Gene expression and regulation

Jun Ma Editor

Gene Expression and Regulation

^ m i W a iiS4± ^ HIGHER EDUCATION PRESS

J ^

Snrinaer wJJ^X l l l g t l .

JunMA Division of Developmental Biology Cincinnati Children's Hospital Research Foundation University of Cincinnati College of Medicine 3333 Bumet Avenue Cincinnati, OH 45229 USA

E-mail: Jun. ma@cchmc. org

S ^ S S K f i ^ B (CIP) UDg S H W * i i - ^ i ^ g = G e n e Expression and R e g u l a t i o n / ^ ^ ± ^ . ISBN 7-04-017675-0

i.»...

n.^... m . S H « i i - w ^ - ^ i

IV.Q753

4^H)K*ffl1^tgCIP|fe|g1^^ (2005) m 140172^ ffl^: 01-2006-0366 Copyright © 2006 by Higher Education Press 4 Dewai Dajie, Beijing 100011, R R. China Distributed by Springer Science+Business Media, LLC under ISBN 0-387-33208-1 woridwide except in mainland China by the arrangement of Higher Education Press. All rights reserved. No part of this book may be reproduced or transmitted in any form or by any means, electronic or mechanical including photocopying, recording or by any information storage and retrieval system, without permission in writing from the Publisher While the advice and information in this book are believed to be true and accurate at the date of going to press, neither the authors nor the editors nor the publisher can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no warranty, express or implied, with respect to the material contained herein. ISBN 7-04-017675-0 Printed in P. R. China

Contents About the Editor Preface

Section I The History Chapter 01

Transcription: The Never Ending Story

3

Section II The Machinery Chapter 02 Chapter 03 Chapter 04 Chapter 05 Chapter 06 Chapter 07

The General Transcription Machinery and Preinitiation Complex Formation 21 The Dynamic Association of RNA Polymerase II with Initiation, Elongation, and RNA Processing Factors during the Transcription Cycle 49 General Cofactors: TFIID, Mediator and USA 67 Chromatin and Regulation of Gene Expression 95 HATsandHDACs 111 Structure and Function of Core Promoter Elements in RNA Polymerase II Transcription

Section III The Regulators Chapter 08 Chapter 09 Chapter 10 Chapter 11 Chapter 12 Chapter 13 Chapter 14 Chapter 15 Chapter 16 Chapter 17 Chapter 18 Chapter 19 Chapter 20

Transcriptional Activators and Activation Mechanisms 147 Transcriptional Repressors and Repression Mechanisms 159 STATs in Cytokine-mediated Transcriptional Regulation 175 Transcriptional Regulation by Smads 185 The Rb and E2F Families of Proteins 207 c-Jun: A Complex Tale of a Simple Transcription Factor 219 HIV Tat and the Control of Transcriptional Elongation 239 Post-translational Modifications of the p53 Transcription Factor 257 Actions of Nuclear Receptors 2 73 NFAT and MEF2, Two Families of Calcium-dependent Transcription Regulators Hox Genes 309 Nuclear Factor-kappa B 321 The ATF Transcription Factors in Cellular Adaptive Responses 329

Section IV The Genome Chapter 21 Chapter 22 Chapter 23 Chapter 24 Chapter 25 Chapter 26

Function md Mechanism of Chromatin Boundaries 343 Heterochromatin and X Inactivation 365 DNA Methylation Regulates Genomic Imprinting, X Inactivation, and Gene Expression during Mammalian Development 377 Comparative Genomics of Tissue Specific Gene Expression 393 Transcription and Genomic Integrity 409 Cell Death and Transcription 431

293

135

Gene Expression and Regulation

Section V Special Topics Chapter 27 Chapter 28 Chapter 29 Chapter 30 Chapter 31 Chapter 32 Chapter 33 Chapter 34 Chapter 35

Pre-mRNA Splicing in Eukaryotic Cells 447 Genome Organization: The Effects of Transcription-driven DNA Supercoiling on Gene Expression Regulation 469 The Biogenesis and Function of MicroRNAs 481 Transcription Factor Dynamics 493 Actin, Actin-Related Proteins and Actin-Binding Proteins in Transcriptional Control 503 Wnt Signaling and Transcriptional Regulation 519 Regulatory Mechanisms for Floral Organ Identity Specification mArabidopsis thaliana 533 Transcription Control in Bacteria 549 Gene Therapy: Back to the Basics 565

