

Meister G, Buhler D, Pillai R, Lottspeich F, Fischer U. (2001). A multiprotein complex mediates the ATP-dependent assembly of spliceosomal U snRNPs. Nat Cell Biol. 3(11), 945-949. Mercatante, D. R., Sazani, P., & Kole, R. (2001). Modification of alternative splicing by antisense oligonucleotides as a potential chemotherapy for cancer and other diseases. Curr Cancer Drug Targets, 1(3), 211-230. Mironov, A. A., Fickett, J. W., & Gelfand, M. S. (1999). Frequent alternative splicing of human genes. Genome Res., 9(12), 1288-93. Moon, S. D., Park, J. H., Kim, E. M., Han, & J. H. et al. (2005). A novel IVS2-1G>A mutation causes aberrant splicing of the HRPT2 gene in a family with hyperparathyroidism-Jaw Tumor Syndrome Journal of Clinical Endocrinology & Metabolism, 2, 878-883 Nanjundan, M., Zhang, F., Schmandt, R., Smith-McCune, K., & Mills, G. B. (2007). Identification of a novel splice variant of AML1b in ovarian cancer patients conferring loss of wild-type tumor suppressive functions. Oncogene, 26(18), 2574-2584. Narla, G., DiFeo, A., Yao, S., Banno, A,, Hod, E., Reeves, H. L., Qiao, R.F., Camacho-Vanegas, O., Levine, A., Kirschenbaum, A., Chan, A. M., Friedman, S. L., & Martignetti, J. A. (2005). Targeted inhibition of the KLF6 splice variant, KLF6 SV1, suppresses prostate cancer cell growth and spread. Cancer Res., 65(13), 5761-5768. Ni, J. Z., Grate, L., Donohue, J. P., Preston, C., & Nobida, N., et al. (2007). Ultraconserved elements are associated with homeostatic control of splicing regulators by alternative splicing and nonsense-mediated decay. Genes Dev,. 21, 708-718. Nilsen, T. W. (2003). The spliceosome: The most complex macromolecular machine in the cell? Bioessays., 25(12), 1147-9. Philips, A. V., Timchenko, L. T., & Cooper, T. A. (1998). Disruption of splicing regulated by a CUGbinding protein in myotonic dystrophy. Science, 280(5364), 737-741. Pilch, B., Allemand, E., Facompre, M., Bailly, C., & Riou, J. F. et al. (2001). Specific inhibition of serine- and argenine-rich splicing factors phosphorylation, spliceosome assembly, and splicing by the antitumor drug NB-506. Cancer Res, 61, 6876-6884. Pollex, R. L., & Hegele, R. A. (2004). Hutchinson-Gilford progeria syndrome. Clin Genet., 66(5), 375381. Real, P. J., Sierra, A., De Juan, A., Segovia, J. C., Lopez-Vega, J. M., & Fernandez-Luna, J. L. (2002). Resistance to chemotherapy via Stat3-dependent overexpression of Bcl-2 in metastatic breast cancer cells. Oncogene, 21, 7611-7618. Ritchie, W., Granjeaud, S., Puthier, D., & Gautheret, D. (2008). Entropy Measures Quantify Global Splicing Disorders in Cancer. PLoS Comput Biol, 4(3), e1000011. doi:10.1371 Roberts, J., Palma, E., Sazani, P., Orum, H., Cho, M., & Kole, R. (2006). Efficient and persistent splice switching by systemically delivered LNA oligonucleotides in mice. Mol Ther, 14(4), 471-475.

307

Alternative Splicing and Disease

Rutter, J. L., Goldstein, A. M., Davila, M. R., Tucker, M. A., & Struewing, J. P. (2003). CDKN2A point mutations D153spl(c.457G>T) and IVS2+1G>T result in aberrant splice products affecting both p16INK4a and p14ARF. Oncogene, 22(28), 4444-4448. Savkur, R. S., Philips, A. V., Cooper, T. A., Dalton, J. C., Moseley, M. L., Ranum, L. P., & Day, J. W. (2004). Insulin receptor splicing alteration in myotonic dystrophy type 2. Am J Hum Genet., 74(6), 1309-1313. Sazani, P., & Kole, R. (2003). Therapeutic potential of antisense oligonucleotides as modulators of alternative splicing. J Clin Invest., 112(4), 481-486. Sebillon, P., Beldjord, C., Kaplan, J. C., Brody, E., & Marie, J. (1995). A T to G mutation in the polypyrimidine tract of the second intron of the human beta-globin gene reduces in vitro splicing efficiency: evidence for an increased hnRNP C interaction. Nucleic Acids Res., 23(17), 3419-3425. Sergeant, N., Sablonniere, B., Schraen-Maschke, S., Ghestem, A., Maurage, C. A., Wattez, A., Vermersch, P., & Delacourte, A. (2001). Dysregulation of human brain microtubule-associated tau mRNA maturation in myotonic dystrophy type 1. Hum Mol Genet., 10(19), 2143-2155. Seznec, H., Agbulut, O., Sergeant, N., Savouret, C., Ghestem, A., Tabti, N., Willer, J. C., Ourth, L., Duros, C., Brisson, E., Fouquet, C., Butler-Browne, G., Delacourte, A., Junien, C., & Gourdon, G. (2001). Mice transgenic for the human myotonic dystrophy region with expanded CTG repeats display muscular and brain abnormalities. Hum Mol Genet., 10(23), 2717-2726. Stenson, P. D., Ball, E. V., Mort. M., Phillips, A. D., Shiel, J. A., Thomas, N. S., Abeysinghe, S., Krawczak, M., & Cooper, D. N. (2003). Human gene mutation Ddatabase (HGMD), 2003 update. Hum Mutat. 21(6), 577-581. Staley, J. P., Guthrie, C. (1998). Mechanical devices of the spliceosome: Motors, clocks, springs, and things. Cell, 92, 315-326. Stickeler, E., Kitirell, F., Medina, D., & Berget, S. M. (1999). Stage-specific changes in SR splicing factors and alternative splicing in mammary tumorigenesis. Oncogene, 18, 3574-3582 Suwanmanee, T, Sierakowska, H., Lacerra, G., Svasti, S., Kirby, S., Walsh, C. E., Fucharoen, S., & Kole, R. (2002a). Restoration of human beta-globin gene expression in murine and human IVS2-654 thalassemic erythroid cells by free uptake of antisense oligonucleotides. Mol Pharmacol., 62(3), 545-553. Suwanmanee, T., Sierakowska, H., Fucharoen, S., & Kole, R. (2002b). Repair of a splicing defect in erythroid cells from patients with beta-thalassemia/HbE disorder. Mol Ther., 6(6), 718-726. Tange, T. O., Nott, A., & Moore, M. J. (2004). The ever-increasing complexities of the exon junction complex. Curr Opin Cell Biol., 16(3), 279-284. Tazi, J., Durand, S., & Jeanteur, P. (2005). The spliceosome: a novel multi-faceted target for therapy. Trends Biochem Sci., 30(8), 469-478. Teraoka, S. N., Telatar, M., Becker-Catania, S., Liang, T., Onengut, S., Tolun, A., Chessa, L., Sanal, O., Bernatowska, E., Gatti, R. A., & Concannon, P. (1999). Splicing defects in the ataxia-telangiectasia gene, ATM: underlying mutations and consequences. Am J Hum Genet., 64(6), 1617-1631

308

Alternative Splicing and Disease

Thomassen, M., Kruse, T. A., Jensen, P. K., & Gerdes, A. M. (2006). A missense mutation in exon 13 in BRCA2, c.7235G>A, results in skipping of exon 13. Genet Test., 10(2), 116-120. Vervoort, R., & Wright, A. F. (2002). Mutations of RPGR in X-linked retinitis pigmentosa (RP3). Hum Mutat,. 19(5), 486-500. Wang, X. Q., Luk, J. M., Leung, P. P., Wong, B. W., Stanbridge, E. J., & Fan, S. T. (2005). Alternative mRNA splicing of liver intestine-cadherin in hepatocellular carcinoma. Clin Cancer Res., 11(2 Pt 1), 483-489. Watermann, D. O., Tang, Y., Zur Hausen, A., Jager, M., & Stamm, S., et al. (2006). Splicing factor Tra2-beta1 is specifically induced in breast cancer and regulates alternative splicing of the CD44 gene. Cancer Res., 66, 4774-4780 Will, C. L. & Luhrmann, R. (2001). Spliceosomal UsnRNP biogenesis, structure and function. Curr Opin Cell Biol., 13(3), 290-301. Xerri, L., Parc, P., Brousset, P., Schlaifer, D., Hassoun, J., & Reed, J. C. et al. (1996). Predominant expression of the long isoform of Bcl-x (Bcl-xL). in human lymphomas. Br. J. Haematol., 92, 900-906 Xie, Y. E., Tang, E. J., Zhang, D. R., & Ren, B. X. (2006). Down-regulation of Bcl-XL by RNA interference suppresses cell growth and induces apoptosis in human esophageal cancer cells. World J Gastroenterol, 12(46), 7472-7477. Zerbe, L. K., Pino, I., Pio, R., Cosper, P. F., & Dwyer-Nield, L. D., et al. (2004). Relative amounts of antagonistic splicing factors, hnRNP A1 and ASF/SF2, change during neoplastic lung growth: implications for pre-mRNA processing. Mol Carcinog, 41, 187-196 Zhou, Z. H., Licklider, L. J., Gygi, S. P., & Reed, R. (2002). Comprehensive proteomic analysis of the human spliceosome Nature, 218, 182-185 Zielenski, J., & Tsui, L. C. (1995). Cystic fibrosis: genotypic and phenotypic variations. Annu Rev Genet., 29, 777-807.

K ey T erms Alternative Splicing: Alternative choice of introns which are spliced out during pre-mRNA processing. Autosomal Recessive Disorder: Disorder that only occurs if both alleles of a pair of autosomal chromosomes are mutated. Beta-Globin Gene: Gene that codes for the beta globin chain of the hemoglobin protein. CFTR (Cystic Fibrosis Transmembrane conductance Regulator): CFTR is an ion channel protein belonging to the class of ABC transporters. It transports chloride ions through the cell membrane. Dysfunction of this protein causes the Cystic fibrosis.

309

Alternative Splicing and Disease

Exon: An exon is a part of the pre-mRNA that is not removed during the RNA-splicing process. Exonic Splicing Enhancer/Silencer: A pre-mRNA sequence motif of about six bases within an exon regulating enhanced/silenced splicing at a close by sequence position. Hereditary Disease: A genetic disorder is called a hereditary disease. Human Gene Mutation Database: The Human Gene Mutation Database (HGMD) constitutes a comprehensive core collection of data on germ-line mutations in nuclear genes underlying or associated with human inherited disease (www.hgmd.org). Hyperexcitability: A mutation in a cation ion channel which leads persistent muscle contractions caused by increased cell membrane voltage. Intron: A pre-mRNA fragment that is cleaved out during pre-mRNA splicing. Intronic Splicing Enhancer/Silences: A pre-mRNA sequence motif of about six bases within an intron regulating enhanced/silenced splicing at a close by sequence position. Ligation: The joining of two molecules facilitated by an enzyme called ligase. In our context ligation denotes the joining of exon fragments during pre-mRNA splicing. Spliceosome: The entire assembly of proteins that facilitates pre-mRNA splicing. Thalassemia: Severe heriditary disease caused by mutations in the beta-globin gene sequence.

310

Section V

Systems Biology and Aging

312

Chapter XVIII

Mathematical Modeling of the Aging Process Axel Kowald Medizinisches Proteom Center (MPC), Ruhr-Universität Bochum, Germany

abstract Aging is a complex biological phenomenon that practically affects all multicellular eukaryotes. It is manifested by an ever increasing mortality risk, which finally leads to the death of the organism. Modern hygiene and medicine has led to an amazing increase in average life expectancy over the last 150 years, but the underlying biochemical mechanisms of the aging process are still poorly understood. However, a better understanding of these mechanisms is increasingly important since the growing fraction of elderly people in the human population confronts our society with completely new and challenging problems. The aim of this chapter is to provide an overview of the aging process, discuss how it relates to system biological concepts, and explain how mathematical modeling can improve our understanding of biochemical processes involved in the aging process. We concentrate on the modeling of stochastic effects that become important when the number of involved entities (i.e., molecules, organelles, cells) is very small and the reaction rates are low. This is the case for the accumulation of defective mitochondria, which we describe mathematically in detail. In recent years several tools became available for stochastic modeling and we also provide a brief description of the most important of those tools. Of course, mitochondria are not the only target of modeling efforts in aging research. Therefore, the chapter concludes with a brief survey of other interesting computational models in this field of research.

W ha t is aging? Looking at the enormous rise of average human lifespan over the last 150 years, one could get the impression that modern research actually has identified the relevant biochemical pathways involved in aging and has successfully reduced the pace of aging. Oeppen and Vaupel (2002) collected data on world

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Mathematical Modeling of the Aging Process

wide life expectancy from studies going back to 1840. Figure 1 shows the life expectancy for males (squares) and females (circles) for the countries that had the highest life expectancy for the given year. Two points are remarkable. Firstly, there is an amazingly linear trend in life expectancy that corresponds to an increase of 3 months per year (!) and secondly there is no leveling off observable. These impressive data suggest strongly that lifespan will also continue to rise in the next years, but it does not show that the actual aging rate has fallen during the last century. Aging can best be described as a gradual functional decline, leading to a constantly increasing risk to die within the next time interval (mortality). The Gompertz-Makeham equation (Gompertz, 1825; Makeham, 1867), m(t) = I ⋅ eG t + E, describes how the exponential increase of mortality depends on intrinsic vulnerability (I), actuarial aging rate (G) and environmental risk (E). All living organisms have a base mortality caused by environmental risks, but it is the aging rate, G, which causes human mortality to double approx. every 8 years. From I

this equation we can derive the following expression for the survivorship function: N(t) = e G

(1−e )− E t. Gt

Figure 1. Male (blue squares) and female (red circles) life expectancy in the world record holding country between 1840 and 2000 based on the annual data of countries world wide (reproduced with permission from Oeppen & Vaupel, 2002).

313

Mathematical Modeling of the Aging Process

As expected we see that the number of remaining survivors depends on all three parameters and consequently a change of the average life expectancy (time until 50% of the population has died) can be caused by a modification of any of those parameters. This point is also discussed in more detail by (Kowald, 2002). And indeed, analyzing the survivorship data of the last 100 years more closely, it becomes clear that the aging rate, G, remained constant. The enormous increase in life expectancy was achieved exclusively by changes of intrinsic vulnerability and environmental risk! Because of the drastic social, economical and political consequences that are brought about by the demographic changes of the age structure of the population, it is now more important than ever to understand what constitutes the biochemical basis for a non-zero aging rate, G. Systems biology might help to achieve this goal.

W hy is aging a prime candida te f or systems

bi ology?

Evolutionary theories of the aging process explain why aging has evolved, but unfortunately they don’t predict specific mechanisms to be involved in aging. As a consequence more than 300 mechanistic ideas have been developed (Medvedev, 1990), each centered around different biochemical processes. This is probably due to the fact that even the simplest multicellular organisms are such complex systems that many components have the potential to cause deterioration of the whole system in case of a malfunction. Figure 2 shows a small sample of the most popular mechanistic theories. The spatial arrangement of the diagram intends to reflect the various connections between the different theories. And it is exactly the large number of interactions that makes it so difficult to investigate aging experimentally and renders it ideal for systems biology. To understand this we will look at a few examples. The Telomere Shortening Theory is an important idea that has gained considerable support in the last 10-15 years. Telomeres are the physical ends of linear eukaryotic chromosomes and vital for the

Figure 2. Graphical representation of some mechanistic theories of aging. The topology of the diagram reflects logical and mechanistic overlaps and points of interaction between different theories.

314

Mathematical Modeling of the Aging Process

functioning of the cell (Lundblad & Szostak, 1989; Yu, Bradley, Attardi, & Blackburn, 1990). It has been recognized for a long time that linear DNA has a replication problem since DNA polymerases can only replicate in the 5’-3’ direction and cannot start DNA synthesis de novo (Olovnikov, 1973; Watson, 1972). This inability leads to a gradual loss of DNA, which was confirmed experimentally for human fibroblasts in 1990 and consequently proposed as being responsible for aging (Harley, 1991; Harley, Vaziri, Counter, & Allsopp, 1992). Telomere shortening provides the explanation and connection to the Hayflick Limit, the long known phenomenon that most cultured cell types have only a limited division potential. This in turn is by some researcher interpreted as evolutionary selected trait that acts as a cancer prevention system by preventing unlimited cell division. While the direct cause of telomere shortening is the lack of the enzyme telomerase, there is an interaction to oxygen radicals that complicates the mechanism. Oxidative stress was shown to increase the rate of telomere shortening and thus modulating the telomere attrition (von Zglinicki, Saretzki, Docke, & Lotze, 1995). As the figure indicates, free oxygen radicals are also the central hub to several other prominent phenomena affecting the aging process. They damage all kinds of macromolecules, leading to cross linking of proteins and the generation of indestructible waste products that accumulate in post mitotic cells (i.e. lipofuscin). Degraded mitochondria are supposed to be a major fraction of these waste products and certain oxygen radicals are known to damage the mitochondrial membrane. It seems, however, that radical induced somatic mutations of the mitochondrial DNA (mtDNA) are the main route to defective mitochondria, which produce less energy, but generate more radicals (Linnane et al., 1990; Linnane, Marzuki, Ozawa, & Tanaka, 1989; Miquel, Economos, Fleming, & Johnson, 1980). These mutants are capable of taking over the mitochondrial population of the cell, causing a chronic energy deficiency and maybe aging. It is still unclear what the selection pressure and mechanism is that leads to the accumulation of defective mitochondria, but several suggestions have been made (de Grey, 1997; Kowald, Jendrach, Pohl, Bereiter-Hahn, & Hammerstein, 2005; Kowald & Kirkwood, 2000). Supporting evidence has been found for all the above mentioned ideas and the many interdependencies make ageing a phenomenon that is very difficult to study experimentally. If a single mechanism is studied in isolation, it is hard to interpret the results that were obtained without the contribution of the other mechanisms. And if a complex system is studied with all involved pathways, it is expensive, technically demanding and now the results are difficult to interpret because of the large number of factors that might have influenced the results. This is exactly the situation where a systems biological approach is useful. Systems biology aims at investigating the components of complex biochemical networks and their interactions, applying experimental high-throughput and whole genome methods, and integrating computational and mathematical methods with experimental efforts. The growing number of high-throughput techniques that have been developed in the last years is a major driving force behind the wish to utilize computational methods to manage and interpret the high data output. Modelers, on the other side, are keen to use the generated data to develop quantitative models of systems with complex interactions. Because of the large number of parameters such models would not be meaningful without sufficient experimental measurements. In addition, quantitative modeling of complex systems has several benefits. First of all, it requires that each aspect of a verbal hypothesis is being made specific. Before a computational model can be developed, the researcher has to define each component and how it interacts with all the other components. This is a very useful exercise to identify gaps in current knowledge and in the verbal model. It helps to complete the conceptual model, respectively motivates experiments to collect the missing

315

Mathematical Modeling of the Aging Process

experimental information. To understand complex systems with components that produce opposing effects it is essential to have a model with quantitative predictions. Purely qualitative models (such as verbal arguments) are not sufficient to decide how a system develops over time if it contains non-linear opposing subcomponents. Computational models are also a convenient way to explore easily and cheaply “what if” scenarios that were difficult or impossible to test experimentally. What if a certain reaction would not exist? What if a certain interaction would be ten times stronger? What if we are interested in time spans too short or too long to observe in an experiment? In the next section we will show in detail how a mathematical model can be constructed for a specific problem in aging research that (i) gives insight into a not well understood phenomenon, (ii) explores several “what if” questions that would be difficult to text experimentally and (iii) makes suggestions for further experiments.

Underst anding

the acc umulati on of defecti

ve mit och ondria

Although a large number of mechanistic theories of aging exist, there are a few that have gained widespread popularity. Probably the most intensively studied idea is currently the free radical theory in combination with the accumulation of defective mitochondria. Large mtDNA deletions were found in post-mitotic tissues (heart, brain skeletal muscle) of aging individuals (Hattori et al., 1991; Linnane et al., 1990). Early studies were performed on tissue homogenates and found that the fraction of defective mtDNAs is well below 1% (Cortopassi, Shibata, Soong, & Arnheim, 1992; Randerath, Randerath, & Filburn, 1996). However, it turned out that the underlying assumption that mitochondrial damage is distributed homogeneously within a tissue is wrong. The combination of PCR amplification of extended sequences together with single cell studies revealed that muscle tissue displays a mosaic pattern of mitochondrial damage. While even in old individuals most cells harbor little or no damaged mitochondria, there are a few cells that contain a large proportion of mitochondrial mutants (Cao, Wanagat, McKiernan, & Aiken, 2001; Gokey et al., 2004; Khrapko et al., 1999). These studies demonstrated that in affected cells the mitochondrial population was apparently taken over by a single mutant, which was different for different cells. This suggests that the cellular accumulation of defective mitochondria proceeds via clonal expansion of a single originating mutant. But how can a single mutant mitochondrial DNA, which lacks essential genes, out-compete the population of wild type mitochondria? The phenomenon that mitochondria form dynamic networks, undergoing constant fission and fusion events has been observed for several cell types, such as yeast, plants, HeLa and human endothelial cells (Arimura, Yamamoto, Aida, Nakazono, & Tsutsumi, 2004; Jendrach et al., 2005; Karbowski et al., 2004; Nunnari et al., 1997; Takai, Inoue, Goto, Nonaka, & Hayashi, 1997; Takai, Isobe, & Hayashi, 1999). This opens the possibility that the shorter replication time of deleted mtDNAs represents the selection advantage, since all the mitochondria of a cell effectively form one large compartment with constant mixing of mtDNA as well as matrix and membrane components. Under these conditions, mtDNA deletions no longer lead to energy and proton gradient deficiencies within a single mitochondrion since there is a common pool of these resources. We therefore developed a model of mtDNA mutation, replication and degradation (Kowald et al., 2005) that should explain the cellular mosaic pattern of mitochondrial damage and the observed distribution of deletion sizes in old rats found by Cao et al. (2001).

316

Mathematical Modeling of the Aging Process

T he Model The model was simulated stochastically to explicitly take into account random fluctuations and the discrete nature of the studied biological objects. Mutation events with their inherently small probabilities require a non-deterministic approach to describe adequately the finding that in old animals some cells do contain mitochondrial mutants and others do not. Gillespie developed exact stochastic simulation algorithms that directly calculate the change of the number of molecules of the participating species during the time course of a chemical reaction (D. T. Gillespie, 1977). Thus stochastic algorithms calculate explicitly the time until the next reaction takes place (e.g. A→B+C) and keep track of how the number of molecules in the system is changed by this reaction (A decreased by one, B and C increased by one). Such an approach also deals with the discrete nature of molecule numbers. This is of special importance for self-replicating entities (like mtDNAs) if the number of objects is either zero or one. One mutant mtDNA can multiply and take over the cell, while zero mtDNA molecules obviously cannot. Differential equations, however, assume that variables can attain continuous values, so that 0.001 mtDNAs is a valid simulation result. Because this value is different from zero it is theoretically possible that a population of mutants can recover from such low levels and replace the wild-type: an unrealistic situation which is avoided by stochastic simulations. The free software package Dizzy was used for all simulations (Ramsey & Orrell, 2005). Dizzy is written in Java and implements several stochastic (Gillespie, Gibson-Bruck, Tau-Leap) and deterministic (ODE solvers) simulation algorithms. Models can be described in Systems Biology Markup Language (SBML) (Hucka et al., 2003) or using a proprietary model definition language (CMDL). Because of a special language construct it was possible to define the 4950 mutation reactions with just five lines of code in CMDL. To be comparable with the experimental conditions of Cao et al. (2001), Gillespie’s direct method was used to calculate the fate of a mitochondrial population within a cell for 1100 days, corresponding to 38 months of a rat’s life. On a modern workstation such a calculation took approx. 1 hour. The simulation was then repeated 1000 times on a Linux cluster to have enough information for a statistical analysis of the accumulation process of defective mitochondria.

Mutations In this simulation study only deletion mutations affecting the large arc (Figure 3B) of the rat genome are considered. It is assumed that deletions which include the heavy or light strand origin of replication (OH and OL) are no longer capable of replication and thus cannot accumulate. Deletions affecting exclusively the minor arc are also excluded, since they have not been observed (Cao et al., 2001). To further simplify and speed up the simulation, deletions are modeled with a granularity of 100 bp, i.e. deletions can be of 100, 200 or 300 bp, but not 250 bp. Consequently, the model contains 100 possible classes of mitochondrial genotypes, wild-type (M0) and 99 different types of deletions ranging from 100 bp (M1) to 9900 bp (M99). Note that the name indicates the size of the deletion. Other assumptions that have been made regarding mitochondrial mutations are: 1.

Deletion mutants can suffer from further deletion events (Mx→My, x0% mutants) at a given time. Under the mutation rate used in these simulations, all cells contained one or more mutants after 400 days. Since each simulation run computes the fate of the mtDNA population of a single cell over time, the ‘fraction of cells’ is identical to the fraction of simulation runs performed. The other contour lines represent higher levels of defective mtDNAs. The point marked by the arrow shows that after approx. 200 days, 60% of the cells had a mtDNA population consisting of at least 20% defective genomes. The other parameters used for this simulation are summarized in Table 1. No boost factor has been used (bF=1), i.e. defective mtDNA did not increase oxidative stress. Parameters ‘k’ and ‘c’, necessary for the calculation of the replication rate, were set to 5000 and 1000, respectively. Together with the 10 day half-life of mitochondrial DNA, this resulted in a mtDNA population size of approx. 5500 (data not shown). This is in good agreement with studies of skeletal and heart muscle that find values between 3000 and 7000 mtDNA molecules per cell (Miller, Rosenfeldt, Zhang, Linnane, & Nagley, 2003).

320

Mathematical Modeling of the Aging Process

Figure 4. Simulation results for a high mitochondrial mutation rate (6*10-7 day-1 kbp-1). A) Summary of the accumulation pattern of defective mitochondria obtained by following the fate of 1000 cells. The curves show the fraction of cells that contain more than 0, 20, 40 or 60% defective mitochondria, i.e. after 200 days roughly 60% of the cells had more then 20% of defective organelles (marked by arrow). B) Distribution of mitochondrial deletion sizes at four equally spaced time points during the life of a rat. Early in life (day 281) the distribution contains a large fraction of small deletions down to 0.5 kbp. As time progresses, these small deletions disappear until finally (day 1127) the distribution is practically free of deletions smaller than 3.5 kbp. The diagram is based on the results of 1000 simulation runs.

The diagram shown in Figure 4A summarizes the total number of defective genomes that accumulate with time, but does not differentiate among different deletion sizes. For this purpose the histogram of deletion sizes at four different time points (day 281 to day 1127) is shown in Figure 4B. As can be seen, early on many small deletions down to 0.5 kbp are present. But as time progresses, the shape of the distribution changes: small deletions disappear and larger deletions emerge. This resembles very closely the size distribution observed experimentally for old rats (Cao et al., 2001). It turns out that the model assumption that mutants can mutate again is responsible for the disappearance of small deletions over time.

321

Mathematical Modeling of the Aging Process

Table 1. Parameters and standard values used for the simulations Name

Value

baseRate

6*10 day kbp

Mutation rate per day and kbp. Order of magnitude is in accordance with (Shenkar et al., 1996).

bF

1

Factor by which the mutation rate is increased if 100% of the mitochondrial population are deletion mutants.

K

5000

If the number of mitochondria is equal to ‘k’, the synthesis rate of new organelles is half maximal. This is related to the number of mtDNAs per cell which ranges from 700 in sperm (Diez-Sanchez et al., 2002), 7000 in heart muscle (Miller et al., 2003) to 25000 in liver (Berdannier & Everts, 2001).

C

1000

degRate

ln(2)/10 day

-7

Description -1

-1

Maximum number of mitochondria that can be synthesized per day. -1

Degradation rate for all mtDNAs. Corresponding to a half-life of 10 days (Huemer, Lee, Reeves, & Bickert, 1971; Korr, Kurz, Seidler, Sommer, & Schmitz, 1998; Menzies & Gold, 1971).

C onclusion In the presented model description we omitted several of the actually performed simulations for brevity, but the main benefits of the modeling approach are clear. The stochastic approach is important to account for the probabilistic nature of mutations, which is likely to be responsible for the mosaic pattern of healthy and impaired cells seen in cross sections of tissues from old organisms. In some of the simulation runs, no mitochondrial mutants were present after 38 months, while in others a deletion event took place and the wild-type mtDNA was replaced by the mutant. A model composed of differential equations could not have captured such a pattern, since that approach is more equivalent to the experimental method of using tissue samples containing millions of cells. The result is in both cases an averaging effect, obscuring the true pattern of accumulation of mtDNA deletion mutants. Furthermore, the model (i) provides the inside that the lack of small deletions might be caused by several successive generations of mutants with increasing deletion size, (ii) it is able to explore several scenarios, which are inaccessible for experiments (high or low mutation rate, different influence of oxidative stress on mutation rate) and (iii) it makes the prediction that the size distribution should be quite different in young animals, with much more small deletions being present.

Tools f or S t ochastic

Mode ling

Most current modeling in systems biology is done using deterministic ordinary differential equations, because many tools exist for this type of modeling and the results are easier to interpret. But as discussed above, there are good reasons to perform stochastic simulations if molecule numbers are low. This approach, however, requires substantially more computing power, since many trajectories have to be simulated for a statistical analysis of the system. The number of software packages capable of stochastic simulations is slowly but constantly growing and in the following we will present a brief survey.

322

Mathematical Modeling of the Aging Process

D izzy ‘Dizzy’ (Figure 5) is the software tool we used for the mitochondrial model described above and it has several nice features that make it our favourite tool. It is written in Java and thus platform independent. This is very helpful in heterogeneous environments consisting of Linux/Unix and Windows machines. Furthermore, Dizzy has an easy to use GUI and the results can be directed to a data file or displayed graphically. Another useful feature is the separation of GUI and the number crunching routines. This made it possible for us to calculate thousands of model trajectories on our Linux cluster and analyse the results later. Dizzy not only contains various stochastic solvers (Gillespie direct method, GibsonBruck, τ-leap method), but also a number of deterministic ODE solvers. Without any modifications a model can be simulated stochastically or deterministically. This is very convenient for comparing the two different approaches and for obtaining a fast first view of the model behaviour (by using the ODE solver). A model can be defined in the de facto standard SBML (Systems Biology Markup Language)

Figure 5. Screenshot of the stochastic simulation software package ‘Dizzy’. Three different windows of the GUI are shown. The editor in the background displays a model description, whose simulation results are shown in the window at the top right. In the front window at the bottom the type of simulator (stochastic or deterministic) and the output destination (diagram, table, file) are chosen.

323

Mathematical Modeling of the Aging Process

or in a powerful model definition language called CMDL. This was essential for our simulations, since it enabled us to define 4950 mutation reactions with only five lines of code. Dizzy is developed by Stephen Ramsey at the Institute for Systems Biology and is freely available (http://magnet.systemsbiology.net/software/Dizzy).

Other T ools Copasi (http://www.copasi.org) is another popular tool that is also capable of stochastic (Gibson-Bruck) and deterministic simulations. Copasi can read and write SBML models and its major strength is the analysis of existing deterministic models. It performs metabolic control and steady state analysis, calculates Lyapunov exponents and can be used for model parameter estimation using time course or steady state data. Like Dizzy it can be used as a command line version for batch processing. Stocks 2 (http://www.sysbio.pl/stocks) can only perform stochastic simulations but contains, in addition to the standard solvers, also a hybrid algorithm for reaction systems that consist of a mixture of rare and frequent molecular species. Stocks models frequent species using an approximate algorithm and slow reactions with an exact Gillespie algorithm. Species are assigned dynamically to the frequent respectively rare group to take care of concentration changes over time. The Systems Biology Workbench (SBW) (Hucka et al., 2002) is a software infrastructure that enables different tools to communicate with each other (http://www.sys-bio.org). That means all SBW aware programs can use services provided by different modules and in turn advertise their own specialized services. A powerful SBW module that provides stochastic simulation and analysis functions has been developed by the Sauro group and can be downloaded from http://public.kgi.edu/~rrao. Popular model construction tools that are SBW aware are for instance JDesigner (included in SBW) or CellDesigner (http://www.celldesigner.org). The software packages discussed so far are only suitable for spatially homogeneous models, which implies a constant and immediate mixing of all participating species. For stochastic simulations of 3D reaction diffusion systems, MesoRD (Hattne, Fange, & Elf, 2005) is suitable. It is free software, written in C++ and implements the next subvolume method to simulate the Markov process corresponding to the reaction-diffusion master equation. It can be obtained from http://mesord.sourceforge.net.

Su r vey of mathema tica l mode ling in aging

research

While the section about the accumulation of defective mitochondria gave an in depth view of the development and use of a mathematical model for aging research, it is of course only one in a large number of models in this area of research. To provide the reader with a broader picture of the types of models that exist and the types of problems that are tackled, we close this chapter with a brief survey of selected models from the literature. The interaction between oxygen radicals and mitochondria plays a very important role in many aging theories and one of the most complete models of oxidative membrane damage to mitochondria has been developed by Antunes et al. (1996). They developed a system of ordinary differential equations describing more than 80 reactions of lipid metabolism in the inner mitochondrial membrane and surrounding matrix environment. Apart from being an invaluable source of kinetic parameters the main result is that the perhydroxyl radical is the main initiator of lipid peroxidation.

324

Mathematical Modeling of the Aging Process

Another publication dealing with mitochondria is by Albert et al. (1996). They model the dynamics of plant mitochondrial genomes, which are composed of a set of molecules of various sizes that generate each other through recombination between repeated sequences. Their stochastic model describes the selection process at the inter-molecular, inter-mitochondrial and inter-cellular level. They show that the inter-mitochondrial level is important for maintaining the entire mitochondrial information in cells. Under those conditions no master circle with maximum fitness is necessary. Since aging is a process that comes about by the interaction of several damage pathways (reflected by the different theories), it is necessary to model the reaction network as a whole. The model of Kowald & Kirkwood (1996) integrates the contributions of defective mitochondria, aberrant proteins and free radicals. It also includes antioxidant enzymes and proteolytic scavengers. The most important result is, that damage accumulation in mitochondria and proteins occurs on different time scales and that the final breakdown seems to be a cooperation of mitochondrial and cytoplasmic reactions. The mitochondria undergo gradual, long term changes, which eventually trigger a short lived cytoplasmic error loop. A rather unusual phenomenon has been observed in Saccharomyces cerevisiae, which are also used as model system for aging. Yeast mother cells have a limited division potential, while young daughter cells start with a fresh division capacity. It has been observed that extrachromosomal ribosomal DNA circles (ERCs) liberate from genomic DNA and accumulate in old yeast cells. A mathematical model was developed that readily explains the observed data, if ERC formation increases with the age of the cell (C. S. Gillespie et al., 2004). Finally, mathematical models have also been used to investigate evolutionary questions about the aging process. The evolution of human menopause is difficult to explain. It has been suggested that there may be little benefit for an older mother in taking the increasing risk of a further pregnancy if existing children depend critically on her survival. Another idea is that post-reproductive grandmothers increase their fitness by assisting their adult daughters. Modeling studies showed that individual theories fail to provide sufficient selection advantage to explain the evolution of menopause, but a combined model can achieve this (Shanley & Kirkwood, 2001). And of course also the evolution of the aging process itself has been modeled. It is not trivial to explain why organisms should grow old and die. What is the selective advantage of this trait and why have different species widely differing life spans ? The disposable soma theory (T. B. L Kirkwood & Holliday, 1986; T. B. L. Kirkwood & Rose, 1991) shows mathematically that aging can be explained as the consequence of an optimal resource allocation between survival and reproduction. The optimal resource allocation (and hence aging rate) differs for different species according to their environmental mortality risk. Mathematical models have been used for many years in aging research to understand phenomena and test explicit predictions of theories. Because aging practically affects all pathways and all levels of a living organism, it is a prime candidate for the emerging field of systems biology. The generation of high throughput data will enable the development of larger models that describe the complex network of interactions underlying the different aging theories.

R eferences Albert, B., Godelle, B., Atlan, A., De Paepe, R., & Gouyon, P. H. (1996). Dynamics of plant mitochondrial genome: Model of a three level selection process. Genetics, 144, 369-382.

325

Mathematical Modeling of the Aging Process

Antunes, F., Salvador, A., Marinho, H. S., Alves, R., & Pinto, R. E. (1996). Lipid peroxidation in mitochondrial inner membranes. I. An integrative kinetic model. Free Radical Biology & Medicine, 21(7), 917-943. Arimura, S., Yamamoto, J., Aida, G. P., Nakazono, M., & Tsutsumi, N. (2004). Frequent fusion and fission of plant mitochondria with unequal nucleoid distribution. Proc Natl Acad Sci USA, 101(20), 7805-7808. Berdannier, C. D., & Everts, H. B. (2001). Mitochondrial DNA in aging and degenerative disease. Mutation Research, 475, 169-183. Cao, Z., Wanagat, J., McKiernan, S. H., & Aiken, J. M. (2001). Mitochondrial DNA deletion mutations are concomitant with ragged red regions of individual, aged muscle fibers: Analysis by laser-capture microdissection. Nucleic Acids Research, 29(21), 4502-4508. Clayton, D. A. (2003). Mitochondrial DNA replication: What we know. IUBMB Life, 55(4-5), 213-217. Cortopassi, G. A., Shibata, D., Soong, N. W., & Arnheim, N. (1992). A pattern of accumulation of a somatic deletion of mitochondrial DNA in aging human tissues. Proc. Natl. Acad. Sci. USA, 89, 73707374. de Grey, A. D. N. J. (1997). A proposed refinement of the mitochondrial free radical theory of aging. BioEssays, 19(2), 161-166. Diez-Sanchez, C., Ruiz-Pesini, E., Lapena, A. C., Montoya, J., Perez-Martos, A., Enriquez, A., et al. (2002). Mitochondrial DNA Content of Human Spermatozoa. Biology of Reproduction, 68, 180-185. Gillespie, C. S., Proctor, C. J., Boys, R. J., Shanley, D. P., Wilkinson, D. J., & Kirkwood, T. B. L. (2004). A mathematical model of ageing in yeast. J. of Theoretical Biology. Gillespie, D. T. (1977). Exact stochastic simulation of coupled chemical reactions. J. of Physical Chemistry, 81, 2340-2361. Gokey, N. G., Cao, Z., Pak, J. W., Lee, D., McKiernan, S. H., McKenzie, D., et al. (2004). Molecular analyses of mtDNA deletion mutations in microdissected skeletal muscle fibers from aged rhesus monkeys. Aging Cell, 3(5), 319-326. Gompertz, B. (1825). On the nature of the function expressive of the law of human mortality and on a new mode of determining life contingencies. Philosophical Transactions of the Royal Society, 2, 513-585. Harley, C. B. (1991). Telomere loss: Mitotic clock or genetic time bomb? Mutation Research, 256, 271282. Harley, C. B., Vaziri, H., Counter, C. M., & Allsopp, R. C. (1992). The telomere hypothesis of cellular aging. Experimental Gerontology, 27, 375-382. Hattne, J., Fange, D., & Elf, J. (2005). Stochastic reaction-diffusion simulation with MesoRD. Bioinformatics, 21(12), 2923-2924. Hattori, K., Tanaka, M., Sugiyama, S., Obayashi, T., Ito, T., Satake, T., et al. (1991). Age-dependent increase in deleted mitochondrial DNA in the human heart: Possible contributory factor to presbycardia. American Heart Journal, 121(6), 1735-1742. 326

Mathematical Modeling of the Aging Process

Hucka, M., Finney, A., Sauro, H. M., Bolouri, H., Doyle, J., & Kitano, H. (2002). The ERATO Systems Biology Workbench: Enabling interaction and exchange between software tools for computational biology. Pac Symp Biocomput, 450-461. Hucka, M., Finney, A., Sauro, H. M., Bolouri, H., Doyle, J. C., Kitano, H., et al. (2003). The systems biology markup language (SBML): A medium for representation and exchange of biochemical network models. Bioinformatics, 19(4), 524-531. Huemer, R. P., Lee, K. D., Reeves, A. E., & Bickert, C. (1971). Mitochondrial studies in senescent mice - II. Specific activity, bouyant density, and turnover of mitochondrial DNA. Experimental Gerontology, 6, 327-334. Jendrach, M., Pohl, S., Vöth, M., Kowald, A., Hammerstein, P., & Bereiter-Hahn, J. (2005). Morphodynamic changes of mitochondria during ageing of human endothelial cells. Mechanisms of Ageing and Development, 126, 813-821. Karbowski, M., Arnoult, D., Chen, H., Chan, D. C., Smith, C. L., & Youle, R. J. (2004). Quantitation of mitochondrial dynamics by photolabeling of individual organelles shows that mitochondrial fusion is blocked during the Bax activation phase of apoptosis. J Cell Biol, 164(4), 493-499. Khrapko, K., Bodyak, N., Thilly, W. G., van Orsouw, N. J., Zhang, X., Coller, H. A., et al. (1999). Cell by cell scanning of whole mitochondrial genomes in aged human heart reveals a significant fraction of myocytes with clonally expanded deletions. Nucleic Acids Research, 27(11), 2434-2441. Kirkwood, T. B. L., & Holliday, R. (1986). Ageing as a consequence of natural selection. In A. H. Bittles & K. J. Collins (Eds.), The biology of human ageing (pp. 1-15). Cambridge University Press. Kirkwood, T. B. L., & Rose, M. R. (1991). Evolution of senescence: Late survival sacrificed for reproduction. Philosophical Transactions of the Royal Society, London B, 332, 15-24. Korr, H., Kurz, C., Seidler, T. O., Sommer, D., & Schmitz, C. (1998). Mitochondrial DNA synthesis studied autoradiographically in various cell types in vivo. Braz J Med Biol Res, 31(2), 289-298. Kowald, A. (2002). Lifespan does not measure ageing. Biogerontology, 3, 187-190. Kowald, A., Jendrach, M., Pohl, S., Bereiter-Hahn, J., & Hammerstein, P. (2005). On the relevance of mitochondrial fusions for the accumulation of mitochondrial deletion mutants: A modelling study. Aging Cell, in press. Kowald, A., & Kirkwood, T. B. L. (1996). A network theory of ageing: The interactions of defective mitochondria, aberrant proteins, free radicals and scavengers in the ageing process. Mutation Research, 316, 209-236. Kowald, A., & Kirkwood, T. B. L. (2000). Accumulation of defective mitochondria through delayed degradation of damaged organelles and its possible role in the ageing of post-mitotic and dividing cells. J. of Theoretical Biology, 202, 145-160. Linnane, A. W., Baumer, A., Maxwell, R. J., Preston, H., Zhang, C., & Marzuki, S. (1990). Mitochondrial gene mutation: The ageing process and degenerative diseases. Biochemistry International, 22(6), 1067-1076.

327

Mathematical Modeling of the Aging Process

Linnane, A. W., Marzuki, S., Ozawa, T., & Tanaka, M. (1989). Mitochondrial DNA mutations as an important contributor to ageing and degenerative diseases. The Lancet, 333, 642-645. Lundblad, V., & Szostak, J. W. (1989). A mutant with a defect in telomere elongation leads to senescence in yeast. Cell, 57, 633-643. Makeham, W. H. (1867). On the law of mortality. J. Inst. Actuaries, 13, 325-358. Medvedev, Z. A. (1990). An attempt at a rational classification of theories of ageing. Biological Reviews, 65, 375-398. Menzies, R. A., & Gold, P. H. (1971). The turnover of mitochondria in a variety of tissues of young adult and aged rats. J. of Biological Chemistry, 246(8), 2425-2429. Miller, F. J., Rosenfeldt, F. L., Zhang, C., Linnane, A. W., & Nagley, P. (2003). Precise determination of mitochondrial DNA copy number in human skeletal and cardiac muscle by a PCR-based assay: Lack of change of copy number with age. Nucleic Acids Res, 31(11), e61. Miquel, J., Economos, A. C., Fleming, J., & Johnson, J. E. (1980). Mitochondrial role in cell ageing. Experimental Gerontology, 15, 575-591. Nunnari, J., Marshall, W. F., Straight, A., Murray, A., Sedat, J. W., & Walter, P. (1997). Mitochondrial transmission during mating in Saccharomyces cerevisiae is determined by mitochondrial fusion and fission and the intramitochondrial segregation of mitochondrial DNA. Molecular Biology of the Cell, 8, 1233-1242. Oeppen, J., & Vaupel, J. W. (2002). Broken limits to life expectancy. Science, 296, 1029-1031. Olovnikov, A. M. (1973). A theory of Marginotomy. J. of Theoretical Biology, 41, 181-190. Ramsey, S., & Orrell, D. (2005). Dizzy: Stochastic simulations of large-scale genetic regulatory networks. J. Bioinf. Comp. Biol., 3(2), 1-21. Randerath, K., Randerath, E., & Filburn, C. (1996). Genomic and mitochondrial DNA alterations in aging. In L. E. Schneider & J. W. Rowe (Eds.), Handbook of The Biology of Aging (4th ed., pp. 198-214). London: Academic Press. Shanley, D. P., & Kirkwood, T. B. (2001). Evolution of the human menopause. Bioessays, 23(3), 282287. Shenkar, R., Navidi, W., Tavare, S., Dang, M. H., Chomyn, A., Attardi, G., et al. (1996). The mutation rate of the human mtDNA deletion mtDNA4977. American J. of Human Genetics, 59(4), 772-780. Takai, D., Inoue, K., Goto, Y., Nonaka, I., & Hayashi, J. (1997). The interorganellar interaction between distinct human mitochondria with deletion mutant mtDNA from a patient with mitochondrial disease and with HeLa mtDNA. J. of Biological Chemistry, 272(9), 6028-6033. Takai, D., Isobe, K., & Hayashi, J.-I. (1999). Transcomplementation between different types of respiration deficient mitochondria with different pathogenic mutant mitochondrial DNAs. J. of Biological Chemistry, 274(16), 11199-11202.

328

Mathematical Modeling of the Aging Process

Tapper, D. P., & Clayton, D. A. (1981). Mechanism of replication of human mitochondrial DNA. Localization of the 5’ ends of nascent daughter strands. J Biol Chem, 256(10), 5109-5115. von Zglinicki, T., Saretzki, G., Docke, W., & Lotze, C. (1995). Mild hyperoxia shortens telomeres and inhibits proliferation of fibroblasts. A model for senescence. Experimental Cell Research, 220(1), 186193. Watson, J. D. (1972). Origin of concatameric T4 DNA. Nature, 239, 197-201. Yu, G.-L., Bradley, J. D., Attardi, L. D., & Blackburn, E. H. (1990). In vivo alteration of telomere sequences and senescence caused by mutated Tetrahymena telomerase RNAs. Nature, 344, 126-131.

K ey T erms Aging: A biological phenomenon observed in most animals leading to increasing functional impairment and constantly rising mortality rate. Age related changes can be observed at intracellular, tissue and organismic level. Many theories about the mechanism of the aging process exist, but the details are currently still unresolved. Disposable Soma Theory: Popular theory about the evolution of the aging process. Aging is explained as the result of an optimal resource allocation between reproduction and self-maintenance. That means, aging itself has no selection advantage, but is a side product of another selected trait. Species specific life-spans are readily explained by different environmental mortalities. Dizzy: A stochastic simulation tool written in Java. Models can be defined in systems biology markup language (SBML) or a proprietary language and simulated using various stochastic and deterministic algorithms. The GUI and the core engine are separate modules so that Dizzy can also be used for batch calculations on a computer cluster. Life Expectancy: Time until 50% of a cohort of newborn individual have died. Also known as average life-span, although technically it is the median life-span. The life expectancy for humans in industrialized countries is currently between 75 and 80 years, and for women 2-3 years higher than for man. Mitochondria: Cellular organelles present in most eukaryotic cells that are important for calcium homeostasis, apoptosis and energy production. Mitochondria are endosymbionts and probably derived from purple bacteria. A remnant of this origin is the small circular mitochondrial DNA (mtDNA) that is at the center of the mitochondrial theory of aging. Stochastic Modeling: A modeling framework that takes care of microscopic random fluctuations and the discreteness of molecules. Stochastic models explicitly calculate the change of the number of molecules of the participating species during the time course of a chemical reaction. The first exact stochastic simulation algorithms were developed by Gillespie (1977) and are now part of several modeling tools. Stochastic simulations are normally more time consuming than deterministic simulations via differential equations.

329

Mathematical Modeling of the Aging Process

Systems Biology Workbench: The Systems Biology Workbench (SBW) is a software systems that enables different modeling programs to communicate with each other and provide or use specialized analysis services. In this way SBW acts as broker for services like deterministic and stochastic simulation engines, stability and bifurcation analysis, model optimization and graphical model building. Popular tools that are SBW aware are among others JDesigner, CellDesigner and Dizzy.

330

331

Chapter XIX

The Sebaceous Gland: A Model of Hormonal Aging Evgenia Makrantonaki Dessau Medical Center, Germany and Charité Universitaetsmedizin Berlin, Germany Christos C. Zouboulis Dessau Medical Center, Germany and Charité Universitaetsmedizin Berlin, Germany

abstract This chapter introduces an in vitro model as a means of studying human hormonal aging. For this purpose, human sebaceous gland cells were maintained under a hormone-substituted environment. This environment consisted of growth factors and sex steroids in concentrations corresponding to those circulating in young and postmenopausal women. The authors suggest that hormone decline, occurring with age, may play a significant role not only in the maintenance of skin homeostasis but also in the initiation of aging. Furthermore, skin, the largest organ of the body, offers an alternative approach to understanding the molecular mechanisms underlining the aging process.

SKIN AGING AND H ORM ONES Signs of aging become evident with time, whereas skin provides the first obvious evidence of this process. Since the collection of specimens from internal organs, such as brain, heart, vessels, bones and endocrine glands throughout life for experimental research purposes is associated with major practical and ethical obstacles in humans, interspecies research but also the use of human skin as a common research tool offer promising alternative approaches. Among multiple factors been involved in the process of skin aging the hormone environment plays a distinct role (Makrantonaki & Zouboulis, 2007). Alterations in appearance due to declining skin quality

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

The Sebaceous Gland

are common complaints in postmenopausal women. The postmenopausal skin state is associated with a rapid worsening of skin structure and functions, which can be at least partially repaired by hormone replacement therapy (HRT) or local estrogen treatment (Brincat, 2000). Improvement of epidermal skin moisture, elasticity and skin thickness (Fuchs, Solis, Tapawan, & Paranjpe, 2003), enhanced production of surface lipids (Sator, Schmidt, Sator, Huber, & Honigsmann, 2001), reduction of wrinkle depth, restoration of collagen fibers (Schmidt, Binder, Demschik, Bieglmayer, & Reiner, 1996) and increase of the collagen III/I ratio (Affinito et al., 1999) have been reported. Further potential benefits of longterm HRT are the prevention of osteoporosis and atherosclerotic cardiovascular diseases (Hulley et al., 1998). There has been considerable interest in the possibility that HRT may also be protective against the risk of developing neurodegenerative diseases e.g. Morbus Alzheimer. This remains controversial and the benefit is at present unproven (Yaffe, Sawaya et al., 1988). Conventional contraindications to HRT include a history of breast cancer or endometrial cancer, recent undiagnosed genital bleeding, active, severe liver disease or a history of thromboembolism. In addition, several current studies, which have shown that the unwished effects are more serious and severe than the advantageous ones have entirely changed the strategy of HRT and limited it in certain cases only (Rossouw et al., 2002; Solomon & Dluhy, 2003)

THE SEBACE OUS G LAND Sebaceous glands or holocrine glands are skin appendages and are found over the entire surface of the body except the palms, soles and dorsum of the feet. They are largest and most concentrated in the face and scalp where they are the sites prone for acne. The normal function of sebaceous glands is to produce and secrete sebum, a group of complex oils including triglycerides and fatty acid breakdown products, wax esters, squalene, cholesterol esters and cholesterol (Downing et al., 1987; Nikkari, Schreibman, & Ahrens, 1974; Ramasastry, Downing, Pochi, & Strauss, 1970; Thody & Shuster, 1989). The most accepted function of sebum is skin lubrication in order to protect it against friction and to make it more impervious to moisture. Furthermore, sebum lipids transport antioxidants in and on the skin and exhibit a natural light protective activity. They exhibit an innate antibacterial activity and have a pro- and anti-inflammatory function. The sebaceous gland can regulate the activity of xenobiotics and is actively involved in the wound healing process (Zouboulis, 2004). It possesses all enzymes required for the intracellular androgen metabolism and confers upon the skin an independent endocrine function (Fritsch, Orfanos, & Zouboulis, 2001). With advancing age the size of sebaceous gland cells tends to decrease, while their number remains approximately the same throughout life (Zouboulis & Boschnakow, 2001). Sebaceous gland cells show an age-related reduced secretory output, which results in a decrease in the surface lipid levels and skin xerosis (Engelke, Jensen, Ekanayake-Mudiyanselage, & Proksch, 1997; Pochi, Strauss, & Downing, 1979) - a major characteristic of aged skin. Hormone substitution with estrogens in vivo could significantly reverse skin xerosis indicating a hormone-dependent function of the sebaceous gland cells (Dunn, Damesyn, Moore, Reuben, & Greendale, 1997). Human SZ95 sebocytes are sebaceous gland cells derived from facial skin and transfected with the SV-40 large T antigen and offer a unique model for investigations on the physiology of aging. They constitute a better alternative to animal research and they functionally behave in a manner concomitant

332

The Sebaceous Gland

Figure 1. Illustration of a human sebaceous gland connected to a hair follicle on the skin surface (face) of a 70-year old man. The sebaceous gland constitutes of sebaceous gland cells which are responsible for the sebum production.

to nontransfected human sebocytes. SZ95 sebocytes show a similar epithelial morphology to normal sebocytes and they can produce squalene and wax esters, as well as triglycerides and free fatty acids, even after 25-40 passages (Patents and patent applications: WO0046353, EP1151082, AU770518, US2002034820, CA2360762, CN100366735C, JP2002535984, IL144683D, PL194865, HU0200048, AT1151082, BE1151082, CH11151082, DE19903920, DK1151082, FR1151082, GB1151082, IE1151082, IT1151082, KR689120) (Zouboulis, Seltmann, Neitzel, & Orfanos, 1999).

IN VITR O MODE L OF H UMAN H ORM ONA L AGING Using models of animal aging, such as the nematode Caenorrhabditis elegans, the fly Drosophila melanogaster, and the mouse Mus musculus, the importance of hormonal signals on the aging phenotype has been already documented. Suppression of the levels of hormones, such as insulin-like peptides, growth hormone (GH) and sterols (Tatar, Bartke, & Antebi, 2003) or of their receptor expression has been shown in animals to increase lifespan and delay age-dependent functional decline. Conboy et al. (2005) showed that the age-related decline of progenitor cell activity of mice could be reversed by

333

The Sebaceous Gland

exposure to young serum and that the cells could retain much of their intrinsic proliferative potential underlining the great importance of the systemic environment (Conboy et al., 2005). Within the scope of the Explorative Project ‘Genetic aetiology of human longevity’ supported by the German National Genome Research Network 2 (NGFN-2) an in vitro model of human hormonal aging has been developed. Human sebaceous gland cells (SZ95 sebocytes) were maintained under a hormone-substituted environment consisting of growth hormone (GH), insulin-like growth factor I, estrogens, androgens and progesterone in concentrations corresponding to those circulating in 20- and in 60-year-old women (Makrantonaki et al., 2006). Upon 15,529 tested genes 899 genes showed a differential expression between SZ95 sebocytes under the 20- and 60-year-old hormone mixture, respectively. This result demonstrates that hormones interact in a complex fashion, and changes in their circulating blood levels may significantly alter the development of cells by regulating their transcriptome. Among the 899 genes, genes were regulated, which are involved in stress response, chaperone activity, ubiquitine-proteosome activity, cholesterol biosynthesis and fatty acid metabolism, eicosanoid biosynthesis, synthesis of extracellular matrix, nucleotides and ATP metabolism, and DNA repair mechanisms - biological processes which are hallmarks of aging. The most significantly altered signaling pathway identified was that of transforming growth factor-β (TGF-β). The TGF-β signaling pathway is involved in different biological processes during embryonic development and plays a distinct role in adult organisms in tissue homeostasis (Massague, 1998). In human skin, the TGF-β signaling pathway has been shown to regulate many cellular processes, such as differentiation and proliferation of keratinocytes and fibroblasts and the synthesis of extracellular matrix proteins (Massague, Freidenberg, Olefsky, & Czech, 1983). In addition, a disturbed function of this cascade has been associated with tumorigenesis, i.e. in pancreatic, prostate, intestine, breast, and uterine cancer (Levy & Hill, 2006). A differential expression of TGF-β isoforms, activins, basal membrane proteins, MADHs/SMADs, and other components of the TGF-β signaling cascade was shown at SZ95 sebocytes under the 60-year-old hormone mixture. These data suggest that age-specific hormonal changes are likely to play a determining role not only in the healthy aging process, but also in tumorigenesis. Interestingly, genes expressed in signaling pathways operative in age-associated diseases such as Huntington’s disease (Luthi-Carter et al., 2002; Sipione et al., 2002), dentatorubral-pallidoluysian atrophy (Luthi-Carter et al., 2002), and amyotrophic lateral sclerosis (Jiang et al., 2005) were also identified. According to these results, a disturbed hormone status may act a part into the generation of neurodegenerative diseases.

C ONC LUSI ON The fundamental aim of the aging research is the better understanding of the mechanisms involved and the prevention of age-associated diseases by early identification of individual molecular risk profiles. Recent data suggest that skin represents an adequate model for aging research and that change of hormone levels occurring with age plays a major role in the generation of aging. Thus, these results could be a basis for an integrated and interdisciplinary approach to the analysis of aging.

334

The Sebaceous Gland

REFERENCES Affinito, P., Palomba, S., Sorrentino, C., Di Carlo, C., Bifulco, G., Arienzo, M. P., et al. (1999). Effects of postmenopausal hypoestrogenism on skin collagen. Maturitas, 33(3), 239-247. Brincat, M. P. (2000). Hormone replacement therapy and the skin. Maturitas, 35(2), 107-117. Conboy, I. M., Conboy, M. J., Wagers, A. J., Girma, E. R., Weissman, I. L., & Rando, T. A. (2005). Rejuvenation of aged progenitor cells by exposure to a young systemic environment. Nature, 433(7027), 760-764. Downing, D. T., Stewart, M. E., Wertz, P. W., Colton, S. W., Abraham, W., & Strauss, J. S. (1987). Skin lipids: An update. J Invest Dermatol, 88(3 Suppl), 2s-6s. Dunn, L. B., Damesyn, M., Moore, A. A., Reuben, D. B., & Greendale, G. A. (1997). Does estrogen prevent skin aging? Results from the First National Health and Nutrition Examination Survey (NHANES I). Arch Dermatol, 133(3), 339-342. Engelke, M., Jensen, J. M., Ekanayake-Mudiyanselage, S., & Proksch, E. (1997). Effects of xerosis and ageing on epidermal proliferation and differentiation. Br J Dermatol, 137(2), 219-225. Fritsch, M., Orfanos, C. E., & Zouboulis, C. C. (2001). Sebocytes are the key regulators of androgen homeostasis in human skin. J Invest Dermatol, 116(5), 793-800. Fuchs, K. O., Solis, O., Tapawan, R., & Paranjpe, J. (2003). The effects of an estrogen and glycolic acid cream on the facial skin of postmenopausal women: A randomized histologic study. Cutis, 71(6), 481-488. Hulley, S., Grady, D., Bush, T., Furberg, C., Herrington, D., Riggs, B., et al. (1998). Randomized trial of estrogen plus progestin for secondary prevention of coronary heart disease in postmenopausal women. Heart and Estrogen/progestin Replacement Study (HERS) Research Group. Jama, 280(7), 605-613. Jiang, Y. M., Yamamoto, M., Kobayashi, Y., Yoshihara, T., Liang, Y., Terao, S., et al. (2005). Gene expression profile of spinal motor neurons in sporadic amyotrophic lateral sclerosis. Ann Neurol, 57(2), 236-251. Levy, L., & Hill, C. S. (2006). Alterations in components of the TGF-beta superfamily signaling pathways in human cancer. Cytokine Growth Factor Rev, 17(1-2), 41-58. Luthi-Carter, R., Strand, A. D., Hanson, S. A., Kooperberg, C., Schilling, G., La Spada, A. R., et al. (2002). Polyglutamine and transcription: Gene expression changes shared by DRPLA and Huntington’s disease mouse models reveal context-independent effects. Hum Mol Genet, 11(17), 1927-1937. Makrantonaki, E., Adjaye, J., Herwig, R., Brink, T. C., Groth, D., Hultschig, C., et al. (2006). Age-specific hormonal decline is accompanied by transcriptional changes in human sebocytes in vitro. Aging Cell, 5(4), 331-344. Makrantonaki, E., & Zouboulis, C. C. (2007). William J. Cunliffe Scientific Awards. Characteristics and pathomechanisms of endogenously aged skin. Dermatology, 214(4), 352-360.

335

The Sebaceous Gland

Massague, J. (1998). TGF-beta signal transduction. Annu Rev Biochem, 67, 753-791. Massague, J., Freidenberg, G. F., Olefsky, J. M., & Czech, M. P. (1983). Parallel decreases in the expression of receptors for insulin and insulin-like growth factor I in a mutant human fibroblast line. Diabetes, 32(6), 541-544. Nikkari, T., Schreibman, P. H., & Ahrens, E. H., Jr. (1974). In vivo studies of sterol and squalene secretion by human skin. J Lipid Res, 15(6), 563-573. Pochi, P. E., Strauss, J. S., & Downing, D. T. (1979). Age-related changes in sebaceous gland activity. J Invest Dermatol, 73(1), 108-111. Ramasastry, P., Downing, D. T., Pochi, P. E., & Strauss, J. S. (1970). Chemical composition of human skin surface lipids from birth to puberty. J Invest Dermatol, 54(2), 139-144. Rossouw, J. E., Anderson, G. L., Prentice, R. L., LaCroix, A. Z., Kooperberg, C., Stefanick, M. L., et al. (2002). Risks and benefits of estrogen plus progestin in healthy postmenopausal women: Principal results From the Women’s Health Initiative randomized controlled trial. Jama, 288(3), 321-333. Sator, P. G., Schmidt, J. B., Sator, M. O., Huber, J. C., & Honigsmann, H. (2001). The influence of hormone replacement therapy on skin ageing: A pilot study. Maturitas, 39(1), 43-55. Schmidt, J. B., Binder, M., Demschik, G., Bieglmayer, C., & Reiner, A. (1996). Treatment of skin aging with topical estrogens. Int J Dermatol, 35(9), 669-674. Sipione, S., Rigamonti, D., Valenza, M., Zuccato, C., Conti, L., Pritchard, J., et al. (2002). Early transcriptional profiles in huntingtin-inducible striatal cells by microarray analyses. Hum Mol Genet, 11(17), 1953-1965. Solomon, C. G., & Dluhy, R. G. (2003). Rethinking postmenopausal hormone therapy. N Engl J Med, 348(7), 579-580. Tatar, M., Bartke, A., & Antebi, A. (2003). The endocrine regulation of aging by insulin-like signals. Science, 299(5611), 1346-1351. Thody, A. J., & Shuster, S. (1989). Control and function of sebaceous glands. Physiol Rev, 69(2), 383416. Zouboulis, C. C. (2004). Acne and sebaceous gland function. Clin Dermatol, 22(5), 360-366. Zouboulis, C. C., & Boschnakow, A. (2001). Chronological ageing and photoageing of the human sebaceous gland. Clin Exp Dermatol, 26(7), 600-607. Zouboulis, C. C., Seltmann, H., Neitzel, H., & Orfanos, C. E. (1999). Establishment and characterization of an immortalized human sebaceous gland cell line (SZ95). J Invest Dermatol, 113(6), 1011-1020.

336

The Sebaceous Gland

KEY TERMS Aging: A complex process that defines the changes observed throughout the organism’s lifespan and cannot be defined by a single pathway or a single cause. Aging is controlled by both environmental factors and the genetic constitution of the individual and has been described as a progressive decline of the ability to withdraw stress, damage and disease. Furthermore, it is characterized by an increase of degenerative and neoplastic disorders. Endogenous Skin Aging: Endogenous aging, otherwise called intrinsic or chronological aging, is influenced by genetics, hormonal changes and metabolic processes, which appear at advanced age. Endogenous skin aging can be viewed on non UV-exposed areas of the body and can be considered as model of the aging process taking place in internal organs. Exogenous Skin Aging: Exogenous aging, otherwise called extrinsic aging, takes place in exposed areas of the body (e.g. head, neck) which are constantly influenced by various environmental factors including ionizing and non-ionizing irradiation, air pollution, natural deleterious gases (e.g. ozone and high concentrations of oxygen), smoking, invasion of pathogenic bacteria, viruses, xenobiotics and mechanical stress. Among them UV-irradiation is the most fundamental one, as it can damage skin to such an extent, that makes it seem prematurely aged (photoaging). This premature aging process is cumulative with sun exposure and affects more individuals of skin phototypes I and II. Hormone: (from Greek όρμή - “to set in motion”) A chemical messenger from one cell (or group of cells) to another. The function of hormones is to serve as a signal to the target cells. Endocrine hormone molecules are secreted (released) directly into the bloodstream, while exocrine hormones (or ectohormones) are secreted directly into a duct, and from the duct they either flow into the bloodstream or they flow from cell to cell by diffusion in a process known as paracrine signaling. Skin: The largest organ of the body, exhibits multiple functions, among them it serves as a protective barrier between internal organs and the environment and is a complex organ with multiple cell types and structures. It is divided into three major compartments: epidermis, dermis and subcutaneous tissue. Sebaceous Glands: Can usually be found in hair-covered areas where they are connected to hair follicles to deposit sebum on the hairs, and bring it to the skin surface along the hair shaft. The structure consisting of hair, hair follicle and sebaceous gland is known as pilosebaceous unit. They are largest and most concentrated in the face and scalp where they are the sites prone for acne. Sebum: (Latin, meaning fat or tallow) Is produced by sebaceous glands and its main function is to protect and waterproof hair and skin, and keep them from becoming dry, brittle, and cracked. It can also inhibit the growth of microorganisms on skin. In the sebaceous glands, sebum is produced within specialized cells and is released as these cells burst; sebaceous glands are thus classified as holocrine glands. In humans, the composition of sebum is as follows: 25% wax monoesters, 41% triglycerides, 16% free fatty acids and 12% squalene. SZ95 Sebocytes: Are sebaceous gland cells derived from facial skin and transfected with the SV-40 large T antigen. They functionally behave in a manner concomitant to nontransfected human sebaceous gland cells.

337

Section VI

Systems Biology Applications in Medicine

339

Chapter XX

Systems Biology Applied to Cancer Research R. Seigneuric GROW Research Institute, University of Maastricht, The Netherlands N.A.W. van Riel Eindhoven University of Technology, The Netherlands M.H.W. Starmans GROW Research Institute, University of Maastricht, The Netherlands

C.T.A. Evelo University of Maastricht, The Netherlands B.G. Wouters GROW Research Institute, University of Maastricht, The Netherlands P. Lambin GROW Research Institute, University of Maastricht, The Netherlands

A. van Erk University of Maastricht, The Netherlands

abstract Complex diseases such as cancer have multiple origins and are therefore difficult to understand and cure. Highly parallel technologies such as DNA microarrays are now available. These provide a data deluge which needs to be mined for relevant information and integrated to existing knowledge at different scales. Systems Biology is a recent field which intends to overcome these challenges by combining different disciplines and provide an analytical framework. Some of these challenges are discussed in this chapter.

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Systems Biology Applied to Cancer Research

Intr od ucti on Systems Biology is emerging as a promising answer to the increasing need for analytical approaches in molecular medicine. Its goal includes modeling interactions, understanding the behavior of a system from interplay of its components, inferring models from data, data integration, confronting the prediction of the model to data, proposing most promising experiments. Solutions to these challenges are often interdisciplinary, and Systems Biology intends to provide such a framework beyond scientific communities ‘dialects’ or differences in approaches (Lazebnik, 2004). Cancer is too complex a disease to be solely and completely described by the existing clinical variables (e.g.: age of the patient, size of the tumor, histological grade, etc.) which are currently used in practice. It is therefore necessary to identify new biomarkers which will provide additional information about the cancer type, origin, or aggressiveness for instance. Within a decade, high-throughput assays have revolutionized biology and are now being introduced in the clinic. Among these techniques, we focus on DNA microarrays which can monitor the expression of tens of thousands of genes in parallel and offer a means to individualize treatment. This should contribute to guide clinicians toward tailored therapies which will lead to reduced over treatments and costs by an improved prognosis, the design of targeted drugs, as well as more accurate application of drugs. Since this is quite a recent field where each analysis requires a large number of steps, consensus has not yet been reached. Furthermore, researchers involved come from various backgrounds (e.g.: Statistics, Engineering, Biology …). Applying tools from all these fields result in a wide spectrum of approaches that may be confusing at first. Nevertheless there are some trends in the biomedical research community that we review in this chapter in the context of cancer. The outline of the chapter is meant to follow a practical analysis pipeline and URLs for accessing resources (i.e.: softwares and data) are provided in Table 1.

W ha t is a Micr oarra y? Quite suited to monitor many genes at once, a DNA microrarray is an inert, solid, flat and transparent surface (e.g.: a microscopic slide) onto which 20,000 to 60,000 short DNA reporters (often called probes) of specified sequences are orderly tethered. Each reporter on the microrarray corresponds to a particular short section of a gene. More and more, a single gene (e.g.: VEGF) is covered by several reporters which span different parts of the gene sequence. Firstly available in the mid 1990’s, companies are nowadays developing micorarrays with increased feature density (i.e.: the number of molecular detectors per array) to scan the genome at regular intervals (‘tiling’ arrays) that are re-usable for instance.

A Micr oarra y E xperiment After a careful experiment design (Kerr & Churchill, 2001; Y. H. Yang & Speed, 2002) to start with, biological samples are collected either from an in vitro or an in vivo experiment. Then, the RNA is extracted and labelled (e.g.: with a fluorescent dye). The central reaction is when the labelled RNA is hybridized (bound) to the microarray reporters. Unbound RNA is subsequently washed out so that the amount of bound and labelled RNA can be measured. The intensity of the signal of the reporter is indicative for the relative expression of the corresponding gene. DNA microarrays measure a surrogate

340

Systems Biology Applied to Cancer Research

Table 1. Systems Biology approach to link microarray data to individualized treatment in molecular oncology: websites referring to possible alternatives for the analysis steps presented in this chapter. Microarray General Y.F.Leung

http://ihome.cuhk.edu.hk/%7Eb400559/

Microarray bibliography

http://www.nslij-genetics.org/microarray/

Pubmed Entrez

http://www.ncbi.nlm.nih.gov/sites/entrez?db=pubmed

MGED

http://www.mged.org/

MIAME

http://www.mged.org/Workgroups/MIAME/miame.html

ArrayExpress

http://www.ebi.ac.uk/arrayexpress/

GEO

http://www.ncbi.nlm.nih.gov/projects/geo/

SMD

http://genome-www5.stanford.edu/

Oncomine

http://www.oncomine.org/main/index.jsp

Rembrandt

http://tr.nci.nih.gov/rembrandt

Data sets repositories

Quality controls Bioconductor

http://www.bioconductor.org/ (package affyQCReport)

dCHIP

http://biosun1.harvard.edu/complab/dchip/

GCOS

http://www.affymetrix.com/products/software/specific/gcos.affx

Genomatix

http://www.genomatix.de/

RMA

http://www.bioconductor.org/ (package affycomp)

RMAExpress

http://rmaexpress.bmbolstad.com/

GCRMA

http://www.bioconductor.org/ (package gcrma)

BRB Array Tools

http://linus.nci.nih.gov/BRB-ArrayTools.html

Cluster & Tree View

http://rana.lbl.gov/EisenSoftware.htm

SAM

http://www-stat.stanford.edu/~tibs/SAM/

BRB Array Tools

http://linus.nci.nih.gov/BRB-ArrayTools.html

GenePattern

http://www.broad.mit.edu/cancer/software/genepattern/

TM4

http://www.tm4.org/

Normalization

Unsupervised & supervised Analyses

Analysis Suite

Time series STEM

http://www.cs.cmu.edu/~jernst/stem/

EDGE

http://www.biostat.washington.edu/software/jstorey/edge/

SAM

http://www-stat.stanford.edu/~tibs/SAM/

CAGED

http://genomethods.org/caged/ Annotation & Gene Ontology

NCBI

http://www.ncbi.nlm.nih.gov/

Ensembl

http://www.ensembl.org/index.html

continued on the following page

341

Systems Biology Applied to Cancer Research

Table 1. (continued) NetAffx

https://www.affymetrix.com/site/login/login.affx

Onto Express

http://vortex.cs.wayne.edu/projects.htm

David Ease

http://david.abcc.ncifcrf.gov/ease/ease.jsp

Gene Ontology

http://www.geneontology.org/

Gene Ontology Annotation

http://www.ebi.ac.uk/GOA/

KEGG

http://www.genome.jp/kegg/

BioPax

http://www.biopax.org/

GSEA

http://www.broad.mit.edu/gsea/

KEGG

http://www.genome.jp/kegg/

GenMAPP

www.genmapp.org/

PathVisio

http://www.pathvisio.org

WikiPathways

http://www.wikipathways.org

Ingenuity

http://www.ingenuity.com/

GeneGo

http://www.genego.com/

GeneXpress

http://genexpress.stanford.edu/

Genomatix

http://www.genomatix.de/

Jaspar

http://jaspar.genereg.net/

Maps & Pathways

Transcription Factors

Network Inference, Visualization & Integration CARRIE

http://zlab.bu.edu/CarrieServer/html/

Cytoscape

http://www.cytoscape.org/

Patika

http://www.patika.org/

NIH Roadmap

http://nihroadmap.nih.gov/

SBML

http://sbml.org/index.psp

Physiome Project

https://www.bioeng.auckland.ac.nz/physiome/physiome_project.php

eCell

http://www.e-cell.org/software/e-cell-system

Virtual Cell

http://www.nrcam.uchc.edu/

BioModels Database

http://www.ebi.ac.uk/biomodels/

Systems Biology & Mathematical Modeling

of RNA abundance with either 1 or 2 channels. Two colour arrays (e.g.: Stanford microarrays) measure by competitive hybridization the relative expression under a given condition (fluorescent red dye Cy5) compared to its control (labelled with a green fluorescent dye, Cy3). The other type of platform only has 1 channel (e.g.: Affymetrix GeneChip) and thus measures absolute expression levels. Whatever the platform, the expression levels are usually converted into log scales. Distribution of the intensities is then no more skewed to the high intensities treating up and down regulated genes symmetrically. The variation is also less dependent on the absolute magnitude (the relative difference between high and

342

Systems Biology Applied to Cancer Research

low expression levels is smaller in the log scale). Expression levels are normalized to a control level, visualized in black. In this situation, overexpression is represented in red, repression in green.

T ypes of S t udies Using Micr oarra y E xperiments The most common applications of microarrays are for class comparison, class prediction and class discovery, although they are often combined in research papers. In the context of class comparison, classes are defined independently of the gene expression levels. Classes can be defined by a pathologist looking at the shape of cells under the microscope, or when the labels of the samples are known (e.g.: control versus treated design). The goal is then to determine if expression differs between theses classes and find which genes are differentially expressed. In the case of class prediction, a classifier (or predictor) is already available and the objective is to accurately predict the class of a new sample based on the expression levels of the genes of the predictor. Class discovery aims at identifying expression structures within a set of samples where classes are not predefined. Even though microarrays are meant to monitor transcription, some authors have also quantified changes in translation in cancer cell lines by polysome assays (Koritzinsky et al., 2005). The authors showed dramatic differences between these 2 levels of regulation of protein expression. Indeed, under a hypoxic environment a major repression at the transcriptional level was shown to not necessarily imply a major repression of protein translation. On the contrary, some genes related to angiogenesis and the unfolded protein response for example were highly translated. The regulation of translation is rather complex and different means have been suggested as the role of functional internal ribosomal entry sites, or micro RNAs (short RNA sequences - about 20 nucleotides long).

R ep osit ories of Micr oarra y S t udies Due to the large use of microarrays, data repositories have flourished world-wide. Three of the largest databases of gene expression are GEO, the Gene Expression Omnibus, of the National Center for Biotechnology Information (NCBI), its European homolog ArrayExpress hosted at the EMBL-EBI in the UK, and the Stanford Microarray Data Base (SMD). Databases dedicated to cancer have also been created such as Oncomine and the REpository of Molecular BRAin Neoplasia DaTa (REMBRANDT). They can be searched for data sets or even to test hypotheses. In Rembrandt for instance, it is possible to compute survival curves on line. Good practices or MIAME (Minimum Information About a Microarray Experiment) are being developed by the MGED (Microarray Gene Expression Data) workgroup. This group of biologists, computer scientists and data analysts aims to set standards to ensure an unambiguous interpretation and the reproducibility of the results.

Initia l q uesti on, hyp othesis

and the fishing

experiment

The starting point usually stems from a peculiar (or even paradoxical) finding that needs to be further investigated. The aim of the study can be to provide a better description of a given system (in a new context and/or with a new combination of assays for instance) or to test a hypothesis. The former ap-

343

Systems Biology Applied to Cancer Research

proach is known as the ‘fishing experiment’. It consists in running an experiment, then analyzing the data to find out inherent structure embedded into the data.

D ata G eneration Design This is one of the key steps that need to be carefully addressed (Churchill, 2002). One of the few points of consensus is that a sound experiment requires positive and negative controls as well as biological replicates. Any experiment is sensitive to 3 sources of variation: biological variation, technical variation and measurement error so that every measurement contains actually a convolution of the 3. Replicates can either be technical or biological (Churchill, 2002; Quackenbush, 2002). The former monitors a biological sample from the same source (e.g.: two microarrays -ideally identical but only similar in practice- are used to assess the expression level of genes from the same patient biopsy. Because the origin of the samples is meant to be the same, the variability in the results is expected to be mostly explained by technical differences (e.g.: microarrays from a different batch, or differences in the procedure or handling). Biological replicates mean repeating a certain number of times a complete assay. In this case, for the same patient, a biopsy would be taken and hybridized on a microarray. This procedure would be repeated twice for example. The variability is then a combination of technical and biological origins (Churchill, 2002). Different designs are possible depending on the goals of the experiment (control versus treated, time series, etc.). Clinical studies are essentially static in the sense that the data is collected from patients without the possibility to assign retrospectively a precise starting point before the first diagnostic (observational studies). In the contrary, in a controlled environment (e.g.: in vitro culture of cancer cell lines) times series are quite suited to assess the behavior of complex systems after an experimental perturbation (Bar-Joseph, 2004). Two essential issues in experiment design are bias and chance, the former being the hardest to address (Ransohoff, 2004). It requires a detailed description of the procedure to be detected. Unfortunately, when a study suffers from bias, hardly anything can be done to compensate for it so that it is often said that ‘bias times 12 is still bias’. Before running the full experiment, one might consider a pilot study. Samples of interest can be selected to provide the expected highest information gain (Tibshirani, 2006).

Protocol & Quality Controls of Samples The design should result in a detailed written protocol carefully followed by the investigators. Regardless of whether the RNA comes from an in vitro or in vivo studies, the primary importance is to yield samples of excellent quality in order to avoid the situation of ‘garbage in, garbage out ‘. At this stage, quality controls are essentially attained with the Nanodrop and the Bioanalyzer (Agilent Technologies, Santa Clara, CA) assays. The former assesses material quantity whereas the later measures the integrity, purity and quality of the sample.

344

Systems Biology Applied to Cancer Research

Microarrays & Quality Controls DNA microarrays can be divided in 2 groups depending on their number of channels. The cDNA microarrays have 2 channels (red and green), but we will focus on the Affymetrix microarray (1 channel) which is currently one of the most widely used commercial platform. A set of quality controls has been developed in the open software R. The corresponding packages can be downloaded from the Bioconductor website and run from the R environment or Excel with BRB Array Tools for instance (see Table 1 for details).

D ata Preprocessing Filtering for Artefacts, Outliers and Controls After a careful examination of the microarray, this step intends to remove bad spots, subtract background, and deal with controls. Control reporters which are highly expressed or even saturated need to be removed.

Normalization Normalization is an attempt to correct for systematic errors in the data (e.g.: one channel of a twochannel array is much higher than the other). Thus it allows comparing the data in an even way for proper analysis. A common normalization assumption is that the expression level of most genes does not change (e.g.: Affymetrix platform). Although normalization is quite suitable, it can not compensate for data of poor quality such as the ‘garbage in, garbage out’ situation already mentioned or insufficient number of samples. How to combine this information detected by different reporters for the same gene is also a part of the normalization step (Quackenbush, 2002), and an area of intense research. Different normalization algorithms have been developed over the years. For the Affymetrix platform, the most common ones are GCOS, RMA, GCRMA, and dChip. These algorithms combine the reporter intensities for a given gene to define a measure of expression that represents the amount of the corresponding mRNA species. They have a profound effect on the detection of differentially expressed genes. This was exemplified in the context of lung cancer where the number of common genes found with 3 different algorithms was quite small (P. Yang et al., 2004). Since no method is clearly established as more reliable than others, the authors suggested combining the genes selected by more than one method. In contrast to these findings, these authors found that once the data was pre-processed, the different analytical tools used to extract genes differentially expressed (see below) gave very similar results (concordance ~ 90%).

Filters for Noise and/or Intensity In order to decrease the risk of spurious findings, it is necessary to filter for noise and absence of variation. Different procedures have been used but no consensus exists yet. Regardless of the experimental design and microarray platform, the idea is to discard reporters with low intensities (probably noisy measurements) or which expression levels remain roughly constant in the conditions studied (e.g.: both

345

Systems Biology Applied to Cancer Research

control and treated samples). Some platforms provide a measure of the reliability of detection (e.g.: the present or absent call for Affymetrix microarrays).

C urse of D imensionality & D ata R eduction T echniques A massive amount of data arises from DNA microarrays. Typically, the number of reporters on a microarray varies between 20,000 to approximately 60,000 while the number of samples is relatively small. Currently, typical (static) in vitro cancer studies contain roughly 50 samples (less than 10 usually for time series). The largest clinical studies span approximately 300 samples but the usual size is around 100 patients. It is thus a challenge (or the so-called ‘curse of dimensionality’) to select a set of genes of interest when the number of potential candidates outreaches by far the number of samples. Data reduction techniques can be helpful to downsize the data set to a more manageable size. In the so called expression space, each experiment is represented by an axis (dimension). For each gene, its expression level (coordinate) is reported in log scale units along the corresponding axis. In the case where just 3 experiments would be run, the axes experiment1-experiment2-experiment3 would be similar to the x-y-z basis used in three-dimensional geometry. A distance can also be defined to measure the closeness (similarity in expression) of 2 or more points (genes). Like in geometry, the Euclidean metric is a common similarity distance but Pearson correlation, Manhattan, etc. similarity measures can also be selected depending on the purpose of the analysis. Although it is not possible to represent it, similarity measures between genes can be computed in the expression space extended to any number of dimensions. Principal Component Analysis (PCA) is based on the singular value decomposition and remains one of the most common techniques to perform data reduction. The idea is to rotate the cloud of data points in the expression space so as to identify the direction of greatest variation (1st principal component). Iteratively, each next component gets the most of the remaining variance. Due to data representation issues, only the 2 or 3 first principal components are computed. These first ‘superaxes’ represent the major part of the total variance in the dataset and may allow the detection of different clusters of data points.

D ata A nalysis Gene Expression Profiling This step provides the list of genes of interest (also called gene expression-based signature or gene signature) which are supposed to be differentially expressed between 2 or more conditions (the control and the treated experiments for instance). The two main ways to tackle this are by an unsupervised or by a supervised approach. Both methods rely on defining a similarity measure which is used to group the genes with similar expression. In general, the choice of the similarity measure is more important than the algorithm to compute it. The differentially expressed genes or gene signatures can be used to identify specific subtypes within individual human tumors and predict their influence on patient treatment. Such gene ‘signatures’, ‘metagenes’ (linear combinations of gene expression values extracted to predict phenotype) or ‘modules’ (sets of genes that act in concert to carry out a specific function) are identified to represent the molecular behaviour of the response, phenotype or function under study. Predictive gene signatures have also been identified from tumor samples (van de Vijver et al., 2002).

346

Systems Biology Applied to Cancer Research

Recently, gene signatures have also been extracted from in vitro experiments with cell lines cultured under defined conditions (Chang et al., 2004; Chi et al., 2006; Seigneuric et al., 2007); with subsequent application to publicly available clinical data sets. Starting from in vitro studies allows not only to record gene expression in very controlled and reproducible situations but also to reduce the chances of overfitting. Overfitting occurs when an identified pattern is actually based on existing random features within the data (a consequence of the curse of dimensionality and of a poor procedure to detect structures embedded in the data). Therefore, the pattern can not be generalized to new, similar data sets.

Unsupervised Methods Unsupervised clustering relies on an algorithm without any a priori knowledge about the number or the type of classes it should find. In this respect, it is unbiased as it seeks to determine inherent structures (clusters) embedded into the data set. Cluster analysis is extremely common to assess shared functions and common regulation often referred to as ‘guilt by association’. It is often done by average-linkage with a Euclidean distance to focus on the highest expression changes. Data can be clustered and visualized with the popular software Cluster & TreeView (Eisen et al., 1998) for instance. Then, the user selects a group or cluster of genes for further analysis. Unsupervised approaches have been used to identify ‘molecular portraits’ of tumors and improve the classification of breast cancer (Perou et al., 2000). To improve breast cancer diagnosis for instance, one would like to refine the pathologist’s classes (e.g.: histological grade) assessed with a microscope by discovering new subclasses on the molecular level based on gene expression. A collection of samples belonging to the same grade is interrogated by an unsupervised algorithm to detect groups of samples that exhibit different expression patterns between the groups while maintaining similarity within the groups. This approach has been applied to provide a means to reduce overtreatment (Wang et al., 2005).

Supervised Methods This approach is based on identifying genes that fit an a priori determined feature (e.g.: pattern of expression). It requires to first define classes based on a different criteria than expression (e.g.: time point for a time series) and assign each sample to its class. The common pitfalls in the building of a predictor for cancer outcome have also been recently addressed in detail (Dupuy & Simon, 2007). A wide variety of algorithms (coming from the statistical and the machine learning communities) is available: the t-test, ANalysis Of Variance (ANOVA), Linear Discriminant Analysis (LDA), Support Vector Machine (SVM), etc. It is in fact necessary to restrict one to the simplest possible tools (e.g.: by starting an analysis with LDA rather than with SVM) to reduce the risk of overfitting. This is known as Occam’s razor after the Franciscan logician from the 14th century who stated that: ‘entities should not be multiplied beyond necessity’. This law of parsimony requires keeping the simplest model which can explain the data at hand. Since the number of samples in microarray data studies is always a limiting factor, some strategies have been selected to get the most out a given data set. One such approach is the Leave-One-Out-Cross-Validation (LOOCV). It consists in identifying genes differentially expressed in all samples but one, and to use the predictor to classify the remaining sample. With n samples this procedure is repeated n times. To decrease overfitting and provide more robust predictors, it is necessary to apply the LOOCV to the full procedure.

347

Systems Biology Applied to Cancer Research

List of D ifferentially E xpressed G enes Independent Validation The list of differentially expressed genes needs to be validated by an independent assay, usually by Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Although the magnitude of the change may be different, it is important that its direction (up- or down-regulation) holds. Because the gene signatures are often large (presently ranging from 11 genes up to more than 500 in oncology), one option may be to select randomly a representative fraction of the (up- and down-regulated) genes to be tested.

Univariate Analysis: Kaplan-Meier Survival Curves Kaplan-Meier curves are used to show the clinical relevance of the gene expression based signature on patient data. Data sets containing gene expression from tumor specimens together with follow-up and clinical variables (e.g., age, tumor size, grade…) can be downloaded from the databases mentioned above and listed in Table 1. They span many cancer types including leukemias and carcinomas. Since clustering is the main method used to stratify patients in groups dependent on the expression of the genes in the signature, Kaplan-Meier survival analysis is the most widely used method to evaluate a gene signature. Log-rank tests are applied to test whether this results in a statistical difference in survival between the groups. Meta-analyses allow merging of small (homogeneous) data sets and therefore increase statistical power.

Multivariate Analysis In the context of molecular oncology, the objective of the multivariate analysis is to quantify the prognostic power of a list of biomarkers (e.g., a gene signature) with respect to the existing multiple variables as: age of the patient, tumor size, grade, mutation status of the gene coding for the essential protein p53 (called the ‘guardian of the genome’), etc. Additional methods are necessary to characterize and validate gene signatures (e.g., area under the curve, sensitivity, specificity or the concordance index).

Gene Ontology In order to get some insight into the biological theme of the list of genes, one often runs a gene ontology query. Ontology is a data model that represents a set of concepts within a domain and the relationships between those concepts (http://en.wikipedia.org/wiki/Ontology_(computer_science)). The current gene ontology contains approximately 20,000 terms to assign the biological process, the cellular component and the molecular function of genes. A wide variety of programs exists to find which of these are overrepresented in the list at hand (links are provided in Table1). Due to the a priori constraints imposed in a supervised analysis, it is harder to define its biological theme relatively to an unsupervised approach.

Pathways Involved An additional step in the analysis is to find the pathways in which the genes of interest are actually involved. This relies on our current understanding and representation of these pathways. The KEGG (Kyoto Encyclopedia of Genes and Genomes) initiative was launched in 1995 in order to link genomes 348

Systems Biology Applied to Cancer Research

to biological systems and its implementation has been recently up-dated by the use of Markup Language and API (Application Program Interface which allows customization). The pathway maps (for metabolic, genetic information processing, information processing and disease) are drawn manually and a z-score quantifies those maps where the genes of interest are overrepresented . The Gene Microarray Pathway Profiler (GenMAPP) software is designed for viewing and analyzing gene expression data in the context of biological pathways. Microarray data can be superimposed on existing maps to visualize up and down regulations. Pathways in GenMAPP can be edited and visualized with the PAthway VISualizatIOn (PathVisio) program which is also meant to display additional types of data (e.g.: proteomics data). A collective effort now intends to develop pathways important to biological research communities on the web (http://www.wikipathways.org/index.php/WikiPathways). Recently, the Biological Pathway eXchange (BioPax) initiative was launched to create a data exchange format for biological pathways in order to integrate knowledge from multiple sources in a coherent and reliable way. BioPax is based on Web Ontology Language (OWL). This language is meant for ontology construction and deployment to evolve from a human-readable graph to a machine-readable format for pathways analysis softwares.

Network Inference The regulation of gene expression is achieved through genetic regulatory systems structured by networks of interactions between DNA, RNA, proteins and small molecules. Due to the massive number of such components and interlocking positive and negative feedback, feedforward loops, formal methods and computer tools are needed to unravel the relevant interactions and their topology. Depending on the goal (fine vs. coarse-grain model) and the collected data, different approaches have been proposed for inferring, modeling and simulating genetic, metabolic and signaling pathways: interaction graphs (Radulescu et al., 2006), Bayesian networks, Boolean networks (and their generalizations), ordinary and partial differential equations, qualitative (piecewise linear) differential equations, stochastic equations, and rule-based formalism. Bayesian Networks (BNs) and their temporal extension the Dynamic Bayesian Networks (DBNs) have received a wide interest. Indeed, unlike most other approaches, BNs and DBNs can handle missing data thanks to hidden variables. It allows circumventing the fact that most of the time, a study focuses on one level (e.g.: gene or protein expression). If one is monitoring gene expression data only (e.g.: by microarrays) no information is available on the protein level. In our perspective, DBNs are of special interest because they can overcome a limitation of BN which are restricted to infer network without feedback loops. DBNs do so by untangling their Directed Acyclic Graph (DAG) as a function of time, allowing reconstructing feedback and feedforward loops essential in biology. Network can be reconstructed from this framework allowing the identification of highly connected nodes (hubs) and apply other analyses using methods from graph theory. Performing experiments on such hubs (e.g.: RNAi, overexpression) will provide optimized set-ups for the molecular biologist who will maximize the effect of his experimental perturbation. Comparison between experiments and reconstructed network will fine tune the model while allowing one to select the most interesting experiments.

Mathematical Modeling Model is a common word which happens to be often misleading depending on the background of scientists using it. A model is a set of hypotheses or concepts that allows a simplified description and understanding of the system of interest. 349

Systems Biology Applied to Cancer Research

For a molecular biologist for instance, a model will be a (mouse) model where cancerous cells are injected to create tumor xenografts. The behaviour of cancer cells can thus be studied in a more controlled manner. But in the same field, a model can also be a molecular device which is used to change the expression status of a gene of interest. In gene therapy, the property of certain types of bacterias (like salmonella) to preferentially be located in hypoxic environments is exploited to target tumors. In this context, a model may be a flip-in construct to switch ON or OFF a specific gene. In molecular biology, a model can also be a breast cancer cell line (e.g.: MCF7) which represents an (in vitro) model for monitoring gene expression. In the field of data mining, this could be a (machine learning) model that is a set of rules identified from a specific data set. With an engineering sciences background, a model could be a (mathematical) model composed of equations containing parameters and variables. This is the meaning of ‘model’ within this paragraph. There is an increasing need for developing mechanistic systems models (van Riel, 2006) in biological sciences as outlined by the National Health Institute RoadMap (http://nihroadmap.nih.gov/). The Hyper Text Markup Language (HTML) language provides tags to give meaning and (hierarchical) structure to a web document. A more flexible version, eXensible Markup Language (XML), can be customized to create and define such tags. This feature is widely used in the Systems Biology Markup Language (SBML) language which aims at representing in a computer-readable format: pathways, biochemical reactions and gene regulations. SBML also provides simulations tools for quantitative modelling as well as a model repository (e.g.: curated cell cycle or MAPKKK cascade models). Numerical attempts to mathematically model and simulate the human heart (Cardiome) and the whole human body (Physiome) are based on this language. With ordinary differential equations, quantitative detailed descriptions spanning large temporal and spatial scales are provided to better understand physiological conditions. Both projects are collaborative efforts of several laboratories world-wide which exemplify some applications of Systems Biology.

Perspecti

ves

Any microarray study is composed of a succession of several steps which were discussed in this chapter. Each one of this step (with many options) represents an active field of research by its own. Due to such a situation (‘moving target’) it is a rule rather than an exception that investigators get somewhat different results. The requirement of the design, the raw and analyzed data on publishers’ website may greatly help clarifying the results and thus our understanding of the molecular biology of cancers. Our body is composed of 100,000,000,000,000 cells from about 250 different types, yet, it is working in harmony as a whole. It is made of organs, tissues, cells, genes, proteins, etc. which span many temporal and physical scales, from less than nanoseconds to tens of years and from atoms to a whole body. These different scales require various assays so that going from the wetlab to the bedside is a challenging endeavor which is indeed by essence multidisciplinary.

Co nc lusi on Systems Biology is a promising framework to improve our current understanding of the biology of tumors for instance. By unraveling the function of key genes, it may lead to individualized treatment

350

Systems Biology Applied to Cancer Research

instead of the ‘one size fits all’ approach. In the future, this may help developing better drugs or identifying beforehand patients who will be most likely to develop drug resistance or who will most benefit from a treatment.

R eferences Bar-Joseph, Z. (2004). Analyzing time series gene expression data. Bioinformatics, 20(16), 24932503. Chang, H. Y., Sneddon, J. B., Alizadeh, A. A., Sood, R., West, R. B., Montgomery, K., et al. (2004). Gene expression signature of fibroblast serum response predicts human cancer progression: Similarities between tumors and wounds. PLoS Biol, 2(2), E7. Chi, J. T., Wang, Z., Nuyten, D. S., Rodriguez, E. H., Schaner, M. E., Salim, A., et al. (2006). Gene expression programs in response to hypoxia: Cell type specificity and prognostic significance in human cancers. PLoS Med, 3(3), e47. Churchill, G. A. (2002). Fundamentals of experimental design for cdna microarrays. Nat Genet, 32 Suppl, 490-495. Dupuy, A., & Simon, R. M. (2007). Critical review of published microarray studies for cancer outcome and guidelines on statistical analysis and reporting. J Natl Cancer Inst, 99(2), 147-157. Eisen, M. B., Spellman, P. T., Brown, P. O., & Botstein, D. (1998). Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA, 95(25), 14863-14868. Kerr, M. K., & Churchill, G. A. (2001). Statistical design and the analysis of gene expression microarray data. Genet Res, 77(2), 123-128. Koritzinsky, M., Seigneuric, R., Magagnin, M. G., van den Beucken, T., Lambin, P., & Wouters, B. G. (2005). The hypoxic proteome is influenced by gene-specific changes in mrna translation. Radiother Oncol, 76(2), 177-186. Lazebnik, Y. (2004). Can a biologist fix a radio? -- or, what i learned while studying apoptosis, (cancer cell. 2002 Sept. 2(3), 179-82). Biochemistry (Mosc), 69(12), 1403-1406. Perou, C. M., Sorlie, T., Eisen, M. B., van de Rijn, M., Jeffrey, S. S., Rees, C. A., et al. (2000). Molecular portraits of human breast tumours. Nature, 406(6797), 747-752. Quackenbush, J. (2002). Microarray data normalization and transformation. Nat Genet, 32 Suppl, 496501. Radulescu, O., Lagarrigue, S., Siegel, A., Veber, P., & Le Borgne, M. (2006). Topology and static response of interaction networks in molecular biology. J R Soc Interface, 3(6), 185-196. Ransohoff, D. F. (2004). Rules of evidence for cancer molecular-marker discovery and validation. Nat Rev Cancer, 4(4), 309-314. Seigneuric, R., Starmans, M. H., Fung, G., Krishnapuram, B., Nuyten, D. S., van Erk, A., et al. (2007). Impact of supervised gene signatures of early hypoxia on patient survival. Radiother Oncol. 351

Systems Biology Applied to Cancer Research

Tibshirani, R. (2006). A simple method for assessing sample sizes in microarray experiments. BMC Bioinformatics, 7, 106. van de Vijver, M. J., He, Y. D., van’t Veer, L. J., Dai, H., Hart, A. A., Voskuil, D. W., et al. (2002). A geneexpression signature as a predictor of survival in breast cancer. N Engl J Med, 347(25), 1999-2009. van Riel, N. A. (2006). Dynamic modelling and analysis of biochemical networks: Mechanism-based models and model-based experiments. Brief Bioinform, 7(4), 364-374. Wang, Y., Klijn, J. G., Zhang, Y., Sieuwerts, A. M., Look, M. P., Yang, F., et al. (2005). Gene-expression profiles to predict distant metastasis of lymph-node-negative primary breast cancer. Lancet, 365(9460), 671-679. Yang, P., Sun, Z., Aubry, M. C., Kosari, F., Bamlet, W., Endo, C., et al. (2004). Study design considerations in clinical outcome research of lung cancer using microarray analysis. Lung Cancer, 46(2), 215-226. Yang, Y. H., & Speed, T. (2002). Design issues for cdna microarray experiments. Nat Rev Genet, 3(8), 579-588.

K ey T erms Biomarker: By definition any bio(logical) marker like a gene or a protein. In molecular oncology, due to the complexity of cancer diseases, highly parallel techniques are needed to identify a set of biomarkers rather than a unique biomarker. Sets of biomarkers are believed to be stronger predictors since they would reflect more reliably the multidimensionality of cancer. Cancer: A genetic disease emerging when cells have acquired at least six important factors contributing to pathogenesis. These hallmarks include evading apoptosis, self-sufficiency in growth signals, insensitivity to anti-growth signal, limitless replicative potential, sustained angiogenesis, and tissue invasion and metastasis. Complex System: Such systems (e.g.: a cell, an organ, a whole human body) are complex because of the large number of players involved and/or because of their time and context dependent interactions. The nature of these interactions or regulatory motifs (e.g.: positive or negative feed-back loop, feed-forward loop) increase the complexity of even a simple system with only a handfull of variables. Microarray: DNA microarray is a technique to monitor the abundance of tens of thousands RNA transcripts at once (by extension, gene expression). Molecular reporters corresponding to complementary sequences of genes of interest are orderly deposited on a glass surface. This is today the most mature of the highly parallel techniques. Model: A commonly used but very misleading term which heavily depends on the background of the investigator. In the broad sense, a model is used in any attempt to describe and explain a system of interest which can not be directly observed. A set of hypotheses are required to represent a simplification of it (i.e: a model).

352

Systems Biology Applied to Cancer Research

Network Inference: The attempt to discover the relationships between the components (or nodes such as genes, proteins, metabolites) of the network. It is a form of the inverse problem where one starts from the observations (gene expression levels from DNA microarrays for instance) and intends to identify the causes that led to such observations. Due to the very large number of potential players, this is a non-trivial problem which requires a massive amount of data. Normalization: The correction for known systematic biases in the data to allow a fair comparison. Omics: Due to the recent advent of highly parallel assays, it is now possible to monitor the behavior of not just one or a couple of variables but rather tens of thousands of variables at once. A growing number of disciplines with the ‘-omics’ suffix like genomics, transcriptomics, metabolomics and so on, intend to describe and understand completely a given level. Systems Biology: A field which studies complex biological systems at different levels to decipher the interactions of its key components and provide a mathematical model integrating this heterogeneous information.

353

354

Chapter XXI

Systems Biology Strategies in Studies of Energy Homeostasis In Vivo Matej Orešič VTT Technical Research Centre of Finland, Finland Antonio Vidal-Puig Institute of Metabolic Science, Addenbrooke’s Hospital, UK

abstract In this chapter the authors report on their experience with the analysis and modeling of data obtained from studies of animal models related to obesity and metabolic syndrome. The complex interactions of genetic and environmental factors contributing to the failure of energy balance that lead to obesity, as well as tight systemic regulation to maintain energy homeostasis, require application of the systems biology strategy at the physiological level. In vivo systems offer the possibility of investigating not only the effects of specific genetic modifications or treatments in selected tissues and organs, but also to elucidate compensatory allostatic mechanisms induced to maintain the homeostasis of the whole system. A key challenge for systems biology is to characterize different systems’ responses in the context of activated pathways. One possible strategy is based on reconstruction of tissue specific pathways using lipidomics, or metabolomics in general, in combination with proteomic and transcriptomic profiles. This approach was applied to obese mouse model and revealed activation of multiple liver pathways that may lead to metabolic products, which may impair insulin sensitivity.

Intr od ucti on The system controlling the energy balance is tigtly regulated. The failure of mechanisms controlling the energy balance may lead to obesity. The causes of such failure may be genetic defects in the mechanisms Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Systems Biology Strategies in Studies of Energy Homeostasis In Vivo

controlling food intake, energy expenditure, partition of nutrients towards specific organs, expandability of the adipose tissue, or genetically inherited traits leading to inactivity. The environmental factors interacting with genetically determined traits are clearly involved, as the obesity is a rather recent problem of the last few decades. The biological redundancy adds another layer of complexity. Since energy homeostasis is so central to survival, the system has evolved towards a tightly regulated redundant system characterised by: (1) similar responses induced by different pathways and (2) compensatory mechanisms systems aiming to restore the steady state of energy homeostasis. Systems biology investigations aiming to address the complexity of obesity should therefore not only consider identification of mechanisms that may lead to obesity, but also aim to identify the compensatory biological strategies that are found in vivo. Some of these compensatory mechanisms may be targeted to increase the success rate of current strategies to lose weight. As obesity may lead to a number of complications such as diabetes and cardiovascular disease, a systems biology approach may be applied to identify early pathways that may lead to obesity-related complications, before they result in clinically identifiable specific diseases.

Lipid omics Lipids play an important role as structural components (e.g., cell membranes), energy storage components (triglycerides in adipose tissue), and as signalling molecules (Vance & Vance, 2004). For example, changes in lipid function due to peroxidation, imbalanced fatty acid composition or their increased flux to peripheral tissues may contribute to development of disorders such as atherosclerosis, diabetes, metabolic syndrome or Alzheimer’s disease (Watson, 2006; Wenk, 2005). Traditional clinical lipid measures quantify total amounts of triglycerides, cholesterol, or lipoproteins. However, serum lipid profile is much more complex at the molecular level. However, the modern lipidomics and metabolomics platforms enable quantitative characterization of 100s of diverse lipid molecular species across multiple lipid classes such as sphingolipids, phospholipids, sterol esters, and acylglycerols. In most cases, exact fatty acid composition for each detected lipid can be determined. Lipid metabolism is regulated both by genetic and environmental factors. For example, using a unique monozygous twin study design in which young adult obese monozygous twins were compared with their non-obese co-twins, we have recently shown that that obesity already in its early stages and independent of genetic influences is associated with deleterious alterations in the lipid metabolism known to facilitate atherogenesis, inflammation and insulin resistance (Pietiläinen et al., 2007). The study also demonstrated the sensitivity of the metabolomics platforms since subtle pathophysiological changes were detected well prior to changes in commonly utilized clinical measures. Of special interest and clinical relevance was the finding that the atherogenic lipid profile of the obese co-twins was associated with whole body insulin resistance, something that could not be detected using classical lipid measures and inflammatory markers only.

IN vivo st udies Lipidomics is increasingly utilized in functional characterization of genetic or environmental interventions in vivo. In vivo systems offer the possibility of investigating not only the effects of specific genetic

355

Systems Biology Strategies in Studies of Energy Homeostasis In Vivo

modifications or treatments in selected tissues and organs, but also to elucidate compensatory allostatic mechanisms (McEwen & Wingfield, 2003) induced to maintain the homeostasis of the whole system. For example, in the context of energy balance, we have observed marked differences in adipogenesis and fat deposition between in vivo and in vitro models. In fact, whereas lack of proadipogenic transcription factor PPARγ2 in vitro results in markedly impaired adipogenesis and fat deposition, its genetic ablation in mice results in normal development of adipose tissue, thus suggesting robust compensatory mechanisms operating in vivo to facilitate fat deposition in adipose tissue. Remarkably, despite its normal adipose tissue appearance, lipidomic analysis revealed qualitative and quantitative differences in the repertoire of lipids stored. We found that lack of PPARγ2 resulted in accumulation of more immature lipids characterized by decreased long chain triacylglycerols and accumulation of lipid precursors such as specific phospholipid species (Medina-Gomez et al., 2005). Lipotoxicity is rapidly emerging as an important concept in the pathogenesis of multiple diseases as well as in aging (Slawik & Vidal-Puig, 2006; Summers, 2006; Summers & Nelson, 2005; Unger, 2002). The lipotoxicity is attributed to products, i.e. toxic lipids such as ceramides, of excessive non-β-oxidative metabolism of fatty acids in peripheral tissues such as skeletal muscle, pancreas, and myocardium (Unger, 2002). High levels of lipotoxic lipids in peripheral tissues are believed to be associated with diabetes, insulin resistance, cardiovascular disease by disrupting cell function and by promoting programmed cell death (lipoapoptosis). In order to investigate the effect of lipid overflow in adipose tissue, and its effect on peripheral tissues, the PPARγ2 KO was also studied in the obese mouse model background (ob/ob). Indeed, this approach allowed the identification of potentially pathogenic ceramide lipid species in adipose tissue. We are currently using this lipidomic approach to identify and characterise lipotoxic dysregulated metabolic networks in relevant metabolic organs for diabetes (Medina-Gomez et al., 2007). The use of this information may identify not only organ specific lipotoxic pathways suitable for pharmacological intervention in the context of the metabolic syndrome but also specific metabolic signatures with prognostic value.

Lipid pathw ay rec onstr ucti on fr om iN vivo st udies of lipot oxicity One question that may arise from the studies of lipotoxicity in vivo is which specific pathways leading to accumulation of reactive lipids in peripheral tissues are being activated. This immediately leads to a problem, as lipidomics today studies characterizes lipids at the intant molecular level, while the common pathway databases such as KEGG (Kanehisa, Goto, Kawashima, Okuno, & Hattori, 2004) contain information only at the generic lipid class level, although it is expected that with advent of lipid bioinformatics (Fahy et al., 2005; L. Yetukuri, Ekroos, Vidal-Puig, & Oresic, 2008) the information on lipids available in public databases will rapidly grow in the future. For example, cardiolipin contains four fatty acids. Assuming there are approximately 40 most common naturally occuring fatty acids in human, there are theoretically approximately 404=2,560,000 possible cardiolipin molecular entities. However, only one entry for cardiolipin exists in KEGG. It is thus not difficult to imagine that reconstruction of complete lipid metabolism at the molecular pathway level would lead to a combinatorial explosion. As a possible solution to the combinatorial explosion problem, we recently proposed a method for bridging the experimental knowledge with known lipid pathways in combination with omics data

356

Systems Biology Strategies in Studies of Energy Homeostasis In Vivo

(Yetukuri et al., 2007). Each compound entry is linked to the available information on lipid pathways (e.g., based on KEGG) as well as contains information necessary for identification from the lipidomics experiments. The pathway instantiation is performed for selected lipids based on identification of Figure 1. From metabolomics data to instantiated pathways. Adapted from (Yetukuri et al., 2007).

G ro u p 1

G ro u p 2

L -S e rine

M etabolic profiles

M etabolic profiles

T ranscriptional and other data

T ranscriptional and other data

C er(d 1 8 :1/18:0 )

C oe x p ressi o n n etwo rks

P athw ay in s tan tiatio n, e.g., f o r C er(d18:1 /18:0)

357

Systems Biology Strategies in Studies of Energy Homeostasis In Vivo

coregulated lipid species (Figure 1). Using our new methodology, we have recently reconstructed the lipotoxic pathways in fatty livers of obese mice (Yetukuri et al., 2007). We found that two ceramide synthesis pathways are upregulated in fatty livers: (1) de novo ceramide synthesis pathways due to increased flux of fatty acids into the cells, (2) glucosylceramidase and galactosylceramidase pathways, leading to release of ceramide from the membrane glycosphingolipids. Reassuringly, recent study showed that pharmacological inhibition of glucosylceramide synthase enhances insulin sensitivity in the obese mouse model (Aerts et al., 2007).

Co nc lusi on Systems approaches to the studies of in vivo systems must address the regulation of biological pathways in the physiological context. Characterization of pathways as either causal or compensatory requires knowledge of changes at the systems level. Studies of lipid metabolism as related to regulation of energy balance is one such example. As shown in this chapter, many practical bioinformatics and computational challenges remain for in vivo systems biology due to the need to bridge multiple special and temporal scales, which will require close cooperation between the theoretical and experimental work.

R eferences Aerts, J. M., Ottenhoff, R., Powlson, A. S., Grefhorst, A., van Eijk, M., Dubbelhuis, P. F., et al. (2007). Pharmacological inhibition of glucosylceramide synthase enhances insulin sensitivity. Diabetes, 56, 1341-1349. Fahy, E., Subramaniam, S., Brown, H. A., Glass, C. K., Merrill, A. H., Jr., Murphy, R. C., et al. (2005). A comprehensive classification system for lipids. J. Lipid Res., 46(5), 839-862. Kanehisa, M., Goto, S., Kawashima, S., Okuno, Y., & Hattori, M. (2004). The KEGG resource for deciphering the genome. Nucl. Acids Res., 32(Database Issue), D277-280. McEwen, B. S., & Wingfield, J. C. (2003). The concept of allostasis in biology and biomedicine. Horm. Behav., 43(1), 2-15. Medina-Gomez, G., Gray, S., Yetukuri, L., Shimomura, K., Campbell, M., Curtis, K., et al. (2007). PPAR gamma 2 prevents lipotoxicity by controlling adipose tissue expandability and peripheral lipid metabolism. PLoS Genet., 3(4), e64. Medina-Gomez, G., Virtue, S., Lelliott, C., Boiani, R., Campbell, M., Christodoulides, C., et al. (2005). The link between nutritional status and insulin sensitivity is dependent on the adipocyte-specific Peroxisome Proliferator-Activated Receptor-{gamma}2 isoform. Diabetes, 54(6), 1706-1716. Pietiläinen, K. H., Sysi-Aho, M., Rissanen, A., Seppänen-Laakso, T., Yki-Järvinen, H., Kaprio, J., et al. (2007). Acquired obesity is associated with changes in the serum lipidomic profile independent of genetic effects - A monozygotic twin study. PLoS ONE, 2(2), e218.

358

Systems Biology Strategies in Studies of Energy Homeostasis In Vivo

Slawik, M., & Vidal-Puig, A. J. (2006). Lipotoxicity, overnutrition and energy metabolism in aging. Ageing Res. Rev., 5(2), 144-164. Summers, S. A. (2006). Ceramides in insulin resistance and lipotoxicity. Prog. Lipid Res., 45(1), 4272. Summers, S. A., & Nelson, D. H. (2005). A role for sphingolipids in producing the common features of Type 2 Diabetes, Metabolic Syndrome X, and Cushing’s Syndrome. Diabetes, 54(3), 591-602. Unger, R. (2002). Lipotoxic diseases. Annu Rev Med, 53, 319-336. Vance, D. E., & Vance, J. E. (Eds.). (2004). Biochemistry of lipids, lipoproteins and membranes (4th ed.). Amsterdam, The Netherlands: Elsevier B. V. Watson, A. D. (2006). Thematic review series: systems biology approaches to metabolic and cardiovascular disorders. Lipidomics: A global approach to lipid analysis in biological systems. J. Lipid Res., 47(10), 2101-2111. Wenk, M. R. (2005). The emerging field of lipidomics. Nat. Rev. Drug Discov., 4, 594-610. Yetukuri, L., Ekroos, K., Vidal-Puig, A., & Oresic, M. (2008). Informatics and computational strategies for the study of lipids. Mol. BioSyst., 4(2), 121-127. Yetukuri, L., Katajamaa, M., Medina-Gomez, G., Seppänen-Laakso, T., Puig, A. V., & Oresic, M. (2007). Bioinformatics strategies for lipidomics analysis: characterization of obesity related hepatic steatosis. BMC Syst. Biol., 1, e12.