About the Editor Jun Ma is an Associate Professor at the Division of Developmental Biology, Cincinnati Children's Hospital Research Foundation and University of Cincinnati College of Medicine. He graduated from Peking University in 1982, majoring in Biology. He did his graduate work with Mark Ptashne at the Department of Biochemistry and Molecular Biology in Harvard University, and was a Junior Fellow at the Harvard Society of Fellows between 1989-1992. He spent the summer of 1988 in the laboratory of Christiane Niisslein-Volhard at the Max-PlanckInstitute for Developmental Biology in Tubingen to collaborate with Wolfgang Driever. He joined the faculty of the University of Cincinnati College of Medicine in 1992 and has remained there since. Currently he also has a collaborative base at the Institute of Biophysics of the Chinese Academy of Sciences in Beijing. His earher work on the yeast activator GAL4 helped pave the way to the development of the yeast two-hybrid system. His current research focuses on the mechanisms of transcription control and development in Dwsophila.

Preface All genes must be expressed to exhibit their biological activities. How genes are expressed and regulated is a central question in molecular biology and our knowledge in this area has been expanding enormously in recent years. The complexity of gene regulation is compounded by the fact that gene activities reach every comer of biology. Transcription is universally the first step toward expressing a gene. It is a highly regulated process. Understanding the molecular mechanisms of transcription regulation is of fiindamental importance. For protein-coding genes, post-transcriptional steps, including pre-mRNA processing, mRNA transport and translation, can also play important roles in regulating gene expression. To contain the scope of this book, we will focus primarily on RNA polymerase II transcription and regulation. We will explore not only the biochemical basis of transcription but also the biological consequences of, and biological influences on gene transcription. The book is composed of 35 individual review articles written by authorities in the field. The chapters are organized into five sections: The History, The Machinery, The Regulators, The Genome, and Special Topics. The History section contains one chapter, written by James Goodrich and Robert Tjian, who provide an excellent historical perspective and overview of the transcription process. The Machinery section has six chapters that cover essential topics on the transcriptional apparatus, general cofactors, chromatin structure, and core promoter structure. The Regulators section has thirteen chapters. While the first two of them investigate the mechanisms of transcriptional activation and repression, the remaining eleven chapters discuss in depth selected gene-specific transcription factors that play critical roles in a variety of biological processes, including STATs, Smads, NFKB, nuclear receptors, NFAT, Rb, p53, HIV Tat, ATFs, c-Jun and Hox proteins. The Genome section contains six chapters that examine topics relevant to transcription regulation and genome behavior, including chromatin boundaries, heterochromatin, DNA methylation, genomic analysis, genomic integrity, and cell death. Finally, the Special Topics section contains nine chapters that investigate such important issues as pre-mRNA splicing, DNA supercoiling, microRNA, transcription factor dynamics, role of actin in transcription, gene therapy, and transcription regulation in bacteria, plants and developmental signaling. When Higher Education Press invited me to write a textbook for their Current Scientific Frontiers book series two years ago, I did not think I had the time needed to tackle such a big project. Instead, I made a proposal—endorsed quickly by HEP—to explore the possibility of editing a book (resembling a textbook style) on the topic of gene expression and regulation, with individual review articles written by experts in the field. Without the enthusiastic support and generous commitment from the contributors, this project would have never even started. I am deeply indebted to all of them. Every chapter in this book is a scholarly work reflecting numerous hours of intense efforts of the contributors. I would like to express my special thanks to Cheng-Ming Chiang for generously contributing two excellent chapters, a few contributors for kindly agreeing to write on relatively short notice, and Gordon Hager for providing the cover photo and design suggestions. I would also like to thank HEP for their flexibility and trust in this project, and the HEP and Springer editorial and design teams, in particular Li Shen at HEP, for their excellent work. Finally, I would like to thank Bingxiang Li at HEP for the countless email communications and her hard work—at every step along the way—that made this book a reality.