K ey T erms Adipose Tissue: Loose connective tissue composed of fat cells or adipocytes. Its main role is to store energy in the form of fat, although it also cushions and insulates the body. Allostasis: The process of achieving stability, or homeostasis, through physiological or behavioral change. Allostasis is generally adaptive in short term, and can be carried out, e.g., by cytokines, autonomic nervous system, or metabolome. Ceramide: Sphingolipid which can induce apoptosis and is a key mediator of lipotoxicity. It consists of sphingosine linked to fatty acid via an amide bond. Structural and signaling molecule. Lipids: A diverse class of biological molecules that play a central role as structural components of biological membranes, energy reserves, and signaling molecules. They are broadly defined as hydrophobic or amphipathic small molecules that may originate entirely or in part by carbanion based condensation of thioesters, and/or by carbocation based condensation of isoprene units. Metabolomics: Metabolomics is a discipline dedicated to the global study of small molecules (i.e., metabolites), their dynamics, composition, interactions, and responses to interventions or to changes in their environment, in cells, tissues, and biofluids .

359

Systems Biology Strategies in Studies of Energy Homeostasis In Vivo

Lipidomics: Lipidomics as a subfield of metabolomics aims at characterization of lipid molecular species and their biological roles with respect to the expression of proteins involved in lipid metabolism and function including gene regulation. Lipotoxicity: Accumulation of (lipo)toxic reactive lipids such as ceramides in non-adipose tissues of metabolically important organs such as pancreatic β-cells, skeletal muscle, liver, and heart. Pathway Instantiation: Reconstruction of possible activated pathways, originating from a specific molecular entity (e.g., protein or metabolite). based on molecular interactions and enzymatic reactions.

360

361

Chapter XXII

Approaching Type 2 Diabetes Mellitus by Systems Biology Axel Rasche Max-Planck-Institute for Molecular Genetics, Germany

abstract We acquired new computational and experimental prospects to seek insight and cure for millions of afflicted persons with an ancient malady. Type 2 diabetes mellitus (T2DM) is a complex disease with a network of interactions among several tissues and a multifactorial pathogenesis. Research conducted in human and multiple animal models has strongly focused on genetics so far. High-throughput experimentation technics like microarrays provide new tools at hand to amend current knowledge. By integrating those results the aim is to develop a systems biology model assisting the diagnosis and treatment. Beside experimentation techniques and platforms or rather general concepts for a new term in biology and medicine this chapter joins the conceptions with a rather actual medical challenge. It outlines current results and envisions a possible alley to the comprehension of T2DM.

Intr od ucti on Type 2 Diabetes mellitus (T2DM) is the most common metabolic disease with more than 170 million patients worldwide. It rapidly increases in the developed and developing countries and is a huge, growing burden for health care systems. In the USA T2DM already accounts for over 130 billion Dollar of the health care costs (Stumvoll, Goldstein, & Haeften, 2005). In the past, T2DM was rarely seen in young people and thus called age-onset diabetes. But its prevalence increases due to changes in the lifestyle. For babies born in 2000 an estimated chance of 33%50% to develop T2DM leads to 11 to 18 years reduced life expectancy. Several risk factors account for this prevalence including genetics, nutrition, low physical activity and low birthweight. The genetical prevalence is identified by looking at the offspring of diabetic patients, a positive family history confers for a 2.4 fold increased risk for T2DM. For first-degree relatives to an afflicted person the risk is Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Approaching Type 2 Diabetes Mellitus by Systems Biology

increased by 15% to 25%. In twin studies the difference of the concordance rate between monozygotic and dizygotic twins returns an estimate of the genetic contribution, as dizygotic twins only share 50% of the genetic code. The concordance rate is 35% to 38% for monozygotic twins and 17% - 20 % for dizygotic twins. Prevalence merges with the environment. Increased availability of food combined with reduced physical activity lead to obesity which itself becomes the major influencing factor. In the USA 1991 12% of the population have been classified to be obese, increasing to 20.9% in 2001 and even 30% today resulting in an anticipated epidemic increase of T2DM in the next decades. Physical inactivity is a controllable factor, so 20 minutes exercise per day is enough for a noticeable improvement in treating T2DM. Unhealthy diet with a surplus of fatty acids completes the problem. Several molecular mechanisms are proposed to link obesity to T2DM. But the connection to the pathophysiology still remains unknown. Less than 10% of the T2DM variants are monogenic disease forms, on the other hand a high number of susceptibility genes is accounted for T2DM. Alterations in an entire network of genes is thought to be responsible for the disease. Most of the costs do not derive directly from diabetes but from its associated complications like macrovascular and microvascular diseases or accelerated atherogenesis. In an unclear pathogenesis, T2DM is preceded by impaired glucose tolerance, where glucose needed for cell energy cannot penetrate the cell wall anymore. Followed by an impairment in insulin action, increased adiposity drives a progression into insulin resistance. Since available T2DM therapies are of limited effectiveness, new insight into the disease by biomedical research must be sought. The classic genetic approaches have been more successful in monogenic diabetes like maturity-onset diabetes in the young or mitochondrial diabetes. The unknown hereditary mode poses a challenge, so far resulting in a number of candidate genes. Transgenic and knock-out mice are helpful in dissecting the transcriptional regulatory network. With the dawn of high-throughput methods a novel way to tackle these challenges arises. Microarrays allow us: 1. 2. 3.

To dissect the diversity of the disease primarily on the transcriptomic level. To identify transcription factor target sets using ChIP-on-Chip. To search for single nucleotide polymorphisms (SNP) using genotyping arrays.

The complex pathophysiological interactions between the tissues fat, muscle, liver, pancreas and brain are captured in distinct expression profiles for different mouse strains and different diets. On the

Figure 1. Different influences on the metabolism cause T2DM with its subsequent complications

362

Approaching Type 2 Diabetes Mellitus by Systems Biology

level of proteomics one now knows the secretory proteins in adipose tissue (Chen, 2005), while massspectrometry experiments are pursued in several labs. In this chapter, systems biology is defined as the development of mathematical models by the aggregation of experimental results. In the following we give an overview of the physiology of T2DM to sketch the complexity of the disease. T2DM is under study in several animal models based on different changes in the genomes. These genetic changes have been the most promising approach in the last years, now complemented by high-throughput gene expression, proteomic or metabolic surveys. The results are merged in the discipline of systems biology to generate and validate mathematical models.

T ype 2 D iabetes

Me llit us: Physi ology

In this subchapter the biologic topic, T2DM, shall be outlined. Central parts of the metabolism are affected. There is no space to address T2DM exhaustively, but only to comprehend the complexity of the affliction. The first paragraph distinguishes different types of diabetes, afterwards we look at the physiological interplay to subsequently describe the pathogenesis, and we finally link this topic to medicine with the diagnosis criteria.

D iabetes The main characteristic of diabetes mellitus is an abnormally high level of glucose in blood (Dean & McEntyre, 2004; Stumvoll et al., 2005). Normal people can mediate their blood glucose, whereas in diabetics glucose levels remain high. Insulin mediates the blood glucose level, and in diabetes insulin is not produced at all, insufficiently or not as effectively as needed. Most common forms are the autoimmune disorder type 1 diabetes (5% of the cases) and obesity associated type 2 diabetes (95%). Some rare variants exist, for example by single gene mutations. T2DM generally occurs in obese adults. Many underlying factors contribute to high blood glucose levels. An important factor is a resistance of the body to insulin, ignoring its insulin secretions. Therefore T2DM is a combination of deficient secretion and deficient insulin action. The rise of obesity in the population is the driving force behind the increase of diabetes. Today it can be difficult to maintain healthy body weight in the presence of abundant food and a sedentary life. Being overweight or obese is defined by looking at the Body Mass Index (BMI). A BMI of 18-25 is healthy, 25-30 overweight and above that level obese.

Physiology Here we follow the interaction of the key players for energy control in the human body. Three interactors are discussed and subsequently the involved tissues: • • •

Glucose, an essential energy source for the body Insulin, regulator of glucose and energy balance Glucagon, opponent of insulin

363

Approaching Type 2 Diabetes Mellitus by Systems Biology

Blood glucose levels are variable depending on the needs of metabolism, rising for three reasons: diet, breakdown of glycogen or hepatic synthesis of glucose. Glucose is regulated by several hormones, in particular by insulin. When glucose is abundant, insulin is released from pancreas and stimulates: • • • • •

Muscle and fat to remove glucose from the blood Cells to convert glucose in ATP Liver/muscle tissue to store glucose as glycogen Fat tissue to store glucose as fat Cells to use glucose in protein synthesis

Glucagon opposes the action of insulin and rises in scarcity. Insulin activates formation of glycogen and glucagon activates glycogen breakdown. Glucagon also helps the body to use alternative resources such as fat and protein. Fasting results in a fall of blood sugar level, leading to lower insulin and higher glucagon. Glucagon raises blood glucose by calling of glycogen from the liver short term reserve and glucose production by converting amino acids in the liver. Glucagon level is stimulated by several causes, like protein-rich food or stress. By fasting for a couple of days, the liver is exhausted by glycogen but continues to make glucose from amino acids and glycerol in fat. When glycogen stores are full, lipogenesis converts glucose into fat. Insulin supports lipogenesis by increasing transporters, mediated release of fatty acids and inhibition of fat breakdown, lowering fatty acid in blood. Insulin also stimulates entry of amino acids into cells and protein production. Four tissues are affected by this interplay: • • • •

Liver: Buffers and produces glucose Fat: Stores energy Skeletal muscle: Stores energy as glycogen Pancreas: Insulin is produced, stored and released from the pancreatic islets.

One of the most important organs in this interplay is the liver. It produces and consumes glucose and buffers glucose levels. From digestion the liver receives glucose-rich blood and removes large amounts of glucose to mediate the blood glucose level. Rise of blood glucose detect the pancreatic beta cells and respond with the release of insulin. This rise of glucose also lowers the release of glucagon and thus the production of glucose from other sources.

Figure 2. Insulin as main regulator

364

Approaching Type 2 Diabetes Mellitus by Systems Biology

In every tissue inside the cell, glycolysis uses some of the glucose. Glycolysis is a central pathway of carbohydrate metabolism which occurs in all body cells and releases energy and carbohydrate intermediates for use in metabolism.

Pathogenesis In the pathogenesis of T2DM, insulin is no more able to stimulate the glucose usage in fat and muscle and to inhibit the glucose production adequately. Impaired insulin sensitivity and glucose intolerance are early phenomena, leading to hyperglycemia, hylerlipidemia and, eventually, to a failure of pancreatic β cells to produce and secrete a sufficient amount of insulin. However, most genes and their associated molecular network contributing to the onset and course of the disease are yet unknown. An understanding of the interplay between obesity and insulin resistance is crucial but not completely resolved (Kahn & Flier, 2000; Stumvoll et al., 2005). Obesity and physical inactivity is strongly associated with insulin resistance. Several mechanisms mediating this relationship are identified. Circulating hormones, cytokines and metabolic fuels from the adipocytes influence insulin action. Sometimes lipids are related to skeletal muscle insulin resistance, highlighting excessive fat storage in non-adipose cells.

D iagnosis Diabetes mellitus is diagnosed on the basis of WHO recommendations from 1999, which includes both fasting and 2h after 75g glucose load criteria into a practicable diagnostic classification (Table 1). impaired fasting glucose and impaired glucose tolerance are conditions predisposing overt diabetes mellitus. If not treated a substantial part of people with these problems will progress to overt diabetes (Stumvoll et al., 2005).

S pecies For the means of molecular biology different tissues of an organism are analysed. Due to ethical restrictions, human tissue is rarely available. To bypass this problem animal models are used in research. In the following some of the most important strains are presented. As mentioned it is difficult to get human tissue for analysis demanding the cooperation of many medical doctors for statistically meaningful samples. In addition, nutrition and lifestyle are not under

Table 1. Diagnostic criteria of diabetes mellitus and other categories of hyperglycaemia (mmol / L)

Fasting

2h after 75g glucose load

Diabetes mellitus

≥ 7.0

or

≥ 11.1

Impaired glucose tolerance (IGT)

< 7.0

and

7.8 – 11

Impaired fasting glucose

6.1 – 6.9

and

< 7.8

Normoglycemia

< 6.1

and

< 7.8

365

Approaching Type 2 Diabetes Mellitus by Systems Biology

control in contrast with lab mice. On the other hand the heritable predisposition for the disease is observable in family studies, twin studies and ethnic or population differences. In the chapter about the genetics I describe approaches to track involved genes. With animal models more finegrained study designs are possible by controlled conditions with regard to nutrition and lifestyle but also genetics. Time series for different disease states and back crossing experiments for genetical insight are further features. T2DM affects the basic metabolic process and therefore is traceable in organisms from mice and rats down to Caenorhabditis Elegans, where we find the most relevant pathways as aging pathways. Although rat models for T2DM exist like the Zucker Diabetic Fatty rat (ZDF rat) or Zucker Fatty rat, most of the available high-throughput screens and genome-wide genetical studies are performed in mouse, now pointed out in more detail. A complete overview about the mouse models used in T2DM research is provided by (Clee & Attie, 2007) highlighting the history of the mouse strains and their susceptibility to impaired glucose tolerance or T2DM. For example the C57BL/6, which accounts for 14% of the experiments, shows diabetessusceptible and diabetes-resistant aspects. With a so-called ob mutation in the Leptin gene, the same mouse strain is severely diabetic. Likewise the BTBR strain shows strong diabetes-susceptibility. The New Zealand Obese (NZO) mouse is a polygenic mouse model reflecting the whole metabolic syndrom, surrounding obesity and T2DM. All of the described mice models are available from the Jackson Labs including the focussed T2DM models (Jackson Labs, 2006). Insight into the metabolism and insulin resistance drawn from mouse models is described in (Nandi, Kitamura, Kahn, & Accili, 2004). The authors break down the plurality of knock-out and transgenic mice by phenotypes and tissue to find unsuspected players, e.g. transcription factors, which emerge from the underlying studies. In summary, major findings can arise from a variety of organisms to understand human metabolism. A caveat is, that the disease in the animal models may have causes different from the human setting. So the results lack comparability and have to be reproduced in different models. To understand the missing comparability we continue with a look at the methods for analyzing differences in genetic code.

G enetics T2DM is clearly associated with a genetic prevalence which is demonstrated for example in family studies. A positive family history is related to a 2.4 fold increased risk (Stumvoll et al., 2005). Twin studies contributed distinguishing non-genetic from genetic factors. For impaired glucose tolerance concordance rates were 88% in monozygotic twins. The two main strategies are the genome-wide scanning and the candidate gene approach. In genomewide scanning different genomes from the same species are compared to each other to narrow down disease related regions. In the candidate gene approach gene sequences of physiologically important proteins are compared among population samples. Both approaches seek to isolate causative genetic changes.

G enome-W ide S canning For the genome-wide scanning in human association studies are performed on patient cohorts raised over years using genotyping microarrays isolating chromosomal regions or, more advanced, single nucleotid polymorphisms (Permutt, Wasson, & Cox, 2005; Sladek et al., 2007).

366

Approaching Type 2 Diabetes Mellitus by Systems Biology

In a variant, called linkage approach, the entire genome of affected family members is compared using genetic markers, to combine the alterations with the family genealogy over several generations and affected sibling pairs to look for associations between parts of the genome and the risk of developing diabetes. This locates genes by the rationale, that family members not only share the phenotype but also chromosomal regions surrounding the involved gene. Positive associations are found in one or more studies, but the following positional cloning of causative genes has mostly been unsuccessful. To make the genetic quest more complicated a possibility arose of a relation of T2DM to imprinted genes. Imprinted genes are genes for which expression varies depending on the sex of the transmitting parent. The genome-wide scan is also used in mice. Through backcrossing between susceptible and unsusceptible strains, arbitrary quantitative trait loci are isolated with a similar goal, with a much smaller demand of individuals as in the human case (Permutt et al., 2005). In the animal model it is more easy to follow and direct the family history. The chromosomal regions linked to the trait, here T2DM, are called quantitative trait loci. Recently the genetic component has been directly linked to the expression level using expression microarrays and genotyping arrays on backcrossed mouse strains (Lan et al., 2006). Thus, it integrates two different information levels and results in narrow genomic candidate regions. Genetic linkage and association to a phenotype, like T2DM, often has a poor replicability, which is regularly attributed to a number of factors amongs others ethnic stratification, population-specific linkage disequilibrium between markers and causal variants but also gene-by-gene and gene-by-environment interactions. Because of the late onset of T2DM, susceptibility gene variants may exist in the control group and reduce the power of genetic-linkage and association analyses.

C andidate G ene A pproach The candidate gene approach examines specific genes on their role in T2DM. In unrelated individuals, the statistical association of an allele and the phenotype T2DM or impaired glucose tolerance is tested. Obvious biological candidates for insulin resistance have been examined (Dean & McEntyre, 2004; Parikh & Groop, 2004). But the candidate gene approach had minor success in identifying causative factors. In many candidate genes, like ABCC8 or GCGR, variants were extensively analysed, but mostly the initial association could not be replicated in subsequent studies (OMIM, 2000). The candidate gene approach is scientifically more simple focussing on disease status and alleles or haplotypes in insulin signalling or glucose metabolism. (Dean & McEntyre, 2004; Parikh & Groop, 2004) describe work and results performed on the most promising candidates. In the animal models genetical manipulation is possible often leading into mouse models as described above (Clee & Attie, 2007).

S ummary Due to the heterogeneity, genetic studies produced very diverse results. At this time their incorporation into a systems biology model is a challenge, as most of the models do not account for changes in genetic code but focus on the physiology. An exhaustive collection of entangled genome regions is provided by OMIM under the identifier #125853 (OMIM, 2000). Mutations of a single gene can result in disease. This happens in rare forms of diabetes. Such mutations can be investigated with sequencing to find responsible alterations in the DNA, so called single nucleotide polymorphisms (SNP). T2DM is assumed to be polygenic. Disease genes may show subtle but common differences in the gene sequence. It is difficult to link these common gene variations to an

367

Approaching Type 2 Diabetes Mellitus by Systems Biology

increased risk of developing T2DM. Therefore it is a remarkable result, that microarray study results converge on the same functional modules by deriving metabolic pathways from expression results (Toye & Gauguier, 2003).

G ene E xpressi on in T 2DM DNA microarrays present a powerful tool for studying the mechanisms of complex diseases and have been used to dissect every aspect of T2DM (Sun, 2007). Behind physiologic and pathologic conditions the technology permits a more comprehensive understanding of the multiple genes involved in the mechanisms of the disease. Microarrays allow the categorization of disease states according to the changes in the mRNA expressed. This is used in parallel in several tissues and different cells at the same time or in the same cell type at several time points. (Sun, 2007) outlines the current status of DNA microarray applications in the field of obesity and T2DM. A number of high-quality microarray data sets can be found at (mult., 2002). Animal models and cultured cells analysed with microarrays are used in a variety of studies. In T2DM they returned a tremendous amount of information about the pathophysiology. Studies in vivo and in vitro profiling adipocytes from intra-abdominal and subcutaneous adipose tissue lead to coordinated depotspecific differences in expression of multiple genes in embryonic development and pattern specification. In the case of the liver the nonalcoholic fatty liver disease is related to lipid metabolism, extracellular matrix remodeling, liver regeneration, apoptosis and detoxification process. In rat skeletal muscle the activation of the hexosamine biosynthesis pathway – a nutrient-sensing mechanism – decreased genes involved in oxidative phosphorylation. Diet effects alter the expression of hundreds of genes primarily related to lipid metabolism and transcription factors in adipocyte differentiation. Expression profiling in the central nervous system is only possible in animals by finding the cytokine signalling box-containing protein 4 expressed in brain areas linked to energy homeostasis. In human analog studies are carried out, like in adipose tissue returning disperse results, e.g. linking genes to lipid and glucose metabolism, membrane transport and promotion of the cell cycle. In liver, for patients with nonalcoholic steatohepatitis gene groups related to (also) lipid metabolism and extracellular matrix remodeling are differentially expressed. In skeletal muscle probably the most important finding is the upregulation of the oxidative phosphorylation pathway in accord with the rat results (see above). The current application of microarrays is accompanied by some problems and challenges. A set of guidelines called Minimum Information about a Microarray Experiment (MIAME) is introduced by the International Microarray Gene Expression Data Society. However there are still some issues to be considered. The total number of probes on a microarray and the selection of the probe sequences from the gene/transcript sequences differs between the chip manufacturers and therefore hinders comparability. Direct comparisons may focus on the overlapping part, in all other cases the differences have to be accounted when interpreting the results. Biological parameters are to keep constant in the experiment like age of the animals or patients, balanced gender ratio and sample collection at same time points in the menstrual cycle. Data analysis is complex due to the large amount of genes and possible study designs. A small number of samples is most often the biggest issue resulting in low power of the study. Microarray experiments mostly result in a list of differentially expressed genes. A plurality of tools has been developed to enhance the expression results, and only selected approaches can be mentioned. (Jensen & Steinmetz, 2005) discuss the comparability of array results in terms of integrating data sets to

368

Approaching Type 2 Diabetes Mellitus by Systems Biology

raise the power and confidence in the results. The number of available experiments suggests to perform first meta-analyses identifying core processes underlying T2DM. A simple way to ascend from the gene expression level to biological function in terms of metabolic or signalling pathways is enrichment. The technique has originally been introduced in (Mootha et al., 2003) as “gene set enrichment analysis”. In (Liu et al., 2007) an advanced approach, “gene network enrichment analysis”, is used to identify network models for T2DM (see below). Not only sets of apparently dependent genes are taken into account but rather subnets of the protein-protein-interaction network. The gene networks are compared with the results of several microarray data sets from (mult., 2002). Altogether the analysis of the transcriptome with microarrays is a valuable ressource of data for systems biology. The mass of data may be frightening and data quality issues are regularly brought up. Nevertheless the alternative, RT-PCR, returns only selective results and thus high-throughput methods support the systems biology approach outlined in the next subchapter.

S ystems

B iology f or T 2DM

Systems biology comprises different aspects exemplified in this chapter. It is sustained by genetical analyses and high-throughput methods on different species. The center is the aggregation of the different evaluations to a comprehensive model (Klipp, Herwig, Kowald, Wierling, & Lehrach, 2005).

S ystems B iology S tarts with D ata Integration On first-level heterogenous resources, like experimental data sets or databases are integrated to parse data and query information. Several types of data sets are described above and can be set in relation to gene or protein sequence databases, interaction data or pathway data for several organisms. In a second level correlations across different sources lead to a more comprehensive and coherent picture. For example the genetic hints by now do rarely correlate with results from expression analysis. On a third level the newly gained information is casted into networks and pathways for the understanding of T2DM on a cellular level.

S ystems B iology is Modeling T2DM is a complex process not following any elementary principles, at least we are not aware any. The outcome from the genotype and lifestyle cannot be foreseen by experience. The properties of an appropriate model let us distinguish between system states, for example T2DM – healthy, obese – lean or high-fat diet – healthy diet. The variables, parameters and constants of the model clear up our possibilites to regulate and control the disease. The substantial changes in T2DM are on the metabolic level. Perhaps a single model cannot serve all purposes. Metabolism is a generic term for catabolic and anabolic reactions. These metabolic reactions transform molecules from one type into molecules of a different type. Metabolic reactions are modeled on three levels of abstraction: • • •

Enzyme kinetics study the dynamic properties of the reactions. Stoichiometric analysis describes the network character. Metabolic control analysis (MCA) quantifies the effect of perturbations in the network. 369

Approaching Type 2 Diabetes Mellitus by Systems Biology

Figure 3. Systems biology facilitates to attain new perceptions

Gene expression can be modelled in two ways. The expression of one to few genes can be described with transcription, translation, including binding of transcription factors and RNA polymerases to DNA and effect of activators or inhibitors and subsequently the different stages of maturation of mRNA. This is not appropriate for microarray experiments with ten thousands of measurements. Reverse engineering methods reconstruct the underlying regulator networks. This approach neglects the complex regulatory machinery covering a larger fraction of genes in a cell and focussing on activators and inhibitors.

S ystems B iology Uses C omputers and Internet Modeling tools help formulate theoretical hypotheses and extract information relevant to the hypotheses. General purpose tools like R, Matlab or Mathematica have a steep learning curve. Focussed tools for the special needs of biologists are easier to use like PyBioS (Wierling, Herwig, & Lehrach, 2007), where the handling of the differential equations is covered behind a web interface. Parameters and kinetics are controlled through this interface. Exchange of models meanwhile is standardized by the systems biology markup language (SBML) also used for some of the models described below. With the rapid increase of biological data the need to organise and structure the data increases and so does the number of databases in the internet. No comprehensive database with the focus T2DM is available. But different databases provide the information needed for the modeling. E.g. several microarray datasets are available at (mult., 2002) or the KEGG pathway database provides the topological model of a T2DM signalling pathway.

S ystems B iology Models S erve D ifferent Purposes A descriptive model elucidates causes and developments or explains the expression signatures that we observe in the experiments. Already projects are under way to use expression signatures in the diagnosis of certain diseases. After the refined diagnosis an optimized drug treatment uses the best possible medi-

370

Approaching Type 2 Diabetes Mellitus by Systems Biology

cine administered in an adequate dose. The admission process for new treatments could be facilitated if accompanying models show that it complies to the restrictions.

Mode ls of T 2DM In the last subchapter we discuss mathematical modeling in the context of T2DM. This subject is not new, but known as physiological modeling for years. New are the computer-assisted techniques and the support by high-throughput data resulting in models of increased scale. The body glucose balance and T2DM itself has been subject to modeling for several years. But despite the availability of these models, we still miss key aspects explaining the pathogenesis or adequate drug targets. Here we first discuss the topic of mathematical modeling and then present five examples of models in this research subject.

Mathematical Modeling The goal of the Systems Biology approach is to create a comprehensive representation of all of the biochemical reactions in human and to understand the control of signalling pathways in complex networks. Therefore mathematical models of descriptive, predictive or elucidative nature are used. Ultimatively a quantitative, kinetic model reflects the outcome of the experiments. Such models are rare by now and none exists for T2DM comprising all tissues and aspects of the disease. Mathematical models have the advantage to be cheap and reduce the number of necessary animal experiments and, at the same time, facilitate the conceptual clarification of the disease and observed biology, independent of the kind of the model, a graph, network model or kinetic, differential equation model (Klipp et al., 2005). Special challenges in T2DM are a suspected entanglement of the mitochondrion, the influence of nutrition and genetic prevalence. No templates exist to incorporate such aspects into a model.

S elected Models Here we present 5 examples of models for T2DM. (Kansal, 2004) or the introduction of (Jiang, Cox, & Hancock, 2007) review several approaches to the topic and are recommended for further reading. The models are intentionally chosen to present different modeling approaches and therefore do not have much in common but the subject T2DM. Model I and V are differential equation models and return numerically exact results. Model II is a large scale model incorporating a maximum of components. Model III and IV are interaction maps for discussion of known interactions in terms of control theory as well as highlight previously unevaluated protein-protein-interactions for possible relationship to T2DM.

Model I 1979 the “minimal model” is presented in (Bergman, Ider, Bowden, & Cobelli, 1979). It models glucose clearance for understanding the action of insulin. It comprises two coupled differential equations: dG (t ) = − {SG + X (t )}⋅ G (t ) dt dX (t ) = p2 ⋅ I (t ) − p3 ⋅ X (t ) dt 371

Approaching Type 2 Diabetes Mellitus by Systems Biology

where G is the concentration of glucose in the plasma, I is the concentration of insulin in the plasma, X is the concentration of insulin in remote compartment. SG is the glucose effectiveness and p2 and p3 are model parameters. For a glucose injection the two equations describe the glucose decline and insulin movement from blood to insulin-sensitive tissue. The first equation is the decline of glucose as an insulin-independent process and an insulin-dependent process. The second equation stands for the insulin removal from blood dependent on the available blood insulin as well as the insulin already in the insulin-sensitive tissue. The model is successful as a clinical tool und meanwhile has been checked and extended in various directions. It is shown here (Figure 4) for its simplicity.

Model II For skeletal muscle the authors of (Pollard et al., 2005) present a large scale model with 157’000 molecular components and more than 210’000 relationships between those components. Building on several microarray data sets, the authors take the challenge to model the entity of the skeletal muscle cells. For an approach of this size reactions cannot be composed by hand but have to be built computationally. On the other hand the intricate complexity of large scale schemes is reduced by restricting expression changes to three categories: expression increased, unchanged or decreased in T2DM. Thus it is directly set up as a qualitative, discrete model reducing parameter space and computation time. The authors apply their model to the treatment of T2DM with different drugs or post-transplant diabetes mellitus.

Model III An interaction map is presented in (Kitano et al., 2004) like in terms of control theory, clearly separating the interactions between the tissues. The robustness of the body energy balance is discussed highlighting several feedback loops for unstable food supply. The interaction map elucidates cross talk between tissues and pathways. This is the only model so far to divide and link the related tissues. In model IV tissues are intermingled and models II and V are focussed on one tissue type each.

Figure 4. Modelling and simulation of the minimal model with PyBioS

372

Approaching Type 2 Diabetes Mellitus by Systems Biology

Model IV In (Liu et al., 2007) the authors identified an insulin signaling and a nuclear receptor network consistently and differentially expressed in several occurences of insulin resistance. Integrating different microarray data sets from (mult., 2002) and combining the results with the protein-protein-interaction network in this model the authors determine the two subnetworks of the protein-protein network. The method does not consider tissues or species but intermingles the data sets and thus presents a robust network. The results for the two subnetworks suggest, that different members are transcriptionally altered under different insulin-resistances. This may be a consequence of noisy microarray data but is also consistent with the conception of T2DM as a combinatorial disease with different gene sets independently causing T2DM under different circumstances.

Figure 5. The insulin signalling network of model IV combining protein-protein-interactions and gene expression data

373

Approaching Type 2 Diabetes Mellitus by Systems Biology

Model V A kinetic model in (Jiang et al., 2007) targets glucose and insulin in pancreatic β cells. The model consists of 44 enzymatic reactions, 59 metabolic state variables and 272 parameters integrating subsystems such as glycolysis, TCA cycle, respiratory chain and pyruvate cycle. This model is focussed on one tissue and cell type but considers compartmentalization of the reactions in cytoplasm and mitochondrial matrix. The analysis of the model elucidates restrictions and chances for the analysis of interspecies differences. Where human and rat have malate dehydrogenase in pancreatic islets, it lacks in mouse pancreatic islets. One of the key findings of the presented model is no dramatic effect on ATP concentration or oscillatory behavior with or without malate dehydrogenase and thus illustrates the robustness of the model and ATP regulation.

Prospect Modelling approaches in T2DM have to tackle enormous challenges like incorporating genetics, nutrition and mitochondria. For this challenges no predecessors exist in other diseases. With the advent of high-throughput experiments and the methods of systems biology a new chance to resolve these issues arose. Models exist but there are still several steps ahead. Previous knowledge is limited as for example only some metabolic pathways are available as kinetic models, where most of the signalling pathways only exist as interaction maps.

R eferences Bergman, R. N., Ider, Y. Z., Bowden, C. R., & Cobelli, C. (1979). Quantitative estimation of insulin sensitivity. Am J Physiol, 236(6), E667-677. Chen, X. a. C., S.W. and Pannell, L.K. and Hess, S. (2005). Quantitative proteomic analysis of the secretory proteins from rat adipose cells using a 2D liquid chromatography-MS/MS approach. J. Proteome Res., 4(2), 570-577. Clee, S. M., & Attie, A. D. (2007). The genetic landscape of type 2 diabetes in mice. Endocr Rev, 28(1), 48-83. Dean, L., & McEntyre, J. (2004). The genetic landscape of diabetes: NCBI. Jackson Labs. (2006). Human disease and mouse model detail for NIDDM. Jensen, L. J., & Steinmetz, L. M. (2005). Re-analysis of data and its integration. FEBS Letters, 579(8), 1802-1807. Jiang, N., Cox, R. D., & Hancock, J. M. (2007). A kinetic core model of the glucose-stimulated insulin secretion network of pancreatic beta cells. Mamm Genome, 18(6-7), 508-520. Kahn, B. B., & Flier, J. S. (2000). Obesity and insulin resistance. J Clin Invest, 106(4), 473-481. Kansal, A. R. (2004). Modeling approaches to type 2 diabetes. Diabetes Technol Ther, 6(1), 39-47.

374

Approaching Type 2 Diabetes Mellitus by Systems Biology

Kitano, H., Oda, K., Kimura, T., Matsuoka, Y., Csete, M., Doyle, J., et al. (2004). Metabolic syndrome and robustness tradeoffs. Diabetes, 53 Suppl 3, S6-S15. Klipp, E., Herwig, R., Kowald, A., Wierling, C., & Lehrach, H. (2005). Systems biology in practice. Wiley-VCH. Lan, H., Chen, M., Flowers, J. B., Yandell, B. S., Stapleton, D. S., Mata, C. M., et al. (2006). Combined expression trait correlations and expression quantitative trait locus mapping. PLoS Genet, 2(1), e6. Liu, M., Liberzon, A., Kong, S. W., Lai, W. R., Park, P. J., Kohane, I. S., et al. (2007). Network-based analysis of affected biological processes in type 2 diabetes models. PLoS Genet, 3(6), e96. Mootha, V. K., Lindgren, C. M., Eriksson, K. F., Subramanian, A., Sihag, S., Lehar, J., et al. (2003). PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet, 34(3), 267-273. mult. (2002). Diabetes Genome Anatomy Project. from http://www.diabetesgenome.org/ Nandi, A., Kitamura, Y., Kahn, C. R., & Accili, D. (2004). Mouse models of insulin resistance. Physiol Rev, 84(2), 623-647. OMIM. (2000, 04.10.2005). Online Mendelian Inheritance in Man, OMIM (TM). from http://www.ncbi. nlm.nih.gov/omim/ Parikh, H., & Groop, L. (2004). Candidate genes for type 2 diabetes. Rev Endocr Metab Disord, 5(2), 151-176. Permutt, M. A., Wasson, J., & Cox, N. (2005). Genetic epidemiology of diabetes. J Clin Invest, 115(6), 1431-1439. Pollard, J., Jr., Butte, A. J., Hoberman, S., Joshi, M., Levy, J., & Pappo, J. (2005). A computational model to define the molecular causes of type 2 diabetes mellitus. Diabetes Technol Ther, 7(2), 323-336. PyBioS (15.03.2008) from http://pybios.molgen.mpg.de/ Sladek, R., Rocheleau, G., Rung, J., Dina, C., Shen, L., Serre, D., et al. (2007). A genome-wide association study identifies novel risk loci for type 2 diabetes. Nature, 445(7130), 881-885. Stumvoll, M., Goldstein, B. J., & Haeften, T. W. v. (2005). Type 2 diabetes: Principles of pathogenesis and therapy. The Lancet, 365, 1333-1346. Sun, G. (2007). Application of DNA microarrays in the study of human obesity and type 2 diabetes. Omics, 11(1), 25-40. Toye, A., & Gauguier, D. (2003). Genetics and functional genomics of type 2 diabetes mellitus. Genome Biol, 4(12), 241. Wierling, C., Herwig, R., & Lehrach, H. (2007). Resources, standards and tools for systems biology. Brief Funct Genomic Proteomic, 6(3), 240-251.

375

Approaching Type 2 Diabetes Mellitus by Systems Biology

K ey T erms Differential Expression: In a case study experiment comparing two expression states of the same tissue or same cell type. DNA Microarray (microarray, array, DNA chip): A microarray is a collection of microscopic DNA spots, commonly representing sequence extracts of single genes, arrayed on a solid surface by covalent attachment to a chemical matrix. DNA arrays are commonly used for gene expression experiments. Impaired Glucose Tolerance (IGT): Impaired Glucose Tolerance is a pre-diabetic state of dysglycemia, that is associated with insulin resistance and increased risk of cardiovascular pathology. IGT may precede type 2 diabetes mellitus by many years. Kinetic Model: A mathematical model using differential equations or similar to allow quantitative, continuous predictions for the behavior of a system. Mathematical Model: A mathematical model is an abstract model that uses mathematical language to describe the behavior of a system. Protein-Protein Network: The union of undirected pairwise interactions between proteins. Interactions experiments may return large lists of protein-protein-interactions, but do not provide information about the character of the interaction, e.g. transient binding or complex building. Type 2 Diabetes Mellitus (T2DM): Type 2 Diabetes mellitus is a metabolic disorder that is primarily characterized by insulin resistance, relative insulin deficiency, and hyperglycemia.

376

377

Chapter XXIII

Systems Biology and Infectious Diseases Alia Benkahla Institut Pasteur de Tunis, Tunisia Lamia Guizani-Tabbane Institut Pasteur de Tunis, Tunisia Ines Abdeljaoued-Tej ESSAI-UR Algorithmes et Structures, Tunisia

Slimane Ben Miled Institut Pasteur de Tunis, Tunisia and ENIT-LAMSIN, Tunisia Koussay Dellagi Institut Pasteur de Tunis, Tunisia

abstract This chapter reports a variety of molecular biology informatics and mathematical methods that model the cell response to pathogens. The authors first outline the main steps of the immune response, then list the high throughput biotechnologies, generating a wealth of information on the infected cell and some of the immune-related databases; and finally explain how to extract meaningful information from these sources. The modelling aspect is divided into modelling molecular interaction and regulatory networks, through dynamic Boolean and Bayesian models, and modelling biochemical networks and regulatory networks, through Differential/Difference Equations. The interdisciplinary approach explains how to construct a model that mimics the cell’s dynamics and can predict the evolution and the outcome of infection.

Intr od ucti on Systems biology is an emerging interdisciplinary field in life science research which purpose is to study the dynamic interactions and the network structure in cells or tissues or whole organisms. It is commonly accepted that the design of research in this field, encompasses the following six steps (Ng, Bursteinas, Gao, Mollison, & Zvelebil, 2006; Philippi & Kohler, 2006): (i) generation of suitable biological data sampled from a population; (ii) enrichment of the collected data by publicly available data; (iii) curation Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Systems Biology and Infectious Diseases

of this data; (iv) exhaustive integration of the curated data; (v) modelling of the mechanism(s) of interest; and (vi) validation of the predicted model. Knowing the complexity of systems biology considered at the tissue or organism level, we will focus in our review on systems biology at the cell level. Systems biology research aims at understanding the mechanisms that shape the biological functions of a cell. It is achieved through the integration of biological information about the cell of interest (Box 1), then the extraction of mathematical models that mimic the behaviour of this cell under different conditions. These models should then guide biologists to design the appropriate experiments to be tested on the bench, which hopefully will yield decisive results. The biological function of the cell is determined by the dynamic interactions between different components or molecules involved in a given pathway. Pathways are not isolated but highly intricate and interconnected, and constitute a large, single, coherent but complex cellular network. The study of the cellular process modulated in response to an external stimulus is a phenomenon that depends not only on the number but also on the diversity and the dynamic of intracellular interactions. The response of host cells to pathogens has been extensively investigated as a model of cellular response to external stimuli. Such model takes systems biology a step further as it integrates data that are generated from two interacting/conflicting living organisms: the host and the pathogen. The specificity of this system should be taken into account during the modelling process and advanced strategies that capture this cohabitation and its consequences are required for modelling (Forst, 2006). Numerous host’s and pathogen’s proteins are usually involved in these interactions and trigger various biochemical reactions regulated in cascade. The outcome of the infection will depend on this complex network of cellular interactions. Another level of complexity is introduced by the interactions/exchanges between the host’s cells and the infectious agent (parasite, virus, bacteria). Especially as high throughput technologies, dedicated to the characterisation of these interactions/exchanges and their effects on the biological function of the two organisms, are still missing. However the use of organism’s oriented biotechnologies (i.e.: transcriptome) allowed a coherent and understandable view of the studied system. Even though these experiments fail to unveil the crosstalk between host and pathogen, they give separate insights into the host or pathogen responses. Developing tools that could integrate and process this data is a major task in infectious systems biology research. Box 1. The modelling of the mechanisms that shape the biological functions of an infected cell is achieved through the integration of information concerning the complexity of the system.

378

Systems Biology and Infectious Diseases

Pathogens are recognised through the host’s cells receptors. The diversity of pathogens and the large array of cells they could infect add complexity to the system. One given pathogen may infect different cell types which may express a different set of receptors, resulting in the activation of different signalling cascades and thus transcription of different sets of genes. In a given cell several pathways could be activated by the pathogen depending on the specific receptor(s) they use to enter the cell and the duration of contact between the infectious agents and the cell. These activated pathways may be different depending on the tissue origin and the activated state of the cell. In this chapter, we will introduce the basics of the host immune response then present the high throughput technologies used for collecting biological data, review the data mining techniques that could integrate these data and how mathematical modelling will help to understand the underlying biological mechanism. The limits of system biology approaches in the investigation of host pathogen interactions will be discussed in the conclusion.

T he Immune R esponse In mammalians, immunity against pathogens could be divided into innate and adaptive immunity. The innate response developed by polymorphonuclears monocytes/macrophages, NK cells and dentritic cells (Figure 1) represent the body’s first line of defence that aims at rapidly destroying invading micro-organisms or at least at containing their multiplication to a certain level. Several pathogens (ie: Leishmania, Mycobacteria, Listeria), specifically target cells of the innate immune system to infect them. In such cases, these cells play a dual role in infection: On the one hand, they offer a shelter and

Figure 1. Hematopoïetic stem cells are multipotent cells from which all the cells of the immune system develop. These cells give rise to all the blood cell types including myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, dendritic cells), and lymphoid lineages. Lymphocytes are T cells (T for thymus were they mature), B cells (B for bone marrow where they originate and Natural Killer (NK) cells.

379

Systems Biology and Infectious Diseases

a replication niche to the pathogen in which the latter can indefinitely persist; and on the other hand, they trigger a primary immune response that could significantly impact the adaptive immune response that will develop later (second line of defence). The issue of infection will result from the net balance between these counteracting mechanisms and systems biology may give useful information on how the micro-organism develop intracellularly and interact with the cell machinery. Cells of the innate immunity express on their surface, receptors that specifically recognize microbial products and that allow sensing the invading pathogens and their crude identification as bacteria, protozoa, fungi or viruses. These receptors participate not only to the engulfment and internalisation of the

Figure 2. Among the receptors involved in the recognition of pathogens the Toll-Like Receptors (TLR). Different TLR have been identified. These receptors recognize different Pathogen-Associated Molecular Pattern (PAMPs) conserved motifs unique to micro-organisms and absent on host. Some of these receptors are expressed on cell surface (TLR1, 2, 4,), other are found on endosomes (TLR3, 7, 8, 9). TLR2 and TLR4 are the principal receptors involved in the recognition of various bacterial cell wall components. TLR4 is crucial for effective responses to Gram-negative LPS. Delivery of LPS to TLR4 requires the accessory proteins LBP (LPS-binding protein; found in serum), CD14 and MD-2 (the latter two proteins can exist in soluble form, or bound to the membrane or TLR itself). TLRs 3, 7, and 8 appear to play important roles in responses to viruses. TLR3 responds to double-stranded viral RNA, and TLRs 7 and 8 mediate responses to single-stranded RNAs (CHAUDHURI, Toll-like receptors and chronic lung disease Clinical Science (2005) 109, (125–133)).

380

Systems Biology and Infectious Diseases

microbe but also activate different biochemical pathways (Figure 2 and 3) and transcription factor that modulate gene transcription and lead to the secretion of different proteins including cytokines, chemokines, and growth factors. This allows the establishment of an inflammatory response, the recruitment of other cell types to the site of infection and the activation and migration of Antigen-Presenting Cells (APCs) to lymph nodes to initiate the cellular or humoral adaptive immune responses (Figure 4). The activation of the latter as a second line of defence will lead to various immune effectors mechanisms associated to pathological processes and also to the reduction of the pathogen load and possibly cure (specific T cell cytotoxicity, activation of macrophage killing activities). Finally, the differentiation of T-cells into memory cells will lead to the development of a state of immunity against re-infection of variable strength and duration. For some pathogens only a state of partial premunition against re-infection will develop (i.e.: Malaria) and persistent infection may be maintained long life despite immune responses (i.e.: Herpes viruses, EB virus, Mycobacteria). The outcome of infection depends to a large part on the initial steps of host-pathogen interaction that take place after phagocytosis of the micro-organism by leukocytes. Several antimicrobial mechanisms Figure 3. TLR signalling pathways. Toll-like receptors (TLRs) recruit adapter molecules within the cytoplasm of cells in order to propagate a signal. Four adapter molecules are known to be involved in signalling (MyD88, Tirap, Trif, Tram). MyD88-dependent pathway possessed by all the TLR family members except for TLR3 is a common pathway to induce inflammatory cytokines. TLRs can also use MyD88 independent pathway. Stimulation with TLRs induces not only pr-oinflammatory cytokine genes but also type I interferon genes.

www.biken.osaka-u.ac.jp/act/act_akira_e.php

381

Systems Biology and Infectious Diseases

Figure 4. A variety of receptors (Rc) (Fcγ Rc, Mannose-fuccose Rc, Complement receptors (CR), scavenger Rc, Toll-Like Receptors (TLR),…), through which infectious agents bind to the cells, are present on the cell membranes of Antigen Presenting cell (APC). Some of these receptors are also involved in internalisation of pathogens. Ingested invaders are next digested and pathogen-proteins are finally presented in the context of Major Histocompatibility Complex (MHC). In the lymph node, this presentation together with the synthesis of IL-12 by APC, allow the stimulation of T helper cells. These cells in turn produce IFNγ, active on macrophages.

Receptor for pathogen

TNF

APC

Tcell

are then activated including chemical attack of pathogens upon the fusion of phagosomes with lysosomes and the generation, via the macrophage oxidative burst, of Reactive Oxygen Intermediates (ROI) such as hydrogen peroxide (H2O2). Generation of Reactive Nitrogen Intermediates (RNI), another effector function of macrophages, is induced only upon the activation of phagocytes. Two cytokines orchestrate this activation: TNFα produced by phagocytes and the IFNγ synthesized by the NK-cells and activated T-cells. Activation of T-cells requires among others, the recognition by T cell receptors of specific antigenic peptides presented by monocytes and dendritic cells in association with products of the Major Histo-Compatibility complex (MHC). IFNγ synthesis by NK cells and T-lymphocytes requires IL-12 a cytokine produced also by phagocytes (Figure 4). In many cases, especially when dealing with virulent pathogens, these defence mechanisms could be inadequate and fail to control infection. In the latter situation, the infected cell orchestrates a series of biochemical events that lead to its programmed cell death or apoptosis. This cell suicide has been recognised as an important component in the host defence against pathogens tightly interconnected with the innate and adaptive immunity. As pathogens co-evolve with their hosts, they frequently have developed strategies to circumvent the defence mechanisms described above. These escape strategies tend to generate an inefficient response and to turn the normal cellular pathways to the pathogen advantage. Thus, pathogens may inhibit receptor mediated immunity by either down-regulating cell surface receptor expression or blocking down stream transducing signals. The intracellular survival of several pathogens may also depend on their ability to alter phagolysosome biogenesis. Blocking antigen processing and up- and down-regulation of various cytokines and/or chemokines, are examples of strategies induced by several pathogens in

382

Systems Biology and Infectious Diseases

Table 1. Survival strategies of different pathogens within macrophages PATHOGENS

ALTERED FUNCTION

T. Gondii Leishmania M. tuberculosis T. Cruzi

Traf.cking to phagolysosome - Inhibition of acidification - Delayed formation - Arrest of phagosome maturation - Escapes into the cytoplasm

T. gondii, Leishmania Salmonella

T. gondii Leishmania M. tuberculosis Leishmania

Ysersinia pseudotuberculosis Bacillus anthracis T. gondii Ysersinia pseudotuberculosis T. gondii Leishmania

Anti-microbial mediators - Inhibition of NO production - Prevention of the trafficking of NADPH oxidase, iNOS. Antigen presentation - Down-regulation of MHC molecules expression Intracellular signalling - Disruption of IFNγ pathway Decreased transcription of IFNγRc Impaired transcription of IFNγ responsive genes Inhibition of IFNγ signalling pathway (JAK/STAT) - Reduction of PKC activity - Enhance intracellular Ca++ - Down-regulation of PTK activity - Activation of phosphatases - MAPK pathway Inhibition of MAPK activation Proteolytical degradation of MAPKs. Transcription factors - Inhibition of STAT1 translocation - NF-κB pathway Inhibition of NF-κB translocation Inhibition of IKK activation Cytokines production - Inhibition of TNFα synthesis Delayed IL-12 production - - Inhibition of IL-12 synthesis

REFERENCE (Mordue, 1999) (Desjardins, 1997) (Fratti, 2001) (Burleigh, 1995) (Luder, 2003) (Proudfoot, 1995) (Vazquez-Torres, 2000) (Luder, 1998) (Meier, 2003)

(Ting, 1999) (Nandan, 1995) (McNeely, 1987) (Eilam, 1985)

(Orth, 1999)

(Shapira, 2002)

(Butcher, 2002) (Carrera et al., 1996)

order to avoid or delay the activation of immune cell responses (Table 1). Furthermore, apoptosis can be either up- or down-regulated by the pathogen (or pathogen components) to facilitate its intracellular survival or to contribute to its dissemination within the host. A better understanding of the dynamic interactions between host cells and pathogens and the identification of the key elements that are at the crossroads of the biology of these two living organisms should lead to the development of improved treatments, diagnostics and vaccines.

H igh thr oughp ut bi otechn ologies Today, a large set of high-throughput biotechnologies that could characterize and quantify the co-evolution of host cells and pathogens at selected time points are routinely available. They allow landscapes of the cell “omics” (Table 2): transcriptome (by DNA microrarrays), proteome (by protein microarrays,

383

Systems Biology and Infectious Diseases

Table 2. This table lists all “omics” biotechniques for systems biology

Proteomics

Transcriptomics

OMIC

Technology

Description

cDNA or oligonucleotide microarrays

cDNA or oligonucleotides are spotted onto the array. Each gene is represented by one or more than one probe: the ensemble of probes mapping to different regions of the gene is usually called probe set.

Serial Analysis of Gene Expression (SAGE)

SAGE is a technique used by molecular biologists to produce a snapshot of the messenger RNA population in a sample of interest.

qPCR

Quantitative polymerase chain reaction (qPCR) is a modification of the polymerase chain reaction used to rapidly measure the quantity of RNA present in a sample.

Two-Dimensional Gel Electrophoresis

Gel electrophoresis research leverages software-based image analysis tools to analyze biomarkers by quantifying individual, as well as showing the separation between one or more protein “spots” on a scanned image of a 2-DE product. Differential staining of gels with fluorescent dyes (difference gel electrophoresis) can also be used to highlight differences in the spot pattern.

Mass spectrometry

Mass spectrometry is an analytical technique that can accurately measure the molecular weights of individual biomolecules, such as proteins and nucleic acids, and determine their structures. Detection of compounds can be accomplished at very low concentrations and in chemically complex mixtures. This can be achieved by labeling one sample with stable isotopes which leads to a mass shift in the mass spectrum. This technique has both qualitative and quantitative uses and is based on.

Yeast two-hybrid analysis

This system utilizes a genetically engineered strain of yeast. This mutant yeast strain can be made to incorporate foreign DNA in the form of plasmids. Separate bait and prey plasmids are simultaneously introduced into the mutant yeast strain. A change in the cell phenotype indicates successful interaction between proteins.

Protein microarrays

A protein microarray is a piece of glass on which different molecules of protein have been affixed at separate locations in an ordered manner thus forming a microscopic array. These are used to identify protein-protein interactions, to identify the substrates of protein kinases, or to identify the targets of biologically active small molecules. The most common protein microarray is the antibody microarray, where antibodies are spotted onto the protein chip and are used as capture molecules to detect proteins from cell lysate solutions.

Immunoaffinity chromatography followed by mass spectrometry

Usually the starting point is an undefined heterogeneous group of molecules in solution, such as a cell lysate, growth medium or blood serum. The molecule of interest will have a well known and defined property which can be exploited during the affinity purification process. The process itself can be thought of as an entrapment, with the target molecule becoming trapped on a solid or stationary phase or medium. The other molecules in solution will not become trapped as they do not possess this property. The solid medium can then be removed from the mixture, washed and the target molecule released from the entrapment in a process known as elution.

ChIP-on-chip

ChIP-on-chip (also known as ChIP-chip) is a technique that combines chromatin immunoprecipitation (ChIP) with microarray technology (chip). Like regular ChIP, ChIP-onchip is used to investigate interactions between proteins and DNA in vivo.

or phage display, or immunoaffinity chromatography followed by mass spectrometry), metabolome (by mass spectrometry), glycome (carbohydrates in a cell), localizome (sub cellular localizations proteins), interactome (protein-protein interactions) and fluxome (flux of metabolites through enzymatic reactions within a cell over time). Systems biology research aims at correctly modelling cell behaviour over time. To this end, experiments should be conducted at critical points of the infection process and at appropriate time intervals. As data produced experimentally are measured at sparse time series, they cannot reflect the flow of events in the infected cells. Hints about the survival strategies developed by different pathogens are

384

Systems Biology and Infectious Diseases

summarized in Table 1; others about the kinetic associated to the response to mycobacterium are summarised in the review of Hestvik and colleagues (Hestvik, Hmama, & Av-Gay, 2005). High-throughput biotechnologies, such as transcriptome, proteome, metabolome, yeast-two-hybrid or mass-spectrometry, are used to independently measure host and pathogen gene products profiling. Global investigations of genes expression in infected human or mouse cells (macrophages, dendritic cells, neutrophils, endothelial, leukocytes, or epithelial cells) or pathogens (Leishmania, Mycobacterium, Plasmodium, Toxoplasma, Trypanosoma, Staphylococcus, Streptococcus, Vibrio cholerae or Yersinia pestis) have been studied (Jansen & Yu, 2006; Jenner & Young, 2005; Maynard, Myhre, & Roy, 2007; Waddell, Butcher, & Stoker, 2007). These studies and others have allowed the identification of a common set of about 500 host’s genes which expression is independent of the pathogen and is shared among different cell types (Jenner & Young, 2005). However, pathogen specific transcriptional responses are also activated, sometimes by the same receptors. The identification of this signature is crucial. Moreover, there is a need to improve the quality of data because of the poor reproducibility of techniques such transcript profiling or MALDI protein profiling or the difficulty to identify cis-regulatory elements. Such limitations are amplified by the use of non-standardised protocols and by the genetic variability of hosts and pathogens which hinder the comparison between different experiments run under different conditions. Despite these limitations high throughput biotechnologies have proved to be very useful. Integrating data from these studies and combining them with other approaches give a systemic view of the cell response to infection.

D ata Integration Systems biology aims at simultaneously investigating and identifying all the cellular components that interact. Sufficient level of details or types of information must be integrated in a common database. Every piece of information about the “genes products” (transcripts, proteins, or metabolites) has to be tracked and processed to allow a functional presentation of the biological question in hand. This requires the access to tools that can rapidly process large scale data and transform it into more functional information such as gene catalogues, gene functional annotation, protein interactions, pathways, etc. The data to be collected must be taken cautiously as they are heterogeneous in quality and as tools to interpret them correctly are still lacking. Indeed, most public databases do not distinguish between direct and indirect, robust and less robust interactions, raising more uncertainty about the impact and the interpretation of the output of some experiments. To improve their quality, data should be carefully evaluated and where possible, manually curated. Thus, extensive efforts should be spent in the development of algorithms that extract, refine and organise this data into flexible repositories. This would guarantee that the generated models reflect the reality of immune cells dynamics, the fast evolution of the system and the conflicting interactions that take place between the host cell and the invading pathogen. Three data mining steps could be distinguished concerning the integration of these heterogeneous data (Klipp, Herwig, Kowald, Wierling, & Lehrach, 2005). The first step aim to parse any data, to query for information and to integrate it into object oriented depositories (i.e.: object=“gene products”). The second step (i.e.: sections 3.2-5 & 3.7) consists in the identification of associations across different datasets in order to gain a coherent view of the same object in the light of diverse data sources and curate the data to be integrated. The third step (i.e.: sections 3.1-2 & 3.6) focuses on the mapping of information gained on the interaction between objects, into graphs that will be used as basic models to depict

385

Systems Biology and Infectious Diseases

the targeted cellular system. The resulting database has to reflect the topology, the robustness and the quantity of the connections between objects. The first step requires the use of molecular biology oriented mining techniques. Due to the heterogeneity of the used technologies and of the data to be integrated formats, several tools (syntactical and semantical) have been developed in order to draw, in a coherent way the different facets of a same object. Thus, sequence similarity search tools (Altschul, Gish, Miller, Myers, & Lipman, 1990; Kent, 2002; Pearson & Lipman, 1988), classical literature mining tools (Becker et al., 2003; Couto et al., 2006; Gladki, Siedlecki, Kaczanowski, & Zielenkiewicz, 2008; Hammamieh et al., 2007; Maier et al., 2005; Muller, Kenny, & Sternberg, 2004; Rubinstein & Simon, 2005; Settles, 2005; Yuan et al., 2006), controlled vocabulary systems (Bairoch et al., 2005; Cimino, 1998; Hide, Smedley, McCarthy, & Kelso, 2003; Kaplan, Vaaknin, & Linial, 2003; Kasprzyk et al., 2004; Letovsky, Cottingham, Porter, & Li, 1998; Muller et al., 2004), or tables’ with identifiers that let the cross-mapping of the same object, are routinely used to establish a relationship between objects. The second step requires sophisticated statistical techniques to establish correlative association between heterogeneous data. Its ultimate goal is to curate data considering complementary data sources (i.e.: transcriptome/proteome, transcriptome/transcription factor binding site, interactome/proteome). To reach this goal mathematical functions such us distances and correlations (Klipp et al., 2005) are commonly used. Conflicts of data measures must be handled. The third step focuses on mapping the previous information gained into graphs that will be used in the modelling. This issue can be addressed by using Boolean and Bayesian techniques (Friedman, Linial, Nachman, & Pe’er, 2000; Pe’er, 2005). Its aim is to predict a snapshot of molecules interaction and structures by combining data from heterogeneous sources (i.e.: predict interactions out of gene profiling data). In the following subsections we will present examples of data (genome, transcriptome and/or proteome databases, etc.) that could be integrated and detail the protocol that can translate them into meaningful information.

G en ome Understanding the host, the pathogen and the vector genome structures is crucial in systems biology. The genomes of many mammals, including human as well as a growing number of different pathogenic microorganisms and vectors genomes have been sequenced and their genes identified (see Table 3). The purpose of these genome projects is to unravel the information encoded into the host, pathogen and (when appropriate) vector genomes and to decipher the impact of their interaction (vector/pathogen, host/pathogen, and possibly host/vector) on the outcome of the infection. The information about hosts’ genome structure is mainly centralized in ENSEMBL (Hubbard et al., 2007), a database that provides an accurate and automatic analysis of many chordate genomes. Functional genomics data in ENSEMBL can be retrieved using BioMart (Kasprzyk et al., 2004) - a tool that can extract exhaustive lists of biological attributes concerning ENSEMBL objects. It contains a flexible “query builder” interface that allows the user to select an object type (e.g. genes), to specify the genomic regions, and refine the result by using various filters. It can generate a number of different types of output, including FASTA sequence or data in flat files. The information about the pathogens’ and vectors’ genome is not centralized and has to be retrieved individually from the corresponding databases. For example, GeneDB (Hertz-Fowler et al., 2004) and 386

Systems Biology and Infectious Diseases

Species

Reference database

Availability

Homo sapiens

ENSEMBL

www.ensembl.org

Mus musculus

ENSEMBL

www.ensembl.org

Rattus norvegicus

ENSEMBL

www.ensembl.org

Canis familiaris

ENSEMBL

www.ensembl.org

HIV-1 and HIV-2

HIV database

www.hiv.lanl.gov

Trypanosomatidae

GeneDB

www.genedb.org

Plasmodium falciparum

PlasmoDB

www.plasmodb.org

Mycobacterium tuberculosis

Mycobacterium tuberculosis Database

www.broad.mit.edu/annotation/genome/mycobacterium_ tuberculosis_spp/MultiHome.html

Aedes aegypti

Vectorbase

www.vectorbase.org

Vectors

Pathogens

Mammal hosts

Table 3. Infection related genome reference databases

VectorBase (Lawson et al., 2007) provides an annotation of several genomes data. A large proportion of the identified genes have a “hypothetical” function, some might point to pathogen/vector specific processes. Comparative genomics approaches complement positively this data and often let the identification of pathogen/vector specific enzymatic pathways or of genes playing a key role during the infection (Zhang & Zhang, 2006). The biological objects that should be characterized are “genes products”. Diverse attributes concerning these objects have to be collected in order to facilitate their connection with the information present in other databases: identifiers of the genes and their products in other databases (EMBL, SwissProt, HGNC, Affymetrix) and the sequence of the products. These attributes are collected through the data mining tools that are usually provided by the genome databases. Several host, pathogen and vector gene families are known to play key roles in infection (Jenner & Young, 2005; Trowsdale & Parham, 2004): chemokines, cytokines, cytoskeleton, inflammatory response, protein folding and targeting, response to stress, cell communication and signalling, transcription related, apoptosis, extra-cellular and membrane associated proteins. In order to detect these key actors, it is recommended to identify all members of these families and to describe their behaviour during the infection. Information that could lead to the identification of these families members is often encoded in a unified controlled vocabulary called Gene Ontology (Diehl, Lee, Scheuermann, & Blake, 2007; Harris et al., 2004) generally provided by complete genome databases. At the third analysis step, integration of information concerning the functions of the identified gene products and their implication into immune related biological processes or molecular functions can generate graphs (Cho, Hwang, Ramanathan, & Zhang, 2007; Daraselia, Yuryev, Egorov, Mazo, & Ispolatov, 2007). However genome data is insufficient to correctly address and integrate infection related information. This includes the redundancy of biochemical pathways in a given organisms or the fact that the same key functions can also be carried out by unrelated proteins in different physiological conditions. It is

387

Systems Biology and Infectious Diseases

therefore recommended to integrate genes’ products profiling (transcriptome, proteome and metabolome) as a complement to genomic approaches.

Gene Product Profiling Host/pathogen/vector gene product profiling data are available in general gene expression public databases like Gene Expression Omnibus (Barrett et al., 2007) and ArrayExpress (Parkinson et al., 2007) or in more specific gene expression databases Innate Immune database (Korb et al., 2008) and GPXMacrophage Expression Atlas (Grimes et al., 2005) and PlasmoDB (Bahl et al., 2002). Important information to be collected and connected, to genes products concerns the physiological status of the tested cell (resting or stimulated), and the genes products expression levels. The tools that are usually used to query for this information are the identifiers of the genes and their products (especially the NCBI gene identifier, Affymetrix identifiers for transcriptome and SwissProt identifiers for proteome), and sequence similarity search tools. Clustering gene product profiling data and confronting them to other data types such us literature data, curate the data in hand and help shaping a coherent picture of the functional relationship among large and heterogeneous sets of genes (Chaussabel & Sher, 2002; Chi, Ibrahim, Bissahoyo, & Threadgill, 2007; Koehler et al., 2005; Menten et al., 2005; Rubinstein & Simon, 2005). Significant expression changes are also commonly used to extract comprehensive and functional information concerning the genes expressed in the cell of interest (Chaussabel et al., 2003; El Fadili et al., 2008; Grinde, Gayorfar, & Hoddevik, 2007; Hofman et al., 2007; Zaffuto et al., 2007). These changes can be used to quantify the edges in graphs or to direct edges in the graphs and network generated in sections 3.3, 3.4 and 3.5 (see below) (Hart et al., 2005; Maciag et al., 2006; Takigawa & Mamitsuka, 2008; Wilczynski et al., 2006). Diverse other techniques has been developed in order to assess the data in hand (Chopra et al., 2008; Gana Dresen, Boes, Huesing, Neuhaeuser, & Joeckel, 2008) and to map the information gained into graphs and pathways (de Jong, 2002; Friedman et al., 2000).

Interacti

on graph

The interaction graph is the collection of all interactions in a given cell at a given time. These interactions involve large molecules composed of proteins, nucleic acids and small molecules. In terms of proteomics, it refers to protein-protein interactions. APID (Prieto & De Las Rivas, 2006) and DIP (Salwinski et al., 2004) are two repositories of protein-protein interactions whereas BIND (Bader, Betel, & Hogue, 2003) is a repository of molecules interactions (protein-protein, protein-DNA, protein-RNA, protein-small molecules, RNA-RNA, etc.). Interactions between gene products are the information that has to be collected during the first step. It is recommended to collect complementary information about: (i) the technologies used to identify those interactions, (ii) the number of times those interactions were verified independently, (iii) the cellular localisation of the gene product, etc. The tools that are usually used to query for this information are the identifiers of the genes and their products, and sequence similarity search tools. Integrating these interactions leads to the generation of non-oriented graphs in which vertexes are molecules and edges are the interactions. Semantic rules and statistical techniques are used, in the

388

Systems Biology and Infectious Diseases

second step, to weight the edges (Komurov & White, 2007; Scott & Barton, 2007). Such non-oriented graphs can be oriented by integrating what is known about the direction of the interaction or rendered time dependent by integrating the gene products expression data at different time points. The graph obtained is either Boolean, Polynomial or Bayesian

R egulatory G raph A regulatory graph is a collection of gene products which interact with DNA segments, thereby governing the rates at which genes are transcribed into mRNA. This graph is sometimes considered as part of the interaction graph. Distinct rounds are decided in the first step: determine the set of genes that are expressed in a given cell at a given time, delimitate their promoter region, identify the cis-regulatory elements governing their expression, and infer the graph. The whole process should lead to the generation of an oriented graph in which vertexes are composed of a hybrid population of gene products: those that are regulated and do regulate (transcription factors) and those that are only regulated. Edges are the impact (activation or silencing; induction or repression) of the first population of gene products on the expression of the second one. Several methods were developed to carry out the above rounds. Achieving the first and second round is quite straightforward: the list of transcribed genes can be obtained from the transcripts profiling (see 3.2) and their promoter region is the region surrounding their Transcription Start Sites (TSS). TSS can be extracted through the mapping of known alternative transcripts data or the integration of the transcripts maps generated in the framework of pilot projects (Birney et al., 2007; Carninci et al., 2005). The latter round might be more complex if we try to target genes’ alternative promoters (Kawaji et al., 2006). The third round is difficult to accomplish as the consensus sequences of cis-regulatory elements may be present everywhere in the genome and could generate a large number of false positives. Several smart tricks and biotechnologies (Nardone, Lee, Ansel, & Rao, 2004) were developed in order to reduce this rate. Besides focusing on the cis-regulatory elements that are localised in the promoter region or into conserved non-coding sequences (Pennacchio et al., 2006), we also cite Chipon-Chip or ChIP technologies (Blais & Dynlacht, 2005; Ren & Dynlacht, 2004), and data generated in the framework of pilot projects (Birney et al., 2007; Carninci et al., 2005). Coupling these approached and developing sophisticated algorithms (Liu, Jessen, Sivaganesan, Aronow, & Medvedovic, 2007) is powerful and should lead to the prediction of a reliable set of regulatory elements. The fourth round is realized by connecting the genes products (TF to genes) using the connections obtained in the third round and by integrating their expression levels (transcripts and proteins) (Hayete, Gardner, & Collins, 2007; Nilsson et al., 2006). Expression data at different time points can be used, as for the interaction graph, to validate the edges of the obtained graph and to add a dynamic.

B iochemica l netw ork Pathways are the organised successive steps used by the cell to keep its homeostasis. A biochemical network inter relates a wide range of biochemical pathways occurring within a cell. Each pathway is composed of a set of biochemical reactions occurring in cascade. These reactions are accelerated and more accurately catalyzed, by enzymes helped by co-factors such as dietary minerals and vitamins. The

389

Systems Biology and Infectious Diseases

kinetics of the biochemical reaction is important for the understanding of the outcome of the reaction and replacing it in the cellular context. The biochemical pathway is an oriented graph in which vertexes are molecules and edges are the biochemical reaction. Collected information will be used to generate an oriented network in which vertexes are expressed genes products and edges are the biochemical pathway and the time of the reaction. The biochemical network can be presumed as a superposition of biochemical pathways. For mammalian hosts, several databases record reliable pathways (Vastrik et al., 2007). For pathogens, a reliable functional annotation is in some cases available (Dieterich, Karst, Fischer, Wehland, & Jansch, 2006). KEGG (Kanehisa, 2002; Kanehisa et al., 2006) is an example of databases that records both host and pathogen pathways and that can be easily used because the pathways were constructed in a uniform way. Kanehisa et al. (2006) have made a tremendous effort in order to connect the pathways they have reconstructed to databases. Information that has to be queried for and connected to the genes products are the biochemical reactions and their kinetics. Tools that are usually used to query for this information, during the first level, are the identifiers of the genes and their products, and the sequence similarity search tools. However, we must stress out here that the pathways recorded in these databases represent several possible biochemical reactions whereas the ones activated after a given stimulus are specific and depend of the pathogen, the cell type and the activated state of a given cell. The interaction and regulatory graphs and profiling data are commonly used to assess the network and to reduce the number of possible reactions (Bebek & Yang, 2007; Sanguinetti, Noirel, & Wright, 2008; Takigawa & Mamitsuka, 2008).

Literature The integration of information absent from public databases and present in the literature is recommended in systems biology and essential in infectious systems biology. The reasons are the absence of highthroughput biotechnologies dedicated to the study of host-pathogen interactions and the temporal and spatial location (nucleosome, phagolosome, plasma) of the interactions. The host-pathogen interaction and the temporal issues can only be addressed through literature mining. The spatial issue can also be addressed through the GO cellular components identifiers or through the integration of the information compiled in dedicated databases (Wiwatwattana, Landau, Cope, Harp, & Kumar, 2007) or through the literature mining. Querying for information from the literature is done through classical techniques of information extraction and text mining (first step). In order to be integrated into the system, all collected information must have a direct connection to gene products (identifier collected in 3.1). They are used to consolidate and complement the information that was integrated about these products and the graphs and network predicted in 3.3-5 (Koehler et al., 2005; Maier et al., 2005).

Orthology D ata The orthology (Fitch, 2000) is the relationship between any two homologous characters from two different species (e.g.: genes, regulatory regions) which common ancestor lies in the cenancestor of the taxa from which the two sequences were obtained. Computed orthology information is used to make bridges between cellular networks from different organisms and might be used to curate data and to validate the graphs and network predicted in 3.3-5.

390

Systems Biology and Infectious Diseases

The input data are proteins from host/pathogen/vectors (downloaded in 3.1), whereas the tools that are commonly used are the sequence similarity search tools (Li, Stoeckert, & Roos, 2003; O’Brien, Remm, & Sonnhammer, 2005) (first step). The integration or non-integration of orthology data depends on the evolutionary level at which the biological question has to be addressed.

Mathematical Modelling Mathematics are used in the different stages going from the identification of correlative associations cross different datasets, to the extraction of key biological processes that are triggered by the infection, to the final drawing of an in silico model that mimics accurately the different cellular events. Mathematical modelling leads to the construction and the understanding, from biological data integrated in section 3, of the cell’s dynamic. Its objective is to overcome a number of difficulties met by infectious molecular biologists, in understanding the kinetics, the evolution and outcome of the infection, and to help them in orienting their research. Interaction between the host cell and the pathogen induces a series of physiological and molecular changes in both organisms. The challenge is to measure these changes and to extract out of these measures hints about the cell’s dynamical behaviour. Deterministic techniques that stay faithful to real data (Boolean models, Polynomial models, Ordinary or Partial Differential Equations (ODE/PDE), etc.) are relevant when we have enough data, whereas stochastic techniques based on probabilities are recommended when dealing with missing or limited data (Markov assumptions Gillespie algorithms, Bayesian models, Chemical Master Equation (CME), etc). Both approaches take as input graphs that integrate a quantifiable measure of the interactions and a set of state variables (node-degree distribution, mean path length, clustering coefficients, architectural features, existence and hierarchical molecules, etc). These complementary approaches have to be taken carefully because of the high complexity of the studied system. Confronting the two approaches is recommended. The specificity of infected cells is that the vertexes of the graphs can represent molecules from different organisms (host and pathogen). The absence of data that reflect the co-evolution of these organisms complicates this modeling. This lack of data has to be integrated into the system and compensated by the development of supplementary sophisticated tools that can circumvent it. In this section will be given a description of the principal approaches for building a model from a certain number of experimental evidences and by using reverse engineering tools based on equations and relation graphs that can be refined step by step.

B ottom-Up, T op-D own and H ybrid Modelling A pproaches Three distinct strategies for modelling the systems behaviour are recognized the bottom-up and top-down approaches which are integrated into a third hybrid strategy. The fundamental philosophical difference between the bottom-up and top-down approaches is the regulation of the system. Is it driven from the bottom (molecular reaction) or from the top (cellular function) or from both? The modelling approach that departs from the result of high throughput biotechnologies represents the bottom-up approach (Bruggeman & Westerhoff, 2006). In the bottom level one has the molecular properties (integrated in section 3). In the middle level one has the generation of the graphs and network presented in 3.3, 3.4 and 3.5 and the development of: (i) dynamical Bayesian models that enable the

391

Systems Biology and Infectious Diseases

description of the dependences of molecules; (ii) dynamical Boolean models that govern the rules of the dependences; (iii) CME or ODE/PDE models that deal with quantitative variables. In the top level, there is the physiological reaction of the cell. The top-down approach (Forst, 2006; Ideker & Lauffenburger, 2003b), represents the reverse direction of the bottom-up approach. In this approach, the biochemical, regulatory and signalling networks, with molecules common to the host and pathogen, are reconstructed starting from system’s reaction. Such networks’ construction is called Reverse Engineering; where mathematical techniques are used to find the model that fit the data (molecular reaction) and predict the future behaviour of molecules from the present state. Hybrid approaches combines bottom-up and top-down approaches. Gene products’ profiling data is commonly used to complement interactions and biochemical reaction data. Assumptions such as molecules with similar expression are likely interacting can be used to reinforce the model (Ideker & Lauffenburger, 2003a; Sjöberg, 2002).

Mode lling of the ce llular netw orks Modelling the interaction, regulatory and biochemical networks is one of the scopes of systems biology. Graphs produced in 3.3 and 3.4 are multiple snapshots of the gene products interactions at different time points. The aim of dynamical Boolean and Bayesian models is to transform these static graphs into a dynamical graphs. In the network produced in 3.5, each signalling pathway can be decomposed into different sets of elementary phosphorylation or dephosphorylation reactions. Each of these reactions is time dependent. The analysis of biochemical networks and the modelling of intracellular dynamics can be done through a deterministic or a stochastic way. The deterministic approach requires the solution of Ordinary or Partial Differential/Difference Equations (ODE/PDE, reaction rate equations) with concentrations as continuous state variables. The stochastic approach involves Differential/Difference Equations with probabilities as variables (Chemical Master Equations, CMEs). Compared to Boolean and Bayesian models, the ODE/PDE and CME approaches allow a continuous and quantitative analysis. All these approaches aim to extract the kinetic of the reaction. Modelling technique appropriate for a given biological system does not only depend on the investigated biological phenomena but is also influenced by the assumptions one makes to simplify the analysis.

D ynamical B oolean Models The qualitative connexion between gene products (3.3 and 3.4) can be expressed through dynamical Boolean model (Saez-Rodriguez et al., 2007). This model is attractive because it deals with the algebraic and topological aspects of the graph and allows the establishment of a global schema which enables bringing the interactions from a static to a dynamical stage. A Boolean graph is a directed graph that consists of molecules (vertexes) sharing a causal relationship (edges). A Boolean function states the behaviour of these molecules with respect to their interactors. This function formulates the logical rules that fit the best the data (presence or absence of interaction) and assigns a dynamic to the graph as asymptotic limit sets. Dynamical Boolean models are limited because the reference molecule is considered to be either present or absent. Since intermediate levels of expression are neglected, this approach allows an altered

392

Systems Biology and Infectious Diseases

comprehension of the dynamic of the cell network. Several other approaches overcome this limitation, among others can be cited the polynomial models (where a gene can be expressed on more than 2 states) (Laubenbacher, 2005).

D ynamical B ayesian Model Dynamical Bayesian models encode real relationships in oriented graphs; they can be considered as a dynamical Boolean model with probabilities attached to the Boolean function (Murphy & Mian, 1999). The qualitative connexion between gene products (3.3 and 3.4) can also be expressed through dynamical Bayesian models. These allow large graphs to be analysed and overflow missing, noisy and inconsistent data (Friedman, Murphy, & Russell, 1998; Kim, Imoto, & Miyano, 2004). They are a special case of a more general class called graphical models in which vertexes (gene products) represent random variables, and the lack of edges represent conditional independence assumptions between gene products; an example of stochastic models with a well defined probabilistic semantics.

Ordinary D ifferential E quations Phosphorylation or dephosphorylation or gene regulation lead to the definition of ODE/PDE which describes how each concentration changes over the time (3.4 and 3.5). A first approximation of the system can be done through the Mass Action Law (Sekiguchi & Okamoto, 2006) where the graph vertexes (gene products’ concentration) are taken as a variable and the graph edges (speed of the reaction, activation or inhibition) are considered as proportional to the concentration of the product. Biochemical reactions or genes regulation are encoded through differential relations between the variables (de Jong, 2002; Klipp et al., 2005). Due to a high number of reactions, a high number of non linear differential equation has to be manipulated and the dynamics can have a chaotic behaviour. The analysis of this chaos necessitates the development of hard tools and algorithms: classical techniques of dynamical systems theory (Periodic orbits, Stability, Liapounov exponent, Attractors, etc) (Katok & Hasselblatt, 1996) and classical numerical analyses (Gradient like methods, Non-linear calculus, etc) (Voit et al., 2006). As for dynamical Boolean models, the goal of ODE/PDE is to determine asymptotic limit sets like attractors (stable states, cyclic attractors) and to analyse their properties (Huang & Ingber, 2000).

C hemical Master E quation Whereas the ODE/PDE approach produces concentrations by solving differential equations; the CME involves also the constitution of a set of equations with probabilities as variables (Gillespie, 1977; Ullah et al., 2006). However, CMEs produce counts of molecules as realisations of random variables drawn from the probability distribution. The numbers of CME grow exponentially with the number of states in the models. Novel strategies were developed in order to enable handling a large number of states (Sjöberg, Lötstedt, & Elf, 2007) and large sets of data.

393

Systems Biology and Infectious Diseases

Box 2. Dynamical Boolean models: Let n = 4 be a number of vertexes, and k = Z/2Z be a finite field of order 2. A dynamical graph N = ( f1, f2, f3, f4), on n vertexes is given by local update functions: f1 (x ) = x1 + x2 x4 f

2

(x ) = x1 x2 x3

f3 ( x) = x1 + x3 f 4 ( x) = x2 + 1 − x4

and a global transition function: f (x ) = ( f1 (x ), f 2 (x ), f 3 (x ), f 4 (x ))

where x = (x1 , x2 , x3 , x4 )∈ k 4 is a collection of variables corresponding to n proteins. Figure 5(a) illustrate an example of Connecting graph for n proteins and Figure 5(b) the Dynamic graph N over k = Z/2Z result of the association of the function f and the Connecting graphs. Ordinary Differential Equations: Let n = 4 be a number of vertexes. A dynamical graph N = ( f1, f2, f3, f4) on n vertexes is given by local update functions: f1 (x ) = f

2

(x ) =

1 x1

+

x2 x4

x1 x2 x3

f3 ( x) =

2 x1

+

f 4 ( x) =

4 x2

+

3 x3

1 x4 A

and a global transition function: f (x ) = ( f1 (x ), f 2 (x ), f 3 (x ), f 4 (x ))

where x = (x1 , x2 , x3 , x4 )∈ R+4 is a collection of variables corresponding to n proteins. Figure 5(a) illustrate an example of Connecting graph for n proteins. The dynamic associated to f depends on the parameters 1 , 2 , 3 , , and δ.

394

Systems Biology and Infectious Diseases

Figure 5. (a) Connecting graph associated in Boolean and ODE dynamics. (b) Dynamical model associated to Boolean graph.

(b)

(a)

Co nc lusi on The complexity of the biological systems to be modelled, may lead to the construction of equations that are too much complexes and in many case have no solution. Also, the number of states grows exponentially with the number of molecules. Therefore it is important to use a set of simple equations that fit the best the biological model. Often it is quite difficult to conciliate between these two imperatives. This aspect needs the development of sophisticated statistical tools that can calculate and test quantitatively “how far are our mathematical models from the real cell dynamics?” Mathematics is used as formalism to help the generation of models used as a tool to test hypothesis or predict behaviours to understand how cells works. However as a human science they cannot succeed or explain biological events. Nowadays, systems biology have been successfully applied on normal or cancerous mammalian cells and helped for example elucidating molecular networks that cause diseases (Chen et al., 2008) or mapping human cancer signalling network (Cui et al., 2007) and promises to be successful in the modelling of infected cells. The ultimate goal of systems biology in the specific field of infectious diseases is to decipher in vivo host-pathogen interactions at the cellular and molecular levels and naturally address the drug discovery issue. In vitro experiments are a major obstacle to drug discovery since they are done in cells isolated from APCs, soluble mediators (cytokines, chemokine, etc.), etc. These experiments miss the structural framework of the tissue itself which surely influence the kinetics and the nature of the response. A compromise would be to work on animal models in vivo then to try to extrapolate and predict the effect of developed drugs on human using systematic approaches. However these models definitely suffer limitations when they involve inbred animals that do not reflect the diversity of out bred populations.

395

Systems Biology and Infectious Diseases

A ckn ow ledgment Many thanks for Karyn MEGY for her critical reading of this manuscript.

R eferences Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic local alignment search tool. J Mol Biol, 215(3), 403-410. Bader, G. D., Betel, D., & Hogue, C. W. (2003). BIND: The biomolecular interaction network database. Nucleic Acids Res, 31(1), 248-250. Bahl, A., Brunk, B., Coppel, R. L., Crabtree, J., Diskin, S. J., Fraunholz, M. J., et al. (2002). PlasmoDB: The Plasmodium genome resource. An integrated database providing tools for accessing, analyzing and mapping expression and sequence data (both finished and unfinished). Nucleic Acids Res, 30(1), 87-90. Bairoch, A., Apweiler, R., Wu, C. H., Barker, W. C., Boeckmann, B., Ferro, S., et al. (2005). The Universal Protein Resource (UniProt). Nucleic Acids Res, 33(Database issue), D154-159. Barrett, T., Troup, D. B., Wilhite, S. E., Ledoux, P., Rudnev, D., Evangelista, C., et al. (2007). NCBI GEO: Mining tens of millions of expression profiles--Database and tools update. Nucleic Acids Res, 35(Database issue), D760-765. Bebek, G., & Yang, J. (2007). PathFinder: Mining signal transduction pathway segments from proteinprotein interaction networks. BMC Bioinformatics, 8, 335. Becker, K. G., Hosack, D. A., Dennis, G., Jr., Lempicki, R. A., Bright, T. J., Cheadle, C., et al. (2003). PubMatrix: A tool for multiplex literature mining. BMC Bioinformatics, 4, 61. Birney, E., Stamatoyannopoulos, J. A., Dutta, A., Guigo, R., Gingeras, T. R., Margulies, E. H., et al. (2007). Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature, 447(7146), 799-816. Blais, A., & Dynlacht, B. D. (2005). Constructing transcriptional regulatory networks. Genes Dev, 19(13), 1499-1511. Bruggeman, F., & Westerhoff, H. (2006). The nature of systems biology. TRENDS in Microbiology, 15(1), 45-50. Carninci, P., Kasukawa, T., Katayama, S., Gough, J., Frith, M. C., Maeda, N., et al. (2005). The transcriptional landscape of the mammalian genome. Science, 309(5740), 1559-1563. Chaussabel, D., Semnani, R. T., McDowell, M. A., Sacks, D., Sher, A., & Nutman, T. B. (2003). Unique gene expression profiles of human macrophages and dendritic cells to phylogenetically distinct parasites. Blood, 102(2), 672-681. Chaussabel, D., & Sher, A. (2002). Mining microarray expression data by literature profiling. Genome Biol, 3(10), RESEARCH0055.

396

Systems Biology and Infectious Diseases

Chen, Y., Zhu, J., Lum, P. Y., Yang, X., Pinto, S., Macneil, D. J., et al. (2008). Variations in DNA elucidate molecular networks that cause disease. Nature. Chi, Y. Y., Ibrahim, J. G., Bissahoyo, A., & Threadgill, D. W. (2007). Bayesian hierarchical modeling for time course microarray experiments. Biometrics, 63(2), 496-504. Cho, Y. R., Hwang, W., Ramanathan, M., & Zhang, A. (2007). Semantic integration to identify overlapping functional modules in protein interaction networks. BMC Bioinformatics, 8(1), 265. Chopra, P., Kang, J., Yang, J., Cho, H., Kim, H. S., & Lee, M. G. (2008). Microarray data mining using landmark gene-guided clustering. BMC Bioinformatics, 9, 92. Cimino, J. J. (1998). Auditing the unified medical language system with semantic methods. J Am Med Inform Assoc, 5(1), 41-51. Couto, F. M., Silva, M. J., Lee, V., Dimmer, E., Camon, E., Apweiler, R., et al. (2006). GOAnnotator: Linking protein GO annotations to evidence text. J Biomed Discov Collab, 1, 19. Cui, Q., Ma, Y., Jaramillo, M., Bari, H., Awan, A., Yang, S., et al. (2007). A map of human cancer signaling. Mol Syst Biol, 3, 152. Daraselia, N., Yuryev, A., Egorov, S., Mazo, I., & Ispolatov, I. (2007). Automatic extraction of gene ontology annotation and its correlation with clusters in protein networks. BMC Bioinformatics, 8(1), 243. de Jong, H. (2002). Modeling and simulation of genetic regulatory systems: A literature review. J Comput Biol, 9(1), 67-103. Diehl, A. D., Lee, J. A., Scheuermann, R. H., & Blake, J. A. (2007). Ontology development for biological systems: immunology. Bioinformatics, 23(7), 913-915. Dieterich, G., Karst, U., Fischer, E., Wehland, J., & Jansch, L. (2006). LEGER: Knowledge database and visualization tool for comparative genomics of pathogenic and non-pathogenic Listeria species. Nucleic Acids Res, 34(Database issue), D402-406. El Fadili, K., Imbeault, M., Messier, N., Roy, G., Gourbal, B., Bergeron, M., et al. (2008). Modulation of gene expression in human macrophages treated with the anti-leishmania pentavalent antimonial drug sodium stibogluconate. Antimicrob Agents Chemother, 52(2), 526-533. Fitch, W. M. (2000). Homology a personal view on some of the problems. Trends Genet, 16(5), 227231. Forst, C. V. (2006). Host-pathogen systems biology. Drug Discov Today, 11(5-6), 220-227. Friedman, N., Linial, M., Nachman, I., & Pe’er, D. (2000). Using Bayesian networks to analyze expression data. J Comput Biol, 7(3-4), 601-620. Friedman, N., Murphy, K., & Russell, S. (1998). Learning the Structure of Dynamic Probabilistic Networks. Paper presented at the Fourteenth Conf. on Uncertainty in Artificial Intelligence (UAI). Gana Dresen, I. M., Boes, T., Huesing, J., Neuhaeuser, M., & Joeckel, K. H. (2008). New resampling method for evaluating stability of clusters. BMC Bioinformatics, 9, 42.

397

Systems Biology and Infectious Diseases

Gillespie, D. T. (1977). Exact stochastic simulation of coupled chemical reactions. J. Phys. Chem., 81, 2340-2361. Gladki, A., Siedlecki, P., Kaczanowski, S., & Zielenkiewicz, P. (2008). e-LiSe - An online tool for finding needles in the “(Medline) haystack”. Bioinformatics. Grimes, G. R., Moodie, S., Beattie, J. S., Craigon, M., Dickinson, P., Forster, T., et al. (2005). GPX-Macrophage Expression Atlas: A database for expression profiles of macrophages challenged with a variety of pro-inflammatory, anti-inflammatory, benign and pathogen insults. BMC Genomics, 6, 178. Grinde, B., Gayorfar, M., & Hoddevik, G. (2007). Modulation of gene expression in a human cell line caused by poliovirus, vaccinia virus and interferon. Virol J, 4, 24. Hammamieh, R., Chakraborty, N., Wang, Y., Laing, M., Liu, Z., Mulligan, J., et al. (2007). GeneCite: A stand-alone open source tool for high-throughput literature and pathway mining. Omics, 11(2), 143151. Harris, M. A., Clark, J., Ireland, A., Lomax, J., Ashburner, M., Foulger, R., et al. (2004). The Gene Ontology (GO) database and informatics resource. Nucleic Acids Res, 32(Database issue), D258-261. Hart, C. E., Sharenbroich, L., Bornstein, B. J., Trout, D., King, B., Mjolsness, E., et al. (2005). A mathematical and computational framework for quantitative comparison and integration of large-scale gene expression data. Nucleic Acids Res, 33(8), 2580-2594. Hayete, B., Gardner, T. S., & Collins, J. J. (2007). Size matters: Network inference tackles the genome scale. Mol Syst Biol, 3, 77. Hertz-Fowler, C., Peacock, C. S., Wood, V., Aslett, M., Kerhornou, A., Mooney, P., et al. (2004). GeneDB: A resource for prokaryotic and eukaryotic organisms. Nucleic Acids Res, 32(Database issue), D339-343. Hestvik, A. L., Hmama, Z., & Av-Gay, Y. (2005). Mycobacterial manipulation of the host cell. FEMS Microbiol Rev, 29(5), 1041-1050. Hide, W., Smedley, D., McCarthy, M., & Kelso, J. (2003). Application of eVOC: controlled vocabularies for unifying gene expression data. C R Biol, 326(10-11), 1089-1096. Hofman, V. J., Moreilhon, C., Brest, P. D., Lassalle, S., Le Brigand, K., Sicard, D., et al. (2007). Gene expression profiling in human gastric mucosa infected with Helicobacter pylori. Mod Pathol, 20(9), 974-989. Huang, S., & Ingber, D. E. (2000). Shape-dependent control of cell growth, differentiation, and apoptosis: switching between attractors in cell regulatory networks. Exp Cell Res, 261(1), 91-103. Hubbard, T. J., Aken, B. L., Beal, K., Ballester, B., Caccamo, M., Chen, Y., et al. (2007). Ensembl 2007. Nucleic Acids Res, 35(Database issue), D610-617. Ideker, T., & Lauffenburger, D. (2003a). Building with a scaffold: Emerging strategies for high- to lowlevel cellular modeling. Trends Biotechnol, 21(6), 255-262. Ideker, T., & Lauffenburger, D. (2003b). Building with a scaffold: Emerging strategies for high- to lowlevel cellular modeling. TRENDS in Biotechnology, 21(6), 255-262.

398

Systems Biology and Infectious Diseases

Jansen, A., & Yu, J. (2006). Differential gene expression of pathogens inside infected hosts. Curr Opin Microbiol, 9(2), 138-142. Jenner, R. G., & Young, R. A. (2005). Insights into host responses against pathogens from transcriptional profiling. Nat Rev Microbiol, 3(4), 281-294. Kanehisa, M. (2002). The KEGG database. Novartis Found Symp, 247, 91-101; discussion 101-103, 119128, 244-152. Kanehisa, M., Goto, S., Hattori, M., Aoki-Kinoshita, K. F., Itoh, M., Kawashima, S., et al. (2006). From genomics to chemical genomics: New developments in KEGG. Nucleic Acids Res, 34(Database issue), D354-357. Kaplan, N., Vaaknin, A., & Linial, M. (2003). PANDORA: Keyword-based analysis of protein sets by integration of annotation sources. Nucleic Acids Res, 31(19), 5617-5626. Kasprzyk, A., Keefe, D., Smedley, D., London, D., Spooner, W., Melsopp, C., et al. (2004). EnsMart: A generic system for fast and flexible access to biological data. Genome Res, 14(1), 160-169. Katok, A., & Hasselblatt, B. (1996). Introduction to the modern theory of dynamical systems. Cambridge University Press. Kawaji, H., Frith, M. C., Katayama, S., Sandelin, A., Kai, C., Kawai, J., et al. (2006). Dynamic usage of transcription start sites within core promoters. Genome Biol, 7(12), R118. Kent, W. J. (2002). BLAT--the BLAST-like alignment tool. Genome Res, 12(4), 656-664. Kim, S., Imoto, S., & Miyano, S. (2004). Dynamic Bayesian network and nonparametric regression for nonlinear modeling of gene networks from time series gene expression data. Biosystems, 75(1-3), 57-65. Klipp, E., Herwig, R., Kowald, A., Wierling, C., & Lehrach, H. (2005). Systems biology in practice. Concepts, implementation and application. Wiley-VCH. Koehler, J., Rawlings, C., Verrier, P., Mitchell, R., Skusa, A., Ruegg, A., et al. (2005). Linking experimental results, biological networks and sequence analysis methods using Ontologies and Generalised Data Structures. In Silico Biol, 5(1), 33-44. Komurov, K., & White, M. (2007). Revealing static and dynamic modular architecture of the eukaryotic protein interaction network. Mol Syst Biol, 3, 110. Korb, M., Rust, A. G., Thorsson, V., Battail, C., Li, B., Hwang, D., et al. (2008). The Innate Immune Database (IIDB). BMC Immunol, 9(1), 7. Laubenbacher, R. (2005). Algebraic models in systems biology. Algebraic Biology, 33-40. Lawson, D., Arensburger, P., Atkinson, P., Besansky, N. J., Bruggner, R. V., Butler, R., et al. (2007). VectorBase: A home for invertebrate vectors of human pathogens. Nucleic Acids Res, 35(Database issue), D503-505. Letovsky, S. I., Cottingham, R. W., Porter, C. J., & Li, P. W. (1998). GDB: The Human Genome Database. Nucleic Acids Res, 26(1), 94-99.

399

Systems Biology and Infectious Diseases

Li, L., Stoeckert, C. J., Jr., & Roos, D. S. (2003). OrthoMCL: Identification of ortholog groups for eukaryotic genomes. Genome Res, 13(9), 2178-2189. Liu, X., Jessen, W. J., Sivaganesan, S., Aronow, B. J., & Medvedovic, M. (2007). Bayesian hierarchical model for transcriptional module discovery by jointly modeling gene expression and ChIP-chip data. BMC Bioinformatics, 8(1), 283. Maciag, K., Altschuler, S. J., Slack, M. D., Krogan, N. J., Emili, A., Greenblatt, J. F., et al. (2006). Systems-level analyses identify extensive coupling among gene expression machines. Mol Syst Biol, 2, 2006 0003. Maier, H., Dohr, S., Grote, K., O’Keeffe, S., Werner, T., Hrabe de Angelis, M., et al. (2005). LitMiner and WikiGene: Identifying problem-related key players of gene regulation using publication abstracts. Nucleic Acids Res, 33(Web Server issue), W779-782. Maynard, J. A., Myhre, R., & Roy, B. (2007). Microarrays in infection and immunity. Curr Opin Chem Biol, 11(3), 306-315. Menten, B., Pattyn, F., De Preter, K., Robbrecht, P., Michels, E., Buysse, K., et al. (2005). arrayCGHbase: An analysis platform for comparative genomic hybridization microarrays. BMC Bioinformatics, 6, 124. Muller, H. M., Kenny, E. E., & Sternberg, P. W. (2004). Textpresso: An ontology-based information retrieval and extraction system for biological literature. PLoS Biol, 2(11), e309. Murphy, K., & Mian, S. (1999). Modelling gene expression data using dynamic bayesian networks. Berkeley: Tech. rep. MIT Artificial Intelligence Laboratory. Nardone, J., Lee, D. U., Ansel, K. M., & Rao, A. (2004). Bioinformatics for the ‘bench biologist’: How to find regulatory regions in genomic DNA. Nat Immunol, 5(8), 768-774. Ng, A., Bursteinas, B., Gao, Q., Mollison, E., & Zvelebil, M. (2006). Resources for integrative systems biology: from data through databases to networks and dynamic system models. Brief Bioinform, 7(4), 318-330. Nilsson, R., Bajic, V. B., Suzuki, H., di Bernardo, D., Bjorkegren, J., Katayama, S., et al. (2006). Transcriptional network dynamics in macrophage activation. Genomics, 88(2), 133-142. O’Brien, K. P., Remm, M., & Sonnhammer, E. L. (2005). Inparanoid: A comprehensive database of eukaryotic orthologs. Nucleic Acids Res, 33(Database issue), D476-480. Parkinson, H., Kapushesky, M., Shojatalab, M., Abeygunawardena, N., Coulson, R., Farne, A., et al. (2007). ArrayExpress--A public database of microarray experiments and gene expression profiles. Nucleic Acids Res, 35(Database issue), D747-750. Pe’er, D. (2005). Bayesian network analysis of signaling networks: A primer. Sci STKE, 2005(281), l4. Pearson, W. R., & Lipman, D. J. (1988). Improved tools for biological sequence comparison. Proc Natl Acad Sci USA, 85(8), 2444-2448. Pennacchio, L. A., Ahituv, N., Moses, A. M., Prabhakar, S., Nobrega, M. A., Shoukry, M., et al. (2006). In vivo enhancer analysis of human conserved non-coding sequences. Nature, 444(7118), 499-502. 400

Systems Biology and Infectious Diseases

Philippi, S., & Kohler, J. (2006). Addressing the problems with life-science databases for traditional uses and systems biology. Nat Rev Genet, 7(6), 482-488. Prieto, C., & De Las Rivas, J. (2006). APID: Agile Protein Interaction DataAnalyzer. Nucleic Acids Res, 34(Web Server issue), W298-302. Ren, B., & Dynlacht, B. D. (2004). Use of chromatin immunoprecipitation assays in genome-wide location analysis of mammalian transcription factors. Methods Enzymol, 376, 304-315. Rubinstein, R., & Simon, I. (2005). MILANO: Custom annotation of microarray results using automatic literature searches. BMC Bioinformatics, 6, 12. Saez-Rodriguez, J., Simeoni, L., Lindquist, J. A., Hemenway, R., Bommhardt, U., Arndt, B., et al. (2007). A logical model provides insights into T cell receptor signaling. PLoS Comput Biol, 3(8), e163. Salwinski, L., Miller, C. S., Smith, A. J., Pettit, F. K., Bowie, J. U., & Eisenberg, D. (2004). The Database of Interacting Proteins: 2004 update. Nucleic Acids Res, 32(Database issue), D449-451. Sanguinetti, G., Noirel, J., & Wright, P. C. (2008). MMG: A probabilistic tool to identify submodules of metabolic pathways. Bioinformatics. Scott, M. S., & Barton, G. J. (2007). Probabilistic prediction and ranking of human protein-protein interactions. BMC Bioinformatics, 8, 239. Sekiguchi, T., & Okamoto, M. (2006). WinBEST-KIT: Windows-based biochemical reaction simulator for metabolic pathways. J Bioinform Comput Biol, 4(3), 621-638. Settles, B. (2005). ABNER: An open source tool for automatically tagging genes, proteins and other entity names in text. Bioinformatics, 21(14), 3191-3192. Sjöberg, P. (2002). Numerical solution of the master equation in molecular biology. Uppsala University, Uppsala. Sjöberg, P., Lötstedt, P., & Elf, J. (2007). Fokker-Planck approximation of the master equation in molecular biology. Comput. Vis. Sci., 10. Takigawa, I., & Mamitsuka, H. (2008). Probabilistic path ranking based on adjacent pairwise coexpression for metabolic transcripts analysis. Bioinformatics, 24(2), 250-257. Trowsdale, J., & Parham, P. (2004). Mini-review: Defense strategies and immunity-related genes. Eur J Immunol, 34(1), 7-17. Ullah, M., Schmidt, H., Cho, K. H., & Wolkenhauer, O. (2006). Deterministic modelling and stochastic simulation of biochemical pathways using MATLAB. Paper presented at the IEE Proceedings - Systems Biology. Vastrik, I., D’Eustachio, P., Schmidt, E., Joshi-Tope, G., Gopinath, G., Croft, D., et al. (2007). Reactome: A knowledge base of biologic pathways and processes. Genome Biol, 8(3), R39. Voit, E. O., Almeida, J., Marino, S., Lall, R., Goel, G., Neves, A. R., et al. (2006). Regulation of glycolysis in Lactococcus lactis: An unfinished systems biological case study. Syst Biol (Stevenage), 153(4), 286-298.

401

Systems Biology and Infectious Diseases

Waddell, S. J., Butcher, P. D., & Stoker, N. G. (2007). RNA profiling in host-pathogen interactions. Curr Opin Microbiol, 10(3), 297-302. Wilczynski, B., Hvidsten, T. R., Kryshtafovych, A., Tiuryn, J., Komorowski, J., & Fidelis, K. (2006). Using local gene expression similarities to discover regulatory binding site modules. BMC Bioinformatics, 7, 505. Wiwatwattana, N., Landau, C. M., Cope, G. J., Harp, G. A., & Kumar, A. (2007). Organelle DB: an updated resource of eukaryotic protein localization and function. Nucleic Acids Res, 35(Database issue), D810-814. Yuan, X., Hu, Z. Z., Wu, H. T., Torii, M., Narayanaswamy, M., Ravikumar, K. E., et al. (2006). An online literature mining tool for protein phosphorylation. Bioinformatics, 22(13), 1668-1669. Zaffuto, K. M., Piccone, M. E., Burrage, T. G., Balinsky, C. A., Risatti, G. R., Borca, M. V., et al. (2007). Classical swine fever virus inhibits nitric oxide production in infected macrophages. J Gen Virol, 88(Pt 11), 3007-3012. Zhang, R., & Zhang, C. T. (2006). The impact of comparative genomics on infectious disease research. Microbes Infect, 8(6), 1613-1622.

K ey T erms Bayesian Network: Represent a probabilistic relationships between a set of nodes: it is a directed graph which vertexes encode conditional independencies between the nodes. Boolean Network: A set of nodes whose state is determined by other nodes in the network: it is a directed graph where nodes are either present (node of value=1) or absent (node of value=0). Biochemical Reaction: Is a chemical reaction that involves biological molecules. Gene Products: RNA, mRNA, protein and metabolites.

402

403

Chapter XXIV

Systems Biology of HumanPathogenic Fungi Daniela Albrecht Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany Reinhard Guthke Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany Olaf Kniemeyer Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany Axel A. Brakhage Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), Germany and Friedrich Schiller University (FSU), Germany

abstract This chapter describes a holistic approach to understand the molecular biology and infection process of human-pathogenic fungi. It comprises the whole process of analyzing transcriptomic and proteomic data. Starting with biological background, information on Aspergillus fumigatus and Candida albicans, two of the most important fungal pathogens, is given. Afterwards, techniques to create transcriptome and proteome data are described. The chapter continues with explaining methods for data processing and analysis. It shows the need for, and problems with data integration, as well as the role of standards, ontologies, and databases. General aspects of these 3 major topics are explained and connected to the research on human-pathogenic fungi. Finally, the near future of this research topic is highlighted. This chapter aims to provide an overview on analyses of data from different cellular levels of human-pathogenic fungi. It describes their integration and application of systems biology methodologies.

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Systems Biology of Human-Pathogenic Fungi

INTR OD UCTI ON In the past, biologists mostly studied one or few genes or gene products at a time. In recent years, it was realized that it is not enough to understand the basic elements of a system. It is also necessary to understand the system as a whole. Systems biology is a holistic, cross-disciplinary approach of studying biological systems (Ideker, Galitski, & Hood, 2001). It considers organisms and their environment as series of hierarchical levels. Systems biology can be divided into two branches. Bottom-up approaches, which aggregate detailed knowledge of single components and their interactions into suitable modules, are the first one. The second branch are top-down approaches, which decompose global data to gain knowledge of smaller modules. Bottom-up approaches are most important in research on human-pathogenic fungi at present. They work by systematically perturbing the biological system under study, monitoring the response, integrating data, and finally modelling the biological process. Iteratively, experiments are made to validate the model and the model is refined to fit experimental findings. A completely sequenced genome of an organism is the framework of any global approach. Together with transcriptomic and proteomic data, it builds the foundation for systems biology (Aggarwal & Lee, 2003). For several human-pathogenic fungi, including Aspergillus fumigatus and Candida albicans, the genome has been sequenced. Several studies have been conducted using ‘omics’ methodologies and storing results in databases. This chapter wants to provide insight into current work that is done on different cellular levels of human-pathogenic fungi and the state of systems biology research in this area.

BACKGR

OUND

Mycoses Experts believe that 1.5 million fungal species exist. Only 100-150 of them are associated with human infections. First human mycoses were discovered in the middle of the 19th century. In the last two decades, the number of patients suffering from invasive forms of fungal infections has grown rapidly. Today, A. fumigatus and C. albicans are the two major causes of such invasive diseases (Kullberg & Oude Lashof, 2002). Main reason for this development is the rising number of immunocompromised patients that are mostly affected by opportunistic pathogens. Humans that undergo immunosuppressive therapy, transplantations, intensive care or massive surgeries as well as humans infected with HIV are most susceptible. In addition, aging of the population and increased survival chances for premature newborns have increased the number of endangered persons. The investigation of the infection process on molecular level will help to reduce the risk of disease for these groups of people. In very recent times, molds other than A. fumigatus (e.g., A. flavus, A. terreus) and yeasts other than C. albicans (e.g., C. glabrata, C. tropicalis) emerged as human pathogens (Kullberg & Oude Lashof, 2002; Nucci & Marr, 2005). Also, other fungal species, for example Coccidioides posadasii or Cryptococcus neoformans, cause mycoses in humans. These fungi are far less common, so this chapter is mainly restricted to A. fumigatus and C. albicans.

Aspergillus Fumigatus Aspergillus fumigatus was first described and characterized by J. B. G. W. Fresenius in 1863. It is the primary mold pathogen and most important airborne fungal pathogen. The fungus can be found in soil 404

Systems Biology of Human-Pathogenic Fungi

and decaying organic matter and is ubiquitously distributed all over the world. It is highly thermotolerant, surviving temperatures up to 70°C. It is characterized by very small gray-green conidia (spores) that can easily reach the lung alveoli (Brakhage, 2005). For most patients, site of penetration and infection is the respiratory tract, especially the lung. Main defense mechanism in humans is the innate immune system, mainly phagocytic cells. The role of anatomical barriers, humoral components or acquired immunity has been rarely studied (Latgé, 1999). Diseases caused by A. fumigatus can be divided in non-invasive and invasive forms. Non-invasive aspergillosis includes allergic bronchopulmonary aspergilloses with effects from asthma to fatal lung destruction. Also aspergilloma, which appear as fungal balls in preexisting lung cavities caused by former lung disorders, are non-invasive. Both diseases can occur in immunocompetent hosts. Invasive forms are characterized by infection of lung or sinus tissue, and dissemination through the blood stream. They are mostly detected in immunocompromised patients. Aspergilloses occur less often than candidiases, but their mortality can be much higher, ranging from 30% to 90%.

Candida Albicans Candida albicans was discovered by C. P. Robin in 1853 as Oidium albicans. Afterwards it was renamed several times and got its final name in 1923 by C. M. Berkhout. The yeast is a commensal of mucosal surfaces (e.g., oral cavity, gastrointestinal tract, vagina) of up to 71% of the human population. It is a frequent cause of superficial infections of skin and mucosae. In immunosuppressed persons, it can also cause invasive infections by entering the bloodstream and penetrating nearly all organs of the body. Such candidaemia has the highest mortality rate of all bloodstream infections of around 40% (Mavor, Thewes, & Hube, 2005). C. albicans enters the blood stream in three ways. Penetration of epithelial cells (mostly from within the gastrointestinal tract) is the most frequent kind of invasion. Medical devices like catheters provide a second possibility of entry. The third way is a damage of body barriers for example by trauma, surgery or drug treatment. The fungus has the ability to change from commensalism to parasitism (Hube, 2004). It can colonize different body sites and cause different types of infections. This makes C. albicans the most frequently isolated fungal pathogen from blood samples and the most important yeast pathogen. Innate immunity plays a major role in fighting invasive infections. Mainly neutrophils, monocytes, and macrophages attack fungal cells. Superficial infections are mainly attacked by T-cell immunity.

W ORKING

ON DIFFERENT

CE LLULAR LE VE LS

G enome Genomics aims to identify genes and non-coding potentially important regions of a genome. The first sequencing project started in 1986. Currently, genomes of 26 fungal species are completely sequenced and published (GOLD, Genomes OnLine Database; retrieved August 29, 2008, http://www.genomesonline. org/). Among them are A. nidulans and Saccharomyces cerevisiae as model organisms for filamentous fungi and yeasts, respectively. Six genomes origin from human pathogens, including A. fumigatus and C. albicans. 19 more human-pathogens are in the process of being sequenced.

405

Systems Biology of Human-Pathogenic Fungi

The genome of A. fumigatus was published in 2005 (Nierman et al., 2005). 29.4 megabases arranged on 8 chromosomes with 9926 predicted genes were assembled. Many genes are annotated with unknown function; a lot of annotation work still has to be done. The 21st assembly of C. albicans sequencing was published in 2007 (van het Hoog et al., 2007). 6090 genes on 8 chromosomes in 15.8 megabases (haploid) were assembled. Sequencing was difficult because the fungus is diploid and many genes show distinct alleles. Annotation is a sophisticated process, controlled by Candida Annotation Working Group. With this wealth of genomic information at hand, it is possible to apply knowledge from model organisms on pathogens and to carry out comparative genomics. For A. fumigatus, this was done for example in a comparison of its genome to the ones of A. nidulans and A. oryzae. A similar project comparing C. albicans and C. dubliniensis can be found in literature. Genomic information also enables proper interpretation of functional genomic studies.

T ranscriptome Transcriptomics was the first ‘omics’ technology to emerge after completion of first genome sequences. Publication of the A. fumigatus genome was already accompanied by a first analysis of its transcriptome in temperature shift experiments (Nierman et al., 2005). Gene expression studies are very important. Genomic sequences alone do not explain interplay between genes or how cells work. Immediate product of transcription is mRNA, which provides the most direct view on genes and their regulatory networks. Transcriptomics works with the entire mRNA complement of a biological sample, the transcriptome. It provides a broader, more complete, and less biased view than looking at only one or few genes. DNA microarray technology is the workhorse for gene expression studies. The concept of this technology was developed in 1985. In 1995, the first gene expression article was published on a study with Arabidopsis thaliana. In research on human-pathogenic fungi, microarrays are mostly glass slides, on which DNA molecules are attached at fixed locations (spots). Several thousand spots per slide are possible. Thus, a whole genome can be arranged and investigated on one array. Many different variants of probe design, target preparation, array imaging, and other parts of the protocol for microarrays exist (Kawasaki, 2006). One possibility to group microarray experiments is by coloring method (Figure 1). The first gene expression article described a robotic printed cDNA array used with probes labeled with two different dyes (Cy3 and Cy5). Results of this method are relative measurements of spot intensities of both colors (channels). Today, also long (50 to 70mer) oligonucleotides are used, which provide a higher sensitivity. Another array format, developed by Affymetrix (Santa Clara, USA), uses photolithographic in-situ hybridized 20 basepair oligos. This format allows a very high density of spotted probes. Here, only one color is used and resulting values are absolute measurements. These two formats are widely used in all fields of biological research today. In studies on human-pathogenic fungi, the twocolor version is used nearly exclusively. Application of microarray techniques in this field includes at first identification of virulence-associated genes in different fungal species such as A. fumigatus and C. albicans. Also detection of cis-regulatory elements and regulons (i.e., sets of co-regulated genes) is important. Furthermore, expression profiles are used as fingerprints for classification purposes or tests for relatedness of different fungal species. Apart from microarrays of any kind, there are several other techniques to investigate mRNA in organisms (Lockhart & Winzeler, 2000). They include differential display and serial analysis of gene expression (SAGE). Few studies using differential display in human-pathogenic fungi can be found. Most of them have been carried out with C. albicans. SAGE was used sparsely in studies with fungal

406

Systems Biology of Human-Pathogenic Fungi

Figure 1. Process of creating DNA microarray data

pathogens (e.g., Cryptococcus neoformans). Both techniques provide additional knowledge to microarray-derived information. Often, results from two or more approaches are similar, but they never seem to be identical.

Proteome The word proteome was introduced in 1994. It describes the ensemble of protein forms expressed in a biological sample. Proteome analysis provides valuable information about living systems. Alternative splicing, different protein isoforms or protein complexes cannot be measured by analyzing the transcriptome. Proteins, not transcripts, are acting in most biological processes in a cell.

407

Systems Biology of Human-Pathogenic Fungi

Traditionally, proteomics was defined as large-scale analysis of proteins by two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) including mainly measuring of expression levels. 2D-PAGE followed by mass spectrometry (MS) for protein identification is the workhorse of this field. Two-dimensional gels are used since 1975 to simultaneously resolve large numbers of proteins. They are able to show post-translational modifications of a protein as a series of spots and thus make them available for analysis. First dimension is isoelectric focusing (IEF) which separates proteins by their isoelectric point. Second dimension is an SDS polyacrylamide gel, separating proteins by molecular weight (Figure 2). Publication of the first genome sequences enhanced the use of this technique dramatically. Function could be assigned to many proteins on the basis of preliminary annotation of these sequences. Also, development of MS techniques as matrix assisted laser desorption/ionization - time of flight (MALDI-TOF) for identifying proteins in 1987 made two-dimensional gel electrophoresis technology more powerful. A more recently (1997) developed special form of 2D-PAGE is difference in gel electrophoresis (DIGE). Here, two samples and one internal standard are colored with different dyes and run on the same gel. Resulting values are ratios (Cy3/Cy2)/(Cy5/Cy2) instead of absolute values. This reduces gel-to-gel variation on the quantity of a protein spot and makes matching of several gels and thus comparisons between gels much easier. This creates statistically significant data with fewer gels than in traditional 2D-PAGE (Marouga, David, & Hawkins, 2005). Classical 2D-PAGE and DIGE are used in various applications in research on human-pathogenic fungi. Important are investigations of yeast-to-hyphal transition for example in C. albicans, Penicillium marneffei, and other dimorphic fungi. Research on composition of fungal cell walls is equally important because it is the first fungal part in contact with host cells. Drug response is investigated largely on proteomic level. Biofilm formation for example of C. albicans is also a topic that is important for infecting humans and is investigated by using 2D-PAGE. Although 2D-PAGE is widely used, it has some disadvantages. It ignores the possibility of co-migration. In addition, types of proteins that can be visualized on a gel are limited. For example, proteins with extreme values of isoelectric point and molecular weight cannot be displayed. To overcome these drawbacks, other methods have emerged. There are several mass spectrometry based approaches like (high performance) liquid chromatography coupled to tandem mass spectrometry ((HP)LC-MS/MS). HPLC-MS/MS was used for example to investigate vaccines against Coccidioides posadasii. Protein arrays are beginning to be used quite similar to mRNA arrays (Pandey & Mann, 2000). They have been applied in few analyses on C. albicans. Again, no single platform exists providing a solution to every problem. Different ones have to be merged for a systematic view.

Other ‘Omics’ Apart from genomics, transcriptomics, and proteomics, many other ‘omics’ approaches exist. Prominent examples are metabolomics, lipidomics, interactomics, and phenomics. Metabolomics investigates all metabolites in an organism. Lipidomics is the field of research on all lipids of a cell. The interactome is the totality of molecular interactions in an organism. A collection of all phenotypic information observed in wild-type organisms and upon mutations of genes is called phenome. Many more are listed with explanations in http://www.genomicglossaries.com/content/omes.asp. Few of them play a role in investigation of human-pathogenic fungi. Metabolomics studies can be found in literature. Phenomics and interactomics research have been conducted in S. cerevisiae as model organism. Most of the other global approaches do not have impact on fungal research yet.

408

Systems Biology of Human-Pathogenic Fungi

Figure 2. Process of creating two-dimensional gel data

PR OCESSING DATA

AND ANA LYSIS OF TRANSCRIPT

OMIC AND PR OTE OMIC

Two-channel DNA microarrays and 2D-PAGE are the most common techniques for analyzing transcriptome and proteome of human-pathogenic fungi. This section aims at describing processing and analysis of such data.

Image A nalysis Programs When experiments on transcriptomic and proteomic level are performed, DNA microarrays or 2D gels are scanned and these scans are analyzed. Raw data of both approaches are monochrome images. Trans-

409

Systems Biology of Human-Pathogenic Fungi

formation into gene expression matrices is not trivial. In research on human-pathogenic fungi, this is preferentially done by special software packages. GenePix (Molecular Devices Corporation, Sunnyvale, USA) and ArrayVision (GE Healthcare UK Ltd, Buckinghamshire, England) are widely used for twochannel microarrays. Manual assistance is often unavoidable because spots might be irregular in shape or fluorescence impurities on chip surface may confuse algorithms. For 2D-PAGE images, DeCyder (GE Healthcare UK Ltd, Buckinghamshire, England) and Delta 2D (Decodon GmbH, Greifswald, Germany) are examples for software able to analyze images from classical 2D-PAGE and DIGE. All these programs provide functionalities for comparing spots across arrays or gels. This is a particular critical step in proteomics. Proteins move freely in a gel and spots do not appear at fixed known positions. None of the available software platforms provides perfect automatic spot detection and matching between gels. Manual inspection is needed. As it is of interest for most experiments, all above platforms detect differentially expressed genes or proteins and give significance measures. In research on human-pathogenic fungi, analyses often rely on this software only and report results without any other bioinformatical inspection of data. In other fields of research, additional methods for data processing are developed and will be the topic of the next sections.

R eplication and E xperimental D esign Observed varieties in experiments have two sources. They can be technically caused or result from biological variability. Therefore, technical and biological replicates need to be carried out. It is possible to spot one probe multiple times on each microarray. If some spots cannot be evaluated due to technical problems, there will be a backup. Making more than one microarray or 2D-PAGE gel out of the same biological sample is another possibility to remove technical variety. It corrects differences in labeling reactions. A third way is the so-called dye swap. It removes gene or protein specific dye effects. All these technical replicates are essential to produce significant data. They address measurement error or noise in experiments. Nevertheless, major variability is caused by different cells, tissues or organisms in one experiment. Hence, biological replicates are as relevant as technical ones. Statistical estimates consider a minimum of three replicates as sufficient. Intensity values of replicates are mostly averaged. To minimize the number of arrays or gels in one experiment that is needed to produce that many replicates, a careful experimental design is necessary (Ehrenreich, 2006). The classical approach is to compare different samples to the same reference. This reference design needs lots of sample material since it is using half of it for measuring the control sample. A better variant is the loop design. Each sample is compared to the following one and the last one is additionally compared to the first. This needs less material by creating more replicates than the reference design. Another experimental design is the all-pair design. All samples are compared to each other. It needs many arrays or gels but provides the most robust data.

Missing Value Imputation Every microarray and 2D-PAGE experiment shows missing values. There are many reasons like occurrence of spots with very low intensities or high background noise. Gels have the additional problem of spot matching mentioned above. In research on human-pathogenic fungi as well as in other research areas especially on proteomic level, this problem is mostly ignored. Spots with missing values are skipped out of analysis or are automatically substituted by zero or very small values within image analysis programs.

410

Systems Biology of Human-Pathogenic Fungi

This ignores correlation structure of microarray or gel data. Some more advanced analysis techniques like special normalization methods, clustering or principle component analysis require complete data. Lots of packages for statistical programming languages like MATLAB (The MathWorks, Inc., Natick, USA) or R (The R Project for Statistical Computing, http://www.r-project.org/) exist and can be applied with little effort. Two approaches for imputation of microarray data (Troyanskaya et al., 2001), namely the k-nearest neighbor (KNN) approach and imputation by singular value decomposition (SVD) were introduced in 2001. KNN is used in a present study with A. fumigatus (Albrecht et al., in preparation). Since 2001, many other methods for imputation have been developed. Among them are regression methods like local least square (LLS) imputation with several variants. Examples for non-regression methods are Gaussian mixture modeling (GMC) and Bayesian principal component analysis (BPCA). Few of them have been used on more than benchmark data, now. GMC has been used in one study with A. fumigatus (Guthke, Kniemeyer, Albrecht, Brakhage, & Moeller, 2007).

N ormalization and T ransformation Normalization of DNA microarray and 2D-PAGE data corrects for systematic biases that can result for example from different amounts of RNA used, array manufacturing method or hybridization conditions. Several methods exist that have been developed for microarray data and can be applied to gel data, too (Jung et al., 2006). There is no method that can be recommended for every study. Different normalization methods may lead to different results when applied on the same dataset. Whenever more than one microarray or gel is investigated, normalization must be done in two parts: within and between arrays or gels. First, background correction has to be done within arrays or gels. One possibility is to subtract local background intensity in an area around the spot from foreground intensity of the spot itself. Afterwards, intensity-based filtering within an array or gel is done. This excludes spots with very low intensities from analysis. It has been shown that these spots disturb most normalization and filtering methods. Now, different channels or arrays and gels are scaled to reduce individual channel, array or gel effects on spot intensities. Sum, mean, median or other statistical measures of intensities in both channels of one array or gel and in different arrays or gels are assumed to be equal (Do & Choi, 2006). A normalization factor is calculated and all features are scaled according to this factor. Afterwards, mostly ratios of intensities of both channels or of two arrays or gels are calculated. Ratios have the disadvantage to treat up- and downregulated features differently, leading to values of 2 and 0.5 for example. By logarithmizing ratios to base 2, such features will get values of 1 and -1, respectively. Applying the logarithm also reduces variation in the variances of medium and high intensity spots. Additionally, it makes data be approximately normally distributed which is important for some filtering approaches. In most studies on human-pathogenic fungi, normalization stops here. All methods for normalization and transformation outlined above are implemented in image analysis programs. It was shown several times for example for DIGE data that normalization by image analysis programs does not remove all bias in data. More sophisticated normalization includes locally weighted linear regression (LOWESS), variance stabilization (VSN) and quantile normalization as prominent methods. All three are freely available within R packages. LOWESS is used within arrays or gels (Do & Choi, 2006). It corrects intensity dependent effects and can also remove spatial bias on arrays and gels. VSN is a method for normalization between arrays or gels (Jung et al., 2006). It uses a multiplicative and additive model to normalize data. The scaling factor reflects dye specific gain and the additive offset removes background

411

Systems Biology of Human-Pathogenic Fungi

fluorescence. Additionally, an asinh function is used instead of logarithmizing ratios to stabilize variance for low intensity spots, too. Quantile normalization works within and between arrays or gels. It assumes that intensities (or means, medians or other statistical measures of intensities) have the same empirical distribution across arrays or gels or across different channels. Result of normalization is a table of normalized intensities or ratios for all features, i.e., genes and proteins, in rows and for all conditions in columns. Now, these features have to be filtered to extract differentially expressed ones.

F iltering Filtering of genes or proteins using a fixed fold change (i.e., ratio of spot intensities of two different channels, arrays or gels) threshold followed by t-test statistics is the most often used method of determining differential expression when working with data of human-pathogenic fungi. Usually a fold change threshold of 2 is used because it was shown that changes of microarray and 2D-PAGE gel data are significant above this level. To detect more subtle regulations, Z-scores can be used (Quackenbush, 2002). Genes or proteins with Z-scores outside the range of [-1.96, 1.96] are differentially expressed at 95% confidence level. This way, the threshold is adapted and thus more specific to the particular dataset. Z-scores did not play a large role in research of human-pathogenic fungi on transcriptome and proteome level yet. They have been applied in one proteomic study investigating the temperature resistance of A. fumigatus (Kniemeyer et al., in preparation). Fold change and Z-score are well correlated. They can be modified to be intensity dependent and hence better reflect data structure. After feature selection using one of the above methods, a significance measure of the resulting list of genes or proteins is needed. t-test or analysis of variance (ANOVA) (Do & Choi, 2006; Jung et, al., 2006) are often used in studies with human-pathogenic fungi as they are implemented in image analysis programs. t-test and ANOVA calculate one p-value for each feature. They do not account for multiple testing that is actually done (each feature is tested against the hypothesis of being differentially expressed). p-values have to be adjusted to be really meaningful. Several methods exist to do such adjustment. Bonferroni’s technique multiplies all unadjusted p-values with the number of tests performed and is therefore very strict. Other methods like Holm’s technique or Benjamini-Hochberg’s technique are more practical. Until now, none of these methods has been applied to data of human-pathogenic fungi.

Interpretation and Visualization Biological interpretation of gene and protein expression data is not always easy and straightforward. Several methods aim at simplifying this process by dividing data into meaningful groups or reducing dimensionality. Others infer regulatory networks from expression matrices to explain biological function. All methods have been widely used on microarray data until now; application on gel data will probably follow. They are based on the assumption that similar expression profiles indicate related biological function. Dividing data into different groups can be done by supervised or unsupervised machine learning (Brazma & Vilo, 2000). Supervised learning needs prior knowledge of classes in data. It aims at constructing classifiers like linear discriminants, support vector machines (SVM) or decision trees to be able to assign a given expression profile to one of predefined classes. Decision trees have been used for analyses with Aspergillus species, investigating antifungal drugs and production of secondary me-

412

Systems Biology of Human-Pathogenic Fungi

tabolites. Unsupervised learning or clustering makes nearly no assumptions on data. Data are mined for naturally occurring clusters that are investigated for similarities within and dissimilarities between them. There are many different clustering methods, hierarchical, partitioning or density based. Every approach has strengths and weaknesses. Hence, it is recommended to validate cluster results by using more than one method. In research on human-pathogenic fungi, clustering has been conducted several times. It is not restricted on transcriptomics or proteomics. Also comparative genomics and metabolomics data of these fungi have been clustered. Mostly hierarchical agglomerative methods were used. In one study, Fuzzy C-means was applied (Guthke et al., 2007). Principal component analysis (PCA) and correspondence analysis (CA) (Fellenberg, Hauser, Brors, Neutzner, Hoheisel, & Vingron, 2001) are techniques of dimension reduction. They try to visualize data in two or three dimensions while preserving commonalities and differences of higher dimensions as good as possible. They display those dimensions that account for the maximum amount of variation in a dataset. It is possible to display features in space of experimental conditions or experimental conditions in feature space. Both methods can also scale data such that rows and columns are treated equivalently. In this way, they can visualize features and experimental conditions simultaneously in the same ‘bi’-plot. PCA was used for example to differentiate clinical strains of A. fumigatus from environmental ones, to measure influence of growth conditions on C. albicans and several filamentous fungi or to visualize serum response to C. albicans cell wall. CA was used for example to type isolates of A. fumigatus or to separate 2D-PAGE gel profiles of patients suffering from invasive candidiasis from those of control patients. Network inference is a reverse engineering method (Filkov, 2005). Nowadays, it is mostly conducted on transcriptomic data. There are several different methods for inference of Boolean or continuous, deterministic or stochastic networks, directed or undirected graphs. One method, namely network inference by using differential equations, has been applied to data from A. fumigatus (Guthke et al., 2007). Thereby, the unique temperature resistance of the fungus was investigated. The same method is currently applied to analyze the response of C. albicans to blood and serum. All results obtained by methods described above are only first steps on the way to understanding underlying biological processes. The workflow in Figure 3 shows the path from experimental data to mathematical models. These models should formulate testable hypotheses and be applied to design further biological experiments to finally validate the hypotheses.

DATA INTEGRATI ON Benefits and Problems Flow of information is complex between different cellular levels. It was especially shown for transcriptomic and proteomic data that correlation is low or medium for most genes and their corresponding proteins. Integration of both types of data clearly provides additional information. Data from different cellular levels may even be informative in a complementary manner. In particular, observed dissimilarities between monitored behaviour on transcriptomic and proteomic level can show important post-transcriptional regulatory junctures (Chan, 2006). It has also been described that data from one special approach can be erroneous or incomplete due to technical problems. Some results may not be reliable even though replicates are used. In 2D-PAGE gels for example, some proteins cannot be found because of their low

413

Systems Biology of Human-Pathogenic Fungi

Figure 3. Iterative process of data analysis

abundance or extreme values of isoelectric point and molecular weight. Results coming from another cellular level and achieved with different technology can correct, verify, and complete data. All these advantages make the integrated analysis of more than one type of data desirable (Figure 4). Still, no integrated analyses of data from human-pathogenic fungi can be found in literature. Few approaches have been made by integrating heterogeneous data from S. cerevisiae. Reason for this may be the fact that data integration is not simple. One problem relies on different half-lifes of mRNAs and proteins in the cell. mRNAs have a half-life of minutes to hours, proteins of minutes to sometimes days. It was shown that in some organisms time delay of protein formation after mRNA production can sometimes be several hours. This complicates the situation even more. By making snapshots of a cellular situation, as it is done by analysing microarrays and gels, it is difficult to conclude whether the level of a special protein really reflects momentary processes on mRNA level or whether it is an artifact of earlier states. This problem can partially be avoided by analyzing time courses and trends in regulation. Time courses have the additional advantage of directly reflecting the dynamic structure of biological systems. Above issues reflect biology and the difficulty to correlate measurements to actual processes in the cell. There are also some technical hindrances. Technical quality of DNA microarrays and 2D-PAGE is hard to compare. Carefully thinking and adapting of all steps of data preprocessing is important to account for specialties of each technology. Another problem is availability and accuracy of cross references between transcripts and corresponding proteins. In human-pathogenic fungi, for many genes there is no protein known yet. This complicates interpretation of transcriptomic results and validation by proteomic data. Another difficulty is heterogeneity of data formats. Different platforms of microarrays or two-dimensional gels produce data in different formats. They are difficult to compare within one cel-

414

Systems Biology of Human-Pathogenic Fungi

Figure 4. Integration of data from different cellular levels

lular level and even more between two levels. To retrieve all information from different formats and to be able to reliably interpret this information, implementation of standards and ontologies is needed.

S tandards and Ontologies Transcriptomic and proteomic data are highly context dependent. Their interpretation and replication requires detailed knowledge of experimental design, samples, and protocols. Standards to achieve accurate and consistent annotation of experiments are necessary. Several international consortia exist that address the issue of standardizing microarray data (Kawasaki, 2006). Microarray Gene Expression Data (MGED) Society (http://www.mged.org) is the most prominent one. It is an international organization of biologists, computer scientists, and data analysts existing since 1999. It aims at facilitating sharing of microarray data by establishing standards for data annotation and exchange as well as creation of databases and software implementing these standards. MGED develops a three component standard. Minimum information about a microarray experiment (MIAME) is a guideline of minimal information essential for unambiguous interpretation and reproduction of microarray data. It contains data on experimental design, array design, samples used, and every experimental step including data analysis. Microarray gene expression object model (MAGE-OM) and

415

Systems Biology of Human-Pathogenic Fungi

markup language (MAGE-ML) are developed for data exchange. MGED ontology (MO) comprises common terms and annotation rules to describe experiments. Since 2002, several journals demand publications being accomplished by data in MIAME compliant format stored in databases supporting this standard. This includes data from human-pathogenic fungi. Control and standardization of proteomic data is not mature yet. Proteomics Standards Initiative (PSI, http://www.psidev.info) of Human Proteome Organization (HUPO) is an open community effort defining standards for data representation since 2002. They are working on a similar package for proteomic data like MGED for microarray data. It consists of MIAPE, a counterpart to MIAME, data exchange formats, and an ontology. Standards documents for MS data are already published. MIAPE: Gel electrophoresis, version 1.2. has been posted on Nature Biotechnology website (http://www.nature.com/nbt/consult/index.html) in December 2006. It is open for community comments and will be published after revision. Standards for other parts of proteomic research like sample preparation and proteomic informatics are under way. Both consortia not only develop their own standards and ontologies but they also incorporate and improve existing ones like functional genomics experiment model specification (FuGE) or gene ontology (GO). A goal for future work of MGED Society and HUPO PSI is working together on an internationally accepted standard for both transcriptomic and proteomic and possibly other ‘omic’ data. All these standards and ontologies are general for all applications in biology. They are not restricted to research on human-pathogenic fungi.

D atabases and D ata W arehouses The huge amount of biological data makes it necessary to store them in local or global databases. There are lots of databases and data warehouses for molecular biology available via internet (Galperin, 2008). Important for nearly every research in this area are for example NCBI GenBank (http://www.ncbi.nlm. nih.gov/Entrez) with all known nucleotide and protein sequences or UniProt (http://www.uniprot.org), the universal protein knowledgebase. Various degrees of data integration can be found in data bases like these. Only few databases are specially important for experimental data of transcriptomics and proteomics from human-pathogenic fungi (Table 1). Data warehouses incorporating experimental data from different cellular levels of these fungi are not available via internet so far. One data warehouse is being developed (Albrecht, Kniemeyer, Brakhage, Berth, & Guthke, 2007). Also, functional genomics databases containing data from different cellular levels of other organisms are not very common. A reason may be the difficulty of storing such heterogeneous, semi-structured, complex data. They have to be stored and displayed in a way that helps scientists to understand and interpret complex observations. A combination of optimal storage (warehousing, information management) and biological reality is desirable. Basic genomic data have to be provided additionally to experimental data. They may be imported out of sequence databases like GenBank and have to be kept up to date. Also annotation of data has to be provided, as well as direct access to experimental information in a standardized format. Automatic annotation is not accurate and comprehensive enough, manual annotation is very time consuming. When building a data warehouse, some basic analysis tools are desirable. Incorporating all these aspects into one database or data warehouse is difficult and labor intensive.

416

Systems Biology of Human-Pathogenic Fungi

Table 1. Databases and data warehouses important for research on human-pathogenic fungi; extended extract of the supplement to Galperin (2007) Name

Description

URL

transcriptomic databases ArrayExpress

Public collection of microarray gene expression data

http://www.ebi.ac.uk/microarrayas/ae/

GEO

Gene expression omnibus: Gene expression profiles

http://www.ncbi.nlm.nih.gov/geo

SWISS-2DPAGE

Annotated 2D gel electrophoresis database

http://www.expasy.org/ch2d

2D-PAGE

Proteome database system for microbial http://www.mpiib-berlin.mpg. research de/2D-PAGE

proteomic databases

fungal databases CandidaDB

Candida albicans genome database

http://genodb.pasteur.fr/cgi-bin/ WebObjects/CandidaDB

Candida Genome

Candida albicans genome database

http://www.candidagenome.org/

Génolevures

A comparison of S. cerevisiae and 14 other yeast species, including C. glabrata

http://cbi.labri.fr/Genolevures/

CADRE

Central Aspergillus data repository

http://www.cadre-genomes.org. uk/

PHI-base

Genes affecting fungal pathogen-host interactions

http://www.phi-base.org/

e-fungi

Genomes and functional genomic data of different fungal species

http://www.e-fungi.org.uk/ database.html

F UT URE TRENDS Systems biology in human pathogenic fungi is just emerging. Techniques are still in their infancies and have to become part of the daily routine of researchers in this field. DNA-microarray technology is well established but still far from being fully exploited (Hoheisel, 2006). Also, 2D-PAGE still suffers from many unsolved problems and is not able to really display a whole proteome of an organism. In the future, research on human-pathogenic fungi should improve both techniques but also make use of alternatives like SAGE and LC-MS/MS. This will provide a broader view on special research topics than we have today. Another issue for future work is to analyze both time-series and spatial data. Compartmentalization is an important issue for future data acquisition, analysis and modeling. Proteomics can reveal localizations of proteins in a cell, but this is rarely used now. Additionally, localization of the pathogen within its host must be analyzed. A. fumigatus and C. albicans can invade tissue and spread over the whole body. This process has not only to be investigated with regard to time but also to localization.

417

Systems Biology of Human-Pathogenic Fungi

Furthermore, research has to include more organisms. A. fumigatus and C. albicans are important fungal pathogens but not the only ones. For example C. glabrata, a pathogenic yeast closely related to S. cerevisiae, could be an interesting model organism. Systems biology is most advanced on S. cerevisiae. Methods should be easily applicable to C. glabrata and could reveal basic pathogenicity mechanisms via comparison to the non-pathogenic yeast. It is also necessary to include data from research on the host site. A. fumigatus and C. albicans are opportunistic fungi. The status of the immune system of the host plays a major role in infection and has therefore to be included in a holistic model, too. Even more important, data have to be integrated. It was shown several times that transcriptomic and proteomic data are complementary. One cellular level alone is not sufficient to fully understand the infection process. At the moment, integration of data is mostly done to support findings of one type of data with another one. This should clearly be extended to integrated models of more than one cellular level. Gene regulatory network models as in Guthke et al. (2007) are valuable and bring new knowledge, but they need to be extended to proteins to reflect biological reality more closely. Databases and data warehouses will play a vital part in this. Integration of different techniques and approaches requires interdisciplinarity between biologists and bioinformaticians of several fields to a much higher extent than today. Integration of knowledge from different fields of biology and tools from mathematics and computer science is essential. This also includes the application and combination of bottom-up and top-down approaches. We have just made few steps in the direction of systems biology. Further steps are necessary to understand the infection process of human-pathogenic fungi and to cure or even prevent mycoses.

C ONC LUSI ON We know a biological system, when we can redesign it and predict its resulting properties. Systems biology of human-pathogenic fungi, as of most other medical research areas, has not come thus far yet. Fully sequenced genomes of some fungal pathogens as basis are available since few years. In many cases, assembly or annotation is not fully finished yet. Data from other cellular levels are being collected and analyzed. Most work is currently done by perturbing systems and measuring response on transcriptomic or proteomic level. Techniques for this part have been developed and are widely applied. We are just starting to reach beyond this mere data collection to understand the complex system of infection. Until now, only little effort has been made in data integration and modeling. Some approaches exist and have been used to S. cerevisiae as a model organism. They can be applied to data from human-pathogenic fungi in the future.

REFERENCES Aggarwal, K., & Lee, K. H. (2003). Functional genomics and proteomics as a foundation for systems biology. Briefings in Functional Genomics and Proteomics, 2(3), 175-184. Albrecht, D., Kniemeyer, O., Brakhage, A. A., Berth, M., & Guthke, R. (2007). Integration of transcriptome and proteome data from human-pathogenic fungi by using a data warehouse. Journal of Integrative Bioinformatics, 4(1), 52.

418

Systems Biology of Human-Pathogenic Fungi

Brakhage, A. A. (2005). Systemic fungal infections caused by aspergillus species: Epidemiology, infection process and virulence determinants. Current Drug Targets, 6(8), 875-886. Brazma, A., & Vilo, J. (2000). Gene expression data analysis. Microbes and Infection, 3(10), 823-829. Chan, E. (2006). Integrating transcriptomics and proteomics. Genomics and Proteomics, 6(3), 20-26. Do, J. H., & Choi, D. K. (2006). Normalization of microarray data: Single-labeled and dual-labeled arrays. Molecules and Cells, 22(3), 254-261. Ehrenreich, A. (2006). DNA microarray technology for the microbiologist: An overview. Applied Microbiology and Biotechnology, 73(2), 255-273. Fellenberg, K., Hauser, N. C., Brors, B., Neutzner, A., Hoheisel, J. D., & Vingron, M. (2001). Correspondence analysis applied to microarray data. Proceedings of the National Academy of Sciences of the United States of America, 98(19), 10781-10786. Filkov, V. (2005). Identifying gene regulatory networks from gene expression data. In Aluru (Ed.), Handbook of Computational Molecular Biology (pp. 27-1 - 27-30). Florida: Chapman&Hall/CRC Press. Galperin, M. Y. (2008). The molecular biology database collection: 2008 update. Nucleic Acids Research, 36(Database issue), D2-D4. Guthke, R., Kniemeyer, O., Albrecht, D., Brakhage, A. A., & Moeller, U. (2007). Discovery of gene regulatory networks in aspergillus fumigatus. Lecture Notes in Bioinformatics, 4366, 22-41. Hoheisel, J. D. (2006). Microarray technology: Beyond transcript profiling and genotype analysis. Nature Reviews. Genetics, 7(3), 200-210. Hube, B. (2004). From commensal to pathogen: Stage- and tissue-specific gene expression of candida albicans. Current Opinion in Microbiology, 7(4), 336-341. Ideker, T., Galitski, T., & Hood, L. (2001). A new approach to decoding life: Systems biology. Annual Review of Genomics and Human Genetics, 2, 343-372. van het Hoog, M., Rast, T. J., Martchenko1, M., Grindle, S., Dignard, D., Hogues, H., et al. (2007). Assembly of the Candida albicans genome into sixteen supercontigs aligned on the eight chromosomes. Genome Biology, 8(4), R52. Jung, K., Gannoun, A., Sitek, B., Apostolov, O., Schramm, A., Meyer, H. E., et al. (2006). Statistical evaluation of methods for the analysis of dynamic protein expression data from a tumor study. RevStatStatistical Journal, 4(1), 67-80. Kawasaki, E. S. (2006). The end of the microarray tower of babel: Will universal standards lead the way? Journal of Biomedical Techniques, 17(3), 200-206. Kullberg, B. J., & Oude Lashof, A. M. L. (2002). Epidemiology of opportunistic invasive mycoses. European Journal of Medical Research, 7(5), 183-191. Latgé, J. P. (1999). Aspergillus fumigatus and aspergillosis. Clinical Microbiology Reviews, 12(2), 310350.

419

Systems Biology of Human-Pathogenic Fungi

Lockhart, D. J., & Winzeler, E. A. (2000). Genomics, gene expression and DNA arrays. Nature, 405(6788), 827-36. Marouga, R., David, S., & Hawkins, E. (2005). The development of the DIGE system: 2D fluorescence difference gel analysis technology. Analytical and Bioanalytical Chemistry, 382(3), 669-678. Mavor, A. L., Thewes, S., & Hube, B. (2005). Systemic fungal infections caused by Candida species: Epidemiology, infection process and virulence attributes. Current Drug Targets, 6(8), 863-874. Nierman, W. C., Pain, A., Anderson, M. J., Wortman, J. R., Kim, H. S., Arroyo, J., et al. (2005). Genomic sequence of the pathogenic and allergenic filamentous fungus aspergillus fumigatus. Nature, 438(7071), 1151-1156. Nucci, M., & Marr, K. A. (2005). Emerging fungal diseases. Clinical Infectious Diseases, 41(4), 521526. Pandey, A., & Mann, M. (2000). Proteomics to study genes and genomes. Nature, 405(6788), 837846. Quackenbush, J. (2002). Microarray data normalization and transformation. Nature Genetics, 32, 496501. Troyanskaya, O., Cantor, M., Sherlock, G., Brown, P., Hastie, T., Tibishirani, R., et al. (2001). Missing value estimation methods for DNA microarrays. Bioinformatics, 17(6), 520-525.

K ey T erms Data Warehouse: Special type of database for storage of heterogeneous data from different sources. Data warehouses are optimized for supporting and including data analyzes. Database: Structured collection of large amounts of data. Queries can be run to collect and display subsets of the data to many users. Filtering: Process of separating different types of data from the whole. A filtering criterion has to be applied, the choice of which is critical for results. Genomics: Determination and investigation of the entire genome of an organism. Sequencing is a big part. However, the functional characterization of genes is a big challenge. Human-Pathogenic Fungi: Fungal species that cause diseases in humans. They can be environmental and act as external pathogens like A. fumigatus. They can also be commensals of humans and act as endogen pathogens like C. albicans. Imputation: Substitution of some values for missing data. When missing values are imputed, data can be analyzed using standard techniques for complete data. Normalization: Process of removing bias in data. Normalization tries to minimize the influence of measurement error on results of analyses.

420

Systems Biology of Human-Pathogenic Fungi

Proteomics: Large-scale study of proteins in a cell, tissue or organism under certain conditions. It is more difficult and less mature than transcriptomics. Proteins are actors of nearly all biological processes. Transcriptomics: Examination of mRNA expression levels in a given cell population. mRNA content and distribution of a cell closely reflects the activation status of its genes.

421

423

Chapter XXV

Development of Speci.c Gamma Secretase Inhibitors Jessica Ahmed* Charité Universitaetsmedizin Berlin, Germany Julia Hossbach* Charité Universitaetsmedizin Berlin, Germany Paul Wrede Charité Universitaetsmedizin Berlin, Germany Robert Preissner Charité Universitaetsmedizin Berlin, Germany

abstract Secretases are aspartic proteases, which specifically trim important, medically relevant targets such as the amyloid-precursor protein (APP) or the Notch-receptor. Therefore, changes in their activity can lead to dramatic diseases like M. Alzheimer caused by aggregation of peptidic fragments. On the other hand, the secretases are interesting targets for molecular therapy of the multiple myeloma, because the over-expressed Notch-receptor does not emerge into the native conformation until the cleavage by the presenilin, the active and catalytic subunit of the gamma secretase, occurs. Here, we focus on a novel methodology of structure-based drug development, feasible without prior knowledge of the target structure—analogy modeling. This combination of similarity screening, fold recognition, ligand-supported modeling, and docking is exemplarily illustrated for the structure of presenilin and specific inhibitors thereof.

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Development of Speci.c Gamma Secretase Inhibitors

Introduction Aspartic proteases have received considerable attention as potential targets for pharmaceutical intervention since many play important roles in physiological and pathological processes. Despite numerous efforts, the only inhibitors for aspartic proteases currently on the market are directed against the HIV protease, an aspartic protease of viral origin (Eder et al. 2007). All other known aspartic protease inhibitors including those targeting renin, BACE1 and gamma secretase (Tsai et al. 2002) did not yet overcome the clinical or preclinical development due to problems regarding their speci. city. Alzheimer disease (AD) is the most frequent cause of dementia. About five million patients in the seven largest Western economies suffer from that disease. The common form affects humans over 60 years of age and its incidence increases as age advances. AD is characterized by a progressive loss of short-term memory and impaired cognitive function. In later stages additional symptoms aggravate the

Figure 1. Processing scheme for the ß-amyloid precursor protein. APP (Amyloid Precursor Protein) is processed in two steps. First, beta secretase generates two fragments, the beta-amyloid precursor peptide and the C-terminal fragment (CTF-ß) C99 fragment. In a second step, the gamma secretase cleaves the C99 fragment into an Aß fragment and AICD (APP Intracellular Domain). Sometimes the gamma secretase generates an Aß fragment with 42 amino acids instead of 40. The 42 peptide aggregates rapidly to amyloid plaques with the fatal consequence that the nerve cell degrades (Figure adopted from Wrede, 2005).

424

Development of Specific Gamma Secretase Inhibitors

situation and patients become totally unable to care for themselves. AD is associated with an accumulation of amyloid plaques and neurofibrillary tangles in the brain. These morphological alterations are believed to be causally related to the neurodegenerative process. The beta-amyloid is produced by proteolytic cleavage of amyloid precursor protein (APP) first by beta and then by gamma secretases (Figure 1). Beta secretase (also known as BACE1, Asp2, Memapsin) is a transmembrane aspartyl protease that generates the N-terminus of beta-amyloid by cleaving APP on the luminal or extracellular side into betaAPP and C99. BACE1 is a prominent target for the treatment and prevention of AD. Since it catalyses a pivotal step in amyloid production, its inhibition should have a positive impact on the progression of the disease (Sinha et al. 1999). In detail, the molecular cause of the severe AD is the aggregation of short peptides with the length of 42 amino acids. These amyloid plaques forming peptides are a fragmentation product of the C99 peptide after hydrolysis by the gamma secretase. The regular function of this protease generates the soluble beta-peptide with 40 amino acids in length.

Role of Secretases in Cancer Multiple myeloma (also known as plasma cell myeloma, or as Kahler’s disease) is a type of cancer of plasma cells, which are immune cells in the bone marrow producing antibodies. Multiple myeloma is the second most prevalent blood cancer (10%) after non-Hodgkin’s lymphoma. It represents approximately 1% of all cancers and 2% of all cancer deaths. Myeloma is regarded as incurable and, therefore, novel therapeutic approaches like proteasome inhibitors or specific gamma secretase inhibitors are in great demand. The gamma secretase complex is a multi component intra-membrane aspartyl-protease that cleaves the amide bonds of its substrates within their transmembrane regions (Wolfe 1999, Wolfe 2001a). Both, Notch and the beta-amyloid precursor protein (APP) are cleaved by presenilin, the catalytic subunit of the gamma secretase that, along with nicastrin, Aph-1 und Pen-2, is necessary for the protease activity (Wolfe 2001b). Its activity towards the Notch-receptor, which is involved in gene regulation mechanisms controlling multiple cell differentiation processes, renders it interesting as a cancer target. The differential effects of kinase inhibitors on beta-amyloid precursor protein processing (without influence on Notch cleavage) are promising for the therapy of Alzheimer´s disease. For the therapy of cancer, however, modulators are in great demand that specifically inhibit the cleavage of Notch, but not of APP (Geling et al. 2002). Here, we present a successful strategy concatenating various in silico and in vitro methods to develop and validate specific gamma secretase inhibitors. The highly conserved Notch-receptor is a transmembrane heterodimeric receptor which consists of four distinct members (Notch 1-4). The physiologic functions of Notch signaling are multifaceted, including maintenance of stem cell regulation, of differentiation as a well as in oncogenesis. Binding of Notch-ligand to the receptor leads to Notch signaling by release of the intracellular domain of Notchreceptor through a cascade of proteolytic cleavages by both alpha secretase and gamma secretase. The initiation starts through contact between the receptor and its ligands. Receptor-ligand interaction leads to successive cleavage events, of which the third is mediated by the gamma secretase. Following this cleavage, the intracellular domain of Notch translocates to the nucleus and acts as a transcription coactivator (Shih 2007). Furthermore, Notch is involved in the Wnt pathway through beta catenin, a cytoskeletal component, which enters the nucleus to act as a transcriptional cofactor. By binding of Wnt to the receptor Frizzled,

425

Development of Specific Gamma Secretase Inhibitors

Figure 2. Notch signaling pathway. Presenilin is associated with gamma secretase activity involved in signaling transmembrane protein notch. The large cell surface protein Notch is activated by contact with membrane-bound ligand on neighboring cells. Binding of delta/Serrate/Lag-2 by notch results in three proteolytic cleavages of Notch. The furin-like enzyme cleaves Notch constitutively adjacent to the amino acid sequence RQRR in the extracellular domain (Jundt et al. 2002). The second cleavage is the cleavage of the extracellular domain and is catalyzed by a metal protease termed TACE or alpha secretase. The third cleavage occurs within the extracellular domain of Notch by a gamma secretaseactivity that is dependent on presenilin and is responsible for the release of Notch to the extracellular domain (NICD). The NICD then moves to the nucleus where it is involved in transcriptional regulation (Shih 2007). (Figure adopted from Biocarta Pathway Collections. http://www.biocarta.com/genes/allPathways.asp)

426

Development of Specific Gamma Secretase Inhibitors

the activity of the glycogen synthase kinase 3 (GSK-3) is inhibited. Phosphorylation of beta-catenin induces ubiquitination and proteolytic degradation of beta catenin by the proteasome, while non-phosphorylated beta-catenin is stable and therefore able to enter the nucleus to regulate transcription by activation of genes responsible for cell survival, proliferation and differentiation during development (Hayward et al. 2008). Notch signaling plays an important part in cancer development; consequentially targeting Notch signal steps can have anti-tumor effect. Targeting the gamma secretase is therapeutically important as the gamma secretase is necessary for the activation of all 4 Notch receptors and in many cancers more than 1 Notch homologue is expressed. Recently, the oncogenic potential of Notch has been analyzed in multiple myeloma and, furthermore, it has been discovered that treatment with a specific gamma secretase inhibitor induces apoptosis in myeloma cells via specific inhibition of Notch signaling (Nefedova et al. 2004). This cytotoxic effect can be explained by the upregulation of the proapoptotic protein Noxa. Furthermore, Nefedova et al. could show that pharmacologic inhibition of Notch signaling may enhance the effect of chemotherapy in multiple myelomas via up regulation of Noxa (Nefedova et al. 2008).

Drug development goals One of the most important goals in drug development is the identification of compounds with simultaneous high target affinity and specificity. A comprehensive compound library aims covering the entire chemical space. Very often, putative compounds have high affinity but also affect all structurally similar targets which may lead to undesired adverse effects. Therefore, a balance between affinity and specificity is aspired. Moreover, a specific modulator can be better than an inhibitor with high affinity. Today, many computational methods are available to propose new putative drugs starting from a lead structure. The 2D-similarity search identifies new compounds with higher affinity than the lead structure, but similar specificity, because the results share the same scaffold. To detect scaffold hoppers, structurally or chemically related conformers with deviate folds, the 3D-similarity screening is the method of choice. Another new approach is fragment-based drug design which increases the affinity and combines different specificities of the fragments. The fragmentation of lead structures into smaller pieces has been used to simplify the analysis of ligand binding and to define different pharmacophoric elements necessary for high affinity binding (Hajduk 2007). Nowadays, the pharmaceutical industry holds large libraries of hits from the High Throughput-Screening assays. These medium-affinity hits could be merged to more specific leads exhibiting affinities-improved by orders of magnitude.

Analogy modeling and drug design principle Considering the fact that the gamma secretase has an outstanding role in many diseases like M. Alzheimer or cancer, it is of great medical interest to develop inhibitors or modulators. For structurebased drug design, a 3D-structure of the gamma secretase or even the structure of the catalytic subunit, the presenilin, has to be available. But until now, no crystal structure of the gamma secretase could be determined, which results in difficulties to develop new inhibitors by bioinformatical methods. In the following, it will be described, how different approaches can be combined to a new methodology, called analogy modeling, enabling structure-based drug design without prior knowledge of the target

427

Development of Specific Gamma Secretase Inhibitors

Figure 3. Drug developmental goals. To find new drugs a comprehensive compound library aims in covering the chemical space (a-axis). The goal is to find putative drugs with high specificity (z-axis) and high target affinity (y-axis).The 2D-similarity screening locates new compounds with higher affinity than the lead structure, but identical specificity. The second mountain illustrates a different scaffold, which can be reached by 3D-similarity searching. Another new approach is fragment-based drug design which increases the affinity and combines different specificities of the fragments (highest point of the bridge between the two scaffolds).

structure (Figure 4). The analogy modeling consists of methods like structure prediction, similarity searching by use of 2D - and 3D - screening.

Structure prediction Fold Recognition / Threading The modeling of a structure for the active subunit of the gamma secretase (presenilin) requires a known structure with a similar fold. The fold recognition uses a sequence-based property profile of the target presenilin, which is threaded through all experimentally determined structures from the Protein Data Bank. In this case, the translocon, a transmembrane-protein, was identified to be compatible with the structural requirements. The translocon is a multifunctional complex involved in regulating the interaction of ribosomes with the endoplasmatic reticulum. Furthermore, the translocon is responsible for the correct orientation of membrane proteins (Skach 2007).

428

Development of Specific Gamma Secretase Inhibitors

Figure 4. Analogy modeling of a presenilin inhibitor. The analogy modeling is a combination of different methodologies to create a structure of a target and to determine new compounds for its inhibition. For structure prediction, in case that just a protein with similar structural requirements exists, fold recognition and ligand supported binding site modeling are combined. Different screening methods like 3D- and 2D-similarity search predict new putative compounds starting from a lead structure, which additionally helps to refine the binding pocket of the target. Furthermore, in vitro and in vivo experiments and X-ray and NMR can help to refine and to validate the target structure and the putative compounds. In vitro assays can be used to sort out quickly non-binders etc. X-ray and NMR titration are used to identify and to verify the binding mode of the inhibitors. The result is an optimized target (presenilin) and putative active ligands.

Ligand-Supported Binding Site Modeling A help for the modeling of the binding site was the availability of the crystal structure of the beta secretase. Both enzymes, gamma and beta secretase, have two catalytic aspartate-residues in their binding sites, which are necessary for the catalytic action. The geometry of the catalytic site of the beta secretase was transferred into the structural arrangement of the translocon.

In sil ico screening-similarity search In contrast to the experimental identification of new compounds, the in vivo screening, the searching for compounds by bioinformatical methods is called in silico screening. The experimental procedure to search for new drugs usually involves the labor- and cost-intensive screening of huge libraries of

429

Development of Specific Gamma Secretase Inhibitors

Figure 5. Structure of the presenilin and the translocon. (a) The presenilin is a transmembrane protein with ten helices. (b) A compatible transmembrane protein is the translocon. The figure shows the model of the catalytic subunit of the gamma secretase, which was built according to the suitable part of the translocon. The two aspartate residues of the catalytic site (taken from the beta secretase) are shown as stick representation.

(a)

(b)

chemicals in biological High-Throughput-Screening (HTS). The bioinformatical approach involves the screening of whole libraries as well, but with effective algorithms that enable the researcher to identify compounds with high structural similarity to known effective substances. With this method compounds can be found, that exhibit the same or even higher efficiency but better bioavailability or less toxic effects. Compared to the biological HTS the bioinformatical screening is fast and affordable, even for academic use. For the determination of new drug candidates, the 2D-and 3D-similarity searching are well-established methods. Substances that show high similarity, on both the 2D-and 3D-level, promise to have similar properties compared to the lead structure (Lyne 2002). Therefore, known inhibitors of the gamma secretase were used to search compound databases containing millions of small molecules. Examples for databases with large amounts of compounds are PubChem (http://pubchem.ncbi.nlm. nih.gov/; Lazo et al. 2006), a database of chemical structures of small organic molecules, ‘SuperDrug’ (http://bioinformatics.charite.de/superdrug/; Goede et al. 2005), a conformational drug database or ‘SuperNatural’ (http://bioinformatics.charite.de/supernatural/; Dunkel et al. 2006), a searchable database of available natural compounds.

2D - similarity searching Similarity screening is an established method for identifying structures with a high similarity assuming that this leads to similar properties of the compound. To identify compounds with the desired structures in the databases, which are used for screening, a twofold method has been used. Firstly, the concept of the `structural fingerprint`, a bit vector, which encodes for chemical and topological characteristics of a molecule, was applied. This structural fingerprint has been calculated for the lead structure and finally has been used to search through the databases. Secondly, this molecule was compared to the compounds of the various databases by using the Tanimoto coefficient. This coefficient gives values in the range of

430

Development of Specific Gamma Secretase Inhibitors

zero (no bits in common) to unity (all bits the same). It is also known as the Jacard coefficient and, when used to measure dissimilarity rather than similarity, as the Soergel distance. The Tanimoto coefficient was used in some of the earliest studies of fingerprint-based similarities and is now the coefficient of choice in different software systems for chemical information management (Willett 2006). The Tanimoto coefficient can be calculated as follows: T =

N ab N a + Nb − N ab

where Na is the number of bits set to 1 in compound a, Nb is the number of bits set to 1 in compound b and Nab is the number of bits, which were set to 1 in compound a as well as in compound b. Only compounds with a 2D-similarity > 85% were considered. The 2D-similarity search is usable to sample the chemical space. Of course, the 2D-similarity does not give any information about the spatial similarity of two compounds, but is a valuable tool to recognize chemical similarity. To consider structural similarity, the 3D-similarity searching has been applied, which will be described in the following.

3D - similarity searching To find new scaffold hoppers, the 3D-similarity search has been performed. For the identification of the scaffold hoppers an automated conformer-based 3D-superposition algorithm (Thimm et al. 2004) was used, which already identified new cancer (Fullbeck et al. 2005) and TSE (Lorenzen et al. 2005) directed compounds. The lead structure is compared with all drug-like components and its conformers, which are pre-computed by the MedChemExplorer of Accelrys (Smellie et al. 2003) and stored in a database, which now consists of about 140 million conformers of about four million different compounds. For the comparison, a plane, which represents the x-,y-,z-extensions, is positioned in all small molecules, their conformers and in the lead structure. These cuboids are superimposed with attached centre of mass, which leads to four different possibilities of superimposition. Assignments of atoms, which are close to each other, were superimposed according to W. Kabsch (Kabsch 1976). The last step is the implementation of refinements to optimize the following score: score = (percentage of superimposed atoms) ∙ e-RMSD

Filtering Lipinski Rule-of-Five To make a statement on the bioavailability of a compound, which might be used as a drug, the Lipinski rule-of-five can be comprised. This rule combines properties, which compounds should fulfill to become drug candidates. This rule claims that an orally available drug has:

431

Development of Specific Gamma Secretase Inhibitors

Figure 6. Principle of the 3D superposition for the similarity screening. For the comparison of the lead structure (query) with all small molecules of a database a plane, representing the moments of inertia, is put into all structures and the centre of mass is calculated for the structures. The long and the small sites of the cuboids are superimposed, whereas the centre of mass is attached, which results in four variants of superimpositions. Assignments of atoms, which are nearer than to a particular cut-off, were superimposed according to W. Kabsch (Kabsch 1976). If necessary, further refinements are performed to optimize the score.

1. 2. 3. 4.

Not more than 5 hydrogen bond donors Not more than 10 hydrogen bond acceptors A molecular weight below 500 g/mol A LogP below 5

LogP is a parameter that gives information about the lipophilicity of a molecule and is defined as the logarithm of the 1-octanol/water partition. Compounds, that do not achieve at least four rules of the rule-of-five, do not promise to be a candidate for a drug (Lipinski et al. 2001).

Docking Docking describes the prediction of the positioning of a ligand in the binding pocket of a target to build a complex with lower energy. It represents a fast and efficient possibility to screen molecule libraries for potential ligands of a target molecule. Modern docking tools use different methods for the prediction of possible binding poses of the ligand. Thereto, in a first stage the active site has to be specified by the user or by the docking program itself. Afterwards, different ligand positions will be predicted, which mostly proceeds in two phases. In the first one, the ligand is positioned in the pocket of the target by rotating and translating the ligand into the binding pocket and considering potential interaction partners in the binding site. Beside the rotation and translation of the whole ligand-molecule, the generation of different conformers by performing intramolecular torsions leads to a better fitting of the ligand in the pocket. In the second phase, an energy minimization of the target-ligand-complex is performed and evaluated by a scoring function. To evaluate putative gamma secretase resp. presenilin inhibitors that have been

432

Development of Specific Gamma Secretase Inhibitors

detected by similarity screening, docking is a suitable approach to predict the binding of the ligands. For docking to the gamma secretase, we applied the commercial program Gold (Jones et al. 1997), which bases on a genetic algorithm to explore the full range of ligand conformational flexibility with partial flexibility of the protein. It mimics the process of evolution by applying genetic operators to a collection of putative poses for a single ligand. Gold contains two scoring functions (fitness function in genetic algorithm terminology), the Chemscore and the GoldScore. The Chemscore contains the following terms: hydrogen bonding, metal binding, lipophilic interactions and freezing of rotable bonds. The Chemscore includes additional terms: a covalent energy term, a penalty for steric overlap and ligand torsion terms (Konstantinou-Kirtay et al. 2007). The GoldScore function consists of four components: protein-ligand hydrogen bond energy, protein-ligand Van Der Waals energy, ligand internal Van Der Waals energy and ligand torsional strain energy.

Results During the screening, we were able to identify a structure which is common in all hits. This structure is mostly symmetric and consists of three aromatic rings and, furthermore, a polar and an apolar side (Figure 7). This characteristic structure could be found in all results of the analogy modeling. In Figure 8 the docking of the best fitting structure is depicted. The docking picture visualizes very strikingly the deep binding of the symmetric structure in the pocket of the presenilin. These results of the analogy modeling have been validated in experimental assays. An inhibition could be detected at a concentration of 20µM, furthermore, the gamma secretase inhibitor could successfully be combined with proteasome inhibitors, like bortezomib, to treat efficiently multiple myeloma (Nefedova et al. 2004).

Figure 7. Shared structure of the best screening hits. The screening hits, which were also validated experimentally, hold the same symmetric structure. They consist of three aromatic rings and a polar (R1) and apolar (R2) site. A1 can be, for example, sulfonamide, whereas A2 can be, for example, oxygen, sulphur.

433

Development of Specific Gamma Secretase Inhibitors

Figure 8. Docking of a screening hit into the binding site of the modeled presenilin pocket. The surface of the binding site is shown and a representative of a putative inhibitor is illustrated in stick representation. The Gold-docking result shows that the best screening hits fit into the binding pocket of the presenilin.

Conclusion Finding novel drug candidates is one of the most amazing and challenging aims of bioinformatical studies. Structure-based drug design has become an established part of the pharmaceutical development pipeline. But often, no structural information of the target is available and in these cases the approaches are restricted to similarity screening or library prioritization. Here, we present a successful example, that the huge amount of nearly 50,000 experimentally determined protein structures enables new approaches like analogy modeling, because there are so many protein folds known, that the number of newly detected folds has decreased dramatically. Thus, for most targets, even membrane proteins, it will be possible to detect homologues with known structure or at least proteins with similar fold. The fold recognition or threading, which delivers rather mid-quality models has to be combined with ligandsupported modeling to improve the quality towards structures suitable for docking of putative ligands. The successful testing of the gamma secretase inhibitors proposed using this analogy modeling scheme encourages further studies regarding targets without detailed structural information.

References Biocarta Pathway Collections. http://www.biocarta.com/genes/allPathways.asp Dunkel, M., Fullbeck, M., Neumann, S., & Preissner, R. (2006). SuperNatural: A searchable database of available natural compounds. Nucleic Acids Research, 34, 678-683. Eder, J., Hommel, U., Cumin, F., Martoglio, B., & Gerhartz, B. (2007). Aspartic proteases in drug discovery. Current Pharmaceutical Design, 13, 271-287

434

Development of Specific Gamma Secretase Inhibitors

Fullbeck, M., Huang, M., Dumdey, R., Frommel, C., Dubiel, W., & Preisnner, R. (2005). Novel curcuminand emodin-related compounds identified by in silico 2D/3D conformer screening induce apoptosis in tumor cells. BMC Cancer, 5, 97. Geling, A., Steiner, H., Willem, M., Bally-Cuif, L., & Haass, C. (2002). A gamma-secretase inhibitor blocks notch signaling in vivo and causes a severe neurogenic phenotype in zebrafish. EMBO, 3, 688694. Goede, A., Dunkel, M., Mester, N., Frommel, C., & Preissner, R.. (2005). SuperDrug: A conformational drug database. Bioinformatics, 21(9), 1751-1753. Hajduk P., J., Geer, J., (2007). A decade of fragment-based drug design: Strategic advances and lessons learned. Nature Reviews Drug Discovery, 6, 211-219. Hayward, P., Kalmar, T., Martinez Arias, A. (2008). Wnt/Notch signalling and information processing during development. Development, 135(3), 411-424. Jones, G., Willett, P., Glen, R.C., & Leach, A.R. (1997). Development and validation of a genetic algorithm for flexible docking. Journal of Molecular Biology, 267(3), 727-748. Jundt, F., Anagnostopoulos, I., Förster R., Mathas, S., Stein, H., & Dörken, B. (2002). Activated Notch1 signaling promotes tumor cell proliferation and survival in Hodgkin and anaplastic large cell lymphoma. Blood, 99(9), 3398-3403. Kabsch, W. (1976). A solution for the best rotation to relate two sets of vectors. Acta Crystallographica Section A, 32(5), 922-923. Konstantinou-Kirtay, C., Mitchell, J, & Lumley, J.A. (2007). Scoring functions and enrichment: A case study on Hsp90. BMC Bioinformatics, 8(1), 27. Lazo, J. S. (2006) Roadmap or roadkill: A pharmacologist’s analysis of the NIH Molecular Libraries Initiative. Molecular Interventions, 6, 240-243. Lipinski, C. A., Lombardo, F., Dominy, B.W., & Feeney, P.J. (2001). Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings. Advanced Drug Delivery Reviews, 46(1-3), 3-26. Lorenzen, S., Dunkel, M., & Preissner, R. (2005). In silico screening of drug databases for TSE inhibitors. Biosystems, 80(2), 117-122. Lyne, P. D. (2002). Structure-based virtual screening: An overview. Drug Discovery Today, 7(20), 1047-1055. Nefedova, Y., Cheng, P., Alsina, M., Dalton, W.S., & Gabrilovich, D.I. (2004). Involvement of Notch-1 signaling in bone marrow stroma-mediated de novo drug resistance of myeloma and other malignant lymphoid cell lines. Blood, 103(9), 3503-3510. Nefedova, Y., Sullivan, D, M, Bolick, S.C., Dalton, W.S., & Garilovich, D.I. (2008). Inhibition of Notch signaling induces apoptosis of myeloma cells and enhances sensitivity to chemotherapy. Blood, 111(4), 2220-2229.

435

Development of Specific Gamma Secretase Inhibitors

Shih, I.-M., & Wang, T.L. (2007). Notch Signaling, gamma-Secretase Inhibitors, and Cancer Therapy. Cancer Res, 67(5), 1879-1882. Sinha, S., Anderson, J., P., John, V., McConlogue, L., Basi, G., Thorsett, E., & Schenk, D. (1999). Purification and cloning of amyloid precursor protein beta-secretase from human brain. Nature, 402(6761), 537-540. Skach, W. R. (2007). The expanding role of the ER translocon in membrane protein folding. Journal of Cell Biology, 179(7), 1333-1335. Smellie, A., Stanton, R., Henne, R., & Teig, S. (2003). Conformational analysis by intersection: CONAN. J Computational Chemistry, 24(1), 10-20. Thimm, M., Goede A., Hougardy, S., & Preissner, R. (2004). Comparison of 2-D similarity and 3-D superposition. Application to searching a conformational drug database. Journal of Chemical Information and Computer Science, 44(5), 1816-1822. Tsai, J., Gerstein, M. (2002). Calculations of protein volumes: Sensitivity analysis and parameter database. Bioinformatics, 18, 985-995. Willett, P. (2006). Similarity-based virtual screening using 2D fingerprints. Drug Discovery Today, 11(23-24), 1046-1053. Wrede, P., & Filter, M., (2005) Bioinformatics: From peptides to profiled leads. Biopharmaceuticals VHC-Wiley, Weinheim, 4, 1771-1801 Wolfe, M. S., De Los Angeles, J., Miller, D.D., Xia, W., & Selkoe, D.J. (1999). Are presenilins intramembrane-cleaving proteases? Implications for the molecular mechanism of Alzheimer’s disease. Biochemistry, 38, 11223-11230. Wolfe, M. S. (2001). Gamma-Secretase inhibitors as molecular probes of presenilin function. Journal of Molecular Neuroscience, 17, 199-204. Wolfe, M. S. (2001). Presenilin and gamma-secretase: Structure meets function. Journal of Neurochemistry, 76, 1615-20.

Key Terms AD: Alzheimer Disease is a neurodegenerative disease, which primarily occurs in groups at the age of 65. About 60 percent of all dementia is caused by AD. APP: (Beta-) Amyloid Precursor Protein is an integrale membrane protein, which might be involved in the development of synapses. BACE1: BACE1 is a synonym of the beta secretase, which is an enzyme of the aspartic protease family and cleaves the APP. It is involved in Alzheimer development. GSK-3: Glycogen Synthase Kinase 3 is a serine/threonine protein kinase.

436

Development of Specific Gamma Secretase Inhibitors

HTS: High Throughput Screening is an approach, which involves the screening of large compound libraries, which allows identification of active molecules in experimental (e.g. cell) assays. NMR: Nuclear Magnetic Resonance is a spectrometric method for determination and analysis of structures and dynamics of molecules. RMSD: Root Mean Square Deviation. In this chapter, the rmsd-value reflects the grade of similarity of two structures. TACE: Tumor Necrosis Factor Alpha Converting Enzyme is a metalloprotease which is responsible for the cleavage of Notch outside the membrane TSE: Transmissible Spongiform Encephalopathies, a condition affecting the brain or nervous system of humans and animals. The main hypothesis for TSE is transmission by prions. X-Ray: Electromagnetic radiation, which is also used for crystallography of unknown structures.

Note *

Both authors contributed equally to this work.

437

438

Chapter XXVI

In Machina Systems for the Rational De Novo Peptide Design Paul Wrede Charité Universitaetsmedizin Berlin, Germany

abstract Peptides fulfill many tasks in controlling and regulating cellular functions and are key molecules in systems biology. There is a great demand in science and industry for a fast search of innovative peptide structures. In this chapter we introduce a combination of a computer-based guided search of novel peptides in sequence space with their biological experimental validation. The computer-based search uses an evolutionary algorithm that includes artificial neural networks as fitness function and a mutation operator, called the PepHarvester. Optimization occurs during 100 iterations. This system, called DARWINIZER, is applied in the de novo design of neutralizing peptides against autoantibodies from DCM (dilatative cardiomyopathy) patients. Another approach is the optimization of peptide sequences by an ant colony optimization process. This biologically-oriented system identified several novel weak binding T-cell epitopes.

WHAT MEANS PEPTIDE DESIGN? Peptides regulate and control many cellular processes. Many cell-cell interactions make use of peptide recognition and binding. Peptides serve as hormones like ACTH and vasopressin or intercellular signaling molecules producing only a specific response in target cells after interaction with the cognate receptor. Most receptors bind only a single or a group of closely related molecules. The humoral immune system synthesizes antibodies and the antigen is often a peptide. A successful application of neutralizing antibody binding by de novo designed peptides is described in detail (Schneider, Wrede 1993; Schneider et al. 1998). In contrast the cellular immune system works with peptides as mediators between antigen presenting cells and T-cells. The binding of peptides to the MHC I receptor and the T-cell receptor

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

In Machina Systems for the Rational De Novo Peptide Design

depends on a variety of similar peptide sequences. In the beginning of the nineties a special binding motif described two anchor positions. In the position 2 and 9 a hydrophobic amino acid with a large side chain seems to be important (Rammensee et al. 1995; Lund et al. 2005). Since this pattern seems to be peculiar for MHC I binding peptides it was introduced into a prediction tool called SYFPEITHI (Rammensee 1999). But many recent studies revealed that this pattern is not sufficient for a prediction with high accuracy. Still all available MHC I binding peptide prediction tools have a disappointing reliability (Peters et al. 2006; Filter, Wrede unpublished observations). Often amino acid sequence patterns are not unique although they fulfill the same function meaning occupying the same binding sites of the target molecule. This makes the development of prediction and design tools an extraordinary endeavour. Some solutions to overcome these hindrances are described in the next section. Several other sources describe the combinatorial chemical process of peptide design. This knowledge is also necessary and included into the computer-based rational peptide predictions. But the article here focuses on the computer-based rational peptide design.

BIOINFORMATIC TOOLS FOR THE COMPUTER-AIDED MOLECULAR DESIGN I highlight novel techniques for molecule design especially peptide design and molecular feature extraction, which can be applied when three-dimensional molecular structures are not available. A necessary prerequisite for any rational attempt to identify or even design molecules with a desired property or activity is an accurate model of the underlying sequence- (structure)-activity relationship (SAR). Such SAR models serve as guideline in the search for novel and optimized compounds in evolutionary design cycles which have become possible due to advances in both compound generation and screening technology. It is obvious that the quality of the model determines the success rate of this multi-dimensional design process. Only if a relevant SAR model is used a rational molecular design can be successful (Wrede, Schneider 1994; Schneider, Soo 2003; Wrede, Filter 2006). How can we develop a good SAR model? It is apparent that no cure-all recipe exists, nevertheless some general rules of thumb can be given. One approach is to consider the task as a pattern recognition problem, where three main aspects must be considered: first the data used for generation of a SAR hypothesis should be representative of the particular problem; second the way molecular structures are described for model generation and its level of abstraction must allow for a reasonable solution for the pattern recognition task; and third the model must permit non-linear relationships to be formulated since the interdependence between molecular activities and structural entities is generally non-linear. The first point seems to be trivial but selection of representative data for hypothesis generation is very difficult and often impossible due to a lack of data. The focus here is on the two latter points, namely different levels of data representation and descriptor types, and non-linear feature extraction from a given data set by artificial neural networks (ANN). Various types of ANN are of considerble value for many fields of research, including chemistry, biology, medicine, and pharmaceutical research. Main tasks performed by these systems are: • •

Feature extraction Function estimation and non-linear modeling

439

In Machina Systems for the Rational De Novo Peptide Design

• •

Classification Prediction

For many applications alternative techniques exist (Milne, 1997; Duda et al. 2001); ANN provide, however, a more flexible and elegant approach offering unique solutions to these tasks. The paradigms offered by ANN lie somewhere between purely empirical and ab initio approaches. Neural networks: • • • •

“Learn” from examples and acquire their own “knowledge” (induction) Are able to generalize Provide flexible non-linear models of input/output relationships Are able to cope with noisy data and are fault tolerant (Schneider, Soo, 2003)

Building Blocks of Neural Network Architecture Artificial neural networks consist of two elements, (i) formal neurons, and (ii) connections between the neurons. Neurons are arranged in layers, where at least two layers of neurons (an input layer and an output layer) are required for construction of a neural network. In Fig 1 a network architecture is shown, which is a three-layered network with a single output neuron (Schneider, Wrede, 1998). Supervised artificial neural networks can be applied as function estimators and classificators (Rumelhart et al. 1986; Hertz et al., 1991). They follow the principle of convoluting simple non-linear functions for approximation of complicated input-output relationships what is known as Kolmogorov theorem. The incoming data are transferred to the hidden neuron which includes a sigmoidal activation or transfer function. Such sigmoidal neuron calculates an output value according to: Sigm(input) =

1 , where input = 1 + e −input

ƒwx− i

i

i

Here w is the weight vector connected to the neuron, x is the neuron´s input signal, and ϑ is the neuron´s bias or threshold value. If a single sigmoidal output neuron is used the overall function represented by the fully connected two-layered feed-forward network shown in is:

ƒwx−

f(x) = Sigm(

i

i

)

i

where x is the input vector (data vector). The network shown in Figure 1 with sigmoidal hidden units and a sigmoidal output unit represents a more complicated function:

f ( x) = Sigm(

ƒ j

j Sigm(

ƒw

i , j xi

−

j)−

out

)

i

where w are the input-to-hidden weights, v are the hidden-to-output weights, ϑ are the hidden layer bias values, and ϑout is the output neuron´s bias. The more layers are present in a network the more complicated overall functions can be represented. At most two hidden layers with non-linear neurons are

440

In Machina Systems for the Rational De Novo Peptide Design

Figure 1. Three-layer artificial neural network

Figure 2. A Bongard problem. Patterns of one class must have a common feature. Here class A is characterized by: Two symbols of very similar size but different shape. Now, it is easy to assign the above pattern to the correct class. This problem is analogous to the classification of peptides.

required to approximate arbitary continuous functions (Cybenko, 1989). Depending on the application and the accuracy of approximation the required number of layers and the number of neurons in a layer can vary. There is a rule of thumb that the number of neurons should not be larger than the number of data points in the training set in order to avoid an overdetermined system. The ratio of data points available (training data) and network weights, ρ should be around 2, where ρ= number of training data points / number of weights. Information flow is from left to right. For clarity only a few connections between the nodes or neurons are shown. Neurons are transfer units (sigmoidal transfer function), the output unit is a linear function, details see text. Beside establishing an adaptive system to approximate the sequence-function relation like an artificial neural network data representation is often crucial for feature extraction in noisy sequence data. The coherence of feature extraction and pattern classification is presented in a symbolized model, a Bongard problem (Figure 2). Twelve patterns belong to two equal sized classes A and B. To which class belongs the additional pattern? Have in mind that all patterns of a class must have a common feature. To find this feature a systematic search for descriptors is necessary to solve the problem. One descriptor can be the “colour”. In a heuristic procedure it turns out that the colour is an irrelevant property. The reader is

441

In Machina Systems for the Rational De Novo Peptide Design

Figure 3. The PepHarvester algorithm. Simplified two-dimensional model of the PepHarvester algorithm. In the centre is the seed-peptide. The shells represent the Euclidian distance of a complete peptide from the centre according to a given distance matrix (Table 1). The formula for calculation of the distance of a peptide with the length I is given in the left.

asked to find the correct properties for the descriptors. Anyway descriptor search is often a big hurdle when biological moledcules like peptides have to be classified. For peptides several descriptors like hydrophobicity, side chain volume, and polarity are often a good first choice. There is no general rule for the number of training cycles required but when the output error is minimized below a given threshold, the prediction quality can be determined with an independent test data set.

PEPHARVESTER: GENERATOR FOR FOCUSED PEPTIDE LIBRARIES Some minor modifications are included in this section here from a publication on the PepMaker algorithm, Schneider G, Grunert HP, Schuchhardt J, Wolf K-U, Müller G, Habermehl K-O, Zeichhardt H, Wrede P (1995). For several de novo design projects enough peptide sequence data can be obtained from literature or current experiments to train artificial neural networks. But for many tasks only a single sequence is available. Here the design of peptides to neutralize autoantibody binding is described. ANN or similar pattern classification tools need a sufficient set of data for feature extraction. Sufficient means as many data as possible which include a common feature and being a representative set of all existing sequences. The PepHarvester algorithm can comply with these requirements generating a focused peptide library starting from a single known peptide. The algorithm generates variants stemming from sequence space regions around a so called “seed-peptide” with a unimodal bellshaped distribution. It is assumed that molecules with an improved function can be identified among the peptides located close to the “seed-peptide” in sequence space (Figure 3). This supposition is motivated by a number of observations (Dayhoff and Eck, 1968; Eigen 1971; Grantham 1974, Kimura 1983, Myata et al., 1979, Rao, 1987; Schuster, 1986): 1. In natural evolutionary processes, large alterations of a protein may occur within a generation, but these extremely different mutants rarely survive (low fitness).

442

In Machina Systems for the Rational De Novo Peptide Design

2. 3.

Most observed mutations leading to a slightly improved function are single-site substitutions keeping the vast majority of the sequence unchanged. Conservative replacements tend to prefer substitutions of amino acids which are similar in their intrinsic physicochemical properties.

Therefore, we chose a localized, bell-shaped distribution of variants for construction of a useful peptide library which is thought to approximately reflect these aspects of natural protein evolution. Even peptides spaced far apart from the seed-peptide in sequence space are included. Large sequence alterations can also lead to improved function. This might be the case if, for example, several optima exist in sequence space (Eigen et al. 1988a, 1988b, Fontana et al. 1993; Kauffman, 1993). The methodology is expected to provide an additional technique to generating equally-distributed sets of peptides for screening if one is interested in a peptide with an optimized or analogue function. There are two central problems to be solved: first an appropriate definition must be given for a distance measure in sequence space; second, a procedure must be at hand that allows the calculation of mutation rates for pairwise amino acid exchanges. In the following part we focus on these two tasks in more detail. An application of the method is provided thereafter.

Selection of an Appropriate Amino Acid Distance Matrix is Context Dependent Simple metrics in sequence space are available by amino acid distance maps which are based on relations between the individual amino acid residues. The euclidian distance between the peptides A and A´ of length n serves as a simple distance-measure in the PepHarvester algorithm:

d AÁ =

n

ƒ

2 i

i =1

The euclidian distance evaluates a single large-step point mutation more severely than several smallstep substituions. The distance between two amino acids at sequence position i, δi, is taken from the amino acid distance matrix (Table 1) employed. Several distance maps have been suggested which are based on very different relationships between amino acid residues. There is much evidence that peptides with a similar biological function (similar phenotype) usually have low pairwise distance values, and “fitness” can be regarded as resulting from natural selection (Li and Graur, 1999). Sequences with a high fitness are preferentially selected which is thought to be reflected by a low distance value here. In this simple PepHarvester model peptide “fitness” is determined solely by the amino acid sequence, and all sequence positions are assumed to contribute to the fitness value of a peptide. In peptide design experiments partly based on the strategy described here we found that the matrix of Feng et al. 1985 is a good first choice if nothing is known about the structuring of the corresponding sequence space (Schneider Wrede, 1994). The Feng Matrix (also termed “GS-matrix) takes into account both genetic and structural distances between amino acids (Table 1). The applicability of a particular metric distance and its usefulness for design is context-dependent. Aspects of an amino acid substitution should be considered which are relevant to the local structural environment or particular residue function (Eigen et al. 1988a, 1988b, Taylor 1986). This context boundedness is reflected by the fact that the same amino acid sequence can adopt different structures or perform different functions in different environments (Minor Kim 1994), just as different sequences can

443

In Machina Systems for the Rational De Novo Peptide Design

Table 1. Amino acid distance matrix according to Feng et al. (1985) A C D E F G H I K L M N P Q R S T V W Y

A 0,00 0,67 0,30 0,30 0,67 0,21 0,81 0,81 0,50 0,81 0,67 0,50 0,25 0,60 0,81 0,21 0,21 0,21 0,61 0,81

C 1,00 0,00 0,83 1,00 0,50 0,60 0,81 0,81 1,00 0,81 0,67 0,67 1,00 1,00 0,81 0,36 0,81 0,81 0,50 0,60

D 0,45 0,83 0,00 0,17 0,83 0,36 0,60 1,00 0,50 1,00 1,00 0,17 1,00 0,36 0,81 0,60 0,81 0,60 1,00 0,81

E 0,45 1,00 0,17 0,00 1,00 0,36 0,81 1,00 0,30 1,00 0,83 0,50 0,75 0,36 0,81 0,60 0,60 0,36 0,83 1,00

F 1,00 0,50 0,83 1,00 0,00 1,00 0,81 0,36 1,00 0,36 0,67 0,83 1,00 1,00 1,00 0,60 1,00 0,36 0,50 0,21

G 0,25 0,50 0,30 0,30 0,83 0,00 1,00 0,81 0,67 0,81 0,83 0,50 0,75 0,81 0,60 0,21 0,81 0,36 0,50 0,81

H 1,00 0,67 0,50 0,67 0,67 1,00 0,00 1,00 0,50 0,60 0,83 0,30 0,75 0,36 0,36 0,60 0,81 1,00 0,83 0,60

I 1,00 0,67 0,83 0,83 0,30 0,81 1,00 0,00 0,67 0,21 0,30 0,67 1,00 1,00 0,81 0,81 0,60 0,21 0,61 0,60

K 0,75 1,00 0,50 0,30 1,00 0,81 0,60 0,81 0,00 0,81 0,67 0,30 1,00 0,36 0,21 0,60 0,36 0,60 0,83 1,00

L 1,00 0,67 0,83 0,83 0,30 0,81 0,60 0,21 0,67 0,00 0,17 0,83 0,75 0,81 0,81 0,81 0,81 0,21 0,30 0,60

M 1,00 0,67 1,00 0,83 0,67 1,00 1,00 0,36 0,67 0,21 0,00 0,83 1,00 0,81 0,81 1,00 0,60 0,36 0,50 0,81

N 0,76 0,67 0,17 0,50 0,83 0,60 0,36 0,81 0,30 1,00 0,83 0,00 1,00 0,60 0,81 0,21 0,36 0,81 1,00 0,60

P 0,25 0,67 0,67 0,50 0,67 0,60 0,60 0,81 0,67 0,60 0,67 0,67 0,00 0,60 0,60 0,36 0,36 0,60 0,67 0,81

Q 0,75 0,83 0,30 0,30 0,83 0,81 0,36 1,00 0,30 0,81 0,67 0,50 0,75 0,00 0,60 0,60 0,60 0,81 0,83 0,81

R 1,00 0,67 0,67 0,67 0,83 0,60 0,36 0,81 0,17 0,81 0,67 0,67 0,75 0,60 0,00 0,60 0,60 0,81 0,67 1,00

S 0,25 0,30 0,50 0,50 0,50 0,21 0,60 0,81 0,50 0,81 0,83 0,17 0,45 0,60 0,60 0,00 0,21 0,81 0,67 0,60

T 0,25 0,67 0,67 0,50 0,83 0,81 0,81 0,60 0,30 0,81 0,50 0,30 0,45 0,60 0,60 0,21 0,00 0,60 0,83 0,81

V 0,25 0,67 0,50 0,30 0,30 0,36 1,00 0,21 0,50 0,21 0,30 0,67 0,75 0,81 0,81 0,81 0,60 0,00 0,50 0,60

W 1,00 0,50 1,00 0,83 0,50 0,60 1,00 0,81 0,83 0,36 0,50 1,00 1,00 1,00 0,81 0,81 1,00 0,60 0,00 0,60

Y 1,00 0,50 0,67 0,83 0,17 0,81 0,60 0,60 0,83 0,60 0,67 0,50 1,00 0,81 1,00 0,60 0,81 0,60 0,50 0,00

give rise to similar folds (Laurents et al. 1994). Signal peptides of secretory proteins give examples for sequence feartures largely encoded by physico-chemical properties like “hydrophobicity” or “polarity” (Schneider Wrede, 1993, Schneider Wrede, 1998). Many sterical constraints must be taken into account, for instance, for the design of idealized helical structures (DeGrado Lear 1990). Thus, selection of a useful measure of sequence similarity is crucial for successful application of the PepHarvester algorithm and correctness of the above made assumption concerning the idea of generating variants. In general, short isolated peptides lack a defined tertiary context and, therefore, distance maps constructed from intrinsic amino acid properties or structural propensities might be useful as a guide for the generation of variants. Tertiary context is a major determinant for the design of large polypeptides. The use of evolutionary sequence profiles might provide alternative sequence descriptions taking some tertiary constraints into account. Jones and coworkers described methods for the rapid generation of mutation data matrices from protein sequences which might also be useful for the PepHarvester approach (Jones et al. 1992).

Mutation Rates are Calculated from Amino Acid Distances Mutations leading to conservative replacements and as a consequence to a very similar phenotype are strongly preferred as a result of natural selection. The distance dA,A´ between the two isofunctional variant sequences A and A´ is small provided a sensitive distance matrix is used. The distance dA,A´ per se is different from the rate of mutation rA,A´ and a general rule for converting distances to rates is not at hand. Based on the results of Myata (1979) who investigated variant hemoglobin sequences and the relation between sequence distances and mutation rates, we assume that the rates of observed (accepted) single-site- substitutions A A´ are approximately Gaussian-distributed with respect to sequence distance (Schneider Wrede 1994). The rates of the A A´ transition are based on the probabilities of amino acid substitutions. Observed substitution probabilities P(i->j) for two amino acids i and j result from both natural mutation rates and subsequent selection. Dayhoff and Eck (1968) described a procedure for calculation of observed mutation rates. For the conversion of an amino acid distance matrix to a (non-symmetric) rate

444

In Machina Systems for the Rational De Novo Peptide Design

matrix we have employed a formula where the distance-dependent exchange rate rij is a monotonously decaying function of the distance: ≈ 2 ÷ ∆ d ij ◊ ◊ exp ∆− ∆ 2 2◊ i ◊ ∆   p (i → j ) = ij = ≈ ÷ 2 ∆ d ij ◊ ◊ Σ exp ∆− ∆ 2 2◊ i ◊ ∆  

r

The Gaussian distribution employed in a special bell-shaped distribiution. Probably another monotonously decaying, localized function, for example, exp (-d/σ ) would not essentially change the outcome. σι is a position-specific parameter defining the shape of the Gaussian distribution which may be subjected to time - dependent alterations, for example in simulation experiments. This was taken into consideration since: 1. 2.

Identical single-site substitutions can have very different effects on peptide function, and The rate of change in amino acid sequences has been only approximately constant in the course of evolution (Benner et al. 1994).

For σι ‑> ∞, the value of rij is 0.05 for each amino acid, i.e. all substitutions are equally probable. Small σι values lead to narrow distributions of the exchange rates which is thought to reflect strong selection pressure. The amino acid distance matrix according to Feng et al. (1985) and the rate matrix with σι =0.1 (narrow distribution) were used. Based on the rate matrix, variants of the “seed peptide” are generated.

PEPTIDE DESIGN CYLE INCLUDES IN VITRO SCREENING AND IN MACHINA CALCULATIONS Once a reliable measure for biological peptide function will be established by in vitro, in vivo or ex vivo tests, the sequences together with this information can be employed for training adaptive systems as artificial neural networks. The next step is to model a mathematical function which is more suitable for assigning “fitness” values to each amino acid sequence with a given length, rather than using a simple distance measure as described above. In this manner, the sequence space might be structured in a more subtle way. Based on such heuristics it might be possible to search for new idealized peptides with a certain function. This peptide strategy design will be described in the next section for the design of peptides used in neutralizing autoantibody binding. A similar approach led to the identification of novel organic molecules as modulators for human Kv1.5 Ion channel (Schneider et al., 2000). A possible peptide design cycle which is based on random screening as well as model-based steps is shown in Figure 4. Starting from a “functional peptide” which might have been found by combinatorial screening is varied by a “guided random search” e.g. by the PepHarvester program.

445

In Machina Systems for the Rational De Novo Peptide Design

Figure 4. Peptide design cycle as a combination of in vitro screening and computational techniques

The PepHarvester needs only a single functional peptide to generate a highly enriched focused library. This library is tested and all data are used in the next step to train an artificial neural network. The ANN presents a model or fitness function for a guided search through the sequence space-an algorithm called the DARWINIZER. Then the new peptides generated are tested for their activity in a biological test. The results obtained by these biological tests provide a basis for a model-based search. The data can be fed into an adaptive system e.g. neural network, which will be used to find a mathematical model describing the relation between the amino acid sequence of a peptide and its biological activity. Besides conventional statistics, neural networks provide flexible systems for approximation of mathematical functions and are of growing importance for amino acid sequence analysis. Such mathematical models may serve as a fitness function for subsequent peptide design in machina. We have implemented an efficient evolutionary algorithm for systematic and fast sequence optimization employing a trained artificial network as fitness function. This simulated molecular evolution or DARWINIZER technique suggests an optimized peptide which may either be used directly for in vitro or serve as the “new seed” peptide for the PepHarvester program, thereby initiating a new round of the design cycle. Combinations of rational and irrational design concepts with evolutionary optimization strategies might well provide a basis for efficient and fast design of peptides. Several in vitro tests of peptides optimized with the DARWINIZER were already successful (Wrede et al. 1998). One example of medical importance is described in the next section.

DESIGN OF SYNTHETIC PEPTIDES PREVENTING THE POSITIVE CHRONOTROPIC EFFECT OF AUTOANTIBODIES FROM DCM PATIENT SERA The application of the above proposed rational design cycle lead to a set of novel peptides which prevent the positive chronotropic effect of anti-ß1-adrenoreceptor autoantibodies from the serum of patients suffering from idiopathic dilated cardiomyopathy (DCM), a severe autoimmune disease (Figure 5). Recent studies identified autoantibodies bind to the first and second loop of the ß1-adrenoreceptor leading to the harmful chronic cardiac adrenergic drive under which DCM patients are suggested to be exposed (Cetta,

446

In Machina Systems for the Rational De Novo Peptide Design

Figure 5. A schematic drawing of the ß-adrenergic receptor. A seven spanning membrane protein belonging to the class of GPCR (G-protein coupled receptors). In the loop 2 on the lumenal site binds the autoantibody of DCM patient serum. Epitope mapping identified the antigenic binding site as the ARRCYNDPKC sequence within the loop.

Michels 1995). The design goal is to find short peptides representing the natural epitope sequences which can be used as therapeutical molecules. Searching follows the de novo design cycle described above: The design cycle commences with the a seed peptide. To get a seed peptide the loop 2 sequence region of the ß-adrenergic receptor is fragmented into decamer peptides, which overlap by a step size of 2 residues. These peptide fragments were measured for binding of anti- ß1-adrenoreceptor antibodies by ELISA technique. The highest signal correlated with the amino acid sequence ARRCYNDPKC (positions 107-116). This epitope was already identified as a natural epitope for antibody binding (Wallukat et al. 1995; Mobini et al. 2000) and used here as the seed peptide for generating a focused peptide library with the PepHarvester algorithm. In Figure 6 the activity of 90 peptides were measured by an ELISA assay. Peptides with the closest euclidian distance from the seed peptide in the origin (0.229) give a stronger signal than the seed peptide, dashed line parallel to abcissa. With increasing euclidian distance from the seed peptide a decaying ELISA signal is observed. Two exceptions from the general trend must be mentioned: First there are several peptides in the close neighbourhood of the seed peptide showing a higher activity than the seed. Second peptides even in the further distance are identified with a comparable activity to the seed. The first observation may be an effect of a local hill climbing in the natural fitness landscape. Probably the seed peptide is a member of a suboptimal location rather than a global optimum. The other observation may be some inaccuracy of the distance measurement in the sequence space or several active peptides reside in other local optima of the fitness landscape. Only in vitro experiments can confirm the applicability of the PepHarvester algorithm for constructing focused peptide libraries. The activity of the seed peptide is indicated by the dashed line. Vertical bars indicate the maximal and minimal activity of the peptides found in the distance intervals marked on the x-axis. With increasing distance from the seed peptide the lower the activity as it is expected. Striking is the slightly higher activity of many peptides compared to the seed peptide indicating that other optima exist in sequenceactivity space.

447

In Machina Systems for the Rational De Novo Peptide Design

Figure 6. Activities of peptides measured in an ELISA of the PepHarvester run

In the next step all ELISA measured peptides are used to train an artificial neural network. The idea behind is to construct an artificial fitness landscape i.e. to approximate the sequence – function relation. All tested 91 peptides including the seed peptide were described by two physico-chemical properties per residue: hydrophobicity (Engelman et al.1986) and side-chain volume (Harpaz et al. 1994) which represent 91 20-dimensional pattern vectors. The quality of the network is sufficient for the further design step when the peptide activity is correctly predicted. To get a suggestion about the distribution of the active peptides with an absorbance >103 and inactive peptides with an absorbance 650 nm, and the fact that its tumor-localizing properties were not as pronounced as first thought. These considerations spurred a large effort amongst organic chemists to develop novel PS that could in theory be candidates for mediating PDT. The net result is a collection of probably hundreds of compounds and it can be bewildering to try to choose among them. The characteristics of the ideal PS have been discussed in recent reviews (Abels, 2004, Allison, 2004). They should have low levels of dark toxicity to both humans and experimental animals and low incidence of administrative toxicity (i.e. hypotension or allergic reaction). They should absorb light in the red or far-red wavelengths in order to penetrate tissue (see later). Absorption bands at shorter wavelengths have less tissue penetration and are more likely to lead to skin photosensitivity (the power in sunlight drops off at λ > 600 nm). Absorption bands at high wavelengths (> 800 nm) mean that the photons will not have sufficient energy for the PS triplet state to transfer energy to the ground state oxygen molecule to excite it to the singlet state (see later). They should have relatively high absorption bands (>20,000 -30,000M−1 cm−1) to minimize the dose of PS needed to achieve the desired effect. Synthesis of the PS should be relatively easy and the starting materials readily available to make large scale production feasible. The PS should be a pure compound with a constant composition and a stable shelf life, and be ideally water soluble or soluble in a harmless aqueous solvent mixture. It should not aggregate unduly in biological environments as this reduces its photochemical efficiency. The pharmacokinetic elimination from the patient should be rapid, i.e. less than one day to avoid the necessity for post-treatment protection from light exposure and prolonged skin photosensitivity. A short interval between injection and illumination is desirable to facilitate outpatient treatment that is both patient-friendly and cost-effective. Pain on treatment is undesirable, as PDT does not usually require anesthesia or heavy sedation. Although high PDT activity is thought to be a good thing, it is possible to have excessively powerful PS that are somewhat unforgiving. With limitations in effectiveness of both PS and light dosimetry, highly active PS may easily permit treatment overdosage. It is at present uncertain whether it is better to have a PS ‘‘tailored’’ to a specific indication and to have families or portfolios of PS for various diseases or patient types, or to seek one PS that works against most diseases. Lastly a desirable feature might be to have an inbuilt method of PS dosimetry monitoring and following response to treatment by measuring in vivo fluorescence and its loss by photobleaching. The majority of PS used both clinically and experimentally, are derived from the tetrapyrrole aromatic nucleus found in many naturally occurring pigments such as heme chlorophyll and bacteriochlorophyll. Tetrapyrroles usually have a relatively large absorption band in the region of 400nm known as the Soret band, and a set of progressively smaller absorption bands as the spectrum moves into the red wavelengths known as the Q-bands. Naturally occurring porphyrins are fully conjugated (non-reduced) tetrapyrroles and vary in the number and type of side groups particularly carboxylic acid groups (uroporphyrin has eight, coproporphyrin has four and protoporphyrin has two). Porphyrins have the longest wavelength absorption band in the region of 630-nm and it tends to be small. Chlorins are tetrapyrroles with the double bond in one pyrrole ring reduced. This means that the longest wavelength absorption band shifts to the region of 650-690nm and increases several-fold in height; both these factors are highly desirable for PDT. Bacteriochlorins have two pyrrole rings with reduced double bonds, and this leads to the absorption band shifting even further into the red, and increasing further in magnitude. Bacteriochlorins may turn out to be even more effective PS than chlorins, but with relatively few candidate molecules

591

Photodynamic Therapy

and some questions about the stability of these molecules upon storage this remains to be seen. There are a set of classical chemical derivatives generally obtained from naturally occurring porphyrins and chlorins that include such structures as purpurins, pheophorbides, pyropheophorbides, pheophytins and phorbins some of which have been studied (a few extensively) as PS for PDT. A second widely studied structural group of PS is the phthalocyanines (PC), and to a lesser extent, their related cousins the naphthalocyanines. Again their longest absorption band is in > 650nm and usually has a respectable magnitude. As can be imagined the presence of four phenyl groups (or even worse four naphthyl groups) causes solubility and aggregation problems. PCs are frequently prepared with sulfonic acid groups to provide water solubility and with centrally coordinated metal atoms. It was found that the asymmetrically substituted disulfonic acids acted as the best PS (compared to mono-, symmetrically di-, tri- and tetra-substituted sulfonic acids) in both the zinc (Fingar, 1993) and aluminum (Peng, 1990) series of PC derivatives. Another broad class of potential PS includes completely synthetic, non-naturally-occurring, conjugated pyrrolic ring systems. These comprise such structures as texaphyrins (Sessler, 2000), porphycenes (Stockert, 2007), and sapphyrins (Kral, 2002). A last class of compounds that have been studied as PS are non-tetrapyrrole derived naturally occurring or synthetic dyes. Examples of the first group are hypericin (from St Johns wort) (Agostinis, 2002) and from the second group are toluidine blue O (Stockert, 1996) and Rose Bengal [31]. As yet these compounds have perhaps been more often studied as agents to mediate antimicrobial photoinactivation (Bottiroli, 1997) rather than as PS designed to kill mammalian cells for applications such as cancer.

Photophysics When a PS molecule absorbs a photon of visible light the result is depicted in Figure 1. This is a diagram originally named after the Polish physicist Aleksander Jablonski that graphically illustrates the processes of light absorption and energy transfer that are at the heart of PDT. The ground state PS has two electrons with opposite spins (this is known as singlet state) in the low energy molecular orbital. Following the absorption of light (photons), one of these electrons is boosted into a high-energy orbital but keeps its spin (first excited singlet state). This excited state is a short-lived (nanoseconds) species and can lose its energy by emitting light (fluorescence) or by internal conversion into heat. The fact that most PS are fluorescent has led to the development of sensitive assays to quantify the amount of PS in cells or tissues, and allows in vivo fluorescence imaging in living animals or patients to measure the pharmacokinetics and distribution of the PS. The excited singlet state PS may also undergo the process known as intersystem crossing whereby the spin of the excited electron inverts to form the relatively long-lived (microseconds) excited triplet-state that has electron spins parallel. The long lifetime of the PS triplet state is explained by the fact that the loss of energy by emission of light (phosphorescence) is a ‘‘spin forbidden’’ process as the PS would move directly from a triplet to a singlet-state.

Photochemistry The PS excited triplet can undergo three broad kinds of reactions that are usually known as Type I, Type II and Type III (Figure 2). Firstly, in a Type I reaction, the triplet PS can gain an electron from a neighboring reducing agent. In cells these reducing agents are commonly either NADH or NADPH. The PS is now a radical anion bearing an additional unpaired electron. Alternatively two triplet PS molecules can react together involving electron transfer to produce a pair consisting of a radical cation and a radical

592

Photodynamic Therapy

Figure 1. Jablonsky diagram illustrating absorption of a photon by the ground state singlet photosensitizer, that gives rise to the short-lived excited singlet state. This can lose energy by fluorescence (negligible in case of fullerenes), internal conversion to heat, or by intersystem crossing to the long-lived triplet state. The triplet state can undergo photochemistry as shown in Figure 2.

anion. Radical anions may further react with oxygen with electron transfer to produce reactive oxygen species in particular superoxide anion. In a Type II reaction, the triplet PS can transfer its energy directly to molecular oxygen (itself a triplet in the ground state), to form excited-state singlet oxygen. Both Type I and Type II reactions can occur simultaneously, and the ratio between these processes depends on the type of PS used, the concentrations of substrate and oxygen. A less common pathway is know as Type III and here the triplet state PS reacts directly with a biomolecule thus destroying the PS and damaging the biomolecules. Type III is likely to be oxygen-independent in nature. Type II processes are thought to best conserve the PS molecular structure in a photoactive state and in some circumstances a single PS molecule can generate 10,000 molecules of singlet oxygen. The PS can in some circumstances also react with the singlet oxygen it produces in a process known as oxygen-dependent photobleaching. Type 1 pathways frequently involve initial production of superoxide anion by electron transfer from the triplet PS to molecular oxygen (monovalent reduction) (Bilski, 1993, Ma, 2001). Superoxide is not particularly reactive in biological systems and does not by itself cause much oxidative damage, but can react with itself to produce hydrogen peroxide and oxygen, a reaction known as ‘‘dismutation’’ that can be catalyzed by the enzyme superoxide dismutase (SOD). Hydrogen peroxide is important in biological systems because it can pass readily through cell membranes and cannot be excluded from cells. Hydrogen peroxide is actually necessary for the function of many enzymes, and thus is required (like oxygen itself) for health.

593

Photodynamic Therapy

Figure 2. Schematic representation of the Type I, Type II and Type III photochemical mechanisms thought to operate in PDT.

Superoxide is also important in the production of the highly reactive hydroxyl radical (HO•). In this process, superoxide actually acts as a reducing agent, not as an oxidizing agent. This is because superoxide donates one electron to reduce the metal ions (such as ferric iron or Fe3+) that act as the catalyst to convert hydrogen peroxide (H2O2) into the hydroxyl radical (HO•). This reaction is called the Fenton reaction, and was discovered over a hundred years ago. It is important in biological systems because most cells have some level of iron, copper, or other metals, which can catalyze this reaction. The reduced metal (ferrous iron or Fe2+) then catalyzes the breaking of the oxygen -oxygen bond of hydrogen peroxide to produce a hydroxyl radical (HO•) and a hydroxide ion (HO ). Superoxide can react with the hydroxyl radical (HO•) to form singlet oxygen, or with nitric oxide (NO•) (also a radical) to produce peroxynitrite (OONO•-), another highly reactive oxidizing molecule. Like H2O2, HO• passes easily through membranes and cannot be kept out of cells. Hydroxyl radical damage is ‘‘diffusion ratelimited’’. This highly reactive radical can add to an organic (carbon containing) substrate (represented by R below), this could be, for example, a fatty acid which would form a hydroxylated adduct that is itself a radical. The hydroxyl radical can also oxidize the organic substrate by ‘‘stealing’’ or abstracting an electron from it. The resulting oxidized substrate is again itself a radical, and can react with other molecules in a chain reaction. For example, it could react with ground-state oxygen to produce a peroxyl radical (ROO•). The peroxyl radical again is highly reactive, and can react with another organic substrate in a chain reaction. This type of chain reaction is common in the oxidative damage of fatty acids and other lipids, and demonstrates why radicals such as the hydroxyl radical can cause so much more damage than one might have expected.

594

Photodynamic Therapy

These ROS, together with singlet oxygen produced via Type 2 pathway, are oxidizing agents that can directly react with many biological molecules. Amino acid residues in proteins are important targets that include cysteine, methionine, tyrosine, histidine, and tryptophan (Grune, 2001, Midden, 1992). Due to their reactivity, these amino acids are the primary target of an oxidative attack on proteins. The reaction mechanisms are rather complex and as a rule lead to a number of final products. Cysteine and methionine are oxidized mainly to sulfoxides, histidine yields a thermally unstable endoperoxide, tryptophan reacts by a complicated mechanism to give N-formylkynurenine, tyrosine can undergo phenolic oxidative coupling. Unsaturated lipids typically undergo ene-type reactions to give lipid hydroperoxides (LOOHs derived from phospholipids and cholesterol) (Bachowski, 1994, Girotti, 1985, Girotti, 1983). DNA can be oxidatively damaged at both the nucleic bases (the individual molecules that make up the genetic code) and at the sugars that link the DNA strands by oxidation of the sugar linkages, or cross-linking of DNA to protein (a form of damage particularly difficult for the cell to repair). Although all cells have some capability of repairing oxidative damage to proteins and DNA, excess damage can cause mutations or cell death. Of the four bases in nucleic acids guanine is the most susceptible to oxidation by 1O2. The reaction mechanism has been extensively studied in connection with oxidative cleavage of DNA (Buchko, 1995). The first step is a [4 + 2] cycloaddition to the C-4 and C-8 carbons of the purine ring leading to an unstable endoperoxide (Buchko, 1993). The subsequent complicated sequence of reactions and the final products depend on whether the guanine moiety is bound in an oligonucleotide or a double stranded DNA (Ravanat, 1995). Because of the high reactivity and short half-life of singlet oxygen and hydroxyl radicals, only molecules and structures that are proximal to the area of its production (areas of PS localization) are directly affected by PDT. The half-life of singlet oxygen in biological systems is < 40 ns, and, therefore, the radius of the action of singlet oxygen is of the order of 20nm (Moan, 1991).

Light Delivery In PDT it is important to be able to predict the spatial distribution of light in the target tissue. Light is either scattered or absorbed when it enters tissue and the extent of both processes depends on tissue type and light wavelength. Tissue optics involves measuring the spatial/temporal distribution and the size distribution of tissue structures and their absorption and scattering properties. This is rather involved because the biological tissue is inhomogeneous and the presence of microscopic inhomogenities (macromolecules, cell organelles, organized cell structure, interstitial layers, etc.) makes it turbid. Multiple scattering within a turbid medium leads to spreading of a light beam and loss of directionality. Absorption is largely due to endogenous tissue chromophores such as hemoglobin, myoglobin and cytochromes. Complete characterization light transport in tissue is a formidable task; therefore, heuristic approaches with different levels of approximations have been developed to model it. An effort for modeling light transport also requires accurate values for the optical properties of the tissue. Scattering is generally the most important factor in limiting light penetration into most tissues and is measured by µs (which for soft tissues is in the range 100 -1000 cm-1). Absorption is usually of lesser importance and measured by µa (values in the range of 0.1 -5 cm-1 for most tissue at green and longer wavelengths). The third parameter necessary to define tissue optical properties is the anisotropy factor that measures the direction of scattering of light. It is possible to use mathematical approaches such as diffusion theory or Monte Carlo modeling to predict how light will travel into target tissue and the illumination parameters (fluence, fluence rate, wavelength, angle of incidence) may then be adjusted to maximize the light dose.

595

Photodynamic Therapy

The combination of absorption of lower wavelength light by the important tissue chromophores (oxy and deoxyhemoglobin and melanin) together with reduced light scattering at longer wavelengths and the occurrence of water absorption at wavelengths greater than 1300-nm has led to the concept of the ‘‘optical window’’ in tissue (see Figure 3). In terms of PDT the average effective penetration depth (intensity reduced to 37%) is about 1 -3mm at 630 nm, the wavelength used for clinical treatment with PF, while penetration is approximately twice that at 700 -850nm (Svaasand, 1984, Wilson, 1985). The increased penetration depth of longer wavelength light is a major incentive for the development of PS absorbing at such wavelengths, and a naphthalocyanine (776 nm) (Firey, 1987) and bacteriochlorin (780 nm) (van Leengoed, 1993) fall into this category. The absorption of light by the PS itself can limit tissue light penetration. This phenomenon has been termed ‘‘self-shielding’’ and is particularly pronounced with PS that absorb very strongly at the treatment wavelength (Dougherty, 1991). Many PS are prone to photo-destruction during light exposure; a process called ‘‘photobleaching’’ (Spikes, 1993). This thought to happen when the singlet oxygen or other ROS produced upon illumination reacts with the PS molecule itself in a manner that reduces its efficiency for further photosensitization processes. PS of different chemical structures have widely varying photobleaching rates and in some cases (particularly that of PPIX) the first product of photobleaching is actually a better PS than the starting molecule. Nevertheless photobleaching usually means loss of PDT reactivity but this may still have beneficial effects regarding treatment differential. These are based on the following considerations: there exists a threshold PDT dose to produce tissue necrosis (Grossweiner, 1997). If photobleaching occurs (which does not have such a threshold) before this threshold is achieved, no tissue damage is incurred. This is

Figure 3. Optical window in tissue. Absorption spectra of important tissue chromophores such as water, oxy- and deoxyhemoglobin and melanin are plotted on a logarithmic scale. 100

Optical Window 10

1

water Hb HbO2 Melanin

0.1

0.01

400

600

800

1000

1200

1400

wavelength (nm)

596

1600

1800

2000

Photodynamic Therapy

desirable for normal tissue exposed to therapeutic light but not for the tumor tissue to be treated. Thus, the net result is that one can achieve greater depth of tumor necrosis while sparing the normal skin.

SUBCELLULAR LOCALISATION OF PS PS uptake by cancer or other cells is crucial for effective PDT. ROS have a short half-life and act close to their site of generation, therefore to a certain degree the type of photodamage that occurs in cells loaded with a PS and illuminated depends on the precise subcellular localization of the PS within the cell. The understanding of PS localization principles is therefore important for choosing the most effective PS for each application. Confocal laser scanning fluorescence microscopy has made the determination of intracellular location of PS much easier, and gives more sensitivity and better spatial resolution than earlier non-confocal techniques. Colocalization of subcellular organelle specific probes with differing fluorescence emission maxima to that of the PS can be used to more closely identify the site of localization (Woodburn, 1991) and these probes can also be used to identify sites of damage after illumination (Kessel, 1997). Fluorescence resonance energy transfer (FRET) (Morris, 2003) can also be used to determine intracellular location of PS. Intracellular distributions in cultured cells have been determined for a range of PS with widely differing structures. The important structural features are (a) the net ionic charge, which can range from -4 (anionic) to +4 cationic, (b) the degree of hydrophobicity expressed as the logarithm of the octanol/ water partition coefficient, (c) the degree of asymmetry present in the molecule. PS which are hydrophobic and have two or less negative charges can diffuse across the plasma membrane, and then relocate to other intracellular membranes. These PS also tend to have the greatest uptakes into cells in vitro, especially when present in relatively low concentrations in the medium (2 negative charges tend to be too polar to diffuse across the plasma membrane, and are therefore taken up by endocytosis. Some PS distribute very broadly in various intracellular membranes. An example is pyropheophorbide-a methyl ester that was reported to be localized in endoplasmic reticulum, Golgi apparatus, lysosomes and mitochondria, in NCI-h446 cells (Sun X., 2002b).

Lysosomes In 1993 lysosomes were proposed to be a critical intracellular target for localization of PS (Geze, 1993). However, succeeding studies (Berg, 1994) have found that although lysosomally localized PS can lead to cell killing upon illumination, the relative efficacy is significantly lower than that seen with PS localized in mitochondria and other organelles (MacDonald, 1999). This may be due to the tendency of PS with greater degrees of aggregation to accumulate in lysosomes. Woodburn et al. (Woodburn, 1991) studied intracellular localization, in V79 Chinese hamster lung fibroblasts and C6 glioma cells, of a series of porphyrins derived from HP and PPIX with side chains chemically modified to give hydrophobic and anionic or cationic residues at physiological pH. Compounds were selected to represent all combinations of these characteristics and it was found that those with a net cationic character localized in mitochondria, while those with net anionic character localized in lysosomes. As the anionic porphyrins all carried two negative charges, these results are in accord with previous work suggesting that sensitizers with a net charge of -2 or greater accumulate in lysosomes. Nagata et al. (Nagata, 2003) showed that the chlorin-based PS, ATX-S10 (Na) had a primary site of accumulation in lysosomes but cells underwent

597

Photodynamic Therapy

apoptosis upon illumination doses leading to 70% cell death, suggesting that apoptotic pathways may be activated via mitochondrial destabilization following the damage of lysosomes by PDT. The initial intracellular localization of PS in lysosomes may redistribute due to photodynamic action after only a small amount of light has been delivered. It was found that exposure of cells preincubated with anionic porphyrins, to light doses that inactivated 20% of the cells resulted in relocalization of the sensitizers from the lysosomes to the cytoplasm in general, and, more specifically, the nucleus (Berg, 1991). This behavior was attributed to photodynamic permeabilization of the lysosomal membrane, thus allowing small molecules, including the PS to leak out into the cytoplasm.

Mitochondria Mitochondria have been found to be a very important subcellular target for many PS used in PDT (Morgan, 2001). This is related to the tendency of many PS to produce apoptosis by mitochondrial damage after illumination (see Section 5). Benzoporphyrin derivative (BPD) is one of the well-studied mitochondrial-localized PS (Runnels, 1999), however, cellular localization depends on cell type and BPD formulation (free BPD, liposomal or encapsulated in polycationic liposomes) used [71,72]. Some endothelial cells (ECV304) preferentially accumulated BPD in perinuclear region, others (HUVEC) in cytoplasm; polycationic liposomal BPD was mostly deposited in the mitochondria while free BPD was also found in perinuclear region (Takeuchi, 2003). Two meso-tetraphenylporphyrin derivatives bearing adjacent: 5,10-di[4-N-trimethylaminophenyl]- 15,20-diphenylporphyrin (DADP-a) or opposite: 5,15-di[4-(N-trimethylaminophenyl)-10,20-diphenylporphyrin (DADP-o) cationic-N-(CH3)3+ groups on two of the para-phenyl positions were compared in study by Kessel et al. (Kessel, 2003). DADP-a localized in mitochondria, while DADP-o (a much more symmetric molecule) localized in lysosomes, and led to extensive lysosomal photodamage after irradiation. PS with cationic charges and which are also hydrophobic can localize in mitochondria (Dummin, 1997); this is thought to be due to the influence of the mitochondrial membrane potential as well as the lipid bilayer of the membrane (Rashid, 1990). It is known that carcinoma cell mitochondria preferentially accumulate and retain certain cationic dyes to a much greater extent than most normal cells. Oseroff et al. (Oseroff, 1986) evaluated 10 rhodamine and cyanine dyes as carcinoma-specific mitochondrial PS in vitro. The most effective, N,N-bis(2-ethyl1,3- dioxolane)kryptocyanine, caused marked, light dependent killing of human bladder, squamous, and colon carcinoma cell lines after 30-min incubations at 1 -0.01 µM but was minimally toxic to human keratinocytes and to normal monkey kidney epithelial cells. Dummin et al. (Dummin, 1997) prepared cationic zinc (II) phthalocyanines with lipophilic side-chains and showed they specifically accumulated in the inner mitochondrial membranes. On irradiation of the incubated HeLa cells, the cristae were affected and finally completely destroyed. The respiration stopped and the energy metabolism was shut down. It was known previously that Pc4 localized in mitochondria and Golgi complexes and ER (Trivedi, 2000). At early times (0 -1 h) after introduction of Pc 4 to LY-R cells, the dye was found in the mitochondria, lysosomes and Golgi apparatus, as well as other cytoplasmic membranes, but not in the plasma membrane or the nucleus. Over the next 2 h, there was some loss of Pc 4 from the lysosomes but an accumulation in the Golgi apparatus and the mitochondria. The exact binding site of Pc4 was discovered only recently. Pc 4-PDT photodamaged Bcl-2 and Bcl-xL, antiapoptotic proteins interacting with the permeability transition pore complex that forms at contact sites between the inner and outer mitochondrial membranes. These complexes and the inner membrane are unique in containing the phospholipid cardiolipin. Nonyl-acridine orange (NAO) is a specific probe of cardiolipin and Morris et

598

Photodynamic Therapy

al. (Morris, 2003) showed evidence for fluorescence resonance energy transfer from NAO to Pc 4, thus defining an intracellular binding site for the PS.

Plasma Membrane Compounds that localize in plasma membranes of cultured cells are relatively uncommon in the PDT field. Aveline and Redmond (Aveline, 1999) used confocal fluorescence microscopy to show that deuteroporphyrin IX (DP) and its monobromo and dibromo derivatives localized preferentially in the plasma membrane of L1210 cells. PF shows a dynamic distribution in human carcinoma cells: the plasma membranes are the main target sites of PF after a brief (3 h) incubation, while the Golgi complex is affected after prolonged (24 h) incubation (Hsieh, 2003). The effects of PDT on cells with plasma membrane-localized PF was found to be a cessation of proliferation post PDT at Photofrin dose less than 7 µg/ml, and at higher dose (28 µg/ml) plasma membrane disruption and cell swelling were observed immediately after PDT. Characteristics typical of apoptosis such as phosphatidylserine externalization and DNA fragmentation were not detected in the cell death process caused by this PDT regime.

Golgi Apparatus and Endoplasmic Reticulum Teiten et al. (Teiten, 2003) studied Foscan subcellular localization in the MCF-7 human adenocarcinoma cell line by means of confocal microscopy and microspectrofluorometry. The fluorescence topographic profiles recorded after cells co-stained with Foscan and organelle-specific fluorescent probes revealed that Foscan presents low localization in lysosomes and a weak accumulation in mitochondria. However, the Foscan fluorescence topographic profile turned out to co-localize perfectly with that obtained for the endoplasmic reticulum (ER) and the Golgi apparatus. The patterns of fluorescence derived from confocal microscopy studies were consistent with predominant localization of Foscan in these organelles. Furthermore, evaluation of enzymatic activity of selected organelles immediately after laser light irradiation (650 nm) indicated the Golgi apparatus and ER as the primary damaged sites resulting from Foscan-mediated PDT in the MCF-7 cell line.

ALA-Induced PPIX Recently there has been much interest in a different approach to PDT where, instead of the PS being administered in a pre-synthesized form, a metabolic precursor is administered and the PS is synthesized in situ in tumors or cells of the target tissue (Peng, 1997). The precursor is 5-aminolevulinic acid (ALA) which interacts with the heme biosynthetic pathway as shown in Figure 4. Almost all types of cells of the human body, with the exception of mature red blood cells, are equipped with this metabolic machinery. In the first step of the pathway ALA is formed from glycine and succinyl CoA. The synthesis of ALA by ALA-synthetase is under feedback regulation by the amount of heme in the cell. The last step in the pathway is incorporation of iron into PPIX catalyzed by the enzyme ferrochelatase and this is rate limiting. By adding exogenous ALA, the feedback inhibition is bypassed, and PPIX will accumulate because of the limited capacity of ferrochelatase to transform PPIX to heme. PPIX is formed in the mitochondria of cells, but rapidly diffuses to other intracellular membrane sites. Gaullier et al. (Gaullier, 1995) found early staining in mitochondria but at later time points the plasma

599

Photodynamic Therapy

Figure 4. ALA-induced PPIX. Schematic diagram illustrating the interaction of the heme biosynthesis pathway with exogenous ALA to give intracellular PPIX. Abbreviations are ALA-D: ALA dehydratase; ALA-S: ALA synthetase; Coprogen III: coproporphyrinogen III; CPO: coproporphyrinogen oxidase; FCH: ferrochelatase; HMB: hydroxymethylbilane, PBG-D: porphobilinogren deaminase; protogen III: protoporphyrinogen; PPO: protoporphyrinogen oxidase; Urogen III: uroporphyrinogen III; UCS: uroporphyrinogen cosynthase, UGD: uroporphyrinogen decarboxylase.

membrane showed strong staining, and fluorescent spots (shown to be lysosomes by co-localization experiments with lysosomal probes) were observed within the cytoplasm especially in the perinuclear region. Fluorescence spectra suggested that the PPIX microenvironments were quite different at short and long incubation times. In vivo the ALA may be administered orally (van den Boogert, 1998), intravenously (Svanberg, 1996), or topically (Calzavara-Pinton, 1995). The reasons why cancer cells tend to synthesize more PPIX than normal cells, has been much investigated. Hypotheses include greater expression of heme biosynthesis enzymes, porphobilinogen deaminase (Gibson, 1998), coproporphyrinogen oxidase (Ortel, 1998), or reduced expression of ferrochelatase (Van Hillegersberg, 1992), but increased delivery of ALA to the tumor may play a role especially in topical application (Szeimies, 1994). Recent attempts to increase the efficacy of ALA-mediated PDT include the use of iron chelators to decrease the amount of PPIX converted to heme by ferrochelatase by removing the free iron that is the necessary for the enzyme to work (Curnow, 1998). Another approach is to administer ALA as one of various alkyl esters (methyl, pentyl, hexyl or benzyl) in order to increase cellular uptake by making the molecule more lipophilic (Fotinos, 2006). Since ALA is frequently applied topically to the skin, the ALA methyl ester that penetrates through the skin’s natural permeability barrier much better than the polar ALA, recently received approval to treat basal cell skin cancers (Lehmann, 2007).

CELL PATHWAYS ACTIVATED BY PDT One of the largest areas of research in the field of mechanisms in PDT in recent years has paralleled the explosion of knowledge in cell biology about signal transduction pathways, transcription factors and

600

Photodynamic Therapy

regulation of cell cycle control, inflammation and cell death. Figure 5 gives a graphical representation of some of these signal transduction pathways activated by PDT.

Calcium PDT of various cell types in vitro has been shown to raise the levels of free calcium within cells and this has been associated with cell death, and in certain occasions and conditions, with cell survival. The Ca2+ rise upon PDT has been proposed to occur via the influx of Ca2+ through ion channels (Joshi, 1994, Penning, 1992), release of Ca2+ sequestered in internal stores in the endoplasmic reticulum (ER) and mitochondria (Hubmer, 1996), and/or activation of ion exchange mechanisms (Specht, 1991). Exposure of Chinese hamster ovary (CHO) cells and T24 human bladder transitional carcinoma cells treated with the PS aluminum phthalocyanine (Alps) and respectively to red light caused an immediate increase of cytoplasmic free calcium, [Ca2+]i, reaching a peak within 5 -15 min after exposure and then returning to basal level (approximately 200 nM) (Penning, 1992). Loading the cells with the intracellular calcium chelators, quin2 or BAPTA prior to light exposure, enhanced cell killing. This indicates that increased [Ca2+]i, caused by extracellular Ca2+ influx after PDT, contributed to survivability of the treated cells by triggering a cellular rescue response. Ding et al. (Ding, 2004) showed that PDT with hematoporphyrin monomethyl ether (HMME)induced cell death by apoptosis and necrosis and using sodium azide (the singlet oxygen quencher) or d-mannitol (the hydroxyl radical scavenger) they could protect HeLa cells from the death. Sodium azide or d-mannitol also inhibited HMME-PDT-mediated [Ca2+]i elevation. Cytochrome c release from mitochondria into cytosol, and caspase 3 activation after HMME-PDT were inhibited by BAPTA/AM (an intracellular calcium chelator). These results demonstrated that ROS generated in HeLa cells by HMME-PDT-induced apoptosis may be through [Ca2+]i elevation which mediates cytochrome c release and caspase 3 activation and initiates the apoptosis. The effects of aminolevulinic acid (ALA)-PDT (induction with 1mM ALA for 4 h followed by a blue light dose of 18 J/cm 2) were studied (Grebenova, 2003) on the human promyelocytic leukemia cell

Figure 5. Signal transduction pathways activated after PDT. Events occur at receptors located at the plasma membrane and lead to alterations in cellular metabolism. These may tend towards increasing apoptosis or increasing cell survival.

601

Photodynamic Therapy

line HL60 using biochemical and electron microscopy methods. It was seen that ALA-PDT activates the mitochondrial apoptotic pathway and the level of endoplasmic reticulum Ca2+-binding chaperones ERp57 and ERp72 and of anti-apoptotic proteins Bcl-2 and Bcl-xL was decreased whereas that of Ca2+binding protein calmodulin and the stress protein HSP60 was elevated following ALA-PDT. Inhibition of the initiator caspase 9, execution caspase 3 and Ca2+-dependent protease m-calpain, did not prevent DNA fragmentation. PDT using the photosensitizer benzoporphyrin derivative (BPD) has been previously shown to induce rapid apoptosis via a mitochondrial-caspase activation pathway. Granville et al. (Granville, 2001) analyzed the impact of PDT on other cellular organelles such as the endoplasmic reticulum (ER). The effect of PDT on [Ca2+]i in control and Bcl-2-overexpressing HeLa cells was assessed. A greater [Ca2+]i transient was observed for Bcl-2 overexpressing cells in response to PDT. The PDT-induced Ca2+ release was due to the emptying of Ca2+ from ER and possibly mitochondrial stores and was not due to an influx of Ca2+ from the medium. Studying PDT effects in cell cultures of rat bladder epithelial cells for the hydrophilic tetrasulfonated aluminum phthalocyanine (AlPcS4) and using confocal microscopy, Ruck et al. (Ruck, 2000) showed transient calcium elevation during the irradiation process, especially in the cell nuclei, followed by a more sustained increase. The activation of the membrane-localized enzymes phospholipase C (PLC) and phospholipase A2 (PLA2) is a very early event in the induction of PDT-induced apoptosis because intracellular Ca2+ acts as a second messenger in cellular signaling in response to a wide range of stimuli and may link activation of PLA2 to activation of PLC. PLC hydrolyzes phosphatidyl inositol-4,5-diphosphate after activation and subsequently produces inositol-3-phosphate (IP3) and diacylglycerol (DAG). It is known that DAG activates protein kinase C (PKC) and that IP3 promotes increases in intracellular Ca2+ (Berridge, 1984). Ca2+ binds to calmodulin in cells, which therefore acts as an intermediary protein that senses calcium levels and relays signals to various calcium-sensitive enzymes, ion channels and other proteins. This frequently happens via a complex with a second protein calcineurin. Once the complex is formed, Ca2+/calmodulin/calcineurin can in turn act to dephosphorylate the transcription factor ‘nuclear factor of activated T cells’ (NFAT). Activated NFAT can regulate transcription through binding its own cognate DNA-binding site. One marker of keratinocyte differentiation, the p21 gene, is activated by NFAT by a different mechanism, with NFAT activating the p21 promoter by acting as a coactivator for the transcription factors Sp1 and Sp3 (Santini, 2001). In general, it is possible to think that Ca2+ is a link between many of the pathways activated by PDT and plays an important role in the effect PDT has on many cellular functions.