JunMa Cincinnati, USA November 18, 2005

Section I The History

Chapter 01 Transcription: The Never Ending Story James A. Goodrich^ and Robert Tjian^ Department of Chemistry and Biochemistry, University of Colorado, Boulder, CO 80309 Molecular and Cell Biology Department, University of California, Berkeley, Berkeley, CA 94720

Key Words: transcription, promoter, activator, coactivator, general factors, chromatin, RNA polymerase II

Summary After more than 30 years of intense and sustained activity, the field of transcriptional control in eukaryotes continues to deliver unexpected and revealing montages of the remarkably complex yet elegant consequences of evolution. Transcription research started from humble beginnings with the isolation of 3 distinct RNA polymerases. This was followed by a rich period of mapping promoters, enhancers and the isolation of the first sequence specific DNA binding regulatory factors. These studies in turn led to the unraveling of the multi-subunit pre-initiation apparatus culminating with the modem era of co-activators and chromatin remodeling complexes. Throughout this opus of biochemical discovery we have witnessed a beautifiil convergence of in vitro biochemical tour-de-force combined with the power of molecular genetics and cell biology. In this short preamble, we offer a brief and very likely incomplete history of the maturing of eukaryotic transcription and its prospects for the fiiture. Fumbling in the Dark: Hoping for Simplicity Emboldened by the inspiring successes of pioneering work in the biochemistry of DNA replication and bacterial phage transcription, early workers struggling with animal and human gene regulation followed suit by isolating not one but three distinct enzymes: RNA polymerase I, II and III each dedicated to the synthesis of rRNA, mRNA, and tRNA/5sRNA

respectively (Krebs and Chambon, 1976; Sklar et al, 1975). However, due to the lack of promoter specific DNA templates or the ability to obtain sufficient quantities of "cloned" DNA, the ability of these 3 distinct enzymes to discriminate between the different classes of genes remained obscure. Nevertheless, the chromatographic separation and in vitro biochemical assays for detecting the RNA polymerases opened the first doors to the fiiture development of high fidelity promoter specific and eventually activator regulated transcription in cellfi-eesystems. Because, eukaryotic RNA polymerases behaved in a rather promiscuous and DNA template independent fashion in vitro, there was a brief period, (after the discovery of heterogeneous nuclear RNA) in which it was popular to posit that, unlike bacterial transcription which is temporally regulated by cascades of a-factors, eukaryotic transcription may be "unregulated". Instead, one imagined that post transcriptional RNA processing (i.e. splicing, poly A addition, capping, etc.) would largely determine the population of mRNA's destined for gene product expression. Although this "random transcription" model fit with some early data regarding the apparent lack of promoter DNA selectivity in vitro of eukaryotic RNA polymerases, it soon became clear from studies of mammalian viruses (SV40, Adeno 2) that at the very least, specific DNA sequences that lie near transcription start sites (i.e. TATA elements and GC boxes) played some role in determining elements of the eukaryotic "promoter" (Fig.1.1) (Myers et al, 1981; Rioe^^/., 1980; Tjian, 1978). As is often the case with biology in general but especially in the study of eukaryotic transcriptional regulation, we invariably opted for simplicity and hoped that a well defined -3 5/-10 like element such as the

Corresponding Author: Robert Tjian, Tel: (510) 642-0884, FAX: (510) 643-9547, E-mail:[email protected]

Section I The History

popular TATA box of Ad2 would suffice to designate the necessary cis-regulatory information of a promoter (Corden et al, 1980; Hu and Manley, 1981). This rather minimalist view was, however, decisively toppled when both in vitro and cell based assays were developed that revealed the existence of important upstream distal as well as proximal DNA sequences in eukaryotic promoters (Banerji et al, 1981; Benoist and Chambon, 1981; Fromm and Berg, 1983; Gidoni et al., 1985; Myers and Tjian, 1980; Picard and Schaffiier, 1984). With the emergence of cloned promoter sequences and DNA template dependent in vitro transcription reactions measured by run-off and primer-extension assays the combinatorial nature of multiple cis-control elements of eukaryotic gene regulatory units became firmly embedded (Mitchell and Tjian, 1989). Add to these in vitro assays the advent of transient transfection assays and microinjection in animal cells that revealed the existence of "orientation and distance independent" enhancer elements and we began, for the first time, to get a glimpse of the complex regulatory network of gene transcription that would follow in succeeding decades (McKnight and Tjian, 1986; McKnight, 1982; Picard and Schafftier, 1984; Treisman et ai, 1983). To this day, the precise mechanisms mediating "long distance" enhancer or silencer functions remain largely obscure despite many plausible models including DNA looping, scanning etc. Mappig cis-control elements: Proximal promoter elememts and enhancers Enhancer