Lipid Metabolism As discussed in the previous section, PDT can lead to rapid changes in intracellular Ca2+ and there are many interconnected pathways between Ca2+ and lipid metabolism largely due to the activation of phospholipases. The rapid release of arachidonic acid metabolites seen in many cases after PDT (Agarwal, 1993, Henderson, 1989, Penning, 1993) may result from the activation of PLA2, an enzyme activated by Ca2+. Penning et al. (Penning, 1993) found that HPD-PDT of human bladder cancer cells led to release of prostaglandin E2 (PGE2) and thromboxane B2 (TBX2), and this was reduced by calcium chelation with EGTA resulting in inhibition of PLA2, or by using indomethacin to inhibit cyclooxygenase. These treatments also increased the cell death suggesting that arachidonic acid metabolism can protect cells from PDT killing. Nevertheless, the role of cyclooxygenases in PDT may depend on the cell type and/or

602

Photodynamic Therapy

the PDT dose, since preincubation of C6 glioma cells with indomethacin increased the number of cells surviving after PDT with HPD, whereas the survival rate for endothelial cells was decreased in the presence of the inhibitor when higher HPD concentrations were used (Foultier, 1992). Fingar et al. (Fingar, 1990) showed that there was a PDT dose-dependent increase in serum thromboxane after Photofrin (PF)-mediated PDT of rats bearing chondrosarcoma tumors. These authors went on to show (Fingar, 1993) that a thromboxane synthetase inhibitor, a thromboxane receptor antagonist and an inhibitor of platelet shape change in combination with PF-PDT reduced vasoconstriction, inhibited vessel permeability and reduced tumor cure. Ferrario et al. (Ferrario, 2002) showed that both porphyrin- and chlorine-based PS were able to elicit PDT-mediated cyclooxygenase-2 (COX-2) expression after PDT in vitro and in vivo. COX-2 (but not COX-1) mRNA and protein levels were increased in radiation-induced fibrosarcoma (RIF-1), BA (mouse mammary carcinoma), LLC (Lewis lung carcinoma) cells and in RIF1 tumors in mice together with release of PGE2 after PF-PDT. These authors also combined PDT with the selective COX-2 inhibitor NS-398 in RIF-1 tumors and demonstrated enhanced PDT responsiveness and decreased induction of both PGE2 and vascular endothelial growth factor in treated tumors. Ceramide is a stress-induced second messenger that is generated from sphingophospholipids (which are part of the cell membrane) by sphingomyelinases. These enzymes cleave sphingophospholipids such as sphingomyelin to yield ceramide and phosphorylcholine, and in addition ceramide can be generated by de novo synthesis by a ceramide synthase (Bektas, 2004, Yang, 2004). The sphingolipid ceramide has proven to be a powerful second-signal effector molecule that regulates diverse cellular processes including apoptosis, cell senescence, the cell cycle, and cellular differentiation. Ceramide has been shown to activate a number of enzymes involved in stress signaling cascades including both protein kinases and protein phosphatases (Separovic, 1998). Dolgachev et al. (Dolgachev, 2004) showed that the oxidative stress induced by phthalocyanine (Pc4)-PDT in Jurkat human T lymphoma and CHO cells was accompanied by increases in ceramide with a concomitant decrease in sphingomyelin. Sphingomyelin synthase, as well as glucosylceramide synthase, was inactivated in a dose-dependent manner and the activity of serine palmitoyltransferase (the enzyme catalyzing the initial step in the sphingolipid biosynthesis) was profoundly inhibited after treatment. Niemann- Pick disease lymphoblasts, which are deficient in acid sphingomyelinase (ASMase) activity, failed to respond to Pc4-PDT with ceramide accumulation and apoptosis, suggesting that ASMase may be a Pc4-PDT target (Separovic, 1999). However, this finding appears to be cell-type specific because in mouse embryonic fibroblasts isolated from ASMase knockout and wild-type mice Pc4-PDT led to increased caspase 3 activity and subsequent apoptosis in both cells (Chiu, 2000). Similarly, ceramide levels were elevated in both cell types post-PDT.

Tyrosine Kinases Signal transduction networks provide mechanisms for cells to receive external stimuli and respond to the signals in an appropriate manner. The mutagen activated protein kinase (MAPK) signaling pathways play an important role in signal transduction in eukaryotic cells, where they modulate many cellular events including: mutagen-induced cell cycle progression through the G1 phase, regulation of embryonic development, cell movement and apoptosis, as well as cell and neuronal differentiation (Murray, 1998). These evolutionarily conserved pathways are organized in ‘‘three-kinase modules’’ consisting of a MAP kinase, an activator of MAP kinase (MAP kinase kinase or MEK) and a MAP kinase kinase kinase (MEK kinase or MEKK). There are at least three distinct MAP kinase signal transduction pathways in mammalian cells, each named after the particular MAPK associated with it. These include the

603

Photodynamic Therapy

extracellular signal-regulated kinases, ERK1/2, the c-Jun N-terminal kinases/stress-activated protein kinases (JNK/SAPK) and the p38 kinases (analogs of HOG1 yeast protein). MAPK family activation following BPD-PDT was found in a transformed murine keratinocyte cell line, Pam212 (Tao, 1996). PDT caused a strong dose- and time-dependent activation of both SAPK and p38 HOG1 but not ERK. Both l-histidine and N-acetyl- cysteine showed a significant inhibitory effect on PDT-induced SAPK and p38 HOG1 activation indicating the effect was partially mediated by reactive oxygen intermediates (ROI). Western blot analysis performed on the proteins of LY-R and CHO cells at various times following lethal (90-99% cell kill) doses of Pc4-PDT found of the three MAPK types, only the p46 and p54 SAPK/JNKs were activated (Xue L., 1999). PDT did not affect ERK and p38/HOG activation in LY-R cells. In the case of CHO cells, however, ERK2 was slightly activated at 5 min post-PDT, then declined, and p38/HOG was strongly activated from 5 to 60 min post-PDT. This study suggests that PDT can stimulate SAPK and p38/HOG cascades and that the latter participates in both rapid and slow PDT-induced apoptosis. Hypericin-PDT of human cancer cells led to upregulation of the inducible COX-2 enzyme and the subsequent release of PGE2 (Hendrickx, 2003). The activation of p38 MAPK alpha and beta mediated COX-2 upregulation at the protein and messenger levels. The p38 MAPK inhibitor, PD169316, abrogated COX-2 expression in PDT-treated cells, whereas overexpression of the drug-resistant PD169316-insensitive p38 MAPK alpha and beta isoforms restored COX-2 levels in the presence of the kinase inhibitor. The half-life of the COX-2 messenger was drastically shortened by p38 MAPK inhibition in transcriptionally arrested cells, suggesting that p38 MAPK mainly acts by stabilizing the COX-2 transcript. Hence, the combination of PDT with pyridinyl imidazole inhibitors of p38 MAPK may improve the therapeutic efficacy of PDT by blocking COX-2 up-regulation, which contributes to tumor growth by the release of growth and pro-angiogenic factors, as well as by sensitizing cancer cells to apoptosis. The role of ERKs in the cell survival after PDT was studied by Tong et al. (Tong, 2002). They examined the response of ERK1/2 in PF-PDT-resistant (LFS087) and PDT-sensitive (GM38A) cells. ERK1/2 activity was induced rapidly in both cell types after PDT but was transient in GM38A cells and by 3 h had returned to a level significant lower than basal levels, whereas the induction of ERK1/2 was sustained in LFS087 cells and lasted for at least 11 h. Blocking of the sustained ERK activity with PD98059, an inhibitor of MAPK/ERK significantly decreased cell survival of LFS087 after PDT. PDT also induced the expression of MAPK phosphatase (MKP-1). ALA-PDT of HaCaT cells led to a six-fold elevation of cellular JNK activity; phosphorylation of p38 MAPK was enhanced to a similar extent. p38 was also phosphorylated by ALA-PDT in the human melanoma cell lines Bro and SkMel-23, applying doses that lead to 80 -95% cell death after 24 h. The effects of ALA-PDT on MAPKs are similar to stresses such as UV irradiation or exposure to hydrogen peroxide with respect to activation of JNK and p38 MAPKs (Klotz, 1998). The epidermal growth factor receptor (EGFR) is a tyrosine kinase involved in the initiation and progression of various cancers especially their proliferative, angiogenic, invasive, and metastatic aspects (Castillo, 2004). Wong et al. (Wong, 2003) used ALA- and PFPDT on human cancer cell lines: hypopharyngeal carcinoma FaDu; cervical adenocarcinoma HeLa; and hepatocellular carcinoma HepG2, and studied the cells response to cytokines, IL-6 and EGF, after PDT. PDT-induced the complete loss of EGFR on the cells membrane. Another study reported (Ahmad, 2001) the involvement of the EGFR-pathway during antiproliferative responses of Pc4-PDT in A431 cells and during ablation of murine skin papillomas. Pc4-PDT of A431 cells was found to result in a time-dependent down-modulation of the protein expression and

604

Photodynamic Therapy

phosphorylation of EGFR and Shc (an immediate downstream molecule in EGFR-pathway). In chemically as well as ultraviolet B radiation-induced squamous papillomas in SENCAR and SKH-1 hairless mice, Pc4-PDT resulted in a time-dependent: inhibition of protein expressions of EGFR; and tyrosine phosphorylation of EGFR and Shc; and induction of apoptosis, during the regression of these tumors. JNK are group of MAPK comprising three protein kinases: JNK1, JNK2, and JNK3, whose genes are alternatively spliced to create 10 isoforms. JNK binds and phosphorylates the N-terminal activation domain of transcription factor c-Jun, resulting in increased transcription activity of c-Jun. JNK1 and JNK2 are ubiquitously expressed, whereas JNK3 is restricted to brain, heart, and testis. JNK can be activated by treatment of cells with cytokines tumor necrosis factor-α (TNF-α) and interleukin 1 (IL-1) or by exposure of cells to a wide variety of environmental stresses (Nakano, 2004). A study (Assefa, 1999) reported that PDT with hypericin induced a strong and persistent activation of the JNK and p38 MAPK signaling pathways while inhibiting ERK2 activity. There was a protective role for the JNK/p38 MAPK pathways during PDT-induced apoptosis. Protein kinase B (Akt/PKB) itself is a serine/ threonine protein kinase and phosphorylates a variety of substrates involved in regulation of key cellular functions such as growth control and survival. Akt/ PKB can phosphorylate ATM, and ATM can phosphorylate BRCA1 and p53, and has also been suggested to interact with DNA mismatch repair proteins. Akt/PKB is thought to mediate various insulindependent biological processes (Scheid, 2003). The distinct functions of individual Akt/PKB isoforms still remain to be fully elucidated. Photosensitization of the murine fibroblast cell line NIH 3T3 with Rose Bengal (RB) increased the phosphorylation of Akt, which is taken as a sign of kinase activation (Zhuang, 2003). This effect was mediated by activation of PI3- K, but was independent of activation of growth factor receptors and of focal adhesion kinase (FAK). Indeed, photosensitization with RB decreased FAK phosphorylation activity, which may explain the reduction in cell adhesion. The effects of singlet oxygen on ERK and Akt/PKB pathways were analyzed in human dermal fibroblasts (Schieke, 2004). While basal ERK phosphorylation was lowered in cells exposed to either UVA or RB-PDT, Akt was moderately activated by PDT in a phosphoinositide 3-kinase-dependent fashion. Likewise, both singlet oxygen and UVA-induced ceramide generation in human skin fibroblasts. Epidermal growth factor (EGF)-induced tyrosine phosphorylation of the EGF receptor was strongly attenuated by PDT but unimpaired by C2-ceramide.

Transcription Factors Transcription factors are proteins that bind to the enhancer or promoter regions of genes and interact such that transcription occurs from only a small group of promoters in any cell. Most transcription factors can bind to specific DNA sequences, and these trans-regulatory proteins can be grouped together in families based on similarities in structure. Within such a family, proteins share a common framework structure in their respective DNA binding sites, and slight differences in the amino acids at the binding site can alter the sequence of the DNA to which it binds. Transcription factors act as intracellular ‘‘third messengers’’ that couple receptor-generated signals to activation-associated changes in gene expression, often forming large transcriptional complexes with a variety of other transcription factors and accessory proteins at response elements within the promoters of the genes the transcription of which they modulate. Activator protein-1 (AP-1) is a homo- or heterodimeric protein complex composed of the products from the proto-oncogenes c-jun and c-fos or related family members. The association between c-jun

605

Photodynamic Therapy

and c-fos is required for binding to DNA and involves a structural motif known as a leucine zipper. Hydrophobic interactions between leucines located every 7th amino acid in an alpha-helix region of each sub-unit, hold the two sub-units together. AP1 binds to DNA sequences (transcription response elements) in the promoter region of many genes, which are involved in regulating cell proliferation. AP1 transcription factors are activated by a variety of physical and chemical stresses and have been related to both induction and prevention of apoptosis, depending on the tissue and on its developmental stage (Shaulian, 2002). Gomer’s laboratory (Luna, 1994) studied the PDT-mediated induction of the early response genes, c-fos, c-jun, c-myc, and egr-1, in murine RIF-1 cells. Incubation of exponentially growing cells with porphyrin based PS in the dark also induced an increase in mRNA levels of early response genes. Nevertheless, the xanthine PS RB, produced increased c-fos mRNA levels only following illumination. PDT with PF also increased transiently c-jun, c-myc and egr-1 mRNA in human adenocarcinoma HeLa cells (Kick, 1996). Furthermore, mRNA stability experiments showed an increased half-life of c-fos and c-jun transcripts in HeLa cells sensitized with PF, and a concomitant increase in AP-1-DNA-binding activity was also observed. The AP-1 pathway was found to be responsible for the rapid increase of IL-6 expression observed after PDT (Kick, 1995) Using the spontaneous transformed murine keratinocyte cell line, Pam212, it was shown that PDT with BPD could induce a time- and dosedependent activation of stress-activated protein kinase (SAPK) and p38 high osmolarity glycerol protein kinase (p38 HOG1) (Tao, 1996). SAPK and p38 HOG1 pathways are implicated in the transduction of stress signals and stimulation by inflammatory cytokines and are responsive to stimuli such as TNF-α, IL-1, UV irradiation, heat, change in osmolarity, and increase in intracellular reactive oxygen species (ROS). Stress kinases can induce activation of AP-1, and possibly a related transcription factor AP-2, thus enabling ROS-mediated gene expression. Depending on the pattern of gene expression induced, cellular responses may range from inflammation, degradation and immmunosuppression to triggering of apoptosis. The transcription factor, nuclear factor kappa B, (NF-κB) was initially discovered as a factor in the nucleus of B cells that binds to the enhancer of the kappa light chain of immunoglobulin NF-κB is present in the cytoplasm as homo- or heterodimers, formed by association of sub-units belonging to the Rel protein family. These complexes are sequestered in the cytoplasm by proteins belonging to the inhibitor of NF-κB (IκB) family. Stimuli leading to NF-κB activation typically initiate a specific signal transduction cascade leading to phosphorylation of IκBs. Once phosphorylated, IκB is selectively ubiquitinated and degraded by the 26S proteosome, releasing NF-κB that is then translocated to the nucleus where it participates in transcriptional activation. NF-κB has been linked to the regulation of many cellular genes including those encoding a number of cytokines and growth factors such as IL-1, IL-2, IL-6, IL-8, granulocyte macrophage colony stimulating factor (GM-CSF), and TNF-α. Other genes include adhesion molecules such as intracellular adhesion molecule, E-selectin, and many other proteins involved in various processes, including immune responses, acute phase reaction and inflammation such as inducible nitric oxidase synthase. Activation of NF-κB upon photosensitization was first shown in studies using mouse leukemia L1210 cells and PF as a sensitizer (Ryter, 1993). PDT of the lymphocytic ACH-2 cell line with methylene blue led to the degradation of IκBa and increased NF-κB DNA-binding activity [60] and similar results were found using proflavine (a PS that intercalates into DNA) that did not cause AP-1 activation (Piret, 1995). The activation of NF-κB and its role in cell death upon PDT was investigated using the PS pyropheophorbide methyl ester (PPME) in HCT-116 human colon carcinoma cells which resulted in NF-κB activation by triggering the signaling pathway mediated by the IL-1 receptor. This involved degradation of the cytoplasmic IκBa pool that contributed

606

Photodynamic Therapy

to the increase in NF-κB DNA binding (Matroule, 1999). NF-κB activation also occurred in human ECV 304 and HMEC-1 endothelial cells after PDT with PPME and this was prevented by antioxidants. The activation of NF-κB was proposed to occur by a mechanism independent of the activation of IκB kinases and required the activity of a tyrosine kinase (Volanti, 2002)]. NF-κB has been shown to either promote or inhibit apoptosis, depending on the cell type and the type of inducer (Kucharczak, 2003). Apoptosis and NF-κB activation was observed with verteporfin PDT in HL60 cells as shown by transient transfection with a NF-κB-luciferase reporter construct (Granville, 2000). However, less intensive PDT regimens can also affect NF-κB, increasing the antiapoptotic mechanisms of survival. E2F is a transcription factor that controls the transition from G1 to S phase in the cell cycle. The induced genes encode DNA replication activities such as DNA polymerase, proliferating cell nuclear antigen, nucleotide biosynthetic activities including thymidine kinase, thymidylate synthase and ribonucleotide reductase, and cell cycle regulatory activities (Bracken, 2004). E2F also directs the synthesis of both cyclin E and cyclin-dependent kinase 2 (cdk2), creating the kinase activity responsible for activation of replication (Stevens, 2003). The retinoblastoma (Rb) gene was initially identified as a genetic locus associated with the development of an inherited eye tumor and the realization that it was a loss of function of Rb that was associated with disease established the tumor suppressor paradigm. Subsequent work identified the E2F transcription factor activity as a key target for the growth suppressing action of the Rb protein. Additional work demonstrated that Rb function, including the ability to interact with E2F, was regulated by phosphorylation and that the primary kinase responsible was the D-type cyclin-dependent kinases. Studies have shown (Ahmad, 1998) that Pc4-PDT results in an induction of the cyclin kinase inhibitor WAF1/CIP1/p21 which, by inhibiting cyclins (E and D1), cdk2 and cdk6, results in a G0/G1-phase arrest followed by apoptosis in human epidermoid carcinoma cells A431. This group went on to show a decrease in the hyper-phosphorylated form of pRb at 3, 6 and 12 h post-PDT with a relative increase in hypo-phosphorylated pRb, which provided evidence for the involvement of pRb-E2F/DP machinery in PDT-mediated cell cycle arrest leading to apoptosis (Ahmad, 1999). Upregulation in WAF1/CIP1/p21 protein levels was also observed upon PDT of human ovarian carcinoma (OVCAR-3)-bearing athymic nude mice with Pc4 (Colussi, 1999) but not in SW480 colon cancer xenografts subjected to PDT with the same PS suggesting that this mechanism is tumor-type dependent (Whitacre, 2000).

Cell Adhesion Mammalian cells adhere to the extracellular matrix and to each other through specific membrane protein receptors. These are classified into the following groups: integrins, immunoglobulin G superfamily, selectins and cadherins. Integrins are ubiquitous trans-membrane adhesion molecules that mediate the interaction of cells with the extracellular matrix and also control cell-cell interactions. Recent research indicates that integrins also function as signal transduction receptors triggering a number of intracellular signaling pathways that regulate cell behavior and development (Hynes, 2002). The selectins mediate transient interactions between leukocytes and endothelial cells or blood platelets. There are three members of the selectin family: L-selectin, which is expressed on leukocytes; E-selectin, which is expressed on endothelial cells; and P-selectin, which is expressed on platelets. The selectins recognize cell surface carbohydrates. One of their critical roles is to initiate the interactions between leukocytes and endothelial cells during the migration of leukocytes from the circulation to sites of tissue inflammation. The selectins mediate the initial adhesion of leukocytes to endothelial cells (Patel, 2002). This

607

Photodynamic Therapy

is followed by the formation of more stable adhesion complexes, in which integrins on the surface of leukocytes bind to ICAMs, which are members of the Ig superfamily expressed on the surface of endothelial cells. The firmly attached leukocytes are then able to penetrate the walls of capillaries and enter the underlying tissue by migrating between endothelial cells. Other members of the Ig superfamily mediate homophilic interactions that lead to selective adhesion between cells of the same type. There are more than 100 members of the Ig superfamily, which mediate a variety of cell-cell interactions. The fourth group of cell adhesion molecules, the cadherins, also displays homophilic-binding specificities. They are not only involved in selective adhesion between embryonic cells but are also primarily responsible for the formation of stable junctions between cells in tissues. For example, E-cadherin is expressed on epithelial cells and homophilic interactions between E-cadherins lead to the selective adhesion of epithelial cells to one another; during cancer progression, however, E-cadherin mediated adhesion is frequently lost (Cavallaro, 2004). Other members of the cadherin family mediate selective adhesion of other cell types (George, 2004). The alterations in the attachment of cancer cells to the substratum and each other are amongst important consequences of PDT. These changes are largely caused by the damage of adhesion molecules located in cell membranes. Several adhesion molecules have been reported to be involved in the PDT response, however specific molecular pathways depend on cell line, fluence rate and PS used (Ball, 2001). BPD-PDT mediated changes in adhesive properties of cells were studied by several groups. Decreased adhesion to collagen IV, fibronectin, laminin and vitronectin, as well as loss of β1 integrin-containing focal adhesion plaques were detected in ovarian cancer cells (Runnels, 1999). A decreased expression of CD44V6, its lectins (aHt1.3, PNA, SNA) and MHC-I molecules were observed in colon cancer (Rousset, 1999). In the later case BPD- and HPD-mediated PDT were compared, however no difference was detected. Vonarx et al. (Vonarx, 1995) investigated the effect of HPD-PDT on colon cancer cells with a difference in vivo metastatic potential. HPD-PDT increased the adhesiveness rate of both cell lines on plastic and decreased it on extracellular matrix, which correlated with decreased metastatic potential. ALA-PDT of human adenocarcinoma (WiDr) cells inhibited the attachment of suspended cells to a plastic substratum. It also induced the increase of intracellular space in dense colonies, formation of lamellipodia between the cells and redistribution of αVβ3 integrin. The distribution of another adhesion molecule, E-cadherin was not changed under these conditions [81]. Pyridinium zinc (II) phthalocyanine and polyhaematoporphyrin were found to significantly decrease the efficiency of trypsinization of RIF-1, HT29 human colonic carcinoma, and ECV304 human umbilical vein endothelial cells adhering to plastic when PDT was carried out (Ball, 2001). Meta-tetrahydroxyphenylchlorin (mTHPC, Foscan) however did not show this effect. This observation was partly explained by an increased activity of the enzyme tissue-transglutaminase in the cells. Similar results were reported by Uzdensky et al. (Uzdensky, 2004) who showed that sublethal PDT of human WiDr adenocarcinoma cells and D54Mg glioblastoma cells with ALA-PPIX or disulfonated tetraphenylporphyrin (TPPS2a) inhibited their trypsin-induced detachment from a plastic substratum. Studies discussed above show that PDT-induced changes in adhesion could lead to a decrease of tumor metastatic potential. However, in one report BPD-mediated PDT of orthotopic rat prostate cancer increased the level of metastasis (Momma, 1998)]. The adhesion changes induced by PDT are different for cancer and normal cells and their substrates. Neutrophil adhesion to endothelial cells is enhanced by PF-PDT with alphaL-, alphaM- or alphaX-_2 receptors of the neutrophils involved in this process (de Vree, 1996). Platelet adhesion to the extracellular matrix and fibrinogen was significantly decreased after PDT of these substrates, however PDT of collagen resulted in significantly increased platelet adhe-

608

Photodynamic Therapy

sion, with large aggregate formation (Fungaloi, 2002). Volanti et al. (Volanti, 2004) used pyropheophorbide-a methyl ester (PPME) to induce the expression of ICAM-1 and vascular cell adhesion molecule (VCAM)- 1 via activation of NF-κB in HMEC-1 cells. Increased ICAM-1 and VCAM-1 expression at the protein level was not observed, although IL-6 was secreted. Using specific chemical inhibitors, they showed that the lack of ICAM-1 and VCAM-1 expression was the consequence of their degradation by lysosomal proteases. The proteosome and calpain pathways were not involved. All these observations were consistent with the fact that no adhesion of granulocytes was observed in these conditions.

Cytokines Cytokines are small-secreted proteins, which mediate and regulate immunity, inflammation, and hematopoiesis. They must be produced de novo in response to a stimulus. They generally (although not always) act over short distances and short time spans and at very low concentration. They act by binding to specific membrane receptors, which then signal the cell via second messengers, often tyrosine kinases, to alter its behavior (gene expression). Responses to cytokines include increasing or decreasing expression of membrane proteins (including cytokine receptors), proliferation, and secretion of effector molecules. The vascular effect that causes hemorrhagic tumor necrosis after PDT, was originally thought to be mediated by TNF-α as administration of this cytokine had been shown to cause similar vascular effects and direct tumor effect in mouse models. The first description of cytokine production by PDT was reported by Evans et al., (Evans, 1990) who measured the energy-dependent production of TNF-α by macrophages treated with PDT using the L929 assay, and TNF-α production was inhibited at the highest PDT doses. TNF-α gene transcription increased in keratinocytes treated with Pc4 and light (Anderson, 1997), and photodynamic activation of the monocyte cell line U937 differentiated into macrophages with mTHPC, also induced a dose-dependent production of TNF-α (Coutier, 1999). However, although anti-TNF-α antibodies and pentoxifylline, an inhibitor of cytokine transcription, prevented cutaneous photosensitivity in adult C3H/HeN mice injected with Pc4, none of these agents affected Pc4 PDT-induced tumor (RIF-1) regression (Coutier, 1999). PF can induce immune responses in the absence of light; a research group compared its effect with PPIX and showed these porphyrins produced lymphocyte proliferation and secretion of IL-2, IL-3, TNF-α and interferon γ (IFNγ), by human or murine mononuclear cells without any activating light (Herman, 1996). Combined stimulation of cells by mitogens and porphyrins maintained optimal vital ionic balance of potassium, sodium and chlorine in the lymphocytes. In the cells, thus, treated, there was a significant increase in intracellular calcium, important for lymphokine secretion. They proposed that the effect of PF on the immune system involves enhanced cytokine secretion, which may account for the subsequent tumor eradication by PDT (Herman, 1996). Treating LLC cells with mono-l-aspartyl chlorine e6 (NPe6) and light increased expression of the mRNA of IL-2, IL-6, and TNF-α 6 h later. Cytokine gene- transfected cells, namely LLC-IL-2, LLC-IL-6, and LLC-TNF-αcells were then treated with PDT. IL10 gene transfected LLC-IL-6 cells were significantly more sensitive and showed higher levels of apoptosis than the parent LLC cells and other cytokine gene-transfected cells, demonstrating that IL-6 expression plays a role in cellular sensitivity to PDT (Usuda, 2001). The effects of PDT on the activity of the IL-10 gene promoter and on IL-10 mRNA stability was studied using the murine keratinocyte line, Pam212 (Gollnick, 2001). In vitro PDT-induced IL-10 mRNA and protein expression from Pam212 cells, which was correlated with an increase in AP-1 DNA-binding activity and activation of the IL-10 gene promoter by PDT. Deletion of an AP-1 response element from

609

Photodynamic Therapy

the IL-10 gene promoter was shown to abrogate the PDT-induced promoter activity indicating that the AP-1 response element is critical to IL-10 induction by PDT. In addition, PDT resulted in an increase in IL-10 mRNA stability, which may also contribute to the increased IL-10 expression in Pam212 cells following PDT (Gollnick, 2001). Neutrophils have become recognized as important contributors to the effectiveness of tumor eradication by PDT. The ability of PDT using the PS 2-[1-hexyloxyethyl]-2-devinyl pyropheophorbide-a (HPPH) to induce proinflammatory cytokines and chemokines, as well as adhesion molecules known to be involved in neutrophil migration, was examined in mice. In this study the researchers found that HPPH-PDT induced neutrophil migration into the treated tumor, which was associated with a transient, local increase in the expression of macrophage inflammatory protein (MIP)-2 (the murine equivalent of IL-8). A similar increase was detected in functional expression of adhesion molecules, i.e. E-selectin and ICAM-1, and both local and systemic expression of IL-6 was detected. The kinetics of neutrophil immigration mirrored those observed for the enhanced production of chemokines, IL-6 and adhesion molecules. Subsequent studies showed that PDT-induced neutrophil recruitment is dependent upon the presence of MIP-2 and E-selectin, but not on IL-6 (Gollnick, 2003). Cecic et al. used a mouse SCCVII squamous cell carcinoma model to investigate the activity of neutrophils in tumors treated by PDT (Cecic, 2001). They saw a massive and sustained sequestration of these cells in PDT-treated tumors but also revealed their activated state evidenced by the presence of released myeloperoxidase. Among the adhesion molecules expressed on tumor vascular endothelium, ICAM-1 appears to be of primary importance in the invasion of neutrophils into PDT-treated tumors, because its functional blocking with monoclonal antibodies reduced the tumor cure rate. A marked upregulation of its ligands CD11b/CD18 and CD11c/CD18 found on neutrophils associated with PDT-treated tumors supports this assumption. IL-1β activity was critical for the therapeutic outcome, since its neutralization diminished the cure rates of PDT-treated tumors. No significant effect was observed with anti-IL-6 and anti-TNF-α treatment (Sun J., 2002a). In a BALB/c mouse model, PDT delivered to normal and tumor tissue in vivo caused marked changes in the expression of cytokines IL-6 and IL-10 but not TNF-α. IL-6 mRNA and protein were strongly enhanced in the PDT-treated EMT6 tumor. PDT also increased IL-6 mRNA in exposed spleen and skin. These data suggest that the general inflammatory response to PDT may be mediated at least in part by IL-6. In addition, IL-6 may modulate the local antitumor immune response. In contrast, IL-10 mRNA in the tumor decreases following PDT. IL-10 is markedly induced in the skin of mice exposed to a PDT regime and it plays a role in the observed suppression of cell-mediated responses seen following PDT (Gollnick, 1997). PF-based PDT of mouse EMT6 tumors induces neutrophilia. In addition to complement fragments (direct mediators) released as a consequence of PDT-induced complement activation, there are many secondary mediators that all arise as a result of complement activity: IL-1β, TNF-α, IL-6, IL- 10, G-CSF and KC, thromboxane, prostaglandins, leukotrienes, histamine, and coagulation factors (Cecic, 2002). PDT-induced cytokines have been measured in patients. IFNγ, IL-1β, IL-2, and TNF-α were assayed for in the urine of four patients treated with PDT for bladder cancer, in seven control patients undergoing transurethral surgical procedures, and in five healthy control subjects. Quantifiable concentrations of all cytokines, except gamma interferon were measured in urine samples from the PDT patients with the highest light energies, while no urinary cytokines were found in the PDT patient who received the lowest light energy nor in any of the control subjects (Nseyo, 1990). Serum samples from patients treated on a Phase I clinical trial of PDT for mesothelioma were examined at the maximally tolerated dose of

610

Photodynamic Therapy

Foscan for evidence of a cytokine-mediated inflammatory response. Patients underwent pleurectomy or extrapleural pneumonectomy followed by intraoperative PDT of the thorax. IFNγ, TNF-α and IL-12 showed no elevation, but IL-1β, IL-6, IL-8 and IL-10 levels were elevated after surgery and PDT. IL-1β showed a statistically significant variation from baseline after surgery and IL-6, after PDT. The results suggest a systemically mediated inflammatory response resulting from thoracic surgery followed by PDT (Yom, 2003).

Hypoxia and Angiogenesis Tumor hypoxia is associated with malignant progression; resistance to chemotherapy, PDT and radiotherapy; increased metastasis and poor prognosis. Many of these effects in hypoxic tumor cells are mediated by oxygen-regulated transcriptional activation of a specific set of genes whose relation to therapy resistance is only poorly understood. The hypoxia-inducible factor (HIF)-1 is a master transcriptional activator of oxygen-regulated genes, which are involved in anaerobic energy metabolism, angiogenesis, cell survival, cell invasion, and drug resistance. HIF-1 is a heterodimer composed two sub-units HIF-1α bound to HIF-1α, but whereas the latter sub-unit is constitutively expressed, HIF-1α is rapidly degraded under normoxic conditions (Semenza, 2004). Hypoxia stabilizes HIF-1α, allowing the formation of the transcriptionally active HIF-1 complex, which binds to the hypoxia response element found in the promoter region of specific genes, including the vascular endothelial growth factor (VEGF) gene (Mazure, 2004). HIF-1 is a positive factor for tumor growth and is constitutively upregulated in several tumor types (Yeo, 2004). Because PDT is capable of rapidly consuming significant amounts of tissue oxygen and also shutting down the blood supply to the tumor that delivers oxygen, the treatment may itself produce severe levels of hypoxia. The possibility of PDT producing an angiogenic response in which new blood vessel formation occurs was first observed in 1989 (Benstead, 1989). The tails of mice injected with meso-tetra (sulphonatophenyl) porphine and illuminated showed an increase in number of blood vessels at a low light dose but not at a dose that led to widespread necrosis. Deininger et al. (Deininger, 2002) used Western blotting to analyze secretion of regulators of angiogenesis to the supernatants of cell lines following Hypocrellin-A and -B PDT. Both proangiogenic factors (VEGF) and antiangiogenic factors (sFlt-1, angiostatin, p43, allograft inflammatory factor-1, and connective tissue growth factor) were detected. PF-mediated PDT-induced expression of the HIF-1α sub-unit of the heterodimeric HIF-1 transcription factor and also increased protein levels of the HIF- 1 target gene, VEGF within treated transplantable BA mouse mammary carcinoma (Ferrario, 2000). PDT treatment of BA tumor cells grown in culture resulted in a small increase in VEGF expression above basal levels, indicating that PDT-mediated hypoxia and oxidative stress could both be involved in the overexpression of VEGF. Tumor-bearing mice treated with combined antiangiogenic therapy (IM862 or EMAPII) and PDT had improved tumoricidal responses compared with individual treatments. This study showed that PDTinduced VEGF expression in tumors decrease when either the antiangiogenic compounds IM862 or EMAP-II was included in the PDT treatment protocol and suggested that combination procedures using antiangiogenic treatments could improve the therapeutic effectiveness of PDT. A synthetic inhibitor of matrix metalloproteinases (MMP), Prinomastat, also increased the percentage of long-term cures after PDT with PF (Ferrario, 2004). PDT increased the expression and activation of MMP-1, -3, -8 and -9 in BA tumors subjected to PDT with PF, and also changed the expression of MMP regulators. Jiang et al. (Jiang, 2004) studied angiogenesis produced in normal rat brains by PF PDT. Angiogenesis induced by

611

Photodynamic Therapy

PDT in normal rat brains. VEGF expression increased within the PDT-treated hemisphere 1 week after treatment and remained elevated for 6 weeks. Three-dimensional morphologic analysis of vasculature within PDT-treated and contralateral brain demonstrated PDT-induced angiogenesis that continued for 4 weeks after PDT. Similar studies found increased VEGF expression also of PCNA (a marker of proliferation) in tumor vessels of mice bearing NR-S1 squamous cell carcinomas up to 2 days post-PDT (Uehara, 2001). Hypoxia-induced genes have been studied in human tumors treated with PDT. PF-mediated PDT induced expression of HIF-1α sub-unit of the heterodimeric HIF-1 transcription factor and its target gene, VEGF, within tumors from patients receiving PF-PDT for early-stage esophageal cancers. High HIF-1α expression was associated with a poor response to treatment (Koukourakis, 2001b).

MECHANISMS OF CELL DEATH IN PDT Although PDT can mediate many signaling events in cells, its main purpose as generally employed is nevertheless to kill undesirable and especially cancerous cells. Recent research has elucidated many pathways whereby mammalian cells can die, and some of the ways that PDT can initiate these processes. The concentration, physicochemical properties and subcellular location of the PS, the concentration of oxygen, the appropriate wavelength and intensity of the light, and the cell type specific properties may all influence the mode and extent of cell death (see Figure 6).

Modes of Cell Death Kerr was the first in 1972 to provide evidence (Kerr, 1972) that cells may undergo at least two distinct types of cell death: The first type is known as necrosis, a violent and quick form of degeneration affecting extensive cell populations, characterized by cytoplasm swelling, destruction of organelles and disruption of the plasma membrane, leading to the release of intracellular contents and inflammation. Necrosis has been referred to as accidental cell death, caused by physical or chemical damage and has generally been considered an unprogrammed process. It is characterized by a pyknotic nucleus, cytoplasmic swelling, and progressive disintegration of cytoplasmic membranes, all of which lead to cellular fragmentation and release of material into the extracellular compartment. In necrosis, decomposition is principally mediated by proteolytic activity, but the precise identities of proteases and their substrates are poorly known. A different type of cell death was termed apoptosis, identified in single cells usually surrounded by healthy-looking neighbors, and characterized by cell shrinkage, blebbing of the plasma membrane, the organelles and plasma membrane retain their integrity for quite a long period. In vitro, apoptotic cells are ultimately fragmented into multiple membrane-enclosed spherical vesicles. In vivo, these apoptotic bodies are scavenged by phagocytes, inflammation is prevented, and cells die in ‘immunological control’ of necrosis resides within or outside cells. Apoptosis, requires transcriptional activation of specific genes, include the activation of endonucleases, consequent DNA degradation into oligonucleosomal fragments, and activation of caspases. Since these first descriptions of necrosis and apoptosis, it has become evident that the situation is somewhat more complicated with alternative modes of cell death being described. These include mitotic cell death (Castedo, 2004), cells exhibit multiple aberrations including retardation at G (2)-M, increased cell volume, and multinucleation; programmed necrosis (Bizik, 2004), involving the processes

612

Photodynamic Therapy

Figure 6. Cellular signaling pathways leading to apoptosis in cells after PDT. Initial targets of PDTgenerated ROS depend on PS localization and include mitochondria, lysosomes, endoplasmic reticulum, plasma membrane and PS binding to Bcl-2.

of induction, commitment, and execution of necrosis triggered solely by the biological stimulus induced by three-dimensional arrangement of the culture, the cysteine cathepsin-(cathepsins B or L) mediated lysosomal death pathway (Leist, 2001), and autophagic cell death (Yu, 2004), in which a normal function used to degrade components of the cytoplasm is involved and which is characterized by autophagosomes, autolysosomes, electron-dense membranous autophagic vacuoles, myelin whorls, multivesicular bodies, as well as engulfment of entire organelles. Caspases are intracellular endopeptidases that employ cysteine at the active site and cleave their targets at aspartic acid residues. The caspases are synthesized as zymogens and these precursors are converted into active enzymes via oligomerization-induced autoprocessing for initiator caspases (nos. 1, 2, 4, 5, 8, 9, 10 and 14) while effector caspases (nos. 3, 6 and 7) are activated by other proteases, including initiator caspases and enzyme B (Shi, 2004a). Proteolytic cleavage of cellular substrates by effector caspases determines the features of apoptotic cell death (Shi, 2004b) and can be initiated by three different pathways involving caspase 8 (death receptor activation), the endoplasmic reticulum stress pathway involving activation of caspase 12, and the mitochondrial pathway, in which release of proteins (including cytochrome c) by mitochondria into the cytoplasm leads to activation of caspase 9 and downstream cleavage of caspase 3, 7 or 6. Effector caspases cleave and inactivate proteins that protect

613

Photodynamic Therapy

living cells from apoptosis, such as the DNA repair protein, poly(ADP-ribose) polymerase, ICAD/DFF45 (inhibitor of caspase-activated DNase, the nuclease responsible for DNA fragmentation), or the antiapoptotic Bcl-2 or Bid (a Bcl-2 homolog), which then promotes apoptosis via the mitochondria. At least 18 Bcl-2 proteins have been isolated with either pro- or anti-apoptotic activity (Martinou, 2001). The antiapoptotic members (such as Bcl- 2 and Bcl-xL) prevent the release of cyto c from the mitochondria and the subsequent procaspase activation. Caspases can be activated by an intrinsic pathway, triggered by various environmental insults and developmental programs, which occurs in mitochondria (Green, 1998). It involves release of cytochrome c and other apoptogenic proteins from the mitochondrial intermembrane space into the cytosol. Cytosolic cyto c acts as a cofactor in the formation of a complex with Apaf-1, procaspase 9, dATP/ATP termed the apoptosome that leads to the activation of caspase 9 and subsequent activation of executioner caspases and cell death commitment. A mechanism has been described in which caspase 8 (activated by ligation of death receptors) cleaves Bid (a BH3 only member of the Bcl-2 family) leading to mitochondrial release of cytochrome c and thence to activation of procaspase 9 and thereby amplifying apoptotic signaling (Bossy-Wetzel, 1999). There have been recent suggestions that non-caspase proteases such as leukocyte elastase inhibitor (LEI)-DNase II (Torriglia, 2000) can trigger a form of programmed cell death different from the traditional pathways of apoptosis.

Apoptosis and Necrosis after PDT Because of the intense interest involving cell death mechanisms, workers in the field of PDT have looked at the occurrence of apoptosis and necrosis both in vitro and in vivo (Agostinis, 2004). Figure 6 illustrates some of the cellular and molecular signaling pathways that have been determined to occur in cells treated with PDT in vitro. Agarwal et al. were the first to report apoptosis after PDT with chloroaluminum phthalocyanine in mouse lymphoma L5178Y cells, and found a rapid induction of apoptosis mediated by phospholipase C activation (Agarwal, 1991). The crucial factors in determining the type of cell death (e.g. apoptosis or necrosis) that occurs after PDT are: cell type, the subcellular localization of the PS; and the light dose applied to activate it locally. In general, it is believed that lower dose PDT leads to more apoptosis, while higher doses lead to proportionately more necrosis (Plaetzer, 2002). Nagata et al. (Nagata, 2003) used the amphiphilic PS ATX-S10(Na) and human malignant melanoma cells and found that light doses that led to less than 70% cytotoxicity induced mainly apoptosis; by contrast, most cells appeared necrotic with doses that induced 99% cytotoxicity. A common feature of the apoptotic program initiated by PDT is the rapid release of mitochondrial cytochrome c into the cytosol followed by activation of the apoptosome and procaspase 3. With PS localized in the plasma membrane, the photosensitization process can rapidly switch the balance towards necrotic cell death likely due to loss of plasma membrane integrity and rapid depletion of intracellular ATP (Kessel, 2000). It is also possible that high doses of PDT can photochemically inactivate essential enzymes and other components of the apoptotic cascade such as caspases. For instance, Lavie et al. (Lavie, 1999) used the perylenequinones (hypericin and dimethyl tetrahydroxyhelianthrone) and found high dose PDT inhibited apoptosis by interfering with lamin phosphorylation, or by photodynamic cross-linking of lamins. Oleinick’s laboratory (Xue L. Y., 2001) compared Pc4-mediated PDT of MCF7 cells that lack caspase 3 with the same cell line with caspase 3 transfected back in. They found apoptotic indicators only in the caspase expressing cells which also showed more loss of viability by an assay involving reduction of a tetrazolium dye; however both cell lines showed an equal degree of cytotoxicity by a clonogenic assay. Pc4 is a PS that localizes in intracellular membranes, especially mitochondria. Pc4-PDT photodamages

614

Photodynamic Therapy

Bcl-2 and Bcl-xL that are antiapoptotic proteins interacting with the permeability transition pore complex that forms at contact sites between the inner and outer mitochondrial membranes (Morris, 2003). These complexes and the inner membrane are distinctive in containing the phospholipid, cardiolipin and it is suggested that Pc4 resides near cardiolipin-containing sites, which are primarily on the inner mitochondrial membrane (Kessel, 1999) and the consequent photodamage of Bcl-2 and Bcl-xL explains the induction of apoptosis by this PS. The importance of Bcl-2 as a target of PDT was emphasized in the study by Usada et al. (Usuda, 2003), who used transfection of wild-type Bcl-2 or certain deletion mutants in either a transient or a stable mode. Overexpression of Bcl-2 decreased apoptosis and cell death, and inhibited the activation-associated conformational change of the proapoptotic protein Bax, and higher doses of Pc4 and light were required to activate Bax in cells expressing high levels of Bcl-2. Treatment with BPD (verteporfin) and broad spectrum fluorescent light rapidly produced apoptosis in murine P815 mastocytoma cells (Granville, 1998). Fragmentation of DNA, a fundamental characteristic of cells undergoing apoptosis, was evident within 3 h following the PDT. Western immunoblot analysis using the specific antiphosphotyrosine monoclonal antibody 4G10 indicated that molecular species of >200 kDa were phosphorylated on tyrosine residues during or immediately following the irradiation of cells loaded with BPD. Increased tyrosine phosphorylation of a 15 kDa protein was evident by 15 min post irradiation. In the absence of light, BPD did not affect the status of cellular protein tyrosine phosphorylation or cause DNA fragmentation. The status of IκB and NF-κB proteins was evaluated for promyelocytic leukemia HL-60 cells treated at different intensities of PDT (Granville, 2000). The action of BPD-MA, and visible light irradiation were assessed. At a BPD concentration that produced the death of a high proportion of cells after illumination, evidence of caspase 3 and caspase 9 processing and of poly(ADP-ribose) polymerase cleavage was present within whole cell lysates. The general caspase inhibitor Z-Val-Ala-Asp-fluoromethylketone (ZVAD.fmk) effectively blocked these apoptosis related changes. The participation of the mitochondrial permeability transition pore (MPT) in PDT-induced apoptosis is mainly based on the experimental evidence that pharmacological inhibitors of the MPT can counteract PDT-mediated cell death induced by compounds that preferentially accumulate in mitochondria (Salet, 1997). Certain PS, such as PPIX and other porphyrins, exhibit high affinity for some components of the MPT pore, in particular for the outer membrane peripheral benzodiazepine receptor (PBR) that was proposed to be a crucial target for mitochondrial PDT (Kessel, 2001). However, subsequent studies showed that binding to the PBR was not correlated with PDT efficacy of different classes of PS (Dougherty, 2002, Morris, 2002). BPD has been shown to target the adenine nucleotide translocator in the mitochondrion, and to induce in a light-dependent fashion the permeabilization of the MPT pore encapsulated into liposomes, which reconstitute the function of the MPT-pore (Belzacq, 2001). Studies with lutetium texaphyrin (Lutex) have shown that this PS induces apoptosis through a selective modulation of members of the Bcl-2 family (Renno, 2000). In a different study it has been shown that Lutex binds to lysosomes of EMT6 cells in vitro and to produce apoptosis in EMT6 tumors in vivo, indicating that lysosomally bound PS can induce apoptosis upon photoactivation (Woodburn, 1997). Canete et al. (Canete, 2004) showed that the PS palladium(II)-tetraphenylporphycene caused only necrotic cell death in A-549 cells even at low doses despite the cells undergoing apoptosis in response to serum starvation, and that this PS could produce apoptosis in a different cell line (HeLa cells). Blank et al. demonstrated that hypericin could induce mitotic cell death by targeting Hsp90 for ubiquitinylation and thus lowering levels of its client proteins mutant p53, Cdk4, Raf-1, and Plk and disturbing multiple cellular functions (Blank, 2003). Thibaut et al. (Thibaut, 2002) used apoptosis inhibitors (BAPTA-AM, Forskolin, DSF,

615

Photodynamic Therapy

and Z-VAD-fmk) to study PDT of murine melanoma B16-A45 cells and mTHPC. Although all inhibitors tested blocked PDT-induced apoptosis, none produced a significant modification of the phototoxic effect of mTHPC on B16 cells. It has been suggested that apoptosis and necrosis share common initiation pathways and that the final outcome is determined by the presence of an active caspase. This implies that apoptosis inhibition reorients cells to necrosis, i.e. those cells sufficiently damaged by PDT appear to be killed, regardless of the mechanism involved. Mitochondria were shown to be the main targets of mTHPC in some reports (Chen, 2000). PDT of mTHPC-sensitized murine leukemia cells (M1 and JCS) caused rapid appearance of the apoptogenic protein cytochrome c in the cytosol (especially pronounced in JCS cells), and well correlated with the extent of apoptotic cell death. Electron microscopy revealed the loss of integrity of the mitochondrial membrane and the appearance of chromatin condensation as early as 1 h after light irradiation. PF, a representative of the first generation PS, is a preparation consisting of HPD. Studies described in several reports revealed the complicated effects of HPD/PF PDT on cells. Depending on the incubation conditions PDT can result in apoptosis (He, 1994) or necrosis (Dellinger, 1996) of target cells. Biochemical analysis indicated that HpD/PF PDT elicited lipid peroxidation and enzyme inactivation on plasma membranes, as well as mitochondria damage and inactivation of mitochondrial enzymes (Bachowski, 1991). The role of apoptosis-related proteins was also studied in the response of human malignancies to PDT (Koukourakis, 2001a). Paraffin-embedded material from 37 patients with early esophageal cancer treated with PDT (intravenous injection of HPD) was studied immunohistochemically for p53 protein nuclear accumulation and Bcl-2 cytoplasmic expression. Positive Bcl-2 and p53 expression was noted in 27% and 39% patients, respectively. 63% of tumors with Bcl-2 expression responded completely to PDT versus 23% of cases with no Bcl-2 expression (p = 0.02). No association of p53, T-stage and of histology grade with response to PDT or PDT/RT was noted. Bcl-2 protein expression was proposed to be associated with favorable response to PDT and could be used as a predictor of cancer response to PDT. This finding was explained by studies showing that PDT induces selective degradation of the Bcl-2 protein, leading to apoptosis by decreasing the Bcl-2/bax ratio (Usuda, 2003).

Autophagy in PDT As mentioned above there has recently been an intense interest in autophagy as a pathway of cell death, particularly in cancer cells that are deficient is some essential components of the apoptotic machinery(Kondo, 2006). The proapoptotic proteins, Bax and Bak, act as a gateway for caspase-mediated cell death. Mammalian target of rapamycin, (mTOR), an Akt downstream effector, plays a critical role in cell proliferation, growth and survival, and inhibition of mTOR induces autophagy. Cell death induced by ionizing radiation in Bax/Bak-/- double knockout (DKO) MEF cells was more pronounced than in wild-type cells despite the DKO cells being unable to undergo apoptosis (Kim, 2006). In DKO cells there was an increase in the pro-autophagic proteins ATG5-ATG12 and Beclin-1. Phosphatase and tensin homolog deleted from chromosome 10 (PTEN) is a lipid phosphatase that is frequently mutated in cancer. Loss of PTEN leads to constitutive activation of the phosphatidylinositol 3’-kinase/serine-threonine kinase (Akt) signal transduction pathway and has been associated with resistance to chemotherapy. PTEN can stimulate autophagy but can also be inhibited by Bax/Bak (Moretti, 2007) Buytaert et al showed (Buytaert, 2006b) that photodamage to the sarco(endo)plasmic-reticulum 2+ Ca -ATPase (SERCA) pump and consequent loss in the ER-Ca2+ homeostasis was led to cell death in hypericin-photosensitized cells. In Bax/Bak double knockout cells, a nonapoptotic pathway dependent

616

Photodynamic Therapy

on sustained autophagy is found after PDT (Buytaert, 2007), and suggests that the decision to die in this paradigm of oxidative stress is taken upstream of Bax-dependent MOMP and that the irreversible photodamage to the ER acts as a trigger for an autophagic cell death pathway in apoptosis-deficient cells (Buytaert, 2006a) Murine leukemia L1210 cells and human prostate Bax-deficient DU-145 cells treated with PDT had ER damage and loss of Bcl-2 function (Kessel, 2006). Both apoptosis and autophagy occurred in L1210 cells after ER photodamage with the latter predominating after 24 hr. Western blots demonstrated processing of LC3-I to LC3-II, a marker for autophagy. In DU145 cells, PDT initiated only autophagy. Phosphatidylinositol-3-kinase inhibitors suppressed autophagy in both cell lines. Kessel and Arroyo (Kessel, 2007) treated L1210 cells with a porphycene photosensitizer that causes photodamage to the endoplasmic reticulum (ER) where Bcl-2 was among the PDT targets. In wild-type cells, they observed a rapid wave of autophagy, presumed to represent the recycling of some damaged organelles, followed by apoptosis. Using shRNA technology, they created a Bax knockdown line (L1210/Bax(-)) where a marked decrease in apoptosis after photodamage or pharmacologic inactivation of Bcl-2 function was observed, but this did not affect PDT efficacy. Loss of viability was associated with a highly-vacuolated morphology consistent with autophagic cell death. It appears that attempts at extensive recycling of damaged organelles are associated with cell death, and that this phenomenon is amplified when apoptosis is suppressed. Xue et al (Xue L. Y., 2007b) investigated the occurrence of autophagy after PDT with the photosensitizer Pc 4 in human cancer cells that are deficient in the pro-apoptotic factor Bax (human prostate cancer DU145 cells) or the apoptosis mediator caspase-3 (human breast cancer MCF-7v cells) and in apoptosis-competent cells (MCF-7c3 cells that stably overexpress human pro-caspase-3 and Chinese hamster ovary CHO 5A100 cells). Further, each of the cell lines was also studied with and without stably overexpressed Bcl-2. Autophagy was identified by electron microscopic observation of the presence of double-membrane-delineated autophagosomal vesicles in the cytosol and by immunoblot observation of the Pc 4-PDT dose- and time-dependent increase in the level of LC3-II, a component of the autophagosomal membrane. Autophagy was observed in all of the cell lines studied, whether or not they were capable of typical apoptosis and whether or not they overexpressed Bcl-2. The presence of stably overexpressed Bcl-2 in the cells protected against PDT-induced apoptosis and loss of clonogenicity in apoptosis-competent cells (MCF-7c3 and CHO 5A100 cells). In contrast, Bcl-2 overexpression did not protect against the development of autophagy in any of the cell lines or against loss of clonogenicity in apoptosis-deficient cells (MCF-7v and DU145 cells). Furthermore, 3-methyladenine and wortmannin, inhibitors of autophagy, provided greater protection against loss of viability to apoptosis-deficient than to apoptosis-competent cells (Xue L. Y., 2007a).

Bystander Effect A different mechanism of cell death was described by Dahle et al. (Dahle, 1997), who showed that during in vitro PDT some cells die by direct effect, but adjacent cells suffer lethal cell damage which is propagated through a chain of adjacent cells, termed the bystander effect. Treatment of MDCK II cells with the lipophilic PS tetra(3-hydroxyphenyl)porphyrin and light was found to induce a rapid apoptotic response in a large fraction of the cells. Furthermore, the distribution of apoptotic cells in microcolonies of eight cells was found to be different from the expected binomial distribution. There was an overabundance of microcolonies that had responded to the treatment as a single unit, that is, in

617

Photodynamic Therapy

which either all or no cells were dead, indicating that the cells are not inactivated independently, but that the bystander effect is involved in the cell death. This observation disagrees with the common view that cells are inactivated only by direct damage and indicates that communication between cells in a colony plays a role in PDT induction of apoptosis. The degree of bystander effect was higher for cells dying by necrosis than for cell dying by apoptosis. Initially it was thought that the process was mediated through gap junctional intercellular communication during or shortly after irradiation, (Dahle, 2000, Dahle, 1999) but when this hypothesis was tested by treatment of microcolonies with 30 µM dieldrin, an inhibitor of gap junctional intercellular communication, there was no reduction of the bystander effect. However, workers in the field of ionizing radiation where the bystander effect is also observed, showed (Shao, 2003) that it may be mediated both by gap-junctional communication and also by generation of diffusible ROS that can be released into the medium and act on neighboring cells.

DNA Damage Sunlight gives rise to DNA damage by two mechanisms. On the one hand, DNA directly absorbs light in the UVC and UVB range of the spectrum (up to 320 nm). The absorption gives rise to characteristic photoproducts, especially the formation of pyrimidine dimers. Their pre-mutagenic properties have been well established. On the other hand, some so far unidentified cellular constituents (probably porphyrins or flavins) act as endogenous PS that react directly with DNA or give rise to the formation of reactive oxygen species. These reactions result in oxidative DNA damage, which is also known to be pre-mutagenic. The contribution of the indirect (PS-mediated) mechanisms to the cancer risk induced by direct sunlight is not very well known. It is anticipated that the indirect mechanisms will not be as effective as direct DNA excitation, but that they will make an important contribution to the genotoxicity of sunlight in the longer wavelength range where DNA has little or no absorption. The photodynamic alteration of DNA is a singlet oxygen-mediated process, while the ionizing radiation degradation is mediated by hydroxyl radicals generated by ionization of water. Damage to DNA has been shown in several studies with in vitro PDT (Oleinick, 1998), however this DNA damage has not been directly linked to lethal effects. PDT has been shown to cause DNA base oxidative damage, strand breaks and cross-links. The mutagenic potential varies between cell types, possibly reflecting differences in repair capacity or damage surveillance mechanisms. Porphyrins and/or metalloporphyrins mediated cleavage of nuclei acids occurs via oxidative attack on the sugar moiety, nucleobase modifications which lead to strand scission or by photo-induced mechanism involving either the porphyrin excited state or singlet oxygen. Free radical reactions have been suggested to be involved at several points in the multistep process of chemically induced carcinogenesis. Singlet oxygen can be readily generated inside cells and reacts efficiently with DNA causing single strand breaks. Its preferential reaction with the guanine moiety in DNA leads mainly to one-G deletions in the DNA sequence. The mutagenicity of singlet oxygen depends on formation of lipid peroxidation products. In general, the most potent PS are usually lipophilic and they do not accumulate in the nucleus. Therefore, despite causing mutagenic products in vitro assays this may not occur in vivo. It has long been known that 5-ALA is capable of causing DNA damage, but it is not certain if this phenomenon is light dependent or not (Fuchs, 2000). When ferritin or metals are present, a catalyzed oxidation of ALA produces reactive oxygen species that can damage plasmid DNA in vitro, and increases the steady state level of 8-oxo-7,8-dihydro-2’-deoxyguanosine in liver, spleen and kidney. The DNA damage could be partially inhibited by SOD, catalase, DTPA, mannitol

618

Photodynamic Therapy

and melatonin. 4,5-Dioxovaleric acid, the final oxidation product of ALA, alkylates guanine moieties within both nucleoside and isolated DNA, producing two diastereoisomeric adducts (Di Mascio, 2000, Douki, 1998). It is possible that these mechanisms could be involved in the increase in liver cancer observed amongst sufferers of acute intermittent porphyria who have elevated levels of 5-ALA due to enzyme deficiencies (Onuki, 2002). Photosensitization of various types of cells by hematoporphyrin or phthalocyanines results in DNA lesions, such as single strand breaks (Cadet, 1986, Fiel, 1981). The mutagenicity of PF-PDT may be related to the repair capabilities as well as to the p53 status of the cell line. Woods et al. (Woods, 2004) studied PDT with human HaCaT keratinocytes using the standard alkaline comet assay protocol to detect DNA strand breaks. They used PF (1 µg/mL) and 630nm laser light and showed a dose-dependent increase in DNA migration (comet tails) starting as low as 1 J/cm 2; however, the breaks produced at the higher irradiation doses (10 and 25 J/cm2) could have been caused by cell death. PF treatment in the absence of light did not result in increased DNA migration. A similar comet assay with tail moment calculation was used to evaluate DNA damage and repair in murine glioblastoma C6 cells after PDT with m- THPC (Rousset, 2000). There were no changes in tail moment of C6 cells in the absence of light, whereas m-THPCPDT (1µg/mL) induced DNA damage immediately after irradiation. The mean value increased with the light dose (0, 10 or 25 J/cm2) and incubation time (every hour from 1 to 4 h), but the cells were capable of significant DNA repair after 4 h, and no residual DNA damage was evident after 24-h post-treatment incubation at 37°C. An increase in the light dose appeared to be less genotoxic than an increase in the m-THPC dose for similar toxicities. Overall, the presently available data indicate that the risk for secondary skin carcinoma after topical ALA-PDT seems to be low, but further studies must be carried out to evaluate the carcinogenic risk of ALA-PDT in conditions predisposed to skin cancer. We can conclude that the DNA-damaging effects of PDT are dependent not only on the all variables implicit in PDT but also on the cellular mechanisms of repair and survival. For treatments giving equal levels of cell survival, DNA damage has been shown to be less for PDT-treated cells compared with those that have been X-irradiated. Although DNA, RNA and protein synthesis are affected following PDT, recovery occurs suggesting that such damage may not necessarily be lethal.

SYSTEMS BIOLOGY STUDIES IN PDT System Biology is defined as the ability to obtain, integrate and analyze complex data from multiple experimental sources using interdisciplinary tools. In popular parlance it has become known as a collection of “omics”. These omics are: • • • • • •

Genomics: Study of the entire DNA sequence of organisms and fine-scale genetic mapping efforts. Transcriptomics: Whole cell or tissue gene expression measurements by DNA microarrays. Proteomics: Complete identification of proteins and protein expression patterns of a cell or tissue through two-dimensional gel electrophoresis or mass spectrometry. Metabolomics: Identification and measurement of all small-molecules metabolites within a cell or tissue Glycomics: Identification of the entirety of all carbohydrates in a cell or tissue. Kinomics: The totality of protein kinases in a cell

619

Photodynamic Therapy

• •

Interactomics: Determining protein-protein interactions (in theory encompassing all interactions between all molecules within a cell) Fluxomics: Deals with the dynamic changes of molecules within a cell over time.

Although the discovery of many of the pathways and cell signaling cascades induced after PDT (discussed previously) have been elucidated by traditional biochemical and cell biology techniques, the newer technologies of “omics” are increasingly being brought to bear on this problem.

Gene Expression Studies in PDT Verwanger et al (Verwanger, 1998) measured transient changes of the expression level of (proto) oncogenes c-myc and bcl-2 in normal and transformed human fibroblasts at different times following photodynamic treatment with 5-aminolaevulinic acid-stimulated endogenous protoporphyrin IX and low-dose irradiation using quantitative reverse transcriptase polymerase chain reaction (RT-PCR). No irreversibly increased (proto) oncogene expression was found, since the over-expression of c-myc and bcl-2 is transient. They found an interaction of bcl-2 and c-myc associated with an increase of the proliferative activity of the cell cycle of transformed cells and a possible role of bcl-2 in counteracting processes that could be at least precursors for apoptosis induction together with a higher constitutive expression of both genes in transformed than in normal fibroblasts. The first use of DNA gene expression arrays was by this group in 2002 (Verwanger, 2002). They used ALA-induced PPIX in the squamous cell carcinoma cell line A-431 after treatment with light. Radioactively labeled cDNAs from untreated and treated cells were hybridized onto UniGene cDNA array filters containing lysed bacterial colonies with inserts representing approximately 32000 different human transcripts. Differentially expressed genes were identified and verified on sub-arrays containing only the candidate genes. They found increased expression of Hsp70 and of the immediate early genes p55-c-fos and c-jun. Increased expression of heme oxygenase-1 following dark incubation was not further increased by irradiation and therefore probably caused by the need for heme degradation. A subsequent study from the same group (Ruhdorfer, 2007) used the same cells and PS (A-431 with ALA-PPIX). After a 16 h incubation with 100 microg/ml ALA and irradiated with a fluence of 3.5 J/cm2 resulting in 50% survival at 8 h post treatment. RNA was isolated at 1.5, 3, 5 and 8 h post treatment and from 3 controls (untreated, light only and dark), radioactively labeled by reverse transcription with 33 P-dCTP and hybridized onto macroarray PCR filters containing PCR products of 2135 genes, which were selected for relevance in carcinogenesis, stress response and signal transduction. Verification of observed expression changes was carried out by real-time RT-PCR. They found a strong induction of expression of the immediate early genes c-jun and c-fos as well as decreased expression of genes involved in proliferation such as myc, genes involved in apoptosis such as Fas associated via death domain (FADD) and the fibronectin gene for cell adhesion. Gene expression changes were observed in the HEL and HL-60 cell lines after the stimulation of protoporphyrin IX synthesis by ALA administration and photodynamic process induction (Belickova, 2000). Isolated ribonucleic acids were radiolabeled by reverse transcription, and the cDNA obtained was hybridized to membrane macroarrays containing 588 gene probes. Besides changes in the activity of genes supposed to be involved in the programmed cell death and DNA reparation processes, increased or diminished transcription activity was also observed in several other genes; the reason for this phenomenon was not clear. The activation of programmed-cell-death genes appeared after the ALA load

620

Photodynamic Therapy

application, indicating the toxic effect of ALA. The gene expression changes observed in the two cell lines differed substantially, only a few of them were common for both cell lines. Cekaite and colleagues (Cekaite, 2007) investigated the changes in the transcriptome after hexylALA-mediated PDT by using transcriptional exon evidence oligo microarrays. They confirmed deviations in the steady state expression levels of previously identified early defense response genes and extend this to include unreported PDT inducible gene groups, most notably the metallothioneins and histones. HAL-PDT mediated stress also altered expression of genes encoded by mitochondrial DNA. The ATF3 alternative isoform (deltaZip2) was up-regulated, while the full-length variant was not changed by the treatment. Results were independently verified by two different technological microarray platforms. Good microarray, RT-PCR and Western immunoblotting correlation for selected genes supported these findings. Zawacka-Pankau et al observed (Zawacka-Pankau, 2007) the induction of p53 target pro-apoptotic genes, e.g. puma (p53-up-regulated modulator of apoptosis), and bak in protoporphyrin (PpIX) treated cells in the absence of light. In addition, p53-independent growth suppression by PpIX was detected in p53-negative cells. PDT treatment (2 J/cm2) of HCT116 cells induced p53-dependent activation of pro-apoptotic gene expression followed by growth suppression and induction of apoptosis. PpIX binds to p53 and disrupts the interaction between p53 tumor suppressor protein and its negative regulator HDM2 in vitro and in cells. The expression of genes encoding complement proteins C3, C5, and C9 was studied following tumor PDT mediated by photosensitizer Photofrin using the mouse Lewis lung carcinoma (LLC) model (Stott, 2007). Treated tumors and the livers of host mice were collected at different times after PDT and the expression of the investigated genes was analyzed by RT-PCR. The results showed a significant up-regulation of C3, C5, and C9 genes in PDT-treated tumors at 24 h after therapy, while no significant increase in the expression of these genes was found in the liver tissues. The expression of C3, C5, and C9 genes also became up-regulated in untreated tumor-associated macrophages (TAMs) co-incubated in vitro with PDT-treated LLC cells. This effect was abolished or drastically reduced in the presence of antibodies blocking heat shock protein 70 (HSP70), Toll-like receptor (TLR) 2 and TLR4, and specific peptide inhibitors of TIRAP adapter protein and transcription factor NF-kappaB. ALA-PDT was found to lead to the perturbation of the Hsp90/p23 multichaperone complex of which the Bcr-Abl is the client protein (Pluskalova, 2006). Bcr-Abl protein was suppressed whereas the bcr-abl mRNA level was not affected. Furthermore several changes were observed in the cytoskeleton organization. ALA-PDT-mediated disruption of filamental actin structure and certain cytoskeleton organizing proteins involved in the cell response to the treatment. Among these proteins, Septin2, which plays a role in maintaining actin bundles, was suppressed. Another one, PDZ-LIM domain protein 1 (CLP36) was altered. This protein acts as an adaptor molecule for LIM-kinase which phosphorylates and thus inactivates cofilin. Cofilin was indeed dephosphorylated and could thus be activated and operate as an actin-depolymerizing factor. Ruiz-Galindo et al (Ruiz-Galindo, 2007) investigated the expression profiles of genes involved in heme biosynthesis in the human retinoblastoma WERI-Rb-1 and Y79 cells by reverse transcriptasepolymerase chain reaction (RT-PCR). Expression levels were highest in protoporphyrinogen oxidase (PPOX), uroporphyrinogen synthase and aminolevulinic acid synthase. Ferrochelatase expression showed a reduction compared to PPOX. PpIX levels were 15- and 18-fold higher in WERI-Rb-1 and Y79 cells, respectively, following induction by delta-aminolevulinic acid.

621

Photodynamic Therapy

PDT-Induced Protective Response In response to many stresses, including heat, oxidizing conditions, and exposure to toxic compounds, all cells produces a common set of heat shock proteins (Hsps) and glucose-regulated proteins (Grps). Experiments in E. coli, yeast, fruit flies and mice have shown that increased expression of these proteins can protect the organism against stress-induced damage. Most, but not all, heat shock proteins are molecular chaperones that bind and stabilize proteins at intermediate stages of folding, assembly, translocation across membranes and degradation. Heat shock proteins have been classified by molecular weight, for example, Hsp70 for the 70-kDa heat-shock protein. The transcription of genes belonging to the Hsp family is regulated by a mechanism involving the binding of heat-shock factors (HSFs) to specific heat-shock elements (HSEs). In nonstress conditions, the transcription factor HSF is found in the cytoplasm, in a monomeric form, associated with Hsp70 (Morimoto, 1993). During cellular stress Hsp70 binds to denatured proteins, freeing HSF that trimerizes and migrates to the nucleus, where it binds to HSE. Gomer et al. first showed (Gomer, 1991b) that elevated levels of mRNA encoding Grps as well as increases in Grp protein synthesis after mouse RIF-1 cells were incubated with PF for 16-h (but not 1 h) and illuminated. In separate experiments, a transient elevation of Grp mRNA levels was observed in transplanted mouse mammary carcinomas following in vivo PDT treatments. They went on to show that in vitro PDT with mono-aspartyl chlorine e6 or tin etiopurpurin but not with PF increased both Hsp70 mRNA and protein levels in RIF-1 cells (Gomer, 1996). PDT of RIF-1 tumors in mice gave an increased expression of Hsp70 using all three PS. In vitro PDT of RIF cells with Npe6-induced HSF-1 binding to HSE, and transiently induced the expression of a reporter gene containing an inducible Hsp70 promoter (Luna, 2000). This led to a proposal that PDT could be a light activated targeted inducer of specific gene expression (for instance suicide genes) if the gene of interest could be linked to the heat shock or Grp promoters (Luna, 2002). Hanlon et al. reported that PF-PDT of HT29 and RIF-1 cells and their PDT resistant sublines led to increase of the mitochondrial Hsp60 and suggested that this protein may contribute to PDT resistance (Hanlon, 2001). The same group subsequently implicated Hsp27 in mediating this PDT-resistance as shown by the creation of cells stably overexpressing Hsp27 (Wang, 2002). In vivo and in vitro studies, using a mouse mammary sarcoma (EMT6) cell line stably transfected with a plasmid consisting of the gene for green fluorescent protein (GFP) under the control of an Hsp70 promoter, showed that sublethal doses of mTHPC-PDT-induced Hsp70- driven GFP expression (Mitra, 2003). Recently Jalil and a group from Poland demonstrated upregulation of Hsp27, Hsp60, Hsp72/73, Hsp90, and Grp78 after PF-PDT of mouse C26 cells and linked this protein expression to the effectiveness of immature dendritic cell mediated immunotherapy (Jalili, 2004). Heme oxygenases (HO) degrade heme to carbon monoxide, iron and biliverdin, which is subsequently reduced to bilirubin by biliverdin reductase. Not only does HO catalyze the removal of the dangerous heme molecules, which can generate harmful radicals when in the free form, but also the products of HO activity can act as neurotransmitters, regulate vascular tone and protect cells from various insults. The HO gene contains binding sites for several transcription factors, including an AP-1 consensus sequence (Alam, 1992) that may contribute to an up-regulation of gene expression since this transcription factor may be activated in PDT (see above). PDT of Chinese hamster fibroblast cells (V-79) with PF or with RB increased HO protein levels (Gomer, 1991c). Other workers have shown that HO can be induced in the dark after incubation of cells with HPD or zinc phthalocyanine (ZnPC) (Bressoud,

622

Photodynamic Therapy

1992). Lin and Girotti showed that pre-incubation of cells with hemin could cause resistance to PDT by inducing expression of HO1 (Das, 2000). Increases in expression of anti-oxidant enzymes may also be caused by PDT. Studies using human adenocarcinoma HeLa cells showed induction of manganese superoxide dismutase (MnSOD) mRNA following photosensitization with PF (Das, 2000). Studies from Poland using murine colon-26 (C26) cells showed that PF-PDT increased the protein levels of MnSOD, but not of Cu,Zn-SOD (Golab, 2003). Transient transfection of the T24 bladder cancer cell line with the MnSOD gene, but not with the Cu,Zn-SOD gene, or pretreatment of C26 and T24 cells with a cell permeable SOD mimetic, resulted in a considerable decrease in the effectiveness of PDT with PF. These results suggest that inhibition of SOD activity may be effective in potentiating the antitumor effectiveness of PDT (Golab, 2003). They then tested 2-methoxyestradiol (2ME), a SOD-inhibitor capable of potentiating the antitumor effects of PDT. The combination produced retardation of tumor growth and prolongation of the survival of tumor-bearing mice. A study (Lu, 2004) showed that human glutathione S-transferase (GST) isoforms GSTP1-1 (P1-1) and GSTA1-1 (A1-1) bind with high affinity to hypericin (HYP) and differentially quench its PDT properties and this antioxidant effect was attributed to classic ligandin activity of GSTs, wherein non-substrate planar aromatic anions are sequestered on, and inhibit, the enzyme.

Studies with PDT-Resistant Cells A group in Canada has devoted some effort to comparing PDT resistant HT29 human colon cancer cells (selected by regrowing surviving cells from sequential PDT treatments), with their wild-type counterparts, with the aim of discovering which genes and pathways are important in susceptibility to PDT induced cell death. They compared gene expression profiles between the Photofrin-resistant cell line (HT29-P14) and its parental cell line HT29 using DNA-microarray analysis (Wang, 2002). A significant up-regulation of Hsp27 was found in HT29-P14 cells. They then transfected HT29 cells with human Hsp27 cDNA and stable transfected cells (H13) showed an increased survival after Photofrin-PDT, suggesting that the up-regulation of Hsp27 is related to the induced resistance to PhotofrinPDT. Phosphorylation of Hsp27 may play an important role in cytoprotection, and an increased Hsp27 phosphorylation level was found in both resistant and overexpressing cells after PDT. The activation of the phosphorylation of Hsp27 induced by PDT was not mediated by the p38 mitogen-activated protein kinase. Next they used messenger RNA (mRNA) differential display to identify genes that were differentially expressed in the parental HT29 cells compared with their resistant variants (Shen, 2005). In comparison with parental HT29 cells, mRNA expression was increased in the PDT-resistant cell variants for BNIP3, estrogen receptor-binding fragment-associated gene 9, Myh-1c, cytoplasmic dynein light chain 1, small membrane protein I and differential dependent protein. In contrast, expression in the PDT-resistant variants was downregulated for NNX3, human HepG2 3’ region Mbol complementary DNA, glutamate dehydrogenase, hepatoma-derived growth factor and the mitochondrial genes coding for 16S ribosomal RNA (rRNA) and nicotinamide adenine dinucleotide (NADH) dehydrogenase subunit 4. The reduction for mitochondrial 16S rRNA in the PDT-resistant variants was confirmed by Northern blotting, and the elevated expression of the proapoptotic BNIP3 in the PDT-resistant variants was confirmed by Northern and Western blotting analysis. They also examined the expression of some additional apoptosis-regulating genes using Western blotting, and showed an increased expression of Bcl-2 and Hsp27 and a downregulation of Bax in the PDT-resistant variants. In addition, the mutant p53 levels in the parental HT29 cells were reduced substantially in the PDT-resistant variants.

623

Photodynamic Therapy

They next tested the hypothesis that since BNip3 is a potent inducer of apoptosis, whether these PDT-resistant cells were cross-resistant to other cytotoxic agents (Dregoesc, 2007). PDT-resistant HT29 cell lines showed a significant increase in cisplatin sensitivity and an increase in both spontaneous and cisplatin-induced apoptosis compared to parental HT29 cells. In addition, the cisplatin sensitivity of the PDT-resistant HT29 variants and several other clonal variants of HT29 cells correlated with increased BNip3 and decreased mutant p53 protein levels, but not Hsp27 protein levels. Finally they investigated whether the PDT-resistant cells were cross-resistant to ultraviolet light (UV) treatment (Zacal, 2007). The HT29 PDT-resistant variants showed cross-resistance to long-wavelength UVA (320-400 nm) but not to short-wavelength UVC (200-280 nm) light. Cell sensitivity to UVA or UVC was then correlated with Hsp27, BNip3 and mutant p53 protein levels in the PDT-resistant variants as well as in several clonal variants of HT29 cells that express different levels of Hsp27, BNip3 and mutant p53. Increased expression of Hsp27 and BNip3 and decreased expression of mutant p53 correlated with increased resistance to UVA. In contrast, increased expression of Hsp27 and BNip3 correlated with increased sensitivity to UVC, whereas increased expression of mutant p53 showed no significant correlation with sensitivity to UVC.

CONCLUSION Systems biology includes a set of powerful new techniques capable of generating large amounts of data on molecules, proteins, gene expression, signaling, molecular interactions and many other processes occurring inside cells. Since PDT induces many complicated and interlocking processes in treated cells, a systems biology approach would appear ideal to tackle this otherwise daunting investigation. As the new techniques used in various disciplines of “omics” become more familiar to scientists working in the field of PDT, we expect to see an increasing number of studies using high throughput technology to address the effect of PDT on both cancer and normal cells.

References Abels, C. (2004). Targeting of the vascular system of solid tumours by photodynamic therapy (PDT). Photochem Photobiol Sci., 3, 765-771. Agarwal, M. L., Clay, M. E., Harvey, E. J., Evans, H. H., Antunez, A. R., & Oleinick, N. L. (1991). Photodynamic therapy induces rapid cell death by apoptosis in L5178Y mouse lymphoma cells. Cancer Res., 51, 5993-6. Agarwal, M. L., Larkin, H. E., Zaidi, S. I., Mukhtar, H., & Oleinick, N. L. (1993). Phospholipase activation triggers apoptosis in photosensitized mouse lymphoma cells. Cancer Res., 53, 5897-902. Agostinis, P., Buytaert, E., Breyssens, H., & Hendrickx, N. (2004). Regulatory pathways in photodynamic therapy induced apoptosis. Photochem. Photobiol. Sci., 3, 721-729. Agostinis, P., Vantieghem, A., Merlevede, W., & de Witte, P. A. (2002). Hypericin in cancer treatment: More light on the way. The International Journal of Biochemistry & Cell Biology, 34, 221-241.

624

Photodynamic Therapy

Ahmad, N., Feyes, D. K., Agarwal, R., & Mukhtar, H. (1998). Photodynamic therapy results in induction of WAF1/CIP1/P21 leading to cell cycle arrest and apoptosis. Proc Natl Acad Sci USA, 95, 6977-82. Ahmad, N., Gupta, S., & Mukhtar, H. (1999). Involvement of retinoblastoma (Rb) and E2F transcription factors during photodynamic therapy of human epidermoid carcinoma cells A431. Oncogene, 18, 1891-6. Ahmad, N., Kalka, K., & Mukhtar, H. (2001). In vitro and in vivo inhibition of epidermal growth factor receptor-tyrosine kinase pathway by photodynamic therapy. Oncogene,20, 2314-2317. Alam, J., & Den, Z. (1992). Distal AP-1 binding sites mediate basal level enhancement and TPA induction of the mouse heme oxygenase-1 gene. J.Biol.Chem., 267, 21894-21900. Allison, R. R., Downie, G. H., Cuenca, R., Hu, X.-H., Childs, C. J., & Sibata, C. H. (2004). Photosensitizers in clinical PDT. Photodiag Photodynam Ther., 1, 27-42. Anderson, C., Hrabovsky, S., McKinley, Y., Tubesing, K., Tang, H. P., Dunbar, R. et al. (1997). Phthalocyanine photodynamic therapy: Disparate effects of pharmacologic inhibitors on cutaneous photosensitivity and on tumor regression. Photochem Photobiol., 65, 895-901. Assefa, Z., Vantieghem, A., Declercq, W., Vandenabeele, P., Vandenheede, J. R., Merlevede, W. et al. (1999). The activation of the c-Jun N-terminal kinase and p38 mitogen-activated protein kinase signaling pathways protects HeLa cells from apoptosis following photodynamic therapy with hypericin. J.Biol. Chem., 274, 8788-8796. Aveline, B. M., & Redmond, R. W. (1999). Can cellular phototoxicity be accurately predicted on the basis of sensitizer photophysics? Photochem Photobiol., 69, 306-16. Baas, P., van Mansom, I., van Tinteren, H., Stewart, F. A., & van Zandwijk, N. (1995). Effect of N-acetylcysteine on Photofrin-induced skin photosensitivity in patients. Lasers Surg Med., 16, 359-67. Bachowski, G. J., Korytowski, W., & Girotti, A. W. (1994). Characterization of lipid hydroperoxides generated by photodynamic treatment of leukemia cells. Lipids, 29, 449-459. Bachowski, G. J., Pintar, T. J., & Girotti, A. W. (1991). Photosensitized lipid peroxidation and enzyme inactivation by membrane-bound merocyanine 540: Reaction mechanisms in the absence and presence of ascorbate. Photochem.Photobiol, 53, 481-491. Ball, D. J., Mayhew, S., Vernon, D. I., Griffin, M., & Brown, S. B. (2001). Decreased efficiency of trypsinization of cells following photodynamic therapy: evaluation of a role for tissue transglutaminase. Photochem.Photobiol., 73, 47-53. Bektas, M., & Spiegel, S. (2004). Glycosphingolipids and cell death. Glycoconj. J., 20, 39-47. Belickova, M., Bruchova, H., Cajthamlova, H., Hrkal, Z., & Brdicka, R. (2000). Genes involved in the destruction of leukaemic cells by induced photosensitivity. Folia Biol (Praha), 46, 131-5. Belzacq, A. S., Jacotot, E., Vieira, H. L., Mistro, D., Granville, D. J., Xie, Z. et al. (2001). Apoptosis induction by the photosensitizer verteporfin: Identification of mitochondrial adenine nucleotide translocator as a critical target. Cancer Res. 61, 1260-1264.

625

Photodynamic Therapy

Benstead, K., & Moore, J. V. (1989). Quantitative histological changes in murine tail skin following photodynamic therapy. Br. J. Cancer, 59, 503-509. Berg, K., Madslien, K., Bommer, J. C., Oftebro, R., Winkelman, J. W., & Moan, J. (1991). Light induced relocalization of sulfonated meso-tetraphenylporphines in NHIK 3025 cells and effects of dose fractionation. Photochem Photobiol, 53, 203-10. Berg, K., & Moan, J. (1994). Lysosomes as photochemical targets. Int. J. Cancer, 59, 814-822. Berridge, M. J., & Irvine, R. F. (1984). Inositol trisphosphate, a novel second messenger in cellular signal transduction. Nature, 312, 315-321. Bilski, P., Motten, A. G., Bilska, M., & Chignell, C. F. (1993). The photooxidation of diethylhydroxylamine by rose bengal in micellar and nonmicellar aqueous solutions. Photochemistry and Photobiology, 58, 11-18. Bizik, J., Kankuri, E., Ristimaki, A., Taieb, A., Vapaatalo, H., Lubitz, W. et al. (2004). Cell-cell contacts trigger programmed necrosis and induce cyclooxygenase-2 expression. Cell Death Differ., 11, 183-195. Blank, M., Mandel, M., Keisari, Y., Meruelo, D., & Lavie, G. (2003). Enhanced ubiquitinylation of heat shock protein 90 as a potential mechanism for mitotic cell death in cancer cells induced with hypericin. Cancer Res., 63, 8241-8247. Bossy-Wetzel, E., & Green, D. R. (1999). Caspases induce cytochrome c release from mitochondria by activating cytosolic factors. J.Biol.Chem., 274, 17484-17490. Bottiroli, G., Croce, A. C., Balzarini, P., Locatelli, D., Baglioni, P., Lo Nostro, P. et al. (1997). Enzymeassisted cell photosensitization: A proposal for an efficient approach to tumor therapy and diagnosis. The rose bengal fluorogenic substrate. Photochem Photobiol, 66, 374-83. Bracken, A. P., Ciro, M., Cocito, A., & Helin, K. (2004). E2F target genes: unraveling the biology. Trends Biochem. Sci., 29, 409-417. Brancaleon, L., & Moseley, H. (2002). Laser and non-laser light sources for photodynamic therapy. Lasers Med. Sci., 17, 173-186. Bressoud, D., Jomini, V., & Tyrrell, R. M. (1992). Dark induction of haem oxygenase messenger RNA by haematoporphyrin derivative and zinc phthalocyanine; agents for photodynamic therapy. J. Photochem. Photobiol. B., 14, 311-318. Buchko, G. W., Cadet, J., Ravanat, J. L., & Labataille, P. (1993). Isolation and characterization of a new product produced by ionizing irradiation and type I photosensitization of 2’-deoxyguanosine in oxygen-saturated aqueous solution: (2S)-2,5’-ANHYDRO-1-(2’-deoxy-beta-D-erythro-pentofuranosyl)5-guanidin ylidene- 2-hydroxy-4-oxoimidazolidine. Int J Radiat Biol. 63, 669-76. Buchko, G. W., Wagner, J. R., Cadet, J., Raoul, S., & Weinfeld, M. (1995). Methylene blue-mediated photooxidation of 7,8-dihydro-8-oxo-2’-deoxyguanosine. Biochim Biophys Acta., 1263, 17-24.

626

Photodynamic Therapy

Buytaert, E., Callewaert, G., Hendrickx, N., Scorrano, L., Hartmann, D., Missiaen, L. et al. (2006a). Role of endoplasmic reticulum depletion and multidomain proapoptotic BAX and BAK proteins in shaping cell death after hypericin-mediated photodynamic therapy. Faseb J., 20, 756-8. Buytaert, E., Callewaert, G., Vandenheede, J. R., & Agostinis, P. (2006b). Deficiency in apoptotic effectors Bax and Bak reveals an autophagic cell death pathway initiated by photodamage to the endoplasmic reticulum. Autophagy, 2, 238-40. Buytaert, E., Dewaele, M., & Agostinis, P. (2007). Molecular effectors of multiple cell death pathways initiated by photodynamic therapy. Biochim Biophys Acta., 1776, 86-107. Cadet, J., Berger, M., Decarroz, C., Wagner, J. R., van Lier, J. E., Ginot, Y. M. et al. (1986). Photosensitized reactions of nucleic acids. Biochimie., 68, 813-834. Calzavara-Pinton, P. G. (1995). Repetitive photodynamic therapy with topical delta-aminolaevulinic acid as an appropriate approach to the routine treatment of superficial non-melanoma skin tumours. J Photochem Photobiol B., 29, 53-7. Canete, M., Ortega, C., Gavalda, A., Cristobal, J., Juarranz, A., Nonell, S. et al. (2004). Necrotic cell death induced by photodynamic treatment of human lung adenocarcinoma A-549 cells with palladium(II)tetraphenylporphycene. Int.J.Oncol., 24, 1221-1228. Castedo, M., Perfettini, J. L., Roumier, T., Andreau, K., Medema, R., & Kroemer, G. (2004). Cell death by mitotic catastrophe: a molecular definition. Oncogene., 23, 2825-2837. Castillo, L., Etienne-Grimaldi, M. C., Fischel, J. L., Formento, P., Magne, N., & Milano, G. (2004). Pharmacological background of EGFR targeting. Ann.Oncol., 15, 1007-1012. Cavallaro, U., & Christofori, G. (2004). Multitasking in tumor progression: signaling functions of cell adhesion molecules. Ann. N.Y. Acad. Sci., 1014, 58-66. Cecic, I., & Korbelik, M. (2002). Mediators of peripheral blood neutrophilia induced by photodynamic therapy of solid tumors. Cancer Lett., 183, 43-51. Cecic, I., Parkins, C. S., & Korbelik, M. (2001). Induction of systemic neutrophil response in mice by photodynamic therapy of solid tumors. Photochem Photobiol., 74, 712-20. Cekaite, L., Peng, Q., Reiner, A., Shahzidi, S., Tveito, S., Furre, I. E. et al. (2007). Mapping of oxidative stress responses of human tumor cells following photodynamic therapy using hexaminolevulinate. BMC Genomics., 8, 273. Chen, J. Y., Mak, N. K., Yow, C. M., Fung, M. C., Chiu, L. C., Leung, W. N. et al. (2000). The binding characteristics and intracellular localization of temoporfin (mTHPC) in myeloid leukemia cells: phototoxicity and mitochondrial damage. Photochem.Photobiol., 72, 541-547. Chiu, S. M., Davis, T. W., Meyers, M., Ahmad, N., Mukhtar, H., & Separovic, D. (2000). Phthalocyanine 4-photodynamic therapy induces ceramide generation and apoptosis in acid sphingomyelinase-deficient mouse embryonic fibroblasts. Int.J.Oncol., 16, 423-427.

627

Photodynamic Therapy

Colussi, V. C., Feyes, D. K., Mulvihill, J. W., Li, Y. S., Kenney, M. E., Elmets, C. A. et al. (1999). Phthalocyanine 4 (Pc 4) photodynamic therapy of human OVCAR-3 tumor xenografts. Photochem Photobiol., 69, 236-41. Coutier, S., Bezdetnaya, L., Marchal, S., Melnikova, V., Belitchenko, I., Merlin, J. L. et al. (1999). Foscan (mTHPC) photosensitized macrophage activation: enhancement of phagocytosis, nitric oxide release and tumour necrosis factor-alpha-mediated cytolytic activity. Br. J. Cancer., 81, 37-42. Curnow, A., McIlroy, B. W., Postle-Hacon, M. J., Porter, J. B., MacRobert, A. J., & Bown, S. G. (1998). Enhancement of 5-aminolaevulinic acid-induced photodynamic therapy in normal rat colon using hydroxypyridinone iron-chelating agents. Br J Cancer., 78, 1278-82. Dahle, J., Bagdonas, S., Kaalhus, O., Olsen, G., Steen, H. B., & Moan, J. (2000). The bystander effect in photodynamic inactivation of cells. Biochim. Biophys. Acta., 1475, 273-280. Dahle, J., Kaalhus, O., Moan, J., & Steen, H. B. (1997). Cooperative effects of photodynamic treatment of cells in microcolonies. Proc Natl Acad Sci USA, 94, 1773-8. Dahle, J., Steen, H. B., & Moan, J. (1999). The mode of cell death induced by photodynamic treatment depends on cell density. Photochem.Photobiol., 70, 363-367. Das, H., Koizumi, T., Sugimoto, T., Yamaguchi, S., Hasegawa, K., Tenjin, Y. et al. (2000). Induction of apoptosis and manganese super-oxide dismutase gene by photodynamic therapy in cervical carcinoma cell lines. Int. J. Clin. Oncol., 5, 97- 103. de Vree, W. J., Fontijne-Dorsman, A. N., Koster, J. F., & Sluiter, W. (1996). Photodynamic treatment of human endothelial cells promotes the adherence of neutrophils in vitro. Br. J. Cancer, 73, 1335-1340. Deininger, M. H., Weinschenk, T., Morgalla, M. H., Meyermann, R., & Schluesener, H. J. (2002). Release of regulators of angiogenesis following Hypocrellin-A and -B photodynamic therapy of human brain tumor cells. Biochem. Biophys. Res. Commu, 298, 520-530. Dellinger, M. (1996). Apoptosis or necrosis following Photofrin photosensitization: influence of the incubation protocol. Photochem. Photobiol., 64, 182-187. Di Mascio, P., Teixeira, P. C., Onuki, J., Medeiros, M. H., Dornemann, D., Douki, T. et al. (2000). DNA damage by 5-aminolevulinic and 4,5-dioxovaleric acids in the presence of ferritin. Arch. Biochem. Biophys., 373, 368-374. Ding, X., Xu, Q., Liu, F., Zhou, P., Gu, Y., Zeng, J. et al. (2004). Hematoporphyrin monomethyl ether photodynamic damage on HeLa cells by means of reactive oxygen species production and cytosolic free calcium concentration elevation. Cancer Lett., 216, 43-54. Dolgachev, V., Farooqui, M. S., Kulaeva, O. I., Tainsky, M. A., Nagy, B., Hanada, K. et al. (2004). De novo ceramide accumulation due to inhibition of its conversion to complex sphingolipids in apoptotic photosensitized cells. J. Biol. Chem., 279, 23238-23249. Dougherty, T. J. (1974). Activated dyes as antitumor agents. J Natl Cancer Inst, 52, 1333-6.

628

Photodynamic Therapy

Dougherty, T. J., Kaufman, J. E., Goldfarb, A., Weishaupt, K. R., Boyle, D., & Mittleman, A. (1978). Photoradiation therapy for the treatment of malignant tumors. Cancer Res, 38, 2628-35. Dougherty, T. J., Lawrence, G., Kaufman, J. H., Boyle, D., Weishaupt, K. R., & Goldfarb, A. (1979). Photoradiation in the treatment of recurrent breast carcinoma. J Natl Cancer Inst, 62, 231-7. Dougherty, T. J., & Potter, W. R. (1991). Of what value is a highly absorbing photosensitizer in PDT. J Photochem Photobiol B, 8, 223-5. Dougherty, T. J., Sumlin, A. B., Greco, W. R., Weishaupt, K. R., Vaughan, L. A., & Pandey, R. K. (2002). The role of the peripheral benzodiazepine receptor in photodynamic activity of certain pyropheophorbide ether photosensitizers: Albumin site II as a surrogate marker for activity. Photochem. Photobiol, 76, 91-97. Douki, T., Onuki, J., Medeiros, M. H., Bechara, E. J., Cadet, J., & Di Mascio, P. (1998). DNA alkylation by 4, 5-dioxovaleric acid, the final oxidation product of 5-aminolevulinic acid. Chem Res Toxicol, 11, 150-7. Dregoesc, D., Rybak, A. P., & Rainbow, A. J. (2007). Increased expression of p. 53 enhances transcription-coupled repair and global genomic repair of a UVC-damaged reporter gene in human cells. DNA Repair (Amst), 6, 588-601. Dummin, H., Cernay, T., & Zimmermann, H. W. (1997). Selective photosensitization of mitochondria in HeLa cells by cationic Zn (II) phthalocyanines with lipophilic side-chains. J Photochem Photobiol B, 37, 219-29. Evans, S., Matthews, W., Perry, R., Fraker, D., Norton, J., & Pass, H. I. (1990). Effect of photodynamic therapy on tumor necrosis factor production by murine macrophages. J Natl Cancer Inst, 82, 34-9. Ferrario, A., Chantrain, C. F., von Tiehl, K., Buckley, S., Rucker, N., Shalinsky, D. R. et al. (2004). The matrix metalloproteinase inhibitor prinomastat enhances photodynamic therapy responsiveness in a mouse tumor model. Cancer Res, 64, 2328-2332. Ferrario, A., Von Tiehl, K., Wong, S., Luna, M., & Gomer, C. J. (2002). Cyclooxygenase-2 inhibitor treatment enhances photodynamic therapy- mediated tumor response. Cancer Res, 62, 3956-61. Ferrario, A., von Tiehl, K. F., Rucker, N., Schwarz, M. A., Gill, P. S., & Gomer, C. J. (2000). Antiangiogenic treatment enhances photodynamic therapy responsiveness in a mouse mammary carcinoma. Cancer Re., 60, 4066-9. Fiel, R. J., Datta-Gupta, N., Mark, E. H., & Howard, J. C. (1981). Induction of DNA damage by porphyrin photosensitizers. Cancer Res, 41, 3543-3545. Figge, F. H., Weiland, G. S., & Manganiello, L. O. (1948). Affinity of neoplastic, embryonic and traumatized tissues for porphyrins and metalloporphyrins. Proc Soc Exp Biol Med, 68, 640. Fingar, V. H., Wieman, T. J., & Doak, K. W. (1990). Role of thromboxane and prostacyclin release on photodynamic therapy-induced tumor destruction. Cancer Res, 50, 2599-603.

629

Photodynamic Therapy

Fingar, V. H., Wieman, T. J., Karavolos, P. S., Doak, K. W., Ouellet, R., & van Lier, J. E. (1993). The effects of photodynamic therapy using differently substituted zinc phthalocyanines on vessel constriction, vessel leakage and tumor response. Photochem Photobiol, 58, 251-8. Firey, P. A., & Rodgers, M. A. (1987). Photo-properties of a silicon naphthalocyanine: a potential photosensitizer for photodynamic therapy. Photochem Photobiol, 45, 535-8. Fotinos, N., Campo, M. A., Popowycz, F., Gurny, R., & Lange, N. (2006). 5-Aminolevulinic acid derivatives in photomedicine: Characteristics, application and perspectives. Photochem Photobiol, 82, 994-1015. Foultier, M. T., Patrice, T., Yactayo, S., Lajat, Y., & Resche, F. (1992). Photodynamic treatment of normal endothelial cells or glioma cells in vitro. Surg Neuro, 37, 83-8. Fuchs, J., Weber, S., & Kaufmann, R. (2000). Genotoxic potential of porphyrin type photosensitizers with particular emphasis on 5-aminolevulinic acid: Implications for clinical photodynamic therapy. Free Radic. Biol. Med, 28, 537-548. Fungaloi, P., Statius van Eps, R., Wu, Y. P., Blankensteijn, J., de Groot, P., van Urk, H. et al. (2002). Platelet adhesion to photodynamic therapy-treated extracellular matrix proteins. Photochem. Photobiol, 75, 412-417. Gaullier, J. M., Geze, M., Santus, R., Sa e Melo, T., Maziere, J. C., Bazin, M. et al. (1995). Subcellular localization of and photosensitization by protoporphyrin IXhuman keratinocytes and fibroblasts cultivated with 5-aminolevulinic acid. Photochem. Photobiol, 62, 114-122. George, S. J., & Dwivedi, A. (2004). MMPs, cadherins, and cell proliferation. Trends Cardiovasc Med, 14, 100-105. Geze, M., Morliere, P., Maziere, J. C., Smith, K. M., & Santus, R. (1993). Lysosomes, a key target of hydrophobic photosensitizers proposed for photochemotherapeutic applications. J. Photochem. Photobiol. B, 20, 23-35. Gibson, S. L., Cupriks, D. J., Havens, J. J., Nguyen, M. L., & Hilf, R. (1998). A regulatory role for porphobilinogen deaminase (PBGD) in delta-aminolaevulinic acid (delta-ALA)-induced photosensitization? Br J Cancer, 77, 235-43. Girotti, A. W. (1985). Mechanisms of lipid peroxidation. J Free Radic Biol Med, 1, 87-95. Girotti, A. W. (1983). Mechanisms of photosensitization. Photochem Photobiol, 38, 745-51. Golab, J., Nowis, D., Skrzycki, M., Czeczot, H., Baranczyk-Kuzma, A., Wilczynski, G. M. et al. (2003). Antitumor effects of photodynamic therapy are potentiated by 2-methoxyestradiol. A superoxide dismutase inhibitor. J Biol. Chem., 278, 407-414. Gollnick, S. O., Evans, S. S., Baumann, H., Owczarczak, B., Maier, P., Vaughan, L. et al. (2003). Role of cytokines in photodynamic therapy-induced local and systemic inflammation. Br J Cancer, 88, 1772-1779.

630

Photodynamic Therapy

Gollnick, S. O., Lee, B. Y., Vaughan, L., Owczarczak, B., & Henderson, B. W. (2001). Activation of the IL-10 gene promoter following photodynamic therapy of murine keratinocytes. Photochem Photobiol, 73, 170-7. Gollnick, S. O., Liu, X., Owczarczak, B., Musser, D. A., & Henderson, B. W. (1997). Altered expression of interleukin 6 and interleukin 10 as a result of photodynamic therapy in vivo. Cancer Res, 57, 3904-9. Gomer, C. J. (1991a). Preclinical examination of first and second generation photosensitizers used in photodynamic therapy. Photochem Photobiol, 54, 1093-107. Gomer, C. J., Ferrario, A., Rucker, N., Wong, S., & Lee, A. S. (1991b). Glucose regulated protein induction and cellular resistance to oxidative stress mediated by porphyrin photosensitization. Cancer Res, 51, 6574-9. Gomer, C. J., Luna, M., Ferrario, A., & Rucker, N. (1991c). Increased transcription and translation of heme oxygenase in Chinese hamster fibroblasts following photodynamic stress or Photofrin II incubation. Photochem Photobiol, 53, 275-9. Gomer, C. J., Ryter, S. W., Ferrario, A., Rucker, N., Wong, S., & Fisher, A. M. (1996). Photodynamic therapy-mediated oxidative stress can induce expression of heat shock proteins. Cancer Res, 56, 235560. Granville, D. J., Carthy, C. M., Jiang, H., Levy, J. G., McManus, B. M., Matroule, J. Y. et al. (2000). Nuclear factor-kappaB activation by the photochemotherapeutic agent verteporfin. Blood, 95, 256-262. Granville, D. J., Levy, J. G., & Hunt, D. W. (1998). Photodynamic treatment with benzoporphyrin derivative monoacid ring A produces protein tyrosine phosphorylation events and DNA fragmentation in murine P815 cells. Photochem Photobiol, 67, 358-62. Granville, D. J., Ruehlmann, D. O., Choy, J. C., Cassidy, B. A., Hunt, D. W., van Breemen, C. et al. (2001). Bcl-2 increases emptying of endoplasmic reticulum Ca2+ stores during photodynamic therapyinduced apoptosis. Cell Calcium, 30, 343-350. Grebenova, D., Kuzelova, K., Smetana, K., Pluskalova, M., Cajthamlova, H., Marinov, I. et al. (2003). Mitochondrial and endoplasmic reticulum stress-induced apoptotic pathways are activated by 5-aminolevulinic acid-based photodynamic therapy in HL60 leukemia cells. J Photochem Photobiol B, 69, 71-85. Green, D. R., & Reed, J. C. (1998). Mitochondria and apoptosis. Science, 281, 1309-1312. Grossweiner, L. I. (1997). PDT light dosimetry revisited. J Photochem Photobiol B, 38, 258-268. Grune, T., Klotz, L. O., Gieche, J., Rudeck, M., & Sies, H. (2001). Protein oxidation and proteolysis by the nonradical oxidants singlet oxygen or peroxynitrite. Free Radic Biol Med, 30, 1243-1253. Hanlon, J. G., Adams, K., Rainbow, A. J., Gupta, R. S., & Singh, G. (2001). Induction of Hsp60 by Photofrin-mediated photodynamic therapy. J Photochem Photobiol B, 64, 55-61. Hausman, W. (1911). Die sensibilisierende wirkung des hematoporphyrins. Biochem Z, 30, 276.

631

Photodynamic Therapy

He, X. Y., Sikes, R. A., Thomsen, S., Chung, L. W., & Jacques, S. L. (1994). Photodynamic therapy with photofrin II induces programmed cell death in carcinoma cell lines. Photochem Photobiol, 59, 468-73. Henderson, B. W., & Donovan, J. M. (1989). Release of prostaglandin E2 from cells by photodynamic treatment in vitro. Cancer Res, 49, 6896-900. Hendrickx, N., Volanti, C., Moens, U., Seternes, O. M., de Witte, P., Vandenheede, J. R. et al. (2003). Up-regulation of cyclooxygenase-2 and apoptosis resistance by p38 MAPK in hypericin-mediated photodynamic therapy of human cancer cells. J Biol Chem, 278, 52231-52239. Herman, S., Kalechman, Y., Gafter, U., Sredni, B., & Malik, Z. (1996). Photofrin II induces cytokine secretion by mouse spleen cells and human peripheral mononuclear cells. Immunopharmacology, 31, 195-204. Hsieh, Y. J., Wu, C. C., Chang, C. J., & Yu, J. S. (2003). Subcellular localization of Photofrin determines the death phenotype of human epidermoid carcinoma A431 cells triggered by photodynamic therapy: when plasma membranes are the main targets. J Cell Physiol, 194, 363-375. Hubmer, A., Hermann, A., Uberriegler, K., & Krammer, B. (1996). Role of calcium in photodynamically induced cell damage of human fibroblasts. Photochem Photobiol, 64, 211-215. Hynes, R. O. (2002). Integrins: bidirectional, allosteric signaling machines. Cell, 110, 673-687. Jalili, A., Makowski, M., Switaj, T., Nowis, D., Wilczynski, G. M., Wilczek, E. et al. (2004). Effective photoimmunotherapy of murine colon carcinoma induced by the combination of photodynamic therapy and dendritic cells. Clin Cancer Res, 10, 4498-4508. Jesionek, A., & von Tappenier, H. (1903). Zur behandlung der hautcarcinomit mit fluorescierenden stoffen. Muench Med Wochneshr, 47, 2042. Jiang, F., Zhang, Z. G., Katakowski, M., Robin, A. M., Faber, M., Zhang, F. et al. (2004). Angiogenesis induced by photodynamic therapy in normal rat brains. Photochem Photobiol, 79, 494-498. Joshi, P. G., Joshi, K., Mishra, S., & Joshi, N. B. (1994). Ca2+ influx induced by photodynamic action in human cerebral glioma (U-87 MG) cells: possible involvement of a calcium channel. Photochem Photobiol, 60, 244-248. Kerr, J. F., Wyllie, A. H., & Currie, A. R. (1972). Apoptosis: a basic biological phenomenon with wideranging implications in tissue kinetics. Br J Cancer, 26, 239-257. Kessel, D. (1982). Components of hematoporphyrin derivatives and their tumor-localizing capacity. Cancer Res, 42, 1703-6. Kessel, D. (1989a). On the purity and definition of oligomeric HPD formulations. J Photochem Photobiol B, 3, 637-8. Kessel, D. (1989b). Probing the structure of HPD by fluorescence spectroscopy. Photochem Photobiol, 50, 345-50.

632

Photodynamic Therapy

Kessel, D. (1986). Proposed structure of the tumor-localizing fraction of HPD (hematoporphyrin derivative). Photochem Photobiol, 44, 193-6. Kessel, D., Antolovich, M., & Smith, K. M. (2001). The role of the peripheral benzodiazepine receptor in the apoptotic response to photodynamic therapy. Photochem Photobiol, 74, 346-9. Kessel, D., & Arroyo, A. S. (2007). Apoptotic and autophagic responses to Bcl-2 inhibition and photodamage. Photochem Photobiol Sci, 6, 1290-5. Kessel, D., Luguya, R., & Vicente, M. G. (2003). Localization and photodynamic efficacy of two cationic porphyrins varying in charge distributions. Photochem Photobiol, 78, 431-435. Kessel, D., & Luo, Y. (1999). Photodynamic therapy: a mitochondrial inducer of apoptosis. Cell Death Differ, 6, 28-35. Kessel, D., Luo, Y., Deng, Y., & Chang, C. K. (1997). The role of subcellular localization in initiation of apoptosis by photodynamic therapy. Photochem Photobiol, 65, 422-6. Kessel, D., & Poretz, R. D. (2000). Sites of photodamage induced by photodynamic therapy with a chlorin e6 triacetoxymethyl ester (CAME). Photochem Photobiol, 71, 94-6. Kessel, D., & Thompson, P. (1987). Purification and analysis of hematoporphyrin and hematoporphyrin derivative by gel exclusion and reverse-phase chromatography. Photochem Photobiol, 46, 1023-5. Kessel, D., Vicente, M. G., & Reiners, J. J., Jr. (2006). Initiation of apoptosis and autophagy by photodynamic therapy. Autophagy, 2, 289-90. Kick, G., Messer, G., Goetz, A., Plewig, G., & Kind, P. (1995). Photodynamic therapy induces expression of interleukin 6 by activation of AP-1 but not NF-kappa B DNA binding. Cancer Res, 55, 2373-2379. Kick, G., Messer, G., Plewig, G., Kind, P., & Goetz, A. E. (1996). Strong and prolonged induction of c-jun and c-fos proto-oncogenes by photodynamic therapy. Br J Cancer, 74, 30-36. Kim, K. W., Mutter, R. W., Cao, C., Albert, J. M., Freeman, M., Hallahan, D. E. et al. (2006). Autophagy for cancer therapy through inhibition of pro-apoptotic proteins and mammalian target of rapamycin signaling. J Biol Chem, 281, 36883-90. Klotz, L. O., Fritsch, C., Briviba, K., Tsacmacidis, N., Schliess, F., & Sies, H. (1998). Activation of JNK and p38 but not ERK MAP kinases in human skin cells by 5-aminolevulinate-photodynamic therapy. Cancer Res, 58, 4297-4300. Kondo, Y., & Kondo, S. (2006). Autophagy and cancer therapy. Autophagy, 2, 85-90. Koukourakis, M. I., Corti, L., Skarlatos, J., Giatromanolaki, A., Krammer, B., Blandamura, S. et al. (2001a). Clinical and experimental evidence of Bcl-2 involvement in the response to photodynamic therapy. Anticancer Res, 21, 663-668. Koukourakis, M. I., Giatromanolaki, A., Skarlatos, J., Corti, L., Blandamura, S., Piazza, M. et al. (2001b). Hypoxia inducible factor (HIF-1a and HIF-2a) expression in early esophageal cancer and response to photodynamic therapy and radiotherapy. Cancer Res, 61, 1830-1832.

633

Photodynamic Therapy

Kral, V., Davis, J., Andrievsky, A., Kralova, J., Synytsya, A., Pouckova, P. et al. (2002). Synthesis and biolocalization of water-soluble sapphyrins. J Med Chem, 45, 1073-8. Kucharczak, J., Simmons, M. J., Fan, Y., & Gelinas, C. (2003). To be, or not to be: NF-kappaB is the answer--role of Rel/NF-kappaB in the regulation of apoptosis. Oncogene, 22, 8961-8982. Lavie, G., Kaplinsky, C., Toren, A., Aizman, I., Meruelo, D., Mazur, Y. et al. (1999). A photodynamic pathway to apoptosis and necrosis induced by dimethyl tetrahydroxyhelianthrone and hypericin in leukaemic cells: possible relevance to photodynamic therapy. Br J Cancer, 79, 423-432. Lehmann, P. (2007). Methyl aminolaevulinate-photodynamic therapy: a review of clinical trials in the treatment of actinic keratoses and nonmelanoma skin cancer. Br J Dermatol, 156, 793-801. Leist, M., & Jaattela, M. (2001). Four deaths and a funeral: from caspases to alternative mechanisms. Nat Rev Mol Cell Biol, 2, 589-598. Lipson, R. L., & Baldes, E. J. (1960). The photodynamic properties of a particular hematoporphyin derivative. Arch Dermatol, 82, 508. Lu, W. D., & Atkins, W. M. (2004). A novel antioxidant role for ligandin behavior of glutathione Stransferases: attenuation of the photodynamic effects of hypericin. Biochemistry, 43, 12761-12769. Luna, M. C., Chen, X., Wong, S., Tsui, J., Rucker, N., Lee, A. S. et al. (2002). Enhanced photodynamic therapy efficacy with inducible suicide gene therapy controlled by the grp promoter. Cancer Res, 62, 1458-1461. Luna, M. C., Ferrario, A., Wong, S., Fisher, A. M., & Gomer, C. J. (2000). Photodynamic therapy-mediated oxidative stress as a molecular switch for the temporal expression of genes ligated to the human heat shock promoter. Cancer Res, 60, 1637-44. Luna, M. C., Wong, S., & Gomer, C. J. (1994). Photodynamic therapy mediated induction of early response genes. Cancer Res, 54, 1374-80. Ma, J., & Jiang, L. (2001). Photogeneration of singlet oxygen (1O2) and free radicals (Sen*-, O2*-) by tetra-brominated hypocrellin B derivative. Free Radical Research, 35, 767-777. MacDonald, I. J., Morgan, J., Bellnier, D. A., Paszkiewicz, G. M., Whitaker, J. E., Litchfield, D. J. et al. (1999). Subcellular localization patterns and their relationship to photodynamic activity of pyropheophorbide-a derivatives. Photochem Photobiol, 70, 789-97. Martinou, J. C., & Green, D. R. (2001). Breaking the mitochondrial barrier. Nat Rev Mo Cell Biol, 2, 63-67. Matroule, J. Y., Bonizzi, G., Morliere, P., Paillous, N., Santus, R., Bours, V. et al. (1999). Pyropheophorbide-a methyl ester-mediated photosensitization activates transcription factor NF-kappaB through the interleukin-1 receptor-dependent signaling pathway. J Biol Chem, 274, 2988-3000. Mazure, N. M., Brahimi-Horn, M. C., Berta, M. A., Benizri, E., Bilton, R. L., Dayan, F. et al. (2004). HIF-1: master and commander of the hypoxic world. A pharmacological approach to its regulation by siRNAs. Biochem Pharmacol, 68, 971-980.

634

Photodynamic Therapy

Midden, W. R., & Dahl, T. A. (1992). Biological inactivation by singlet oxygen: distinguishing O2(1 delta g) and O2(1 sigma g+). Biochim Biophys Acta, 1117, 216-222. Mitra, S., Goren, E. M., Frelinger, J. G., & Foster, T. H. (2003). Activation of heat shock protein 70 promoter with meso-tetrahydroxyphenyl chlorin photodynamic therapy reported by green fluorescent protein in vitro and in vivo. Photochem Photobiol, 78, 615-622. Moan, J., & Berg, K. (1991). The photodegradation of porphyrins in cells can be used to estimate the lifetime of singlet oxygen. Photochem Photobiol, 53, 549-553. Momma, T., Hamblin, M. R., Wu, H. C., & Hasan, T. (1998). Photodynamic therapy of orthotopic prostate cancer with benzoporphyrin derivative: local control and distant metastasis. Cancer Res, 58, 5425-31. Moretti, L., Attia, A., Kim, K. W., & Lu, B. (2007). Crosstalk between Bak/Bax and mTOR signaling regulates radiation-induced autophagy. Autophagy, 3, 142-4. Morgan, J., & Oseroff, A. R. (2001). Mitochondria-based photodynamic anti-cancer therapy. Adv Drug Deliv Rev, 49, 71-86. Morimoto, R. I. (1993). Cells in stress: transcriptional activation of heat shock genes. Science, 259, 1409-1410. Morris, R. L., Azizuddin, K., Lam, M., Berlin, J., Nieminen, A. L., Kenney, M. E. et al. (2003). Fluorescence resonance energy transfer reveals a binding site of a photosensitizer for photodynamic therapy. Cancer Res, 63, 5194-5197. Morris, R. L., Varnes, M. E., Kenney, M. E., Li, Y. S., Azizuddin, K., McEnery, M. W. et al. (2002). The peripheral benzodiazepine receptor in photodynamic therapy with the phthalocyanine photosensitizer Pc 4. Photochem Photobiol, 75, 652-661. Murray, A. W. (1998). MAP kinases in meiosis. Cell, 92, 157-159. Nagata, S., Obana, A., Gohto, Y., & Nakajima, S. (2003). Necrotic and apoptotic cell death of human malignant melanoma cells following photodynamic therapy using an amphiphilic photosensitizer, ATXS10(Na). Lasers Surg Med, 33, 64-70. Nakano, H. (2004). Signaling crosstalk between NF-kappaB and JNK. Trends Immunol, 25, 402-405. Nseyo, U. O., Whalen, R. K., Duncan, M. R., Berman, B., & Lundahl, S. L. (1990). Urinary cytokines following photodynamic therapy for bladder cancer. A preliminary report. Urology, 36, 167-171. Nyman, E. S., & Hynninen, P. H. (2004). Research advances in the use of tetrapyrrolic photosensitizers for photodynamic therapy. J Photochem Photobiol B, 73, 1-28. Oleinick, N. L., & Evans, H. H. (1998). The photobiology of photodynamic therapy: cellular targets and mechanisms. Radiat Res, 150, S146-56. Onuki, J., Teixeira, P. C., Medeiros, M. H., Dornemann, D., Douki, T., Cadet, J. et al. (2002). Is 5-aminolevulinic acid involved in the hepatocellular carcinogenesis of acute intermittent porphyria? Cell Mol Biol, 48, 17-26.

635

Photodynamic Therapy

Orenstein, A., Kostenich, G., Roitman, L., Shechtman, Y., Kopolovic, Y., Ehrenberg, B. et al. (1996). A comparative study of tissue distribution and photodynamic therapy selectivity of chlorin e6, Photofrin II and ALA-induced protoporphyrin IX in a colon carcinoma model. Br J Cancer, 73, 937-44. Ortel, B., Chen, N., Brissette, J., Dotto, G. P., Maytin, E., & Hasan, T. (1998). Differentiation-specific increase in ALA-induced protoporphyrin IX accumulation in primary mouse keratinocytes. Br J Cancer, 77, 1744-51. Oseroff, A. R., Ohuoha, D., Ara, G., McAuliffe, D., Foley, J., & Cincotta, L. (1986). Intramitochondrial dyes allow selective in vitro photolysis of carcinoma cells. Proc Natl Acad Sci USA, 83, 9729-33. Patel, K. D., Cuvelier, S. L., & Wiehler, S. (2002). Selectins: critical mediators of leukocyte recruitment. Semi Immunol, 14, 73-81. Peng, Q., Moan, J., Nesland, J. M., & Rimington, C. (1990). Aluminum phthalocyanines with asymmetrical lower sulfonation and with symmetrical higher sulfonation: a comparison of localizing and photosensitizing mechanism in human tumor LOX xenografts. Int J Cancer, 46, 719-26. Peng, Q., Warloe, T., Berg, K., Moan, J., Kongshaug, M., Giercksky, K. E. et al. (1997). 5-Aminolevulinic acid-based photodynamic therapy. Clinical research and future challenges. Cancer, 79, 2282-308. Penning, L. C., Keirse, M. J., VanSteveninck, J., & Dubbelman, T. M. (1993). Ca(2+)-mediated prostaglandin E2 induction reduces haematoporphyrin-derivative-induced cytotoxicity of T24 human bladder transitional carcinoma cells in vitro. Biochem J, 292 ( Pt 1), 237-240. Penning, L. C., Rasch, M. H., Ben-Hur, E., Dubbelman, T. M., Havelaar, A. C., Van der Zee, J. et al. (1992). A role for the transient increase of cytoplasmic free calcium in cell rescue after photodynamic treatment. Biochim Biophys Acta, 1107, 255-260. Piret, B., Legrand-Poels, S., Sappey, C., & Piette, J. (1995). NF-kappa B transcription factor and human immunodeficiency virus type 1 (HIV-1) activation by methylene blue photosensitization. Eur J Biochem, 228, 447-455. Plaetzer, K., Kiesslich, T., Krammer, B., & Hammerl, P. (2002). Characterization of the cell death modes and the associated changes in cellular energy supply in response to AlPcS4-PDT. Photochem Photobiol Sci, 1, 172-177. Pluskalova, M., Peslova, G., Grebenova, D., Halada, P., & Hrkal, Z. (2006). Photodynamic treatment (ALA-PDT) suppresses the expression of the oncogenic Bcr-Abl kinase and affects the cytoskeleton organization in K562 cells. J Photochem Photobiol B, 83, 205-12. Rashid, F., & Horobin, R. W. (1990). Interaction of molecular probes with living cells and tissues. Part 2. A structure-activity analysis of mitochondrial staining by cationic probes, and a discussion of the synergistic nature of image-based and biochemical approaches. Histochemistry, 94, 303-8. Ravanat, J. L., & Cadet, J. (1995). Reaction of singlet oxygen with 2’-deoxyguanosine and DNA. Isolation and characterization of the main oxidation products. Chem Res Toxicol, 8, 379-88. Renno, R. Z., Delori, F. C., Holzer, R. A., Gragoudas, E. S., & Miller, J. W. (2000). Photodynamic therapy using Lu-Tex induces apoptosis in vitro, and its effect is potentiated by angiostatin in retinal capillary endothelial cells. Invest Ophthalmol Vis Sci, 41, 3963-3971. 636

Photodynamic Therapy

Rousset, N., Keminon, E., Eleouet, S., Le Neel, T., Auget, J. L., Vonarx, V. et al. (2000). Use of alkaline Comet assay to assess DNA repair after m-THPC-PDT. J Photochem Photobiol B, 56, 118-131. Rousset, N., Vonarx, V., Eleouet, S., Carre, J., Kerninon, E., Lajat, Y. et al. (1999). Effects of photodynamic therapy on adhesion molecules and metastasis. J Photochem Photobiol B, 52, 65-73. Ruck, A., Heckelsmiller, K., Kaufmann, R., Grossman, N., Haseroth, E., & Akgun, N. (2000). Lightinduced apoptosis involves a defined sequence of cytoplasmic and nuclear calcium release in AlPcS4photosensitized rat bladder RR 1022 epithelial cells. Photochem Photobiol, 72, 210-216. Ruhdorfer, S., Sanovic, R., Sander, V., Krammer, B., & Verwanger, T. (2007). Gene expression profiling of the human carcinoma cell line A-431 after 5-aminolevulinic acid-based photodynamic treatment. Int J Oncol, 30, 1253-62. Ruiz-Galindo, E., Arenas-Huertero, F., & Ramon-Gallegos, E. (2007). Expression of genes involved in heme biosynthesis in the human retinoblastoma cell lines WERI-Rb-1 and Y79: implications for photodynamic therapy. J Exp Clin Cancer Res, 26, 195-200. Runnels, J. M., Chen, N., Ortel, B., Kato, D., & Hasan, T. (1999). BPD-MA-mediated photosensitization in vitro and in vivo: cellular adhesion and beta1 integrin expression in ovarian cancer cells. Br J Cancer, 80, 946-53. Ryter, S. W., & Gomer, C. J. (1993). Nuclear factor kappa B binding activity in mouse L1210 cells following photofrin II-mediated photosensitization. Photochem Photobiol, 58, 753-6. Salet, C., Moreno, G., Ricchelli, F., & Bernardi, P. (1997). Singlet oxygen produced by photodynamic action causes inactivation of the mitochondrial permeability transition pore. J Biol Chem, 272, 2193843. Santini, M. P., Talora, C., Seki, T., Bolgan, L., & Dotto, G. P. (2001). Cross talk among calcineurin, Sp1/Sp3, and NFAT in control of p21(WAF1/CIP1) expression in keratinocyte differentiation. Proc Natl Acad Sci USA, 98, 9575-9580. Scheid, M. P., & Woodgett, J. R. (2003). Unravelling the activation mechanisms of protein kinase B/Akt. FEBS Lett, 546, 108-112. Schieke, S. M., von Montfort, C., Buchczyk, D. P., Timmer, A., Grether-Beck, S., Krutmann, J. et al. (2004). Singlet oxygen-induced attenuation of growth factor signaling: possible role of ceramides. Free Radic Res, 38, 729-737. Semenza, G. L. (2004). Hydroxylation of HIF-1: oxygen sensing at the molecular level. Physiology, 19, 176-182. Separovic, D., Mann, K. J., & Oleinick, N. L. (1998). Association of ceramide accumulation with photodynamic treatment-induced cell death. Photochem Photobiol, 68, 101-9. Separovic, D., Pink, J. J., Oleinick, N. A., Kester, M., Boothman, D. A., McLoughlin, M. et al. (1999). Niemann-Pick human lymphoblasts are resistant to phthalocyanine 4-photodynamic therapy-induced apoptosis. Biochem Biophys Res Commun, 258, 506-12.

637

Photodynamic Therapy

Sessler, J. L., & Miller, R. A. (2000). Texaphyrins: new drugs with diverse clinical applications in radiation and photodynamic therapy. Biochem Pharmacol, 59, 733-9. Shao, C., Furusawa, Y., Kobayashi, Y., Funayama, T., & Wada, S. (2003). Bystander effect induced by counted high-LET particles in confluent human fibroblasts: a mechanistic study. FASEB J, 17, 14221427. Shaulian, E., & Karin, M. (2002). AP-1 as a regulator of cell life and death. Nat Cell Biol, 4, E131-6. Shen, X. Y., Zacal, N., Singh, G., & Rainbow, A. J. (2005). Alterations in mitochondrial and apoptosisregulating gene expression in photodynamic therapy-resistant variants of HT29 colon carcinoma cells. Photochem Photobiol, 81, 306-13. Shi, Y. (2004a). Caspase activation, inhibition, and reactivation: a mechanistic view. Protein science: A Publication of the Protein Society, 13, 1979-1987. Shi, Y. (2004b). Caspase activation: revisiting the induced proximity model. Cell, 117, 855-858. Specht, K. G., & Rodgers, M. A. (1991). Plasma membrane depolarization and calcium influx during cell injury by photodynamic action. Biochim Biophys Acta, 1070, 60-68. Spikes, J. D. (1990). Chlorins as photosensitizers in biology and medicine. J Photochem Photobiol B, 6, 259-74. Spikes, J. D., & Bommer, J. C. (1993). Photobleaching of mono-L-aspartyl chlorin e6 (NPe6): a candidate sensitizer for the photodynamic therapy of tumors. Photochem Photobiol, 58, 346-50. Stevens, C., & La Thangue, N. B. (2003). E2F and cell cycle control: a double-edged sword. Arch Biochem Biophys, 412, 157-169. Stockert, J. C., Canete, M., Juarranz, A., Villanueva, A., Horobin, R. W., Borrell, J. I. et al. (2007). Porphycenes: facts and prospects in photodynamic therapy of cancer. Curr Med Chem, 14, 997-1026. Stockert, J. C., Juarranz, A., Villanueva, A., & Canete, M. (1996). Photodynamic damage to HeLa cell microtubules induced by thiazine dyes. Cancer Chemother Pharmacol, 39, 167-9. Stott, B., & Korbelik, M. (2007). Activation of complement C3, C5, and C9 genes in tumors treated by photodynamic therapy. Cancer Immunol Immunother, 56, 649-58. Sun, J., Cecic, I., Parkins, C. S., & Korbelik, M. (2002a). Neutrophils as inflammatory and immune effectors in photodynamic therapy-treated mouse SCCVII tumours. Photochem Photobiol Sci, 1, 690-695. Sun, X., & Leung, W. N. (2002b). Photodynamic therapy with pyropheophorbide-a methyl ester in human lung carcinoma cancer cell: efficacy, localization and apoptosis. Photochemistry and photobiology, 75, 644-651. Svaasand, L. O. (1984). Optical dosimetry for direct and interstitial photoradiation therapy of malignant tumors. Prog Clin Biol Res, 170, 91-114. Svanberg, K., Liu, D. L., Wang, I., Andersson-Engels, S., Stenram, U., & Svanberg, S. (1996). Photodynamic therapy using intravenous delta-aminolaevulinic acid-induced protoporphyrin IX sensitisation in experimental hepatic tumours in rats. Br J Cancer, 74, 1526-33.

638

Photodynamic Therapy

Szeimies, R. M., Sassy, T., & Landthaler, M. (1994). Penetration potency of topical applied delta-aminolevulinic acid for photodynamic therapy of basal cell carcinoma. Photochem Photobiol, 59, 73-6. Takeuchi, Y., Kurohane, K., Ichikawa, K., Yonezawa, S., Nango, M., & Oku, N. (2003). Induction of intensive tumor suppression by antiangiogenic photodynamic therapy using polycation-modified liposomal photosensitizer. Cancer, 97, 2027-2034. Tao, J., Sanghera, J. S., Pelech, S. L., Wong, G., & Levy, J. G. (1996). Stimulation of stress-activated protein kinase and p38 HOG1 kinase in murine keratinocytes following photodynamic therapy with benzoporphyrin derivative. J Biol Chem, 271, 27107-15. Teiten, M. H., Bezdetnaya, L., Morliere, P., Santus, R., & Guillemin, F. (2003). Endoplasmic reticulum and Golgi apparatus are the preferential sites of Foscan localisation in cultured tumour cells. B J Cancer, 88, 146-152. Thibaut, S., Bourre, L., Hernot, D., Rousset, N., Lajat, Y., & Patrice, T. (2002). Effects of BAPTA-AM, Forskolin, DSF and Z.VAD.fmk on PDT-induced apoptosis and m-THPC phototoxicity on B16 cells. Apoptosis, 7, 99-106. Tong, Z., Singh, G., & Rainbow, A. J. (2002). Sustained activation of the extracellular signal-regulated kinase pathway protects cells from photofrin-mediated photodynamic therapy. Cancer Res, 62, 55285535. Torriglia, A., Perani, P., Brossas, J. Y., Altairac, S., Zeggai, S., Martin, E. et al. (2000). A caspase-independent cell clearance program. The LEI/L-DNase II pathway. Ann N Y Acad Sci, 926, 192-203. Trivedi, N. S., Wang, H. W., Nieminen, A. L., Oleinick, N. L., & Izatt, J. A. (2000). Quantitative analysis of Pc 4 localization in mouse lymphoma (LY-R) cells via double-label confocal fluorescence microscopy. Photochem Photobiol, 71, 634-639. Uehara, M., Inokuchi, T., Sano, K., & ZuoLin, W. (2001). Expression of vascular endothelial growth factor in mouse tumours subjected to photodynamic therapy. Eur J Cancer, 37, 2111-2115. Usuda, J., Azizuddin, K., Chiu, S. M., & Oleinick, N. L. (2003). Association between the photodynamic loss of Bcl-2 and the sensitivity to apoptosis caused by phthalocyanine photodynamic therapy. Photochem Photobiol, 78, 1-8. Usuda, J., Okunaka, T., Furukawa, K., Tsuchida, T., Kuroiwa, Y., Ohe, Y. et al. (2001). Increased cytotoxic effects of photodynamic therapy in IL-6 gene transfected cells via enhanced apoptosis. Int J Cancer, 93, 475-480. Uzdensky, A. B., Juzeniene, A., Kolpakova, E., Hjortland, G. O., Juzenas, P., & Moan, J. (2004). Photosensitization with protoporphyrin IX inhibits attachment of cancer cells to a substratum. Biochem Biophys Res Commun, 322, 452-457. van den Boogert, J., van Hillegersberg, R., de Rooij, F. W., de Bruin, R. W., Edixhoven-Bosdijk, A., Houtsmuller, A. B. et al. (1998). 5-Aminolaevulinic acid-induced protoporphyrin IX accumulation in tissues: pharmacokinetics after oral or intravenous administration. J Photochem Photobiol B, 44, 29-38.

639

Photodynamic Therapy

Van Hillegersberg, R., Van den Berg, J. W., Kort, W. J., Terpstra, O. T., & Wilson, J. H. (1992). Selective accumulation of endogenously produced porphyrins in a liver metastasis model in rats. Gastroenterology, 103, 647-51. van Leengoed, H. L., Schuitmaker, J. J., van der Veen, N., Dubbelman, T. M., & Star, W. M. (1993). Fluorescence and photodynamic effects of bacteriochlorin a observed in vivo in ‘sandwich’ observation chambers. Br J Cancer, 67, 898-903. Verwanger, T., Sanovic, R., Aberger, F., Frischauf, A. M., & Krammer, B. (2002). Gene expression pattern following photodynamic treatment of the carcinoma cell line A-431 analysed by cDNA arrays. Int J Oncol, 21, 1353-9. Verwanger, T., Schnitzhofer, G., & Krammer, B. (1998). Expression kinetics of the (proto) oncogenes c-myc and bcl-2 following photodynamic treatment of normal and transformed human fibroblasts with 5aminolaevulinic acid-stimulated endogenous protoporphyrin IX. J Photochem Photobiol B, 45, 131-5. Volanti, C., Gloire, G., Vanderplasschen, A., Jacobs, N., Habraken, Y., & Piette, J. (2004). Downregulation of ICAM-1 and VCAM-1 expression in endothelial cells treated by photodynamic therapy. Oncogene, 23, 8649-8658. Volanti, C., Matroule, J. Y., & Piette, J. (2002). Involvement of oxidative stress in NF-kappaB activation in endothelial cells treated by photodynamic therapy. Photochem Photobiol, 75, 36-45. Vonarx, V., Foultier, M. T., Xavier de Brito, L., Anasagasti, L., Morlet, L., & Patrice, T. (1995). Photodynamic therapy decreases cancer colonic cell adhesiveness and metastatic potential. Res Exp Med (Berl), 195, 101-116. Wang, H. P., Hanlon, J. G., Rainbow, A. J., Espiritu, M., & Singh, G. (2002). Up-regulation of Hsp27 plays a role in the resistance of human colon carcinoma HT29 cells to photooxidative stress. Photochem Photobiol, 76, 98-104. Whitacre, C. M., Feyes, D. K., Satoh, T., Grossmann, J., Mulvihill, J. W., Mukhtar, H. et al. (2000). Photodynamic therapy with the phthalocyanine photosensitizer Pc 4 of SW480 human colon cancer xenografts in athymic mice. Clin Cancer Res, 6, 2021-7. Wilson, B. C., Jeeves, W. P., & Lowe, D. M. (1985). In vivo and post mortem measurements of the attenuation spectra of light in mammalian tissues. Photochem Photobiol, 42, 153-62. Wong, T. W., Tracy, E., Oseroff, A. R., & Baumann, H. (2003). Photodynamic therapy mediates immediate loss of cellular responsiveness to cytokines and growth factors. Cancer Res, 63, 3812-3818. Woodburn, K. W., Fan, Q., Miles, D. R., Kessel, D., Luo, Y., & Young, S. W. (1997). Localization and efficacy analysis of the phototherapeutic lutetium texaphyrin (PCI-0123) in the murine EMT6 sarcoma model. Photochem Photobiol, 65, 410-5. Woodburn, K. W., Vardaxis, N. J., Hill, J. S., Kaye, A. H., & Phillips, D. R. (1991). Subcellular localization of porphyrins using confocal laser scanning microscopy. Photochem Photobiol, 54, 725-32. Woods, J. A., Traynor, N. J., Brancaleon, L., & Moseley, H. (2004). The effect of photofrin on DNA strand breaks and base oxidation in HaCaT keratinocytes: a comet assay study. Photochem Photobiol, 79, 105-113. 640

Photodynamic Therapy

Xue, L., He, J., & Oleinick, N. L. (1999). Promotion of photodynamic therapy-induced apoptosis by stress kinases. Cell Death Differ, 6, 855-864. Xue, L. Y., Chiu, S. M., Azizuddin, K., Joseph, S., & Oleinick, N. L. (2007a). Protection by Bcl-2 against apoptotic but not autophagic cell death after photodynamic therapy. Autophagy, 4. Xue, L. Y., Chiu, S. M., Azizuddin, K., Joseph, S., & Oleinick, N. L. (2007b). The death of human cancer cells following photodynamic therapy: apoptosis competence is necessary for Bcl-2 protection but not for induction of autophagy. Photochem Photobiol, 83, 1016-23. Xue, L. Y., Chiu, S. M., & Oleinick, N. L. (2001). Photodynamic therapy-induced death of MCF-7 human breast cancer cells: a role for caspase-3 in the late steps of apoptosis but not for the critical lethal event. Exp Cell Res, 263, 145-155. Yang, J., Yu, Y., Sun, S., & Duerksen-Hughes, P. J. (2004). Ceramide and other sphingolipids in cellular responses. Cell Biochem Biophys, 40, 323-350. Yeo, E. J., Chun, Y. S., & Park, J. W. (2004). New anticancer strategies targeting HIF-1. Biochem Pharmacol, 68, 1061-1069. Yom, S. S., Busch, T. M., Friedberg, J. S., Wileyto, E. P., Smith, D., Glatstein, E. et al. (2003). Elevated serum cytokine levels in mesothelioma patients who have undergone pleurectomy or extrapleural pneumonectomy and adjuvant intraoperative photodynamic therapy. Photochem Photobiol, 78, 75-81. Yu, L., Lenardo, M. J., & Baehrecke, E. H. (2004). Autophagy and Caspases: A New Cell Death Program. Cell Cycle, 3, 1124-1126. Zacal, N., & Rainbow, A. J. (2007). Photodynamic therapy resistant human colon carcinoma HT29 cells show cross-resistance to UVA but not UVC light. Photochem Photobiol, 83, 730-7. Zawacka-Pankau, J., Issaeva, N., Hossain, S., Pramanik, A., Selivanova, G., & Podhajska, A. J. (2007). Protoporphyrin IX interacts with wild-type p53 protein in vitro and induces cell death of human colon cancer cells in a p53-dependent and -independent manner. J Biol Chem, 282, 2466-72. Zhuang, S., & Kochevar, I. E. (2003). Singlet oxygen-induced activation of Akt/protein kinase B is independent of growth factor receptors. Photochem Photobiol, 78, 361-371.

key terms 5-ALA: 5-aminolevulinic acid, small amino-acid that is a natural precursor of PPIX. Apoptosis: Programmed cell death characterized by nuclear condensation and DNA fragmentation. Autophagy: Programmed cell death characterized by autodestruction using lysosomal machinery. BPD: Benzoporphyrin derivative, PS also known as Visudyne or Verteporfin clinically used by ophthalmologists.

641

Photodynamic Therapy

Bystander Effect: Phenomenon in which uninjured cells surrounding a dying cell also die. HPD or PF: Hematoporphyrin or Photofrin, first clinically used PS derived from ox blood. m-THPC: m-tetrahydroxyphenylchlorin, PS also known as Foscan clinically used for cancer. Necrosis: Non-programmed cell death characterized by membrane bursting. 1

O2: Singlet oxygen, excited state reactive form of oxygen.

PC: Phthalocyanine, PS containing tetrapyrrole structure but made synthetically. PDT: Photodynamic therapy, treatment combining dyes and light to destroy cells. Photobleaching: Light dependent alteration of PS molecule. PPIX: Protoporphyrin IX, naturally occuring PS whose production in cells is increased when 5ALA is administered. PS: Photosensitizer, dye (frequently a tetrapyrrole) used in PDT. 3

PS: Triplet state, a relatively long-lived excited state of PS.

RB: Rose Bengal, PS with xanthene structure and strong pink color. ROS: Reactive oxygen species general term for oxidizing species such as singlet oxygen, superoxide anion, hydrogen peroxide and hydroxyl radical. SOD: Superoxide oxide dismutase, an antioxidant enzyme that converts superoxide to hydrogen peroxide and oxygen.

642

643

Chapter XXXVI

Modeling of Porphyrin Metabolism with PyBioS Andriani Daskalaki Max Planck Institute for Molecular Genetics, Germany

abstract Photodynamic Therapy (PDT) involves administration of a photosensitizer (PS) either systemically or locally, followed by illumination of the lesion with visible light. PDT of cancer is now evolving from experimental treatment to a therapeutic alternative. Clinical results have shown that PDT is at least as efficacious as standard treatments of malignancies of the skin and Barrett’s esophagus. Hemes and heme proteins are vital components of essentially every cell in virtually all eukaryote organisms. Protoporphyrin IX (PpIX) is produced in cells via the heme synthesis pathway from the substrate aminolevulinic acid (ALA). Exogenous administration of ALA induces accumulation of (PpIX), which can be used as a photosensitiser for tumor detection or photodynamic therapy. Although the basis of the selectivity of ALA-based PDT or photodiagnosis is not fully understood, it has sometimes been correlated with the metabolic rate of the cells, or with the differential enzyme expressions along the heme biosynthetic pathway in cancer cells. An in silico analysis by modeling may be performed in order to determine the functional roles of genes coding enzymes of the heme biosynthetic pathway like ferrochelatase. Modeling and simulation systems are a valuable tool for the understanding of complex biological systems. With PyBioS, an object-oriented modelling software for biological processes, we can analyse porphyrin metabolism pathways.

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Modeling of Porphyrin Metabolism with PyBioS

INTRODUCTION The use of PDT for curative treatments of superficial tumors of the skin and for palliative treatments of disseminated tumors of skin and oral mucosa is well known (Daskalaki 2002). PDT also is efficacious as treatment of malignancies of Barrett’s oesophagus (Foroulis and Thorpe 2006). PDT is based on a photochemical process, where photosensitizers (PS) act cytotoxic by generation of 1 O2 after laser irradiation. The use of fluorescence measurements as quantitative indicators for PpIX accumulation after exogenous ALA administration is suitable for differentiating neoplastic, necrotic and inflammatory tissues from normal tissues. The modulation of ALA-induced PpIX accumulation and expression will provide more diagnostic information and more accuracy for the diagnosis of unhealthy tissue, especially in border-line cases. The modulation of fluorescence characteristics of ALA-induced PpIX with NAD has been used for differentiation between fibroblast and fibrosarcoma (Ismail et al. 1997). The flow of substrates into the porphyrin pathway is controlled by tsynthesis of d–aminolevulinic acid (ALA), the first committed precursor in the porphyrin pathway. Although light is required to trigger ALA synthesis and differentiation of chloroplasts (Reinbothe and Reinbothe, 1996), a feedback inhibition of ALA synthesis by an end product of the porphyrin pathway is thought to be involved in the regulation of influx into the pathway (Wettstein et al., 1995; Reinbothe and Reinbothe, 1996). Both the nature of the product and the mechanism involved in effecting feedback inhibition remain unknown, probably because there have been no porphyrin pathway mutants identified so far that affect both chlorophyll and heme biosyntheses. Thus, modelling of porphyrin pathway may fill this gap and allow researchers to address these questions. Downey (2002) tried to show how the porphyrin pathway may be an integral part of all disease processes through a model. Analytical techniques capable of measuring porphyrins in all cells are needed. Data gathered from plant and animal studies need to be adapted to humans where possible. An inexpensive, accurate and rapid analysis needs to be developed so porphyrins can be measured more routinely. The committed step for porphyrin synthesis is the formation of 5-aminolevulinate (ALA) by condensation of glycine (from the general amino acid pool) and succinyl-CoA (from the TCA cycle), in the mitochondrial matrix. This reaction is catalyzed by two different ALA synthases, one expressed ubiquitously (ALAS1) and the other one only expressed in erythroid precursors (ALAS2) (Ajioka, 2006). Heme inhibits the activity of ALA synthetase, the first and rate-limiting enzyme of the biosynthetic pathway, thereby preventing normal cells from drowning in excess production of its own porphyrins. This negative feedback control can be bypassed in certain malignant cells exposed to an excess amount of ALA, which is metabolised leading to overproduction of PpIX. Excess accumulation of PpIX occurs because of the enzyme configuration in malignant cells (Kirby 2001). The enzyme ferrochelatase (FECH) catalyzes insertion of an iron atom into PpIX forming heme which is not photoreactive. However, cancer cells have a relatively low activity of ferrochelatase which leads to an excess accumulation of PpIX (Schoenfeld 1988). Another factor leading to augmented PpIX synthesis is an increased activity of the rate-limiting enzyme porphobilinogen deaminase in various malignant tissues (Wilson 1991). Kemmner W et al. (2008) recently showed that in malignant tissue a transcriptional down-regulation of FECH occurs causeing endogenous PpIX accumulation. Furthermore, accumulation of intracellular PpIX because of FECH small interfering RNA (siRNA) silencing provides a small-molecule-based approach to molecular imaging and molecular therapy.

644

Modeling of Porphyrin Metabolism with PyBioS

Kemmner W et al (2008) demonstrated accumulation of the heme precursor PpIX in gastrointestinal tumor tissues. To elucidate the mechanisms of PpIX accumulation expression of the relevant enzymes in the heme synthetic pathway has been studied. Kemmner W et al (2008) described a significant downregulation of FECH mRNA expression in gastric, colonic, and rectal carcinomas. Accordingly, in an in vitro model of several carcinoma cell lines, ferrochelatase down-regulation and loss of enzymatic activity corresponded with an enhanced PpIX-dependent fluorescence. Silencing of FECH using siRNA technology led to a maximum 50-fold increased PpIX accumulation. Bhasin G et al. (1999) investigated the hypothesis that inhibition of ferrochelatase will cause in situ build up of high PpIX concentrations which may act as a putative agent for photodestruction of cancer cells. The parenteral administration of lead acetate, a known inhibitor of ferrochelatase, to mice bearing cutaneous tumors (papillomas and carcinomas) caused a six-fold enhancement in the concentration of PpIX in tumors within a period of one month. A significant reduction in tumor size was observed starting as early as day one following the treatment. 5-Aminolevulinate synthase (ALAS) is a mitochondrial enzyme that catalyzes the first step of the heme biosynthetic pathway. Mitochondrial import as well as synthesis of the nonspecific ALAS isoform (ALAS1) is regulated by heme through a feedback mechanism (Munakata 2004).

Mutations A deficiency of FECH activity underlies the excess accumulation of protoporphyrin that occurs in erythropoietic protoporphyria (EPP). In some patients, protoporphyrin accumulation causes liver damage that necessitates liver transplantation. Mutations of the codons for 2 of [2Fe-2S] cluster ligands in patients with EPP support the importance of the iron-sulfur center for proper functioning of mammalian

Figure. 1. Schematic illustration of PpIX biosynthesis. One part of the synthesis is localized in mitochondrium the other part in cytoplasm. In this scheme not all biosynthesis steps are to be seen.

645

Modeling of Porphyrin Metabolism with PyBioS

FECH and, at least in humans, its absence has a direct clinical impact (Schneider-Yin X. et al. 2000). Fu-Ping Chen et al.(2002) studied patients who developed liver disease with mutations in the FECH gene. Recent attempts to increase the efficacy of ALA-mediated PDT include the use of iron chelators to decrease the amount of PPIX converted to heme by FECH in removing the free iron that is necessary for the enzyme to work (Curnow, 1998. Ferreira et al., 1999). X-linked sideroblastic anemias (XLSAs), a group of severe disorders in humans characterized by inadequate formation of heme in erythroblast mitochondria, are caused by mutations in the gene for erythroid eALAS, one of two human genes for ALAS (Astner et al., 2005). Cloning and expression of the defective gene for delta-aminolevulinate dehydratase (ALAD) from patients with ALAD deficiency porphyria (ADP) were performed by Akagi et al.(2000). Mitchel et al.(2001), studied Escherichia coli and human porphobilinogen synthase (PBGS) mutants.

MODELING OF PORPHYRIN METABOLISM Quantitative modeling studies of pathways have been successfully applied to understand complex cellular processes (Schoeberl 2002, Klipp 2005). Particular attention has been paid to the way, in which PpIX is distributed and accumulated in cells under the effect of ALA (Gaullier et al. 1995). For induction of a clinical effect it is important to recognize the kinetics of PpIX accumulation in cells, as influenced by the applied ALA dose . Cellular content of tis photosensitizer precursor should be optimal for induction of the photodestructive effect, following light exposure of targeted neoplastic lesions. The kinetics of PpIX formation under the effect of exogenous ALA is thought to result from circumvented bottle-neck linked to synthesis of endogenous ALA, the level of which remains under control of free heme (Kennedy and Pottier (1992). Considering that these problems may not only be of theoretical significance, but also have a practical value for establishing conditions of a photodynamic therapy,we have to define kinetics of PpIX accumulation in different cells under the effect of various concentrations of ALA.

Pathway Databases Pathway databases can act as a rich source for such graphs, because a reaction graph is simply a pathway. The reactome pathway database (Vastrik et al., 2007) has been used as a key starting point for kinetic modelling since it entails detailed models for reaction graphs, which describe the series of biochemical events involved in the models and their relationships. The graphs establish a framework for the models and suggest the kinetic coefficients that should be obtained experimentally. Kamburov et al. (2006) developed ConsensusPathDB (Figure 1), a database that helps users to summarize and verify pathway information and to enrich a priori information in the process of model annotation. The database model allows integration of information on metabolic, signal transduction and gene regulatory networks. Cellular reaction networks are stored in a PostgreSQL database and can be accessed under http://pybios.molgen.mpg.de/CPDB. By forward modelling we integrate all interactive properties of molecular components to understand systems behavior (Westerhoff et al. 2008). The forward-modeling approach supports the formulation

646

Modeling of Porphyrin Metabolism with PyBioS

Figure 2. CPDB database. ConsensusPathDB assists the development, expansion and refinement of computational models of biological systems and the context-specific visualization of models provided in SBML.

of hypothesezing for e.g. in silico knock-out experiments. Thus, to construct a model of the porphyrin metabolism pathway, one should consider one enzymatic or transport step at a time, should comb the literature for information about this enzyme, its cofactors and modulators, and should translate this information into a mathematical rate law which could be a Michaelis-Menten, among a wide variety of possibilities. The collection of all rate laws governs the dynamics of this model. Comparisons of model responses with biological observations support the validity of this appointed model or suggest adjustments in assumptions or parameter values. This forward process may lead to model representations of the pathway exhibiting the same features as reality, at least qualitatively, if not quantitatively. The porphyrin metabolism model was assembled, simulated and analysed by PybioS. PyBioS is an object-oriented tool for modeling and simulation of cellular processes. This tool has been established for the modelling of biological processes using metabolic pathways from databases like KEGG and the Reactome database. Modeling and simulation techniques are valuable tools for the understanding of complex biological systems. The platform is implemented as a Python-product for the Zope web application server environment. 647

Modeling of Porphyrin Metabolism with PyBioS

PyBioS acts as a model repository and supports the generation of large models based on publicly available information like the metabolic data of the KEGG database. An ODE-system of this model may be generated automatically based on pre- or user-defined kinetic laws and used for subsequent simulation of time course series and further analyses of the dynamic behavior of the underlying system.

Modeling with PyBioS A model of a disease-relevant pathway, such as porphyrin metabolism, has been employed to study the relationship between basic enzymes and products in the biosynthetic pathway. Visualization of the porphyrin metabolism interaction network (Figure 2) was enabled by automatically generated graphs that include information about the objects, reactions and mass- and information-flow. The model includes a total of 16 reactions, and 42 objects. It is composed of an ordinary differential equations system with 14 state variables and 16 parameters. The law of mass-action has been applied to describe the rate of porphyrin metabolism.Time-dependent changes of the concentration of participating proteins and protein complexes are determined by a system of differential equations. Mutations related to genes FECH and ALAS have been analyzed by simulating knockouts of these genes by using a mathematical model in order to study mutation effects in the concentration of heme.

Figure 3. A part of the porphyrin metabolism pathway is illustrated as a network diagram in PyBioS. Catalysis of heme formation by the enzyme ferrochelatase is illustrated in the network graphic in PyBioS.

648

Modeling of Porphyrin Metabolism with PyBioS

Figure 4. Ferrochelatase (FECH) catalyzes the terminal step of the heme biosynthetic pathway. Graphical illustration of the time course of the PpIX concentration , heme and ferrochelatase (FECH). FECH catalyzes the production of heme by PpIX.

Table 1. Parameters in the model Parameter symbol

Biological meaning

massi_k (FECH homodimer )

Heme production rate constant

deg_degradation_k (heme [mitochondrial matrix])

Heme degradation rate constant

massi_k (ALAS homodimer)

5-aminolevulinate production rate constant

massi_k (PPO homodimer (FAD cofactor)

Protoporphyrin IX production rate constant

massi_k (CPO homodimer )

Protoporphyrinogen IX production rate constant

ComplexFormationReversible_kf (ALAD homooctamer )

Formation of complex rate constant

massi_k (ALAD homooctamer (Zinc cofactor)

Porphobilinogen production rate constant

massi_k (Porphobilinogen deaminase)

Hydroxymethylbilane (HMB) production rate constant

massi_k (UROD homodimer )

Coproporphyrinogen III production rate constant

Degradation_degradation_k (ALAD homooctamer (Pb and Zn bound)

Degradation rate constant

Degradation_degradation_k (Coproporphyrinogen I

Degradation rate constant

massi_k (Uroporphyrinogen-III synthase)

Uroporphyrinogen III production rate constant

massi_k (Protoporphyrin IX)

Export rate constant for Protoporphyrin IX

massi_k (Coproporphyrinogen)

Export rate constant for Coproporphyrinogen III

massi_k (ALAD)

Formation of ALA Dehydratase inactive complex

massi_k Hydroxymethylbilane

Dissociation rate constant for Hydroxymethylbilane

649

Modeling of Porphyrin Metabolism with PyBioS

Table 2. State variables (proteins) in the model Parameter symbol

Biological meaning

5-aminolevulinate [cytosol]

5-aminolevulinate in the cytosol

5-aminolevulinate [mitochondrial matrix]

5-aminolevulinate in the mitochondrial matrix

ALAD homooctamer (Pb and Zn bound) [cytosol]

ALA Dehydratase inactive complex in the cytosol

ALAD homooctamer (Zinc cofactor) [cytosol]

ALA Dehydratase in the cytosol

ALAS homodimer [mitochondrial matrix]

ALA Synthetase in the mitochondrial matrix

Coproporphyrinogen I [cytosol]

Coproporphyrinogen I in the cytosol

Coproporphyrinogen III [cytosol]

Coproporphyrinogen III in the cytosol

Coproporphyrinogen III [mitochondrial intermembrane space]

Coproporphyrinogen III in the mitochondrial intermembrane space

CPO homodimer [mitochondrial intermembrane space]

Coproporphyrinogen oxidase in the mitochondrial intermembrane space

FECH homodimer (2Fe-2S cluster) [mitochondrial matrix]

Ferrochelatase in the mitochondrial matrix

heme [mitochondrial matrix]

Heme in the mitochondrial matrix

PPO homodimer (FAD cofactor) [mitochondrial intermembrane space]

Protoporphyrinogen oxidase in the mitochondrial intermembrane space

UROD homodimer [cytosol]

Uroporphyrinogen III-Decarboxylase in the cytosol

Uroporphyrinogen-III synthase [cytosol]

Uroporphyrinogen-III synthase in the cytosol

Figure 5. A diagram summarizing the heme production. Illustration of (A) heme production and (B) PPIX time course in case of mutation of ferrochelatase. FECH inhibition is indicated by a blunted line. The simulation analysis of the model indicates that FECH inhibition caused a (B) decrease of heme.

650

Modeling of Porphyrin Metabolism with PyBioS

Figure 5. (continued)

Figure 6. Illustration of 5-aminolevulinate production time course of ALAS. ALAS inhibition is indicated by a blunted line . The simulation analysis of the model indicates that ALAS inhibition because of ALAS mutation caused a decrease of 5-aminolevulinate.

651

Modeling of Porphyrin Metabolism with PyBioS

CONCLUSION The modeling and simulation platform PyBioS has been used for the in silico analysis of porphyrin metabolism pathway. This model of a porphyrin metabolim pathway should be used for hypotheses generation by forward modeling. Also the model should be disturbed to test tinfluences of gene knock-outs, mutations and performance of this model system. Knock-out experiments can be performed in order to determine the functional roles of genes coding enzymes of the heme biosynthetic pathway like ferrochelatase by studying the defects caused by the resulting mutation. A next step should be integration of experimental data into the kinetic model of this pathway. The results of the in silico experiments have to be compared with the experimental data to decide, which kind of perturbation caused the phenotype of the investigated system. Thus, we should be able to test mutations of enzymes playing an important role in the heme biosynthetic pathway.

References Ajioka, R. S., Phillips, J. D., & Kushner, J. P. (2006). Biosynthesis of heme in mammals, biochimica et biophysica acta (BBA). Molecular Cell Research, 1763(7), 723-736. Akagi, R., Shimizu, R., Furuyama, K., Doss, M. O., & Sassa, S. (2000, March). Novel molecular defects of the delta-aminolevulinate dehydratase gene in a patient with inherited acute hepatic porphyria. Hepatology, 31(3), 704-8. Astner, I., Schulze, J. O., van den Heuvel, J., Jahn, D., Schubert, W.-D., & Heinz, D.W. (2005). Crystal structure of 5-aminolevulinate synthase, the first enzyme of heme biosynthesis, and its link to XLSA in humans. EMBO J, 24, 3166-3177 Bhasin, G., Kausar, H., & Athar, M. (1999, November, December). Ferrochelatase, a novel target for photodynamic therapy of cancer. Oncol Rep, 6(6),1439-42. Chen, F.-P., Risheg, H., Liu Y., & Bloomer, J. (2002, February). Ferrochelatase gene mutations in erythropoietic protoporphyria: Focus on liver disease. Cell Mol Biol (Noisy-le-grand), 48(1), 83-9 Daskalaki, A. (2002). The use of photodynamic therapy in dentistry. Clinical and experimental studies. Diss. Berlin: FU. Downey, D. C. (2002). The porphyrin pathway: The final common pathway? Medical Hypotheses, 59(6), 615-621. Ferreira, G. C., Franco, R., & José, J. (1999). Ferrochelatase: A new iron-sulfur center containing enzyme. 3.3 Steady - State kinetic properties of ferrochelatase. Iron metabolism. Wiley-VCH. Foroulis, C N., & Thorpe, J A. C. (2006). Photodynamic therapy (PDT) in Barrett’s esophagus with dysplasia or early cancer. Eur J Cardiothorac Surg, 29, 30-34 Gaullier, J.M., Geze, M, Santus, R, Sa, M.T., Maziere, J.C., Bazin, M., Morliere, P., & Dubertret. L. (1995). Subcellular localization of and photosensitization by protoporphyrin IX in human keratinocytes and fibroblasts cultivated with 5-aminolevulinic acid. Photochem Photobiol, 62, 114-122 652

Modeling of Porphyrin Metabolism with PyBioS

Ismail, M.S., Dressler, C., Strobele, S., Daskalaki, A., Philipp, C., Berlien, H-P, Weitzel, H., Liebsch, M., & Spielmann, H. (1997). Modulation of 5-ALA-induced PplX xenofluorescence intensities of a murine tumour and non-tumour tissue cultivated on the chorio-allantoic membrane. Lasers in Medical Science, 12, 218-225. Kamburov, A., Wierling, C., Lehrach, H., & Herwig, R. (2006, December 1-2). ConsensusPathDB - Database for matching pathway annotation. Systems Biology, Proceedings of Computational Proteomics Joint Annual RECOMB 2005 Satellite Workshops on Systems Biology and on Regulatory Genomics, San Diego, CA, USA. Kemmner, W., Wan K., Rüttinger S., Ebert B., Macdonald R., Klamm U., & Moesta K.T. (2008, February). Silencing of human ferrochelatase causes abundant protoporphyrin-IX accumulation in colon cancer. FASEB J., (2), 500-9. Epub 2007, Sep 17. Kennedy, J. C., & Pottier, R. H. (1992).Endogenous protoporphyrin IX, a clinical useful photosensitizer for photodynamic therapy. J Photoresponse Chem Photobiol, 14, 275-292 Kirby, I., Bland, J., Daly, M., Constantine, & Karakousis, P. (2001). Surgical oncology: Contemporary principles and practice. New York: McGraw-Hill. Klipp, E., Herwig, R., Kowald, A., Wierling, C., & Lehrach, H. (2005). Systems biology in practice. Concepts, implementation and application. WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim. Klipp, E., Nordlander, B., Kruger, R., Gennemark, P., Hohmann, S. (2005). Integrative model of the response of yeast to osmotic schock. Nat Biotechnol, 23, 975-982. Mitchell, L. W., Volin, M., Martins, J., & Jaffe, E. K. (2001) Mechanistic implications of mutations to the active site lysine of porphobilinogen synthase. J Biol Chem, 12, 276(2), 1538-44. Munakata, H., Sun, J-Y., Yoshida, K., Nakatan, T., Honda, E., Hayakawa, S., Furuyama, K., & Hayashi, N. (2004). Role of the heme regulatory motif in the heme-mediated inhibition of mitochondrial import of 5-aminolevulinate synthase. J Biochem, 136, 233-238, 136(2), 233. Reinbothe, S., & Reinbothe, C. (1996).The regulation of enzymes involved in chlorophyll biosynthesis. Eur J Biochem, 237, 323-343 . Vastrik, I., D‘Eustachio, P., Schmidt, E., Joshi-Tope, G., Gopinath. G., Croft. D., de Bono. B., Gillespie, M., Jassal, B., Lewis. S., Matthews, L., Wu. G., Birney. E., Stein. L. (2007). Reactome: A knowledge base of biologic pathways and processes. Genome Biology, 8, R39. Von Wettstein, D., Gough, S., & Kannangara, C.G. (1995). Chlorophyll biosynthesis. Plant Cell, 7, 1039-1057. Westerhoff, H. V. et al. (2008). Systems biology towards life in silico: Mathematics of the control of living cells. J Math Biol. Wierling, C., Herwig, R., & Lehrach, H. (2007).Resources, standards and tools for systems biology. Briefings in Functional Genomics and Proteomics, 10, 1093/bfgp/elm027. Wilson, J.H.P., van Hillegersberg, R., van den Berg, J.W.O., Kort, W.J., & Terpsta, O.T. Photodynamic therapy for gastrointestinal tumors. Scand J Gastroenterol, 26(Suppl), 188: 20-25.

653

Modeling of Porphyrin Metabolism with PyBioS

Schneider-Yin X., Gouya, L., Dorsey, M., Rüfenacht U., & Deybach J.-C. (2000). Mutations in the ironsulfur cluster ligands of the human ferrochelatase. Blood, 96, 1545-1549 Schoeberl, B., Eichler-Jonsson, G., Gilles, E.D., Muller, G. (2002). Computational modeling of the dynamics of the MAP kinase cascade activated by surface and internalized EGF receptors. Nat Biotechnol, 20, 370-375. Schoenfeld, N., Epstein, O., Lahav, M., Mamet, R., Shaklai, M., & Atsmon A. (1988). The heme biosynthetic pathway in lymphocytes of patients with malignant lymphoproliferative disorders. Cancer Lett, 43, 43-48.

KEY TERMS ALA: The first committed precursor of the porphyrin pathway Ferrochelatase: Also known as FECH is an enzyme involved in porphyrin metabolism, converting protoporphyrin IX into heme. Forward Modeling: Modeling approach to study the interaction of processes to produce a response. Heme: Iron-containing porphyrin (heme-containing protein or hemoprotein) that is extensively found in nature ie. hemoglobin. Knockout-Experiment : A experiment, where an organism is engineered to lack the expression and activity of one or more genes. Mutation: Changes to the nucleotide sequence of the genetic material of an organism. Mutations can be caused by copying errors in the genetic material during cell division, by exposure to ultraviolet or ionizing radiation, chemical mutagens, or viruses. Porphyrin: Porphyrins are heterocyclic macrocycles, consisting of four pyrrole subunits (tetrapyrrole) linked by four methine (=CH-) bridges. The extensive conjugated porphyrin macrocycle is chromatic and the name itself, porphyrin, is derived from the Greek word for purple. PyBioS: PyBioS is a system for the modeling and simulation of cellular processes. It is developed at the Max-Planck-Institute for Molecular Genetics in the department of Prof. Lehrach.

654

Section X

Modeling Cellular Physiology

656

Chapter XXXVII

Interference Microscopy for Cellular Studies Alexey R. Brazhe Technical University of Denmark, Denmark and Moscow State University, Russia Nadezda A. Brazhe Technical University of Denmark, Denmark and Moscow State University, Russia

Georgy V. Maksimov Moscow State University, Russia Erik Mosekilde Technical University of Denmark, Denmark Olga V. Sosnovtseva Technical University of Denmark, Denmark

Alexey N. Pavlov Saratov State University, Russia

abstract This chapter describes the application of interference microscopy and double-wavelet analysis to noninvasive study of cell structure and function. We present different techniques of phase and interference microscopy and discuss how variations in the intrinsic optical properties of a cell can be related to the intracellular processes. Particular emphasis is given to the newly developed phase modulation laser interference microscope. We show how this setup, combined with wavelet analysis of the obtained data series, can be applied to live cell imaging to investigate the rhythmic intracellular processes and their mutual interactions. We hope that the discussion will contribute to the understanding and learning of new methods for non-invasive investigation of intracellular processes.

INTRODUCTION There is a significant and rapidly growing interest in the development of new experimental techniques that will allow us to perform non-invasive studies on live cells with a spatial and temporal resolution

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Interference Microscopy for Cellular Studies

that is sufficient to reveal the motion of intracellular structures and to simultaneously follow cellular processes that take place in different compartments and on different time scales. Most cells are practically transparent to light and limited information is directly available from conventional amplitude microscopy. To examine processes within the cell various forms of staining have to be used. However, such dye-based approaches only allow the investigation of a few processes at a time and, moreover, the staining affects normal cellular processes. Local refractive index, an intrinsic optical property of biological objects, provides additional valuable information. Although a cell often doesn’t absorb light efficiently, various cellular structures may have different values of the refractive index and therefore retard light beams that propagate through the object differently. The idea of exploiting the associated phase shifts underlies a number of different microscopy setups. A main advantage of the phase imaging technique is that no staining is required to visualize the transparent structures in the cell. Moreover, phase imaging allows the spatial resolution to exceed the Rayleigh barrier which is impossible in amplitude microscopy. Besides techniques for imaging it is also essential to develop non-invasive techniques that can be used to examine the dynamics of the cellular processes and their mutual interactions. The possibility of using the intrinsic optical properties as a non-invasive probe of neuronal properties was first considered by Hill and Keynes (Hill and Keynes, 1968). They observed changes in the light scattering intensity of a nerve fibre during electrical activity. Cohen (Cohen, 1969) found that the intrinsic optical properties depend on the ion currents through the plasma membrane, and Stepnoski (Stepnoski et al., 1991) observed that the intensity of light scattered by neurons depends on their membrane potential. By now it is clear that the intrinsic optical properties of a cell also depend on the organization of the cytoskeleton and on the location of the various organelles (Haller, 2001). Cells exhibit dynamic processes over a broad range of different time scales and across a variety of cellular compartments. Moreover, these processes interact with one another to produce mutual modulation. It appears worthwhile to examine the possibility of time-resolved phase measurement for non-invasive studies of cellular processes. Such studies must, of course, be accompanied by a development of new mathematical methods capable of unravelling the complexity of the interacting processes. The following section presents a general background for our discussion, describing a number of different approaches to phase imaging and providing an introduction to the use of wavelet analysis of rhythmic phenomena in non-stationary time series. This is followed by a section on cell visualization where we examine several cell types in order to clarify the kinds of information that one can obtain in such studies. Finally, we present the results of a time-resolved interference microscopy study of several cell types.

GENERAL BACKGROUND Phase Microscopies Phase Contrast Historically, the first technique applied to convert phase shifts in the light passing through a transparent specimen into amplitude or contrast changes was phase contrast microscopy. This technique was invented by Frits Zernike in 1930s, and in 1953 he received the Nobel prize in physics for this invention.

657

Interference Microscopy for Cellular Studies

The core idea of the phase contrast design is to place a condenser annulus and a phase plate in conjugated aperture planes (Bennett, 1951). When the light wave hits an object with refractive index different from the medium, part of the light diffracts and/or refracts to produce a new light wave. The original (surrounding) wave is reduced in intensity and retarded by the phase plate while the diffracted wave is left mostly unchanged. Recombination of the two waves on the image plane results in their mutual interference thus enhancing the contrast in transparent objects (Ross, 1967). Phase contrast microscopy is mainly used in microbiology and for studies of single cell algae and protista. The technique is qualitative and introduces several artefacts. At places where the spatial refractive index gradient is high, bright halos emerge, thus making it hard to determine the exact boundaries of the object. Such halos are often observed near the cell membrane and around some of the organelles. Moreover, an object of uniform refractive index doesn’t necessarily appear uniform in the phase contrast image, but a shade off arises near the centre because it is impossible to fully separate the surrounding and diffracted waves. Phase contrast techniques also imply a very small aperture which reduces their sensitivity and accuracy.

Differential Interference Contrast This type of microscopy is used to visualize local gradients of refractive index in a specimen (Murphy, 2001). The spatial resolution is better than for the phase contrast microscopy, the aperture of the lens system is higher and the resulting image lacks the artefacts specific to phase contrast microscopy. The light from the source is split by a Nomarski-modified Wollanstone prism into two beams polarized at 90o to each other and slightly sheared. After focusing, these two displaced beams go through adjacent points of the specimen, the distance being typically about 0.2 μm. The beams thus experience slightly different optical path lengths. In reality many pairs of beams go through the specimen and the light thus carries two slightly displaced bright-field images made by beams with different polarization. The beams then pass through the objective lens system and are focused on a second Nomarski prism in which they are combined into a single beam. This leads to interference which elucidates phase differences in the beam pairs associated with the variation of the refractive index along the sample. Thus one obtains a “first-derivative” of the phase image of an object. This kind of setup, known as a shearing interferometer, thus visualizes refractive non-uniformities of the sample. The resulting images look like gray-scale objects under oblique illumination with strong light and dark shadows on corresponding faces. The direction of apparent illumination is determined by the orientation of the Wollanstone prisms. Features parallel to this direction are not visible. To obtain full information on the object one has to image the sample at different shear directions. The main limitation of this technique is that a cell has to be relatively thin and transparent and the differences between the optical paths in adjacent points have to be less than half of the wavelength. This technique is not quantitative in its traditional setups as the local measured light intensities depend not only on interference but also on absorbance by the specimen.

Interferometers Quantitative information on the refractive index values in the sample can be obtained with microscopes based on double-beam interferometers. In these setups one of the beams passes through the sample while the other one — the reference beam — doesn’t. If the speed of light propagation in the sample differs from the speed in the medium, then the optical path difference between the beams is:

658

Interference Microscopy for Cellular Studies

Φ = (ns − nm ) z

(1)

where ns and nm are the refractive indices of the sample and of the medium respectively and z is the thickness of the sample. The two beams form an interference image on the detector. Mach-Zehnder and Linnik interferometers are usually used for interference microscopy. The latter is simpler and is similar to a Michelson interferometer (Figure 1a), only with microscope objectives added. The MachZehnder interferometer has a more complex design with two beam splitters (Figure 1b) (Zetie, 2000). Contrary to the Linnik interferometer, which is a reflected-light type setup where the sample is placed on the mirror and light passes through the sample twice, the Mach-Zehnder interferometer is usually a transmitted-light type setup and light passes through the object only once. This allows the investigator to study specimens of greater optical and physical thickness. The Mach-Zehnder scheme also offers an improved sensitivity, and another advantage is that the two branches of the interferometer can be adjusted independently. Broad-band (e.g. white) light has low temporal coherence and a precise matching of the two optical paths is needed to obtain an interference image. Shuch twin-matched optical systems are hard to set up and use. If a laser light source with long temporal coherence is used, the two optical paths can be of unequal length and still produce interference patterns.

Figure 1. Schemes of Michelson (a), Mach-Zehnder (b), and modified Mach-Zehnder (c) interferometers. L is the light source, D is detector, PM is phase modulation mirror. BS are beamsplitters, M are mirrors O are objectives and WP are wave plates.

659

Interference Microscopy for Cellular Studies

Two approaches are usually applied to measure optical path differences (phase height) in any point of an object (Davies, 1954) In first approach the optical path difference between the object beam and the reference beam is varied linearly across the field producing bands (fringes) of interference across the field. This is done by an optical wedge in the reference beam. Introducing an object to the system results in the displacement of the fringes which is related to the optical path difference brought in by the object. In order to correctly reconstruct the optical path lengths through the object one needs to use several images made under different band positions. In the second approach the background field is made uniformly illuminated. Introducing an object then results in changes in the light intensity according to the formula: I = A02 + A12 + 2A0 A1cos (

1

−

0

)

(2)

where A0, φ0 and A1, φ1 are amplitudes and phases of the reference and object beams, respectively. Four raw images taken at different φ0 values are needed to reconstruct φ1 values. So, in both approaches, full interference images are recorded and optical path lengths through different points of the object are then reconstructed. There are two possible problems in these approaches. First, the distribution of light intensities in the image can be altered as a result of light refraction. Second, the measured intensity I can be very small in some regions of the object thus lowering the accuracy of results, even if the intensity of the object beam A1 is high. Modern applications may involve complicated mathematical procedures to preform the reconstruction and avoid some of the problems.

Phase-Modulation Laser Interference Microscopy The results discussed in the following sections were obtained with an interference microscope where the optical path lengths in the sample are obtained in another way. The phase modulation microscope MIM2.1, based on the modified Mach-Zehnder scheme (Figure 1c) and developed by the Russian company Amphoralabs Ltd. (www.amphoralabs.ru) (Andreev, 2003; Andreev, 2005) was used. In this setup the problems that we discussed above are eliminated by a clever approach to the of phase measurement. The main idea is that the phase is determined independently for each pixel of the photo-sensitive camera. The length of the reference beam is harmonically modulated at 500 Hz. For each pixel, the intensity I is measured as a function of time and the position of the mirror corresponding to the maximal rate of change in I is determined. The phase shift of the reference beam in this position of the modulation mirror is offset by �/2 relative to the phase of the object beam. Thus, optical path lengths are obtained independently for each point of the object. We will further use the term phase height for the optical path difference:

Φ=

0

− 2

obj

∂ − Φ0 2

(3)

here φ0 is the initial phase, φobj the phase in the presence of the object, λ the wavelength of laser light, and Φ0 a constant phase shift determined by the choice of the reference point. Phase heights in all points of an object define a phase image. For heterogeneous objects, as living cells are, the phase height in each pixel i is given by:

660

Interference Microscopy for Cellular Studies

Z

Φ i = ∫(ni (z ) − nm )dz − Φ 0

(4)

0

with ni(z) being the refractive index of the cell in a point i at a distance z from the mirror and nm is a constant refractive index of the physiological saline surrounding. Z is the upper limit of integration that is chosen as a point just above the cell. The lateral resolution of the method depends on the laser wavelength λ and the numerical aperture (NA) according to the Abbe formula (Brandon, 1999): D ≈ 0.61λ / NA for the results to be presented the NA value is 0.15 and λ = 532nm. Thus D=2.16 μm. The power of laser light per cell is 2 mW. Both the physical size of the cell and its refractive index contribute to the measured phase height. In static imaging one can remove of this ambiguity by comparing the results for several physiological salines with known refractive indices or for lasers of different wavelengths. When measuring variations of the phase height in a point of a cell, the main input is mostly associated with changes in the refractive index rather than with changes in the cell shape. To show this, we can consider a general form of differential for phase height: d Φ = zdno + (n − nm )dz

For a typical cell we have n – nm ≈ 0.02, n ≈ 1.4, and z ≈ 10 μm. If we consider 1% changes in z and n, then zdn = 0.14 μm, and (n – nm)dz = 0.002 μm. In our experiments with cell imaging the working field was 27 × 27 μm, and images of 256 × 256 pixels were obtained. One of the pixels was chosen as a “reference pixel” where the optical phase difference was assumed to be zero. In other pixels Φ was calculated relative to this value. The time required to measure the phase in each pixel is 2 ms.The setup allows us to perform measurements of phase heights in arbitrarily selected individual pixels and along lines or rectangular sets of pixels. The sampling rate for each acquisition channel will then be 500 Hz divided by the total number of pixels. One can therefore adjust the sampling rate for the obtained data series in the dynamical studies.

Wavelet Analysis Cellular activity involves processes at many different time-scale and occurring in various compartments. Many cell processes are interrelated and depend on each other. It is already established, that cellular electric activity, modification of plasma membrane structures, cytoplasm compartmentalization, as well as position and shape of organelles alter the local refractive index (Cohen, 1968; Stepnoski, 1991; Haller, 2001; Rappaz, 2005). Evidently, regular cooperative processes in the cell result in regular changes of the intrinsic optic properties, i.e. in the refractive index. Therefore, analysis of the variations of refractive index provides information about the frequencies of the regular cellular processes. An important step in the analysis of biological data is the choice of an appropriate mathematical tool. We demonstrate how the combination of interference microscopy with advanced time-series analysis can be applied to study multimode dynamical phenomena in cells. Spectral analysis of biological time series is often based on the application of a wavelet-transformation (Grossmann, 1984; Daubechies, 1992). The advantages of this approach in comparison with the 661

Interference Microscopy for Cellular Studies

classical Fourier-transform have been widely discussed (Kaiser, 1994). The wavelet-transform of a signal x(t) is obtained as follows:

Tx (a,t )=

1 a

∞

≈u − t ÷ ∆ ◊du  a 

∫ x (u )

−∞

(5)

Here ψ is a “mother” function that is soliton-like with zero average. Tx(a,t) are the wavelet coefficients and a is a time scale parameter. The bar over the wavelet function denotes complex conjugate. The details of this transform (e.g., the choice of ψ) depend on the problem to be solved. In the analysis of rhythmic components, the Morlet function is typically considered. A simplified expression for the Morlet function has the form:

()

−1/ 4

exp (

0

− 2  ⁄  2 

)exp …

(6)

The parameter f 0 allows us to search for a compromise between the localizations of the wavelet in the time and frequency domains. In our work f 0 =1 or 5, depending on the frequency band. The relation between the scale a and the central frequency for the mother function f in this situation is f=1/a. Besides the coefficients Tx(a,t), the energy density of the signal x(t) in the time scale plane can be estimated: Ex(a,t) ~ |Tx(a,t)|2. Following the definition used by Kaiser (Kaiser, 1994), the coefficient of proportionality between Ex(a,t) and |Tx(a,t)|2 depends on both the scale and the shape of the mother wavelet although in some works the simple expression Ex(a,t) = |Tx(a,t)2| is used. Note that the moduli of the original wavelet coefficients Tx(a,t) estimated from Eq. (5) do not correspond to actual amplitudes of the rhythmic components. To study amplitude variations, it is possible to slightly change the definition of the wavelet transform or to make corrections for the energy density Ex(a,t). In the present work we consider 2 Ex (a,t )= Ca −1 Tx (a,t ) , where C is a parameter that depends on the wavelet mother function.

CELL VISUALIZATION To demonstrate the use of phase-modulation laser interference microscopy for cell visualization we chose three different types of cells: erythrocytes, mast cells and neurons. Erythrocytes can be regarded as “tough” cells due to the strong submembrane cytoskeleton. They have a simple intracellular structure, and their refractive index (RI) is determined mainly by the distribution of haemoglobin and by the structure of the cytoskeleton net. On the contrary, mast cells and, especially, neurons are “soft” cells with complicated cytoplasmic compartmentalization and therefore inhomogeneous distribution of the refractive index. Such cells can hardly be visualized by means of atomic force microscopy, a technique that has become quite popular during recent years.

Preparation The studied samples were human erythrocytes, rat mast cells and isolated neurons of the pond snail Lymnaea stagnalis and the medical leech Hirudo medicinalis. Erythrocytes were taken from the blood of healthy donors and from patients with heart failure, functional NIHA II classification at the stage of

662

Interference Microscopy for Cellular Studies

decompensation. Our experiments were performed in accordance with the standards of the Ethics Committee of the A. L. Myasnikov Institute of Clinical Cardiology. Preparation of mast cells and neurons were done as described by Brazhe et al. (Brazhe, 2005; Graevskaya, 2001). During the experiments the cells were placed in a containment chamber with a mirror bottom layer and filled with an appropriate physiological solution (Brazhe, 2006). In order to avoid photodamage cells were tested for the effect of laser light. Neurons and mast cells absorb weakly in the region of the used laser light (532 nm), so their photodamage is minimal. We also note that the used laser light did not cause lysis of any of the studied cells.

Phase Images Figure 2 shows the typical photograph in the transmitted light (a) and the phase height image (b) of an erythrocyte from the blood of a healthy donor. It has the shape of a normal erythrocyte: a discocyte. The typical toroidal form is clearly seen on the phase height image. The discocyte has a smooth shape (that is also seen from the photograph) and a homogeneous distribution of the refractive index, indicating a uniform hemoglobin distribution. On the contrary, the phase height image of the erythrocyte of the patient with heart failure (Figure 2d) has a rough toroidal form with protuberances. It is important, that such structures can not be seen from the photograph (Figure 2c) that appears similar to the erythrocyte of a healthy person (Figure 2a). The observed protuberance toroidal shape results from complex changes of the cytoskeleton structure and from an inhomogeneous distribution of hemoglobin in the cytoplasm and in the submembrane region. These changes can partly be caused by pathological processes in erythrocytes in connection with the heart failure. There is evidence that severe hypoxia and blood system diseases affect the plasma membrane fluidity and hemoglobin properties of erythrocytes (Rodnenkov, 2005). Another explanation of the protuberance toroidal form is that it reflects the initial phase of the discocyte transformation into echynocyte. This example demonstrates that phase-modulation laser

Figure 2. Photographs in the transmitted light (a, c) and phase images of human erythrocytes (b, d) from the blood of a healthy donor (a, b) and patient with heart failure (c, d). Erythrocytes have the discocytic form. Cell visualization was performed by means of phase-modulation laser interference microscopy. Figure 1a: bar is 10 μm; fig. 1 b: x, y bar are 10 μm, z bar is 100 nm.

663

Interference Microscopy for Cellular Studies

interference microscopy (PM-LIM) can be used as an additional technique to monitor erythrocytes as it is sensitive to changes in the cell shape and intrinsic optical properties and it can reveal differences between “healthy” and “non-healthy” cells that can not be seen on photographs, obtained in transmitted light (Figure 2a-d) (Brazhe, 2006). Our next example shows an application of the interference microscopy to the study of neurons in different functional states. Figure 3a presents the photograph of a pond snail neuron in transmitted light while Figure 3b is a phase image of a part of the same neuron under normal conditions (i.e. in normal physiological solution). The neuron has a smooth shape after isolation and only a small axon hillock is seen on the cell top. The granular structure of the cytoplasm can be observed on the photograph, however, it seems to be similar in density in different cell parts (Figure 3a). On the contrary, the phase image (Figure 3b) reveals the complex inhomogeneous structure of the neuron cytoplasm. One can clearly see the difference between various neuron parts that originates from the difference in the local refractive index values due to the special landscape of organelles, cytoskeleton and submembrane structures. K+depolarization produced by bath application of KCl in high concentration increases the phase height of the neuron (there are more red and white areas on the phase image, Figure 3c). An explanation of the observed changes can be the following: a solution with high K+ concentration produces depolarization of the plasma membrane, short-term activation of Na+ and Ca2+-channels and prolonged activation of the Na+/Ca2+-exchanger (Hille, 1992). Influx of Ca2+ into the cytoplasm triggers Ca2+-sensitive signaling

Figure 3. Photograph in the transmitted light of a neuron under normal conditions (a), its phase images under normal conditions (b) and in the physiological solution with high K+ concentration (c). Frame on Figure 3a shows region for registration of the phase image. (d) and (e) are photograph in the transmitted light of a mast cell and its phase image, respectively. X bars on all figures are 10 μm. Colour and grey bars represent scale for phase images in nm.

664

Interference Microscopy for Cellular Studies

pathways and affects cytoskeleton structure (Metuzals, 1981; Mironov, 2005). This results in complex reorganizations of the cytoplasm and in changes of the local refractive index (Haller, 2001). Our third example concerns mast cells, one of the most useful objects to study the effect of newly synthesized anti-allergic drugs. Mast cells possess an extremely intensive exocytosis, which can be easily stimulated by many factors (red light, pressure, neurotransmitters, Ca2+ ionofores, etc.). Therefore the visualization of live mast cells without significant artificial modification of their state is a difficult task. Mast cells have three major compartments: cytoplasm, large nucleus with one or several nucleoli and vesicles of different-size (up to 1 mm in diameter) with mediators (histamine, serotonin. etc.) (Yen, 1994). These structures can only be guessed from the photograph in the transmitted light (Figure 3d), but they are much more pronounced in the phase image (Figure 3e). The large nucleus (light-grey region in the image) is well distinguished from the surrounding cytoplasm (dark grey region) and a small nucleolus is clearly seen in the nucleus region (white and black hillock in the 2 o’clock position). Several exocytotic vesicles can also be observed as smaller hillocks close to the nucleus. Thus, any dynamical changes of intracellular compartmentalization of mast cells caused by external or internal stimuli can be traced and visualized by interference microscopy.

STUDY OF CELLULAR DYNAMICS Characteristic Frequencies in the Dynamics of the Refractive Index Since different types of cells are diverged in properties and processes it is natural to expect different dynamics of the refractive index. In the following examples we compare the dynamics of the refractive index for excitable (neurons) and for non-excitable cells (mast cells and erythrocytes). Neurons have the most active processes at the plasma membrane, and the local changes of the refractive index associated with these processes should exceed the changes observed for the other cells. Mast cells represent a cell type with an active vesicular transport and exocytosis, whereas erythrocytes are cells with a dense packing of hemoglobin and a rigid submembrane structure. Due to the intracellular compartmentalization, the processes in cytoplasm, submembrane and membrane regions are localised. Study of the refractive index dynamics in various parts of the cell can therefore provide information about the different spatially separated processes. Here we will consider variations of the refractive index in the boundary region of the neurons and mast cells. As the membrane/cytoplasm volume ratio is higher for the boundary region of the cell than for the centre, the contribution of the membrane and submembrane processes into the RI dynamics is also higher for the cell boundary. Hence, in the case of the boundary region (membrane region) we explore mainly membrane and submembrane processes. In the experiments with erythrocytes we do not distinguish different cellular regions.

Neurons Wavelet analysis of data (time-dependence of the local refractive index in a certain part of the cell) gives a matrix of wavelet coefficients showing the time-dependence of the frequencies and their power. With the wavelet coefficients one can calculate instantaneous and averaged power spectra. Figures 4a, b show time-averaged power spectra of the refractive index variations in the membrane region of neuron. The low and high frequency bands are represented separately since different values of f 0 are

665

Interference Microscopy for Cellular Studies

used for their calculation (f 0=1 and f 0=5, respectively) and because the involved rhythmic components have very different powers. Several well-defined rhythms can be observed in the low frequency range around 0.1, 0.2-0.4, 1 and 2-3 Hz (Figure 4a). The structure of the high frequency range is not so clear, however there is a group of pronounced frequencies around 10 and 20-25 Hz (Figure 4b). We associate low frequencies with plasma membrane processes and high frequencies with cytoplasmic events. There is an evidence for such an assumption. Firstly, low frequency rhythms are much more pronounced in the membrane region than in the centre of neurons, while the 20-25 Hz rhythms display an opposite behaviour (Brazhe, 2006). Secondly, there are data of independent experiments on the same type of neurons showing the existence of regular processes. Szucs and co-workers (1999) found that frequencies in the range of 0.2-0.4 Hz depend on the activity of Ca2+-channels. Another group showed that neurons of invertebrates possess intrinsic electric activity with 1, 1.5-3 Hz frequencies (Schutt, 2000). The suggestion about the origin of high frequencies (20-25 Hz) from the cytoplasm processes is in the accordance with experimental data on vesicle movements in neurons (8-40 Hz) obtained by light scattering measurements (Landowne, 1969).

Mast Cells The structure of the power spectra in the membrane region of mast cells differs significantly from the structure of spectra in neurons. Rhythms around 1-2 Hz are broader than the same for neurons and

Figure 4. Power spectra calculated via the wavelet technique for the low (a, c, e) and high (b, d, f) frequency bands of the refractive index variations in the membrane region of the neuron (a, b), mast cell (c, d) and erythrocyte (e, f). Measurements are performed by means of phase-modulation laser interference microscopy.

666

Interference Microscopy for Cellular Studies

peaks at 0.1-0.4 Hz, that have the highest power in neurons, are absent. Besides, mast cells possess a new rhythm around 4-6 Hz (Figure 4c). Contrary to neurons, the power of the high frequency peaks (24 and 26 Hz) in the membrane region of the mast cell essentially exceeds peaks in the low frequency range (Figure 4d). It is natural to assume, that the highest peaks in the power spectra belong to the most active cellular processes. As the most active processes in neurons are related to the changes of the membrane potential, the highest peaks in their spectra should be rhythms that originate from the processes underlying electric activity (0.1-0.4 and 1-3 Hz). For mast cells the major processes are vesicle transport and exocytosis (Dvorak, 1991). Thus, rhythms with the highest power (24 and 26 Hz) are associated with transport and exocytosis processes.

Erythrocytes Figures 4e, f present the low (e) and high (f) frequency ranges of the power spectra for RI dynamics of erythrocytes. The spectrum structure is different from the structure observed for neurons and mast cells, and the magnitude of the main peaks is much lower. We assume that this is due to the rigid submembrane and membrane structure that prevents strong changes in the membrane and cytoplasm and, therefore, eliminate significant changes of the refractive index (Discher, 1995).

Modulation Properties of Rhythms Cellular processes are interrelated and influence one another. It is obvious that interaction of processes underlying rhythmic variations of RI will result in the modulation of rhythms by slower oscillations. Thus, our next step is to investigate each frequency range in a view of detecting such interactions. This was done on the refractive index variations in the membrane region of neurons. Figure 5a shows so-called skeletonogram, i.e., the time-dependence of the main frequency components in the low frequency range (590nm long pass filter) and the green fluorescence channel (λexcitation, 450-490nm band pass filter, λdetection, >515nm long pass filter), each. Illumination times required for image acquisitions with respect to optimal fluorescence imaging were digitally measured by the AxioCam MRc camera for every image (variation range, 268-2354ms). Statistical evaluation, Ratios of the fluorescence amplitudes measured in the red and the green channel were evaluated for every image frame after correcting the amplitudes with the illumination times applied in each case. The average value in every temperature group was used for statistical assessments of red and green fluorescence intensities.

RESULTS After labeling MX1 mitochondria with MTG more or less evenly, cytoplasmic distributions inside intact control cells (37°C) were observed. Because of comparatively high organelle numbers per cell single

677

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

mitochondria could not be distinguished from each other with the optical magnification applied in Figure 2. Under mild stress conditions at 40°C the mitochondrial fine structure already was diminished when compared with the control. In the 42°C group aggregation of mitochondria was obvious. This process was enhanced in the 45°C group, definitely supported by the changes of cell morphologies and sizes, since MX1 cells were smaller and round after stress at 45°C. Treatments at more severe stress conditions (50°C or 56°C) resulted in pronounced diffuse pan cellular distributions, although cell morphologies again resembled the control cells as well as the 40°C and 42°C stress group. This fact clearly indicated that 30min 45°C induced an active heat stress response when the cells shrunk and were rounding up while higher stress temperatures did not permit active cell responses anymore (Figure 2).

Figure 2. Mitochondrial fluorescence in heat stressed MX1 cells after labeling with MitoTracker Green FM (Molecular Probes, Invitrogen Germany). Panel A shows control cells incubated at 37°C, panels B-F show heat stressed cells treated with the temperatures indicated at every panel for 30min each.

A) 37°C

B) 40°C

C) 42°C D) 45°C

F) 56°C E) 50°C

678

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

Since MTG labeling did not provide any information about functional states of heat-stressed mitochondria, MX1 cells were then labeled with the mitochondrial membrane potential sensor JC-1 in order to monitor heat-stress induced effects on ΔΨm. The fluorescence micrographs in Figure 3 clearly

Figure 3. Green (left) and red (right) fluorescence of heat stressed MX1 cells after mitochondrial transmembrane potential dependent labeling with JC-1 (Molecular Probes, Invitrogen Germany). Panel A shows control cells incubated at 37°C, panels B-F show heat stressed cells treated with the temperatures indicated at every panel for 30min each. Illumination times employed for acquiring the images were: panel A) 645ms green, 268ms red; panel B) 580ms green, 295ms red; panel C) 711ms green, 633ms red; panel D) 571ms green, 656ms red; panel E) 765ms green, 1172ms red; panel F) 677ms green, 2345ms red.

A) 37°C

B) 40°C

C) 42°C

D) 45°C

continued on following page

679

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

Figure 3. (continued)

E) 50°C

F) 56°C

showed membrane potential correlated labeling of mitochondria in MX1 cells. With increasing stress temperatures at 40°C, 42°C, 45°C, 50°C, or 56°C the ΔΨm dependent orange-red and green fluorescences in MX1 cells labeled with JC-1 were altered when compared with control cells. The orange-red fluorescence of J-aggregates at mitochondria with high ΔΨm was imaged in both fluorescence channels while green fluorescence of monomer JC-1, of course, was only imaged in the green channel. After the mitochondria in the control group and the 40°C, 42°C, and 45°C stress groups exhibited orange-red fluorescence, the signal color in the red channel was changed in the 50°C and 56°C stress groups. Hyperthermic temperatures at 50°C or 56°C caused JC-1 to show deep red fluorescence (Figure 3). A direct readout of fluorescence intensities imaged in both channels for every object was not possible, since acquisition times used for making the images were digitally adjusted with the purpose of optimal contrast for fluorescence imaging. Therefore the ratio of mean fluorescence amplitudes measured in the red and the green channel was corrected with the inverse ratio of the acquisition times to get the real red/green ratio for every region of interest or every image pair, respectively. Average red/green ratios of the control group and the different heat stress groups were plotted against the temperatures MX1 cells were treated with (Figure 4). The red/green fluorescence ratios were shown to decrease with increasing stress temperatures in a nonlinear manner, because orange-red fluorescence intensities discontinuously decreased while green fluorescence intensities increased and consequently the red/green ratios declined. The nonlinear interrelation between mitochondrial depolarization and stress temperature is presented by the exponential function shown in Figure 4. Whereas the red-to-green fluorescence intensity ratios decayed rather rapidly in the temperature range 40°C-45°C and switched over to a more decelerated decay at higher temperatures following an exponential curve progression as illustrated in Figure 4. In Figure 5 the fluorescence intensities in the green and red channel were separated and illustrated as monochromatic 3D profiles.

680

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

Figure 4. Average ratios of fluorescence amplitudes measured in the red and the green fluorescence channel. Red/green ratios are indicating changes of the quantitative relation between orange-red fluorescent J-aggregates in MX1 cells with high ΔΨm and green fluorescent JC1 monomers in cells with low ΔΨm. Standard deviations are given as mean square deviations.

Figure 5. Green and red fluorescence distributions in heat stressed MX1 cells after mitochondrial membrane potential dependent labeling with JC-1 (Molecular Probes, Invitrogen Germany). The regions of interest (left) were devided into red (center) and green (right) data fraction for the green fluorescence channel (atop in every panel) and red fluorescence channel (at the bottom of every panel) each and illustrated as 3D fluorescence distributions. Panel A shows control cells incubated at 37°C, panels B-F show heat-stressed cells treated with the temperatures indicated at every panel for 30min each. Two representative cells are shown in every panel.

A)

37°C

green

red

continued on following page 681

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

Figure 5. (continued)

B)

40°C

green

red

C) C) 4 42°C 2°C

geen

red

continued on following page

682

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

Figure 5. (continued) D)

45°C

green

red

E) E) 5

50°C 0°C

green

red

continued on following page

683

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

Figure 5. (continued)

F) F) 5

56°C 6°C

green

red

Generally, these results indicated that the amount of red fluorescent J-aggregates accumulating at mitochondria with comparatively high transmembrane potentials decreased with increasing stress temperatures opposite to the enhanced green fluorescence of J-monomers in cells with more or less depolarized ΔΨm. In the control group the red/green ratio was approximately 1.7. Under mild heat-stress conditions at 40°C or 42°C the red/green ratios only slightly decreased compared with control cells. The ratios in these groups were definitely above 1 denoting that orange-red signal intensities of J-aggregates fluorescence was higher than green fluorescence signal intensities. With higher stress temperatures at 45°C and 50°C ratios drastically decreased with values below 0.7, because, accordingly, red fluorescence intensities were weaker than green fluorescence intensities. Exposing cells to 56°C heat resulted in pancellular green and red fluorescence distributions, whereas the green signal intensities were much higher than red signal intensities, which only represented residual background fluorescence. Therefore in the 56°C stress group the average red/green ratio again was drastically decreased to reach a value of approximately 0.2 showing that red fluorescence intensity was approximately 20% of the green fluorescence intensity measured in this experimental group. The red signal intensity decrease resulted from massive depolarization of ΔΨm under exposure to 56°C heat accompanied by structural organelles destruction enhancing green fluorescence of JC-1 monomers inside severely damaged MX1 cells. The fluorescence intensity distributions inside cells imaged in the red and the green fluorescence channel were derived as three-dimensional (3D) illustrations. Characteristic examples of 3D fluorescence intensity profiles are shown in Figure 4. Here the fluorescence amplitudes were corrected with the respective acquisition times in order to compare distributions of absolute signal intensities with

684

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

each other. Each 3D image is z scaled to the maximum of fluorescence intensity. The red fluorescence intensity maxima (RFIM) were highest and nearly constant in the temperature range between 37°C and 42°C. From a stress temperature of 45°C on, RFIM drastically declined while the green fluorescence intensity maxima (GFIM) exceeded RFIM. This again indicated an amplified depolarization of mitochondria in response to hyperthermic stress.

DISCUSSION The aim of the present study was to investigate mitochondrial responses to heat stress in the temperature range between 40°C and 56°C (30min each) in breast cancer cells species MX1. In this subcoagulative stress range obvious mitochondria-involving stress responses were expected. As stress-sensitive indicator mitochondrial ΔΨm was analyzed by fluorescence microscopy after selective staining of mitochondria with JC-1. The ΔΨm results were correlated with MTG mediated structure analysis. Several studies have documented ΔΨm to be a parameter sensitive to various kinds of environmental derogations [Keshavan, 2004; Zunino, 2006; Lieven, 2003; Cossarizza, 1993]. Since heat also represents an environmental stress factor, we were interested in the cellular ΔΨm response to elevated temperatures. Hyperthermia has been proposed a potential therapeutic implementation in clinical cancer therapy [van der Zee, 2002]. The cellular mechanisms involved in heat-stress responses and their impact on various subcellular structures so far have only been described for selected tissue models. Funk et al. studied heat-stress induced changes of mitochondrial morphologies in astrocytes and MDCK cells by video-enhanced contrast microscopy using a perfusion cell chamber system [Funk, 1999]. In their study the morphological alterations inside mitochondria exposed to moderate hyperthermic stress conditions were revealed to be reversible. Recovery of mitochondrial changes subsequent to heat treatment was also detected in microglial cells [Macouillard-Poulletier, 2000]. Metabolic investigations on microglial cells revealed dropping of the physiological ATP content by 60% 1h after a 20min heat shock at 45°C indicating that heat stress leads to scaling down of energy resource ATP in this cell type [MacouillardPoulletier, 1998]. In heat-shocked rats failing of energy metabolism and ATP depletion were detected as the earliest cell-damaging factors of ischemic insult [Wang, 2005]. These data emphasize the interface actions of energy supplying processes during cellular stress responses. Several subcellular structures were already analyzed in MX1 cells after heat stress. In a previous study the F-actin cytoskeleton was shown to be thermally more sensitive than the plasma membranes, since F-actin fibers exhibited morphological alterations under comparatively mild stress at 40°C or 42°C while plasma membrane morphologies were not affected by these conditions. Only temperatures exceeding 42°C induced detectable morphological changes in plasma membranes [Dressler, 2005; Beuthan, 2004]. These results did not give any information about the functionalities of the investigated cell components. It had been previously shown that MX1 cell viability was not attenuated after stress at 40°C or 42°C. When exposed to 45°C or higher temperatures cell viabilities were increasingly diminished. Comparing these results it should be concluded that reorganization of F-actin cytoskeletons in MX1 cells resulted from active stress response under hyperthermic stress at 40°C or 42°C, which is supposed to be compensated during cellular recovery from heat stress. It was also demonstrated earlier that MX1 cells undergo necrosis during 30min treatment at 56°C, but not at 50°C or lower temperatures, because cells exposed to 50°C did not exhibit necrotic phenotypes [Beuthan, 2004]. Therefore complete depolarization

685

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

of mitochondria in cells stressed at 56°C was a consequent result of necrosis. This process was clearly initiated during 50°C treatment. Mitochondrial permeability transition in general is an early sign of the initiation of cellular apoptosis or necrosis provoking a collapse in the electrochemical gradient across mitochondrial membranes [Crompton, 1999; Kim, 2003; Cossarizza, 1993]. Especially cellular responses to sublethal stress temperatures, as used for different therapeutic hyperthermia applications, are essential for the understanding of tissue-specific effects induced by heat. Mild or severe heat stress is not unequivocally definable and depends on cell species, tissue origin, cell cycle, developmental stages, as well as exposure times. There possibly exists a rough borderline between lethal and sublethal heat stress [Park, 2005], which might be influenced by intrinsic and environmental factors. As the central factory of cellular energy metabolism mitochondria present cardinal targets of hyperthermic stress and other nonthermal stressors [Funk, 1999; Huckriede, 1995; Lai, 1996; MacouillardPoulletier, 2000]. Mitochondrial dysfunctions lead to an important decrease of cellular ATP levels and phosphorylation efficiencies [Wang, 2005] thus triggering problems with energetic supplies. Depolarization of mitochondria was detected in MX1 cells after heat stress, whereas a nonlinear interrelation between mitochondrial depolarization dynamics and stress temperatures was revealed [Dressler, 2006]. This response was reflected by an exponential decay function describing the average ratios of fluorescence amplitudes measured for the membrane potential sensor JC-1 in the red and the green emission channel (Figure 5). The standard deviation, which is comparatively large in this case, should be reduced by increasing the number of investigated micrographs. In myocytes also an exponentially proceeding depolarization of mitochondria was detected after application of FCCP (4-(trifluoromethoxy) phenylhydrazone). The decrease of ΔΨm dependent tetramethylrhodamine ethyl ester (TMRE) fluorescence was measured in this study when spontaneous transient ΔΨm depolarizations were observed [O´Reilly, 2003]. There depolarizations were reversible and not permanent like in our study [Dressler, 2006]. Apparently mitochondrial depolarizations follow exponential dynamics. Only the red fluorescent J-aggregates measure the ΔΨm dependent accumulation at mitochondria, and the green fluorescence depends on passive binding of JC-1 monomers to any cellular membrane. It should be considerded that the fluorescence intensity ratios of red and green emissions relate to phenomena occurring in different cellular regions. [Bernardi, 1999]. Since orange-red fluorescence of aggregated JC-1 strictly depend on high ΔΨm, the fluorescence intensity ratios measured in this study reflect the heat-induced depolarization of mitochondria. The nonlinear response of MX1 mitochondria to hyperthermic stress corresponded very well with our results obtained using various microscopic techniques for investigating heat-stress responses of different subcellular structures in MX1 cells [Dressler, 2005]. In our previous studies nonlinear responses of plasma membranes, cytoskeletons in heat stressed MX1 cells were observed, too [Dressler, 2005; Beuthan, 2004]. Applications of heat as therapeutic agent in general are conflicted with spatial and temporal variations of temperature distributions inside a target volume and surrounding structures [Dewhirst, 2003]. It is also possible that different subcellular components in a certain cell species exhibit various heat sensitivities. Consequently thermal destruction-inducing therapies should apply very precise and specific intervention protocols concerning the volume and location of diseased tissue, blood supply and perfusion dynamics, heat dose, application geometry and control techniques, as well as the patient´s

686

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

physical condition. Only a well-balanced interplay of all relevant parameters may ensure a successful thermotherapy [Roggan, 2001].

Connecting Experimental Data to Models The use of systems biology tools help to enrich a priori information for the laboratory work. Cellular reaction networks are stored in several databases (ConsensusPathDB, Biocarta) that will help users to summarize and verify cellular processes, pathways and systemic interrelations. Understanding of HSP-associated pathways requires integration of different kinds of functional annotations. The HSP network is illustrated as interactive graphic models of cellular pathways (Figure 6). ConsensusPathDB assists the development, expansion and refinement of computational models of biological systems and context-specific visualization of models provided in SBML. The database model allows integration of information on metabolic, signal transduction and gene regulatory networks. A heat shock response dependends on a complex regulatory network involving 21 known transcription factors and 4 HSP families. It is well known that HSP and transcription factors (Hsfs) are involved in cellular response to various forms of stress besides heat [Swindell, 2007]. However, the role of HSP and Hsfs under cold and non-thermal stress conditions is not well understood, and it is unclear which types of stress interact least or most strongly with HSP and Hsf response pathways. To address this issue, transcriptional response profiles should be analyzed and evaluated in the near future. Figure 6. Stress induction of HSP regulation. Pathway information is provided by BioCarta [http://cgap. nci.nih.gov/Pathways/BioCarta/h_hsp27Pathway]

687

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

CONCLUSION Our fluorescence investigations on mitochondrial responses to hyperthermic stress in MX1 breast cancer cells revealed a comparatively high thermosensitivity, since mitochondrial morphologies and cellular distributions already changed when exposed to a mild stress temperature of 40°C (30min) after MTG labeling. Morphological changes were not directly accompanied by ΔΨm depolarizations, because JC-1-labeled mitochondria exhibited only minor ΔΨm reductions after stress in a temperature range between 40°C and 45°C when compared with control cells. More severe stress conditions at 50°C or 56°C induced complete mitochondrial depolarization detected by massive decrease of orange fluorescence intensities shifting to weak red fluorescence. Orange fluorescence was emitted by J-aggregates accumulated at highly polarized mitochondria. In cells containing depolarized organelles JC-1 formed green fluorescent monomers. Heat-induced ΔΨm depolarization of mitochondria was monitored by the absolute fluorescence intensity ratios evaluated for the maximum fluorescence amplitude measured in the red and the green fluorescence image of every object (red:green ratio). Our results should not be considered as groundbreaking novelties, but nevertheless may support further developments in the field of thermotherapeutic dosimetry and irradiation planning (LITT). Anyhow, the biology of heat still presents an open field of unresolved questions and all experimental data will contribute more or less essential pieces to the puzzle of systemic stress- response mechanisms.

References Bernardi, P., Scorrano, L., Colonna, R., Petronelli, V., & Di Lisa, F. (1999). Mitochondria and cell death. Eur. J. Biochem, 264, 687-701. Beuthan, J., Dressler, C., & Minet, O. (2004). Laser-induced fluorescence detection of quantum dots redistributed in thermally stressed tumor cells. Laser Physics, 14(2), 213-219. Campbell, R. B. (2007). Battling tumors with magnetic nanotherapeutics and hyperthermia, turning up the heat. Nanomed, 2(5), 649-652. Colombo, R., Salonia, A., Da Pozzo, L. F., Naspro, R., Freschi, M., Paroni, R., Pavone-Malasco, M., & Rigatti, P. (2003). Combination of intravesical chemotherapy and hyperthermia for the treatment of superficial bladder cancers: Preliminary and clinical experience. Crit Rev Oncol/Hematol, 47(2), 127139. Cossarizza, A., Baccarani-Contri, M., Kalashnikova, G., & Francheschi, C. (1993). A new method for the cytofluorimetricanalysis of mitochondrial membrane potential using the J-aggregate forming lipophilic cation 5,5´,6,6´-tetrachloro-1,1´,3,3´-tetraethylbenzimidazolcarbocyanine iodide (JC-1). Biochem Biophys Res Commun.,197(1), 40-45. CPDB . http://pybios.molgen.mpg.de/CPDB Crompton, M. (1999). The mitochondrial permeability transition pore and its role in cell death. Biochem J, 341(2), 233-249.

688

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

Debes, A., Willers, R., Göbel, U., & Wessalowski, R. (2004). Role of heat treatment in childhood cancers: Distinct resistance profiles of solid tumor cell lines towards combined thermotherapy. Pediatr. Blood Cancer, 45(5), 663-669. Dewhirst, M. W., Viglianti, B. L., Lora-Michiels, M., Hanson, M., & Hoopes, P. J. (2003). Basic principles of thermal dosimetry and thermal thresholds for tissue damage from hyperthermia. Int. J. Hyperthermia, 19(3), 267-294. Dressler, C., Minet, O., Novkov, V., Müller, G., & Beuthan, J. (2005). Microscopical heat stress investigations under application of quantum dots. J Biomed Optics, 10, 1-9. Dressler, C., Beuthan, J., Müller, G., Zabarylo, U., & Minet, O. (2006). Fluorescence imaging of heatstress induced mitochondrial long-term depolarization in breast cancer cells. J Fluor, 16, 689-695. Duchen, M. R., Leyssens, A., & Crompton, M. (1998). Transient mitochondrial depolarizations reflect focal sarcoplasmic reticular calcium release in single cardiomyocytes. J Cell Biol, 142(4), 975-988. Funk, K. R. H. W., Nagel, F., Wanka, F., Krinke, H. E., Gölfert, F., & Hofer, A. (1999). Effects of heat shock on the functional morphology of cell organelles observed by video-enhanced microscopy. Anat Rec, 255(4), 458-64. Gellermann, J., Wlodarczyk, W., Hildebrandt, B., Ganter, H., Nicolau, A., Rau, B., Till,y W., Fähling, H., Nadobny, J., Felix, R., & Wust, P. (2005). Noninvasive magnetic resonance thermography of recurrent rectal carcinoma in a 1.5 Tesla hybrid system. Cancer Res, 65(13), 5872-5880. Gewiese, B., Beuthan, J., Fobbe, F., Stiller, D., Müller, G., Böse-Landgraf, J., Wolf, K-J., & Deimling, M. (1994). Magnetic resonance imaging-controlled laser-induced interstitial thermotherapy. Investig Radiol, 29(3), 345-351. Hehr, T., Wust, P., Bamberg, M., & Budach, W. (2003). Current and potential role of thermoradiotherapy for solid tumours. Onkologie, 26 (3), 295-302. Hobohm, U. (2001). Fever and cancer in perspective. Cancer Immunol Immunother, 50, 391-396. Hobohm, U. (2005). Fever therapy revisited. Br J Cancer, 92, 421-425. Invitrogen. Probes for Mitochondria. Retrieved from http://probes.invitrogen.com/handbook/ sections/1202.html Invitrogen. JC-1/pH 8.2. Retrieved from http://probes.invitrogen.com/servlets/spectra?fileid=3168p82 Invitrogen. JC-1. Retrieved from http://probes.invitrogen.com/media/publications/159.pdf Invitrogen. MitoTracker® Green FM/MeOH. Retrieved from http://probes.invitrogen.com/servlets/ spectra?fileid=7514moh Huckriede, A., Heikema, A., Sjollema, K., Briones, P., & Agsteribbe, E. (1995). Morphology of the mitochondria in heat shock protein 60 deficient fibroblasts from mitochondrial myopathy patients. Effects of stress conditions. Virchows Arch, 427(2), 159-65. Jakobs, S. (2006). High resolution imaging of live mitochondria. Biochim Biophys Acta, 1763, 561575.

689

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

Johannsen, M., Gneveckow, U., Thiesen, B., Taymoorian, K., Cho, C. H., Waldöfner, N., Scholz, R., Jordan, A., Loening, S., &. Wust, P. (2007). Thermotherapy of prostate cancer using magnetic nanoparticles: Feasibility, imaging, and three-dimensional temperature distribution. Eur Urol, 52, 1653-1662. Jordan, A., Scholz, R., Maier-Hauff, K., van Landegehm, FK., Waldoefner, N., Teichgraeber, U., Pinkernelle, J., Bruhn, H., Neumann, F., Thiesen, B., von Deimling, A., & Felix, R. (2006). The effect of thermotherapy using magnetic nanoparticles on rat malignant glioma. J. Neurooncol., 78(1), 7-14. Keshavan, P., Schwemberger, S. J., Smith, D. L. H., Babcock, G. F., & Zucker, S. D. (2004). Unconjugated bilirubin induces apoptosis in colon cancer cells by triggering mitochondrial depolarization. Int. J. Cancer, 112(3), 433-445. Kim, J-S., He, L., & Lemasters, J. L. (2003). Mitochondrial permeability transition: A common pathway to necrosis and apoptosis. Biochem. Biophys. Res. Commun., 304(3), 463-470. Kregel, K. C. (2002). Molecular biology of thermoregulation. Invited review. Heat shock proteins: Modifying factors in physiological stress responses and acquired thermotolerance. J. Appl. Physiol., 92(5), 2177-2186. Lai, Y. K., Lee, W. C., Hu, C. H., & Hammond, G. L. (1996). The mitochondria are recognition organelles of cell stress. J. Surg. Res., 62(1), 90-94. Lieven, C. J., Vrabec, J. P., & Levin, L. A. (2003). The effects of oxidative stress on mitochondrial transmembrane potential in retinalganglion cells. Antioxidants & Redox Signaling, 5(5), 641-646. Lindquist, S. (1986). The heat-shock response. Ann. Rev. Biochem., 55, 1151-1191 Mack, M., Straub, R., Eichler, K., Söllner, O., Lehnert, T., & Vogl, T. (2004). Breast cancer metastases in liver: Laser-induced interstitial thermotherapy-Local tumor control rate and survival data. Radiol, 233(2), 400-409. Macouillard-Poulletier de Gannes, F., Merle, M., Canioni, P., & Voison, P-J. (1998). Metabolic and cellular characterization of immortalized human microglial cells under heat stress. Neurochem. Intl., 33(1), 61-73. Macouillard-Poulletier de Gannes, F., Leducq, N., Diolez, P., Belloc, F.., Merle, M., Canioni, P., & Voison, P-J. (2000). Mitochondrial impairment and recovery after heat shock treatment in a human microglial cell line. Neurochem. Intl., 36(3), 233-241. Nikfarjam, M. & Christophi, C. (2003). Interstitial laser thermotherapy for liver tumours. Brit. J. Surg., 90(9), 1033-1047. O´Reilly, C. M., Fogarty, K. E., Drummond, R. M., Tuft, R. A., & Walsh Jr., J. V. (2003). Quantitative analysis of spontaneous mitochondrial depolarizations. Biophys. J., 85(5), 3350-3357. Park, H. G., Han, S. I., Oh, S. Y., & Kang, H.S. (2005). Cellular responses to mild heat stress. Cell. Mol. Life Sci., 62(1), 10-23. Proskuryakov, S. Y., Konoplyannikov, A. G., Gabai, V. L. (2003). Necrosis: A specific form of programmed cell death? Experim. Cell Res., 283, 1-16.

690

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

Roggan, A., Ritz, J-P., Knappe, V., Germer, C-T., Isbert, C., Schädel, D., & Müller, G. (2001). Radiation planning of thermal laser treatment. Med. Laser Appl., 16(2), 65-72. Sonna, L. A., Fujita, J., Gaffin, S. L., & Lilly, C. M. (2002). Effects of heat and cold stress on mammalian gene expression. J. Appl. Physiol., 92(4), 1725-1742. Swindell, W. R., Huebner, M. & Weber, A. P. (2007). Transcriptional profiling of Arabidopsis heat shock proteins and transcription factors reveals extensive overlap between heat and non-heat stress response pathways. BMC Genomics, 8, 125 Takayama, S., Reed, J. C., & Homma, S. (2003). Heat-shock proteins as regulators of apoptosis. Oncogene, 22(56), 9041-9047. van der Zee, J. (2002). Heating the patient: A promising approach? Ann. Oncol., 13(8), 1173-1184. Vaux, D. L. (2002). Apoptosis and toxicology-what relevance? Toxicol., 181-182, 3-7 Wang, J-L., Ke, D-S., & Lin, M-T. (2005). Heat shock pretreatment may protect against heatstrokeinduced circulatory shock and cerebral ischemia by reducing oxidative stress and energy depletion. Shock, 23(2), 161-167 Zunino, S. J. & Storms, D. H. (2006). Resveratrol-induced apoptosis is enhanced in acute lymphoblastic leukemia cells by modulation of the mitochondrial permeability transition pore. Cancer Lett. 240, 123-134

Key Terms Depolarization: This term describes the process or act of neutralizing polarity. In biology D. is a decrease in the absolute value of a cell’s membrane potential. Thus, changes in membrane voltage in which the membrane potential becomes less positive or less negative are both depolarizations. Heat Shock Proteins (HSP): This term summarizes a group of proteins that are present in all cells in all life forms and are induced by various types of environmental stresses like heat, cold or oxygen deprivation. HSP act like ‘chaperones,’controling shape and location of proteins inside cells exposed to physiological or stress conditions. Hyperthermia: In general this term describes a condition of elevated body temperature that might cause heat stroke in an advanced state. In clinical applications H. is intentionally produced for thermotherapy of cancers. Local, regional, and whole-body H. need to be differentiated. Laser-Induced Thermotherapy (LITT): LITT is a minimally invasive method for the treatment of malign and benign tumors in different organs (i.e. liver, lung, brain, head and neck area, abdomen, prostate). The tumor is not removed by LITT but ablated in situ, whereupon surrounding normal tissues are spared. After punture the laser radiation is directed into the target tissue via flexible optical waveguides and appropriate application systems. Because of light absorption temperatures between 45°C and 100°C are achieved inside the target volume, inducing massive protein coagulations and destruction of radiated tissue.

691

Fluorescence Imaging of Mitochondrial L ong-Term Depolarization in Cancer Cells

Mitochondrial Transmembrane Potential (ΔΨm): ΔΨm is an electrical potential difference (voltage) between interior and exterior of mitochondrial membranes. The voltage results from different electrolyte concentrations seperated by the mitochondrial membrane. ΔΨm governs ion fluxes across mitochondrial membranes.

692

Section XI

Tools for Molecular Networks

694

Chapter XXXIX

Protein Interactions and Diseases Athina Theodosiou* Biomedical Research Foundation of the Academy of Athens, Greece Charalampos Moschopoulos* Biomedical Research Foundation of the Academy of Athens, Greece Marc Baumann Biomedicum, Helsinki University, Finland Sophia Kossida Biomedical Research Foundation of the Academy of Athens, Greece, and Biomedicum, Helsinki University, Finland

abstract In previous years, scientists have begun understanding the significance of proteins and protein interactions. The direct connection of those with human diseases is now unquestionable and proteomics have become a scientific section of great research interest. In this chapter, we present a detailed description of the nature of protein interactions and describe the more important methodologies that are being used for their detection. Moreover, we review the mechanisms leading to diseases and involving protein interactions and refer to specific diseases such as Huntington’s disease and cancer. Lastly, we give an overview of the most popular computational methods that are used for the prediction or the healing of the diseases.

INTRODUCTION The recent completion of many genome-sequencing projects of various organisms, from viruses to mammals, is undoubtedly the greatest triumph of molecular biology since the discovery of the DNA double helix. After the complete genome sequencing of many organisms, including human, the focus

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Protein Interactions and Diseases

of molecular biology has gradually shifted the interest from genomes to proteomes, in order to explore and discover the function of proteins (Eisenberg et al., 2000; Pandey et al., 2000). One of the great challenges in the protein field is to reconstruct the complete protein interaction network within the cells, the so-called interactome. There is great difficulty in achieving this goal as the nature of the protein interactions varies depending on many environmental conditions that affect the cell (Nooren et al., 2003). However, due to the fact that protein interactions play a vital role in the basic functions of an organism’s cell, analysis of these networks will unravel the secrets of the pathways in which the under question interactions are detected and ultimately provide insights in how diseases are developed (Sam et al., 2007). Several methods, which will be detailed within this book chapter, exist for the detection of protein interactions. During the last years, new high-throughput methodologies are being used to detect a great amount of protein interactions with a single experiment (Piehler 2005). Unfortunately, these methods are error-prone, therefore the generated data need further analysis (Droit et al., 2005). Today, large amounts of protein interactions of many organisms are stored in large on-line databases and are available for academic purposes. These data are useful in order to better understand the connection between protein interactions and diseases (Chen 2006). In this chapter, we present a detailed description of protein interactions and a full overview of the approaches taking advantage of these, to better understand specific diseases. The chapter is organized as follows: the first section reviews the nature of protein interactions and various experimental and computational methods for detecting and predicting those. The most important databases used for storing and integrating protein interactions and protein interactions associated with disease are described, whereas the recent information about the human interactome is mentioned. The second section describes mechanisms of protein interactions that have been shown to lead to disease and the third section describes the computational methods that are used for the holistic understanding of specific diseases.

PROTEIN INTERACTIONS Introduction One of the goals of system biology is to understand the behaviour of the biological systems by studying the molecules that are involved in them. Therefore, it is of great importance to determine the interactions taking place among the molecules. The study of protein interactions has been vital to the understanding of how proteins function within the cell, in where proteins interact with other proteins, metabolites and nucleic acids. More specifically, protein interactions are crucial for forming structural complexes, for extra-cellular signalling, for intra-cellular signalling, for cell communication and for several other aspects of cellular function. The characterization of protein interactions is really important to understand the molecular mechanism of biological pathways and disease processes. Complete knowledge of these pathways will help us to understand how diseases, such as cancer, develop. Since almost all processes are regulated by multiple complexes, the absence of some interactions or the complete absence of physical interactions can be the cause of disease in humans (Ryan and Matthews, 2005).

695

Protein Interactions and Diseases

The following section will focus on the general information about protein interactions. A brief description of physical protein interactions is presented and it is divided into two major groups: protein-protein interactions and protein-DNA interactions. Another distinction between protein interactions is the predicted and experimentally measured interactions (Uetz et al., 2005) Furthermore, several experimental and computational methods for predicting protein interactions are reviewed. Moreover, several databases used to store and integrate protein interactions and interactions related to diseases are explored. In addition, the latest information available on the complete human interactome is discussed.

Protein - Protein Interactions Most proteins live and function in very complex environments and have many potential binding partners. Some proteins are very selective on their binding partner, while other proteins are more “openminded” and can interact with different kind of proteins making the binding more competitive. This, so called, multi-specific binding between two protein families is very common in regulatory pathways and networks (Nooren et al., 2003). There is an important distinction between the types of protein-protein interactions. They can be classified according to the proteins involved in the interactions, (structural or functional) or they can be classified based on their physical properties. From the structural point of view, protein-protein interactions can occur between identical or non identical chains (homo or heterooligomers). In addition, depending on the stability and mechanism of the formation of a protein-protein complex, they can be subdivided into non-obligated (short living) complexes and obligated (stable) complexes. Furthermore, they can also be divided into transient and permanent, based on the lifetime of the complex. Last but not least, protein-protein interactions can be classified based on their functional role. Common functional classes are the enzyme-inhibitor complexes, antibody-protein complexes and protein-receptor complexes.

Protein - DNA Interactions Protein–nucleic acid interactions play important role in various important cellular processes such as transcriptional regulation, recombination, genome rearrangement, replication, repair and DNA modification. A classification of protein-DNA complexes was attempted by various authors (Harisson, 1991; Luisi, 1995; Luscombe et al., 2000). The process of transcription is mediated by a number of protein–protein and DNA-protein complexes. The protein factors modulating gene transcription are the transcriptional regulators which bind to specific DNA sequences named promoter sequences. Several transcription factor- DNA interactions have revealed new insights into the molecular basis of cancer and other human diseases (Tan et al., 1998). Genome-wide protein–DNA interactions may be measured using chromatin immunoprecipitation (ChIP) in conjunction with expression microarrays (Lee et al., 2002). In contrast with protein-protein interactions, protein–DNA interactions are not obligate, as both the proteins and the DNA exist in isolation (Jones et al., 1999).

Methodologies to Detect Protein Interactions In recent years, a huge variety of methodologies has been developed in order to detect protein interactions. For the detection of protein–protein and protein–nucleic acid interactions, the scientists follow

696

Protein Interactions and Diseases

different strategies and methodologies. They can be separated in two main categories: the experimental methods and the computational ones. The computational methodologies are used to predict potential protein interactions, to validate the results of high-throughput interaction screens and to analyze the protein networks inferred from interaction databases. Various data mining procedures, pattern recognition techniques and neural or Bayessian networks are being used in order to predict protein interactions (Valencia et al., 2002). The experimental methods can be separated into: the in vitro methods which are performed in biological laboratories and the in vivo methods that are performed in living cells (Figure 1). Because of the nature of the proteins and the different interaction types, many parameters have to be taken into consideration when in vitro methods are applied. The in vivo methods have the advantage that they are applied in a natural cellular environment. Below, an overview of the most popular techniques of the experimental category is provided.

In Vitro Methods for Protein-Protein Interactions The classical methods for detecting protein–protein interactions are co-immunoprecipitation (Adams et al., 2002) and pull down assays (Vikis et al., 2004). The first one uses an antibody specific to the protein of interest and it is added during the cell lysis. The sample is incubated for some hours, when the antibody forms a complex with the under question protein. All the remaining proteins are washed away and in the end, the complex is separated. Any other proteins bound to the under question protein are separated too. Finally, Western blot analysis is used for the identification of the proteins (Hall 2004). The pull down assay method is similar to the co-immunoprecipitation one, with the exception that a

Figure 1. In vitro and in vivo methodologies for detecting protein-protein interactions

697

Protein Interactions and Diseases

protein and not an antibody is used as a bait. Usually, Glutathione-S-transferase (GST)-fusion proteins are used as baits. A refinement of the above mentioned methods is the Tandem Affinity Purification (TAP) technique (Rigaut et al., 1999; Puig et al., 2001). TAP uses a tag, which consists of two IgG binding domains and a calmodulin binding peptide separated by a TEV protease, which is fused to the under question protein. This tag is selected to maintain the expression of the fusion protein at, or close to, its natural level. Two different affinity steps are followed in order to separate the protein complex from the TAP tag and some associated components. The purified protein complexes are subsequently analyzed by SDS-PAGE and mass spectrometry. Although TAP technique is a very useful one, it can not detect transient interactions (Piehler 2005). Recently, a new technology has been developed, called protein microarrays (Zhu et al., 2001; Templin et al., 2003; Stoll et al., 2005). A protein microarray is a piece of glass on which many different probes are fixed. By combining small volume of proteins with these probes, valuable conclusions on protein interactions can be extracted. Many probes can be fixed on a protein microarray, hence massive amounts of information can be obtained by a single experiment.

In Vivo Methods for Protein-Protein Interactions The most popular technique is the so called yeast two-hybrid system (Y2H) (Fields et al., 1989). In this technique, the “bait” protein is fused to a DNA binding domain (DBD) and the “fish” proteins are fused to an activation domain (AD). AD and DBD are parts of the transcription factor. If the two proteins interact, a reporter gene is transcriptionally activated and a color reaction can be recorded on specific media. This method can be applied in various organisms with many variations (Toby et al., 2002). However, the Y2H method does not offer any information about the kind of the interaction determined between the proteins and it is prune to errors. For this reason, the Y2H system is usually used in combination with other techniques (Johnsson et al., 2003 for example). The Y2H system is also used to detect protein-DNA interactions (Joung et al., 2000). Another commonly used in vivo technique is the Phage Display method (Smith et al., 1997; Willats 2002). This method integrates multiple genes from a gene bank into phages which are subsequently added to a small plastic dish with the protein of interest. The dish is washed and the phage-displaying proteins interacting with the unknown protein remain attached to the dish. The DNA extracted from the interacting phages contains the sequence of the interacting proteins. The size limitation of protein sequence is a drawback of this method. Although, these two methods detect protein interactions in vivo, they do not function in real time. Currently the most powerful technique for real time detection in living cells is fluorescence resonance energy transfer (FRET) (Yan et al., 2003). FRET describes an energy transfer mechanism between two fluorescent molecules. Fluorescence microscopy techniques and flow cytometry can by combined with FRET and take advantage of its features (Kenworthy 2001; Chan et al., 2004). However, these techniques are experimentally and technically very demanding.

Methods to Detect Protein-Nucleic Acid Interactions The most commonly used technique for the detection of protein-nucleic acid interactions is called Electrophoretic Mobility Shift Assay (EMSA) (Fried 1989; Jing et al., 2004). The assay is based on the

698

Protein Interactions and Diseases

fact that protein-DNA complexes migrate more slowly through a native polyacrylamide or agarose gel than unbound DNA. The individual protein-DNA complexes can be visualized as discrete bands within the gel using chemiluminescence or radioisotopic detection. The method has the ability to recognize all the proteins and the DNA fragments that interact with each other. A variation of this method is the technique called Supershift Assay (Denissova et al., 2000) which is using antibodies in order to make the complexes between proteins and DNA more stable within the gel. Another relatively old technique is the one called DNA Footprinting (Petri et al., 1997). The method uses an enzyme that can cut or modify DNA at every base pair. However, the fragments of DNA that interact with a protein are protected from these changes. At the end of the experiment, the DNA is examined in order to record the changes that occurred. The unmodified remaining parts are the ones interacting with the protein.

Human Protein Interactome Proteins react with other proteins forming complexes, whereas complexes are part of an extensive network. The so-called interactome network is the complete collection of all physical protein-protein interactions that can take place within a cell. The first large scale protein interaction studies were done in yeast (Uetz et al., 2000; Ito et al., 2001) but have more recently been done in the fly (Giot et al., 2003) and the worm (Li et al., 2004). After these studies the research community has put more emphasis into the human interactome. A comprehensive and accurate mapping of human protein interaction network (Colland et al., 2004; Stelzl et al., 2005) has been constructed. Interaction maps were constructed from literature (Ramani et al., 2005) and from experimental approaches (Rual et al., 2005; Stelzl et al., 2005). A catalog of all human protein-protein interactions is seen as a crucial prerequisite to understand how cells function and to decipher the general principles governing this function. Importantly, such information should also enhance the understanding of complex disease processes such as cancer. In various bioinformatics analyses, the authors collected information, concerning human interactome, and constructed maps by identifying conserved orthologous interactions (Lehner and Fraser, 2004). However, transferring interaction information from model organisms to humans has been shown to be a difficult task (Bork et al., 2004; Ramani et al., 2005). In order to understand disease mechanisms and signalling cascades, smaller protein interaction networks, representing part of the human interactome, were generated. For instance the interaction network for Huntigton`s disease included 186 interactions (Goehler et al., 2004) and the network for the transforming growth factor-β signalling pathway contained 755 interactions (Colland et al., 2004). Moreover, a study of the interaction attributes of all known human cancer genes has been attempted, where it was showed that cancer proteins display a different global topology from non-cancer proteins (Jonsson and Bates, 2006). This study clearly demonstrated the central role of cancer proteins within the human interactome. The human protein interactome has proven to reveal information about potential new target genes responsible for genetic diseases (Xu and Li, 2006).