^mr

HRE

^ ^

SRE H GC |>"^H TATA^iJy^ft^*- 5' helicase activity is critical for both DNA repair and transcription, the XPD 5'-^3' helicase activity is only required for DNA repair (Zurita and Merino, 2003). The ATP-dependent DNA helicase activities of TFIIH are also necessary for opening the promoter region surrounding the transcription start site and maintaining the transcription open complex (Holstege et a/., 1997). This requirement for XPB helicase activity in transcription may be bypassed by the use of either supercoiled or premelted templates (Parvin and Sharp, 1993; Pan and Greenblatt, 1994; Parvin er a/., 1994; Tantin and Carey, 1994), further supporting a role of TFIIH in open complex formation. D: TFIIH and Nucleotide Excision Repair Nucleotide excision repair (NER) is a process where damaged DNA is removed and replaced by newly synthesized DNA based on sequence information from the intact template strand. The finding that p89/XPB is identical to ERCC3, a DNA excision repair protein which is defective in patients with xeroderma pigmentosum, led to the hypothesis that transcription might be coupled to DNA repair (Schaeffer et al., 1993). Consistent with the fact that TFIIH may play a dual role in transcription and DNA repair is the observation that transcriptionally active genes are preferentially repaired (Bohr et al, 1985; Mellon and Hanawalt, 1989). For NER, the combined helicase activities of XPB and XPD seem to be required. Experiments have shown that

microinjection of TFIIH into human XPD- or XPBmutant cells led to complementation of repair -deficient phenotype (van Vuuren et aL, 1994). Similarly, yeast cells with a mutation in the yeast homolog for XPD was rescued with the addition of TFIIH and not by the addition of XPD alone, suggesting that NER is only functional in the context of TFIIH (Wang et aL, 1994). Subsequent studies have shown multiple components in TFIIH are required for DNA repair, including XPB, XPD, p62, p52, and p44 (Drapkin et aL, 1994; Humbert et aL, 1994; Schaeffer et aL, 1994; Wang et aL, 1995; Jawhari et aL, 2002). The XPB and XPD helicase functions are required for transcription-coupled NER, as defects in helicase activity are linked to human diseases including XP, TTD, and CS. Recent studies have unraveled the mechanism by which the XPB helicase subunit of TFIIH functions in NER and transcription. Experiments showing phosphorylation of the serine 751 residue of XPB leads to inhibition of NER activity, but does not prevent TFIIH from unwinding DNA (Coin et aL, 2004). Instead, phosphorylation of XPB serine 751 prevents the 5' incision triggered by the ERCCl-XPF endonuclease (Coin et aL, 2004), providing convincing evidence that a separate but essential role of TFIIH is involved in both transcription and DNA repair. E: TFIIH and CTD Phosphorylation CDK7 is the kinase responsible for phosphorylating the serine 5 residue of the pol II CTD, whose activity is regulated by cyclin H, MATl, TFIIE and Mediator (Svejstrup et aL, 1996). The CDK7-cyclin H-MATl CAK complex in the context of TFIIH has higher activity in phosphorylating the CTD compared with the free form of CAK (Yankulov and Bentiey, 1997). Phosphorylation of serine 5 leads to recruitment of 5' capping enzyme (Cho et aL, 1997; Komamitsky et aL, 2000; Rodriguez et aL, 2000; Schroeder et aL, 2000; Pei et aL, 2001) and promoter escape. That CTD phosphorylation regulates the transitionfi-omtranscription initiation to elongation is supported by observations that pol II enters PIC assembly as the hypophosphorylated IIA form and escapes the promoter as the hyperphosphorylated IIO form (Hampsey, 1998). Besides phosphorylating CTD, TFIIH has also been shown to phosphorylate transcriptional activators, such as p53 (Lu et aL, 1997), retinoic acid receptom (Rochette-Egly et aL, 1997), retinoic acid receptory (Bastien et aL, 2000), Ets-1 (Drane et aL, 2004), estrogen receptora (Chen et aL, 2000), and general cofactor PC4 (Kershnar et aL, 1998). The CTD kinase activity of TFIIH can also be stimulated via interaction with transcriptional activators (Jones, 1997).

Chapter 02

GTFs and PIC Formation

F: TFHH-Activator Interactions Many activators have been shown to interact with TFIIH including Gal4-VP16, E2F1, Rb, p53, ERa, RARa, RARy, and androgen receptor (reviewed by Zurita and Merino, 2003). Consistent with TFIIH's ability to interact with many activators is the finding that TFIIH can function as a coactivator in a reconstituted cell-free transcription system (Wu et al, 1998). Perhaps activators may work by enhancing the recruitment of TFIIH for PIC assembly or stimulating the enzymatic activities of TFIIH (Zurita and Merino, 2003). Conversely, TFIIH may covalently modify amino acid residues critical for activator fiinction. For example, TFIIH has been shown to stimulate the transcriptional activity of the N-terminal activation domain (AF-1) of nuclear receptors RARa 1 and RARy via phosphorylation of specific serine residues in AF-1 (Rochette-Egly et al, 1997; Bastien et al, 2000). Other than functioning through the kinase activity of CDK7, mutations in the XPD subunit of TFIIH also exhibited impaired phosphorylation of RARa (Keriel et a/., 2002), indicating that XPD may modulate CDK7 activity within the TFIIH complex and thereby regulate nuclear receptor phosphorylation and its transactivation activity. This finding fiirther suggests that XPD not only participates in DNA repair but also in the transcriptional process. PIC Assembly A: Initiation of PIC Assembly Formation of the PIC on the promoter is usually the rate-limiting step in transcriptional activation (Lemon and Tjian, 2000). Within eukaryotic genes, there are enhancer regions with clusters of upstream activation sequences, which allow for activator binding to regulate transcription activity. In addition to enhancers, eukaryotic genes may also contain locus control regions (LCRs) consisting of multiple transcription factor-binding sites; but unlike enhancers, which are orientation-independent and distanceindependent, LCR functions are limited by position (Grosveld, 1999). Initiation of PIC formation is normally triggered by activator binding to their cognate binding sites and followed by recruitment of transcriptional coactivators or by directly contacting GTFs. A single activator may have multiple contacts with GTFs in order to regulate muhiple steps of PIC formation. For example, p53 can interact with multiple GTFs, including TBP, TAFs, TFIIB, and TFIIH (Ko and Prives, 1996). These interactions may stimulate

35

TFIID-TFIIA-promoter complex assembly (Xing et ai, 2001) or target different steps of PIC formation in a temporal manner in response to environmental stresses (Espinosa et aL, 2003). Conversely, multiple activators, as in an enhanceosome complex, may work in a combinatorial manner to initiate the assembly of a transcription-competent complex (reviewed by Carey, 1998; Merika and Thanos, 2001). B: Chromatin Barrier to PIC Assembly An additional level of complexity must be contemplated when considering that competent PIC formation must first overcome the inherently repressive nature of chromatin. TFIID with its ability to covalently modify histones (see TFIID section) may play a critical role in modifying chromatin structure for transcription to occur. Experiments have shown that TFIID, rather than TBP, is essential for activator-dependent transcription on chromatin templates (Wu et ah, 1999). In addition to TFIID, pol II holoenzyme, which also contains SWI/SNF and GCN5, is able to initiate transcription from chromatin (Wu et a/., 1999), implicating an important role of chromatin-modifying activity in overcoming nucleosome-mediated repression of PIC assembly. With the advent of in vitro chromatin assembly, initially using Xenopus oocyte extracts (Glikin et al, 1984) and now with a completely defined recombinant chromatin assembly system coupled to transcription analysis (Fyodorov and Kadonaga, 2003; An and Roeder, 2004; Thomas and Chiang, 2005), the answers to many of these fascinating questions involving PIC formation on chromatin templates will be further uncovered in the near future. C: Stepwise Recruitment vs. Pol II Holoenzyme Pathway Evidence exists for both models of PIC assembly (Hampsey, 1998; Lemon and Tjian, 2000). The differences in factor recruitment and composition of the general transcription machinery assembled on distinct p53 target genes, in response to DNA-damaging agents (Espinosa et al., 2003), certainly argue for the existence of the sequential assembly pathway in vivo. The fact that diverse transcription complexes can be detected and isolated in vivo and in vitro further supports this model. The advantage for the stepwise assembly pathway is to selectively fine-tune individual steps for different signaling events without globally inactivating the cascade leading to gene activation. It also provides an efficient way to reactivate the pathway by simply modulating the rate-limiting step. However, a de novo assembly of functional transcription complexes may

36'