Protein Interaction Graphs The new biological methodologies have generated large amounts of data concerning protein-protein interactions. A very efficient way of summarizing these new datasets is by forming protein interaction graphs (Figure 2). These graphs provide a valuable tool that helps the better understanding of the functional organization of the proteome. 699

Protein Interactions and Diseases

Figure 2. A subgraph of human’s interactome derived from DIP database as it is represented with the help of Cytoscape Tool

A graph is represented as G = (V,E), where V is the set of the graph vertices and E is the set of the graph edges. In a protein interaction graph, the vertices represent the proteins and the edges the pairwise interaction between two proteins. A protein interaction graph can be weighted or unweighted. In a weighted one, each edge connecting two proteins has been characterized by a number that represents the validly of the connection between these two proteins. In an unweighted protein interaction graph, an assumption is made that this number is equal to 1 for all the edges of the graph. Generally, the protein interaction graphs are undirected and unweighted graphs. Some properties have been identified to be common between the protein interaction graphs of all the organisms. First of all, they are all scale free. Moreover, it is proved that similar proteins usually interact with each other and that they lie within short distance in the interaction graph. Finally, there are few vertices having many interactions and many that have few interactions. This means that if some proteins are eliminated, the topology of the protein interaction graph does not change which subsequently confirms the robustness of the organisms as they can afford to loose some proteins without jeopardizing the existence or even the normal function of the network. In protein interaction graphs, the dense subgraphs are valuable since they provide details concerning the functionality of the subgraph proteins and the consistency of protein complexes. Given the mathematical representation of a graph, algorithms derived from the graph theory are well suited in order to isolate these dense areas.

Protein Interaction Databases The amount of data that has been derived from high-throughput approaches, automated text mining techniques, and/or manually from the scientific literature, has been stored in databases called proteinprotein interaction databases. These databases are valuable resources for the researchers, where from

700

Protein Interactions and Diseases

they can easily retrieve and analyze the stored data (Suresh et al., 2005). Usually these databases include data of protein interactions obtained from many organisms. The most popular databases that include data concerning human protein interactions are HPRD (Peri et al., 2003), BIND (Alfarano et al., 2005), MINT (Zanzoni et al., 2002) and IntAct (Hermjakob et al., 2005). A more comprehensive review of protein interaction databases to date is presented in Table 1. All these databases support the PSI-MI (http://psidev.sourceforge.net/mi/xml/doc/user) format which is a format for the protein-protein interaction data. The HPRD database has recorded about 3 times more human protein interactions compared to the other databases. All the remaining databases have almost the same amount of human protein interactions. Moreover, there is a significant difference in the total number of protein-protein interactions among the various protein-protein interaction databases (Mathivanan et al., 2006), due to the fact that data for each database were derived using different methods. Finally, all these databases have some entries where disease genes from the OMIM database with at least one protein-protein interaction are recorded. Apart from the databases where data obtained from experimental methods are stored, there are some other databases where protein interactions predicted by computational methods are stored. The most significant one is called Online Predicted Human Interaction Database (OPHID) (Brown et al., 2005) and combines the data that are stored in HRPD, BIND and MINT databases with in silico predicted data. The STRING database has integrated known and predicted interactions from a variety of sources as well (Von Mering et al., 2007).

Table 1. The most important protein interaction databases Databases

Features

Web links

References

BIND

Binary molecular interactions, molecular complexes and pathways

http://www.blueprint.org/bind/bind.php

Alfarano et al., 2005

DIP

PPI data manually curated from literature

http://dip.doe-mbi.ucla.edu/

Xenarios et al., 2000

HPRD

Human PPIs, information about posttranslational modifications, subcellular localization, protein domain architecture, tissue expression and human disease associations

http://www.hprd.org/

Peri et al., 2003

MINT

Experimental verified protein interactions

http://mint.bio.uniroma2.it/mint/Welcome.do

Zanzoni et al., 2002

MIPS

Mammalian interaction data manually curated from literature

http://mips.gsf.de/proj/ppi/

Pagel et al., 2005

IntAct

Interactions, experimental methods and literature citation of human proteins. No species restriction

http://www.ebi.ac.uk/intact/site/index.jsf

Hermjakob et al., 2005

PDZBase

PPIS involving protein with PDZ domains, confirmed in vitro and in vivo experiments

http://icb.med.cornell.edu/services/pdz/start

Beuming et al., 2005

Reactome

Pathways and biochemical reactions in humans

http://www.genomeknowledge.org/

Joshi-Tope et al., 2005

STRING

Known and predicted protein-protein interactions from various organisms

http://string.embl.de/

Von Mering et al., 2007

OPHID

Predicted human protein protein interactions

http://ophid.utoronto.ca/ophid/index.html

Brown et al., 2005

701

Protein Interactions and Diseases

The HPRD and the OMIM database, due to their importance in relation to this chapter will be presented in more detail in the following paragraphs.

OMIM Online Mendelian Inheritance in Man (OMIM) (Hamosh et al., 2005) is an online database focusing on human genes and genetic disorders. Initially, it was based on Dr. Victor A. McKusick’s book entitled “Mendelian Inheritance in Man”. Today, the online database OMIM is distributed electronically by the National Center for Biotechnology Information (NCBI). It is updated daily and provides links to a variety of related resources. OMIM catalogues all the known diseases with a genetic component and it links them to the relevant human genes, when this information is available. Each entry has textual information and it is accompanied with references. Many other databases, including HPRD, are based on the entries provided by OMIM which strengthens the trust in the quality of the data included within the database.

HPRD The Human Protein Reference Database (HPRD) (Peri et al., 2003; Peri et al., 2004) is an online database providing information about human proteins. This database was developed from Dr. Akhilesh Pandeyat’s team in Johns Hopkins University and the Institute of Bioinformatics. The database includes domain architecture, protein functions, protein-protein interactions, post-translational modifications, subcellular localization and disease association of genes (Mishra et al., 2006). HPRD also reports interactions of proteins with other nucleic acids and small molecules. HPRD is a curated database where data are derived manually by expert biologists reading the published literature. The larger part of HPRD data is derived from in vitro methods. The property that makes HPRD a very important database is that it contains information about the connection of many proteins with diseases. This kind of information is obtained from OMIM database where the disease genes form these proteins are annotated. The HPRD is a database that connects proteins with diseases based on OMIM database information. Moreover, HPRD has information about protein modifications which are very important as they are related with diseases. The identification of protein modifications can lead to the design of new and more effective drugs.

PROTEIN INTERACTION AND DISEASES Introduction One among the major goals of biological science, that has a great impact to our society, is to improve our understanding of the many diseases that currently exist. Some diseases are caused by a single gene, where one and only one gene has a dramatic influence on the disease phenotype. In contrast, the more complex diseases such as diabetes and heart diseases, are caused by a combination of multiple genes, environmental factors and behaviors. The latter scenario is more frequently met within the population (review in Pevsener, 2003). Many human diseases can be the result of abnormal protein-protein interac-

702

Protein Interactions and Diseases

tions or the result of the loss of essential interactions (Ryan and Matthews, 2005). In this section, we review the mechanisms leading to diseases and involving protein interactions. It is possible that protein interactions are the cause of pathological processes, for example Huntington’s disease (Li and Li, 2004), Alzheimer’s disease and prion diseases (Cohen and Prusiner, 1998) and several types of human cancer (zur Hausen, 2000). Moreover, interactions between virus proteins can occur during replication and human viruses can be assembled in the host cells (Loregian et al., 2002). Here, we present, in more detail, some case studies for possible links between protein interactions and diseases.

Huntington’s Disease and Protein Interactions Huntington’s disease belongs to the family of inherited neurodegenerative diseases that are caused by expansion of CAG repeats that encode polyQ tracts in the associated disease proteins (review Li and Li, 2004). This expansion of protein huntingtin (htt) produces an altered form of the Htt protein, the mutant Huntingtin (mHtt). Strong evidence indicates that the aggregation of mutant htt is linked to disease progression (Davies et al., 1997). Therefore, it is possible that proteins interacting with htt and influencing the aggregation; are possible modulators of disease pathogenesis. The htt protein has many interaction partners and a range of functions including anti-apoptotic effects, transcription regulation, cellular trafficking and neuronal development (Harjes and Wanker, 2003). It has been shown that the htt protein interacts with p53 transcription factor. It is believed that the expanded repeat of htt protein causes aberrant transcriptional regulation through its interaction with cellular transcription factors like p53, which may result in neuronal dysfunction and cell death (Steffan et al., 2000). Many huntingtin-interacting proteins were characterized, but how these proteins function in interacting network in normal situation or how dysregulation of these proteins affect physiology is still unknown (Borell-Pages et al., 2006).

Cancer and Protein-Protein Interactions Cancer is a multi-step process that generally occurs when cell division gets out of control. The transformed cell has six “acquired capabilities” (Hanahan and Weinberg, 2000). These are self-sufficiency in growth signals, insensitivity to anti-growth signals, apoptosis, limitless replicative potential, sustained angiogenesis and tissue invasion and metastasis. In this section, we will examine examples of abnormal protein interactions form pathogens leading to cancer and different approaches of protein-protein interaction inhibitors influencing the activities that the transformed cell is capable of. The ultimate goal is the development of new therapies for various human diseases.

Pathogen-Host Interactions A major mechanism leading to disease is the interactions of virus components with cellular proteins. Several types of human pappiloviruses (HPVs) infect humans and can lead to cervical cancer and several other types of carcinomas (zur Hausen, 2000, Baseman 2005). Pappiloma viruses are double stranded viruses and infect epithelial cells by taking over the cell mechanism for their own replication and survival. Interactions of viral oncoproteins with growth-regulating host cell proteins have been

703

Protein Interactions and Diseases

reported. HPV genomes, particular those which are generally thought as high-risk genomes, code for at least three proteins with growth-stimulating and transforming properties (E5, E6, E7). E5 is a protein found in the Golgi apparatus and in the plasma membrane (Burkhardt et al., 1989). This protein interacts with various transmembrane proteins such as epidermal growth factor receptor (Hwang et al., 1995). A number of interactions have been reported for E6 and E7 proteins that give stronger evidence, compared to E5, about their functions as oncoproteins. E6 and E7 proteins were shown to immortalize and transform cells in culture (Vousden, 1994). E6 protein is found to bind with the cellular protein p53 and is mediated by E6-associated ligase (reviewed in zur Hausen, 2000), whereas E7 protein binds to the pRB family of pocket proteins resulting in the loss of normal control over cell cycle progression. Another interaction of E7 protein is that it inactivates the cyclic dependent kinase inhibitors p21CIP-1 and p27KIP-1 (reviewed in zur Hausen, 2000). This is believed to be one of the major factors in growth stimulations of the infected by papiloma viruses cells.

Protein-Protein Interaction Inhibitors There has been a particular interest in inhibiting specific protein-protein interactions in order to develop therapies for various human diseases and particularly cancer (reviewed in Arkin, 2005). Protein complexes of cells and microbes have been looked upon as real drug targets and several approaches have been developed in order to generate inhibitors in order to block abnormal protein-protein interactions. For example, antibodies and therapeutic proteins are widely used as antagonists of extracellular protein complexes. Antibodies against growth factors or their receptors are widely used to treat several types of cancer (Hinoda et al., 2004) for instance. However, antibodies cannot block intracellular targets due to their big size, therefore smaller molecules like cross linked peptides and peptide mimetics are more likely to target intracellular and extracellular protein-protein interactions (Zhao and Chmielewski, 2005). An interesting interaction is the one between p53 and murine double-minute 2 (MDM2). Substantial progress and effort has been made in order to develop inhibitors of the p53-MDM2 interactions (reviewed in Klein and Vassilev, 2004). p53 is a sequence specific DNA binding transcritpion factor regulating cell cycle and also functioning as tumour suppressor. The main function of MDM2 is to regulate the protein level and activity of the tumour suppressor p53. In the normal cell, p53 is usually inactive and kept at a low level, bound to the protein MDM2, which prevents its action and promotes its degradation by acting as ubiquitin ligase. P53 is usually activated by cancer causing agents like stress signals or DNA damage and takes on an active role as transcription regulator which leads to DNA repair and at some cases, apoptosis (Jin, 2001). In cases of cancer, MDM2 is found over-expressed, binds to p53, blocks the transcription activation domain and the function of p53 in general, and promotes the growth of tumours (Chen et al., 1996). Restoring p53 function by inhibiting its interaction with MDM2 is viewed as a viable anticancer strategy (Chene, 2003; Ventura et al., 2007). The programmed cell death, termed apoptosis, is one of the major activities of transformed cells. Several protein-protein complexes, such as the Bcl-2 family of proteins, have a potential role in regulating apoptosis (reviewed in Arkin, 2005). Over-expression of Bcl-2 has been observed in several types of cancer (Buolamwini, 1999) and all proteins of the family act by forming complexes with other members of the family (Fry and Vassilev, 2005). The development of inhibitors of these proteins as potential anticancer therapeutics has been previously explored (reviewed in Enyedy et al., 2001), but obtaining smallmolecule inhibitors has proved difficult owing to the necessity of targeting a protein-protein interaction. Evidence suggested that inhibiting Bcl-2 could reverse the resistance to chemotherapy.

704

Protein Interactions and Diseases

Another example of inhibitor is the binding of small molecule inhibitor to the papilloma E2 protein that was designed to prevent the binding of E1 proteins and prevent viral replication (reviewed in Ryan and Matthews, 2005).

APPLICATIONS OF COMPUTATIONAL METHODS IN PROTEIN INTERACTIONS AND DISEASES The protein interactions contain a great amount of information that can be used in order to unravel the mechanisms of the diseases. Research is focusing on proteins and on the identification of active pathways that are related with a specific disease. Usually, computational methods are used for prediction of the evolution of a disease or for the design of new more potent drugs. In order to obtain results of high quality, the computational methods need to have good quality input data. As far as the protein interaction data are concerned, this is very difficult to be achieved due to the error prone experimental methods. To overcome this issue, the data fusion technique for the implementation of a computational method was introduced. Data fusion is the process of putting together information obtained from many different sources such as protein interaction databases, experimental data etc. This technique generates input sets that have more reliability than those that are obtained from a single source such as an experimental method or a protein database. The last years, several computational approaches on this matter have emerged, proving that there is an increasing interest by the scientific community in this field. The well known conference of Pacific Symposium on Biocomputing has a session which is dedicated to the impact of protein interactions in diseases. An overview of the most significant approaches taken by the computational techniques as described at the Pacific Symposium of Biocomputing are presented below.

Computational Applications Machine learning techniques and classifiers have been broadly used in order to reveal the connection between proteins and specific diseases (Terribilini et al., 2006; Xu et al., 2006). These methods utilize two kinds of datasets: the training and the evaluation dataset. These datasets contain data about protein properties, which are every time chosen depending on the selected approach. The records in these datasets have a tag that identifies if the particular record is connected with a disease or not. All records within these datasets have been verified experimentally. In many occasions, the structural properties of the proteins are used. In this way, the prediction of the protein interactions involved in the disease is more accurately determined (Ye et al., 2006; (Kelly et al., 2007). Furthermore, through the structural analysis of the interacting proteins, the disease mechanism can be better understood and more potent drugs could ultimately be designed. The study of the whole protein interaction network of an organism could complement the above mentioned goal. As we saw earlier, a protein interaction network can be represented as a graph. The data forming the protein interaction network are obtained from protein databases or scientific literature with the help of data mining techniques. Subsequently, algorithms can determine the significance of each protein regarding a specific disease (Chen 2006; Gonzalez et al., 2007). Various algorithms derived from the graph theory exist which can be applied in order to detect protein pathways (Bandyopadhyay et al., 2006) or proteins that play vital role in a disease (Toyoda et al., 2000).

705

Protein Interactions and Diseases

Computational methods are used to simulate the behavior of living cells (Troncale et al., 2006) as biological processes are often difficult to be studied by in vivo or in vitro methods. In addition, the design of new tools has been shown to help guiding the in vivo and/or in vitro experiments (Cook et al., 2007). The initial results of the fruitful exchange of the experimental and computational approaches seem really promising for the future in the field of protein interactions and diseases.

NOTE *

Both authors contributed equally to this work.

REFERENCES Adams, P. D., Seeholzer, S., & Ohh, M. (2002). Identification of associated proteins by coimmunoprecipitation. In Protein- Protein Interactions, edited by E. Golemis. Cold Spring Harbor Laboratory Press. (pp. 59-74). Alfarano. C., Andrade, C. E., Anthony, K., Bahroos, N., Bajec, M., Bantoft, K., Betel, D., Bobechko, B., Boutilier, K., Burgess, E., et al.,(2005). The biomolecular interaction network database and related tools 2005 update. Nucleic Acids Research, 33, 418-424. Arkin, M. (2005). Protein-protein interactions and cancer: Small molecules going in for the kill, Current opinion in chemical biology, 9, 317-324. Bandyopadhyay, S., Kelley, R., & Ideker, T. (2006). Discovering regulated networks during HIV-1 latency and reactivation. Pacific Symposium on Biocomputing, 11, 354-366. Baseman, J. G., & Koutsky, L.A. (2005). The epidemiology of human papillomavirus infections. J Clin Virol, 32(Suppl 1), S16-24. Beuming, T., Skrabanek, L., Niv, M. Y., Mukherjee, P., & Weinstein, H. (2004). PDZBase: A proteinprotein interaction database for PDZ-domains. Bioinformatics, 21, 827-828. Bork, P., Jensen, L. J., von Mering, C., Ramani, A. K., Lee, I., & Marcotte, E. M. (2004). Protein interaction networks from yeast to human. Current Opinion in Structural Biology, 14, 292-299. Borrell-Pages, M., Zala, D., Humbert, S., & Saudou, F. (2006). Huntington’s Disease: From Huntingtin function and dysfunction to therapeutic strategies. Cell Mol Life Sci, 63, 2642-2660. Brown, K., & Jurisica, I. (2005). Online Predicted Human Interaction Database. Bioinformatics, (21), 2076-2082. Buolamwini, J. K. (1999). Novel anticancer drug discovery. Curr. Opin. Chem. Biol., 3, 500-509. Burkhardt, A., Willingham, M., Gay, C., Jeang, K. T., & Schlegel, R. (1989). The E5 oncoprotein of bovine papillomavirus is oriented asymmetrically in Golgi and plasma membranes. Virology, 170, 334-339.

706

Protein Interactions and Diseases

Chan, F. K., & Holmes, K. L. (2004). Flow cytometric analysis of fluorescence resonance energy transfer: a tool for high-throughput screening of molecular interactions in living cells. Methods Mol Biol, 263, 281-292. Chen, J. Y. (2006). Mining Alzheimer Disease Relevant Proteins from Integrated Protein Interactome Data. Pacific Symposium on Biocomputing, 11, 367-378. Chen, J., Wu, X., Lin, J. and Levine, A.J. (1996). mdm-2 inhibits the G1 arrest and apoptosis functions of the p53 tumor suppressor protein, Molecular and Cellular Biology, 16, 2445-2452. Chene, P. (2003). Inhibiting the p53-MDM2 interaction: an important target for cancer therapy. Nature Reviews, 3, 102-109. Cohen, F.E., & Prusiner, S.B. (1998). Pathologic conformations of prion proteins. Annual review of Biochemistry, 67, 793-819. Colland, F., Jacq, X., Trouplin, V., Mougin, C., Groizeleau, C., Hamburger, A., Meil, A., Wojcik, J., Legrain, P., & Gauthier, J.M. (2004). Functional proteomics mapping of a human signaling pathway. Genome research, 14, 1324-1332. Cook, D., Wiley, J., & Gennari. (2007). CHALKBOARD: Ontology-Based Pathway Modeling and Qualitative Inference of Disease Mechanisms. Pacific Symposium on Biocomputing, 12, 16-27. Davies, S. W., Turmaine, M., Cozens, B. A., DiFiglia, M., Sharp, A. H., Ross, C. A., Scherzinger, E., Wanker, E. E., Mangiarini, L., & Bates, G. P. (1997). Formation of neuronal intranuclear inclusions underlies the neurological dysfunction in mice transgenic for the HD mutation. Cell, 90, 537-548. Denissova, N., Pouponnot, C., Long, J., He, D., & Liu, F. (2000). Transforming growth factor β-inducible independent binding of SMAD to the Smad7 promoter PNAS, 97, 6397-6402. Droit, A., Poirier, G., & Hunter, J. (2005). Experimental and bioinformatic approaches for interrogating protein-protein interactions to determine protein function. Journal of Molecular Endocrinology 34, 263-280. Eisenberg, D., Marcotte, E.M., Xenarios, I., & Yeates, T.O. (2000). Protein function in the post-genomic era. Nature, 405, 823-826. Enyedy, I. J., Ling, Y., Nacro, K., Tomita, Y., Wu, X., Cao, Y., Guo, R., Li, B., Zhu, X., Huang, Y., Long, Y. Q., Roller, P. P., Yang, D., & Wang, S. (2001). Discovery of small-molecule inhibitors of Bcl-2 through structure-based computer screening. Journal of Medicinal Chemistry, 44, 4313-4324. Fields, S., & Song, O. (1989). A novel genetic system to detect protein protein interactions. Nature, 340, 245-246. Fried, M. G. (1989). Measurement of protein-DNA interaction parameters by electrophoresis mobility shift assay. Electrophoresis, 10(5-6), 366-376. Fry, D.C., & Vassilev, L.T. (2005). Targeting protein-protein interactions for cancer therapy. Journal of molecular medicine (Berlin, Germany), 83, 955-963.

707

Protein Interactions and Diseases

Giot, L., Bader, J.S., Brouwer, C., Chaudhuri, A., Kuang, B., Li, Y., Hao, Y.L., Ooi, C.E., Godwin, B., Vitols, E., Vijayadamodar, G., Pochart, P., Machineni, H., Welsh, M., Kong, Y., Zerhusen, B., Malcolm, R., Varrone, Z., Collis, A., Minto, M., Burgess, S., McDaniel, L., Stimpson, E., Spriggs, F., Williams, J., Neurath, K., Ioime, N., Agee, M., Voss, E., Furtak, K., Renzulli, R., Aanensen, N., Carrolla, S., Bickelhaupt, E., Lazovatsky, Y., DaSilva, A., Zhong, J., Stanyon, C. A., Finley, R. L., Jr., White, K. P., Braverman, M., Jarvie, T., Gold, S., Leach, M., Knight, J., Shimkets, R. A., McKenna, M. P., Chant, J., & Rothberg, J. M. (2003). A protein interaction map of Drosophila melanogaster. Science, 302, 17271736. Goehler, H., Lalowski, M., Stelzl, U., Waelter, S., Stroedicke, M., Worm, U., Droege, A., Lindenberg, K.S., Knoblich, M., Haenig, C., Herbst, M., Suopanki, J., Scherzinger, E., Abraham, C., Bauer, B., Hasenbank, R., Fritzsche, A., Ludewig, A. H., Bussow, K., Coleman, S. H., Gutekunst, C. A., Landwehrmeyer, B. G., Lehrach, H., & Wanker, E. E. (2004). A protein interaction network links GIT1, an enhancer of huntingtin aggregation, to Huntington’s disease. Molecular Cell, 15, 853-865. Gonzalez, G., Uribe, J. C., Tari, L., Brophy, C., & Baral, C. (2007). Mining dene-disease relationships from biomedical literature: Weighting protein protein interactions and connectivity measures. Pacific Symposium on Biocomputing, 12, 28-39. Hall, R. A. (2004). Studying protein-protein interactions via blot overlay or far western blot. In ProteinProtein Interactions, Methods and Applications, Methods in Molecular Biology, 261, Humana Press, Totowa, N.J., (pp. 167-174). Hamosh, A., Scott, A. F., Amberger, J. S., Bocchini, C. A., & McKusick, V. A. (2005). Online Mendelian inheritance in man (OMIM), a knowledgebase of human genes and genetic disorders. Nucleic Acids Research, 33, D514-D517. Hanahan, D., & Weinberg, R. A. (2000). The hallmarks of cancer. Cell, 100, 57-70. Harjes, P., & Wanker, E. E. (2003). The hunt for huntingtin function: Interaction partners tell many different stories. Trends in Biochemical Sciences, 28, 425-433. Harrison, S. C. (1991). A structural taxonomy of DNA-binding domains. Nature, 353, 715-719. Hermjakob, H., Montecchi-Palazzi, L., Lewington, C., Mudali, S., Kerrien, S., Orchard, S., Vingron, M., Roechert, B., Roepstorff, P., Valencia, A., et al.,(2004). IntAct: An open source molecular interaction database. Nucleic Acids Research, 32, 452-455. Hinoda, Y., Sasaki, S., Ishida, T., & Imai, K. (2004). Monoclonal antibodies as effective therapeutic agents for solid tumors. Cancer science, 95, 621-625. Hwang, E. S., Nottoli, T., & Dimaio, D. (1995). The HPV16 E5 protein: Expression, detection, and stable complex formation with transmembrane proteins in COS cells. Virology, 211, 227-233. Ito, T., Tashiro, K., & Kuhara, T. (2001). Systematic analysis of Saccharomyces cerevisiae genome: Gene network and protein-protein interaction network. Tanpakushitsu kakusan koso, 46, 2407-2413. Jin, S., & Levine, A. J. (2001). The p53 functional circuit, Journal of cell science, 114, 4139-4140.

708

Protein Interactions and Diseases

Jing, D., Beechem, J. M., & Patton, W. F. (2004). The utility of a two-color fluorescence electrophoretic mobility shift assay procedure for the analysis of DNA replication complexes. Electrophoresis, 25(15), 2439-2446. Johnsson, N., & Varshavsky, A. (1994). Split ubiquitin as a sensor of protein interactions in vivo. Proceedings of the National Academy of Sciences of the United States of America, 91, 10340-10344. Jones, S., van Heyningen, P., Berman, H. M., & Thornton, J. M. (1999). Protein-DNA interactions: A structural analysis. Journal of Molecular Biology, 287, 877-896. Jonsson, P. F., & Bates, P. A. (2006). Global topological features of cancer proteins in the human interactome. Bioinformatics (Oxford, England), 22, 2291-2297. Joshi-Tope, G., Gillespie, M., Vastrik, I., D’Eustachio, P., Schmidt, E., de Bono, B., Jassal, B., Gopinath, G. R., Wu, G. R., Matthews, L., Lewis, S., Birney, E., & Stein, L. (2005). Reactome: A knowledgebase of biological pathways. Nucleic Acids Research, 33, 428-432. Joung, J., Ramm, E., & Pabo, C. (2000). A bacterial two-hybrid selection system for studying proteinDNA and protein-protein interactions. Proc Natl Acad Sci U S A 97, 13, 7382-7387. Kelly, L., Karchin, R., & Sali, A. (2007). Protein interactions and disease phenotypes in the ABC transporter superfamily. Pacific Symposium on Biocomputing, 12, 51-63. Kenworthy, A. K. (2001). Imaging protein-protein interactions using fluorescence resonance energy transfer microscopy. Methods, 24, 289-296. Klein, C., & Vassilev, L. T. (2004). Targeting the p53-MDM2 interaction to treat cancer. British Journal of Cancer, 91, 1415-1419. Lee, T. I., Rinaldi, N. J., Robert, F., Odom, D. T., Bar-Joseph, Z., Gerber, G. K., Hannett, N. M., Harbison, C. T., Thompson, C. M., Simon, I., Zeitlinger, J., Jennings, E. G., Murray, H. L., Gordon, D. B., Ren, B., Wyrick, J. J., Tagne, J. B., Volkert, T. L., Fraenkel, E., Gifford, D. K., & Young, R. A. (2002). Transcriptional regulatory networks in Saccharomyces cerevisiae. Science, 298, 799-804. Lehner, B., & A. G. Fraser. (2004). A first-draft human protein-interaction map. Genome Biol, 5(9), R63. Li, S. H., & Li, X. J. (2004). Huntingtin-protein interactions and the pathogenesis of Huntington’s disease. Trends Genet, 20, 146-154. Li, S., Armstrong, C. M., Bertin, N., Ge, H., Milstein, S., Boxem, M., Vidalain, P. O., Han, J. D., Chesneau, A., Hao, T., Goldberg, D. S., Li, N., Martinez, M., Rual, J. F., Lamesch, P., Xu, L., Tewari, M., Wong, S.L., Zhang, L. V., Berriz, G.F., Jacotot, L., Vaglio, P., Reboul, J., Hirozane-Kishikawa, T., Li, Q., Gabel, H. W., Elewa, A., Baumgartner, B., Rose, D. J., Yu, H., Bosak, S., Sequerra, R., Fraser, A., Mango, S. E., Saxton, W. M., Strome, S., Van Den Heuvel, S., Piano, F., Vandenhaute, J., Sardet, C., Gerstein, M., Doucette-Stamm, L., Gunsalus, K. C., Harper, J. W., Cusick, M. E., Roth, F. P., Hill, D. E., & Vidal, M. (2004). A map of the interactome network of the metazoan C. elegans. Science, 303, 540-543. Loregian, A., Marsden, H. S., & Palu, G. (2002). Protein-protein interactions as targets for antiviral chemotherapy. Reviews in medical virology, 12, 239-262.

709

Protein Interactions and Diseases

Luisi, B. F. (1995). DNA-protein interaction at high resolution. In DNA ProteinStructural Interactions. Edited by Lilley DMJ. New York: Oxford University Press. (pp. 1-48). Luscombe, N. M., Austin, S. E., Berman, H. M., & Thornton, J. M. (2000). An overview of the structures of protein-DNA complexes. Genome Biology, 1, REVIEWS001. Mathivanan, S., Periaswamy, B., Gandhi, T. K. B, Kandasamy, K., Suresh, S., Mohmood, R., Ramachandra, Y. L., & Pandey, A. (2006). An evaluation of human protein-protein interaction data in the public domain. BMC Bioinformatics, 7(Suppl 5), S19. Mishra, G. R., Suresh, M., Kumaran, K., et al., (2006). Human protein reference database--2006 update. Nucleic Acids Research, 34, D411-D414. Nooren, I. M. A., & Thornton, J. M. (2003). Diversity of protein protein interactions. EMBO, 22(14), 3486-3492. Pagel, P., Kovac, S., Oesterheld, M., Brauner, B., Dunger-Kaltenbach, I., Frishman, G., Montrone, C., Mark, P., Stümpflen, V., Mewes, H.W., Ruepp, A., & Frishman, D. (2005). The MIPS mammalian protein-protein interaction database. Bioinformatics, 21, 832-834. Pandey, A., & Mann, M. (2000). Proteomics to study genes and genomes. Nature, 405, 837-846. Peri, S., Navarro, J. D., Amanchy, R., Kristiansen, T. Z., Jonnalagadda, C. K., Surendranath, V., Niranjan, V., Muthusamy, B., Gandhi, T. K., Gronborg, M., et al., (2003). Development of human protein reference database as an initial platform for approaching systems biology in humans. Genome Research, 13, 2363-2371. Peri S., Navarro, J. D., Kristiansen, T. Z. et al., (2004). Human protein reference database as a discovery resource for proteomics. Nucleic Acids Research, 32, D497-D501. Petri V, & Brenowitz, M. (1997). Quantitative nucleic acids footprinting: Thermodynamic and kinetic approaches. Current Opinion in Biotechnology, 8(1), 36-44. Pevsener, J. (2003). Bioinformatics and functional genomics. Hoboken, NJ: John Wiley & Sons Inc. Phillips, A. C., & Vousden, K. H. (1997). Analysis of the interaction between human pappilomavirus type 16 E7 and the TATA-binding protein. TBP, Journal of General Virology, 78, 905-909. Piehler, J. (2005). New methodologies for measuring protein interactions in vivo and in vitro. Current Opinion in Structural Biology, 15, 4-14 . Puig, O., Caspary, F., Rigaut, G., Rutz, B., Bouveret, E., Bragado-Nilsson, E., Wilm, M., Seraphin, B. (2001). The tandem affinity purification (TAP) method: A general procedure of protein complex purification. Methods, 24, 218-229. Ramani, A. K., Bunescu, R. C., Mooney, R. J., & Marcotte, E.M. (2005). Consolidating the set of known human protein-protein interactions in preparation for large-scale mapping of the human interactome. Genome Biology, 6, R40. Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., & Seraphin, B. (1999). A generic protein purification method for protein complex characterization and proteome exploration. Nat Biotechnology, 17, 1030-1032. 710

Protein Interactions and Diseases

Rual, J. F., Venkatesan, K., Hao, T., Hirozane-Kishikawa, T., Dricot, A., Li, N., Berriz, G. F., Gibbons, F. D., Dreze, M., Ayivi-Guedehoussou, N., Klitgord, N., Simon, C., Boxem, M., Milstein, S., Rosenberg, J., Goldberg, D. S., Zhang, L. V., Wong, S. L., Franklin, G., Li, S., Albala, J.S., Lim, J., Fraughton, C., Llamosas, E., Cevik, S., Bex, C., Lamesch, P., Sikorski, R. S., Vandenhaute, J., Zoghbi, H. Y., Smolyar, A., Bosak, S., Sequerra, R., Doucette-Stamm, L., Cusick, M. E., Hill, D. E., Roth, F. P., & Vidal, M. (2005). Towards a proteome-scale map of the human protein-protein interaction network. Nature, 437, 1173-1178. Ryan, D. P., & Matthews, J. M. (2005). Protein-protein interactions in human disease. Current Opinion in Structural Biology, 15, 441-446. Sam, L., Liu, Y., Li, J., Friedman, C., & Lussier, Y. (2007). Discovery of protein interaction networks shared by disease. Pacific Symposium on Biocomputing, 12, 76-87. Smith, G., & Petrenko, V. (1997). Phage Display. Chem. Rev., 97, 391-410. Steffan, J. S., Kazantsev, A., Spasic-Boskovic, O., Greenwald, M., Zhu, Y. Z., Gohler, H., Wanker, E. E., Bates, G. P., Housman, D. E., & Thompson, L. M. (2000). The Huntington’s disease protein interacts with p53 and CREB-binding protein and represses transcription. Proceedings of the National Academy of Sciences of the United States of America, 97, 6763-6768. Stelzl, U., Worm, U., Lalowski, M., Haenig, C., Brembeck, F. H., Goehler, H., Stroedicke, M., Zenkner, M., Schoenherr, A., Koeppen, S., Timm, J., Mintzlaff, S., Abraham, C., Bock, N., Kietzmann, S., Goedde, A., Toksoz, E., Droege, A., Krobitsch, S., Korn, B., Birchmeier, W., Lehrach, H., & Wanker, E. E. (2005). A human protein-protein interaction network: a resource for annotating the proteome. Cell, 122, 957-968. Stoll, D., Templin, M. F., Bachmann, J., Joos, T. O. (2005). Protein microarrays: Applications and future challenges. Current Opinion in Drug Discovery and Development, 8(2), 239-52. Suresh, S., Sujatha, Mohan, S., Mishra, G., Hanumanthu, G. R., Suresh, M., Reddy, R., & Pandey, A. (2005). Proteomic resources: Integrating biomedical information in humans. Gene, 364, 13-18. Tan, S., & Richmond, T. J. (1998). Eukaryotic transcription factors. Current Opinion in Structural Biology, 8, 41-48. Templin, M. F., Stoll, D., Schwenk, J. M., Potz, O., Kramer, S., & Joos, T. O. (2003). Protein microarrays: Promising tools for proteomic research. Proteomics, 3(11), 2155-66. Terribilini, M., Lee, J-H., Yan, C., Jernigan, R. L., Carpenter, S., Honavar, V., & Dobbs, D. (2006). Identifying interaction sites in “Recalcitrant” proteins: Predicted protein and RNA binding sites in rev proteins of HIV-1 and EIAV agree with experimental data. Pacific Symposium on Biocomputing, 11, 415-426. Toby, G. G., & Golemis, E. A. (2001). Using the yeast interaction trap and other two-hybrid-based approaches to study protein-protein interactions. Methods, 24, 201-217. Toyoda T., & Takigawa Y. (2000). Selection of candidate genes for polygenic diseases by utilizing protein-protein interaction networks. Genome Informatics, 11, 286-288.

711

Protein Interactions and Diseases

Troncale, S., Tahi, F., Campard, D., Vannier, J-P., & Guespin, J. (2006). Modeling and simulation with hybrid functional Petri Nets of the role of interleukin-6 in human early haematopoiesis. Pacific Symposium on Biocomputing, 11, 427-438. Uetz, P., Giot, L., Cagney, G., Mansfield, T. A., Judson, R. S., Knight, J. R., Lockshon, D., Narayan, V., Srinivasan, M., Pochart, P., Qureshi-Emili, A., Li, Y., Godwin, B., Conover, D., Kalbfleisch, T., Vijayadamodar, G., Yang, M., Johnston, M., Fields, S., & Rothberg, J. M. (2000). A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae. Nature, 403, 623-627. Uetz, P., & Finley, R. L., Jr. (2005). From protein networks to biological systems. FEBS Letters, 579, 1821-1827. Valencia, A., & Pazos, F. (2002). Computational methods for the prediction of protein interactions. Current Opinion in Structural Biology. 12, 368-373. Ventura, A., Kirsch, D. G., McLaughlin, M. E., Tuveson, D. A., Grimm, J., Lintault, L., Newman, J., Reczek, E. E., Weissleder, R., & Jacks, T. (2007). Restoration of p53 function leads to tumour regression in vivo. Nature, 445, 661-665. Vikis, H. G., & Guan, K.-L. (2004). Glutathione-s-transferase-fusion based assays for studying proteinprotein interactions. In Protein-Protein Interactions, Methods and Applications, Methods in Molecular Biology, 261, Fu, H. (ed.). Totowa, NJ: Humana Press. (pp. 175-186). Von Mering, C., Jensen, L. J., Kuhn, M., Chaffron, S., Doerks, T., Kruger, B., Snel, B., & Bork, P. (2007). STRING 7-Recent developments in the integration and prediction of protein interactions. Nucleic Acids Research,, D358-D362. Vousden, K .H. (1994). Interactions between papillomavirus proteins and tumor suppressor gene products. Advances in Cancer Research, 64, 1-24. Willats, W. (2002). Phage display: Practicalities and prospects. Plant Molecular Biology, 50, 837-855. Xenarios, I., Rice, D. W., Salwinski, L., Baron, M. K., Marcotte, E. M., & Eisenberg, D. (2000). DIP: The Database of Interacting Proteins. Nucleic Acids Research, 28, 289-291. Xu, J., Li, Y. (2006). Discovering disease genes by topological features in human protein-protein interaction network. Bioinformatics, (22), 2800-2805. Yan, Y., & Marriott, G. (2003). Analysis of protein interactions using fluorescence technologies. Current Opinion in Chemical Biology, 7,.635-640. Ye, Y., Li, Z., & Godzik A. (2006). Modeling and analyzing three-dimensional structures of human disease proteins. Pacific Symposium on Biocomputing, 11, 439-450. Zanzoni, A., Montecchi-Palazzi, L., Quondam, M., Ausiello, G., Helmer-Citterich, M., Cesareni, G. (2002). MINT: a Molecular INTeraction database. FEBS Lett, 513, pp.135-140. Zhao, L., & Chmielewski, J. (2005). Inhibiting protein-protein interactions using designed molecules. Current Opinion in Structural Biology, 15, 31-34. Zhu, H., & Snyder, M.. (2001). Protein arrays and microarrays. Current Opinion in Chemical Biology, 5, 40-45. 712

Protein Interactions and Diseases

Zur Hausen, H. (2000). Papillomaviruses causing cancer: evasion from host-cell control in early events in carcinogenesis. Journal of the National Cancer Institute, 92, 690-698.

KEY TERMS ChIP: Abbreviation for Chromatin Immunoprecipitation. It refers to a procedure used to determine whether a given protein binds to or is localized to a specific DNA sequence in vivo. Databases: A database is a collection of records or data that are stored in a computer in such a way that a computer program can easily select desired pieces of data. Diseases: The terms disease refers to the abnormal situation of a living organism that impairs function. It may include disabilities, disorders syndromes and infections. Protein Complexes: Protein complex is a group of two or more associated proteins, formed by protein-protein interaction. It is usually stable over time and it is a form of quaternary structure. Protein Interactions: Protein interactions refer to the association of protein molecules with proteins, DNA or any other molecule and the study of these associations from the perspective of biochemistry, network and signal transduction. Protein Network: A protein network is a map of protein protein interaction. The network is usually presented as a graph where nodes indicate proteins and links between them indicate the interactions between the proteins. SDS-PAGE: Abbreviation for sodium dodecyl sulfate polyacrylamide gel electrophoresis. This is a technique used in biochemistry, genetics and molecular biology to separate proteins according to their electrophoretic mobility. TAP: Abbreviation for Tandem Affinity Purification. It involves the fusion of the TAP tag to the target protein of interest and the introduction of the construct into the cognate host cell or organism.

713

714

Chapter XL

The Breadth and Depth of BioMedical Molecular Networks: The Reactome Perspective Bernard de Bono European Bioinformatics Institute, UK and University of Malta, Malta

abstract From a genetic perspective, disease can be interpreted in terms of a variation in molecular sequence or expression (dose) that impairs normal physiological function. To understand thoroughly the knockon effect such pathological changes may have, it is crucial to map out the physiological relationship affected genes maintain with their functional neighbors. The goal of the Reactome project is to build such a network knowledgebase for all human genes. Constructing a map of such extent and scope requires a considerable range of expertise, so this project collaborates with field experts to integrate their pathway knowledge into a single quality-checked human model. This resource dataset is systematically cross-referenced to major molecular and literature databases, and is accessible to the community in a number of well-established formats. As an evolving network systems resource, Reactome is also starting to provide increasingly powerful and robust tools to investigate tissue-specific biology and steer targeted drug design.

INTRODUCTION A major theme emerging from biomedical research in recent years is the multifactorial origin of many diseases (for example, (Talmud 2004; Barnetche, Gourraud et al. 2005)). This feature is thought to reflect the concerted evolution of a number of genes responsible for our survival on the one hand, and rapidly changing environmental pressures on the other. Therefore, disease is seen as a reporter phenotype for evolutionary and environmental change.

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

The Breadth and Depth of BioMedical Molecular Networks

As the effort to establish the genetic basis of disease intensifies, single genes and their products are under close scrutiny to determine their biological role and their individual contribution to pathology and morbidity. The challenge today is to integrate this accumulated knowledge to provide the ‘bigger picture’ – a global functional context in which every human gene has a well-defined role. A matrix of this nature, that describes the function of all genes in relation to each other, requires an eloquent grammar for the step-wise depiction of biological processes in detail. From a medical standpoint, the notion of disease is based on a deviation from normal function. In the course of studying a specific pathology, establishing how to identify and quantify this deviation depends on a proper definition of function under normal conditions. Establishing a standardized approach to describe all large scale biological processes therefore creates a common platform that connects and relates all known disease mechanisms at a molecular level. Furthermore, such an approach provides a unique opportunity to reclaim and integrate applicable knowledge generated from studies using model organisms that are of relevance to human disease. In this review I discuss the basic principles and limitations of the methods employed to depict human molecular physiology.

Background: Depicting normal human gene function A key step to integrating knowledge about gene function is to develop a unified method to describe the properties of their products. The Gene Ontology (GO) Consortium (Harris, Clark et al. 2004) has developed a successful interdisciplinary project to catalogue and standardize a vocabulary of terms depicting biological activity and localization of expressed products. Each term is supported by a text-based description that illustrates and defines a biological property, with which any number of gene products may be associated. This annotation strategy has achieved considerable coverage of a large number of genes from a wide variety of model organism databases (http://geneontology.org). This qualitative relational classification of descriptive GO terms provides vital bearings on the functional landscape of sequence molecules. GO maintains actively three distinct ontologies of terms, namely, ‘Molecular Function’, ‘Biological Process’ and ‘Cellular Component’. GO’s stated objective is to keep its ontologies strictly orthogonal to each other, thus minimizing the descriptive overlap of these vocabularies. Both ‘Molecular Function’ and ‘Biological Process’ terms represent some form of biological activity associated with gene products – a ‘process’ can be seen as a recognized series of ‘functions’. Some activity terms deal with the movement of biological entities (for example, ‘protein transporter activity’ (GO:0008565)), a significant proportion with a molecular conversion of some kind (for example, ‘adenylosuccinate lyase activity’ (GO:0004018)), while others are concerned with assembly (for example, ‘actin cable formation’ (GO:0045011)). In many ways, GO activity terms relate to a structural change that has a biological implication. The ‘Cellular Component’ ontology describes subcellular and extracellular locations, representing a higher level of structural complexity, starting from macromolecular assemblies. For example, the GO term ‘actin cable’ (GO:0030482) is defined as ‘a long bundle of actin filaments, comprising filamentous actin and associated proteins, found in cells’. In practice, GO terms describe where gene products locate themselves as well as an indication as to what their role is and how this is carried out. The wording employed in GO terms also provides a unique insight into the conceptual relationship of structure and activity and the difficulties often encountered in

715

The Breadth and Depth of BioMedical Molecular Networks

distinguishing the two. For instance, it is possible to find examples in which the biological purpose of a structure is considered at par with its activity (for example, ‘nutrient reservoir activity’ (GO:0045735) and ‘structural constituent of chitin-based cuticle’ (GO:0005214 ) are both Molecular Function terms). An activity term may also be qualified by a timeframe (for example, Biological Process term: ‘activation of plasma proteins during acute inflammatory response’ (GO:0002541)). In such scenarios, the structure containing an activity may also be seen to denote time span, in that a particular process is taken to occur within the lifetime of its housing structure (for example, Biological Process term: ‘proteolysis within endosome associated with antigen processing and presentation’ (GO:0002499)). Analogous situations where structures assume the role of progress milestones are a familiar feature in development (for example, Biological Process term: ‘multi-layer follicle stage, oogenesis’ (GO:0048162)) and tumour staging (for example, colon cancer (Sarma 1988)). Furthermore, the use of quantifiable structural change between sequence molecules, given a mathematical model of evolution, is at the basis of estimating species divergence times (for example, Lecomte, Vuletich et al. 2005; Jansen, Devaere et al. 2006, and see also Box 1.). A number of high level structures are also referred to in GO activity terms. These include references to elements from the Cell Component ontology (for example, Molecular Function term: ‘axon guidance receptor activity’ (GO:0008046)), as well as standard taxonomic terms (for example, Biological Process term: ‘neuroblast fate determination (sensu Nematoda and Protostomia)’ (GO:0043347)). The above examples seem to suggest that, in certain cases, the same biological property is used in more than one orthogonal ontology. This feature is especially evident in the case of structural properties that are used concurrently as a context, as a timeframe, as a location, as well as an activity. From this perspective, it may be legitimate to consider the precise role structure should take in the depiction of biological activity, particularly if a demonstrable structural change is at the basis of a consistent depiction of a biological event. This approach should also be coupled with more precise criteria that distinguish a simple assembly of gene products from a higher order Cell Component term (for example, 1-phosphatidylinositol-4-phosphate kinase, class IA complex (GO:0005943)), as well as which collection of Molecular Functions should be mapped onto a higher order Biological Process term. A step-based approach to these problems, discussed in the following section, may well supply some of the answers.

The Reactome Knowledgebase The rationale for representing biological processes in pathway form is based on the notion that a crisp depiction of function depends on clear description of structural change. This approach is less vulnerable to potential ambiguities that stem from the structure-function duality illustrated above. The Reactome (Vastrik, D’Eustachio et al. 2007) (http://reactome.org) model of human molecular biology consists of a broad descriptive graph of Reaction nodes (Figure 1). Each node recounts the conversion of one or more input Entities into a resultant output, often brought about by some participating catalyst that brokers this step. Input, output and catalyst Entities represent definite biological structures that are cross-referenced to appropriate accession identifiers when available (for example, proteins, small molecules). In contrast, the GO strategy uses an approach in which the definition of the Molecular Function term ‘adenylosuccinate lyase activity’ (GO:0004018) is the ‘Catalysis of the reaction: N6-(1,2dicarboxyethyl)AMP = fumarate + AMP’, specified in free text.

716

The Breadth and Depth of BioMedical Molecular Networks

All Entities and Reactions are contained within a housing structure called a Compartment, that corresponds to a selection of well-established non-overlapping cellular locations featured in the ‘Cell Component’ ontology from GO. A set of Reactions in Reactome, usually consecutive and interlinked, can be grouped to form a Pathway. Pathways and Reactions are generically called Events. GO terms from both ‘Molecular Function’ and ‘Biological Process’ vocabularies can also be linked directly to the action of catalysts (as in the above case of adenylosuccinate lyase), Reactions and Pathways, providing a valuable rational mapping between terms from these two ontologies (Figure 2). Both Events and Entities may be further qualified through the association of key literature references, as well as the annotation with original diagrams and summaries to highlight items of interest. It has to be pointed out that this large scale, objective and computationally accessible representation of function in Reactome is based strictly on the pathway connectivity and corresponding structural conversions. While this network is able to tell a clear, consistent and well-defined story, however, the value of extra links, commentaries and graphical enhancements in making this resource human readable should not be underestimated.

Building Content The complexity of building the network at the basis of human physiology stands as a firm reminder that ‘everything is connected to everything else’(First Law of Ecology (Commoner 1971)). At a molecular level, this approach provides a meaningful context for the interaction of human proteins with each other and with other types of molecule (not necessarily produced by human synthetic machinery - for example, significant amounts of Vitamin K are produced by bacterial flora (Hill 1997)). Creating a detailed functional model to gain further understanding of the behaviour of this vast physiological network is a formidable task. Representation, even of the most basic and fundamental of processes, such as energy balance, requires extensive mechanistic knowledge of both cause and effect, spanning a number of molecular pathways and organ systems. A list of top-level pathways is featured on the main panel of the Reactome website shown in Figure 3. A pathway model provides the starting point for a number of investigations. With increasing volumes of high-throughput protein interaction and gene expression results, it is crucial to interpret such data in the functional context of a standard pathway reference framework. The ability to map experimental results onto a curated model, is therefore a key step to gaining insight through the correlation with pathway-specific knowledge. The structure of the model is also indicative of the expected behaviour of its components. Modeling of protein and small molecule connectivity thus provides a way to analyse crosstalk and feedback loops that determine the functional interdependencies between network elements (Klamt, Saez-Rodriguez et al. 2006). Therefore, integrating detailed knowledge of physiological mechanisms enables the logical analysis of their pathways, as well as the identification of optimal intervention target points for further scientific enquiry and biotechnological development. However, the creation of a molecular model of sufficient quality and breadth to address for instance, energy balance, is hampered by a number of production issues. The first is securing the biological expertise necessary to describe molecular mechanisms ranging from carbohydrate metabolism and lipid synthesis to the physiology of growth and the regulation of appetite and temperature (Jungermann and Barth 1996; Hill 2006; Trayhurn and Bing 2006). Secondly, given the resources invested in such an

717

The Breadth and Depth of BioMedical Molecular Networks

undertaking, the model then requires (a) regular maintenance and updating, as well as (b) packaging in a manner that is accessible to and adaptable by the scientific community. The main objective of the Reactome Knowledgebase is to provide a scalable solution to these production issues by integrating verifiable curated pathway data into a unified human model under constant expert and editorial scrutiny. This supervision has also to ensure that the model is scientifically sound and consistent throughout as, from a human biology perspective, knowledge is often: a.

b.

c.

Lacking: Detailed structural and functional characterization of individual genes and their products is a very time consuming task, such that only a fraction of human genes have been subjected to thorough analysis. Dispersed: Although much of this knowledge is carefully written up and recorded, it is also scattered over a number of literature sources in disparate formats, emphasis, styles and levels of quality. This renders the interpretation of such information largely inaccessible to computational recovery methods (for example, text mining). Inapplicable: For a number of practical and ethical reasons, a substantial amount of research in molecular biology has been carried out on non-human (‘model’) organisms. This poses a problem of applicability. For instance, are pathways in a mouse hepatic cell line identical to those in the human liver? What lessons learnt from the study of eye development in Drosophila are applicable to human embryology?

In collaboration with Reactome, the expert biologist plays a central role in overcoming these restrictions, while ensuring the quality of the model. For instance, identifying knowledge from model organisms that is applicable to humans would provide a combined solution to problems (a) and (c), making up for the shortcomings of direct investigation (the computational techniques involved are discussed in Box 1). In those ‘non-human’ cases in which applicability to human is ascertained by the expert, the Reactome protocol is to construct Events pertaining to the model organism interactions first. These are annotated using the original literature reference as evidence. The corresponding molecules from human are then selected to create a new set of inferred Events that point to the equivalent lower organism annotation as evidence. The overall objective of the collaborating expert is to extend the Reactome graph model by creating new Pathways on a particular topic module in the style of a formal literature review process. The structure and content of Pathways and Reactions embedded in this review are constructed under the direct supervision of the expert to reflect current consensus in the field. This publication process is completed through the review by a second independent expert who checks for quality and clarity and suggests refinements, prior to release.

Bricks and Mortar: The Modelling Kit Given the relationship of function with biological structure, much of the eloquence of the process grammar in Reactome depends on the descriptive properties of the Physical Entity representation of structure (Figure 1). Where possible, Entities in Reactome are strictly referenced using external accession identifiers. For instance, participating protein are cross referenced with accession identifiers to a number of wellestablished databases (for example, UniProt (Wu, Apweiler et al. 2006), KEGG (Kanehisa, Goto et al.

718

The Breadth and Depth of BioMedical Molecular Networks

Box 1. The need to draw reliable inferences from homologous biological systems has spurred considerable efforts to create rigorous frameworks in comparative biology and quantify structural differences between species. A considerable body of comparative work in molecular biology has been based on sequence alignment and the premise that in most cases, 3D structure (and consequent function) is far better preserved than primary sequence (Dunbrack 2006). Orthology maps based on this approach can bridge corresponding homologous genes between model organisms and human, thus providing across-species indications about genes that are likely be functionally equivalent (for example, the OrthoMCL resource (Chen, Mackey et al. 2006)).Increasingly sophisticated graph-based methods have been developed that specifically track the process of sequence evolution: a.

b.

Sequence profiles: The ability to find matching sequences that share a common evolutionary origin has been greatly enhanced by the use of sequence profiles. In protein biology, for instance, a family alignment can be converted into a hidden Markov Model (hMM) graph with so-called ‘match’ and ‘insert’ nodes representing homologous amino acid positions (Figure 4). Such profiles can match sequences, and more recently other sequence profiles, allowing the detection of novel distant proteins that are likely to have similar structural and functional properties in common with known ones (Debe, Danzer et al. 2006). Phylogenetic trees: Given a model of evolution, these simple graphs depict relationships between molecules based on sequence differences. A functional relationship has often been shown to exist between two sequence families that have very similar phylogenetic trees to each other. Improved methods that compare phylogenetic trees have recently enhanced the detection of shared evolutionary constraints, and thus the large-scale prediction of functional relationships between sequence molecules (Jothi, Cherukuri et al. 2006).

Graph-based orthology calculations focus on the quantitative assessment of structural change during the process of mutation-driven molecular evolution (usually over considerable timescales). Pathway graphs, by and large, are concerned with processes over a shorter time period, such as the qualitative depiction of cell signaling cascades and small molecule metabolism that typically take place over the lifetime of a cellular housing structure. Advances in graph analysis methods in sequence evolution have contributed valuable insights into biological systems through the creation of increasingly powerful homology detection and other useful prediction tools. However, the development of similar quantitative approaches to analyse pathway processes on a large scale has yet to overcome two considerable obstacles: 1.

Distance functions between entities: Given a model of evolution, it is possible to calculate a mathematical distance (i.e. an unambiguous and quantifiable measure of difference) between sequences, that is based upon the mutations that distinguish one from the other. In the case of small molecules, a number of distance methods have been developed using a number of approaches (for example, the Tanimoto co-efficient method based on the analysis of chemical group fingerprints (Godden, Stahura et al. 2005)). In the more eventful Pathway model, gene products may assume

719

The Breadth and Depth of BioMedical Molecular Networks

Box 1. (continued)

a number of structural states given the various changes in chemical composition they may undergo (for example, fragmentation, glycosylation, phosphorylation, etc). It may be difficult, therefore, to create a distance function that can reconcile and quantify this vast spectrum of changes spanning both proteins and small molecules. 2. Rate equations: Kinetic pathway models use rate equations to provide a detailed and dynamic mathematical description suitable for simulating a small system of molecules. They are usually the result of detailed work on a small scale in an attempt to answer very specific questions about a particular aspect of molecular biology. A significant collection of such models is now available online (for example, the BioModels resource (Le Novere, Bornstein et al. 2006)). A series of practical limitations, however, confine the level of structural detail and number of molecules they can incorporate, although the community is focusing its efforts to ensure the required compatibility standards for such models to be merged (Le Novere, Finney et al. 2005).



2006), EnsEMBL (Birney, Andrews et al. 2006), and Entrez Gene (Wheeler, Barrett et al. 2007)). In the case of molecules that are not sequence-based, the ChEBI database (Chemical Entities of Biological Interest (de Matos, Ennis et al. 2007)) plays a key role by providing expertise and curatorial support to the addition of new small molecules in Reactome. While the re-arrangement of structure in a small molecule can be described in terms of a change from one ChEBI accession ID to another, it is more complicated to represent protein modification in discrete form. The states of phosphorylation or palmitoylation of a protein, to mention just two instances, can not be distinguished on the basis of a change in its UniProt accession ID. The same holds true for protein cleavage into fragments, as well as sequence polymorphism. The start and end amino acid position is recorded in the case of fragmentation. If a particular residue is modified, the nature of the new chemical group is referred to in terms of the corresponding ChEBI accession ID. In Reactome, any shift from the original form of the protein results in the creation of a new Physical Entity that, however, will still retain a pointer to its primary UniProt ID. This feature enables the interaction tracking of different states of the same molecule across the entire model, notwithstanding the number of modifications it may have gone through. A number of biological processes are strictly partitioned such that the transition of a molecule from one compartment to another may have profound effects, and is therefore held under strict control (as in the case of signaling triggered by the influx of calcium ions into the cytosol). As compartment type is one of the basic defining features of a Physical Entity, a transport Reaction is able to simply map, as input and output, two distinct Entities that refer to the same molecular accession ID but have different localization properties. The notion of ascribing functional equivalence to different structures is a key feature of the Reactome toolkit, as a specific role in a Reaction may be assumed equally well by a number of molecules. For instance, different isoforms of regulatory and catalytic components of an enzyme dimer may exist (for example, PI3K). Another example may involve a large family of hormones binding differentially to a corresponding set of related receptors (for example, FGF receptors). On similar lines, it may be

720

The Breadth and Depth of BioMedical Molecular Networks

required to represent the number of different molecules transported by the same membrane channel (for example, bile salts co-transport with sodium). The use of Sets in Reactome does away with the necessity of depicting every possible combinatorial Reaction instance, without losing any of the detail such an Event is required to convey. The formation of molecular complexes is a mainstay in representing a number of biological scenarios. All types of Physical Entity, including small molecules, proteins, Sets and any other complex can be used as a component for assembly. Such complexes are also linked to GO ‘Cellular Component’ terms and literature references, where applicable. The potential descriptive space of the Physical Entity is therefore considerable, being roughly the product of (1) the set of small molecules and chemical groups, (2) all possible protein fragments in all species, and (3) all cellular compartments. Any number of Physical Entities may feature in one Reaction, in an input, output or catalytic role. The skill essential to the Reactome curatorial process is matching the requirements of the expert biologist using the appropriate descriptive instruments from this data model palette.

Using Reactome The layout of the Reactome website takes the form of a regular and and hierarchical presentation of pathway annotation (Figure 5). Pathways are presented as a series of crosslinked panels containing author-reviewed diagrams and suumaries, together with hyperlinked Reaction depictions. Less experienced users can access extensive documentation on how to best use Reactome resources. Through the website, every Event can be individually exported in a number of well-established formats such as SBML (http://sbml.org), BIOPAX (http://biopax.org) and Cytoscape (http://cytoscape.org) or repackaged in PDF/RTF for printing and perusal. The Reactome site also provides a number of other services and specific query functions. Visualization of the global context for every human molecular event is provided at the top graphical panel of the website (Figure 3), known as the ‘Sky’, which lays out Pathway constellations of all Reactions for user ‘point-and-click’ interaction. The related ‘SkyPainter’ provides a simple interface to highlight Reactions on the Sky given a submitted list of recognized accession IDs for sequence, small molecule, and other established data types (for example, GO, InterPro, Affymetrix, MIM etc). SkyPainter allows exploration, for example, of the influence and effects of differential gene expression, as its identifiers are linked to numeric qualifiers. Multiple numeric columns attached to particular submission are rendered as an animated movie. In order to provide more user-friendly and rapid data retrieval, Reactome has recently launched a BioMart service that allows the formulation and handling of complex queries. A complex query may take the form of, for example, ‘what genes are involved in the apoptosis pathway?’ BioMart is a simple, federated query system designed to allow efficient and speedy data retrieval, even from complex queries (Kasprzyk, Keefe et al. 2004). Given that Reactome curates specifically human Pathways, is may be useful to determine what proportion of these Events may also be found in lower organisms. The OrthoMCL method (Li, Stoeckert et al. 2003) uses protein sequence matching and clustering to produce a set of orthologs and recent paralogs between two species. The resulting orthology maps play a central role in automatically linking inferred human Events to the underlying lower organism data., and suggesting pathways across which their products may interact.

721

The Breadth and Depth of BioMedical Molecular Networks

The Reactome toolkit consists of a number of complementary features, developed to facilitate access, maintainance, updating and broadcasting of pathway material. Both the Reactome database and toolkit are open access, so it is possible to install Reactome software locally (http://www.reactome. org/download/index.html) and to carry out customized operations for analysis and curation. Reactome software uses MySQL (serves all Event network and Physical Entity data), and Application Programming Interface (API) tools (available as Perl, Java and SOAP-based webservices kits). The Perl and Java API classes drive the website and curation clients respectively. However, Reactome data tables can also be accessed and manipulated directly by integrating such APIs into any implementation.

Conclusion The classification of disease has long been a preoccupation and practice in the pursuit of both cause and cure. Before the advent of microscopy, surgical definitions of pathology where based on the palpable abnormality of anatomical structure (for example, developmental anomalies, hypertrophy, tumour growth, atrophy) and compartmental connectivity (for example, ulceration, obstruction, oedema, laceration) (Russell, Williams et al. 2004). More recently, studies on changes in key physiological parameters such as volume, pressure, tension, and temperature has improved understanding of the role played by controlled adaptations in the electrical and material properties of tissue fabric. Such introduction of concepts from studies in cellular and molecular biology has added depth and nuance to the manner in which normality and disease is perceived. The genetic basis of disease is rooted in the pathological variation of sequence (i.e. somatic or inherited mutations for example, (Greenman, Stephens et al. 2007)) or dosage. The latter may be altered though (a) the mis-expression of genes that belong to the host, or the significant expression of non-self genes (i.e. infecting parasites or mutated self genes), or (b) compartmental breakdown (blockages or leaks). Both mechanisms lead to an altered molecular localization and concentration. The wealth of accessible information ingrained in the human Reactome events is therefore opportune, now that graph-based methods are increasingly relying on verified interaction networks to predict protein function (Sharan, Ulitsky et al. 2007) and consequent disease phenotypes (Lage, Karlberg et al. 2007). The key integrative thrust of the Reactome effort is focused on establishing a deep and robust connectivity between established external databases, as well as providing ample scope and means to interpret this molecular network in a genomic context. The interplay between genes and the environment plays an important role in the modern understanding of disease. The current definition of normality is increasingly based on the function of the highest frequency alleles and the highest frequency gene combinations within a specific geographical population (for example, case control studies (WTCCC 2007); the selective advantage of heterozygous sickle cell anemia in malarial regions (Williams 2006)). Furthermore, specific pathologies appear to be associated with ‘disease gene modules’ that show a higher likelihood of physical interactions between their products, as well as higher expression profiling similarity for their transcripts (Goh, Cusick et al. 2007). In addition, ambitious exercises that survey and classify all known normal activity in molecular biology have shown that, for biological activity to be defined on the ability to change structure, a clear and consistent distinction between the two notions has to be kept. Yet, it is often not straightforward to separate what a molecule is from what it does.

722

The Breadth and Depth of BioMedical Molecular Networks

The successful elucidation of major disease processes depends on making full use of knowledge acquired so far in the discovery of novel associations between the sequence and functional properties of key human molecules. However, the selective recovery and interpretation of information from the literature is largely inaccessible to computational mining methods. Although much of biological knowledge is carefully written up and recorded, it is also dispersed over a number of literature sources in disparate formats, emphasis, styles and indeed levels of quality. Expertise is therefore required to reclaim knowledge that is credible, well established and reliable. The collaboration between field biologists and the Reactome editorial style of curation guarantees more objectivity to this process and ensures consistent standards throughout the model. In Reactome, the unit of knowledge sought for inclusion is that molecular interaction or modification that has a definite and manifest biological purpose. The principal function and purpose of many nascent polypeptide chains is to form a stable three-dimensional structure. The use of motifs of primary structure in hidden Markov Models has had a major impact in identifying a broader range of sequences with the same ability, as well as our understanding of the process of protein evolution. In Reactome, a finely granular data model maps a number of molecular processes in a step-wise manner by tracking the series of structural conversions along interconnected Events. Given the mapping of Reactions and Pathways to GO ‘function’ and ‘process’ terms, it is likely that future developments in the quantitative comparison of molecular structures may identify those recurring motifs of structural change that define specific biological activities.

Acknowledgment Reactome is a joint project between the European Bioinformatics Institute (EBI), Cold Spring Harbor Laboratories (CSHL) and the Gene Ontology Consortium (GO). It is supported by a grant from the US National Institutes of Health (P41 HG003751), a grant from the European Union Sixth Framework Programme (LSHG-CT-2003-503269), and a subcontract from the EBI Industry Programme. The author acknowledges the Reactome team for a number of insightful discussions about pathway informatics and helpful comments about the manuscript: Ewan Birney, Imre Vastrik, Esther Schmidt, Bijay Jassal and David Croft at EBI, Lincoln Stein, Peter D’Eustachio, Gopal Gopinath, Marc Gillespie, Lisa Matthews and Guanming Wu at CSHL, and Suzanna Lewis at GO.

References Barnetche, T., Gourraud, P. A., et al. (2005). Strategies in analysis of the genetic component of multifactorial diseases; biostatistical aspects. Transpl Immunol, 14(3-4), 255-66. Birney, E., Andrews, D., et al. (2006). Ensembl 2006. Nucleic Acids Res, 34(Database issue), D55661. Chen, F., Mackey, A. J., et al. (2006). OrthoMCL-DB: Querying a comprehensive multi-species collection of ortholog groups. Nucleic Acids Res, 34(Database issue), D363-8. Commoner, B. (1971). The closing circle. New York: Knopf.

723

The Breadth and Depth of BioMedical Molecular Networks

de Matos, P., Ennis, M., et al. (2007). ChEBI - Chemical entities of biological interest. NAR Molecular Biology Database Collection, (646). Debe, D. A., Danzer, J. F., et al. (2006). STRUCTFAST: Protein sequence remote homology detection and alignment using novel dynamic programming and profile-profile scoring. Proteins, 64(4), 960-7. Dunbrack, Jr., R. L. (2006). Sequence comparison and protein structure prediction. Curr Opin Struct Biol, 16(3), 374-84. Godden, J. W., Stahura, F. L., et al. (2005). Anatomy of fingerprint search calculations on structurally diverse sets of active compounds. J Chem Inf Model, 45(6), 1812-9. Goh, K. I., Cusick, M. E., et al. (2007). The human disease network. Proc Natl Acad Sci USA, 104(21), 8685-90. Greenman, C., Stephens, P., et al. (2007). Patterns of somatic mutation in human cancer genomes. Nature, 446(7132), 153-8. Harris, M. A., Clark, J., et al. (2004). The gene ontology (GO) database and informatics resource. Nucleic Acids Res, 32(Database issue), D258-61. Hill, J. O. (2006). Understanding and addressing the epidemic of obesity: An energy balance perspective. Endocr Rev, 27(7), 750-61. Hill, M. J. (1997). Intestinal flora and endogenous vitamin synthesis. Eur J Cancer Prev, 6(Suppl 1), S43-5. Jansen, G., Devaere, S., et al. (2006). Phylogenetic relationships and divergence time estimate of African anguilliform catfish (Siluriformes: Clariidae) inferred from ribosomal gene and spacer sequences. Mol Phylogenet Evol, 38(1), 65-78. Jothi, R., Cherukuri, P. F., et al. (2006). Co-evolutionary analysis of domains in interacting proteins reveals insights into domain-domain interactions mediating protein-protein interactions. J Mol Biol, 362(4), 861-75. Jungermann, K., & Barth, C. A. (1996). Energy metabolism and nutrition. Comprehensive Human Physiology, 2, 1425-1457. Kanehisa, M., Goto, S., et al. (2006). From genomics to chemical genomics: New developments in KEGG. Nucleic Acids Res, 34(Database issue), D354-7. Kasprzyk, A., Keefe, D., et al. (2004). EnsMart: A generic system for fast and flexible access to biological data. Genome Res, 14(1), 160-9. Klamt, S., Saez-Rodriguez, J., et al. (2006). A methodology for the structural and functional analysis of signaling and regulatory networks. BMC Bioinformatics, 7, 56. Lage, K., Karlberg, E. O., et al. (2007). A human phenome-interactome network of protein complexes implicated in genetic disorders. Nat Biotechnol, 25(3), 309-16.

724

The Breadth and Depth of BioMedical Molecular Networks

Le Novere, N., Bornstein, B., et al. (2006). BioModels database: A free, centralized database of curated, published, quantitative kinetic models of biochemical and cellular systems. Nucleic Acids Res, 34(Database issue), D689-91. Le Novere, N., Finney, A., et al. (2005). Minimum information requested in the annotation of biochemical models (MIRIAM),.Nat Biotechnol, 23(12), 1509-15. Lecomte, J. T., Vuletich, D. A., et al. (2005). Structural divergence and distant relationships in proteins: evolution of the globins. Curr Opin Struct Biol, 15(3), 290-301. Russell, R. C. G., Williams, N. S., et al. (2004). Bailey and Love’s short practice of surgery. Hodder Arnold. Sarma, D. P. (1988). Dukes’ classification of rectal cancer. South Med J, 81(3), 407-8. Sharan, R., Ulitsky, I., et al. (2007). Network-based prediction of protein function. Mol Syst Biol, 3, 88. Talmud, P. J. (2004). How to identify gene-environment interactions in a multifactorial disease: CHD as an example. Proc Nutr Soc, 63(1), 5-10. Trayhurn, P., & Bing, C. (2006). Appetite and energy balance signals from adipocytes. Philos Trans R Soc Lond B Biol Sci, 361(1471), 1237-49. Vastrik, I., D’Eustachio, P., et al. (2007). Reactome: A knowledgebase of biological pathways and processes. Genome Biol, 8(3), R39. Wheeler, D. L., Barrett, T., et al. (2007). Database resources of the National Center for Biotechnology Information. Nucleic Acids Res, 35(Database issue), D5-12. Williams, T. N. (2006). Human red blood cell polymorphisms and malaria. Curr Opin Microbiol, 9(4), 388-94. WTCCC (2007). Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. Nature, 447(7145), 661-78. Wu, C. H., Apweiler, R., et al. (2006). The Universal Protein Resource (UniProt), an expanding universe of protein information.Nucleic Acids Res 34(Database issue), D187-91.

KEY TERMS Biological Process: A biological process, as described by this set of GO terms, occurs through one or more ordered assemblies of molecular functions. It can be difficult to distinguish between a biological process and a molecular function, but the general rule is that a process must have more than one distinct step. Cellular Component: The cellular component ontology describes locations, at the levels of subcellular structures and macromolecular complexes.

725

The Breadth and Depth of BioMedical Molecular Networks

Gene Ontology (GO): A collaborative effort to address the need for consistent descriptions of gene products in different databases. It has developed three structured controlled vocabularies (ontologies) that describe gene products in terms of their associated biological processes, cellular components and molecular functions in a species-independent manner. Homology: In biology, entities or their functional systems that share common ancestry are said to be ‘homologous’. Kinetic Model: A model is a conceptual representation of a system or set of experimental observations. A kinetic model permits the simulation of such a system to observe the behaviour of its quantitative features. Molecular Function: A set of GO terms describing activities, such as catalytic or binding activities, that occur at the molecular level. These represent activities rather than the molecules or complexes that perform the actions. Molecular functions generally correspond to activities that can be performed by individual gene products, but some activities are performed by assembled complexes of gene products. Orthology: Homology (see above) as applied to features shared between species. Pathway: In Reactome, a Pathway is any grouping of related Reactions or Pathways, collectively known as Events. An Event may be a member of more than one Pathway. Physiology: The science of large-scale behaviour of biological entities and their related chemical and physical phenomena. PubMed: PubMed is a service of the U.S. National Library of Medicine that includes a large number of citations from life science journals for biomedical articles back to the 1950s. PubMed includes links to full text articles and other useful resources. Reaction: In Reactome, a Reaction is defined as the conversion of input substrate molecules to output product molecules in a single step.

726

The Breadth and Depth of BioMedical Molecular Networks

Appendix Figures Figure 1. The interactions of five Complexes, one Set and two small molecules described over three consecutive Reactions (filled blue circles) that form part of the larger Insulin Receptor Cascade Pathway. Protein rectangles are shaded blue, small molecules are white. The reaction ‘R3’ depicts the autophosphorylation of the hormone-bound receptor. The Set represents three human IRS proteins that play a role in binding the activated receptor at this stage in the cascade.

Figure 2. Reactome establishes a deep and robust connectivity between external ‘dictionaries’. Unique and complex relationships are captured between Gene Ontology terms and curated database entries for proteins and small molecules.

727

The Breadth and Depth of BioMedical Molecular Networks

Figure 3. The Reactome home page showing the Transcription Pathway highlighted on the ‘Sky’

Figure 4. A sketch representing a type of hidden Markov Model used in sequence matching. ‘M’, ‘I’ and ‘D’ labels denote ‘Match’, ‘Insert’ and ‘Delete’ nodes respectively

728

The Breadth and Depth of BioMedical Molecular Networks

Figure 5. The Human Apoptosis Pathway in Reactome. The top-most panel on this web page shows the highlighted set of Reactions in the ‘Sky’ that form part of this Pathway. The hierarchy of Events that make up this process is accessible through the panel that follows. A summary compiled by the expert biologists for this module is also available. A series of links to related molecular and genomic database records, as well as to orthology-based pathway predictions in lower organisms, is found in the lower part of this page. A number of export options are visible in the very last section.

729

Section XII

Mathematical Modeling Approaches

731

Chapter XLI

Entropy and Thermodynamics in Biomolecular Simulation Jorge Numata Freie Universität Berlin, Germany

abstract Thermodynamics is one of the best established notions in science. Some recent work in biomolecular modeling has sacrificed its rigor in favor of trendy empirical methods. Even in cases where physicsbased energy functions are used, entropy is forgotten or left “for later versions”. This text gives an overview of the utility of a more rigorous treatment of thermodynamics at the molecular level in order to understand protein folding and receptor-ligand binding. An intuitive understanding of thermodynamics is conveyed: enthalpy is the quantity of energy, while entropy stands for its quality. Recent advances in entropy estimation from information theory and physical chemistry are outlined as they apply to biological thermodynamics. The different enthalpic, entropic, and kinetic driving forces behind protein folding and binding are detailed. Finally, some medical applications enabled by an understanding of the free energy folding funnel concept are outlined, such as HIV-1 protease folding inhibitors.

Introduction Thermodynamics is not new and it’s not trendy. Thermodynamics doesn’t carry the glow of bioinformatics, pharmacokinetic modeling or metabolic networks. Should we care? In this chapter, I will argue for the importance of thermodynamics and entropy in the study of biomolecules. The field of systems biology deals with the emerging dynamical behavior of complex networks. It is often possible to dispense with details and still understand the basic features of signaling and reaction networks. But this should ideally not happen at the cost of ignoring thermodynamic principles. It is the intention of this chapter to demystify the notions of thermodynamics relevant to biology and help the reader acquire an intuitive grasp on the meaning of entropy.

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Entropy and Thermodynamics in Biomolecular Simulation

The enzymes present in a given cellular compartment determine which reactions are catalyzed and their kinetic rates. But they do not determine the directions of reactions or the amount of energy that is stored, transferred, or is required to synthesize a given reactant. (Alberty, 2006) This is predicted by thermodynamics as the direction of spontaneous processes, such as protein association events and the extent of biochemical reactions. Thermodynamics quantifies equilibrium, phase changes and stability using unmeasurable quantities like energy and entropy. These are coupled to experimentally measurable ones, like temperature and pressure, through mathematical relationships. This way, thermodynamics creates a self-consistent system of explanation for physicochemical transformations in micro- and macromolecular systems. The concept of “free energy” has established itself as the main criterion to predict if, and to what extent, a process will occur in a spontaneous way. It represents the evolution of the qualitative idea of “chemical affinity”, widespread until the 19th century. Free energy allows us to establish the equilibrium in chemical reactions and physicochemically driven processes such as non-covalent association. Important processes governed by non-covalent bonding are hormone binding to receptors, mRNA codon recognition on the ribosome (Almlöf, Andér, & Åqvist, 2007) and protein-protein interactions. Free energy allows us to predict the strength of such non-covalent interactions and the corresponding equilibrium constants. A reliable calculation of equilibrium constants for elementary reactions among biochemical metabolites and kinetic rates of enzymes from first principles would be an invaluable advance for the field of systems biology. The methods presented in this review carry such potential. The theoretical estimation of protein folding and ligand binding free energy is the subject of many excellent reviews (Chipot, Andricioaei, Hummer et al., 2007; Gilson & Zhou, 2007; Lazaridis & Karplus, 2003; Shakhnovich, 2006; van Gunsteren, Bakowies, Baron et al., 2006). This review will concentrate on conveying an intuitive understanding of entropy as it pertains to proteins at the molecular level, sacrificing generality but not compromising on rigor. Many interesting developments are occurring in the field of high-throughput virtual screening and prediction of protein-protein interactions. In order to gain computational speed, some physical details will be inevitably lost. My point on insisting on a thermodynamic treatment of biomolecular interactions is that we shouldn’t forget what generations of chemists have learned and replace it with ad-hoc formulations. Simplifications are useful and inevitable, so let us be guided by thermodynamics to propose models with solid foundations in physical chemistry. Simplified approaches to predict free energy which nevertheless retain a solid theoretical foundation have earned an important place in engineering thermodynamics of liquid mixtures (Mueller & Gubbins, 2001) and protein-protein binding (Audie & Scarlata, 2007).

An intuitive notion of entropy Internal energy and enthalpy quantify energy. Entropy measures the quality of that energy; the lower its entropy, the more useful that energy is. At first sight, the Earth seems to be kept alive by the energy arriving from the Sun. This is a superficial understanding, because in the steady state the amount of energy arriving from the Sun and the amount radiated back are the equal (ignoring for a moment the Earth’s internal energy sources). If the energy stayed, the Earth would become unbearably warmer every day. As noted by (Schrödinger, 1944) in an

732

Entropy and Thermodynamics in Biomolecular Simulation

article directed to a lay audience, life is maintained by a constant influx of low entropy. He coined the term “negentropy”, which in this context means that organisms are constantly expelling high entropy and feed on “negative entropy” to survive. The earth receives low-entropy electromagnetic radiation, which partly trickles down through the food chain and metabolic networks, and is ultimately emitted back as high-entropy radiation. Yellow, high-frequency light arrives to the earth. Infrared, low frequency radiation gets emitted. Consider Planck’s blackbody radiation formula: E = hν E=energy, h=Planck's constant and ν=Frequency. The arriving high frequency photons carry more energy per photon than those leaving. To keep the balance of energy in the steady state, more photons leave than those that arrive. A larger number of photons means more degrees of freedom, and thus the higher entropy. For more on this, see Chap. 27 of (Penrose, 2005). Entropy is dissipation and irreversibility. This can be illustrated with a waterfall analogy. A small amount of water at the top of a mountain falls into the ocean, which is flattened and all at the same level. In this process, its energy is not lost - it just becomes more dispersed. As it falls down, it may or may not be used to drive an industrial or biological process. Entropy is a measure of disorder. A crystal is an example of a low entropy material because of its predictable regularity. This is not to say that particles in a crystal are static, but their displacements due to thermal energy are relatively small. If we take a crystal vibrating in a lattice and heat it, it will become a liquid and its entropy will rise. If we heat it further, it may become a gas that fills the whole room. Can you now predict where each molecule is? The entropy (uncertainty) is now much larger than in the crystal. We cannot go back to the crystal in a predictable fashion, putting everything back into place the way it was before. This irreversibility results in an arrow of time that points just in one direction. (Bragg, Atkins, Grady et al., 2004). Finally, entropy is a measure of multiplicity and variability within a system. It is a counting of states in a logarithmic scale. Entropy was rediscovered in the context of telecommunications by (Shannon & Weaver, 1948) to provide a measure for channel transmission capacity. Shannon’s ideas went on to become the foundation of information theory, a whole branch of applied mathematics closely related to statistics. An intuitive connection between the “quality of energy” understanding of entropy and the “multiplicity of states” view from information theory can be gained with the following example: Consider how we rub our hands together in a cold day. We use high quality energy gained from food to apply very directed work, which is a collective effort of many muscle cells applying a force in the same direction (low “multiplicity”). It gets transformed into low quality energy that we perceive as a rise in temperature. This transformed energy has a high “multiplicity” because it quickly becomes spread out in all directions and involves the random, undirected vibrations of many particles. It is of lower quality because it cannot be completely turned back into directed motion, as dictated by the Second Law of Thermodynamics. Today, the concept of entropy has found widespread application in science and engineering. The generality of thermodynamics has afforded it a place in physical chemistry (Dill & Bromberg, 2003), engineering (Bejan, 1997), astrophysics (Hawking, 1976) and of course the life sciences (Atkins & Paula, 2006). Entropy also lives a parallel life in statistics (Jaynes & Bretthorst, 2003) and information theory (Cover & Thomas, 2006; Shannon & Weaver, 1948). However, entropy is still often misunderstood, ignored or pointed as the cause of inexplicable results. 733

Entropy and Thermodynamics in Biomolecular Simulation

Misconceptions about energy and entropy A folded protein in solution represents the optimized balance between minimum energy (enthalpy) and maximum multiplicity of configurations and conformations (entropy) of all interacting particles (water, ions, ligands and proteins). Here is a small list of misconceptions and wrong ideas regarding protein thermodynamics which are nevertheless widespread: •

•

•

•

•

Proteins have a special attraction for the minimum energy state. Collections of particles, including proteins, do not have an inherent preference for low energy states. It just happens that energy is available in limited quantities at a given temperature. If a certain amino acid side chain is in a very high energy state, it leaves no energy for the other particles. High energy conformations are thus not intrinsically unfavorable; they are just very unlikely. The protein folding problem is in essence an optimization problem: We just need to efficiently and correctly locate the global minimum in the potential energy. For some decades, practical methods for obtaining the potential energy of large molecules from their conformations have been available in the form of quantum chemical calculations and molecular mechanics force fields. In some lucky cases, a favorable potential energy (enthalpic contribution) dominates the binding of rigid ligands to rigid receptors. In general, however, free energy must account for both enthalpic and entropic contributions. This means that receptor-ligand binding and protein folding cannot be directly reduced to an optimization problem solvable through minimization algorithms. Energy is a perfectly understood concept. Actually, we have no mechanistic understanding of what energy is. We know that energy is conserved and we know, through the first law of thermodynamics, that it’s interconvertible. The first law of thermodynamics is nevertheless only the statement of a fact, not a description of a mechanism. Understanding of the mechanism of conservation is however not necessary for the application of the principle. Entropy is a mysterious force of nature. Despite its reputation as an enigmatic property, entropy is many ways less abstract than energy. It’s a counting of states: a measure of the multiplicity of ways a system can arrange itself into. Nature tends to spread out into all available possibilities. This spreading out grows with time in real, irreversible processes (and as a matter of fact, it defines the arrow of time itself). Entropy drives all systems into disorder. The first definition of entropy we hear is that it is a measure of disorder. This is actually correct. But the search for maximum entropy in one part of a system may be the driving force for organization in another. This is indeed the case in protein folding, where the hydrophobic effect maximizes the entropy of the water by collapsing the protein chain into a more orderly, low conformational entropy state. The net result is the minimum free energy of the whole system.

Thermodynamics: from steam engines to actin filaments Although thermodynamics was born in the realm of industrial plants, its wide applicability has afforded it a place in biology. For example, the thermodynamics of actin filaments has been explored (Sept & McCammon, 2001). Actin proteins are self-assembling units that play key roles in muscle cells and in the

734

Entropy and Thermodynamics in Biomolecular Simulation

formation and reshaping of the cytoskeleton. The tools of computer simulation can be used to calculate the thermodynamic driving forces behind processes like actin nucleation and polymerization. Thermodynamics consists of a set of tools to reason about energies and entropies. The basic building blocks are two laws and some multivariate calculus: 1st law (Energy balance): dU = δq + δw

(1)

where U=internal energy; q= heat; w=work. d indicates U is a path-independent state variable, while δ means that heat and work depend on the application path. 2nd law (Tot. Entropy never decreases): dS ≥ 0

(2)

where S = entropy (Boltzmann, 1896; Clausius, 1865). The First Law simply states that energy in all forms is conserved, and that it can be exchanged through heat and work. The Second Law can be seen as “half a conservation law”, because entropy can be created but not destroyed. (Falk, 1985) By combining the First and Second Laws at constant number of particles (N), Volume (V) and Temperature (T), we may obtain an expression describing the approach to equilibrium of any process. This criterion is what we mean with free energy: Free energy differential: dF = dU – TdS ≤ 0

(3)

“Laws of Thermodynamics in Lay Terminology 1st Law: It is impossible to obtain something from nothing, but one may break even 2nd Law: One may break even but only at the lowest possible temperature 3rd Law: One cannot reach the lowest possible temperature Implication: It is impossible to obtain something from nothing, so one must optimize resources” - From (Annamalai & Puri, 2002)

Free energy in processes involving proteins Protein folding and receptor-ligand binding occur in a spontaneous and specific way because the folded and bound states have a lower free energy than their denatured and unbound counterparts, respectively. The Helmholtz free energy change ∆F or the Gibbs free energy change ∆G=∆F+P∆V predict the equilibrium constant (Keq) for folding and binding. For macromolecules solvated in incompressible fluids like water, the volume term P∆V is negligible:

735

Entropy and Thermodynamics in Biomolecular Simulation

∆G ≈ ∆F = ∆U − T ∆S = −k BT ln K eq

All processes occur at temperatures higher than -273.15oC, so the entropic term -T∆S will play a role. For macromolecules and soft matter in general, understanding of the driving forces that together result in a given free energy or binding constant requires consideration of flexibility and motion. Regarding molecules as static entities has thwarted advance in understanding of biological thermodynamics.

Timeline of paradigms in protein flexibility and binding Protein flexibility is quantified by conformational entropy. If we are able to develop a reliable way of estimating the conformational entropy of macromolecules, we are in fact quantifying their conformational flexibility. But the importance of this flexibility is sometimes ignored in structural biology and molecular mechanics studies. A timeline of the paradigm shift is shown in Table 1.

Predicting ligand binding and protein-protein interactions The difference in free energy between two states tells us if a process will occur spontaneously, and to what extent. For a thermodynamic state function such as free energy to be meaningful, the start and end states should be clearly defined. For example, the stability of a protein against unfolding is given Table 1. Timeline of paradigms 1894

“Lock and key” hypothesis of Emil Fischer. Protein and ligand are specific and reciprocal. Enzymes are rigid templates of attractive and repulsive regions. (Demetrius, 1998)

1954

First computational chemistry simulations: Monte-Carlo of hard spheres. (Rosenbluth & Rosenbluth, 1954)

1958:

“Induced fit” model of Koshland. Ligands induce conformational changes in enzymes that cause a tighter fit.

1959

: X-ray crystal structure of a protein by Max Perutz. This in an invaluable advance. But it reinforced in many the paradigm of the frozen, rigid structure.

1962

“Everything that living things do can be understood in terms of the jiggling and wiggling of atoms.” (Feynman, 1962)

1965:

“Allosteric Modulation” model of Monod, Wyman & Changeux: Applicable to enzymes that aside from the active site also posses other effector sites. Binding at all sites can cause conformational changes. (Monod, Wyman, & Changeux, 1965)

1977

First molecular dynamics (MD) simulation published on protein BPTI. (McCammon, Gelin, & Karplus, 1977) Molecular dynamics has accelerated understanding of protein motion as essential for function and not just accessory.

1981

: Public release of MD simulation programs. (Bernard R. Brooks, 1983) Conformational motion modes may be separated with Principal Component Analysis, also known as the quasi-harmonic approximation to entropy. Pioneered by (Karplus & Kushick, 1981)

2001:

“Network of coupled promoting motions,” a paradigm to explain the function of enzymes. (Billeter, Webb, Agarwal et al., 2001; Hammes-Schiffer, 2006) Collective modes are reservoirs of entropy.

Present

Sequence-encodes-dynamics-encodes-function. (Bahar, Chennubhotla, & Tobi, 2007) Stabilization of sets of functional conformational ensembles upon binding. The solvated ensemble consists of conformational clusters (whose populations depend on their relative free energy). Upon binding, one of these clusters becomes favored. By selecting an already existing collective motion mode, the entropy penalty upon binding is reduced. This is called “conformational selection” (Lange, Lakomek, Farès, et al., 2008)

736

Entropy and Thermodynamics in Biomolecular Simulation

by ∆Gunfolding= Gfolded – Gdenatured. If ∆Gunfolding is negative, thermodynamics will favor the folded state. Similarly, the binding free energy for a ligand-receptor complex is:

∆Gbinding = Gcomplex − (Gligand + G protein )= − RT ln K a A factor-of-ten increase in the binding affinity constant Ka implies a change of 1.3 kcal/mol in ∆Gbinding at room temperature. This additional stability can come from either enthalpic or entropic contributions within the whole system (ligand, receptor protein, solvent, etc.) It is essential to report experimental binding free energy with respect to a standard concentration 0 C , which is arbitrary (Mihailescu & Gilson, 2004). Likewise, theoretical methods that estimate binding free energy should produce concentration-dependent predictions. If C0 is changed from 1M to 1nM, then every experimental standard free energy of binding will be reported as RT ln(109) = 12 kcal/mol more positive. (Gilson & Zhou, 2007). Consistent with the mass-action law, a favorable binding free energy becomes more negative with increasing concentration. The equilibrium constant Ka is: K a = e −∆G

0

/( RT )

≈ Ccomplex C 0 =∆ ∆Creceptor Cligand 

÷ ◊◊ eq

The dependency on C0 is only removed when the relevant quantity is ∆∆G.

Conformational entropy The net enthalpic (∆H) and entropic (T∆S) contributions from all particles (solute and solvent) almost cancel out in natural or properly engineered proteins (Zoete, Meuwly, & Karplus, 2005). Stability against

Figure 1. Proteins are molecular machines with motion networks that catalyze reactions. They obey the laws of thermodynamics, as first laid out for steam engines. Photo of a sculpture taken by the author at Tacheles, Berlin in 2006.

737

Entropy and Thermodynamics in Biomolecular Simulation

unfolding is typically around ∆G= 5 to 15 kcal/mol (Keq = 10-4 to 10‑11). Upon folding, the solute becomes more rigid and loses conformational entropy. This unfavorable contribution is typically T∆Sconformational= 10 to 100 kcal/mol. Any estimation of free energy lacking this contribution will grossly overestimate stability against unfolding. The entropy Sconformational can be defined in terms of the probabilities of microstates. A microstate is an individual conformation of a molecule: Sconformational = − k B ƒ pi ln pi

Here, pi represents the net probability of occupancy of a given microstate, including all correlations and statistical dependencies that give rise to it. Some flawed methods to estimate conformational entropy of proteins incorrectly assume independent motion of side-chain and additive rotamer entropy (Pickett & Sternberg, 1993). It is known from information theory that ignoring correlations and statistical dependencies will cause an overestimation of entropy (Jaynes, 1965). Some of the microstates of a molecule are strongly quantized, as is the case of fast vibrations with frequencies much larger than kB T / . Others may behave more classically, with closely spaced energy levels (Keeler, 2005), such as low frequency soft modes (the largest reservoirs of vibrational entropy). Still others arise from very closely spaced, practically indistinguishable energy levels, such as rotational and translational entropy. Linear correlation, and more generally non-linear statistical dependence among all modes, will reduce their individual contributions and thwart additivity. As we need to make use of statistics to define entropy through pi, it is convenient to review how probability entered the equations of physical chemistry and thermodynamics.

The statistical in mechanics Statistics deals with uncertainty and probabilities. For many, the mention of statistics brings up the idea of a defeat of determinism. Shouldn’t science be about fixed relationships and deterministic models? Statistics is much more than smudging over our ignorance. If we want to predict the behavior of large collections of particles (such as a protein), we need to quantify their collective behavior with statistics. But if we want to understand the behavior of a single particle with quantum detail, it turns out we also need probabilities. It seems that a purely deterministic description suffices only for very simple classical systems. Chemistry and thermodynamics were regarded for a long time as an exclusively macroscopic science. At the time when Ludwig Boltzmann was alive (late 1800’s), it was hotly debated whether chemical matter is particulate or a continuum. One of his main opponents was Walther Nernst. Boltzmann settled the argument by reconciling the atomic theory of matter with the theory of heat. “As chemical systems were proven to be made up of enormous amounts of molecular or atomic units, Boltzmann’s statistical approach which took into account the stochastic nature of microscopic processes in which sharply defined macroscopic physical values become distributions proved to be the accurate way to treat them” (Lazar, 2003). But Boltzmann himself never lived to see the success of his theories. It’s a sad fact that he committed suicide in 1906 in the midst of a scientific consensus that matter is a continuum. Albert Einstein once said, thinking about the rankings of scientific theories, that thermodynamics “is the only physical theory of universal content that within the framework of its basic notions will never

738

Entropy and Thermodynamics in Biomolecular Simulation

be toppled.” This came from a man who overthrew classical mechanics twice. The published PhD dissertation (Einstein, 1906) deals with deterministic equations. This seems to have been a compromise, as his PhD advisor Alfred Kleiner would not accept his molecular kinetic treatment of fluids, allegedly because of its statistical nature. (Uffink, 2006) This idea is supported by the fact that during the previous years he had been publishing papers about entropy and thermodynamics with a strong statistical component (Einstein, 1903). Another realm of research that involves statistical distributions and probabilities is quantum mechanics. Usually, in physics textbooks, the birth of quantum mechanics is credited to Planck’s resolution of the discrepancy between experiment and theory for the energy distribution for black body radiation through the introduction of quantized energy. It was Planck’s deep insight into thermodynamics that enabled him to solve the problem by formulating it in terms of the entropy of oscillators. Max Planck’s favorite topic seemed to be the Second Law of Thermodynamics. For years, Planck had upheld a macroscopic view of entropy and matter as a continuum. But with his resolution of the black body radiation problem, Planck was not only introducing the Wirkungsquantum, but at the same time recognizing the need for a statistical treatment. (Kragh, 2000) “I was, however, at that time still too far oriented towards the phenomenological aspect to come to closer quarters with the connection between entropy and probability […] I busied myself… with the task of elucidating a true physical character for the [entropy] formula, and this problem led me automatically to a consideration of the connection between entropy and probability, that is, Boltzmann’s trend of ideas” said Planck in his Nobel prize lecture (Planck, 1918). He continued throughout his life to study and teach thermodynamics. (Planck, 1945). The success of statistical mechanics and quantum physics has given statistics a new standing in science. Rather than being a replacement for mechanistic understanding, statistics is a powerful tool for inductive and logical reasoning with complex data. (Jaynes & Bretthorst, 2003) For all the success of statistics as a scientific tool, not everyone agrees about its indispensability. Recently I had the chance to ask Nobel prize winner Robert Laughlin whether he thought information theory will play a larger role in theoretical developments for emergent behavior of soft and biological matter in the mesoscopic, or “middle way” scale (Laughlin, Pinesdagger, Schmalian et al., 2000). His answer was a clear “no”, and his explanation, “because it’s not physical”. He then pointed to the assumption of equal probabilities of molecular microstates as useful but unfounded. Although the “maximum entropy” method (Jaynes, 1957) provides a mathematical formalism and generalization of “equal a priori probabilities” and the “principle of insufficient reason”, in the end this assumption is not physically cemented. However, “it is possible to make a sharp distinction in statistical mechanics: the physical and the statistical. We formulate our partial knowledge into a physical model. This model should deliver a correct enumeration of the states of a system and their properties. The statistical part is a straightforward example of inference.” (Jaynes, 1957) Arieh Ben-Naim argues that entropy can be reduced to plain common sense, as: 1. The Second Law is basically a law of probability [as Boltzmann established]. 2. The laws of probability are basically the laws of common sense [as Laplace said]. 3. It follows from (1) and (2) that the Second Law is basically a law of common sense - nothing more. (Ben-Naim, 2007)

739

Entropy and Thermodynamics in Biomolecular Simulation

Entropy measures the multiplicity of microstates A microstate is an individual conformation of a molecule. According to the Boltzmann distribution, a microstate of lower energy will be more populated than one of higher energy. Expressing the Boltzmann distribution in terms of the probability of microstates i and j:

≈ −( Ei − E j ) ÷ pi = exp ∆ ◊ for T > 0K pj k BT  

(4)

E is a microscopic energy inherent to the conformation. E is a function of (N,V) but not of temperature or entropy themselves (T,S). Higher temperatures mean that thermal energy k BT will allow significant occupation of higher energy levels. The system acquires an internal energy U according to which microstates are actually populated. The macroscopic (average) internal energy U is the average over all macrostates: t

U = E = ƒ pk Ek k =1



(5)

The toy model in Figure 2 captures many interesting properties of energy and entropy. This molecule has positively and negatively charged ends, which attract and may bind with a favorable energy -ε. Since the compact conformation has the least energy, one could reach the conclusion that it is the most populated. But what if the microstates of the open type are more numerous? This multiplicity of states (W) is quantified by the entropy as S=k Bln(W).

Figure 2. A 4-bead toy model of a folding molecule. The compact state is unique and contains one attractive interaction with a favorable energy of –ε. The four open microstates have no long-range interactions. The entropy can be calculated as Scompact=kBln(1) and Sopen=kBln(4). Based on Fig 10.1 of (Dill & Bromberg, 2003)

740

Entropy and Thermodynamics in Biomolecular Simulation

The concept of free energy uses both U and S to assess the stability of each macrostate. A macrostate is a collection of microstates with the same energy: Helmholtz free energy F= U – TS We are interested in the relative stability between two such macrostates: open ∆Fcompact = ∆U − T ∆S = − k BT ln K eq

The equilibrium constant Keq gives the proportion of compact vs. open conformations:

≈ −∆F ÷ ≈ −∆U K eq = exp ∆ ◊ = exp ∆  k BT   k BT

÷ ≈T ∆S ÷ ◊exp ∆ ◊   k BT 

The “unfolding” free energy for Figure 3 is: open ∆Fcompact = (0 − (− )) − T (k B ln 4 − k B ln1) = − k BT ln 4

Keq for Figure 3 is:

≈ − ÷ ≈ k BT ln(4) ÷ ≈− ÷ K eq = exp ∆ ◊exp ∆ ◊ = 4 ∂exp ∆ ◊  k BT   k BT   k BT  The entropy looks difficult to interpret when expressed as ∆S= k Bln(4)= 2.75 cal/(mol K). But its contribution to the equilibrium constant is a dimensionless number measuring multiplicity W=4. This means simply 4 times more open than compact conformations. In this light, entropy is more intuitive and easier to understand than energy itself! Energy and entropy can be interpreted likewise in protein folding. A conformational entropy change of 33.3 cal/(mol K) means there exist Wdenatured/Wnative= exp(T∆S/k BT)= 1.9x107 times more denatured conformations than native ones. I use the word denatured and not unfolded because the denatured state is not a random chain. Just seen from this chain conformational entropy contribution, folding is unfavorable. For folding to occur, other interactions such as the hydrophobic entropy gain, and favorable enthalpic interactions have to compensate for this large conformational entropy loss.

Stabilization by entropy In Figure 3 we see the situation where two conformers of a protein x1 and x2 differ in their internal energies. A conformer is a collection of macrostates with similar energies and conformations around a major energy well. Conformer 1 has a lower internal energy U1, for instance due to having more favorable residue contacts than conformer 2. Because the energy difference U2 - U1= ½k BT is smaller than thermal energy k BT, significant interconversion will occur. Although each individual high energy macrostate with E≈U2 around the basin x2 is less likely (see Eq. 4), there are many more such states. The sheer multiplicity of states around x2 allows it to be significantly populated. High multiplicity means high entropy, depicted here as the width of the well S2>S1. 741

Entropy and Thermodynamics in Biomolecular Simulation

Figure 3. The horizontal axis is a collective “reaction coordinate” measuring folding, for example the radius of gyration. The conformation at x1 is more compact and has more energetically favorable contacts than the one at x2. However, x2 may be favored by entropy. Figure based on (van Gunsteren et al., 2006)

A biological example of conformational entropic stabilization, in this case of the folded state, occurs in hyperthermophilic organisms. Their genes code for proteins enriched in positively charged amino acids. But the positive charge is achieved more frequently through lysines rather than arginines. This significant bias was recently explained (Berezovsky, Chen, Choi et al., 2005) through the much higher number of rotamers available to lysine. Because the effective conformational freedom of lysine is greater, it constitutes a reservoir of conformational entropy in the folded state, thereby stabilizing the protein as a whole. It should be mentioned that it’s actually the total free energy that tends to a minimum, and this includes the solvent, ions and any other relevant degrees of freedom and their interactions.

Enthalpy-entropy compensation in protein stability and binding Protein folding and binding involves non-covalent interactions. These have very narrow free energy ranges. For biological processes, the net difference between states is often between 5 and 15 kcal/mol. This is about 10 times more than thermal energy at physiological temperature RT= 0.6 kcal/mol. Ken Dill set an error goal of 0.1 kcal/mol per amino acid for the estimation of free energy of proteins. (Dill, 1997) Such precision would allow us to use theoretical methods for folding, binding or other processes with large conformational changes. Enthalpy-entropy compensation is just enough for folding. Proteins have evolved in such a way that the changes in enthalpy from intramolecular interactions, electrostatic solvation free energy, a favorable hydrophobic effect and an unfavorable conformational entropy loss almost cancel out. This razor thin window for compensation is bad news for simulation-based calculation of thermodynamic variables. Each one of the aforementioned factors can contribute 10 to 100 kcal/mol. The methods for estimating these enthalpic and entropic contributions should be extremely precise in order not to miss the total

742

Entropy and Thermodynamics in Biomolecular Simulation

free energy, which for a spontaneous process may be almost zero, but always negative. Thus the quest for more precise methods. The literature abounds with examples of half-successful attempts at estimating free energy of unfolding from energetic contributions. For example, (Pace, Shirley, McNutt et al., 1996) estimate the unfolding free energy of RNAase T1 from simulations as ∆GNU =-15 kcal/mol, whereas experiment turned out +9 kcal/mol. Because the sign is negative, simulation is actually predicting that the denatured conformation will be more stable. Likely a lot more examples could be found in the hard drives of theoreticians who didn’t dare to publish them.

Configurational energy landscape, a.k.a. potential energy surface Statistics can help us enumerate configurations and calculate entropy. But we still need a physical model to provide their energy (enthalpy). For small molecules, a fully quantum mechanical description is feasible. For macromolecules, however, a meaningful sampling of configurational space is best achieved by employing classical potentials. It was recognized in the 1960’s that the potential energy of a protein can be practically evaluated as a function of its coordinates (Karplus, 2006), and that this function could be obtained from a combination of quantum chemical data and experiments. This potential energy is called a “force-field” in the context of molecular dynamics simulation programs. In other contexts, the potential energy surface is called a configurational “energy landscape”. All thermodynamic properties may be obtained from the partition function. This quantity represents the amount of states that are effectively accessible to the system at the given conditions. For the conformational degrees of freedom of a molecule, the partition function may be obtained by locating all the minima on the potential energy surface, and estimating the density of states around them, with a method such as normal mode analysis (NMA) or Quasi-harmonic entropy with supralinear corrections (Numata, Wan, & Knapp, 2007). Local minima are stationary points on the potential energy surface with just positive or zero NMA frequencies. The free energy surface is a result of the network of stationary points in the potential energy surface (enthalpy) and the density of states around them (entropy).

Free energy landscape, a.k.a. folding funnel The free energy landscape or folding funnel is not the same as the potential energy landscape because it includes entropy. It is the resulting free energy from energetic (enthalpic) and entropic components. It represents the free energy surface including the solvent (e.g. water) and the solvated protein. This folding funnel has thousands of dimensions even for a small peptide. The folding funnel is attributed to Ken Dill and Hue Sun Chan (Dill & Chan, 1997). The idea is conceptually very useful and has become popular. (Brooks_III, Gruebele, Onuchic et al., 1998) It has also been misinterpreted. In a conversation with John Chodera (former coworker of Ken Dill), he pointed out that some have naïvely interpreted the funnel by thinking that a simple mathematical optimization algorithm could solve the protein folding problem. Of course, in actuality the optimization of the free energy landscape is not a simple problem and its result is not necessarily a single populated conformer.

743

Entropy and Thermodynamics in Biomolecular Simulation

Figure 4. Free energy folding funnel. This 3- dimensional version of the folding funnel you may be familiar with is a cartoon. The folding funnel depicts the change in enthalpy+effective solvation energy (vertical axis) and conformational entropy (both horizontal axes) during protein folding.

As always, when projecting objects in reduced dimensions, there are ambiguities. One can consider the example of a 2D map of the Earth. The position of the North Pole is not uniquely defined on the map. In the free energy surface, one can ascribe a coordinate system locally to any one basin and perhaps a few similar neighboring ones, but this does not apply throughout the configurational space. (Laughlin et al., 2000). This projection into three dimensions is nevertheless conceptually useful. Figure credit: Peter G. Wolynes (UCSD).

Kinetic constants from a molecular perspective To obtain the kinetics of a molecular process, for example of a conformational transition, we must locate all transition states that link the local minima. These are points in the potential energy surface that possess a single imaginary frequency. Once these points are known, methods from statistical rate theory such as kinetic Monte Carlo may be employed to quantify transitions. Steepest descent paths provide an approximation of the actual routes the transitions will follow under thermal energy. Kinetic constants are, in this light, accessible from knowledge of the minima and saddle points in the potential energy surface. (Wales, 2005) In order to study proteins, the potential energy surface should be an effective one that includes interactions among all particles, like water, cofactors, ions, etc. For this purpose, an implicit model approach such as Generalized Born (Chen, Im, & Brooks, 2006) is useful. It can, however, falsify the kinetic transitions because of the lack of solvent viscosity.

Enthalpic, entropic and kinetic stabilization Most processes are controlled by a balance between enthalpy and entropy, and enabled by kinetics relevant to the timescales of cellular processes. For contrast, some extreme examples of processes

744

Entropy and Thermodynamics in Biomolecular Simulation

where either enthalpy, entropy or kinetics alone plays the major role, overriding the other influences, are shown in Table 2. Unimolecular reactions of small molecules need not consider entropy changes. Frequently, organic chemists working with small molecules think of reaction free energies only in terms of internal energy changes. This is admissible for unimolecular reactions and those obeying the Hammond principle (Fersht, 1999) because covalent bond rearrangement in molecules made from tens of atoms can be reasonably described by enthalpic changes. As Tomasz Borowski (Jagellonian University) recently put it, calculating entropy from quantum chemistry in this field is almost cosmetic, as it usually doesn’t tip the balance for reactions. The situation is very different for non-covalent binding of organic macromolecules consisting of hundreds of atoms, like proteins and DNA. Both enthalpic and entropic contributions are sizeable and neither should be neglected a priori.

Contributions to protein stability from molecular interactions and conformational freedom Protein thermodynamic stability is a delicate business, involving the interplay and correlations within the protein and its environment. The following table (Table 3) of energetic contributions to free energy is very rough and meant only for gaining a qualitative perspective.

Additivity of free energy Contrary to earlier suggestions (Dill, 1997; Mark & van Gunsteren, 1994), it is theoretically sound to mathematically define additive group contributions for bonds, interactions and solvation free energy (Lazaridis & Karplus, 2003). Conformational entropy, on the contrary, depends on statistical correlations and dependencies spanning at least the whole protein complex, and cannot be generally divided into group contributions (Numata et al., 2007).

Table 2. Enthalpic •

Entropic Unimolecular chemical reactions (Hammond principle)

•

•

Kinetic Binding of HIV protease inhibitor Lopinavir (Shuman, Hämäläinen, & Danielson, 2004) Conformational entropy controls transport properties (diffusion, thermal conductivity, shear viscosity) of liquids (Laughlin et al., 2000) (Kauzmann, 1943).

• •

Lipid Membrane composition per leaflet (Poznansky & Lange, 1978) Beginning of amyloid fibril formation (dimerization) (Hwang, Zhang, Kamm et al., 2004)

745

Entropy and Thermodynamics in Biomolecular Simulation

Table 3. Contribution to free energy

Energy in kcal/mol

Covalent bond

-80 per bond

Hydrogen bond (included in electrostatic and water desolvation)

-2 to +1 per bond (Day, 1996; Zoete et al., 2005)

van der Waals interactions

-1 per bond

Electrostatic interactions

-5 per bond

Water electrostatic desolvation and the hydrophobic effect upon folding or binding

+3 per amino acid

Conformational entropy TS (coil to folded chain, rigidification)

+1 to +10 per amino acid

Positive values are destabilizing. Compare to thermal energy kBT=0.6 kcal/mol

Covalent bonds and disulphide bridges From the table, it is evident that covalent interactions are the strongest. It’s only possible to break them with the concerted effort of enzymes, and very rarely by thermal energy alone. This doesn’t mean that covalent bonds directly stabilize the folded state with their energy. When calculating free energy differences, it is crucial to define the end states very precisely. Otherwise, one could think that a disulphide bridge contributes 80 kcal/mol to folding stability. The proper way is to define the folding free energy between the denatured chain and the native folded conformation. Both denatured and folded states already contain all covalent bonds, including the disulphide bridge, so covalent bonds don’t contribute much to the folded-denatured difference in internal energy except through strain. Molecular mechanics calculations show that covalent bonding energy is very similar in folded and denatured states, corresponding to different but relaxed conformations. Also noteworthy is that the unfolding free energy is state function. This means that the stability of the protein is independent of the exact path followed by the cellular synthesis mechanism that created the protein and disulphide bridges. All we need to analyze are the ensembles of the folded and the denatured protein, both of which contain the same covalent bonds. (Gelpí, Orozco, Rueda et al., 2007) ran MD trajectories of hundreds of proteins in explicit water and analyzed the conformational entropy with the (Schlitter, 1993) method. Several contained 1 to 3 disulphide bridges. The authors conclude that disulphide bridges do not restrict conformational space sampling and do not lower entropy of the folded state compared to proteins without these bridges. The stabilization from strategically placed disulphide bridges should then come from lowering the entropy of the denatured state, making the folding entropy penalty smaller.

Electrostatic, van der Waals interactions and hydrogen bonds Electrostatic interactions are modeled based on the experimental observation expressed in Coulomb’s law. Van der Waals forces are caused by the momentary polarization of molecules and are much shorter ranged. Van der Waals forces are often modeled in molecular mechanics by the attractive part of a Lennard-Jones potential.

746

Entropy and Thermodynamics in Biomolecular Simulation

Hydrogen bonds (H-bonds) are not explicitly modeled in modern molecular dynamics force fields. (MacKerell_Jr., 2004) Instead, hydrogen bonds arise naturally from electrostatic, van der Waals interactions and solvation free energy. They are thus not a separate energetic contribution in the current analysis, but are worth discussing because the debate in the literature about their role in protein stability has a long history. One could naïvely think that the contribution of a hydrogen bond to folding stability can be evaluated as the interaction energy between the CO and NH groups. But the free energy should always be defined as a difference between two states: for example folded vs. denatured. Even the enthalpy of an intramolecular side chain-side chain hydrogen bond cannot be generalized because orientation and environment can play a big role. One can say the maximum strength of such a hydrogen bond is between 2 and 10 kcal/mol. But this is not the net free energy contribution. The denatured state is partially unfolded, so many potential hydrogen bonding partners in the polypeptide chain are satisfied by hydrogen bonds to water. Anthony Day (Day, 1996) mentions that “When the protein folds, these protein-to-water H-bonds are broken, and only some are replaced by (often sub-optimal) intra-protein H-bonds. McDonald & Thornton showed that while only 1.3% of backbone amino groups and 1.8% of carbonyl groups in proteins fail to H-bond (without any obviously compensating interactions), 80% of main chain carbonyls fail to form a second hydrogen bond. Thus, if one considers enthalpy terms alone, it would appear that hydrogen bonding is destabilizing to folded protein structure.” Proteins often prefer water hydrogen bonds of flexible and optimal orientations to intramolecular ones. Some authors suggest that H-bonds should generally make a favorable contribution to protein stability (Pace et al., 1996) and estimated this as -1.5±1.0 kcal/mol. (Day, 1996) More recent studies based on calculating total solvation energies (for example through Poisson-Boltzmann) and total electrostatic energies in the two states (folded-denatured or bound-unbound) suggest otherwise (Lazaridis & Karplus, 2003). Because frequently these contributions added together are positive (unfavorable), it can be concluded that hydrogen bonds don’t necessarily make a big contribution to folding free energy. However, they are still important in providing geometric directionality. (Zoete et al., 2005) Using a combination of analysis of experimental data and simulations, (Honig, Yang, & Sharp, 1992) also concluded that the effect of favorable hydrogen bonds is largely cancelled out by other factors.