Section II

The Machinery

require a significant time, considering more than 40 polypeptides must be assembled correctly in a limited time frame to respond to cellular demands. Conversely, pol II holoenzymes are preformed prior to the initiation of transcription and are thus able to respond more rapidly to the transcriptional need of the cell. A major disadvantage of the holoenzyme pathway is that a distinct set of preassembled complexes must exist for different types of transcriptional events, which is economically unfavorable for cells to generate many complexes differing in peripheral components. However, multiple pol II holoenzyme complexes with different protein compositions involved in various biological processes have indeed been isolated (Lee and Young, 2000; see also the holoenzyme section). Thus, how transcription complexes are assembled in vivo on distinct activator-targeted genes and its functional implications remain to be investigated both on an individual and on a genome-wide basis. Conclusion Tremendous progress has been achieved concerning the structure and function of GTFs and pol II. TFIID is recognized as the key promoter recognition factor, while TFIIA and TFIIB stabilize TFIID binding to DNA. In addition to core promoter recognition, TFIID also functions as a coactivator in mediating interactions between activators and GTFs. It is an enzyme with multiple activities, including kinase, acetylase, and ubiquitin activating/conjugating activities. These multiple activities of TFIID on histones may aid in PIC assembly on chromatin templates. Following the assembly of TFIID-TFIIA-TFIIB on the promoter region, pol II/TFIIF, TFIIE, and TFIIH join the complex to form a PIC. The enzymatic activities inherent to TFIIH then facilitate promoter melting and the transition from initiation to elongation following initial phosphodiester bond formation. Although PIC assembly was defined biochemically in a stepwise fashion in vitro, it remains unclear whether the PIC is indeed assembled in this manner in vivo, or as a preexisting pol II holoenzyme complex, or via other undefined pathways. Regardless of which pathway operates in vivo, a common theme in gene regulation is activator-mediated recruitment of GTFs and pol II to upregulate PIC assembly. Activators may target individual GTFs, such as TFIID (Burley and Roeder, 1996; Naar et al, 2001; Wu and Chiang, 2001a), TFIIB (Roberts et al, 1993; Colgan et al, 1993; Sauer et al, 1995), TFIIE (Martin et ah, 1996), TFIIF (Joliot et al, 1995; Martin et al, 1996; McEwan and Gustafsson, 1997; Reide^ al, 2002),

TFIIH (Zurita and Merino, 2003), TFIIA (Ozer et al, 1994, 1998a; Kobayashi et al, 1995; Lieberman et al, 1997), and pol II (Cheong et al, 1995; Wu and Chiang, 2001a). Alternatively, activators may recruit pol II holoenzyme to the promoter via interaction with Mediator, the key component in pol II holoenzyme originally identified in yeast (Naar et al, 2001; Wu et al, 2003). Although it is generally agreed that Mediator may function as a coactivator in mediating transcriptional activation by facilitating pol II entry to the TFIID-TFIIB-promoter complex (Wu et aL, 2003), whether it exists as a preassembled pol II holoenzyme complex in a cellular environment or is recruited separately to pol II by transcriptional activators remains to be further investigated. Acknowledgment We are grateful for Drs. Parminder Kaur, Mary C. Thomas and Shwu-Yuan Wu for their comments on this chapter. The research conducted in Dr. Chiang's laboratory is currently sponsored by grants CA103867 and GM59643 from the National Institutes of Health in the United States.

References Ahn, S. H., Kim, M., and Buratowski, S. (2004). Phosphorylation of serine 2 within the RNA polymerase II C-terminal domain couples transcription and 3' end processing. Mol. Cell 13, 67-76. Albright, S. R., and Tjian, R. (2000). TAFs revisited: more data reveal new twists and confirm old ideas. Gene 242, 1-13. An, W., and Roeder, R. G. (2004). Reconstitution and transcriptional analysis of chromatin in vitro. Methods Enzymol. 377,460-474. Andel III, R, Ladumer, A. G., Inouye, C , Tjian, R., andNogales, E. (1999). Three-dimensional structure of the human TFIID-IIA-IIB complex. Science 286, 2153-2156. Apone, L. M., Virbasius, C. A., Holstege, F. C. R, Wang, J., Young, R. A., and Green, M. R. (1998). Broad, but not universal, transcriptional requirement for yTAFnl7, a histone H3-like TAFn present in TFIID and SAGA. Mol. Cell 2, 653-661. Archambauh, J., Chambers, R. S., Kobor, M. S., Ho, Y., Cartier, M., Bolotin, D., Andrews, B., Kane, C. M., and Greenblatt, J. (1997). An essential component of a C-terminal domain phosphatase that interacts with transcription factor IIF in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 94, 14300-14305. Archambault, J., Pan, G., Dahmus, G. K., Cartier, M., Marshall, N., Zhang, S., Dahmus, M. E., and Greenblatt, J. (1998). FCPl, the RAP74-interacting subunit of a human protein phosphatase