Electrostatic solvation Electrostatic solvation free energy stems from the charge interactions between the solute and the solvent (e.g. water), plus possibly ions. It can be seen as the free energy change between vacuum and water. The Poisson Boltzmann (PB) equation and its approximations such as Generalized Born (GB) are methods rooted in physics to calculate the electrostatic solvation free energy. There exist many reviews on this topic (Koehl, 2006; Warshel, Shara, Kato et al., 2006). The catalytic activity of most proteins depends crucially on pH and the redox potential of the solution. The protonation states of titratable groups in the protein are variable and a function of the solvent environment and ionic strength, as well as of the interaction among titratable groups themselves. Protonation and deprotonation of these side-chains may be calculated using electrostatic solvation free energy and a Monte Carlo sampling scheme (Ullmann & Knapp, 1999). The Monte Carlo importance sampling results in a Boltzmann weighting of the titration pattern. Additionally, the accompanying

747

Entropy and Thermodynamics in Biomolecular Simulation

hydrogen-bonding and salt-bridge conformational changes may also be considered in a self-consistent way (Kieseritzky & Knapp, 2007). PB and GB model the electrostatic solvation free energy, which includes an entropic component. However, this is not the whole configurational entropy of the water. PB and GB are mean-field approaches which do not account for directional interactions with the solute that alter configurational freedom. At room temperature, the hydrophobic effect is mostly due to a change in this kind of entropy, and is thus not included.

The hydrophobic effect The hydrophobic effect is the major driving force affecting protein stability (see Chap. 17 (Fersht, 1999)). Ironically, much more effort has been dedicated to understanding the electrostatic aspects of solvation. At room temperature, the hydrophobic effect is primarily due to a maximization of the entropy of water. The hydrophobic effect arises from a complex interplay of geometric, probabilistic and energetic effects and remains to this day not fully understood. Oil drops in water can be used as a model for the behavior of macromolecular solutes such as the residues of a protein. Let us discuss the situation of oil and water at room temperature. After thoroughly shaking a bottle with oil and water, oil drops are spread and to a good degree mixed with water. Closed systems tend to maximize entropy, reaching a state where configurational freedom is highest, while striking a balance with the enthalpic (energetic) cost. For the oil drops, this state of maximum disorder would mean spreading out evenly through the liquid in one phase. At temperatures below ~25°C, the enthalpy of transfer of oil to water is, surprisingly, favorable. But as we know from experience, the oil drops gather slowly and form a separate phase. Why? From the point of view of the water, being mixed with the oil is not so comfortable. Water molecules in the vicinity of oil prefer to align specifically pointing to other water molecules, because oil cannot form hydrogen bonds with them. This state with fewer possibilities of arrangement lowers the entropy of the solution, but is compensated by keeping the hydrogen bonds. The first-shell water molecules arrange in a network of tangentially oriented O-H bonds. However, the number of such configurations is limited, i.e. much smaller than the number of possible configurations water molecules can have in bulk water, thus reducing the entropy. (Rispens, 2004). The oil droplets join together not because they intrinsically dislike water. The oil collects in one phase to minimize contact area with the water, to minimize the disturbance. This way the free energy of both phases is optimized. The situation in the more constrained residues of a protein is similar. The formation of a hydrophobic core is now recognized as an extremely important driving force in protein folding. At mesophilic temperatures, it also occurs in order to maximize solvent entropy. The net effect at physiological temperature is a compact protein structure with a lower exposed surface area than the denatured conformation.

Experimentalists’ Concept of Hydrophobicity A well established proxy for the hydrophobic effect is total solvent accessible surface area. As a first approximation, this area is contributed by all components of the protein equally. If one were to suggest to an experimental protein scientist that all amino acids are approximately as hydrophobic, this would be

748

Entropy and Thermodynamics in Biomolecular Simulation

met with surprise and downright rejection. The conflict is one of definition. The idea of hydrophobicity that experimentalists are more familiar with is a combination of the hydrophobic effect (water reordering) and solvation free energy. This measures the effective behavior, and makes some side chains more hydrophilic and some more hydrophobic. There are many tables available with the so-called hydropathicity index of amino acids. The problem is that the effective behavior might not be transferable to all cases. The tables differ very much in their classifications. For example, 5 amino acids are ranked in some scales as most hydrophobic and then again as least hydrophobic in others. (Southall, Dill, & Haymet, 2002) It is more useful to separate this contribution into hydrophobic (water reordering) free energy and electrostatic solvation free energy to make it more general and explore its microscopic origins.

Conformational freedom As stated from several points of view in this review, conformational freedom of the protein and its ligands makes an important contribution to stability. Loss of conformational entropy opposes folding and binding. One frequently unappreciated fact is that many proteins in the cell stably exist in a high entropy state. They populate a partially folded state sometimes called a “highly structured molten globule”. Some of them are speculated to acquire a more rigid structure only upon ligand binding. Such proteins are underrepresented in the literature and the PDB database. In experiments, they are hard to discern from on-path folding intermediates. In molecular dynamics simulation, their very high flexibility would demand prohibitively long trajectories to acquire reliable statistics (Gruebele, Ervin, Larios et al., 2002).

Theoretical methods to calculate conformational entropy Conformational entropy may be estimated from energy minimized conformations (as in the case of Normal Mode Analysis), or from thermodynamically equilibrated collections of conformations from molecular dynamics (MD) or Monte Carlo (MC) simulations. Some methods to calculate conformational entropy include: •

•

•

• • •

Single conformation normal mode analysis (NMA). Best done in an implicit solvent to include solvation free energy. It estimates a local harmonic density of states around the minimum. (Hollup, Salensminde, & Reuter, 2005) Quasi-harmonic approximation (QHA). It applies Principal Component Analysis to decompose covariance. Quantum entropy is calculated from the harmonic oscillator entropy formula. (Andricioaei & Karplus, 2001) Classical entropy from the k-nearest neighbor algorithm (kNN). It employs a technique from information theory to estimate statistical dependence beyond correlation. (Hnizdo, Darian, Federowicz et al., 2007) Quasi-harmonic (QHA) entropy corrected with kNN. (Numata et al., 2007) Mining Minima 2 (M2): Decomposition of entropy contributions from local energy wells. (Chang, Chen, & Gilson, 2007) Other methods. (Meirovitch, 2007)

749

Entropy and Thermodynamics in Biomolecular Simulation

Experimental estimates of conformational entropy Thermodynamic variables may be measured in the laboratory for example through microcalorimetry (T dependence) and potentiometric titrations (pH dependence) (Pfeil & Privalov, 1976). For proteins, calorimetric measurements yield total enthalpy and entropy of folding or association. However, it is not straightforward to separate this into contributions coming from solvent and solute. This was tried with limited success. (Makhatadze & Privalov, 1994) An alternative method probes the internal dynamics of the protein upon binding with several binding target domains. Six short peptides binding to the same protein (Calmodulin) were found by isothermal titration calorimetry to have similar affinities (and thus similar free energies of binding). However, the total enthalpic and entropic components of this free energy differ widely. Figure 5 shows this behavior. The entropy value obtained from isothermal titration calorimetry experiments that can be read in the figure above is a net entropy change for all of the following: Calmodulin protein, short peptide, water (hydrophobic effect) and calcium ions. An experimental measurement of the isolated conformational entropy of the protein or peptide is much more difficult to obtain. Entropy is related to conformational variations, a proxy of which is the order parameter, a number from 0 to 1 that indicates the freedom of a coordinate. In an innovative approach, order parameters are estimated from NMR experiments. (Igumenova, Frederick, & Wand, 2006) This order parameter was found to change for several side chain methyl groups upon binding of Calmodulin to the peptides, but not for the Calmodulin backbone. The conformational entropy is then estimated as a function of the order parameter.

Figure 5. Enthalpy (DH), entropy (-TDS) and free energy (DG) change for the formation of six calciumsaturated CaM-peptide complexes at 35 °C, as determined by isothermal titration calorimetry. Notice that the binding free energy is almost identical among ligands, but the enthalpic and entropic contributions vary. In the case of nNOS(p) there is even a slight net entropy gain upon binding (Frederick, Marlow, Valentine et al., 2007).

750

Entropy and Thermodynamics in Biomolecular Simulation

Although this experiment is groundbreaking, it has several limitations. The most conspicuous absence is the conformational entropy change for the small binding peptides, which will surely contribute (opposing) binding in a significant way because of the rigidification that occurs with the formation of the complex. Nevertheless, a strong correlation was found by the authors between the total calorimetric entropy change and the Calmodulin protein conformational entropy change estimated from NMR order parameters. (Frederick et al., 2007)

Medical applications of protein thermodynamics Most drugs currently on the market are agonists or antagonists that directly bind to the active site of a protein. Antagonists suppress a cellular response, for example by competitively binding to the active site but not activating a response. Antagonists provoke a conformational change that is not compatible with catalytic activity or signal transduction. Agonists, on the other hand, bind a group of active sites and activate a cellular response. Agonists elicit a conformational change that enables signal transduction and resembles the one occurring upon binding of the natural hormones or binding partners of that receptor. But not all drugs need to bind to the active site. Allosteric modulators bind outside the receptor binding site proper and induce a change in binding affinity, and thus a change in activity. Allosteric antagonists can induce a decrease in binding affinity of agonists by inducing a conformational change. It is also possible that the allosteric deformation of the receptor increases affinity for an agonist, resulting in allosteric synergism. (H Lüllmann, 2000) Allosteric modulators directly affect the relevant protein motion networks. Most HIV-1 protease inhibitors to date are antagonists of the active site. Design of drugs less susceptible to resistance may be accomplished by altering the thermodynamics of stability and folding of the protease (PR) dimer. Allosteric inhibitors bind to residues whose dynamics are coupled to the flap opening-closing collective motion network. They may either keep the flap open or closed shut, inhibiting its cleaving activity. (Perryman, Lin, & McCammon, 2004) Another strategy is to inhibit folding of the PR dimer; this has been achieved with peptides that bind and reshape the free energy landscape to make inactive conformations thermodynamically stable. (Broglia, Levy, & Tiana, 2008) Alzheimer’s, Hungtington’s (Numata, 2005) and Creutzfeld-Jakob (prion) diseases (Chiti & Dobson, 2006) all share protein misfolding and aggregation as a common feature. Recent experiments have lent credibility to the hypothesis that ß-amyloid aggregates are causal in the pathogenesis, at least in Alzheimer’s Disease. (Meyer-Luehmann, Spires-Jones, Prada et al., 2008) The normal folded and the aggregated misfolded conformations represent two local minima in the free energy landscape. The misfolded conformation is much lower in entropy, but is stabilized by enthalpy, mostly through tight van der Waals interactions in a so-called steric zipper (Sawaya, Sambashivan, Nelson et al., 2007). The two free energy minima are separated by a kinetic barrier to oligomerization. The design of compounds that block aggregation will hopefully be assisted by a detailed understanding of the thermodynamics and kinetics of misfolding.

751

Entropy and Thermodynamics in Biomolecular Simulation

Conclusion An understanding of energies and entropies can lead to better methods to predict the phenomena that make life possible. This information can assist us in the design of pharmacologically active substances. Entropy has been often neglected in biomolecular simulation methods because it is perceived as mysterious and intractable. It is hoped that this review may have helped the reader grasp an intuitive understanding of it. Theoretical and experimental methods to estimate entropy are undergoing rapid advances, bringing closer the prospect of a firmly grounded thermodynamic treatment of biological processes.

Acknowledgment The author would like to thank Lev Levitin (Boston University) and Dennis J. Diestler (University of Nebraska-Lincoln) for insightful and entertaining discussions about entropy.

References Alberty, R. A. (2006). Biochemical thermodynamics - applications of mathematica. Almlöf, M., Andér, M., & Åqvist, J. (2007). Energetics of codon-anticodon recognition on the small ribosomal subunit. Biochemistry, 46, 200-209. Andricioaei, I., & Karplus, M. (2001). On the calculation of entropy from covariance matrices of the atomic fluctuations. J Chem Phys, 115, 6289-6292. Annamalai, K., & Puri, I. K. (2002). Advanced thermodynamics engineering: CRC Press. Atkins, P., & Paula, J. D. (2006). Physical chemistry for the life sciences. New York: WH Freeman and Co./Oxford University Press. Audie, J., & Scarlata, S. (2007). A novel empirical free energy function that explains and predicts protein-protein binding affinities. Biophys Chem, 129, 198-211. Bahar, I., Chennubhotla, C., & Tobi, D. (2007). Intrinsic dynamics of enzymes in the unbound state and relation to allosteric regulation. Curr Opin Struct Biol., 17, 633-640. Bejan, A. (1997). Advanced engineering thermodynamics (2nd edition). New York: Wiley Interscience. Ben-Naim, A. (2007). Entropy demystified: The second law reduced to plain common sense. Berezovsky, I. N., Chen, W. W., Choi, P. J., & Shakhnovich, E. I. (2005). Entropic stabilization of proteins and its proteomic consequences. PLoS Computational Biology, 1(4), e47. Bernard, R., Brooks, R. E. B., Barry, D., Olafson, D. J., States, S., & Swaminathan, M. K. (1983). CHARMM: A program for macromolecular energy, minimization, and dynamics calculations. J Comput Chem, 4(2), 187-217.

752

Entropy and Thermodynamics in Biomolecular Simulation

Billeter, S. R., Webb, S. P., Agarwal, P. K., Iordanov, T., & Hammes-Schiffer, S. (2001). Hydride transfer in liver alcohol dehydrogenase: Quantum dynamics, kinetic isotope effects, and role of enzyme motion. J Am Chem Soc, 123, 11262-11272. Boltzmann, L. (1896). Vorlesungen über gastheorie. Leipzig: J.A. Barth. Bragg, M., Atkins, P., Grady, M., & Gribbin, J. (2004). BBC radio 4 -in our time- the second law of thermodynamics. Broglia, R. A., Levy, Y., & Tiana, G. (2008). HIV-1 protease folding and the design of drugs which do not create resistance. Current Opinion in Structural Biology, 18, 60-66. Brooks_III, C. L., Gruebele, M., Onuchic, J. N., & Wolynes, P. G. (1998). Chemical physics of protein folding. PNAS, 95, 11037-11038. Chang, C.-E. A., Chen, W., & Gilson, M. K. (2007). Ligand configurational entropy and protein binding. PNAS, 104(5), 1534-1539. Chen, J., Im, W., & Brooks, C. L. (2006). Balancing solvation and intramolecular interactions: Toward a consistent generalized born force field (CMAP opt. for GBSW). J Am Chem Soc, 128, 3728-3736. Chipot, C., Andricioaei, I., Hummer, G., Pande, V., Mark, A., & Simonson, T. (2007). Free energy calculations: Theory and applications in chemistry and biology. Chiti, F., & Dobson, C. M. (2006). Protein misfolding, functional amyloid, and human disease. Annu. Rev. Biochem., 75, 333-366. Clausius, R. (1865). Über verschiedene für die Anwendung bequeme Formen der Hauptgleichungen der mechanischen Wärmetheorie. Annalen der Physik, 201, 353-400. Cover, T. M., & Thomas, J. A. (2006). Elements of information theory (2nd ed.). Day, A. (1996). The source of stability in proteins (Doctoral presentation at Birkbeck University, London). from http://www.cryst.bbk.ac.uk/PPS2/projects/day/TDayDiss/ Demetrius, L. (1998). Role of Enzyme-Substrate Flexibility in Catalytic Activity: an Evolutionary Perspective. J Theor. Biol., 194, 175-194. Dill, K. A. (1997). Additivity principles in biochemistry. J Biol Chem, (272), 701-704. Dill, K. A., & Bromberg, S. (2003). Molecular driving forces: Garland Science. Dill, K. A., & Chan, H. S. (1997). From Levinthal to pathways to funnels. Nature Struc Biol, 4, 10-19. Einstein, A. (1903). Eine theorie der grundlagen der thermodynamik. Annalen der Physik, 14(S1), 135153. Einstein, A. (1906). Eine neue Bestimmung der Moleküldimensionen. Annalen der Physik, 19. Falk, G. (1985). Entropy, a resurrection of caloric-a look at the history of thermodynamics. Eur J Phys, 6, 108-115.

753

Entropy and Thermodynamics in Biomolecular Simulation

Fersht, A. (1999). Structure and mechanism in protein science: A guide to enzyme catalysis and protein folding. Freeman. Feynman, R. (1962). The Feynman lectures on physics, 1, 3-6. Frederick, K. K., Marlow, M. S., Valentine, K. G., & Wand, A. J. (2007). Conformational entropy in molecular recognition by proteins. Nature, 448, 325-330. Gelpí, J. L., Orozco, M., Rueda, M., Ferrer-Costa, C., Meyer, T., Pérez, A., Camps, J., & Hospital, A. (2007). A consensus view of protein dynamics. PNAS, 104, 796-801. Gilson, M. K., & Zhou, H.-X. (2007). Calculation of protein-ligand binding affinities. Annu. Rev. Biophys. Biomol. Struct., 36, 21-24. Gruebele, M., Ervin, J., Larios, E., Osváth, S., & Schulten, K. (2002). What causes hyperfluorescence: Folding intermediates or conformationally flexible native states? Biophys J, 83(1), 473-483. H Lüllmann, A. Z., Mohr, K., Bieger, D. (2000). Color atlas of pharmacology (2nd ed.). Stuttgart: Thieme. Hammes-Schiffer, S. (2006). Enzyme motions inside and out. Science, 312, 208-209. Hawking, S. (1976). Black holes and thermodynamics. Phys Rev D, 13, 191-197. Hnizdo, V., Darian, E., Federowicz, A., Demchuk, E., Li, S., & Singh, H. (2007). Nearest-neighbor nonparametric method for estimating the configurational entropy of complex molecules. J Comput Chem, 28(3), 655-668. Hollup, S. M., Salensminde, G., & Reuter, N. (2005). WEBnm@: A Web application for normal mode analyses of proteins. BMC Bioinformatics,, 6(52). Honig, B., Yang, A.-S., & Sharp, K. A. (1992). Analysis of the heat capacity dependence of protein folding. J Mol Biol, 227(3), 889-900. Hwang, W., Zhang, S., Kamm, R. D., & Karplus, M. (2004). Kinetic control of dimer structure formation in amyloid fibrillogenesis. PNAS, 101(35), 12916-12921. Igumenova, T. I., Frederick, K. K., & Wand, A. J. (2006). Characterization of the fast dynamics of protein amino acid side chains using NMR relaxation in solution. Chem Rev, 106(5), 1672-1699. Jaynes, E. T. (1957). Information theory and statistical mechanics (part 1). Phys. Rev., 106(4), 620630. Jaynes, E. T. (1965). Gibbs vs. Boltzmann entropies. Am J Phys, 33(5), 391-398. Jaynes, E. T., & Bretthorst, G. L. (2003). Probability theory: The logic of science. Karplus, M. (2006). Spinach on the ceiling: A theoretical chemist’s return to biology (Autobiography). Annu. Rev. Biophys. Biomol. Struct., 35, 1-47. Karplus, M., & Kushick, J. N. (1981). Method for estimating the configurational entropy of macromolecules. Macromolecules, 14(2), 325-332.

754

Entropy and Thermodynamics in Biomolecular Simulation

Kauzmann, W. (1943). The nature of the glassy state and the behavior of liquids at low temperatures. Chem Rev, 43(2), 219-256. Keeler, J. (2005). Molecular energy levels and thermodynamics (Handout for Part IB Chemistry A at Cambridge University, UK). from http://www-teach.ch.cam.ac.uk/teach/IBA/ Kieseritzky, G., & Knapp, E. W. (2007). Optimizing pKA computation in proteins with pH adapted conformations. Proteins: Structure, Function, and Bioinformatics, (Early online). Koehl, P. (2006). Electrostatics calculations: Latest methodological advances. Current Opinion in Structural Biology, 16, 142-151. Kragh, H. (2000). Max Planck: the reluctant revolutionary. Physics World. Lange, O., Lakomek, N.A., Farès, C., Schröder, G.F., Walter, K.F.A., Becker, S., Meiler, J., Grubmüller, H., Griesinger, C., de Groot, B.L. (2008). Recognition dynamics up to microseconds revealed from an RDC-derived ubiquitin ensemble in solution. Science, 320, 1471-1475. Laughlin, R. B., Pinesdagger, D., Schmalian, J., Stojkovic, B. P., & Wolynes, P. (2000). The middle way. PNAS, 97(1), 32-37. Lazar, T. (2003). Book Reviews: Molecular driving forces: Statistical thermodynamics in chemistry and biology. By K. A. Dill, S. Bromberg. Macromolecular Chemistry and Physics, 204(14), 1800. Lazaridis, T., & Karplus, M. (2003). Thermodynamics of protein folding: A microscopic view. Biophysical Chem, 100, 367-395. MacKerell_Jr., A. (2004). Empirical force fields for biological macromolecules: Overview and issues. J Comput Chem, 25, 1584-1604. Makhatadze, G. I., & Privalov, P. L. (1994). Hydration effects in protein unfolding. Biophys Chem, 51, 291-309. Mark, A. E., & van Gunsteren, W. F. (1994). Decomposition of the free energy of a system in terms of specific interactions: Implications for theoretical and experimental studies. J Mol Biol, 240(2), 167176. McCammon, J., Gelin, B., & Karplus, M. (1977). Dynamics of folded proteins. Nature, 267, 585-590. Meirovitch, H. (2007). Recent developments in methodologies for calculating the entropy and free energy of biological systems by computer simulation. Curr Opin Struct Biol., 17, 181-186. Meyer-Luehmann, M., Spires-Jones, T. L., Prada, C., Garcia-Alloza, M., Calignon, A. d., Rozkalne, A., Koenigsknecht-Talboo, J., Holtzman, D. M., et al. (2008). Rapid appearance and local toxicity of amyloid beta plaques in a mouse model of Alzheimer’s disease. Nature, 451, 720-724. Mihailescu, M., & Gilson, M. K. (2004). On the theory of noncovalent binding. Biophys J, 87, 23-26. Monod, J.-P., Wyman, J., & Changeux. (1965). On the nature of allosteric transitions: A plausible model. J Mol Biol, 12, 88-118.

755

Entropy and Thermodynamics in Biomolecular Simulation

Mueller, E. A., & Gubbins, K. E. (2001). Molecular-based equations of state for associating fluids: A review of SAFT and related approaches. Ind. Eng. Chem. Res., 40, 2193-2211. Numata, J. (2005). Conformational search of Huntingtin in the early steps of aggregation (MSc. Thesis). Freie Universität Berlin. Numata, J., Wan, M., & Knapp, E.-W. (2007). Conformational entropy of biomolecules: Beyond the quasi-harmonic approximation. Genome Informatics, 18, 192. Pace, C., Shirley, B., McNutt, M., & Gajiwala, K. (1996). Forces contributing to the conformational stability of proteins. FASEB Journal, 10, 75-83. Penrose, R. (2005). The road to reality: A complete guide to the laws of the universe: Vintage books USA. Perryman, A. L., Lin, J.-H., & McCammon, A. (2004). HIV-1 protease molecular dynamics of a wildtype and of the V82F/I84V mutant: Possible contributions to drug resistance and a potential new target site for drugs. Prot Sci, 13, 1108-1123. Pfeil, W., & Privalov, P. (1976). Thermodynamic investigations of proteins: I. Standard functions for proteins with lysozyme as an example. Biophys Chem, 4(1), 23-32. Pickett, S. D., & Sternberg, M. J. (1993). Empirical scale of side-chain conformational entropy in protein folding. J Mol Biol, 231(3), 825-839. Planck, M. (1918). Nobel lecture: The genesis and present state of development of the quantum theory [Electronic Version], from http://nobelprize.org/nobel_prizes/physics/laureates/1918/planck-lecture. html Planck, M. (1945). Treatise on thermodynamics (German 7th, English 1st ed.): Dover. Poznansky, M., & Lange, Y. (1978). Transbilayer movement of cholesterol in phospholipid vesicles under equilibrium and non-equilibrium conditions. Biochim Biophys Acta, 506(2), 256-264. Rispens, T. (2004). Cycloadditions in weakly and highly organized aqueous media. Rijksuniversiteit Groningen. Rosenbluth, M. N., & Rosenbluth, A. W. (1954). Further results on monte carlo equations of state (Hard spheres). J Chem Phys, 22, 881-884. Sawaya, M. R., Sambashivan, S., Nelson, R., Ivanova, M. I., Sievers, S. A., Apostol, M. I., Thompson, M. J., Balbirnie, M., et al. (2007). Atomic structures of amyloid cross-bold beta spines reveal varied steric zippers. Nature, 447, 453-457. Schlitter, J. (1993). Estimation of absolute and relative entropies of macromolecules using the covariance matrix. Chem Phys Letters, 215, 617-621. Schrödinger, E. (1944). What is life? The physical aspect of the living cell. Sept, D., & McCammon, J. A. (2001). Thermodynamics and Kinetics of Actin Filament Nucleation. Biophys J, 81(2), 667-674.

756

Entropy and Thermodynamics in Biomolecular Simulation

Shakhnovich, E. (2006). Protein folding thermodynamics and dynamics: Where physics, chemistry and biology meet. Chem. Rev., 106(1559-1588). Shannon, C. E., & Weaver, W. (1948). A mathematical theory of communication. Bell Syst. Tech. J. Shuman, C. F., Hämäläinen, M. D., & Danielson, U. H. (2004). Kinetic and thermodynamic characterization of HIV-1 protease inhibitors. J Mol Recognit, 17(2), 106-119. Southall, N. T., Dill, K. A., & Haymet, A. D. J. (2002). A view of the hydrophobic effect. J Phys Chem B, 106, 521-533. Uffink, J. (2006). Insuperable difficulties: Einstein’s statistical road to molecular physics. Studies in History and Philosophy of Modern Physics. Ullmann, M., & Knapp, E. W. (1999). Electrostatic models for computing protonation and redox equilibria in proteins. Eur Biophys J, 28, 533-551. van Gunsteren, W. F., Bakowies, D., Baron, R., Chandrasekhar, I., Christen, M., Daura, X., Gee, P., Geerke, D. P., et al. (2006). Biomolecular modeling: Goals, problems, perspectives. Angew. Chem. Int. Ed., 45(25), 4064-4092. Wales, D. J. (2005). Energy landscapes and properties of biomolecules. Physical Biology, 2, S86-S93. Warshel, A., Shara, P. K., Kato, M., & Parson, W. W. (2006). Modeling electrostatic effects in proteins. Biochimica et Biophysica Acta, 1764(11), 1647-1676. Zoete, V., Meuwly, M., & Karplus, M. (2005). Study of the insulin dimerization: Binding free energy calculations and per-residue free energy decomposition. Proteins: Structure, Function, and Bioinformatics, 61, 79-93.

KeY TermS Configurational Energy Landscape: Also known as the Potential energy surface. It is a highly dimensional surface depicting the potential energy of a molecule against each distance coordinate. Configurational Entropy: It is the conformational entropy plus the entropy due spatial rearrangements. For example, water has an internal molecular conformational freedom (vibrational, rotational and translational) and can also become rearranged in several hydrogen bonding constellations, giving it configurational freedom. Conformational Entropy: A measure of the internal freedom of a molecule, having contributions from vibrations (like stretching), rotations and translations. It is a logarithmic measure of the density of states (multiplicity) of a macrostate or conformer. Conformer: Collection of macrostate conformations of a molecule or protein with similar energies around a major energy well. Well-known examples are the boat and chair conformers of cyclohexane and glucose.

757

Entropy and Thermodynamics in Biomolecular Simulation

Entropy: A counting of the states available to a system in a logarithmic scale. In thermodynamics, this is multiplied by Boltzmann’s constant k B, which is only due to our arbitrary choice for the units of temperature. Entropy in information theory and thermodynamics is equally a measure of the multiplicity of states. Folding Funnel: Also known as the free energy landscape. In its reduced 3D projection, it is a cartoon of what actually is a highly dimensional free energy surface. The folding funnel is a representation of the change in enthalpy (vertical axis) and conformational entropy (both horizontal axes) during protein folding. Free Energy: A criterion for stability which predicts the direction of a process connecting two states. A system will undergo a process spontaneously if it lowers its free energy. For example, a partially unfolded, denatured protein in a high free energy state will fold to its native state with lower free energy. Free energy encompasses together energetic (enthalpic) and entropic driving forces. Hydrophobic Effect: The tendency of large solutes to gather together when solvated in associating liquids. The hydrophobic effect causes phase separation of oil drops in water at room temperature mostly to avoid disturbing the hydrogen bonding pattern of water. The disturbance of hydrogen bonding by oil causes a lowering of entropy. Phase separation occurs to raise the water entropy and lower the total free energy of the whole solution. The hydrophobic effect is the main driving force for protein folding, causing polypeptide chains to collapse onto themselves. Generalized to associating solvents other than water, it is known as the solvophobic effect. Information Theory: A branch of applied mathematics, closely related to statistics, where the central quantity is entropy. It is widely used in communications and thermodynamics to analyze the multiplicity of states and arrangements of a system. Macrostate: A collection of individual conformations (microstates) with the same energy. Experimentally accessible. Microstate: Individual, unique conformation of a molecule with a given energy. Experimentally indistinguishable from other conformations with identical energy and similar conformation.

758

759

Chapter XLII

Model Development and Decomposition in Physiology Isabel Reinecke Zuse Institute Berlin, Germany Peter Deuflhard Zuse Institute Berlin, Germany; Freie Universität Berlin, Germany; and DFG Research Center Matheon, Germany

abstract In this chapter some model development concepts can be used for the mathematical modeling in physiology as well as a graph theoretical approach for a decomposition technique in order to simplify parameter estimation are presented. This is based on the human menstrual cycle. First some modeling fundamentals are introduced that are applied to the model development of the human menstrual cycle. Then it is shown how a complex mathematical model can be handled if a large number of parameters are used where the parameter values are not known for the most part. A method is presented to divide the model into smaller, disjoint model parts. At the same time, it is shown how this technique works in the case of the human menstrual cycle. The principles for model development and decomposition can be used for other physiological models as well.

Introduction This chapter presents how a complex mathematical model of physiological processes (e.g. control systems in the human body) can be developed. Complexity makes successful parameter estimation difficult which is why a possibility to simplify this problem is shown. In the first part of this chapter, Background, some modeling techniques are presented which are used in the second part, Development of a Complex Mathematical Model for the Human Menstrual Cycle. In the third part, Decomposition of Complex Mathematical Models in Physiology, it is demonstrated, how Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Model Development and Decomposition in Physiology

complex mathematical models can be divided reasonably into smaller parts in order to simplify parameter estimation. This decomposition method is applied to the model for the human menstrual cycle.

Background First, some principle modeling concepts are introduced that could be useful in the modeling of physiological processes and that are used to construct the complex mathematical model of the human menstrual cycle. The concept of compartmentalization of the considered body parts and how the connections between the compartments can be modeled, for example, via receptor binding and feedback mechanisms, is described. If the biochemical mechanisms are known, simple reaction kinetics can be used and if enzymes catalyze the reaction, simple enzyme kinetics are applied. Taking into account the fact that the different elements of the system influence each other with a certain delay, delay differential equations instead of ordinary differential equations are used.

Compartmentalization of the Human Body The human body is not a closed homogeneous system; it consists of organs and tissues etc. in which different processes take place. In order to reduce biological complexity, the body parts that are essential in the processes are extracted and divided into discrete body elements, referred to as compartments (Andersen, 1991) that are interconnected via the shared blood system (Luecke & Wosilait, 1979), here called transport compartment. The characteristics of compartments are that isolated processes take place, but at the same time they can interact with each other. The model formulating the relations between these compartments is called compartmental model (Takeuchi et al., 2007) and this process of organizing the human body in compartments is referred to as compartmentalization which is the concept of pharmacokinetic modeling (Andersen, 1991). More precisely, physiological based compartments are used in this context since the compartments are based on the actual anatomy and physiology (Andersen, 1991).

Interfaces between the Compartments The compartments are non-closed systems and can influence each other. The question arises, how exactly the exchange takes place and what possibilities there are for interrelations between compartments. On the one hand, it is possible that only coarse interrelations such as inhibiting or stimulating effects are known. Then these feedback mechanisms can be modeled by Hill functions. On the other hand, it is possible to model on a biochemical basis via e.g. receptor binding.

Receptor Binding and Recycling It is often the case that the hormone which is synthesized in one compartment reaches another compartment through the blood circulation and binds to its corresponding receptor. They form a complex and thereby the receptor becomes activated: Ractivatable + H → (H-Ractivated )

760

Model Development and Decomposition in Physiology

Usually, the receptor does not return directly to the activatable state after dissociating from the hormone, but becomes first desensitized or inactivatable: Ractivatable → Ractivated → Rinactivatable → Ractivatable

Feedback Regulation If a substrate S stimulates another substrate P, we have: S increases Ω S decreases Ω

P increases P decreases

where the italics denote the corresponding concentrations now and in the following. The inhibition of S on P can be described by: S increases Ω S decreases Ω

P decreases P increases

A simple method to model these observations mathematically, is the appliance of Hill functions. They have values between 0 and 1, thus they are bounded. Additionally, the Hill functions provide a sort of switch, enabling to model the event that the concentration has to exceed a certain threshold value in order to be effective. This switch is the more distinctive the higher the Hill coefficient is. At this switch the values of the Hill function change between values near 0 to values near 1. The Hill function for stimulation and the resulting dynamics of P if S is stimulatory are given by:

(S ) (S;T,n ):= T S n 1 + (T ) n

+

h

=

Sn T n + Sn

Ω

d P = p + ∂h + ( S ; T , n), dt

p + ≠ IR +

and the Hill function for inhibition and the resulting dynamics of P if S is inhibitory are given by:

1 Tn h − (S;T,n ):= = n n n 1 + (TS ) T + S

Ω

d P = p − ∂h − ( S ; T , n), dt

p − ≠ IR +

where T ≠ IR+ denotes the threshold value and n ≥ 1 the Hill coefficient. It is h + (T + ; T + , n) = h − (T − ;T − , n) = 12 . If S exerts an inhibitory effect at low concentrations and a stimulatory effect at high concentrations on the dynamics of P, then we have the biphasic Hill function (Reinecke & Deuflhard, 2007): h − , + ( S ) := h − ( S ; T − , T + , n) := h − ( S ; T − , n) + h + ( S ; T + , n),

T− 1

denotes the standard Gamma density. The masses of the foregoing pulses are not considered since it is assumed that: j −1

M GnRH ,i

i =1

VPPS

ƒ

∂ (t − Ti )
0 then N′ = N′ + 1; VNgroup = V jpre ; ' for l = j + 1,...,N do if | Vl temp |> 0 then if V jpre \V jexp = Vl pre \Vl exp then VNgroup = VNgroup ∪ Vl exp ; ' ' temp Vl = ; end end end end end

782

Model Development and Decomposition in Physiology

V6group = V6pre ∪ V7pre, V7group = V8pre, V8group = V9pre ∪ V10pre, V9group = V12pre.

Determination of Disjoint Model Parts Our objective is a disjoint partition of the model. First of all, it is necessary to define the criteria for a reasonable partition of the model. For example, it could be desired that the maximal dimension of the model parts is not too large or that the maximal number of parameters to be estimated is rather small. We define as the first criterion to determine the grouping with minimal number of parameters. If the minimum is not unique, then the second criterion is applied to find the grouping with minimal number of elements in the set of groupings with minimal number of parameters. If the minimum is still not unique, the element with the smallest index of these groupings is chosen since in this case the choices are considered to be equivalent. In order to apply the first criterion it is necessary to define the set of parameters belonging to one grouping: group j

P

:=

n group j

P l =1

V jgroup ( l )

, n group :=| V jgroup | j

where V jgroup (l ) is defined as the l-th component if the elements of V jgroup are sorted by ascending index. The idea consists in removing the elements of the first chosen grouping from the other grouping. Then the next grouping is chosen according to the criteria mentioned above and again, the elements of this grouping are removed from the remaining groupings. This procedure is continued until there is only one grouping left. That means that first:

Box 2. j

V jgroup

1

1

2

2, 3, 4, 5, 6, 7, 8

3

2, 3, 4, 5, 6, 9, 10

4

11, 12, 13, 14, 15, 16, 17, 18, 24, 25, 26, 27, 28, 30, 31, 33, 34, 42

5

11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 43, 49

6

11, 12, 13, 14, 15, 16, 17, 18, 24, 25, 26, 27, 28, 30, 31, 33, 34, 35, 36, 44, 45

7

11, 12, 13, 14, 15, 16, 17, 18, 24, 25, 26, 27, 28, 30, 31, 33, 34, 35, 36, 37, 46

8

11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 47, 48

9

11, 12, 13, 14, 15, 16, 17, 18, 50

783

Model Development and Decomposition in Physiology

1 group ÷ := arg≈ |◊ j min ∆min | Pj  j  1 is calculated. If | j min |> 1 , then:

′ ,1 := arg≈ j min | V jgroup | ÷ ∆min ◊ 1  j≠ jmin 

′ ,1 |> 1 , then the element with smallest index is taken: j min ′′ ,1 := j min ′ ,1 (1) . For simplicity is determined. If | j min 1 1 ′ ,1 and j min ′′ ,1 also by j min in the following. Define as the model and parameter part for j min denote j min V j1part := V jgroup , Pj1part := Pjgroup . 1 1 min

min

min

min

then the other groupings of both the elements and the parameters are reduced: 1 V jgroup \V jgroup , Pjgroup \Pjgroup , ∀j ≠ jmin . 1 1 min

min

2 In the second step the same procedure as above must be conducted. Assume for simplicity that j min is unique. Then it is: 2 jmin := arg≈ | Pjgroup \ Pjgroup 1 ∆min 1 min j j ≠  min

|÷ ◊ 

and the emerging model and parameter parts are given by:

V jpart := V jgroup \ V jgroup , Pjpart := Pjgroup \ Pjgroup . 2 2 1 2 2 1 min

min

min

min

min

min

Again, the remaining groupings of elements and parameters are reduced:

(V (P

) )

≈2 ÷ 1 2 \V jgroup \V jgroup = V jgroup \ ∆ V jgroup 1 2 l ◊, ∀j ≠ jmin ∏ j ≠ jmin min min min l = 1   2 ≈ ÷ group 1 2 \Pjgroup \Pjgroup = Pjgroup \ ∆ Pjgroup 1 2 l ◊ ∀j ≠ jmin ∏ j ≠ jmin . j min min min l = 1   group j

This procedure can be continued until there is only one element grouping and one parameter grouping left which form the last model and parameter part (after reduction). Definition 12. Generally, the model parts and the parameter parts are defined by:

V j1part := V jgroup , Pj1part := Pjgroup 1 1 min

min

min

min

where: ≈ ÷ 1 jmin := arg ∆ min | V jgroup | ◊(1) ∆j≠ arg (min| Pkgroup |) ◊ k  

and for l ′ = 2,  , N ' :

784

Model Development and Decomposition in Physiology

÷ ÷ ≈l ′−1 ≈l ′−1 V jpart \ ∆ V jgroup , Pjpart \ ∆ Pjgroup = Pjgroup = V jgroup l′ l′ l l′ l′ l ◊, ◊ min min min min min min    l =1  l =1 where:

≈ ÷ l ′−1 ∆ ◊ ≈ ÷ l′ jmin := arg ∆ min V jgroup \ ∆ V jgroup 1 ◊ ◊(1) min ′− ≈ ÷ ≈l 1 ÷  l =1 ◊ ◊ Pkgroup \ ∆  P group ∆j≠ arg ∆∆k ≠ jmin ◊ l l  l=1 jmin  ◊  min ∀l 1 then

% second criterion:

(

)◊÷;

≈arg min | V part jmin = jmin ∆ ′ ( jmin ( j )) | N min j =1,,| jmin |  if | jmin |> 1 then jmin = jmin (1); end end

′ | do for l = 1, ,| N min if l ≠ jmin then part part VNpart ′ ( l ) = VN min ′ ( l ) \VN min ′ ( jmin ) ; min part part PNpart ′ ( l ) = PN min ′ ( l ) \PN min ′ ( jmin ) ; min

end end ′ = N min ′ \jmin ; N min end

V jinp = V jinp ,exp ∪ V jinp , app

∏ V jinp ,exp ∩ V jinp ,app = , ∀j ≠ {1, , N '}.

The sets V jinp ,app and V jinp ,exp , j = 1,  , N ' , are given by:

V jinp ,app := V jinp \ V exp , V jinp ,exp := V jinp \ V jinp ,app .

786

Model Development and Decomposition in Physiology

Box 3. j

V jpart

1

1

2

2, 3, 4, 5, 6, 7, 8

3

9, 10

4

24, 25, 26, 27, 28, 30, 31, 33, 34, 42

5

40, 41, 43, 49

6

35, 36, 44, 45

7

37, 46

8

20, 21, 22, 23, 29, 32, 38, 39, 47, 48

9

11, 12, 13, 14, 15, 16, 17, 18, 50

Due to the construction of the model parts, there is a j ≠ {1,...,N′} such that V jinp , app = φ and P = : V j1part = . Thus we can start the parameter estimation with this model part, as it does not need min any input from other model parts (if at all input of approximations of experimental data). After parameter estimation of this model part, approximations of its elements can be generated that can be used as input for the remaining model parts in the further parameter estimation. If there are several model parts that do not require input (except for exp-elements), then parameter estimation can be performed parallelly. Box 4 displays the required input for the model parts of the model in Table 2. Hence it is possible part part to start parameter estimation with the two model parts V1 and V9 since V1inp , app = ∏P1inp = and V9inp , app = ∏P9inp = . inp j

Result for the Model of the Human Menstrual Cycle As result, we obtain the different disjoint model parts as well as the arcs between the model parts. There is an arc from a first model part to a second model part, if there is an arc of one vertex of the first model part to a vertex of the second model part. The result is presented in Table 1 as well as visualized in Figure 5. We can see that the model parts can be classified in three groups of model parts that could be treated parallelly in parameter estimation: V1 part V2part

→ V3part

V9part

→ V4part

→ V6part

→ V7part

→ V8part

→ V5part

Since the order for the parameter parts is more restrictive:

(( P

1

part

→ P2part → P3part ), P9part )→ P4part → P6part → P7part → P8part → P5part

where P1 part → P2part → P3part and P9part can be treated parallely, the model parts must be determined in this order, too.

787

Model Development and Decomposition in Physiology

Box 4. j

V jinp ,exp

V jinp ,app

Pjinp

1

42, 43

-

-

2

1, 42, 43

-

7, 8

3

42, 43, 50

5

7, 8, 38

4

8

12, 13, 14, 15, 16, 17, 18

38, 70

5

-

29, 32, 38, 39

38, 173, 174, 176, 177

6

-

28, 31, 33, 34

38, 150, 151, 153, 154

7

-

28, 31, 35

38, 160, 161

8

10

11, 12, 13, 14, 15, 16, 17, 18, 28, 31, 36, 37

38, 163, 164, 166, 167

9

8,10

-

-

Table 1. The results of the model decomposition for the mathematical model with 49 differential equations and an equation for inhibin (n = 50) as well as of the nP = 208 parameters (Table 2)

j

V jpart / V rest V exp ∩V jpart

Pjpart / P rest

V jinp ,exp V jinp ,app

Pjinp

| V jpart | | Pjpart |

1

1

1

1,...,8

42,43

-

-

1

8

2

2,...,8

8

9,...,40

1,42,43

-

7,8

7

32

3

9,10

10

41,...,54,59,60

42,43,50

5

7,8,38

2

16

4

24,...,28,30, 31, 33,34,42

42

93,...,106,117,..., 134,145,...,155, 185,186,187

8

12,...,18

38,70

10

46

5

40,41,43,49

43,49

179,...,184,188, 189,190,206,207, 208

29,32,38,39

38,173,174, 176,177

4

12

6

35,36,44,45

44,45

156,...,165, 191,...,196

28,31,33,34

38,150,151, 153,154

4

16

7

37,46

46

166,167,168,197, 198,199

28,31,35

38,160,161

2

6

8

20,...,23,29,32, 38,39,47,48

47,48

88,...,92,107,..., 116,135,...,144, 169,...,178, 200,...,205

10

11,...,18,28,31, 36,37

38,64,163, 164,166,167

10

41

9

11,...,18,50

50

55,...,58, 61,...,86

8,10

-

-

9

30

10

19

-

87

-

18

86

1

1

788

-

Model Development and Decomposition in Physiology

Figure 5. Visualization of the subgraphs G jpart, j = 1,...,N′, representing the model parts without the rest set V rest. The arc from Gipart to G jpart is given if Vi part ∩ V jinp ≠ . If Vi part ∩ V jinp ,exp ≠ then the arc is dotted, otherwise it is solid. The subgraphs are represented by undirected graphs.

Conclusion This chapter concentrates on the modeling and the first steps in the determination of parameter values. First some concepts are presented that can be used for modeling of physiological processes. Then these concepts are applied to the case of the human menstrual cycle. In the third part of this chapter it is shown how this constructed model can be decomposed. Again, this concept is shown for the case of the human menstrual cycle. Although this topic concerns a considerable part of the population, comparatively little is done in the modeling of the human menstrual cycle. This complex model which has been developed in Reinecke & Deuflhard (2007) and which is presented in the section entitled Development of a complex mathematical model for the human menstrual cycle is only the beginning in the field of mathematical modeling of the human menstrual cycle. There are many possibilities to expand this model in order to make it more realistic and to offer a larger number of applications. For example, the action of oral contraceptives can be included in the modeling process where more compartments such as the stomach, the intestine, and the liver could be incorporated into the compartmental model. If the model gives a realistic representation of the essential processes in the body, we have many possibilities to examine different ways to influence the cycle in order to achieve the desired results. The existing models are smaller and include only the essential components of the system limiting the possibilities of manipulations.

789

Model Development and Decomposition in Physiology

A significant problem in the development of these rather complex and large models is the rising number of parameters, especially in the human body since in many cases experimental data are not available. Even coarse values are possibly not known making it difficult to determine the remaining parameter values by parameter estimation methods. One possibility to simplify parameter estimation is presented here. It is easier to cope with the problem if the dimension of the system is small. By the method of model decomposition using available experimental data, we obtain several smaller models. Even parallel parameter estimation is possible under certain conditions. In order to be able to apply this procedure, it is necessary that experimental data are provided for at least two of the elements. The more experimental data is available, the smaller the model parts become on average. The mathematical basis is, for example, a system of differential equations. With the help of these model parts, it is possible to perform parameter estimation for smaller dimensions. At the end, the model parts can be recomposed replacing the input of approximations of experimental data by the corresponding elements of other model parts resulting in a dynamic model. The detailed procedure for the determination of the model parts can be summarized as follows: 1. 2. 3. 4. 5. 6. 7. 8.

Transformation of the mathematical model into the corresponding graph Calculation of the adjacency matrix Defining the set of exp-elements Reducing the graph by removing the arcs starting in exp-elements Determining the sets of predecessors, the elements whereupon the exp-elements depend Merging sets of predecessors to groupings if they match except for the exp-element Subsequently finding the grouping with the smallest number of parameters (if unique) and removing the elements of this grouping from the other groupings in order to obtain disjoint model parts Determining the direct predecessors of the elements of the model parts and distinguish between exp-elements and elements that need to be approximated (non-exp-elements)

Finally, we obtain a decomposition of the model into disjoint model parts. This decomposition is not necessarily complete. It is possible that there are elements that do not belong to one of the model parts forming the rest set. These elements cannot be estimated. An example of the functionality is presented showing that it is possible to reduce the dimension of the problem n = 50 to N ' = 10 problems with a dimension of order in the range of 1 to 10. The number of parameters of each parameter part is between 6 and 46 instead of np = 208. And it is partly possible to perform partly parameter estimation parallelly which reduces the total time for solving this optimization problem. This occurs if there is more than one model part that, if at all, needs input from approximations of experimental data. That means that in this case parameter estimation can be performed independently from the other model parts. If there is more than one part with these conditions, it is possible to start parameter estimation with all of these model parts simultaneously. This could reduce the time that is needed to perform parameter estimation for all model parts and for the entire model in the end.

790

Model Development and Decomposition in Physiology

Table 2. Model equations. The 49 delay differential equations, one equation for the exp-element y50 and auxiliary functions are listed. In the first column, the delay differential equations are consecutively numbered. The corresponding equations are given in the second column. No

1

Equation

≈ ÷ p3p4 y43 (t − p8 ) p6 d ∂ + ∂p2 y1 (t ) = p4 1 ∆ p6 p6 ◊ p4 dt p3 + y42 (t − p7 )  p5 + y43 (t − p8 )  1 p1

y1 (T j ) − y1 (T j −1 ) = ( − ln(1 − U j )) , U j ~U [0,1], ∀j ≠ IN 2

3

≈ ÷ p31p11 y43 (t − p8 ) p13 d + ∂p9 y2 (t ) = ∆ p11 p13 p13 ◊ p11 dt p12 + y43 (t − p8 )   p10 + y43 (t − p8 ) y2 (T j ) − y2 (T j −1 ) p18p19 p d y3 (t ) = 16 + ∂ ∂(t − T j ) p19 −1 ∂exp(− p18 ∂(t − T j )) dt p17 p17 Γ( p19 ) − p15 ∂y3 (t ) ∂y4 (t ) − p14 ∂y3 (t ), t ≠ T j , T j +1 ), ∀j ≠ IN

4

p − y3 (t ) d y4 (t ) = p22 ∂ 23 + p21 ∂y6 (t ) − p20 ∂y3 (t ) ∂y4 (t ) dt p23 + y3 (t )

5

d y5 (t ) = p20 ∂y3 (t ) ∂y4 (t ) − p24 ∂y5 (t ) dt

6

d y6 (t ) = p24 ∂y5 (t ) − p21 ∂y6 (t ) dt p26p27 y43 (t − p8 ) p29 y42 (t − p7 ) p36 d y7 (t ) = p25 + p27 p ∂ ∂ − 30 dt p26 + y42 (t − p7 ) p27 p28p29 + y43 (t − p8 ) p29 p35p36 + y42 (t − p7 ) p36

7

8

≈ p31p32 y43 (t − p8 ) p34 ∂∆ p32 + p32 p33p34 + y43 (t − p8 ) p34  p31 + y43 (t − p8 )

÷ ◊∂p37 ∂y5 (t ) ∂y7 (t ) 

÷ p ≈ p31p32 y43 (t − p8 − p39 ) p34 d y8 (t ) = 37 ∂∆ p32 + p32 p34 p34 ◊ dt p38  p31 + y43 (t − p8 − p39 ) p33 + y43 (t − p8 − p39 )  y (t − p7 − p39 ) p36 ∂ p36 42 ∂y5 (t − p39 ) ∂y7 (t − p39 ) − p40 ∂y8 (t ) p35 + y42 (t − p7 − p39 ) p36 y42 (t − p7 ) p51 p52p53 p42p43 d y9 (t ) = p41 + p43 ∂ p − ∂ 44 dt p42 + y50 (t − p45 ) p43 p50p51 + y42 (t − p7 ) p51 p52p53 + y50 (t − p45 ) p53

9

≈ p46p47 y43 (t − p8 ) p49 ∂∆ p47 + p47 p48p49 + y43 (t − p8 ) p49  p46 + y43 (t − p8 )

÷ ◊∂p54 ∂y5 (t ) ∂y9 (t ) 

continued on the following page

791

Model Development and Decomposition in Physiology

Table 2. (continued)

10

÷ p ≈ p46p47 y43 (t − p8 − p59 ) p49 d y10 (t ) = 54 ∂∆ p47 + ∂y5 (t − p59 ) ∂y9 (t − p59 ) p47 p49 p49 ◊ dt p38  p46 + y43 (t − p8 − p59 ) p48 + y43 (t − p8 − p59 )  y (t − p7 − p59 ) p51 p52p53 ∂ p51 42 ∂ − p60 ∂y10 (t ) p50 + y42 (t − p7 − p59 ) p51 p52p53 + y50 (t − p45 − p59 ) p53

11

y (t − p64 ) p63 d y11 (t ) = p61 ∂ p63 10 + p65 ∂y10 (t − p64 ) p67 − p66 ∂y10 (t − p64 ) p68 ∂y11 (t ) dt p62 + y10 (t − p64 ) p63

12

(

)

(

d y12 (t ) = p66 ∂y10 (t − p64 ) p68 ∂y11 (t ) + p69 ∂y10 (t − p64 ) p72 ∂y8 (t − p70 ) p73 dt

)

− p71 ∂y10 (t − p64 ) p74 ∂y8 (t − p70 ) p75 ∂y12 (t )

(

)

13

d y13 (t ) = p71 ∂y10 (t − p64 ) p74 ∂y8 (t − p70 ) p75 ∂y12 (t ) + p76 ∂y8 (t − p70 ) p78 − p77 ∂y8 (t − p70 ) p79 ∂y13 (t ) dt

14

d y14 (t ) = p 77 ∂y8 (t − p 70 ) p79 ∂y13 (t ) − p80 ∂y14 (t ) dt

15

d y15 (t ) = p80 ∂y14 (t ) − p81 ∂y15 (t ) dt

16

d y16 (t ) = p81 ∂y15 (t ) − p82 ∂y8 (t − p 70 ) p83 ∂y16 (t ) dt

17

d y17 (t ) = p82 ∂y8 (t − p 70 ) p83 ∂y16 (t ) − p84 ∂y8 (t − p 70 ) p85 ∂y17 (t ) dt

18

d y18 (t ) = p84 ∂y8 (t − p 70 ) p85 ∂y17 (t ) − p86 ∂y18 (t ) dt

19

d y19 (t ) = p86 ∂y18 (t ) − p87 ∂y19 (t ) dt

20

d y20 (t ) = p88 ∂y21 (t ) + p89 ∂y23 (t ) − p90 ∂y10 (t − p64 ) ∂y20 (t ) dt

21

d y21 (t ) = p90 ∂y10 (t − p64 ) ∂y20 (t ) − ( p91 + p88 ) ∂y21 (t ) dt

22

d y22 (t ) = p91 ∂y21 (t ) − p92 ∂y22 (t ) dt

23

d y23 (t ) = p92 ∂y22 (t ) − p89 ∂y23 (t ) dt

24

d y24 (t ) = p93 ∂y25 (t ) + p94 ∂y27 (t ) − p95 ∂y8 (t − p70 ) ∂y24 (t ) dt

25

d y25 (t ) = p95 ∂y8 (t − p70 ) ∂y24 (t ) − ( p96 + p93 ) ∂y25 (t ) dt continued on the following page

792

Model Development and Decomposition in Physiology

Table 2. (continued) 26

d y26 (t ) = p96 ∂y25 (t ) − p97 ∂y26 (t ) dt

27

d y27 (t ) = p97 ∂y26 (t ) − p94 ∂y27 (t ) dt

28

d ≈7 ÷ y28 (t ) = p98 ∂∆ƒ p99 + i ∂y11+ i (t ) ◊∂y25 (t ) − p99 ∂y28 (t ) dt  i =1 

29

d ≈8 ÷ y29 (t ) = p107 ∂∆ƒ p108+ i ∂y10 + i (t ) ◊∂y21 (t ) − p108 ∂y29 (t ) dt  i =1 

30

d ≈7 ÷ y30 (t ) = p117 ∂∆ƒ p118+ i ∂y11+ i (t ) ◊∂y25 (t ) − p118 ∂y30 (t ) dt  i =1 

31

d ≈7 ÷ y31 (t ) = p126 ∂∆ƒ p127 + i ∂y11+ i (t ) ◊∂y25 (t ) − p127 ∂y31 (t ) dt  i =1 

32

d ≈8 ÷ y32 (t ) = p135 ∂∆ƒ p136 + i ∂y10 + i (t ) ◊∂y21 (t ) − p136 ∂y32 (t ) dt  i =1 

33

p ∂y (t ) − p147 ∂y34 (t ) y33 (t ) d y33 (t ) = p145 ∂y30 (t ) − y28 (t ) ∂ 146 33 − p150 ∂y31 (t ) ∂ dt p148 + y33 (t ) + p149 ∂y34 (t ) p151 + y33 (t ) − p152 ∂y33 (t )

34

35

p ∂y (t ) − p147 ∂y34 (t ) y34 (t ) d y34 (t ) = y28 (t ) ∂ 146 33 − p153 ∂y31 (t ) ∂ − p155 ∂y34 (t ) dt p148 + y33 (t ) + p149 ∂y34 (t ) p154 + y34 (t )

y33 (t ) p ∂y (t ) − p157 ∂y36 (t ) d y35 (t ) = p150 ∂y31 (t ) ∂ − y28 (t ) ∂ 156 35 dt p151 + y33 (t ) p158 + y35 (t ) + p159 ∂y36 (t ) − p160 ∂y31 (t ) ∂

36

y35 (t ) − p162 ∂y35 (t ) p161 + y35 (t )

y34 (t ) p ∂y (t ) − p157 ∂y36 (t ) d y36 (t ) = p153 ∂y31 (t ) ∂ + y28 (t ) ∂ 156 35 dt p154 + y34 (t ) p158 + y35 (t ) + p159 ∂y36 (t ) − p163 ∂y31 (t ) ∂

37

38

y36 (t ) − p165 ∂y36 (t ) p164 + y36 (t )

y35 (t ) y37 (t ) d y37 (t ) = p160 ∂y31 (t ) ∂ − p166 ∂y28 (t ) ∂ − p168 ∂y37 (t ) dt p161 + y35 (t ) p167 + y37 (t )

y36 (t ) y37 (t ) d y38 (t ) = p163 ∂y31 (t ) ∂ + p166 ∂y28 (t ) ∂ dt p164 + y36 (t ) p167 + y37 (t ) − y29 (t ) ∂

p169 ∂y38 (t ) − p170 ∂y39 (t ) y38 (t ) − p173 ∂y32 (t ) ∂ − p175 ∂y38 (t ) p171 + y38 (t ) + p172 ∂y39 (t ) p174 + y38 (t ) continued on the following page

793

Model Development and Decomposition in Physiology

Table 2. (continued) 39

p ∂y (t ) − p170 ∂y39 (t ) y39 (t ) d y39 (t ) = y29 (t ) ∂ 169 38 − p176 ∂y32 (t ) ∂ − p178 ∂y39 (t ) dt p171 + y38 (t ) + p172 ∂y39 (t ) p177 + y39 (t )

40

y38 (t ) p ∂y (t ) − p180 ∂y41 (t ) d y40 (t ) = p173 ∂y32 (t ) ∂ − y29 (t ) ∂ 179 40 − p183 ∂y40 (t ) dt p174 + y38 (t ) p181 + y40 (t ) + p182 ∂y41 (t )

41

y39 (t ) p ∂y (t ) − p180 ∂y41 (t ) d y41 (t ) = p176 ∂y32 (t ) ∂ + y29 (t ) ∂ 179 40 − p184 ∂y41 (t ) dt p177 + y39 (t ) p181 + y40 (t ) + p182 ∂y41 (t )

42

p d y42 (t ) = 185 ∂y34 (t − p186 ) − p187 ∂y42 (t ) dt p38

43

p d y43 (t ) = 188 ∂y41 (t − p189 ) − p190 ∂y43 (t ) dt p38

44

p d y44 (t ) = 191 ∂y35 (t − p192 ) − p193 ∂y44 (t ) dt p38

45

p d y45 (t ) = 194 ∂y36 (t − p195 ) − p196 ∂y45 (t ) dt p38

46

p d y46 (t ) = 197 ∂y37 (t − p198 ) − p199 ∂y46 (t ) dt p38

47

p d y47 (t ) = 200 ∂y38 (t − p201 ) − p202 ∂y47 (t ) dt p38

48

p d y48 (t ) = 203 ∂y39 (t − p204 ) − p205 ∂y48 (t ) dt p38

49

p d y49 (t ) = 206 ∂y40 (t − p207 ) − p208 ∂y49 (t ) dt p38

50

y50 (t ) = p55 + p56 ∂y12 (t ) + p57 ∂y17 (t ) + p58 ∂y18 (t )

References Andersen, M. E. (1991). Physiological modelling of organic compounds. Annals of Occupational Hygiene, (3), 309-321. Anderson, L. (1996). Intracellular mechanisms triggering gonadotrophin secretion. Reviews of Reproduction, 1, 193-202. Beineke, L. W., Wilson, R. J., (Eds.) (1997). Graph connections. Oxford Science Publications. Blum, J. J., Reed, M. C., Janovick, J. A., & Conn, P. M. (2000). A mathematical model quantifying GnRHinduced LH secretion from gonadotropes. Am. J. Physiol. Endocrinol. Metab., 278, E263-E272.

794

Model Development and Decomposition in Physiology

Chabbert-Buffet, N., & Bouchard, P. (2002). The ormal human menstrual cycle. Reviews in Endocrine and Metabolic Disorders, 3, 173-183. Chauvet, G. (2004). The mathematical nature of the living world. The Power of Integration. World Scientific. Chávez-Ross, A., Franks, S., Mason, H. D., Hardy, K., & Stark, J. (1997). Modelling the control of ovulation and polycystic ovary syndrome. Journal of Mathematical Biology, 36, 95-118. Clément, F., Monniaux, D., Stark, J., Hardy, K., Thalabard, J. C., Franks, S., & Claude D. (2001). Mathematical model of FSH-induced cAMP production in ovarian follicles. Am. J. Physiol. Endocrinol. Metab., 281, E35-E53. Conley, A. J., & Bird, I. M. (1997). Minireview: The role of cytochrome P450 17α-hydroxylase and 3βhydroxysteroid dehydrogenase in the integration of gonadal and adrenal steroidogenesis via the Δ5 and Δ4 pathways of steroidogenesis in mammals. Biology of Reproduction, 56, 789-799. Diestel, R. (2005). Graph theory. (3rd edition). Electronic edition. Springer. Godsil, C., & Royle, G. (2001). Algebraic graph theory. Springer. Gordan, J. D., Attardi, B. J., & Pfaff, D. W. (1998). Mathematical exploration of pulsatility in cultured gonadotropin-releasing hormone neurons. Neuroendocrinology, 67, 2-17. Greenspan, F. S., & Strewler, G. J., (Eds.). (1997). Basic & clinical endocrinology. 5th edition. Appleton & Lange. Harris, L. A. (2001). Differential equation models for the hormonal regulation of the menstrual cycle. PhD Thesis: North Carolina State University. Heinze, K., Keener, R. W., & Midgley Jr., A. R. (1998). A mathematical model of Luteinizing hormone release from ovine pituitary cells in perifusion. Am. J. Physiol. Endocrinol. Metab., 275, E1061-E1071. Herbison, A. E. (1997). Noradrenergic regulation of cyclic GnRH secretion. Reviews of Reproduction, 2, 1-6. Keck, C., Neulen, J., Behre, H. M., & Breckwoldt, M. (2002). Endokrinologie, Reproduktionsmedizin, Andrologie. 2nd edition. Georg Thieme Verlag. Keenan, D. M., & Veldhuis, J. D. (1998). A biomathematical model of time-delayed feedback in the human male hypothalamic-pituitary-leydig cell axis. Am. J. Physiol. Endocrinol. Metab., 275(1), E157-E176. KEGG PATHWAY Database (2006). http://www.genome.jp/kegg/pathway.html Lacker, H. M., & Akin, E. (1988). How do the ovaries count? Mathematical Biosciences, 90, 305-332. Luecke, R. H., & Wosilait, W. D. (1979). Drug elimination interactions: Analysis using a mathematical model. Journal of Pharmacokinetics and Biopharmaceutics, 7(6), 629-641. Magoffin, D. A., & Jakimiuk, A. J. (1997). Inhibin A, Inhibin B and Activin A in the follicular fluid of regularly cycling women. Human Reproduction, 12(8), 1714-1719.

795

Model Development and Decomposition in Physiology

Moenter, S. M., Brand, R. C., & Karsch, F. J. (1992). Dynamics of Gonadotropin-releasing hormone (GnRH) secretion during the GnRH surge: Insights into the mechanism of GnRH surge induction. Endocrinology, 130(5), 2978-2984. Rasgon, N. L., Pumphrey, L., Prolo, P., Elman, S., Negrao, A., Licinio, J., & Garfinkel, A. (2003). Emergent oscillations in mathematical model of the human menstrual cycle. SNS Spectrums, 8(11), 805-814. Reinecke, I., & Deuflhard, P. (2007). A complex model of the human menstrual cycle. Journal of Theoretical Biology, 247(2), 303-330. Skinner, D. C., Evans, N. P., Delaleu, B., Goodman, R. L., Bouchard, P., & Caraty, A. (1998). The negative feedback actions of progesterone on gonadotropin-releasing hormone secretion are transduced by the classical progesterone receptor. Proc. Natl. Acad. Sci., 95, 10978-10983. Strauss III, J. F. (1999). The synthesis and metabolism of steroid hormones. In S. S. C. Yen, R. B. Jaffe, R. L. Barbieri (Eds.), Reproductive endocrinology. physiology, pathophysiology, and clinical management, 125-154, 4th edition. W.B. Saunders Company. Strauss III, J. F., & Williams, C. J. (1999). The ovarian life cycle. In S. S. C. Yen, R. B. Jaffe, R. L. & Barbieri (Eds.). Reproductive endocrinology. physiology, pathophysiology, and clinical management, 213-253, 4th edition. W.B. Saunders Company. Swerdloff, R. S., Jacobs, H. S., & Odell, W. D. (1972). Synergistic role of progestogens in estrogen induction of LH and FSH surge. Endo, 90(6), 1529-1536. Takeuchi, Y., Iwasa, Y., & Sato, K., (Eds.) (2007). Mathematics for life science and medicine. Springer. Washington, T. M., Blum, J. J., Reed, M. C., & Conn, P. M. (2004). A mathematical model for LH release in response to continuous and pulsatile exposure of gonadotrophs to GnRH. Theoretical Biology and Medical Modelling, 1(9), 1-17. Yen, S. S. C. (1991). The human menstrual cycle: Neuroendocrine regulation. In S. S. C. Yen, R. B. Jaffe (Eds.), Reproductive endocrinology. physiology, pathophysiology, and clinical management, 191-217, 3rd edition. W.B. Saunders Company.

key TERMS Biphasic Hill Function: At low values the biphasic Hill function is decreasing and at high values increasing. Compartmentalization: The human body is divided into compartments, open systems that are interconnected. Delay Differential Equation: The dynamics are not only dependent on the time point t but on time points that lie in the past.

796

Model Development and Decomposition in Physiology

Positive and Negative Feedback: If substrates are regulated by other substrates that inhibit or stimulate, we speak of positive and negative feedback, respectively. Michaelis-Menten Mechanism: If reactions are catalyzed by enzymes, then the simplest approach for the mathematical modeling is the Michaelis-Menten mechanism. Model Decomposition: That is the partition of the mathematical model into disjoint model parts in order to simplify the parameter estimation. Pulse Generator: There are substances that are not released at a constant rate but in pulses. In the hypothalamus there is the GnRH pulse generator responsible for the pulsatile release of GnRH. It is appropriate to choose a stochastic approach for the mathematical model. Receptor Recycling: The unbound receptors are not active. They become activated when reacting with its ligand. After having accomplished its objective it is not degraded but returns first in an inactivatable state and then in the unbound, activatable state.

797

798

Chapter XLIII

A Pandemic Avian Influenza Mathematical Model Mohamed Derouich Faculté des sciences Oujda-Morocco, Morocco Abdesslam Boutayeb Faculté des sciences Oujda-Morocco, Morocco

abstract Throughout the world, seasonal outbreaks of influenza affect millions of people, killing about 500,000 individuals every year. Human influenza viruses are classified into 3 serotypes: A, B, and C. Only influenza A viruses can infect and multiply in avian species. During the last decades, important avian influenza epidemics have occurred and so far, the epidemics among birds have been transmitted to humans; but the most feared problem is the risk of pandemics that may be caused by person-to person transmission. The present mathematical model deals with the dynamics of human infection by avian influenza both in birds and in humans. Stability analysis is carried out and the behaviour of the disease is illustrated by simulation with different parameters values.

INTRODUCTION Worldwide, seasonal outbreaks of influenza (also known as flu) affect millions of people, killing about 500,000 individuals every year (WHO, 2005). Human influenza viruses are classified into three serotypes: A, B and C. Only influenza A viruses are known to infect and multiply in avian species. These viruses present 16 HA (haemagluttinin) and 9 NA (neuraminidase) subtypes (H1N1, H2N2, H3N2, H5N1, H7N7,....) (Alexander, 2004). At the domestic poultries, the infection by viruses of avian influenza provokes two main forms of illness characterized by an extremely weak and extremely elevated virulence. The first form weakly pathogen only provokes some benign symptoms (tousled feather, less frequent punter) and can pass Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

A Pandemic Avian Influenza Mathematical Model

easily unobserved. The second form pathogen has consequences well more serious. It propagates very quickly in raisings and of which the mortality rate can approach 100%, the death often occurring in the 48 hours. The wide spread of influenza in poultry and wild birds during the last decade and the occurrence of human influenza infection has raised the question of pandemics. For a pandemic to start, three conditions are required: a novel influenza virus subtype must emerge against which the general population has in its majority no immunity; the virus infects humans and causes serious illness; and the new virus should have a high rate of person-to-person transmission (WHO 2005; Ferguson, 2004). Three major pandemics occurred during the last century. In 1918, the Spanish flu has killed an estimated 40-50 million people, in 1957 the pandemic (Asian flu) killed about 2 million people and the Hong Kong flu killed an estimated one million people in 1968. Although influenza pandemics are considered inevitable, the avian epidemics that occurred during the last decade, starting in 1997 (Hong Kong), have not engendered pandemics. Studies have shown that direct contact with diseased poultry was the source of infection and found no evidence of person-to-person spread of the virus. However, due to the potential for cross-species of avian and human influenza viruses and the possibility of viruses reassortment, the high rates of mortality among the few cases observed recently (Table 1) could lead to devastating pandemics (Yuen, 2005; Kuiken, 2006; Smith, 2006). Consequently, the risk of pandemics and its corollaries remains on the agenda of national and international health bodies.

Table 1. Cumulative number of confirmed human cases of avian influenza A/(H5N1) reported to WHO (last update: 6 June 2007). Total number of cases includes number of deaths. WHO reports only laboratory-confirmed cases. All dates refer to onset of illness. (WHO, 2007). Country

2003

2004

2005

2006

2007

Total

cases

deaths

cases

deaths

cases

deaths

cases

deaths

cases

deaths

cases

deaths

Azerbaijan

0

0

0

0

0

0

8

5

0

0

8

5

Cambodia

0

0

0

0

4

4

2

2

1

1

7

7

China

1

1

0

0

8

5

13

8

3

2

25

16

Djibouti

0

0

0

0

0

0

1

0

0

0

1

0

Egypt

0

0

0

0

0

0

18

10

16

4

34

14

Indonesia

0

0

0

0

20

13

55

45

24

21

99

79

Iraq

0

0

0

0

0

0

3

2

0

0

3

2

Lao People’s Democratic Republic

0

0

0

0

0

0

0

0

2

2

2

2

Nigeria

0

0

0

0

0

0

0

0

1

1

1

1

Thailand

0

0

17

12

5

2

3

3

0

0

25

17

Turkey

0

0

0

0

0

0

12

4

0

0

12

4

Viet Nam

3

3

29

20

61

19

0

0

0

0

93

42

Total

4

4

46

32

98

43

115

79

47

31

310

189

799

A Pandemic Avian Influenza Mathematical Model

Mathematical models have been used for infectious diseases in general and for influenza in particular (Alexander, 2004; Ferguson, 2004; Hethcote, 2000; Mena-Lorca, 1992; Derouich, 2006). In the case of avian influenza, deterministic models were used for comparing interventions aimed at preventing and controlling influenza pandemics (Ferguson, 2004; Carrot, 2006) and stochastic models were proposed to model and predict the worldwide spread of pandemic influenza (Colizza, 2006; Colizza, 2007). In the present chapter, we propose a mathematical model to study the dynamics of human infection by avian influenza. The model deals with both infections (avian and human). Stability analysis is given and simulation is carried out with different parameters values. The model illustrates in particular, the importance of parameters such as the average number of adequate contacts of a human susceptible with infected human and the average number of adequate contacts of a human susceptible with infected birds in determining the incidence of the disease and consequent preventive strategies.

FORMULATION OF THE MODEL AND STABILITY ANALYSIS Parameters of the Model Let N and N0 denote the human and bird population size. In this model death is proportional to the population size with rate constant μ and we suppose that N and N0 are constant. The human population (respectively bird population) of size N (resp. N0) is formed of Susceptible S, of Infective I and of Removed R (resp. S0 and I0). (

I I + 0 0 ) S is the human incidence, i.e. the rate at which susceptible individuals become infectious. N N0

If the time unit is days, then the incidence is the number of new infection per day. The daily contact rate β is the average number of adequate contacts of a human susceptible with infected human per day, The daily contact rate β0 is the average number of adequate contacts of a human susceptible with infected birds per day,

I I is the infectious fraction of the human population and 0 is the infectious fraction of N0 N

the bird population. Time units of weeks, months or years could also be used. Similarly

' 0 0

I S0 is the bird incidence and N0

' 0

is the average number of adequate contacts of a bird

susceptible with other birds per day. The man life span is taken equal to 25 000 days (68.5 years), and the one of the bird is about 2500 days. The other parameters used in the model are birth rate constant (μ); contact rate, human to human (β); effective contact rate, bird to human (β0); effective contact rate, ' bird to bird ( 0); human life span (1/μ); and host infection duration (1/(μ + γ).

Equations of the Model A schematic representation of the model is shown in Figure 1. In human we consider SIRS compartmental model that is to say that human susceptible individuals become infectious then removed with temporary immunity after recovery from infection and susceptible when again immunity fades away, in bird population we consider SI compartmental model. The model is governed by the following equations:

800

A Pandemic Avian Influenza Mathematical Model

Figure 1. S ( I+

0

S0 I )/ N

0 0

' 0 0

I /N

0 0

I

I0 0

R R

Human population:  dS  dt   dI  dt   dR  dt   dN  dt

= N −( +

I I + 0 0 )S + R N N0

=(

I I + 0 0 )S − ( N N

=

I −( + ) R

=Λ −

+

+

)I

N − I

Bird population:

 dS0 = 0 N0 − (   dt  '  dI 0 = 0 I 0 S − 0  dt N0 

0 +

' 0 0

I ) S0 N0

I

0 0

Introducing the proportions: s =

S I R I S ; i = ; r = ; s0 = 0 ; and i0 = 0 . N N N N0 N0

So with the conditions s+i+r=1 and s0+i0= 1 i.e r=1-(s+i) and s0=1 –i0, the two previous systems become:

801

A Pandemic Avian Influenza Mathematical Model

 ds  dt   di  dt   dr  dt  di  0  dt

=

−( + i+

=( i+

i )s + r

0 0

i )s − (

+ +

0 0

)i

= i − ( + )r =

i (1 − i0 ) −

' 0 0

i

0 0

Equilibrium Points Theorem 1 Let R =

0 0

and

=

+ +

, then the previous system admits the following equilibrium points:

If R ≤ 1 there are two equilibrium points: 1. The trivial state E1(1,0,0,0) is the only equilibrium which is locally asymptotically stable for σ ≤ 1. ≈ + + ÷ ( + ) , ( − ( + + )) × , i,0 ◊ 2. The endemic equilibrium E1' ∆

•

( + )( + + ) −



( + )



which is locally asymptotically stable for σ ≤ 1. If R > 1 then an endemic equilibrium E2 (sh , ih , iv , nh ) will be the equilibrium point that is locally asymptotically stable.

•

Proof Equilibrium Points The equilibrium points satisfy the following relations:

− ( + i + 0i0 ) s + r = 0 ( i + 0i0 ) s − ( + + )i = 0 i − ( + )r = 0 ' 0 i0 (1 − i0 ) − 0 i0 = 0 From the equation (4) we have: i0 = 0 or i0 = 1 − From the equation (3) we have: r =

+

1. For i0 = 0: From the equation (2) we have: i = 0 or s = • •

802

0 ' 0

=

0 ' 0

( R − 1) where R =

i. + +

If i = 0 so r = 0 and s = 1. Then the equilibrium point is E1(1,0,0,0) + + from the equation (1) we have: If s =

' 0 0

.

(1) (2) (3) (4)

A Pandemic Avian Influenza Mathematical Model

i=

( − ( + + )) ×

( + ) ( + )( + + ) −

=

. So i>0 for

+ +

>1

In this case the equilibrium point is:

≈ + + E1' ∆  2.

,

( − ( + + )) ×

For i0 = 1 −

0 ' 0

( + ) ( + )( + + ) −

,

÷ i,0 ◊ ( + ) .

:

≈ + + From the equation (1) we have: s = 1 − ∆ 

−

÷ ◊i ( + )

From the equation (2) we have:



≈ + + − ∆ ∆ 

÷2  ◊i + … − ( + + ) − ( + )◊  

−



≈ + + Since s = 1 − ∆ ∆ 

We have Q(0) =

Q(

0 ' 0

−

≈ + + i ∆ ∆ 

0 0

÷ ◊i ≥ 0 and i ≥ 0 then i ≠ ( + ) ◊

−

÷ ◊⁄ i + ( + )◊ 

 ( + ) 0, …  ( + )( + + ) −

i =0

0 0

 ⁄. 

( R − 1) and

( + ) ( + )( + + ) −

)=−

( + )( + + ) − ( + )

( + + ) 1 then Q(0) > 0 therefore there exists a unique root in the interval which implies the existence of □ a unique equilibrium points: E2 (sh , ih , iv , nh ) Stability Proof The matrix of linearization (Jacobian matrix) is given by: − s ≈− ( + i + i0 ) ∆ −( + + ) 0 i + i0 ∆ J =∆ 0 −( + ) ∆ ∆ 0 0 0 ∆ 

− −

s 0s 0

0 0 (R − 1 − 2

' 0 0

÷ ◊ ◊ ◊ ◊ i0 ) ◊◊  803

A Pandemic Avian Influenza Mathematical Model

1.

For the point E1 the matrix J becomes:

≈− ∆ ∆0 J =∆ 0 ∆ ∆0 

−

−

−( + + )

0 −( + )

0

0

÷ ◊ ◊ 0 ◊ 0 ◊ ◊ 0 ( R − 1)  0

−

So E1 is stable if and only if R ≤ 1. 2. For the point E1' the matrix J becomes: − s ≈− ( + i ) ∆ −( + + ) 0 i ∆ J =∆ 0 −( + ) ∆ ∆ 0 0 0 

−

s ÷ ◊ − 0s ◊ ◊ 0 ◊ ◊ 0 ( R − 1)  0

Thus the eigenvalues of matrix J are λ1 = –μ(1–R) and the root of the polynomial:

(

P ( ) = −( +

+ ) − ( + i + )(−( + +

P( ) = −

2

(

2

)

si +

i

(( + + ) + + i + ( + )) + ( ( + + ) + ( + + ) i ) + − ( ( + )( + + ) + i (( + )( + + ) − ) ) 3

+

+ )) +

2

si

)

If we put

A=( + + )+ + i+( + ) B = ( + + )+( + + ) i C = ( + )( + + ) + i (( + )( + + ) −

)

So: AB > C , A > 0 , B > 0 and C > 0 then following Routh-Hurwitz conditions for the polynomial P, the state E2 is locally asymptotically stable for R ≤ 1. □ 3. The local stability of E2 is demonstrated in the same way as for E1'.

RESULTS AND DISCUSSION Stability analysis and values of the threshold were obtained. Simulation was carried out with different values of the parameters and illustration was given by Figures 2-5. Figure 2 illustrates the behaviour of the solutions in the case of endemic equilibrium.(R > 1). Figure 3 and Figure 4 give a comparison of the human infectious according to different values of the effective contact rate β (birds to human). Figure 5 shows the typical behaviour of the solutions indicating that the rate of (human) susceptible, infectious and removed, as well as the avian infectious approaches, asymptotically, the trivial equilibrium (R ≤ 1). The wide spread of avian influenza in birds poses two main risks for human and birds health. The first risk of direct infection in birds and human when the virus passes from birds to birds and to human.

804

A Pandemic Avian Influenza Mathematical Model

Figure 2.

0

= 0.0004 ,

0

= 0.035,

= 0.00004 , = 0.25,

= 0.1,

= 0.002

Figure 3.

0

= 0.0004 ,

0

= 0.035,

= 0.00004 , = 0.25,

= 0.1,

= 0.002

805

A Pandemic Avian Influenza Mathematical Model

Figure 4.

Figure 5.

806

0

0

= 0.04,

= 0.04,

0

0

= 0.035,

= 0.00004 , = 0.25, = 0.1,

= 0.002

= 0.035,

= 0.00004 , = 0.25, = 0.1,

= 0.002,

= 0.075

A Pandemic Avian Influenza Mathematical Model

The second risk is that the virus may change into a form that is highly infectious for birds and/or for humans. However, as stressed in the introduction section, the most crucial case is the eventual occurrence of a pandemic, caused by person-to-person spread of the virus. As indicated by the simulation of different patterns, the dynamics of the disease is mainly determined by the average number of adequate contacts of a human susceptible with infected human and the average number of adequate contacts of a human susceptible with infected birds. These two parameters constitute essential keys to preventive strategies against pandemics.

REFERENCES Alexander, M. E., Bowman, C., Moghadas, S. M., Summers, R., Gumel, A. B. & Sahai, B. M. (2004). A vaccination model for transmission dynamics of influenza. SIAM Journal of Applied Dynamical Systems, 3(4), 503-524. Bradt, D. A. & Drummond, C. M. (2006). Avian influenza pandemic threat and health systems response. Emergency Medicine Australia, 18(5-6), 430-443. Carrot, F., Luong, T., Lao, H., Sallé, A. V. , Lajaunie, C. & H. Wadernagel. (2006). A small-world-like model for comparing interventions aimed at preventing and controlling influenza pandemics. Biomedical Central Medicine, 4, 26-28 Colizza, V., Barrat, A., Barthelemy, M., Valleron, A. J., & Vespignani, A. (2006). The modelling of global epidemics: stochastic dynamics and predictability. Bulletin of Mathematical Biology, 68, 1893-1921. Colizza, V., Barrat, A., Barthelemy, M., Valleron, A. J., & Vespignani, A. (2007). Modelling the worldwide spread of pandemic influenza: Baseline case and containment intercations. Plos Medicine, 4(1) e13 Derouich, M., & Boutayeb, A. (2006). Dengue fever: Mathematical modelling and computer simulation. Applied Mathematics and Computation, 177, 528-544. Ferguson, N. M., Fraser, C., Donnelly, C. A., Ghani, A. C., & Anderson, R. M. (2004). Public health risk from the avian H5N1 influenza epidemic. Science, 304, 968-969. Heatcote, H. W. (2000). The mathematics of infectious diseases. SIAM Review, 42(4), 599-653. Jaime Mena-Lorca, & Heatcote, H. W. (1992). Dynamic models of infectious diseases as regulators of population sizes. Journal of Mathematical Biology, 30, 693-716. Kuiken, T., Holmes, E. C., McCauley, J., Rimmelzwaan, G. F., Williams, C. S., & Grenfell, B. T. (2006). Host species barriers to influenza virus infections. Science, 312, 394-397. Smith, D. J. (2006). Predictability and preparedness in influenza control. Science, 312, 392-394. WHO. (2007). Avian influenza (“bird flu”)-Fact sheet. Retrieved June 06, 2007, from http://www.who. int/csr/disease/avian\_influenza

807

A Pandemic Avian Influenza Mathematical Model

WHO. (2007). Avian influenza: assessing the pandemic threat. Retrieved June 06, 2007, from http://www. who.int/csr/disease/influenza/H5N1-9reduit.pdf Yuen, K. Y. & Wong, S. S. M. (2005). Human infection by avian influenza A H5N1. Hong Kong Medical Journal, 11, 189-199.

KeY TERms Avian: Related to birds. Immunity: Inherited, induced or acquired (by vaccine) resistance to infection by a specific pathogen. Incidence: The number of new cases of a specific disease occurring during a given period (a year in general). Influenza: An acute contagious viral infection characterized by inflammation of the respiratory tract and by fever, chills and muscular pain. Mathematical Model: An abstract model using equations to describe the behaviour of a system (biological, physical, …). Pandemic: Epidemic affecting a large proportion of a population over a wide geographical region. Susceptible: Lacking immunity and resistance and consequently at risk of infection. Stability: The condition of being resistant to changes and perturbations.

808

809

Chapter XLIV

Dengue Fever:

A Mathematical Model with Immunization Program Mohamed Derouich Faculté des sciences Oujda-Morocco, Morocco Abdesslam Boutayeb Faculté des sciences Oujda-Morocco, Morocco

abstract Dengue fever is a re-emergent disease affecting more than 100 countries. Its incidence rate has increased fourfold since 1970 with nearly half the world’s population now at risk. In the chapter, a mathematical model with immunization is proposed to simulate the succession of 2 epidemics with variable human populations. Stability of the equilibrium points is carried out and simulation is given for different parameters settings.

INTRODUCTION At the dawn of the third millennium, the world population is facing a double burden of non communicable diseases (NCDs) and infectious diseases (Boutayeb, 2006). NCDs, once known as the disease of “the rich”, are now also affecting developing countries where Cardio-Vascular Diseases (CVDs), cancer and diabetes are flourishing (WHO, 2003; Boutayeb, 2005; Parkin, 1999). In parallel, infectious diseases continue to be the major causes of mortality and morbidity in low and middle income countries, where, well known existing, emerging and re-emerging diseases like tuberculosis, cholera, meningitis, hepatitis, malaria, dengue, yellow fever, AIDS, Ebola, SARS and others are causing suffering and mortality to a wide population. Among the infectious diseases, dengue fever, especially known in Southeast Asia, is now endemic in more than 100 countries world-wide. Its incidence has increased fourfold since 1970 and nearly half the world population (2.5-3 billion) is now at risk. It estimated that more than 50

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Dengue Fever

million people are infected every year of which half a million of Dengue Haemorrhagic Fever (DHF) (DengueNet, 2007; Reprot, 2002; Teixeira, 2002). The two recognised species of the vector transmitting dengue are Aedes aegypti and Aedes albopictus. The first is highly anthropophilic, thriving in crowded cities and biting primarily during the day while the later is less anthropophilic and inhabits rural areas. Consequently, the importance of dengue is two- fold: •

•

With increasing urbanisation, crowded cities, poor sanitation and lack of hygiene, environmental conditions foster the spread of the disease which, even in the absence of fatal forms, breeds significant economic and social costs (absenteeism, immobilisation, debilitation, medication). The potential risk of evolution towards the haemorrhagic form and the dengue shock syndrome with high economic costs and which may lead to death.

Many authors have presented the disease as a major health problem either for the last decades of the 20th century or for the third millennium (Gubler, 1997; Gubler, 2002). The need for research and surveillance is often dealt with and many authors have stressed that DF/DHF is still perceived as unimportant and receives little attention despite its social and economic impact being similar to some of the most visible infectious diseases (Meltzer, 1998; Coleman, 2004). Different mathematical models were proposed. In general, they use compartmental dynamics with Susceptible, Exposed, Infective and Removed for human; and Susceptible and Infective for mosquito. SEIRS models were considered with an evaluation of the impact of ultra-low volume (ULV) insecticide applications on dengue epidemics (Newton, 1992). The values of basis parameters used in simulation by these authors constituted a data source (Table 1) for other authors. A general model with the population of susceptible and infectious human assumed constant and facing only one virus was considered by Esteva and Vargas (1998). These authors also proposed models where the human population was supposed to grow exponentially and to have a constant disease rate (Esteva, 1999), two serotypes of virus and variable human population and the impact of vertical transmission and interrupted feeding on the dynamics of the disease (Esteva, 2000; Esteva 2003). In previous papers, while pointing out that the idea of two viruses coexisting in the same epidemic is controversial, mathematical models with constant human population (N h ) and two different viruses acting at separated intervals of time were considered by the authors (Derouich, 2003; Derouich, 2004). The case of variable human population (N h ), was also considered Derouich, 2006). Building on that, the present chapter introduces a compartment of vaccinated people and hence considers a SVIR model.

FORMULATION OF THE MODEL AND STABILITY ANALYSIS Parameters of the Model Let Nh and Nv denote the human and vector population size. In this model death is proportional to the populations size with rate constant μh and we assume a constant Λh due to births and immigrations. So dN h = Λh − dt

810

h

Nh

Dengue Fever

Whereas for vector population we suppose that Nv is constant. The human population (respectively of mosquito population) of size Nh (resp. Nv) formed of Susceptibles Sh, of vaccinated V h, of Infective Ih and of Removed R h (resp. Sv and Iv). The model supposes a homogeneous mixing of human and mosquito population so that each bite has an equal probability of being taken from any particular human. While noting bs the average biting rate of susceptible vectors, phv the average transmission probability of an infectious human to a susceptible vector, the rate of exposure for vectors is given by: (phv Ihbs)/Nh It is admitted that some infections increase the number of bites by the infected mosquitoes in relation to the susceptible, therefore, we will assume that the rate of infected mosquito bites bi is greater than the one of the susceptible mosquitoes bs. •

•

Noting pvh the average transmission probability of an infectious vector to human and Iv the infectious vector number, the rate of exposure for humans is given by: (pvhIv bi)/Nh. So the adequate contact rate of human to vectors is given by: Chv=phv.bs. The adequate contact rate of vectors to human is given by:Cvh=pvh.bi.

ωh is the rate at which susceptible individuals receive the vaccine; δh is the rate at which vaccinebased immunity wanes. The man life span is taken equal to 25 000 days (68.5 years), and the one of the vector is of 4 days. Other parameters values are given in Table 1.

Equations of the Model A schematic representation of the model is shown in Figure 1. We consider a compartmental model that is to say that every population is divided into classes, and that one individual of a population passes from one class to another with a suitable rate. Up to now there is no vaccine against dengue viruses but research is going on and the eventuality of an immunization program is not excluded in the medium term. In this study we investigate the effect of such an immunization option.

Table 1. Definitions and values of basis parameters used in simulations [19] Name of the parameter Transmission probability of vector to human Transmission probability of human to vector Bites per susceptible mosquito per day Bites per infectious mosquito per day Effective contact rate, human to vector Effective contact rate, vector to human Human life span Vector life span Host infection duration

Notation phv pvh bs bi Chv Cvh

1/μh 1/μv 1/(μh + γh)

Base value 0.75 0.75 0.5 0.1 0.375 0.75 25000 days 4 days 3 days

811

Dengue Fever

Figure 1. Schematic diagram: Compartments of human and vector populations

First Epidemic The model is governed by the following equations: Human population: C vh I v  dS h  dt = Λ h − ( h + h + N ) S h + h   dVh = h S h − ( h + h )Vh  dt   dI h C vh I v S h − ( h + h + h )I h =  Nh  dt  dRh = h I h − h Rh   dt  dN h = Λh − h Nh − hIh   dt

812

Vh

h

Dengue Fever

Vector population: C hv I h  dS v  dt = v N v − ( v + N ) S v  h   dI v = C hv I h S − I v v v  dt Nh

Introducing the proportion: s h = sv =

Sh Λh /

; vh = h

Vh Λh /

; ih = h

Ih Λh /

; rh = h

Rh Λh /

; nh = h

Nh Λh /

; h

I Sv ; and iv = v . Nv Nv

So with the conditions sh+vh +ih+rh=nh and sv+iv1 i.e. rh=nh-( sh+vh +ih) and sv =1 -iv, the two previous systems become:  ds h C m = h − ( h + h + vh iv ) s h +  nh  dt  dv h = h s h − ( h + h )v h   dt  dih C vh m iv s h − ( h + h + h )ih =  nh  dt  div C hv (1 − iv ) − v iv =  nh  dt  dn  h = h − h nh − h I h  dt

v

h h

with m =

Nv Λh /

h

Equilibrium Points Theorem 1 The previous system admits two equilibrium points: •

If

h

≈ ( R − 1) ≤ p the trivial state E1 ∆ ∆ 

h h

h

,

+p (

h

+ p)(

h h

÷ ,0,0,1◊◊ is the only equilibrium. + h) 

( R − 1) > p then an endemic equilibrium E2 (sh , vh , ih , iv , nh ) will be the equilibrium point, where mC hv C vh ≈ ÷ h R= and p = h ∆ ◊◊ 1− ∆ v( h + h + h) h + h  

•

If

h

Proof The equilibrium points satisfy the following relations: h

−(

h

+

h

+

C vh m iv ) s h + nh

v = 0

h h

(1)

813

Dengue Fever

s −(

h h

h

+

C vh m sh − ( nh

−

h

nh −

)v h = 0

+

h

Chv (1 − iv ) − nh h

h

)ih = 0

(3)

i = 0

(4)

I = 0

(5)

h

+

h

v v

h h

C hv ih . C hv ih + v nh

From the equation (4) we have: iv = From the equation (5) we have: nh =

h

−

i

h h

, so iv =

h

From the equation (2) we have: v h = From the equation (1) we have: (

h

h

+

h C hv −

(

h

C hv ih h )i h +

h

(1 −

)) s h =

h

+

h

h

C vh m iv s h. nh −( h + h + h + p

−

C vh m iv s h = ( h + h + h )ih then s h = h nh C m From the equation (3) we have: vh iv s h − ( h + h + h )ih = 0 thus: nh − ( h + h + h )ih h h C hv i h −( h + C vh m × × × h ( ) − i C − i + h h h h hv h h v h h + p −

h

v

)

h

h

On the other hand,

h

. v

s h,

h

+

h

 p ih … (1 + )(Chv h …

(2)

≈ p ih2 − ∆Chv Cvh m + (1 + )( h Chv − 2 h h  h

h

v

÷ ) ◊ih + 

h

h

+

)ih

h

Chv Cvh m − + h+ h

.

)ih = 0 then

h h

h

v

(1 +

On the other hand we have R =

mC hv C vh v( h + h +

h

+

h

)

then mC hv C vh =

v

(

h

+

h

p  )⁄ = 0 ⁄ h 

(6)

+

h

) R. Therefore

if we put: p

A = (1 +

)(Chv

h

−

h

v

)

h

h

p

B = 2(1 +

)

h

v

− (1 +

h

C=

h

v

h

p

) hChv −

v

(

h

h

+

)R

h

(R −1 −

p

)

h

then the solutions of this equation (6) are ih = 0 and the roots of the polynomial Q (iv ) = Ai h2 + Bi h + C . Since s h =

814

h

−(

h

+ h+ h + p

h

)ih

 0, ≥ 0 and ih ≥ 0 then ih ≠ … 

v h

+

h

 ⁄, + h

Dengue Fever

we have Q(0) =

h

v

p

(R − 1 −

) and:

h

)=

h

Q( h

+

+

h

When  0, … 

h

−( (

+ p )( h + h ) [( 2 h + h + h)

h

h

+

h

)

v

+

h

+ C hv ]< 0

( R − 1) ≤ p the value of the polynomial Q(ih) is negative at the end points of the interval

h

 ⁄ therefore there is no root in this interval. h + h + h v

If h ( R − 1) > p then Q(0) > 0 therefore there exists a unique root in the interval which implies the □ existence of a unique equilibrium points: E2 (sh , vh , ih , iv , nh ).

Stability Theorem 2 •

For R ≤

h

+p

the state E1 is globally asymptotically stable (ie lim I h (t ) = 0). t →∞

h

•

For R >

+p

h

the state E2 is locally asymptotically stable.

h

Proof 1. The point E1: ≈A B ÷ For E1 the matrix of linearization (Jacobian matrix) is giving by: J E1 = ∆ ∆0 D ◊◊ with   ≈− ( h + h ) ÷ h ◊ A=∆ ∆ − ( h + h ) ◊ h 

and ≈ ∆− ( ∆ D=∆ ∆ ∆ ∆ 

h

+

h

+

h

)

C vh −

h

÷ 0 ◊ ◊ 0 ◊ ◊ − h◊ ◊ 

C vh m h h + p − v 0

Then the characteristic polynomial of A is given by:

PA ( ) =

2

+ (2

h

+

h

+

h

) +

h

(

h

+

h

+

h

)

and the characteristic polynomial of D is given by: PD ( ) = −(

h

≈ + )∆ ∆ 

2

+(

h

+

h

+

h

+

v

)++

h

+

h

) +

v

(

h

+

h

+

h

)(1 −

R ÷ )◊ + p ◊

h h

815

Dengue Fever

Thus the eigenvalues of matrix D are 2

+(

h

+

h

+

h

+

v

)++

h

+

h

1

) +

=− v

(

h

h

and the root of the polynomial:

+

h

+

h

)(1 −

R ) +p

h h

So E1 is stable if and only if the coefficients of polynomial: 2

+(

h

+

satisfy R ≤

h

+ h

h

+p

+

v

)++

h

+

h

) +

v

(

h

+

h

+

h

)(1 −

R ) +p

h h

.

h

2. The point E2 for δh = 0: The local stability of E2 is governed by the matrix of linearization (Jacobian matrix) of E2 is given by:

So from the equation (1) we have: From the equation (3) we have: ( From the equation (4) we have:

h

h

+

+

h

h

+

+

h

C vh m iv = h nh sh )=

C hv ih C hv ih = + n h iv nh

C vh m iv s h nh ih v

Then the matrix became:

Therefore the eigenvalues of the matrix J E2 are –μ h and the roots of the polynomial q ( ) = 3 + A 2 + B + C , where: A= B= C=

816

h

+ h v h mC vh s h iv C hv ih + + , sh ih nh iv n h

C hv ih mC vh C hv s h iv mC vh iv ( h nh − + + s h iv n h nh2 ih nh2 h

h

mC vh C hv (nh − s h + s h iv ) mC vh C hv s h ih − nh3 nh3

i s

h h h

Dengue Fever

So: AB > C, A > 0 , B > 0 and C > 0 then following Routh-Hurwitz conditions for the polynomial q, +p the state E2 is locally asymptotically stable for R > h . □ h

Second Epidemic In the same way as in the previous section we suppose the onset of a second epidemic with another virus. But in this case, we may assume that a proportion of the population of susceptibles is globally immunized against the four serotypes or partially immunized against one, two or three viruses. But in this model we suppose that the human population is divided into two categories: • •

A subpopulation that is infected once by serotype 2. A sub-population SNh that is infected twice: the first by the serotype 1 and the second by the serotype 2, this subpopulation is derived only from the removed from the first epidemic (serotype 1) who are exposed to DHF (Snh(t0)=Ssh(t0)=rh*). Therefore the model is given by the following equations: Human population:

C vh I v  dS h  dt = Λ h − ( h + h + N ) S h + hVh h   dVh = h S h − ( h + h )Vh   dt  dI h C vh I v  dt = N S h − ( h + h + h ) I h h   dRh  dt = h I h − h Rh   dN h = Λh − h Nh − hIh   dt C vh I v  dSS h  dt = −( h + h + N ) SS h + h SVh h   dSVh = h SS h − ( h + h ) SVh   dt  dSI h C vh I v  dt = N SS h − ( h + h + h ) SI h h   dSRh = h SI h − h SRh   dt

817

Dengue Fever

Vector population: Chv ( I h + SI h )  dSv ) Sv  dt = v N v − ( v + Nh    dI v = Chv ( I h + SI h ) S − I v v v  dt Nh

As in the first epidemic, introducing the proportions: sh =

Sh Λh /

Ss h = sv =

; vh = h

SS h Λh /

Vh Λh /

; Sv h = h

; ih = h

Ih Λh /

; rh = h

SVh SI h ; Sih = Λh / h Λh /

Rh Λh /

; Srh = h

; h

Nh SRh ; nh = Λh / h Λh /

; h

I Sv ; and iv = v Nv Nv

and with the conditions: rh=nh-( sh+vh +ih+Snh) where Sn h (t 0 ) = Ss h (t 0 ) = rh , dSnh =− dt

h

Snh −

h

Sih, Srh=Snh-(Ssh+Svh+Sih) and sv =1-iv then the two previous systems become:

C vh m  ds h  dt = h − ( h + h + n iv ) s h + h v h h   dv h = h s h − ( h + h )v h  dt   dih C vh m  dt = n iv s h − ( h + h + h )ih h   div C hv  dt = n (1 − iv ) − v iv h   dnh = h − h nh − h ih   dt C vh iv  dSs h  dt = −( h + h + N ) Ss h + h Sv h h   dSv h = h Ss h − ( h + h ) Sv h   dt  dSih C vh iv  dt = N Ss h − ( h + h + h ) Sih h   dSn h  dt = − h Snh − h Sih 

818

Dengue Fever

Equilibrium Points Theorem 3 The previous system admits two equilibrium points: • •

If

≈

( R − 1) ≤ p the trivial state E1 ∆ ∆

h

h

,

h

÷ ,0,0,1,0,0,0 ◊◊ is the only equilib+ h) 

 h + p ( h + p )( h rium. If h ( R − 1) > p then an endemic equilibrium E 2 s h , v h , ih , iv , nh ,0,0,0 will be the equilibrium ≈ ÷ mC hv C vh h ◊◊ 1− and p = h ∆ point, where R = ∆ v( h + h + h) h + h   h

(

)

Proof The proof follows as in Theorem 1.

Stability Theorem 4 •

For R ≤

+p

h

the state E1 is globally asymptotically stable (ie lim ih (t ) = 0 and lim Sih ( t ) = 0). x →∞

h

•

For R >

+p

h

x →∞

the state E2 is locally asymptotically stable.

h

Proof 1. The point E1: For E1 the matrix of linearization (Jacobian matrix) is giving by: ≈J 11 J E1 = ∆ ∆0  ≈− ( A=∆ ∆  ≈ ∆− ( ∆ D=∆ ∆ ∆ ∆  J 22

≈− ∆ =∆ ∆ 

J 12 ÷ ≈A B ÷ ◊◊ with J 11 = ∆ ∆0 D ◊◊, J 22   

h

+

h

) −(

h

h

+

h

+

C vh − − 0 0

h

h

h

÷ ◊, + h ) ◊ h

h

)

h

C vh m h h + p − v 0

÷ 0 ◊ ◊ 0 ◊, and ◊ − h◊ ◊ 

0 ÷ ◊ 0 ◊ −( h + h + h) − h − h ◊ 0

819

Dengue Fever

Thus the eigenvalues of matrix J E1 are given by the eigenvalues of J11 and the eigenvalues if J22. So the eigenvalues of J22 are 1 = −( h + h ), 2 = − h and 1 = −( h + h + h ). According to Theorem 2 the eigenvalues of J11 have a negative real parts if and only if: R≤

h

+p h

Then E1 is stable if and only if R ≤

h

+p h

2. The point E2: The local stability of E2 is governed by the matrix of linearization (Jacobian matrix) of E2 this matrix ≈J 11 J 12 ÷ has the form J E2 = ∆ ∆ 0 J ◊◊ where: 22  

J 22

≈ ∆− ∆ =∆ ∆ ∆ ∆ 

h

−

h

−

mC vh iv nh

0 0

÷ 0 ◊ ◊ 0 ◊ −( h + h + h) ◊ − h − h◊ ◊  0

Thus the eigenvalues of matrix J E1 are given by the eigenvalues of J11 and the eigenvalues if J22. So the mC vh iv ), 2 = − h and 3 = −( h + h + h ). According eigenvalues of J22 are 1 = −( h + h + nh to Theorem 2 the eigenvalues of J11 have a negative real parts if and only if: R>

h

+p h

Then E2 is stable if and only if R >

h

+p

.

h

Remark: The inequality R ≤

h

+p

represents the principle of herd immunity because the susceptible

h

population may be protected from epidemics if enough people are immunized.

RESULTS AND DISCUSSION Stability analysis was carried out for the two epidemics and values of the threshold were obtained . Illustration of the dynamics of each epidemic is given by Figures 2-4. 820

Dengue Fever

Figure 2 shows the typical behaviour of the solutions indicating that the rate of susceptible, infectious and removed approaches, asymptotically, the trivial state of the system (the ideal state) i.e. to the +p case where all the population is and will remain healthy (in this case R ≤ h ). h

Figure 3 illustrates an oscillatory behaviour near the neighbourhood of the endemic equilibrium point. +p This behaviour can be justified in the fact that if R > h and if the initial values of sh, Ssh, and Ssv h

satisfy the relation: R ( s h + Ss h + s v ) > 1 then ( s h + Ss h + s v ) decreases and the rate of the infectious (ih + Sih + iv ) grows until a maximum, then it decreases since there is not enough susceptible to be infected. However after a low value of (ih + Sih + iv ), the rate of susceptible starts growing because of birth of susceptible, once big, an epidemic kid releases and so forth. Figure 4 illustrates the benefits of vaccination in the control of the epidemic, a comparison is given for different values of the proportion (ωh = 0, 0.5 and 0.95), but this eventuality remains subject to the advent of the vaccine.

CONCLUSION By its nature, dengue is a complex disease resulting from the interaction of human, biological, environmental, geographical and socio-economic factors. The present chapter is devoted to the understanding of the dynamics of dengue and essentially its evolution to the haemorrhagic form. The model considers

Figure 2. Convergence -4

0. 2

10

population

population

F irs t infection s econd infection

0. 1 0. 05

10

0

50

time Number of the infectious (s econd epidemic) -3 x 10

0

3

0

700

800 900 1000 time Number of the infectious humans (s econd epidemic) -4 x 10 s econd infection

2

population

5

-5 600

5

-5 600

150

100

infectious humans (1s t inf) infectious vectors

population

infectious humans (s econd epidemic)

infectious humans infectious vectors

0. 15

0

x 10

1 0

700

800 time

900

1000

-1 600

700

800 time

900

1000

821

Dengue Fever

Figure 3. Oscillation Number of the infectious humans (s econd epidemic) 0. 3 F irs t infection s econd infection 0. 2

0. 5 infectious humans infectious vectors

population

population

0. 4 0. 3 0. 2

0. 1 0

0. 1 0

0

10

20

30 40 50 60 time Number of the infectious (s econd epidemic)

0. 015

0. 01

0. 005

0

640 660 680 time Number of the -12 infectious humans (s econd epidemic) x 10 1

0

2000

4000 6000 time

8000

620

0

population

population

infectious humans (1s t inf) infectious vectors

-0. 1 600

-1 s econd infection -2 3000 4000 5000 6000 7000 8000 9000 10000 time

10000

Figure 4. The role of vaccination in the eradication of the disease in the first and second epidemic Infectious humans (st epidemic)

Infectious humans (ndepidemic)

0.

0.

ωh=0 population

population

ωh=0.

0.

ωh=.0

0.0 0 -0.0

0.0 0.0 0.0

0

0 -6



ωh=0

0.0

x 0

0 time

0

0 00

0

Infectious humans (ndepidemic st inf)

0 -3



x 0

0

0 time

0

ωh=0.

ωh=0.

population

population

0

Infectious humans (ndepidemic nd inf)

ωh=0. 0

0



ωh=0.





0 -5 00

822

0

0 time

0

0

0 00

0

0 time



0

Dengue Fever

a variable human population and the succession of two epidemics at different intervals of time. The reproductive number R as a threshold of control of the epidemics is discussed through stability analysis. Simulations with different parameters settings give illustration of the succession of two epidemics and their amplitudes. The model shows that environmental management alone as a vector control is not sufficient, it can only delay the outbreak of the epidemics. The eventuality of a vaccine protecting simultaneously against the four serotypes remains a hope for the future. Meanwhile, partial vaccination could be part of a preventive strategy based on the control of environmental and socio-economic factors.

REFERENCES Coleman, P.G., Fèvre, E. M., & Cleaveland, S. (2004). Estimating the public health impact of rabies. Emerging Infectious Diseases, 10(1), 140-142. Derouich, M., Boutayeb, A., & Twizell, E.H. (2003). A model of dengue fever. Biomedical Engineering Online, 2-4. Derouich, M., & Boutayeb, A. (2004). Fièvre dengue: Modélisation et simulation. In Proceeding of the International Symposium on Health and Biomedical Research Interaction, Oujda, Morocco, 41-45, ISBN: 99954-0-0973-6. Derouich, M., & Boutayeb, A. (2004). Dengue fever: Mathematical modelling and computer simulation. Applied Mathematics and Computation, 177, 528-544. Esteva. L., & Vargas, C. (1998). Analysis of a dengue disease transmission model. Mathematical Biosciences, 150(2), 131-151. Esteva. L., & Vargas, C. (1999). A model for dengue disease with variable human population. Journal of Mathematical Biology, 38, 220-240. Esteva. L., & Vargas, C. (2000). Influence of vertical and mechanical transmission on the dynamics of dengue disease. Mathematical Biosciences, 167(1), 51- 64. Esteva. L., & Vargas, C. (2003). Coexistence of different serotypes of dengue virus. Journal of Mathematical Biology, 46, 31- 47. Gubler, D.J. (1997). Dengue and C: Its history and resurgence as a global public health problem. In Gubler DJ and Kuno G (eds.), Dengue and dengue haemorrhagic fever. New York: CAB International, (pp. 1-22). Gubler, D.J. (2002). Epidemic dengue/ dengue haemorrhagic fever as a public health, social and economic problem in the 21st century. TRENDS in microbiology, 10, 100-103. Meltzer, M. I., Rigau-Perez, J. G., Clark, G. G., Reiter, P., & Gubler, D. J. (1998). Using DALY to assess the economic impact of dengue in Puerto Rico: 1984-1994. Am. J. Trop. Med. Hyg, 59, 265-271. Newton, E. A., & Reiter, A. (1992). A model of the transmission of dengue fever with an evaluation of the impact of ultra-low volume (ULV) insecticide applications on dengue epidemics. Am J Trop Med Hyg, 47, 709-720. 823

Dengue Fever

Parkin, D. M., Pisani, P., & Ferlay J. (1999). Global Cancer Statistics. CA Cancer J Clin, 49, 33-64 Report of the Scientific Working Group on Insect Vectors and Human Health. Insect Vectors and Human Health, TDR/SWG/VEC/03.1, Geneva, 2002. Teixeira, M. G., Barretoo, M. L., Costa, M. C. N., Ferreira, L. D. A., Vasconcelos, P. F. C., & Cairncross, S. (2002). Dynamics of dengue virus circulation: A silent epidemic in a complex urban area. Trop. Med. Intern. Health 7, 757-762. WHO. ( 2003). Shaping the future. The World Health Report 2003. WHO, Geneva.

Key Terms Adequate Contact Rate: The average number of contacts between a person and a mosquito. Compartmental Model: A model subdivided into different classes. Dengue: An acute, infectious tropical disease caused by an arbovirus transmitted by mosquitoes, and characterized by high fever, rash, headache. Epidemic: A disease (infection) that is spread (in general by transmission) affecting a large part of the population over a wide area. Immunization: natural or acquired protection against infection. Incidence: The frequency with which a disease appears in a particular population or area in a given period of time. Simulation: The use of a mathematical model to recreate a situation, or to imagine different scenarios with various parameters settings. Stability Analysis: Analysis indicating how a model reacts to perturbations and changes.

824

Section XIII

Data Processing in Histopathology

826

Chapter XLV

Automated Image Analysis Approaches in Histopathology Ross Foley University College Dublin (UCD), Ireland

Laoighse Mulrane University College Dublin (UCD), Ireland

Matthew DiFranco University College Dublin (UCD), Ireland

R. William Watson University College Dublin (UCD), Ireland

Kenneth Bryan University College Dublin (UCD), Ireland

Pádraig Cunningham University College Dublin (UCD), Ireland

Elton Rexhepaj University College Dublin (UCD), Ireland

William M. Gallagher University College Dublin (UCD), Ireland

abstract The field of histopathology has encountered a key transition point with the progressive move towards use of digital slides and automated image analysis approaches. This chapter discusses the various methods and techniques involved in the automation of image analysis in histopathology. Important concepts and techniques are explained in the 5 main areas of workflow within image analysis in histopathology: data acquisition, the digital image, image pre-processing, segmentation, and machine learning. Furthermore, examples of the application of these concepts and techniques in histopathological research are then given.

INTRODUCTION As computing technology advances at a rapid pace worldwide, the impact is starting to be seen in the field of histopathology. Digital imaging offers a wealth of advantages over traditional microscopy

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Automated Image Analysis Approaches in Histopathology

procedures, including storage of image data for later use, automation of image analysis tasks, and the application of novel image processing and machine learning techniques. The development of large-scale image databases opens the door for collaboration amongst remote laboratories by giving concurrent access to the same data. In clinical pathology, this type of collaboration can lead to better consensus in image reading, as well as the potential to develop new training techniques. In systems biology, access to remote image data allows researchers to engage in wide-ranging studies far beyond the constraints of a single lab. Automated image analysis approaches can serve as a valuable aide to clinical pathologists and systems biology researchers in the domain of histopathology. The objectives of automation are to analyse data efficiently, accurately, and reproducibly in high-throughput environments. Appropriate image processing techniques must be employed so as to extract, from images, as much relevant information as possible in as short a time as possible.  This chapter is divided into five main sections which describe the key steps in a digital histopathology environment. The first section deals with data acquisition, including tissue sample preparation, staining, digital slide management, and a brief introduction to tissue microarrays (TMAs). Section two provides an overview of digital image content, including grayscale and colour representations, as well as textural features of images. The third section provides a detailed overview of image pre-processing techniques which are used to prepare image data for analysis. Techniques which are covered include grayscale transformations, contrast enhancement, smoothing and edge detection. Segmentation, the fourth section, deals with the critical process of automatically identifying important image regions. Segmentation topics discussed include thresholding, region-based segmentation, watershed segmentation, template matching, and active contour models. The fifth and final section, Machine Learning, introduces methods of image data analysis, including dimensionality reduction and supervised learning techniques.

DATA ACQUISITION There are a number of crucial steps that take place before a tissue sample can be digitally imaged and subsequently analysed. Artifacts, i.e. anything that interferes with the examination of the tissue, can be introduced during each of these steps that can greatly reduce the quality of the image and, therefore, the accuracy of the image analysis performed later.

Tissue Processing The tissue sample is first removed during surgery, biopsy or autopsy and placed in a fixative, typically formalin, to prevent decay. It is then dehydrated by submerging it in ethanol. The sample is then permeated with paraffin and encased in a paraffin block. If the processes above are not carried out correctly, the paraffin-embedded tissue can become brittle and difficult to work with, which can lead to degraded image quality.

827

Automated Image Analysis Approaches in Histopathology

Tissue Sectioning The paraffin-embedded tissue is now sectioned into slices of between 2 and 8 µm and placed on a glass slide. Many problems found in the images produced later are related to this process. Often the section can warp or fold as it is being cut. Parts of the tissue can also break away from the section. To reduce the warping and folding affects, the tissue section is floated on warm water after it has been cut in a process known as mounting. The thickness of the section dramatically affects the final image and must be considered carefully. If the section is too thick, it will be difficult to automatically identify and process individual cells due to overlaps. On the other hand, if the section is too thin then many of the cells will be missing their nuclei, leading to inaccuracies in automated analysis algorithms which rely on nucleus detection.

Staining/Counterstaining The slide must be stained so that various interesting features of the tissue can be seen. The most commonly used staining in histopathology is Haematoxylin and Eosin (H&E). Haematoxylin pigments acidic structures (nucleus) purplish-blue and Eosin pigments basic structures (cytoplasm) pinkish-red. An H&E stained prostate cancer tissue section is shown in Figure 1 (a). Another important staining method is immunohistochemical staining. In this method, a specific antibody is developed that binds selectively to a specific protein in tissue. The site of this antibody binding is visualised using a coloured marker (Stevens, Lowe & Young, 2002). Various other stainings exist, but a similar set of problems exist for all stains. The slides can be either under or overstained, resulting in images with poor contrast and definition. The strength of the staining can change within one slide and between slides, making it difficult to develop an analysis algorithm that is accurate and transferable between slides. Another glass slide, i.e. coverslip, is attached so that the tissue section lies between the two. Artifacts such as dust or air-bubbles can get trapped between the two slides and greatly degrade the final image.

Digital Microscopy/Scanning The stained slide must now be scanned and stored onto a computer using a digital microscope. The quality of the digital image produced will depend heavily on the microscope itself. There must be uniform lighting on the slide in order to produce a usable image. The microscope must also produce a sharp image suitable for analysis.

Telepathology The growth of digital microscopy means that there are now an enormous number of histopathological images available as digital image files. Each of these files is typically 200 – 700 MB in size. These large file sizes offer their own unique challenges with regard to storage and circulation. The increased bandwidth and reliability of the internet in recent years offers the opportunity to share these images between pathologists in distant geographical locations quickly and at relatively low cost. Having a larger pool of pathologists available to remotely examine digital images can mean improved treatment for patients and also global standardisation of the analysis procedure. Moreover, this vast wealth of image data can be

828

Automated Image Analysis Approaches in Histopathology

Figure 1. Various steps in a watershed segmentation algorithm using (a) an H&E stained prostate tissue sample, including (b) a grayscale representation of the original image, (c) contrast enhancement to reduce noise, (d) edge detection, (e) thresholding to create a binary region map, and (f) the .nal watershed segmentation result.

(a) Original Image

(b) Grayscale Transformation

(c) Contrast Enhancement

(d) Edge Detection

(e) Thresholding

(f) Watershed Segmentation

For a color version of the image, please visit http://www.igi-global.com/daskalaki_ch45.

829

Automated Image Analysis Approaches in Histopathology

utilised to develop more accurate automated image analysis algorithms if it is stored in databases that are easily accessible (Weinstein, Bloom & Rozek, 1987, Weinstein et al, 1997, Kayser et al, 2004).

Annotation In a clinical setting, any algorithm that is created to perform an image analysis task in histopathology must be trained using images annotated by a pathologist. This makes the task of annotation crucially important to the process of automated image analysis. However, the annotation process is highly subjective and studies have shown that inter and intra-observer repeatability is a huge problem (Cross, 2001, Deolekar & Morris, 2003). One of the benefits of the development of automated image analysis approaches is that they can offer objective and consistent results and can, therefore, contribute to further standardisation of annotation practices.

Tissue Microarrays Tissue microarrays (TMAs) allow multiple tissue sections to be analysed on the same slide (Kononen et al, 1998, Brennan et al, 2007, Mulrane et al, 2007). Regions of interest (or sometimes arbitrary regions) are identified in different tissue samples. Circular cores of between 0.6 and 2mm diameter are then removed from these regions of their original paraffin block and collected as an ordered array in a new paraffin block as shown in Figure 2 (a). Up to one thousand cores can be placed in a block, albeit the convention is to use several hundred specimens as a maximum Such TMAs can be processed as

Figure 2. An example TMA. (a) TMA containing H&E stained rat liver tissue cores. (b) Close up of one TMA core.

830

Automated Image Analysis Approaches in Histopathology

with standard full face sections (see above), and image analysis can be performed on a large number of cores simultaneously. TMAs have received a lot of attention in recent years as they are well suited to a high-throughput environment and become extremely powerful when combined with automated image analysis techniques. Studies involving large numbers of tissue samples can be performed using relatively few slides. For example, Brennan et al. (2008) used automated image analysis techniques on TMAs to investigate surviving protein expression as a prognostic indicator of breast cancer.

THE DIGITAL IMAGE An image is stored digitally as an array or matrix of pixels, each pixel representing light intensity at a particular point in the image. The quality of the image is determined by the number of pixels used to store the image, i.e. the length and width of the array, and also the number of quantization levels used to measure the light intensity. All further analysis is performed on this array of pixels (Sonka, Hlavac & Boyle, 1999).

Brightness/Grayscale The simplest representation of an image is its grayscale representation. Each pixel has only one value associated with it corresponding to the brightness of the light at that point. The image is displayed as varying shades of gray from black, at the lowest brightness, to white, at the highest. Figure 1 (b) shows a grayscale representation of an H&E stained prostate tissue section.

Colour Colour is a property of enormous importance in the analysis of histopathological images. Image analysis using grayscale alone requires high-intensity staining and good contrast between objects and background. Different tissue structures often stain in different colours and, therefore, colour information is necessary in order to analyse these slide stainings correctly. The interpretation of colour is highly subjective and there are, therefore, numerous different ways to represent colour. Some are generic and open source while others are commercially owned and controlled. This section focuses on three important, generic, representations used in histopathology, RGB, CMYK and HSV.

RGB Colour Space In a standard RGB colour image, each pixel is represented by a 3D vector value corresponding to the intensity of red, green and blue light at that point. Black is represented by the vector (0, 0, 0) and white by the vector (n, n, n), where n is the number of light intensity quantization levels (usually 256). The RGB model is described as an additive model because the three primary colours are added together to create white. All other colours are represented by a mixture of these three primary colours. The addition of the primary colours in RGB is shown in Figure 3 (a).

831

Automated Image Analysis Approaches in Histopathology

CMYK Colour Space A colour space that has proved useful in histopathology is the CMYK which represents each pixel in terms of the secondary colours. The secondary colours are those which comprise two of the primary colours, namely cyan, magenta and yellow. This colour space is described as a subtractive model because each of these secondary colours, mentioned above, can be used to subtract one of the primary colours from white light. The K in the model title stands for key or black to signify that subtraction of all three secondary colours yields black. The subtraction of the secondary colours in CMYK is shown Figure 3. Different colour models. (a) Red Green Blue (RGB) is an additive colour model. The three primary colours are added together to form other colours. (b) Cyan Magenta Yellow Key (CMYK) is a subtractive colour model because the three secondary colours are subtracted from white to form other colours. (c) Conical representation of the Hue Saturation Value (HSV) colour model. HSV models human perception of colour differences more accurately. As colours approach black on the value (light intensity) scale, there are less saturation and hue levels available.

(a) RGB Colour Model (additive)

(b) CMYK Colour Model (subtractive)

(c) HSV Colour Model

For a color version of the image, please visit http://www.igi-global.com/daskalaki_ch45.

832

Automated Image Analysis Approaches in Histopathology

in Figure 3 (b). Pham et al. (2007) showed that the yellow channel in the CMYK model offers a large contrast between immunohistochemical staining and counterstaining intensities and, therefore, a greater sensitivity when compared with other colour schemes.

HSV Colour Space The RGB and CMYK colour spaces do not match the human perception of colour differences. Often in the analysis of histopathology images, the colours are transformed to a different, more intuitive colour space. The HSV colour space represents each pixel by its Hue – its perceived colour, Saturation – its saturation with white light (dark or light colour) and Value – the intensity of the light. The hue and saturation together represent colour in a similar manner to human perception (Sonka, Hlavac & Boyle, 1999). Another advantage of the HSV colour space is that it is highly resistant to illumination changes (Mete et al, 2007). A conical representation of the HSV colour space can be seen in Figure 3 (c).

Texture A powerful property that can be used to describe and segment a region is its textural properties. There is no precise definition of texture due to the abstract nature of the concept but a major characteristic that is accepted is the repetition of a group or a number of groups of pixels throughout a region. These groups of pixels are referred to as texture primitives or texels. The texture of a region depends on the number and size of these texels (Haralick, 1979). Texture is generally described in three ways; statistically, structurally and spectrally (Gonzalez and Woods, 1992). We usually describe texture as fine, course, rough, smooth, etc. These are statistical descriptions but are too ambiguous and are, therefore, not sufficient for the purpose of segmentation. Structural and spectral properties are used to improve the textural description. Structural properties deal with the arrangement of and relationships between texture elements. Spectral properties deal with intensity and colour properties of the texture elements. The focus in histopathology has been on structural texture properties, which have been used to locate diagnostically useful areas (Hamilton et al, 1997), distinguish between normal and cancerous tissue (Esgiar et al, 1998), and classify various grades of tumour (Gilles et al, 1994).

IMAGE PRE-PROCESSING Image pre-processing encompasses a range of techniques, performed at the pixel level, used to facilitate more accurate further analysis of the image. It should be noted that these techniques do not increase the amount of information in the image but reduce it. However, they are used to remove redundant information from the image and enhance image features that are interesting. Image pre-processing can, therefore, be vital to the image analysis process.

Gray-Scale Transformations Frequently in histopathology, the intensity of the staining is critical and the colour is supplementary. In these cases, a grayscale transformation is performed which maps the colour image onto a grayscale equivalent (Figure 1 (b)). This reduces the complexity of the analysis from three dimensions to one.

833

Automated Image Analysis Approaches in Histopathology

Different transformation functions can be used so that, for example, the negative grayscale image is produced. One transformation function that is widely used in histopathology is histogram equalisation. Histogram equalisation allows interesting ranges of intensities to be enhanced while other, less interesting, ranges are impaired. The use of histogram equalisation for contrast enhancement is shown in Figure 1 (c). Boudraa et al. (2000) used histogram equalization to increase the contrast between cerebrospinal fluid and multiple sclerosis lesions. Grayscale transformations can reveal morphological details within the tissue that may not be visible in the original image (Levenson & Hoyt, 2000).

Smoothing Filters Any image taken using a digital microscope will contain some level of noise. A smoothing filter is used to reduce this noise. In its simplest form, this is achieved by assigning a new value to each pixel, the average of the brightness values of all the pixels within a defined distance of the original pixel. The original pixel is sometimes given a higher weight in this averaging process so that it better approximates the properties of Gaussian noise. One of the drawbacks of this kind of smoothing is that it causes a blurring of edges and sharp objects. One way of avoiding this blurring is to apply a median filter which operates in much the same way except the pixel is assigned the median value of all the other pixels (Tyan, 1981). Jadhav et al. (2006) used median filtering as a pre-processing technique in the analysis of precancerous lesions. Other, more intelligent smoothing algorithms exist which combine edge detection (discussed later) with filtering to prevent edges from becoming blurred.

Position-Dependent Brightness Correction A degrading affect that is often seen in histopathology is uneven illumination, especially at the peripheries: this is called vignetting. Vignetting should be corrected before any analysis is performed on the image. One solution is to image an empty space and use the illumination in this image as a correction filter. However, a more desirable correction would not require the second white space image. Leoung, Brady and McGee (2003) proposed a correction technique that uses illumination features available in the original images. A Gaussian smoothing filter is used to blur the image so that only the brightness of local regions in the image remains. This filtered version of the image can then be used as the correction filter.

Edge Detection One of the major challenges in the analysis of histopathology images is the segmentation of nuclei. Once the nuclei have been segmented properly, various attributes of the nuclei and cells can be quantified and utilized in a more in-depth analysis. An edge, in an image analysis point of view, is defined as pixels where the brightness changes abruptly (Sonka, Hlavac & Boyle, 1999). This is generally the case between nuclei and cytoplasm, where the staining will abruptly change from dark blue to pink. Changes are described in calculus using derivatives. Using calculus, we can find the pixels where the most abrupt changes occur and define these as the edges. At these pixels, the first derivative will be a maximum (as these are the points of maximum change in brightness) and the second derivative will, therefore, be zero. In practice, it is easier and more precise to measure a zero crossing than a maximum so the second derivative is used (Marr & Hildreth, 1980). The use of a derivative-based edge detection algorithm to

834

Automated Image Analysis Approaches in Histopathology

discover nuclei borders is shown in Figure 1 (d). Keenan et al. (2000) used edge detection techniques in the segmentation of nuclei for the purposes of grading cervical intraepithelial neoplasia (CIN).

SEGMENTATION In practice, treating an image as a large matrix of pixels is not very useful. Therefore, it is desirable to employ segmentation, the name given to the process performed by a group of techniques which transforms this pixel level representation of the image into larger objects which better reflect the actual content of the image. In histopathology, a segmented image could contain cell cytoplasm objects, cell nuclei objects, white space objects, vacuole objects, etc. In such complicated scenes, complete segmentation into the real-world objects contained in the image is generally not achievable by one segmentation process. A series of partial segmentations and post-processing is used to achieve complete segmentation. The choice of segmentation method(s) depends on the properties of the image.

Thresholding A fundamental and extremely useful technique which is widely used in the segmentation of histopathological images is thresholding. The simplest form is grayscale thresholding. This assumes that an object and its background can be distinguished from the background based on its grayscale values. A threshold is set on the grayscale and each pixel is assigned to one of two classes depending on whether its grayscale value is above or below this threshold. Figure 1 (e) shows the results of grayscale thresholding on an H&E stained prostate image for the purposes of nuclear segmentation. Grayscale thresholding was used effectively by Goldlust et al. (1996), Beier and Fahimi (1992), and Francis et al. (2000). Thresholding can also be performed using the different colour channels or using mathematical combinations of the colour channels, for example, the red channel divided by the blue channel. Colour thresholding is useful in histopathology as the nature of H&E staining means that nuclei are heavily expressed in the blue channel and cytoplasm in the red channel. The feature and the threshold value are chosen based on the spectral (colour) properties of the regions being segmented. Colour thresholding techniques were used by Sharipo et al. (1990), Lehr et al. (1997) and Lehr et al. (1999). Thresholding is easy to implement and offers good results when two regions do not overlap. However, the threshold requires calibration which can affect an analysis algorithm when transferred to other images. Moreover, there are usually at least some overlapping nuclei in histopathological images. These cannot be segmented using thresholding so more complicated post-processing techniques must be employed.

Region-Based Segmentation Region-based segmentation methods are extremely important in image processing. They are used to construct regions directly rather than by detecting edges and boundaries. Regions can be created with very specific properties. Some of the most common region-based segmentation techniques are described in this section.

835

Automated Image Analysis Approaches in Histopathology

Region Splitting Quadtree segmentation is a partial segmentation technique suited to heterogeneous images where some areas of the image contain much more detail and information than others. Many types of histopathological images have this property as large areas of the tissue sample can be white space while others can contain minute sub-cellular details. Quadtree segmentation is a top down (or splitting) technique that begins with large square regions, as few as is possible to cover the entire image, which are continuously split into their four constituent square regions of equal size until some condition of homogeneity is satisfied for all regions. This has the effect of segmenting the image into large square regions in areas of low detail and very small square regions in areas of high detail. The homogeneity condition can be based on grayscale intensity, colour, texture, shape, some higher level symantic model, etc (Haralick and Shapiro, 1985, Zamperoni, 1986, Grimson and Lozano-Perez, 1987, Pal and Pal, 1987, Adams and Bischof, 1994, Chang and Li, 1994, Chang and Li, 1995, Kurita, 1995, Baraldi and Parmiggiani, 1996). The properties chosen for this homogeneity condition will affect the nature of the regions produced. For example, an image that is segmented based on a shape condition such as circularity will contain

Figure 4. Quadtree segmentation of an H&E stained prostate tissue section. Homogenous regions are segmented into large squares whereas more detailed regions are broken up into smaller squares.

836

Automated Image Analysis Approaches in Histopathology

very different regions from the same image segmented based on some intensity condition. The result of a quadtree segmentation on an H&E stained prostate cancer tissue sample is shown in Figure 4. A relatively relaxed grayscale intensity homogeneity condition was used so quite large variance in intensity is permitted within each region.

Region Merging The simplest region merging (or growing) technique treats every pixel as an individual region to begin with. Regions are then repeatedly merged together based, once again, on some homogeneity condition. This process yields very good results as the regions left when the process has completed are not rigid squares but unbounded organic shapes that better represented the form of the objects within the image. However, this technique is highly computationally expensive as often there are a large number of competing regions that satisfy the merging condition with a large number of other regions. A huge number of decisions must be made on which regions to merge. Another possible drawback of this merging technique is that it will yield different objects when it is carried out a number of times. The final segmentation depends on where in the image the initial merging operation takes place. Ong, Giam and Sinniah (1993) used a region growing technique in the detection of membrane structures in kidney electron micrographs. Seeded region growing is a directed region growing technique which is very effective but usually requires some prior knowledge concerning the properties of the regions being segmented. It relies on picking suitable seed pixels and growing regions from these seeds. tenKate et al. (1993) used seeded region growing for counting mitoses in breast cancer tissue sections. It was known that mitoses were dark regions, so dark pixels were selected as seed pixels for the region growing process.

Split-and-Merge Techniques An approach that combines both merging and quadtree splitting can yield results with the advantages of both techniques (Horowitz and Pavlidis, 1974, Pavlidis, 1977). A compromise initial segmentation can be used that lies somewhere between complete segmentation to the pixel level in the merging technique and very little segmentation in the splitting technique. The regions can then be continuously split or merged until some homogeneity condition is maintained for all regions (Chen et al. 1991). This combinational technique saves an enormous amount of processing power and delivers excellent segmentation results.

Watershed Segmentation In watershed segmentation, the image is treated as a topographical image where each pixels grayscale value is analogous to altitude in a geographical image. If we consider the image in this way, the process of watershed segmentation is the equivalent of flooding the image iteratively up the grayscale. New local minima, or catchment basins (think of them as valleys on a geographical map), are marked when the rising grayscale level reaches their intensity values. Each new catchment basin is deemed to be a new region. As the grayscale level rises, these regions are gradually grown outwards from these catchment basins. As the grayscale level continues to rise, lines along which two regions merge are called watersheds (think of these as hills being submerged) and these mark the boundaries between different regions (Vincent and Soille, 1991). This technique has the advantage of being able to separate between overlapping regions

837

Automated Image Analysis Approaches in Histopathology

with similar grayscale values. It can be used to successfully segment overlapping nuclei from each other in histological images. Watershed segmentation requires a high level of computational power and has become more popular in recent years with the advances in computer processing technology. Law et al. (2003) successfully used this algorithm to segment immunohistochemically stained tissue sections. The nuclear segmentation resulting from a watershed algorithm is shown in Figure 1 (f).

Template Matching Template matching is a segmentation technique that gives a measure of how similar two images are, also called the registration of two images with each other. This is useful in cases where a large image contains a smaller image or a repeating pattern of a smaller image. Histopathological images contain many repeating cellular and sub-cellular structures which can be identified in this manner. The smaller image is used as a template which is passed over the larger image and at each point a correlation function is performed based on some matching criteria. Regions where the result of this function is high are deemed to match the template image. This method of matching has not been heavily used in histology up to now. This may be due to the large variation in shape and size that cellular structures can have. Choosing general templates is extremely difficult (Loukas and Linney, 2003).

Active Contour Models - Snakes A group of template matching methods that have received attention in histopathology are the active contour models or snakes (Kass, Witkin & Terzopoulos, 1987). An active contour (snake) can be considered as an adaptive spline that warps so that it matches regions within the image with predefined desired attributes. It does this using an energy minimization technique. The snake’s energy depends on its shape and location within the image. Each desired property has an energy function that contributes to the overall energy of the snake. Local minima of the snake’s energy correspond to desired properties of the region to be matched. Fok, et al. (1996) used active contour models to segment nerve cells. It should be noted that snakes are highly affected by their initial position so care should be taken in their initialization.

MACHINE LEARNING Machine learning is an area of computer science concerned with the organization or classification of data based on a number of features extracted from the data. Machine learning techniques are widely used in histopathology. The goal of image analysis is often to gain some understanding of the image as a whole. A major step towards achieving this image understanding is the recognition of individual objects within the image. Machine learning approaches aim to classify different segmented regions as different cellular and tissue objects. In order to classify or organize the data a measure of similarity between regions must be computable. Each region is represented by the features extracted from it. These features can be colour, texture, shape, etc. The values of these features are stored in a vector for each region. If we consider each feature as a dimension in a multi-dimensional graph, or feature space, then each region’s feature vector represents one point in this space. How close two points are to each other in this space indicates how similar the corresponding regions are to each other. Machine learning

838

Automated Image Analysis Approaches in Histopathology

techniques are employed to either cluster the points in the most appropriate fashion or to discriminate between different classes of points, based on their position in this space. It is clear that the features used in the machine learning process are crucial and must be selected carefully. Figure 5 (a) & (b) show regions defined by two features, the average grayscale value of the region and the roundness of the region, plotted as points in a 2D feature space. These regions have a feature vector of size two.

Dimension Reduction The “curse of dimensionality” is a phrase that is commonly used in machine learning. Hundreds, if not thousands of different colour, texture, shape and other higher level features can be extracted from histopathological images using techniques described earlier. When data objects that are the subject of analysis using machine learning techniques are described by a large number of features (i.e. the data is high dimension) it is often beneficial to reduce the dimension of the data. Dimension reduction can be beneficial not only for reasons of computational efficiency but also because it can improve the accuracy of the analysis. One reason for this is the fact that objects appear more similar to each other in higher dimension. Another reason is that often, especially in image analysis, two or more features are highly correlated with each other and there is no benefit in using all of these features in the machine learning process. In fact, use of redundant features will usually reduce accuracy as they constitute noise.

Feature Selection One of the main methods for achieving dimension reduction is to perform a feature selection operation, for instance by ranking features using information gain, prior to the analysis. Entropy is a measure of randomness or disorder in a system. Information gain calculates how predictive a feature is for an outcome, and therefore how useful a feature is, by measuring the reduction in the entropy of a data system after sorting the data on that feature. If a feature is highly predictive of the outcome, then sorting on that feature will cause a large reduction of the entropy in the system and therefore a large information gain. Finding the information gain for each feature separately does not solve the problem of correlated features. A wrapped filter deals with this by calculating the information gain for a set of features. It starts with the feature with the highest information gain. It then adds some of the features with the next highest information gain separately and tests how they perform with the first feature. The best of these features is chosen. Features are continually added to the filter until the most predictive feature set is obtained (Witten & Frank, 2005). Jelonek and Stefanowski (1997) used the wrapped filter model to choose an optimal feature subset for the classification of tumours in the central nervous system.

Feature Transformation Another type of dimension reduction is feature transformation. These techniques transform the feature set to a completely different feature set of lower dimensionality. They do this through a series of matrix operations. Principal Component Analysis (PCA) transforms the feature set into a new feature set whose dimensions map to variance in the data. The idea is to capture the majority of the variance in as few of the dimensions as possible. Once this mapping is completed the new dimensions that capture the least variance can be removed. PCA works well when input features are correlated with each other.

839

Automated Image Analysis Approaches in Histopathology

If features are correlated, most of the variance can be captured in fewer dimensions. The resulting features are not correlated. Performing PCA is equivalent to carrying out Singular Value Decomposition (SVD) on a matrix (Jolliffe, 1986, Duda, Hart & Stork, 2001). However, PCA is not necessarily good for discrimination in classification. Linear Discriminant Analysis (LDA) seeks to find a transformation that maximises the between-class variance and minimises the within-class variance. This results in a feature set of fewer dimensions that discriminates well between the classes (Klecka, 1980). Both LDA and PCA were used by Decaestecker et al. (1997).

Supervision in Machine Learning The most fundamental distinction in Machine Learning is that between supervised and unsupervised techniques. The defining characteristic of supervised learning is the availability of annotated training data. The name invokes the idea of a ’supervisor’ that instructs the learning system on the labels to associate with training examples. Typically these labels are class labels in classification problems. Supervised Learning algorithms induce models from these training data and these models can be used to classify other unlabelled data (Cord and Cunningham, 2008). In order to classify unlabelled samples, the classes of the labeled samples must be separated by some boundary (boundaries) in the feature space. Unlabelled samples that reside close to this (these) boundary (boundaries) are the most difficult samples to label. Unsupervised learning lacks external guidance in the form of labels; thus the process of building a model from the data is more difficult. Often all that can be done is to cluster or organise the data in some way. Labelled training data is available in the vast majority of histopatholigical image analysis problems due to the fact that the objective is usually to automate the classification of already known tissue structures and pathologies rather than trying to discover novel patterns in the image data. As a result, supervised techniques dominate in the area so only these are discussed here.

K - Nearest Neighbour Perhaps the most straightforward classifier available in machine learning and one that is widely used in image analysis is the K - nearest neighbour classifier (KNN). Classification is achieved by identifying the nearest neighbours to a query example and using those neighbours to determine the class of the query. How “near” a neighbour is depends on its feature values. K denotes the number of nearest neighbours that are used in the classification process. The neighbours are generally weighted such that nearer neighbours have more influence on the classification than more distant ones. The distance between samples is usually taken as the Euclidian distance but other measures such as Manhattan or Mahalanobis distances can also be used. The nearest neighbour classifier is described as a lazy technique because it requires all of the training samples to be available at run-time. This limits the number of neighbours that can be used to classify unlabelled data due to processing problems (Cover and Hart, 1967). Figure 5 (a) shows a 3-nearest neighbour classifying unlabelled regions of tissue as either normal or diseased based on two features. Esgiar et al. (1998) used a KNN model to distinguish between and classify normal and cancerous colonic mucosa.

Support Vector Machines Support Vector Machines (SVMs) are an extremely powerful group of supervised learning techniques. SVMs are described as eager techniques because they build a classification model during a training 840

Automated Image Analysis Approaches in Histopathology

Figure 5. Different classifiers employed to classify image regions in a 2D feature space as either normal or diseased. (a) K-nearest neighbour classifier using 3 nearest neighbours to classify unlabelled data. (b) Support Vector Machine (SVM) model. The support vectors in each class are shown as circled points on the dotted black circles and are used to define the maximum margin decision boundary (continuous black circle). The two classes are not linearly seperable in this 2D feature space. (c) SVM, using the kernel trick, projects the data into a 3D feature space where the classes are linearly separable by a hyper-plane. This SVM uses a quadratic kernel. The resulting dimensions are a quadratic combination of the 2D ones.

(a) K-Nearest Neighbour (b) SVM: Maximum Margin

(c) SVM: Projection

stage prior to run-time. Only the points that lie close to the neighbouring class are used in classification and these so called support vectors are selected to define a decision boundary of maximum margin. In other words, the support vectors define a boundary between the classes that achieves optimum separation of the classes (Figure 5 (b)). Only using a small number of points to define this boundary makes SVM algorithms very efficient and prevents the model from overfitting the training data. Another major advantage of SVMs is that they allow the separation of non-linearly separable classes (Figure 5 (b)) through the use of a process known as the kernel trick. The kernel trick projects the data into a higher dimensional space where the classes are linearly separable (Figure 5 (c)) (Burges, 1998. Vapnik, 1995).

841

Automated Image Analysis Approaches in Histopathology

Doyle et al. (2007) used SVMs to classify the different Gleason grades of prostate cancer while Glotos et al. (2005) used them in grade diagnosis of brain tumour astrocytomas.

Neural Networks Artificial Neural Networks (ANNs) were originally introduced as models of biological neuronal networks in which nodes corresponded to neurons and connections between them to synapses (McCulloch and Pitts, 1943). However they are rarely used for this purpose anymore. They are generally used as an eager supervised learning technique. All neural networks are based on the fundamental idea of a node. A node has a variable number of weighted inputs which it combines together with a bias term to produce one binary output. A feed-forward neural network (FFNN) is made up of cascades of these nodes that can be trained to perform complex non-linear classification. The weights on the inputs and the bias are continuously updated for each node throughout the training process so that the overall system classifies the training data correctly. Furthermore, with the correct architecture, neural networks can be configured in such a way that they will select their own feature set for classification by self-organisation during the training process (Looney, 1997). It should be noted that ANNs are somewhat prone to overfitting the training dataset. Karakitsos (1998) used ANNs to classify benign and malignant gastric cells. Sjostrom, Frydel and Wahlberg (1999) used ANNs to automatically segment cell structures for the purpose of cell counting.

Ensembles Condorcet’s jury theorem (1785) states, that the probability of a group of people making a correct decision is greater than that of an individual. It also states, that as the size of the group increases this probability also increases. However, this theorem is only true if the new members add diversity to the group. Diversity implies that each member of the group is specialised in some way regarding the subject being deliberated over. This notion of diversity is incorporated into ensemble methods. Ensembles use the results of a number of different classifiers to classify data. Each classifier is chosen or designed so that it specialises in correctly classifying one section of the data. The ensemble selects a class for the unlabelled data based on a majority voting scheme by a group of classifiers. Ensembles exploit the specialities of individual classifiers while also minimising the effect of the limitations of individual classifiers on the classification (Sharkey et al, 2000). Two different methods that are used to achieve diversity in an ensemble are bagging and boosting. Bagging ensemble techniques use a different random subset of the training examples to train each classifier. As a result, the classifiers specialise in classifying their subset of the training data. Bagging can be considered as a parallel ensemble technique because all ensemble members can be trained in parallel (Breiman, 1996). Boosting, on the other hand, can be considered as a serial ensemble technique because each ensemble member uses the output of the previous member to create the new overall classifier. Training data samples that were incorrectly classified in the previous ensemble member are weighted so that they have a greater influence in the new member. In this way, the ensemble members specialise on the data that was classified incorrectly by the previous members (Freund & Schapire, 1995). Doyle et al. (2006) used a boosting ensemble in the detection of prostate cancer. Daskalakis et al. (2007) used a majority voting scheme ensemble to discriminate between benign and malignant thyroid nodules.

842

Automated Image Analysis Approaches in Histopathology

Conclusion The future of image analysis in histopathology lies firmly in the digital domain. This chapter has discussed some of the most important techniques and given examples of their use in the area up to now. Many of the earlier stages of analysis such as pre-processing and segmentation techniques have reached maturity. Although some progress will undoubtedly be made in these areas over the next five years, the vast majority of research will be focused on the more complicated task of using machine learning to achieve higher level image understanding. Machine learning is being applied to histopatholgical image analysis problems of ever increasing complexity. The high levels of processing power and the advanced set of processing and analysis techniques available to researchers today make complete and automated image analysis achievable.

Acknowledgment WG, ER and LM would like to acknowledge the support of the Marie Curie Transfer of Knowledge Industry-Academia Partnership Programme, Target-Breast (www.targetbreast.com), the Health Research Board under the auspices of the Programme Grant “Breast Cancer Metastasis: Biomarkers and Functional Mediators”, and the EU Integrated Project, InnoMed, under the PredTox component of this programme (www.innomed-predtox.com). PC, RF, MdiF and KB would like to acknowledge the support of IRCSET and SFI.

References Adams, R., Bischof, L. (1994), Seeded region growing. IEEE Transactions on Pattern Analysis and Machine Intelligence, 16, 641-647. Baraldi, A., & Parmiggiani, F. (1996). Single linkage region growing algorithms based on the vector degree of match. IEEE Transactions on Geoscience and Remote Sensing, 34, 137-148. Beier, K., & Fahimi, H. D., (1992). Application of automated image analysis for quantitative morphological studies of peroxisomes in rat liver in conjunction with cytochemical staining with 3-3’-diaminobenzidine and immunocytochemistry. Microscopy Research and Technique, 21, 271-282. Boudraa, A., Dehak, S.M.R., Zhu, Y., Pachai, C., Boa, Y., & Grimaud, J. (2000). Automated segmentation of multiple sclerosis lesions in multispectral MR imaging using fuzzy clustering. Computers in Biology and Medicine, 30(1), 23-40. Breiman, L. (1996). Bagging predictors. Machine Learning, 24(2), 123-140. Brennan, D. J., Kelly, C., Rexhepaj, E., Dervan, P. A., Duffy, M. J., & Gallagher, W. M. (2007). Contribution of DNA and tissue microarray technology to the identification and validation of biomarkers and personalised medicine in breast cancer. Cancer, Genomics and Proteomics, 4, 121-134.

843

Automated Image Analysis Approaches in Histopathology

Brennan, D. J., Rexhepaj, E., O’Brien, S. L., Mc Sherry, E., O’Connor, D. P., Fagan, A., Culhane, A. C., Higgins, D. G., Jirstom, K., Millikan, R. C., Landberg, G., Duffy, M. J., Hewitt, S. M., & Gallagher, W. M. (2008). Altered cytoplasmic-to-nuclear ratio of surviving is a prognostic indicator in breast cancer, [in press] Clinical Cancer Research, 14(9). Burges, C. J. C. (1998). A tutorial on support vector machines for pattern recognition. Data Mining and Knowledge Discovery, 2(2), 121-167. Chang, Y. L., & Li, X. (1994). Adaptive image region growing. IEEE Transactions on Image Processing, 3, 868-872. Chang, Y. L., & Li, X. (1995). Fast image region growing. Image and Vision Computing, 13, 559-571. Chen, S.Y., Lin, W. C., & Chen C. T. (1991). Split-and-merge image segmentation based on localized feature analysis and statistical tests. Computer Vision, Graphics, and Image Processing – Graphical Models and Image Processing, 22(5), 457-475. Condorcet, M., (1785). Essay on the application of analysis to the probability of majority decisions. Cord, M., & Cunningham., P. (2008). Machine learning techniques for multimedia. Springer, Verlag Berlin Heidelberg. Cover, T., & Hart, P. (1967). Nearest neighbour pattern classification. IEEE Transactions on Information Theory, 13(1), 21-27. Cross, S. S., (2001). Observer accuracy in estimating proportions in images: implications for the semiquantitative assessment of staining reactions and a proposal for a new system. Journal of Clinical Pathology, 54(5), 385-390. Daskalakis, A., Kostopoulos, S., Spyridonos, P., Glotsos, D., Ravazoula, P., Kardari, M., Kalatzis, I., Cavouras, D., & Nikiforidis, G. (2007). Design of a multi-classifier system for discriminating benign from malignant thyroid nodules using routinely H&E-stained cytological images. Computers in Biology and Medicine, 38(2), 196-203. Decaestecker, C., Lopes, B. S., Gardower, L., Camby, I., Cras, P., Martin, J J., Kiss, R., VandenBerg, S .R., & Salmon, I. (1997). Quantitative chromatin description in Feulgen-stained nuclei as a diagnostic tool to characterize the oligodendrogial and astrogial components in mixed oligo-astrocytomas. Journal of Neuropathology and Experimental Neurology, 56(4), 391-402. Deolekar, M., & Morris, J. A. (2003). How accurate are subjective judgements of a continuum? Histopathology, 42(3), 227-232. Doyle, S., Hwang, M., Shah, K., Madabhushi, A., Feldman, M., & Tomaszeweski, J. (2007). Automated grading of prostate cancer using architectural and textural image features. 4th IEEE International Symposium on Biomedical Imaging: From Nano to Macro. (pp 1284-1287). Doyle, S., Madabhushi, A., Feldman, M., & Tomaszeski, J. (2006). A boosting cascade for automated detection of prostate cancer from digitized histology. Medical Imaging Computing and Computer-Assisted Intervention, 4191, 504-511.

844

Automated Image Analysis Approaches in Histopathology

Esgiar, A. N., Naguib, R. N. G., Sharif, B. S., Bennett, M. K., & Murray, A. (1998). Microscopic image analysis for quantitative measurement and feature identification of normal and cancerous colonic mucosa. IEEE Transactions on Information Technology in Biomedicine, 2, 197-203. Fok, Y. L., Chan, J. C. K., & Chin, R. T. (1996). Automated analysis of nerve-cell using active contour models. IEEE Transactions on Medical Imaging, 15, 353-368. Francis, I. M., Adeyanju, M. O., George, S. S., Junaid, T. A., & Luthra, U. K. (2000). Manual versus image analysis estimation of PCNA in breast carcinoma. Analytical and Quantitative Cytology and Histology, 22, 11-16. Freund, Y., & Schapire, R. E., (1995). A decision-theoretic generalization of on-line learning and an application to boosting. The Proceedings of the Second European Conference on Computational Learning Theory, Barcelona, ESP. Gilles, F., Gentile, A., Le Doussal, V., Bertrand,. F., & Kahn, E. (1994). Use of texture parameters in the classification of soft tissue tumours. Analytical and Quantitative Cytology and Histology, 16, 95-100. Glotsos, D., Spyridonos, P., Cavouras, D., Ravazoula, P., Dadioti, P., Arapantoni, P., & Nikiforidis, G. (2005). An image-analysis system based on support vector machines for automatic grade diagnosis of brain-tumour astrocytomas in clinical routine. Medical Informatics and the Internet in Medicine, 30, 3, 179-193. Goldlust, E. J., Paczynski, R. P., He, Y. Y., Hsu, C. Y., & Goldberg, M. P. (1996). Automated measurement of infract size with stained images of triphenyltetrazolium chloride-stained rat brains. Stroke, 27, 1657-1662. Gonzalez, R. C. A., & Woods, R. E. (1992). Digital image processing. Reading, MA: Addison-Wesley. Grimson, W. E. L., & Lozano-Perez, T. (1987). Localizing overlapping parts by searching the interpretation tree. IEEE Transactions on Pattern Analysis and Machine Intelligence, 9, 4, 469-482. Hamilton, P. W., Bartels, P. H., Thompson, D., Anderson, N. H., Montironi, R., & Sloan, J. M. (1997). Automated detection of dysplastic fields in colorectal histology using image texture analysis. Journal of Pathology, 182, 68-75. Haralick, R. M. (1979). Statistical and structural approaches to texture. Proceedings IEEE, 67(5), 786804. Haralick, R. M., & Shapiro, L. G. (1985). Image segmentation techniques. Computer Vision, Graphics, and Image Processing, 29, 100-132. Horowitz, S. L., & Pavlidis, T. (1974). Picture segmentation by a directed split-and-merge procedure. Proceedings of the 2nd International Joint Conference on Pattern Recognition, Copenhagen, Denmark. (pp. 424-433). Jadhav, A. S., Banerjee, S., Dutta, P. K., Paul, R. R., Pal, M., Banerjee, P., Chaudhuri, K., & Chatterjee, J. (2006). Q¬uantitative analysis of histopathological features of precancerous lesion and condition using image processing technique. Proceedings of the 19th IEEE Symposium on Computer-Based Medical Systems. (pp. 231-236). 845

Automated Image Analysis Approaches in Histopathology

Jelonek, J., & Stefanowski, J. (1997). Feature subset selection for classification of histological images. Artificial Intelligence in Medicine, 9, 227-239. Jolliffe, I. T. (1986). Principal component analysis. New York: Springer-Verlag. Kass, M., Witkin, A., & Terzopoulos, D. (1987). Snakes: Active contour models. Proceedings of 1st International Conference on Computer Vision, London, UK. (pp. 259-268). Kayser, K., Kayser, G., Radziszowski, D., & Oehmann, A. (2004). New developments in digital pathology: From telepathology to virtual pathology lab. Studies in Health Technology and Informatics, 105, 61-69. Keenan, S. J., Diamond, J., McCluggage, W. G., Bharucha, H., Thompson, D., Bartels, P. H., & Hamilton, P W. (2000). An automated machine vision system for the histological grading of cervical intraepithelial neoplasia (CIN). Journal of Pathology, 192(3), 351-362. Klecka, W. R. (1980). Discriminant analysis. CA, USA: Sage Publications. Kurita, T. (1995). An efficient clustering algorithm for region merging. The Institute of Electronics. Information and Communication Engineers Transactions on Information and Systems, 78-D, 1546-1551. Law, A. K. W., Lam, K. Y., Lam, F. K., Wong, T. K. W., Poon, J. L. S., & Chan, F. H. Y. (2003). Image analysis system for assessment of immunohistochemically stained proliferative marker (MIB-1) in oesophageal squamous cell carcinoma. Computer Methods and Programs in Biomedicine, 70, 37-45. Lehr, H. A., Mankoff, D. A., Corwin, D., Santeusanio, G., & Gown, A. M., (1997). Application of photoshop-based analysis to quantification of hormone receptor expression in breast cancer. Journal of Histochemistry and Cytochemistry, 45, 1559-1565. Lehr, H. A., Van der Loos, C. M., Teeling, P., & Gown, A. M., (1999). Complete cromogen separation and analysis in double immunohistochemical stains using photoshop-based image analysis. Journal of Histochemistry and Cytochemistry, 47, 199-225. Leoung, F. J. W., Brady, M., & McGee, J. O. (2003). Correction of uneven illumination (vignetting) in digital microscopy images. Journal of Clinical Pathology, 56, 619-621. Levenson, R. M., & Hoyt, C. C. (2000). Spectral imaging and microscopy. American Laboratory, 32(22), 26-33. Looney, C. G. (1997). Pattern recognition using neural netorks. Oxford, UK: Oxford University Press. Loukas, C. G., & Linney, A. (2003). A survey of histolgical image analysis-based assessment of three major biological factors influencing radiotherapy: Proliferation, hypoxia and vasculature. Computer Methods and Programs in Biomedicine, 74, 183-199. Marr, D., & Hildreth, E. (1980). Theory of edge detection. Proceedings of The Royal Society, B 207, 187-217. McCulloch, W., & Pitts, W. (1947). A logical calculus of ideas immanent in nervous activity. Bulletin of Mathematical Biophysics, 5, 115-133.

846

Automated Image Analysis Approaches in Histopathology

Mete, M., Xu, X., Fan, C., & Shafirstein, G. (2007). Automatic delineation of malignancy in histopathological head and neck slides. Biomed Central Bioinformatics, 8, 7. Mulrane, L., Rexhepaj, R., Smart, V., Callanan, J. J., Orhan, D., Eldem, T., Mally, A., Schroeder, S., Meyer, K., Wendt, M., O’Shea, D., &Gallagher, W. M. (2008). Creation of a digital slide and tissue microarray resource from a multi-institutional predictive toxicology study in the rat: an initial report from the PredTox group. Experimental and Toxicologic Pathology, in press. Ong, S. H., Giam, S. T., & Sinniah, R. (1993). Adaptive window-based tracking for the detection of membrane structures in kidney electron micrographs. Machine Vision and Applications, 6, 215-223. Pal, N. R., & Pal, S .K. (1987). Segmentation based on contrast homogeneity measure and region size. IEEE Transactions on Systems, Man and Cybernetics, 17(5), 857-868. Pavlidis, T. (1977). Structural pattern recognition. Berlin: Springer Verlag. Pham, N., Morrison, A., Schwock, J., Aviel-Ronen, S., Iakovlev, V., Tsao, M., Ho, J., & Hedley, D.W. (2007). Quantitative image analysis of immunohistochemical stains using a CMYK color model. Diagnostic Pathology, 2, 8. Sharipo, E., Hartant, V., Lepor, H. (1990). Quantifying the smooth-muscle content of the prostate using double-immunoenzymatic staining and colour assisted image analysis. Journal of Urology, 147, 1167-1170. Sharkey, A. J. C., Sharkey, N., Gerecke, U., & Chandroth, G. O. (2000) The test and select approach to ensemble combination. Proceedings of the First International Workshop on Multiple Classifier Systems. Sjostrom, P. J., Frydel, B. R., & Wahlberg, L. U. (1999). Artificial neural network-aided image analysis system for cell counting. Cytometry, 36, 18-26. Sonka, M., Hlavac, V., & Boyle, R. (1999). Image Processing. Analysis and Machine Vision Second Edition. London, UK: International Thomson Publishing Europe. Stevens, A., Lowe, J. S., & Young, B. (2002). Wheater’s basic histopathology, 4th Edition. London, UK: Churchill Livingstone. tenKate, T. K., Belien, J. A. M., Smeulders, A. W. M., & Baak, J. P. A. (1993). Method for counting mitoses by image processing in Feulgen stained breast cancer sections. Cytometry, 14, 241-250. Tyan, S. G. (1981). Median filtering, deterministic properties. In Huang, T.S., (ed.) Two-Dimensional Digital Signal Processing, 2. Berlin, Germany: Springer Verlag, Vapnik, V. (1995). The nature of statistical learning theory. New York: Springer-Verlag. Vincent, L., & Soille, P., (1991). Watersheds in digital spaces: An efficient algorithm based on immersion simulations. IEEE Transactions on Pattern Analysis and Machine Intelligence, 13, 6, 583-598. Weinstein, R. S., Bhattacharyya, A. K., Graham, A. R., & Davis, J. R. (1997). Telepathology: A ten-year progress report. Human Pathology, 28, 1, 1-7. Weinstein, R. S., & loom, Rozek, (1987). Telepathology and the networking of pathology diagnostic services. Archives of Pathology and Laboratory Medicine, 111, 7, 646-652.

847

Automated Image Analysis Approaches in Histopathology

Witten, I. H., & Frank, E. (2005). Data mining, 2nd Edition. CA, USA: Morgan Kaufmann Publishers Zamperoni, P. (1986). Analysis of some region growing operators for image segmentation. Advances in Image Processing and Pattern Recognition. North Holland, Amsterdam. (pp 204-208).

KEy TeRms ANN: Artificial Neural Network. Any network that is made up of nodes that simulate the function of neurons, and connections between them that represent synapses, in the brain. Automated Image Analysis: Encompasses the automation of every step in the work flow of image analysis in histopathology, from the production of the image, to the high level understanding of the different objects present in the digital image produced. CMYK: Cyan, Magenta, Yellow, Key colour space. A representation of colour using the three secondary colours, cyan, magenta and yellow. All other colours are formed by subtracting different combinations of these three from white. Data Acquisition: The group of techniques performed in order to achieve a digital image of a tissue sample, suitable for analysis. FFNN: Feed Forward Neural Network. A classifier made up of a cascading ANN. H&E: Haematoxylin and Eosin. A staining technique used in Histopathology that pigments nucleic structures blue and cytoplasmic structures pink. Histopathology: The study of disease by microscopically analysing tissue samples. HSV: Hue, Saturation, Value colour space. A representation of colour that better represents human perception of differences in colour. The intensity (value) is separated the two terms that we use to define colour, hue (perceived colour) and saturation (light or dark) Image Pre-Processing: The group of techniques carried out globally on an image in order to allow more accurate analysis of the image. KNN: K - Nearest Neighbour. A classifier that decides on the class of an unlabeled sample based on its k nearest labeled neighbouring samples according to some distance measure (usually Euclidian). LDA: Linear Discriminant Analysis. A dimension reduction technique used to transform a feature set into a smaller set of features that best discriminates between the different classes in the data. Machine Learning: The automation of the classification of different regions in the image as objects. PCA: Principal Component Analysis. A dimension reduction technique used to transform a feature set into a new feature set whose features map to the variance in the system. The new features that provide the least amount of variance can subsequently be removed.

848

Automated Image Analysis Approaches in Histopathology

RGB: Red, Green, Blue colour space. A representation of colour using the three primary colours, red, green and blue. All other colours are formed by different combinations of these three. Segmentation: The process of building regions within an image which better represent the real world objects present in the image. SVD: Singular Value Decomposition. The series of matrix operations carried out in order to perform PCA on a set of features. SVM: Support Vector Machine. A classifier that builds an optimum decision boundary between classes based on a subset of labeled samples closest to the boundary. These samples are known as support vectors. TMA: Tissue Microarray. An array of tissue samples from different sources, collected on one paraffin block.

849



About the Contributors

Andriani Daskalaki received her PhD degree in dentistry at the Free University of Berlin. She received MS degree in bioinformatics. Her research areas is systems biology, PDT and laser applications in dentistry. She is the editor of the “Handbook of Research on Systems Biology Applications in Medicine”. *** Ines Abdeljaoued-Tej is a mathematician with special field in Computer Algebra. She did her PhD studies in LIP6 at the Université Pierre et Marie-Curie (France) with Annick Valibouze as supervisor. She taught general Informatics and Mathematics at Université de Versailles and Université Paris 6 (from 1996 to 2000), is Assistant Professor at the Université de Carthage (Tunisia) since 2000 and is currently in charge of the Optimization and Operational Research courses at the Ecole Supérieure de la Statistique et de l’Analyse de l’Information. She is part of the research Unit Algorithmic and Structures, author of Package PrimitiveInvariant in Gap and is co-author of 2 publications. Julia Adolphs studied physics at the Free University in Berlin. She is currently a PhD student in the Emmy-Noether group of Dr. Thomas Renger. Jessica Ahmed was born in Berlin, Germany. She obtained her Master of science in bioinformatics at the Free University, Berlin in 2006. Since then she has been a PhD student at the Institute of Molecular Biology and Bioinformatics, Charité-University Medicine Berlin at the group of Robert Preissner. Her main fields of research are cancer research and drug development. Daniela Albrecht was born in 1983. She achieved her diploma in 2006 in bioinformatics at the Friedrich Schiller University (FSU), Jena. Presently she is working on her PhD at the Leibniz-Institute for Natural Product Research and Infection Biology – Hans-Knoell-Institute (HKI), Jena. Her research areas are databases and data warehouses, proteomics (data processing and analysis) and integrated analysis of data from transcriptomic and proteomic level of human-pathogenic fungi. Roberta Alfieri received the Master of science in bioinformatics from the University of MilanoBicocca, Milan, Italy. She is PhD student in “Computer Science and Complex Systems” at the School of Advanced Studies, University of Camerino, Macerata, Italy. Her research activities in the field of systems biology concerns the development of databases and tools for the mining and the integration

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

About the Contributors

of cell cycle related information. She also works on the mathematical modelling of biological system, with particular interest in the mammalian cell cycle process, using the high performance computing techniques on distributed platforms in GRID at Italian National Research Council. Christos Argyropoulos received his medical degree from the University of Patras, Greece in 1997, and his MSc and PhD degrees in biomedical sciences from the Graduate Program in Medical Sciences of Patras Medical School in 2003 and 2005 respectively. He is currently a fellow in the Renal and Electrolyte Division in the University of Pittsburgh. His main research interest lie in the field of Bioinformatics and especially in the application of Bayesian and maximum entropy methods in the analysis of microarray datasets. Pantelis G. Bagos received a BSc in biology in 1997, a MSc in biostatistics in 2002, and a PhD in bioinformatics in 2005 from the University of Athens, Athens, Greece. Since then, he has been working as a post-doctoral research fellow at the Department of Cell Biology and Biophysics, Faculty of Biology, University of Athens, and as visiting assistant professor at the University of Central Greece, Lamia, Greece, where he is teaching biology and bioinformatics. He was recently elected assistant professor at the Department of Informatics with Applications in Biomedicine at the University of Central Greece. His research interests include computational analysis of protein sequences, biological databases, machine learning algorithms in bioinformatics and genetic epidemiology. Marc Baumann studied medicine and biochemistry at the University of Zürich, Switzerland, where he graduated in 1984. Currently, he is the director of the Protein Chemistry/Proteomics Unit at the University of Helsinki, Faculty of Medicine, Finland. His current research interests are focused on three main subjects, i) the studies on protein misfolding disorders, e.g. Alzheimer’s disease, CADASIL disease, Prion disorders and other amyloidoses, ii) searching for new protein biomarkers for various clinical conditions, e.g sepsis with and without organ failure and episodic/long term hazardous alcohol misuse, iii) development of nano-coated micro-chip based analytical devices for proteome studies and medical diagnosis. Slimane Ben Miled is a biomathematician. He has a Master thesis in theoretical physics and a PhD in mathematics at the Non-Linear Institute of Nice. He was associated professor at the Federal University of Rio de Janeiro and research associated at the Third Word Academy of Science. Now he is assistant professor at the University of Tunis. He is co-organizer and co-fonder of the Tunis Winter School of Biomathematics open to biologist who want to learn mathematics and co-responsible of a Master diploma on Biomathematics for mathematicians who want to learn biology. His research field is dynamical systems, ecology/evolution. Alia Benkahla is a bioinformaticist. She did her PhD studies at the IGS-CNRS in Marseille with Jean-Michel Claverie as PhD supervisor, did her Post-Doc at the Max-Planck Institute in Berlin, and moved to LIVGM at Institut Pasteur de Tunis 36 months ago. She invested her initial period at IPT in capacity building in the field of Bioinformatics by: training students; starting a research group; coorganizing international events in Africa; and looking for funds in Bioinformatics for pathogen and disease vectors. She is co-author of 5 publications among which 3 Nature.



About the Contributors

David Benovoy is pursuing his doctoral degree in the field of Human Genetics at McGill University under the supervision of Dr. Jacek Majewski. He received a BS degree in biochemistry and Master’s degree in biology, both from the University of Ottawa. His current research interests are in comparative transcriptomics where he is studying variation of alternative splicing at a tissue, population and species level. Juergen Beuthan researches in experimental use of laser-induced fluorescences in biomedical optics (specifically metabolic monitoring on cells). His research also covers diaphanoscopy, optical tomography and tissue optics in optical medical diagnostics. He studied electronics at the Humboldt University of Berlin and physics at the University of Greifswald. Between 1983 and 1986 he received his doctor’s degree and habilitated in experimental physics. Postdoc he stayed twice at the Moscow Academy of Sciences to work in the team of Nobel Laureate Professor Basov. He received scientific honours like the Stauffer Award (USA) and two innovation awards. His scientific achievements have been presented and manifested in some 150 papers and over 40 patents. Abdesslam Boutayeb received a doctorate in data analysis from Pau University (France) in 1983, a MSc and a PhD in numerical analysis from Brunel University (GB). He is currently a professor of applied mathematics at the University Mohmed Ier (Morocco). In 1997, he obtained a Fulbright grant for a three months visit to Colorado School of Mines (USA). He has supervised many PhDs and MScs and lead research projects. His main area of research is numerical analysis and mathematical modelling with applications in medicine and biomedical sciences. During the last decade, he published 4 books and more than 30 papers. Axel Artur Brakhage was born in 1959. He achieved his diploma in biology in 1985 and his PhD 1989 in microbiology, molecular biology and biochemistry at the University of Münster. Presently he is full professor (C4) of microbiology / molecular biology at the FSU, Jena. He is head of the HKI in Jena. His research areas are molecular microbiology, molecular biotechnology of fungi, virulence of fungi as well as the interaction of immune effector cells and Aspergillus fumigatus (Cellular Microbiology). Alexey R. Brazhe graduated in 2003 from the Moscow State University (Russia) and got a PhD in biology and biophysics in 2006. Since 2006 he is a researcher at Moscow State University and postdoc at Technical University of Denmark. His research interests are cell biophysics and neurophysiology, self-organization and mathematical modelling, fractals in biology, data series analysis. Nadezda A. Brazhe graduated in 2003 from the Moscow State University (Russia) and got a PhD in biology and biophysics in 2006. Since 2006 she is a researcher at Moscow State University and postdoc at Technical University of Denmark. Her research interests are cell biophysics and neurophysiology, including intercellular communications in the nervous system and modulation of erythrocyte properties under external stimuli. At present time she specializes in the application of interference microscopy to the cell studies and investigation of nitric oxide role in the nervous and cardiovascular systems. Kenneth Bryan received an honours degree in microbiology from The University of Dublin, Trinity College, in 2001. After attaining a Graduate diploma in I.T. from Dublin City University in 2002 he returned to Trinity where he completed a PhD in machine learning/bioinformatics, which focused



About the Contributors

on the development of novel unsupervised methods for analysing microarray gene expression data. He is currently employed as a research fellow in the Machine Learning Group at the Complex and Adaptive Systems Laboratory (CASL) in University College Dublin. Current research topics include the 27 developing semi-supervised methods for gene expression data analysis and supervised feature selection methods for metabolomics data analysis. Kwang-Hyun Cho received the BS (summa cum laude), MS, and PhD degrees in electrical engineering from the Korea Advanced Institute of Science and Technology (KAIST) in 1993, 1995, and 1998, respectively. He is currently associate professor at the College of Medicine, Seoul National University, Korea and holds a joint position at the Bio-MAX Institute, Seoul National University, Korea as a Director of Systems Biology Laboratory. His research interests cover the areas of systems science with bio-medical applications including systems biology, nonlinear dynamics, and discrete event systems. His focus is on biotechnology and bio-medical science applications, from genetic to cellular systems. Pádraig Cunningham is professor of knowledge and data engineering in the School of Computer Science and Informatics at University College Dublin. His current research focus is on the use of machine learning techniques in processing high-dimension data, particularly bioinformatics and multimedia data. He has published extensively on the applications of supervised and unsupervised machine learning techniques. His current research focus is on the application of machine learning techniques in image analysis and on using dimension reduction and feature selection techniques for biomarker discovery. Antonis Daskalakis received his diploma in physics from the University of Patras, Greece in 2003 and his MSc in medical physics from the Medical School of the University of Patras in 2005. Since 2005, he is a PhD candidate in medical physics at the University of Patras, Greece. His main research interests lie in the field of bioinformatics and especially in the image processing and analysis of microarray images. Ana Katerine De Carvalho Lima Lobato has a BSc and a MSc in chemical engineering from the Federal University of Rio Grande do Norte, Brazil. Soon after her MSc she started in a chemical engineering PhD program researching on metabolic engineering, where part of it was developed at the University of Manchester, School of Chemical Engineering and Analytical Science, UK. Currently, she is a professor at the Potiguar University which is part of the Laureate International Universities group. She has experience in the area of chemical engineering focusing on biotechnology, working mainly in the following fields: biofuel, biosurfactants, antibiotic production and metabolic flux analysis. Bernard de Bono studied medicine at the University of Malta and has experienced working as a medical and surgical intern at St.Luke’s Hospital in Malta. He then read for an MPhil in protein engineering at the University of Malta followed by PhD in biology at the Medical Research Council Laboratory of Molecular Biology, University of Cambridge. His main research focus is the evolution, signalling and disease association of immunoglobulin superfamily proteins. He is also directly involved in the development of software and training methods in integrative physiology, with particular emphasis on the combination of gene expression with pathway data.



About the Contributors

Koussay Dellagi is professor of haematology at the Faculty of Medicine of Tunis. His main research interests are in immunology of host parasite interactions and genetics of haematological diseases. He was director general of Institut Pasteur de Tunis (Tunisia) from 1988 until 2005 and head of the Research Laboratory of Immunology, Vaccinology and Molecular Genetics (1985-2007). Since 2007 he is director of the Centre de Recherche et de Veille sur les Maladies Emergentes dans l’Océan Indien (CRVOI) at La Réunion (France). Member of the WHO Regional Advisory Committee (EMRO, WHOCAIROEGYPT) since 2005. Member of the Scientific and Technical Advisory Committee (STAC) of TDR (2000-2003). Member of the scientific advisory committee of the WHO-Kobe Centre. Prerak Desai is currently pursuing his PhD at Utah State University (Logan, UT) with an emphasis on microbial physiology and cellular microbiology. He has a Master’s in food science (Utah State University, Logan, UT) and a BTech in dairy technology (Gujarat Agricultural University, Gujarat, India). He aspires to have a research based career answering questions related to infectious diseases and food safety. Mohamed Derouich is a researcher in biomathematics with special interest in mathematical models applied to diabetes and communicable diseases transmitted by vectors. His MSc dissertation was presented in 1997 on epidemiological and ecological models in discrete time then he received a PhD in modelling and simulation in 2001 from the University Mohamed Ier (Oujda-Morocco). He is currently teaching mathematics at a secondary school and computer sciences as a part time lecturer at the faculty of Sciences (Errachidia Morocco). Peter Deuflhard. 1994, Gerhard Damköhler Medal. 2002, Co-initiator DFG Research Center MATHEON Berlin. 2007, ICIAM Maxwell prize (for fundamental contributions to applied mathematics). Matthew DiFranco is a PhD candidate in the Machine Learning Group at the School of Computer Science and Informatics, University College Dublin. He is currently working as an IRCSET Scholar under prof. Pádraig Cunningham and Dr. William Watson on a supervised learning approach to automated Gleason grading of prostatic carcinoma in prostate immunohistochemistry slides. Prior to his arrival in Dublin, he worked as a research assistant under prof. Peter Hammond at the Biomedical Informatics Unit of the Eastman Dental Institute, University College London, employing 3D statistical shape modeling techniques to investigate facial dysmorphology of cleft lip and/or palate as part of an $8 million US National Institutes of Health grant. He graduated in 2004 from University College London with a Master’s of research (MRes) in computer vision, image processing, graphics and simulation. Cathrin Dressler is a biologist and works at the research company Laser-Medizin-Technologie Berlin, Germany, since 1996. Her research interests are settled in the field of optical diagnostics/bioanalytics and are focused on laser tissue interactions, micropreparation of cells and subcellular structures as well as stress reactions in various animal tissues. She is also involved in investigating and developing nanotechnological tools and devices. In this respect special emphasis deals with bioanalytical applications of near-field optics and luminescent nanosensors.



About the Contributors

Federico Esposti has a Master degree in biomedical engineering with full marks from the Politecnico di Milano in 2005 and at present is PhD student in bioengineering from January 2006. His activity concerns the analysis of neuronal cultivations signals in cooperation with the Università degli Studi di Milano and the non linear analysis of fetal heart rate variability signal. From 2006 he is co-lecturer for the course of electronics bioengineering and bioimages of the Politecnico di Milano. He is author of several peer reviewed international papers in the field of non linear signal processing (whether biomedical or not) and biomechanics. Chris T.A. Evelo is head of the BiGCaT Bioinformatics group of the Maastricht University in the Netherlands. Dr. Evelo has a PhD in molecular toxicology. His research focus is on integration of critical evaluation of data and database quality with powerful analytical methods and creative ways to look at data and to understand it in the context of what we already know. He applies this systems biology approach in the fields of nutrigenomics, cardiovascular genomics, toxicogenomics and cancer. Lloyd Flack is a research assistant at the Institute for Molecular Bioscience. He gained his BSc, majoring in biology in 1973 and his MStats in 1995. Most of his work has been on the application of statistics to biological, agricultural and environmental problems. He has been an author on papers and technical reports. His main interests are in the statistical modelling of biological systems, in classification and clustering methods, and in smoothers. Ross Foley is a PhD student in the Machine Learning Group at the School of Computer Science and Informatics, University College Dublin. He is working under Prof. Pádraig Cunningham and Prof. William Gallagher as part of an IRCSET group scholarship in bioinformatics. He is working as part of the multi-national PredTox project on machine learning in automated image analysis approaches to histopathology regarding predictive toxicology. He graduated from UCD with an honours degree in electronic engingeering in 2004. He subsequently worked as a telecommunications engineer for Ericsson in Dublin. William M. Gallagher is an associate professor of cancer biology within the UCD School of Biomolecular and Biomedical Science, University College Dublin, with his laboratory being located at the UCD Conway Institute. A major of focus of prof. Gallagher’s research work is the identification and validation of candidate biomarkers of breast cancer and melanoma, with particular emphasis on translation of transcriptomic and proteomic datasets into clinically relevant assays via the use of tissue microarrays and associated image analysis approaches. Prof. Gallagher currently co-ordinates an FP6 Marie Curie Transfer of Knowledge Industry-Academia Partnership Programme, Target- Breast (www. targetbreast.com), which involves 3 academic and 2 industrial partners across 3 EU countries (running from 2006-2010). Prof. Gallagher is also a central participant of the PredTox component of the FP6 Integrated Project, InnoMed (2005- 2009), which aims to harness post-genomic approaches to better monitor and understand drug-related toxicological effects. He has received a number of awards based on his research work to date, including the BACR/AstraZeneca Young Scientist Frank Rose Award in 2004 and the St. Luke’s Silver Medal Award in 2008. Prof. Gallagher is also on the Scientific Advisory Board of SlidePath Ltd. Prof. Gallagher originally graduated from the Department of Biochemistry, UCD in 1993 with a 1st Class Joint Honours degree in molecular genetics and biochemistry. Subsequently, he obtained a PhD in molecular and cellular biology from the Cancer Research UK Beatson Laboratories



About the Contributors

in Glasgow. In 1997, he moved to Paris to undertake a Marie Curie Individual Fellowship at RhonePoulenc Rorer. Afterwards, he returned to Ireland upon receipt of an Enterprise Ireland Post-Doctoral Fellowship (1999-2000) and, subsequently, a Marie Curie Return Fellowship (2000–2001). In 2001, he was employed in a permanent capacity as college lecturer at UCD within the former Department of Pharmacology. In January 2005, he was appointed senior lecturer within the UCD School of Biomolecular and Biomedical Science and was promoted to associate professor of cancer biology in July 2006. Prof. Gallagher is also a principal investigator at the Conway Institute. In May 2007, he co-founded OncoMark Ltd., which is a private company centred on the development and application of biomarker panels and associated technologies, on both tissues and biological fluids. A major focus of the company is to provide the link from –omic level discovery to validation via the use of multiplex antibody-based assays and high-throughput tissue microarray screening. Georgi Georgiev studies physics in the Sofia University since 2000. From the beginning of 2005, he works as young researcher in the Institute of Mechanics and Biomechanics (IMBM) to Bulgarian Academy of Sciences. His scientific interests and publication activities are in the field of computer programming, bioinformatics and computational systems biology. Peter Ghazal, chair of molecular genetics and biomedicine, head of Division of Pathway Medicine. Associate director, Centre for Systems Biology in Edinburgh. Professor, The Scripps Research Institute. Founding director, Scottish Centre for Genomic Technology and Informatics. Duncan Gillies graduated from Cambridge University with a degree in engineering science in 1971. He obtained his PhD in the area of artificial intelligence from Queen Mary College. Currently, he is the professor of biomedical data anlaysis at Imperial College, London where his research work has mostly concerned the application of computers in medicine and biology. In particular he has worked on interactive graphics for simulation of endoscopic procedures, geometric and physical modelling of the upper human airway, the use of Bayesian inference in visual diagnosis, and statistical analysis of microarray data. To date he has published over 120 papers, been granted five patents, awarded 24 research grants and supervised twenty successful research students. Vanathi Gopalakrishnan is assistant professor of biomedical informatics, intelligent systems and computational biology at the University of Pittsburgh. She received her doctorate in computer science from the University of Pittsburgh in 1999. She has been involved in bioinformatics training and curriculum development since 2000. Dr. Gopalakrishnan is the recipient of a five-year K25 quantitative research career award from the NIGMS at the National Institutes of Health, USA. In 2006, she was awarded a Pitt Innovator Award for having been involved in successful licensing of technology developed in her lab to a commercial biotech company doing biomarker validation research. Lamia Guizani-Tabbane has a PhD in immunology at the Université Pierre et Marie Curie (France). She’s working at the Institut Pasteur de Tunis. Her field of interest is host-pathogen interaction. She founded a research group studying the alteration of macrophage-signal transduction in response to pathogens and especially to Leishmania infection.



About the Contributors

Reinhard Guthke was born in 1950. He achieved his diploma in 1973 in physics, his PhD in biophysics in 1978 and his PhD (Dr. sc. nat.) in biotechnology in 1988 at the FSU Jena. Presently he is vice head of the Department Molecular and Applied Microbiology and head of the Systems Biology and Bioinformatics Group at the HKI Jena. His research areas are bioprocess data analysis (data mining), design of knowledge based systems, mathematical modeling and process simulation, mathematical model-based experimental design as well as process optimization and control. Hendrik Hache is a PhD candidate at the Max Planck Institute of Molecular Genetics. His research interests are focused on the development and validation of reverse engineering methods of gene regulatory networks. He graduated with a diploma in the faculty of physics at the Humboldt University in Berlin, Germany. Michael R Hamblin is associate professor of dermatology at the Wellman Center for Photomedicine. His research areas include photodynamic inactivation of pathogens, PDT-induced anti-tumor immunity, low level light therapy for healing and biostimulation. He is author of book’s chapters and international peer-reviewed papers in the field of low-light therapy. Stavros J. Hamodrakas received his BSc from the Physics Department, of the University of Athens, Athens, Greece in 1970 and his PhD from the Astbury Department of Biophysics of the University of Leeds, Leeds, U.K. in 1974. He is currently a full professor at the Department of Cell Biology and Biophysics, Faculty of Biology, University of Athens, Athens, Greece. He also is the general director of a post-graduate program in “bioinformatics”. Research interests include structural and functional studies of insect chorion (eggshell) and insect cuticle, prediction of protein structure, function and interactions, relational and object-oriented protein databases, automatic analyses of genomes, study of fibrous and globular protein structure, function and interactions and studies of structure and self-assembly mechanisms of amyloids. Julia Hossbach was born in Jena, Germany. She obtained her diploma in biology from the Friedrich-Schiller University Jena in 2003. At the University of Leipzig she was working as a PhD student until 2006. She joined the Institute of Molecular Biology and Bioinformatics, Charité-University Medicine Berlin in 2006 where she is currently working at the group of Robert Preissner. Her main field of research interest comprises the investiagtion of bioactive compounds from natural and synthetic compound libraries. Jürgen Kleffe received the PhD degree in 1976, from Humboldt-University in Berlin in the field of mathematical statistics. He received the DSc for outstanding research work on analysis of variance and variance component estimation. His research in the area of mathematical statistics has been recognized with support by the American Academy of Sciences and inclusion in the 8th edition of the International Who’s Who of Intellectuals. He is head of the group for Automatic Gene Annotation at the Charité Berlin which is part of the Berlin Center for Genome Based Bioinformatics. He was a visiting professor in USA Universities. He worked on applications in various fields including gene prediction and fast sequence matching, biostatistics, econometric models, growth curve analysis, actuarial mathematics and missing data analysis. Bioinformatics, improvement of methodology and algorithms for statistical analysis of DNA sequences and the reliability of genomic sequence assembly constitute his main areas of interest. 

About the Contributors

Sophia Kossida obtained her DPhil in 1998 from Oxford University, Merton College in the UK. She carried out a post-doc at Harvard University, USA at the Molecular & Cellular Biology Department. She joined Biomedical Research Foundation of the Academy of Athens in July 2004 as tenure track research bioinformatician, Center of Basic Research II, Biotechnology Division. Her current research interests are focused on bioinformatics and medical informatics. Vladimir Kotev is a PhD student at the Institute of Mechanics to the Bulgarian Academy of Sciences. He graduated from the Technical University – Sofia, Bulgaria, having completed a Master’s degree in general mechanical engineering. He investigates the qualitative and quantitative behavior of the nonlinear models describing signaling pathways and gene-regulation systems. His research interests are in the nonlinear dynamics, system biology and bioinformatics. Axel Kowald (born 1962) holds a PhD in mathematical biology from the National Institute for Medical Research, London. He has worked at the University of Manchester, the Institute for Advanced Studies in Budapest, the Humboldt University Berlin and the Max Planck Institute for Molecular Genetics in Berlin. His current research interests focus on the mathematical description of biochemical pathways involved in the aging process and systems biology. Andrew Kuznetsov obtained his degrees in biochemistry (MSc), microbiology (PhD) and biotechnology (DrSci) in the former Soviet Union, where he was active in the gene engineering and transgenesis. Andrew was a postdoc fellow 2002-2005 in molecular biotechnology at the Freiburg University, Germany. He is now a joined scientist in Institute for Microsystems Engineering at the same University. Andrew developed Synbiology Database working for NEST Project (http://www.synthetic-biology.info/). He was a leader of iGEM2006 Freiburg team. He is the author of 25 papers and he is interested in the unconventional computation, synthetic biology and evolution by communication. Tony Kwan obtained his PhD in biochemistry from McGill University in Montreal, Canada under the supervision of Dr. Philippe Gros on the “Structural and functional analysis of the mouse Mdr3 Pglycoprotein.” He then completed an industrial post-doctoral fellowship in bioinformatics from 2001 to 2003 at Targanta Therapeutics in Montreal, a biotechnology company developing antibacterial therapies. He remained at Targanta Therapeutics until 2005, before returning to McGill for a 2nd postdoctoral fellowship in the Department of Human Genetics under the direction of Dr. Jacek Majewski. Dr. Kwan’s research is currently focused on the use of microarray technologies for the study of human genetic variation. Philippe Lambin is a professor in the Department of Radiation Oncology (MAASTRO) at the University of Maastricht and division leader at the Research Institute GROW. His main areas of interest are directed towards translational research in radiation biology with a specific focus on tumor hypoxia, functionnal imaging and lung cancer. His most recent research investigates the use of systems biology approaches combined with large databases of biological (geno-proteomic), clinical, imaging and treatment data coupled with an artificial intelligence system. This approach will allow computer-aided individualized treatment.



About the Contributors

Andrea Maffezzoli obtained a Master’s degree in biomedical engineering from the Politecnico di Milano in 2003 and at present he is a PhD student in Bioengineering from March 2005. His study and research activity concerns mainly the analysis of data elaboration methods and the implementation of related software applied on neuronal cultivations signals, with the collaboration of “Università degli Studi” of Milan. He is author of some proceedings, book’s chapters and international peer-reviewed papers in the field of data elaboration, data mining and informatics applied in medicine. Jacek Majewski is an assistant professor and Canada research chair at the Department of Human Genetics, McGill University, Montreal, Canada. His background in physics and biology promoted his interest in bioinformatics, genomics and large-scale biological data analysis. His current research interests include genome evolution, regulation of gene expression, and alternative splicing. Georgy V. Maksimov is a professor of biology at the Moscow State University (Russia) and holds a PhD and Russian DrSci degree in biophysics and human physiology. His main interests lie in the area of cell biophysics including studies of the membrane and cytoplasm processes in excitable cells and erythrocytes under normal conditions, laser irradiation, magnetic field and various pathologies, axo-glial interactions during demyelinization and Lyme disease. He published about 150 papers and 4 books on the cell biophysics and basis of rhythmic excitation. Evgenia Makrantonaki was born in 1978. She studied at the Aristoteles University Thessaloniki, and Medical School, Charité University Medicine Berlin. Since 2006 is resident at the Departments of Dermatology and Immunology, Dessau Medical Center. IFMSA-, Erasmus- and Verein zur Förderung der Dermatologie e.V. She is a scholarship holder, prize winner of the Hermal prize (2006) and the William J. Cunliffe Scientific prize (2006). Ferda Mavituna has BSc (with distinction) in chemical engineering (Middle East Technical University, Turkey), MSc in advanced chemical engineering and PhD in biochemical engineering, both from the Victoria University of Manchester, UK. She is currently a professor of chemical and biochemical engineering in the School of Chemical Engineering and Analytical Science, The University of Manchester, UK. She is the co-author of Biochemical Engineering and Biotechnology Handbook and coeditor of two books. Her research activities have been in the following areas: plant biotechnology for pharmaceuticals production and somatic embryogenesis, immobilised microbial and plant cell cultures, modelling, metabolic engineering and systems biology. Elisabeth Maschke-Dutz received her diploma in mathematics and computer science from the Technical University Berlin. She has worked at the bioinformatics department of the German Resource Center for Genomics Research (RZPD). Currently her work at the Max Planck Institute for Molecular Genetics in Berlin focuses on the development of computational methods and tools for systems biology. Her research interests include mathematical modeling and analysis of biological and biomedical systems Thomas Meinel studied chemistry at the Technical University in Berlin with focus on physical chemistry and biochemistry. After several laboratory work on protein complexes in the interdisciplinary field of photosynthesis, he joined Martin Vingron’s Department of Computational Molecular Biology

10

About the Contributors

at the Max Planck Institute for Molecular Genetics in Berlin-Dahlem. He incorporated taxonomic and multiple alignment features to the SYSTERS web interface, analyzed taxonomic specificities of protein families, and developed the PhyloMatrix phylogenetic profiling tool. He joined Hans Lehrach’s Department of Vertebrate Genomics at the MPIMG. Geoff McLachlan is professor of statistics in the Department of Mathematics and a professorial research fellow in the Institute for Molecular Bioscience. He is also a chief investigator in the Australian Research Council (ARC) Centre of Excellence in Bioinformatics. His research has been recognized with various awards, including a DSc in 1994 and an ARC Professorial Fellowship in 2006.His numerous publications include five monographs, the last four as volumes in the Wiley series in Statistics. His research in statistics has been concentrated on the related fields of classification machine learning, and pattern recognition, and in the field of statistical inference. The focus in the latter field has been on the theory and applications of finite mixture models and on estimation via the EM algorithm. More recently, he has become actively involved in the field of bioinformatics with the focus on the statistical analysis of microarray gene expression data in which he has coauthored a Wiley monograph. Luis Mendoza holds a PhD in biomedical sciences, from the Universidad Nacional Autónoma de México (UNAM). He continued his preparation by doing a postdoctoral stay at the Karolinska Institute, in Stockholm; and later he worked as an associate scientist for the biotechnology company Serono, in Geneva. Since 2006 he is a group leader at the Instituto de Investigaciones Biomédicas, UNAM; there, he leads the ComBioLab, developing models of regulatory networks in biological systems of interest. Luciano Milanesi received his PhD in health physics from University of Milan in 1986. He is currently researcher of the Italian National Research Council. Institute of Biomedical Technologies (CNR-ITB). He is the coordinator of the CNR Bioinformatics project, CNR-Bioinformatics. He has been principle investigator for the European projects: TRADAT (TRAnscription Database and Analysis Tools), ORIEL “an Online Research Information Environment for the Life Sciences” and EGEE. He is the coordinator of the European BIOINFOGRID (Bioinformatics Grid Applications) for life science. and the LITBIO (Laboratory of Bioinformatics Technologies). He is an editorial board member of the IEEE Transactions on Nanobioscience and Briefings in Bioinformatics. He has published more then 150 refereed publications in journals, books and conference proceedings relating to the areas of bioinformatics, system biology and medical informatics. Olaf Minet’s research is in tissue optics, spectroscopy, mathematical modelling and image processing. After first degree in theoretical physics from the Technical University in Darmstadt, Germany in 1986, he joint the Institute for Medical Physics and Optical Diagnosis at Charité, Berlin. He conducted doctoral research in optical diagnosis of rheumatoid arthritis including advanced image processing. Alok Mishra is a PhD candidate at Imperial College, London where he is researching techniques to integrate various biological datasets using kernel based methods. He did his MSc degree in computing science at Imperial College and another MSc in artificial intelligence at Univ. of Edinburgh. He did his undergraduate engineering degree from Indian Institute of Technology, Kharagpur (India). His research is funded by the Imperial College Deputy Rector’s Scholarship.

11

About the Contributors

Erik Mosekilde is a professor of physics at the Technical University of Denmark with complex systems theory and modelling of biological systems as his main interests. He is also coordinator of BioSim, a European Network of Excellence in “Biosimulation – A New Tool in Drug Development”. Erik Mosekilde holds a PhD and a Danish DrSci degree in experimental and theoretical physics. He started to work in systems biology and mathematical modelling of cellular and physiological systems in 1977 and published about 220 scientific papers and a number of books on application of nonlinear dynamics to physical, technical and biological systems. Charalampos Moschopoulos studied computer science at the University of Patras in Greece, where he obtained his Master’s degree in 2006. Currently, he is a PhD student at the Biomedical Foundation Research of the Academy of Athens in cooperation with the University of Aegean in Greece. His research interests are focused on artificial intelligence techniques in bioinformatics, including machine learning and data mining. Laoighse Mulrane received a 1st Class Joint Honours degree (BSc) in genetics & pharmacology from University College Dublin in 2007. She is currently studying for an MSc in pharmacology in Prof. William Gallagher’s lab in the UCD School of Biomolecular and Biomedical Science in Dublin, Ireland. The subject of her thesis is the study of toxicity biomarkers and their validation using tissue microarrays.

Raul Munoz-Hernandez is a chemical engineering PhD student from The University of Manchester, and his research is in metabolic engineering and systems biology. Raul started his career in biotechnology after finishing his BSc (chemistry) in ITESM, Mexico. He studied an MSc (food science) in CIAD, collaborating with Arizona University (USA). He also holds an MBA (honours). His experience in industry includes the pulp & paper (quality engineer) and the poultry industry (new products & special projects manager). Currently he is interested in the biopharmaceutical innovation management; and he is working to spin-out from the University his venture “InLife Technologies” (www.inlifetech.com) George Nikiforidis received his Laurea in physics and his MSc in atomic and nuclear physics both from the University of Milan, Italy in 1973 and 1980 respectively and his PhD in medical physics from the University of Patras, Greece in 1981. He is currently a professor of medical physics and the director of the Department of Medical Physics, University of Patras, Greece and of the post-graduate course on medical physics, from the same institution. He has been the principal investigator or been involved in a variety of national or European research and development projects. Svetoslav Nikolov’s research and educational interests are in the fields of mathematical modeling, nonlinear(chaotic) dynamics and bifurcation analysis of systems in cell biology. His MS in mechanical engineering he received from the Technical University of Sofia, Bulgaria, in 1994 and PhD degree from the Institute of Mechanics and Biomechanics (IMech)-Bulgarian Academy of Science (BAS), in 1999. Since 2005 he has been associate professor at IMech and since 2004 a joint position as a lecturer at Faculty of Biology, University of Sofia, Bulgaria.

12

About the Contributors

Matej Orešič holds a PhD in biophysics from Cornell University. Since 2003 he leads the research in domains of quantitative biology and bioinformatics (http://sysbio.vtt.fi/) at VTT Technical Research Centre of Finland (Espoo, Finland), with the main research areas being metabolomics applications in pharmacology, biomedical research and integrative bioinformatics. Recent investigations include studies of statin induced myopathy, longitudinal metabolic profiles of children who progressed to Type 1 Diabetes (DIPP study) and investigations of lipidomic profiles associated with lipotoxicity induced insulin resistance. Prior to joining VTT, Dr. Orešič was a head of computational biology and statistics at Waltham/Massachusetts-based BG Medicine, Inc., and bioinformatician at LION Bioscience Research in Cambridge/MA. Alexey N. Pavlov graduated in 1995 from the Saratov State University (Russia). In 1998 he got a PhD in physics and mathematics. Since 2002 he is associate professor at Saratov State University. His research interests are the dynamics of living systems and time-series analysis. He is co-author of about 50 papers in peer-reviewed journals. Valko Petrov is physicist by education and begins to work as young researcher in 1973 at Institute of Mechanics and Biomechanics (IMBM) to Bulgarian Academy of Sciences. In 1987, he became doctor (PhD) on biomechanics and works in IMBM on the field of mathematical modeling nonlinear dynamics of biological systems. As a head of section of biodynamics and biorheology to IMBM, he reads regular lectures on this discipline. Tuan Pham received his PhD in 1995 from the University of New South Wales with a thesis entitled “Fuzzy Finite Element Analysis of Engineering Problems” which was the pioneering work in the field and has attracted attention of researchers in engineering computations. He has been an associate professor and appointed the director of the Bioinformatics Applications Research Centre at James Cook University. His research interests include image processing, molecular and medical image analysis, pattern recognition, bioinformatics, biomedical informatics, fuzzy-set algorithms, genetic algorithms, neural networks, geostatistics, signal processing, fractals and chaos. Tuan Pham is a senior member of the Institute of Electrical and Electronics Engineers (IEEE), and editorial board member of several journals and book series including Pattern Recognition, Current Bioinformatics, Recent Patents on Computer Science, Book Series on Bioinformatics and Computational BioImaging. Robert Preissner was born in Berlin, Germany. He obtained his diploma in biophysics in 1988 from the Humboldt-University, Berlin. Until 1990, he worked as a research associate in the Department of Biomathematics at the Academy of Sciences. When the Berlin wall came down he joined the Institute of Protein Crystallography at the Free University, Berlin. He received his PhD with a thesis on the relations between sequences and structures of proteins. Since 2007 he is assistant professor at the Institute of Molecular Biology and Bioinformatics, Charité-University Medicine Berlin. He favours multidisciplinary approaches and his main field is structural bioinformatics. Axel Rasche studied mathematics at the ETH Zurich and the Humboldt-University in Berlin. He is currently PhD student at the Max-Planck-Institute for Molecular Genetics in Berlin-Dahlem. His research topics are preprocessing of Affymetrix GeneChip arrays, statistical analysis of alternative splicing and data integration with a focus on type 2 diabetes mellitus.

13

About the Contributors

Isabel Reinecke studied mathematics at the University of Hamburg and at the Institut National des Sciences Appliquées (INSA) in Toulouse. From 2004 until 2006 she was a member of the research group “Computational Medicine”. Since 2006 she is a member of the research group “Computational Drug Design” Zuse Institute Berlin. Elton Rexhepaj received an MSc in computer science from the University of Lausanne in 2005. He is presently a PhD student in the group of Prof. William Gallagher at the UCD School of Biomolecular and Biomedical Science, UCD Conway Institute, University College Dublin, funded under the Health Research Programme “Breast Cancer Metastasis: Biomarkers and Functional Mediators”. His current research is focused on development novel algorithms for the analysis of immunohistochemical data. George Sakellaropoulos received his diploma in physics from the National and Kapodistrian University of Athens, Greece in 1993 and his MSc and PhD in medical physics from the University of Patras, Greece in 1995 and 2001 respectively. He is currently lecturer of medical physics at the Department of Medical Physics, University of Patras, Greece. His main research interests lie in the field of biomedical informatics, statistical learning and decision support systems. Elizabeth Santiago-Cortés holds a BSc in experimental biology from the Universidad Autónoma Metropolitana, México. She is currently a PhD student working in the development of computational models about the molecular and cellular mechanisms for differentiation in the root of Arabidopsis thaliana. She works at the Instituto de Investigaciones Biomédicas in the group of Luis Mendoza. Renaud Seigneuric is a post-doctoral fellow in the Department of Radiation Oncology (MAASTRO) at the University of Maastricht in the Netherlands. His background is in physics and he received a French PhD in health sciences from the University of Grenoble as well as a Canadian PhD in biomedical engineering from the University of Montreal. Renaud Seigneuric investigates the dynamics of complex systems in biology and medicine at different scales, combining mathematical modelling and experimental work. Nikolaos G. Sgourakis received a BSc degree in biology (2004) and a MSc degree in bioinformatics (2006) from the faculty of biology of the University of Athens. Since 2003 he has been involved in the development of bioinformatics tools focusing on the automated prediction of properties of G-protein coupled receptors, under the supervision of professor Stavros J. Hamodrakas. He is currently a doctoral candidate at Rensselaer Polytechnic Institute (group of Dr. Angel Garcia). His research interests cover the areas of protein folding and dynamics, including the implementation of novel methods for the interpretation of NMR observables based on molecular dynamics simulations. Maria G. Signorini is associate professor at the Biomedical Engineering Department, Politecnico di Milano, since december 2003. In the same university she received a Master degree in electric engineering and in 1995, a PhD in biomedical engineering on nonlinear analysis and modelling of cardiovascular time series. Her teaching acitivities are in the field of electronic bioengineering and biomedical signal and image processing. Since 2004, she is the coordinator of the PhD degree program in bioengineering, School of Doctoral Programs, Politecnico di Milano. Her main research interests are nonlinear analysis and modelling of biological signals.

14

About the Contributors

Olga V. Sosnovtseva graduated in 1989 from the Saratov State University (Russia). In 1996 she got a PhD in physics and mathematics. Since 2005 she is associate professor in biophysics at the Technical University of Denmark. Her research interests are systems biology, nonlinear dynamics and modelling of biological systems. Most of here works in systems biology are devoted to studies of the pressure and flow regulation in kidney, neuro-glial and axo-glial interactions. She is co-author of about 60 papers in peer-reviewed journals. Sree N. Sreenath, Ph.D., is a faculty in the Electrical Engineering and Computer Science Department at Case Western Reserve University, Cleveland, Ohio in the United States. His research and educational interests are in complexity research (modeling, structural issues and simulation) focused on systems biology. He applies multilevel hierarchical systems approaches to understand problems in cell signalling implicated in Acute Myelogeous Lukemia (AML), inflammation and prostate cancer, and coordination of the heart-brain interaction. His also director, Case Complex Systems Biology Center, and a recipient of the US NIH Research Career award for 2004-2009. Maud Starmans, MSc, is a PhD student in the Department of Radiation Oncology (MAASTRO) at the University of Maastricht. She is working on the project that investigates the use of in vitro and in vivo microarray derived gene signatures in patient outcome prediction. These gene signatures can provide valuable information on tumor status, prognosis and prediction. This will help individualizing treatment and should result in better tumor control, and more rapid and cost-effective research and development. Heike Stier studied biology at the University of Hohenheim; Stuttgart. Worked on the influence of gangliosides on regernerating peripheral nerves: Diploma Dept. Prof. Dr. H. Rösner. Topic of the PhD thesis: Influence of Müller Glia cells on axonal path finding of retina ganglion cells during development: research work has been done at the NMI Reutlingen, Prof. Dr. B. Schloßhauer.Post-doctoral research at the NMI Reultingen. Post-doctoral research at University of Utah, School of Medicine, Utah, USA , laboratory of Prof. Dr. S.B. Kater, Calcium imagine of neuronal growth cones. (Feodor Lynen fellowship of the Alexander von Humboldt Foundation). Postgraduate studies in Bioinformatics at the University of Applied Science, Berlin; Dept.: Prof. Dr. I. Koch. Master thesis: Alternative Splicing of Membrane Protein; Dept: Institut für Molekularbiologie und Bioinformatik: Priv. Doz. Dr. J. Kleffe. Since April 2007: scientific assistant at Analyze&Realize AG (a&r), Berlin. Athina Theodosiou studied biology at the Aristotle University of Thessaloniki in Greece where she obtained her first degree, in 2005. She did her Master’s degree in bioinformatics at the University of Manchester in UK the year 2006. Currently she is a PhD student at the Biomedical Research Foundation of the Academy of Athens in cooperation with the University of Patras. Her research interests are focused on evolution, proteomics, and bioinformatics. Arie van Erk has a background in medicine (MD) and informatics (MSc). He is now working as a PhD student at the BiGCaT Bioinformatics group of the University Maastricht. In this function, he focuses on large scale data analysis and exploring regulatory elements in mRNA transcription.

15

About the Contributors

Natal van Riel is assistant professor of biomodeling and systems biology in the Department of Biomedical Engineering at Eindhoven University of Technology and principal investigator of Metabolic Systems Biology Eindhoven. His research interests include mathematical modelling and identification of biological systems. Paolo Vicini, Ph.D., is associate professor of bioengineering at the University of Washington, Seattle, and director of the Resource Facility for Population Kinetics, a NIH/NIBIB research resource. He holds a PhD from the Polytechnic of Milan, Italy (1996) and a Laurea degree in electrical engineering from the University of Padova (1992). His research interest focus on mathematical and statistical models of biological systems, in particular regarding the inverse problem, the estimation of biologically meaningful parameters from noisy data, modeling and simulation software development and issues of model selection. He received the EMBS Early Career Award in 2003. Antonio Vidal-Puig, MD, PhD is a reader in human metabolism at Cambridge University, deputy director of MRC Center for Obesity and Associated Diseases (CORD), honorary consultant in metabolic medicine at Addenbrooke’s Hospital. He received his MD from Valencia University and his PhD from Granada Medical School. Dr. Vidal-Puig did his postdoctoral training and become junior faculty at Harvard University before relocating in 1999 to Cambridge University. His areas of interest are related to the role of lipids in insulin resistance and diabetes, and more specifically to the concept of lipotoxicity as the pathogenic mechanism linking obesity to insulin resistance. R. William Watson is a senior lecturer in the School of Medicine and Medical Science, University College Dublin (UCD) and principal investigator at the UCD Conway Institute and Dublin Molecular Medicine Centre. He is also lead co-ordinator of the Cancer Biology Group in the UCD Conway Institute, which consists of 29 independent investigators. He has used transcriptomic and proteomic approaches to investigate the cellular and molecular mechanisms by which prostate cancer epithelial cell die, leading to new diagnostic tools and therapeutic targets. He is a founding member of the Prostate Cancer Research consortium and chair of the Bio-Resource Management and Implementation group of the consortium were he has established standard operating procedures for the appropriate collection of tissue, blood and urine from men undergoing radical prostatectomy. Bart Weimer directs the Center for Integrated BioSystems (CIB) at Utah State University. He is a recognized expert in microbial physiology and functional genomics. As director he is focused on using his expertise to lead the CIB in research, core services, and biotechnology training. Prior to joining USU, he obtained degrees from University of Arizona (BS, honors) and Utah State University (PhD) in microbiology. He trained at the University of Melbourne (Australia) as a postdoctoral fellow in genetics and biochemistry. He has worked in microbiology for over 17 years. Peter Wellstead’s research is in mathematical modelling and data analysis motivated by problems in biology, physiology and medicine. After an apprenticeship with Marconi Instruments and a first degree in electrical engineering from the Hatfield College of Technology, UK in 1967, he conducted doctoral research in random signal processing at Warwick University UK, graduating in 1970, with DSc awarded in 1988. A period with CERN was followed by a career at the Control Systems Centre (UMIST) where

16

About the Contributors

he became professor of control engineering. Since 2004 he has been Science Foundation Ireland (SFI) research professor of systems biology at the Hamilton Institute. Olaf Wolkenhauer’s research is in mathematical modelling and data analysis, focussing on nonlinear dynamic systems in cell biology. After first degrees in control engineering from the University of Applied Sciences in Hamburg, Germany and the University of Portsmouth, U.K. in 1994, he conducted doctoral research in possibility theory for data analysis at UMIST, Manchester, graduating in 1997. A research lectureship at the Control Systems Centre (UMIST) led to a joint senior lectureship between Biomolecular Sciences and Electrical Engineering and Electronics, at UMIST. Since 2003 he has held the Chair in Systems Biology and Bioinformatics at University of Rostock in Germany. Bradly G. Wouters is professor and head of the laboratory of radiation oncology at Maastricht University in the Netherlands. Professor Wouters received his PhD from the Medical Biophysics Department at the University of British Columbia and then conducted post-doctoral research at Stanford University. He is an expert in the field of molecular radiation oncology with a primary interest in understanding the cellular and molecular responses to hypoxia and their influence on the biological behavior of tumors. Dr. Wouters also has active research interests in DNA repair and is actively involved in translational research studies with the radiation oncology. Paul Wrede studied biology at the Freie Universität Berlin. He worked on molecular evolution topics at The Max-Planck-Institut für Molekulare Genetik, Berlin, Diploma and PhD, Dept. Prof. Wittmann. He has done his post-doctoral research at Massachusetts Institute of Technology, Cambridge, USA, laboratory of Prof. Alexander Rich, evolution of tRNAs. He was assistant at University of Heidelberg, Lab. Prof. Hermann Bujard and at the Freie Universität Berlin, working on membrane proteins, protein integration and secretion, founding the bioinformatics group, Lab. Biophysics Dept. Prof. Georg Büldt. Currently he isprofessor and bioinformatics group leader at the Charité in the Institut für Molekularbiologie und Bioinformatik, head Prof. Burghardt Wittig. Wasco Wruck received his diploma in computer science from Technical University Berlin in 1990. After working in a research project for parallel computer architectures and developping software in the telecommunication industry he joined the Max-Planck-Institute for Molecular Genetics in 1999. His interests are in image analysis and in microarray evaluation methodology. Urszula Zabarylo obtained her Bachelor’s degree in medical physics in 1999 from the University of Nicolai Copernicus in Poland and Master of Science degree in experimental Physics from the Free University of Berlin in 2004. Since 2005 she joints the Institute for Medical Physics and Optical Diagnosis at Charité, Berlin. Her research interests include image processing, tissue optics and optical diagnostics in medicine. Christos C. Zouboulis was born in 1960. MD, University of Athens; Dr. Med, Medical School, The Free University of Berlin; Diploma in dermatology, venerology, allergology and proctology (Berlin Medical Association). Since 2000 is professor of dermatology, Medical School, The Free University of Berlin. Since 2005 chair of departments of Dermatology and Immunology, Dessau Medical Center and head of the Laboratory for Biogerontology, Dermato-Pharmacology and Dermato-Endocrinology,

17

About the Contributors

Institute of Clinical Pharmacology and Toxicology, Charité Universitaetsmedizin Berlin. President of the European society of Anti-Aging Medicine (ESAAM), spokesperson of the research group “DermatoEndocrinology” of DDG, chair of the executive committee William J. Cunliffe Scientific Awards and of the german register Morbus Adamantiades-Behçet e.V.. Oskar-Gans-, Felix Wankel-, Geroulanos-, Paul-Gerson-Unna-, Springer-Verlag prize winner, Honorary member of the Lithouanian Dermatology Society.

18



Index

Symbols 2D-PAGE 408,  409,  410,  411,  412,  413, 414,  417 5-aminolevulinic acid (ALA) 599,  600,  601,  602,  604,  608,  618,  619,  620,  621, 630,  636,  641,  642,  643,  644,  646, 649,  650,  653,  654 β-barrel 182,  183,  184,  185,  186,  187, 188,  189,  190,  191,  192,  193,  194, 195,  196

A adaptive immunity 6,  379,  382 additive model 256,  411,  502,  504,  830 adenosine diphosphate (ADP) 573,  574,  587, 614,  615,  646 adenosine triphosphate (ATP) 307,  334, 364,  374,  459,  573,  574,  587,  614, 685,  686 adipose tissue 355,  356,  358,  363,  368,  467 Affymetrix 249,  250,  251,  252,  253,  254,25 5,  256,  257,  259,  255,  260,  251, 260,  255,  261,  262,  263,  264,  265, 266,  269,  276,  342,  345,  346,  387, 388,  406,  721 agglomerative clustering 209,  211 allelic association 263,  266 allostasis 24,  358 alternative splicing 144,  148,  160,  241, 259,  262,  263,  264,  265,  266,  267, 269,  270,  271,  272,  273,  274,  275, 276,  277,  291,  293,  295,  298,  300, 302,  304,  305,  306,  307,  308,  309 amplitude modulation 667,  668,  669

analysis of variance (ANOVA) 270,  347,  412 Andronov-Hopf bifurcation 36,  37,  40,  41, 43,  55,  57,  59,  60,  61,  72 apoptosis 22,  74,  75,  79,  80-85,  93,  94, 298,  309,  327, 329, 351,  352,  359, 368,  382,  383,  387, 398,  427,  435, 487,  539,  588,  589, 598-609,  612628,  631-639,  641,  675,  686,  690, 691,  703,  704,  707,  721 avian influenza 797,  798,  799,  803,  807

B background correction 222,  231,  232,  237, 242,  243,  251,  254,  411 backpropagation through time 504,  514 bacterial robot 106 balance equation 76,  82 basic local alignment search tool (BLAST) 135,  146,  149,  150,  152,  161,  162, 166,  245,  249,  399,  485,  494 Bayesian information criterion (BIC) 212,  213,  215,  217,  507 Bayesian networks 8,  10,  100,  112,  113,  34 9,  397,  499,  506,  507,  508,  512,  514,   520,  526,  528 bead-level-analysis 242,  243 BeadArray 239,  249 BeadStudio 240,  241,  242,  243,  244 beta-thalassemia 291,  308 biobricks 104,  113 biochemical network 8,  327,  389,  390,  493,   569 bioconductor 240,  241,  242,  243,  244,  247, 248,  260,  286,  289,  290,  341,  345

Copyright © 2009, IGI Global, distributing in print or electronic forms without written permission of IGI Global is prohibited.

Index

biomarker 10,  119,  120,  121,  126,  130, 132,  133,  134,  137,  138,  140,  352 Boolean logic 4,  75 Boolean models 75,  391,  392,  393,  394,  500 bootstrapping 150,  219 bottom-up approach 112,  391,  392

C candidate gene approach 366,  367 cell division cycle (CDC) 31 ceramides 356,  360,  637 chromatin immunoprecipitation 384,  401,  518,  519,  696 cluster analysis 100,  119,  210,  214,  217, 218,  219 combinatorial complexity 1 conformational entropy 734,  736,  738,  741,  742,  744,  746,  749,  750,  751,  756, 757,  758 controllability 16 cross-hybridization 253,  254,  255 crosstalk 16,  17,  18,  23,  24,  378,  635, 674,  717

D data integration 340,  403,  414,  416,  418, 476,  477,  478,  480,  481,  482,  483, 484,  485,  486,  488,  489,  490,  491, 492,  516,  517,  523 dehydroepiandrosterone (DHEA) 467,  468,  772,  774,  778 delay differential equation (DDE) 33,  34,  35,  36,  66,  67 dengue fever 808,  809,  810,  820,  822,  823 depolarization 638,  664,  668,  680,  684,  685, 686,  688,  689,  690 deterministic kinetic modeling 74 deterministic models 75,  324,  738,  799 differential expression 119,  242,  248,  334,  412 dilatative cardiomyopathy (DCM) 438,  446,  447,  449,  456 dimension reduction 118,  213,  214,  413, 838,  847 discrete dynamical system 531,  533,  534,  535,  537



discriminant analysis 118,  210 disulphide bridges 746 divisive clustering 211 dynamical Bayesian models 391,  393 dynamical Boolean models 392,  393 dynamical diseases 30 dynamical system 14,  16,  25,  34,  54,  500, 501,  502,  515,  531,  532,  534,  535, 537,  540

E eigenvalue 41,  43,  57,  82,  84,  95,  578, 803,  815,  819 electrostatic solvation 742,  747,  748,  749 enthalpy 731,  732,  734,  742,  743,  744,  745, 747,  748,  750,  751,  758 entropy 139,  225,  227,  231,  232,  234, 236,  237,  238,  500,  511,  545,  731, 732,  733,  734,  735,  736,  737,  738, 739,  740,  741,  742,  743,  744,  745, 746,  748,  749,  750,  751,  752,  753, 754,  755,  756,  757,  758,  838 enzyme-linked immunsorbent assay (ELISA) 447,  448,  449,  456 equilibrium constant 77,  78,  735,  737,  741 erythrocytes 379,  662,  663,  664,  665,  667, 669 exciton 573,  576,  578,  579,  583,  584,  586 Exon Array 263,  264,  270,  272,  274,  276 expressed sequence tag (EST) 263,  267,  269, 270,  274,  275,  276,  305,  487

F FARMS 256,  261 feature extraction 119,  120,  121,  439,  441,  442 feedback control 12,  15,  24,  71,  554,  644 feedback loops 15,  17,  23,  30,  31,  72,  80,  91,  349,  372,  533,  534,  535,  536, 540,  717 fluorescence intensity 680,  684,  685,  686,  688 fluorescence microscopy 120,  597,  599,  639,  685 free energy 731,  732,  734,  735,  736,  737, 738,  741,  742,  743,  744,  745,  746,

Index

747,  748,  749,  750,  751,  752,  755, 757,  758 frequency modulation 667,  668

G G-protein coupled receptors (GPCRs) 167, 168,  170,  171,  169,  171,  172,  173, 174,  175,  176,  177,  179,  180,  181 Gene Expression Profile 236 gene ontology 348,  397,  416,  493,  519,  521, 522,  523,  524,  526,  724 gene regulatory network 9,  74,  503,  512,  516 gene shaving 215,  219 gene signature 346,  348 genetic algorithm 124,  433,  435,  502,  503,  504,  513,  580,  581 genetic regulatory network 531,  532,  535,  539 genome-wide scanning 366 gonadotropin 768,  794,  795 gonadotropin releasing hormone (GnRH) 764,  765,  766,  767,  768,  774,  793, 794,  795

H heat shock proteins 588,  589,  622,  631, 674,  691 heat stress response 678,  691 heme 130,  575,  588,  589,  591,  599, 600,  620,  621,  622,  625,  631,  637, 643,  644,  645,  646,  648,  649,  650, 652,  653,  654 hierarchical clustering 149,  152,  153,  163, 164,  210,  211,  213,  218,  249 high-throughput methods 362,  369 Hill function 760,  761,  762,  766,  767,  768 ,795 histopathology 825,  826,  827,  829,  830, 831,  832,  833,  834,  837,  842,  846, 847 homeostasis 12,  13,  15,  32,  33,  329,  331, 334,  335,  354,  355,  356,  359,  368, 389,  460,  530,  533,  538,  616 Hopf's theorem 27 host-pathogen interaction 381,  390

human-pathogenic fungi 403,  404,  406,  408, 409,  410,  411,  412,  413,  414,  416, 417,  418 hybridization 118,  220,  222,  226,  240, 242,  249,  252,  253,  254,  255,  257, 259,  261,  264,  265,  266,  267,  268, 280,  289,  342,  400,  411,  527 hydrogen bonds 183,  186,  746,  747,  748 hydrophobicity 131,  174,  186,  187,  442, 444,  448,  597,  749 hyperthermia 673,  674,  675,  685,  686, 688,  689

I identifiability 15 image pre-processing 825,  826 immune response 377,  379,  451,  536,  539, 610 immunocompromised 404,  405 in-paralogs 145,  147,  151,  164 in-silico simulation 12,  14,  21 infectious systems biology 378,  390 interaction graph 388,  389,  700 interference microscopy 656,  657,  659,  661, 662,  663,  664,  665,  666,  669,  670, 671,  672 interferometers 658,  659,  672 in vitro 52,  107,  112,  114,  195,  300,  308, 331,  334,  335,  340,  344,  346, 347,   350,  356,  368,  425,  429,  445-447 ,  467,  470,  542,  543,  546,  554, 597,  598,  601,  603,  614-618,  621, 622,  628,  630,  632,  635-637,  641, 645,  697,  701,  702,  706,  710 in vivo 31,  52,  107,  110,  175,  192,  195, 327,  332,  340,  344,  355-358,  368, 384,  395,  429,  435,  445,  470,  485, 542,  546,  554,  591,  592,  603, 608,  610,  614,  615,  618,  622,  625, 631,  635,  637,  640,  697,  698,  701, 706,  709,  710,  712,  713 isoform 19,  262,  263,  264,  270,  273,  274,  275,  276,  277,  293,  300,  303,  309, 358,  621,  645



Index

J J-aggregates 675,  676,  677,  680,  681,  684,  686,  688 Jacobian matrix 82,  83,  84,  87,  802,  814, 815,  818,  819 Jaynes 237 JC-1 monomers 676,  684,  686 joint probability distribution 505,  506

K k-means clustering 209,  523 Kalman filtering 17 kinetic laws 76,  77,  89,  489,  648 knowledge discovery 126,  127,  128,  133, 134,  137,  477,  486

L laboratory evolution 105 Law of Mass Action 77,  78 least square fit 503 lipidomics 354,  355,  356,  357,  359,  408 lipotoxicity 356,  359,  360 Lyapunov-Andronov theory 27,  28,  44

M Mach-Zehnder interferometer 659,  672 Markov Chain Monte Carlo (MCMC) 508,  515 mass spectrometry 100,  102,  117,  119,  120,  121,  122,  123,  124,  131,  132,  138, 282,  284,  384,  408,  619,  698 mast cell 664,  666,  667,  669,  670,  671 MATLAB 14,  18,  24,  25,  47,  61,  99,  113,  401,  411,  468 maximum likelihood method 212,  215,  220, 228,  504,  557,  559,  560,  561,  562,  570 metabolic control analysis (MCA) 74,  75,  85,  88,  91,  95 metabolic engineering 278,  458,  459,  465,  471 metabolic flux balancing 458,  459,  460,  462, 465,  467,  468,  469,  470,  471 metabolic pathways 2,  4,  7,  14,  30,  74, 103,  134,  158,  283,  284,  288,  368,



374,  401,  452,  459,  462,  465,  470, 523,  647 metabolomics 8,  278,  279,  284,  286,  353, 354,  355,  357,  360,  408,  413 MicroArray quality control (MAQC) 246, 247,  248,  249,  259,  260 microarrays 5,  117,  118,  123,  124,  209, 219,  226,  229,  232,  237,  239,  246, 250,  251,  252,  258,  259,  263,  266, 274,  275,  289,  290,  305,  339,  340346,  349,  351,  353,  361,  362, 366 369,  375,  383,  384,  400,  406,  409, 410,  414,  420,  467,  487,  497,  512, 517,  518,  526-529,  619,  621,  696, 698,  711,  712,  826,  829 micro electrode array (MEA) 541,  542,  543,  544,  545,  546,  548,  549,  550,  551, 553,  554 minimal genome 106,  110 mitochondrial transmembrane potential 675,  677,  679,  690 mixed effects models 558,  559,  561,  564, 566,  570,  571 mixed models 215,  218 mixture models 212,  213,  219,  221,  229 model-based clustering 212,  527 model decomposition 776,  779,  787 multiple myeloma 423,  427,  433 multiple sequence alignments 151,  152,  175,  180 mutual information 153,  154,  500,  501, 505,  513,  514

N nanorobot 106 natural language processing (NLP) 171,  174 neuronal network 541,  542,  545,  550,  551, 554

O obesity 354,  355,  358,  359,  362,  363,  365,  366,  368,  375,  467,  724 observability 16 ODE system 75,  77,  82,  83,  89,  489 optimal control 13,  17,  22 orthogonal life 110

Index

orthology 145,  146,  147,  148,  149,  150,  151, 152,  159,  160,  161,  162,  390,  391,  719, 721,  729 OrthoMCL 151,  158,  162,  164,  400,  719,  7 21,  723 overfitting 347,  840,  841 oxygenic photosynthesis 573,  574

P P-POD 151,  163 paralogy 147,  148,  150,  161,  165 parameter scanning 74,  75,  82,  85,  89 pathway biology 1,  2,  4,  6,  10 Petri Net 9,  508,  512,  513,  537 Pfam 145,  151,  152,  155,  158,  163,  164,  177,  180,  199 phase contrast microscopy 657,  658 phase image 658,  660,  664,  665,  672 PhIGs 152,  162 photodynamic therapy (PDT) 624,  625,  626,  627, 628,  629,  630,  631,  632,  633,  634,  635, 636,  637,  638,  639,  640,  641,  643,  646, 652,  653 phylogenetic profiling 143,  144,  154,  158,  160, 161,  164,  165 Poisson process 546,  766 population kinetic analysis 556,  557,  568 porin 189,  190,  191,  196,  197,  198,  199,  201, 202,  203,  204,  205 porphyrin metabolism 643,  647,  648,  652,  654 Power Series Distribution 237 preprocessing 251,  253,  254,  256,  257,  259, 414,  509 principal component analysis 187,  346,  736,  749,838,  847 probe set 252,  255,  256,  257,  258,  384 profile hidden Markov models 170 protein crystallization 127,  128,  129,  130,  138 protein interaction graph 700 protein interaction network 9,  10,  399,  695,  699,  705,  708,  711,  712

proteome 9,  10,  119,  132,  146,  147,  148,  203, 282,  351,  383,  385,  386,  388,  403,  407, 409,  412,  417,  418,  495,  526, 699,  710, 711 proteomics 113,  119,  120,  121,  127,  131,  137, 138,  139,  143,  278,  279,  283,  286,  349, 363,  388,  408,  410,  413,  416,  418,  419, 477,  479,  488,  495,  694,  707,  710 protoporphyrin IX (PPIX) 596,  597,  599,  600, 608,  609,  615,  620,  641,  642,  646,  650 PyBioS 82,  85,  90,  91,  370,  372,  375,  643, 647,  648,  652,  654

Q QFAST algorithm 171,  172,  173 quantitative sequence activity relation (QSAR) 179,  451,  453,  457

R rate equation 76,  77 rational design 105,  446,  455 Reactome 2,  8,  92,  146,  165,  401,  487,  489, 490,  495,  647,  653,  701,  709,  714,  716, 717,  718,  720,  721-729 refactoring 103 refractive index 657,  658,  661-672 regulatory modules 516,  517,  522,  527 resampling 212,  397 retinitis pigmentosa 296,  298 rhodopsin 168,  173,  175,  176,  179 RNA silencing 27,  28,  51,  52,  53,  61,  66,  67, 68,  69,  71 robustness 16,  23,  66,  70,  71,  263,  266,  372, 374,  375,  386,  700 Routh-Hurwitz 36,  41,  45,  47,  54,  55,  57,  65,  803,  816

S sebaceous gland 331,  332,  333,  334,  336,  337 secretase 423,  424,  425,  426,  427,  428,  429, 430,  432,  433,  434,  435,  436



Index

segmentation 121,  122,  123,  124,  135,  136,   139,210,  212,  214,  228,  231,  237,  825,  826, 828,  832,  833,  834,  835,  836,  837,  842, 843,  844,  847 sequence similarity 143,  144,  145,  146,  147, 148, 149,  151,  158,  159,  160,  166, 174, 185,  189,  191,  194,  196,  386,  388,  390, 391,  444,  485 signaling pathways 23,  75,  102,  103,  168,  169, 175,  334,  335,  349,  494,  603,  605,  607, 613,  614,  625,  664,  675 single nucleotide polymorphisms (SNP) 259,  263,  267,  268,  270,  272,  276,  277,  362,  367 Smith-Waterman algorithm 146,  149 spike sorting 544,  553 spinal muscular atrophy 291,  302,  304,  305,  306 steady states 30,  55,  85,  531,  533,  534, 536,  540 stochastic control 17 stochastic models 75,  101,  393,  499,  509,  799 stoichiometry 76,  96,  462,  463 structure prediction 126,  128,  134,  135,  137, 138,  139,  140,  177,  428,  429,  724 supervised learning 513,  524,  826,  839,  841 support vector machine (SVM) 173,  174,  202, 347,  412,  840,  848 SYS biology 97,  98,  100,  110,  115 systematization 127,  128,  130,  134 System for Population Kinetics (SPK) 556, 557,  558,  560,  561,  562,  563,  564, 565,  566,  568 systems biology 2,  5,  6,  8,  9,  11-18,  23, 25,  70,  74,  90,  94,  95,  112,  113, 126,  128,  137,  143-145,  228,  251, 278-280,  284,  287, 288,  314,  322, 325,  327,  329,  354,  355,  358,  359,  361,  363,  367,  369,  370,  374,  375,  378,  380,  384,  386,  390,  392,  395397,  399-404,  418,  438,  452,  458, 459,  471,  476-480,  485,  486,  488 493,  513,  514,  539,  569,  588,  589, 624,  653,  674,  687,  710,  731,  732, 826



Systems Biology Workbench (SBW) 90,  99,  324,  330 systems theory 12,  13,  14,  15,  16,  28,  393

T Tanimoto coefficient 430,  431 taxonomy 152,  153,  161,  484,  708 thermodynamics 731,  732,  733,  734,  736, 737,  738,  739,  751,  752,  753,  754, 755,  756,  757,  758 time-course simulation 81,  84 transcriptional rate 233,  531 transcriptional regulatory network 362,  516 transcription factors 91,  366,  368,  370, 389, 401,  487,  498,  516,  518-523, 528,  530,  531,  535, 588,  589,  600, 602,  605,  606,  622,  625,  687,  691, 703,  711 transcriptomics 353,  408,  413,  416,  419, 421,  479 transmembrane 167-197,  199,  200-202,  206, 207,  301,  304,  425,  426,  428,  430, 573,  673,  675,  677,  679,  684,  690, 704,  708 TreeFam 152,  164,  165

V von Willebrand disease 296,  305

W wavelet analysis 656,  657,  665,  667,  668, 669,  671