Chapter 02

GTFs and PIC Formation

that dephosphorylates the carboxyl-terminal domain of RNA polymerase IIO. J. Biol. Chem. 273, 27593-27601. Armache, K.-J., Kettenberger, H., and Cramer, P. (2003). Architecture of initiation-competent 12-subunit RNA polymerase II. Proc. Natl. Acad. Sci. USA 100, 6964-6968. Armache, K.-J., Mitterweger, S., Meinhart, A., and Cramer, P. (2005). Structures of complete RNA polymerase II and its subcomplex, Rpb4/7. J. Biol. Chem. 280, 7131-7134. Aso, T., Vasavada, H. A., Kawaguchi, T., Germino, F. J., Ganguly, S., Kitajima, S., Weissman, S. M., and Yasukochi, Y. (1992). Characterization of cDNA for the large subunit of the transcription initiation factor TFIIF. Nature 555, 461-464. Asturias, F. J. (2004). RNA polymerase II structure, and organization of the preinitiation complex. Curr. Opin. Struct. Biol. 14, \1\-\19. Auble, D. T., Wang, D., Post, K. W., and Hahn, S. (1997). Molecular analysis of the SNF2/SWI2 protein family member MOTl, an ATP-driven enzyme that dissociates TATA-binding protein from DNA. Mol. Cell. Biol. 17, 4842^851. Auty, R., Steen, H., Myers, L. C , Persinger, J., Bartholomew, B., Gygi, S. P., and Buratowski, S. (2004). Purification of active TFIID from Saccharomyces cerevisiae. Extensive promoter contacts and co-activator function. J. Biol. Chem. 279, 49973-49981. Bagby, S., Kim, S., Maldonado, E., Tong, K. I., Reinberg, D., and Ikura, M. (1995). Solution structure of the C-terminal core domain of human TFIIB: similarity to cyclin A and interaction with TATA-binding protein. Cell 82, 857-867. Bangur, C. S., Pardee, T. S., and Ponticelli, A. S. (1997). Mutational analysis of the Dl/El core helices and the conserved N-terminal region of yeast transcription factor IIB (TFIIB): identification of an N-terminal mutant that stabilizes TATA-binding protein-TFIIB-DNA complexes. Mol. Cell. Biol. 77,6784-6793. Bangur, C. S., Faitar, S. L., Folster, J. R, and Ponticelli, A. S. (1999). An interaction between the N-terminal region and the core domain of yeast TFIIB promotes the formation of TATA-binding protein-TFIIB-DNA complexes. J. Biol. Chem. 274,23203-23209. Barberis, A., Miiller, C. W., Harrison, S. C , and Ptashne, M. (1993). Delineation of two functional regions of transcription factor TFIIB. Proc. Natl. Acad. Sci. USA 90, 5628-5632. Baskaran, R., Dahmus, M. E., and Wang, J. Y. J. (1993). Tyrosine phosphorylation of mammalian RNA polymerase II carboxyl-terminal domain. Proc. Natl. Acad. Sci. USA 90, 11167-11171. Bastien, J., Adam-Stitah, S., Riedl, T., Egly, J.-M., Chambon, R, and Rochette-Egly, C. (2000). TFIIH interacts with the retinoic acid receptor y and phosphorylates its AF-1-activating domain through cdk7. J. Biol. Chem. 275, 21896-21904. Berroteran, R. W., Ware, D. E., and Hampsey, M. (1994). The sua8 suppressors of Saccharomyces cerevisiae encode

37'

replacements of conserved residues within the largest subunit of RNA polymerase II and affect transcription start site selection similarly to sua7 (TFIIB) mutations. Mol. Cell. Biol. 14, 226-237. Boeger, H., Bushnell, D. A., Davis, R., Griesenbeck, J., Torch, Y, Strattan, J. S., Westover, K. D., and Komberg, R. D. (2005). Structural basis of eukaryotic gene transcription. FEBS Lett. 579, 899-903. Bohr, V. A., Smith, C. A., Okumoto, D. S., and Hanawah, R C. (1985). DNA repair in an active gene: removal of pyrimidine dimers from the DHFR gene of CHO cells is much more efficient than in the genome overall. Cell 40, 359-369. Brand, M., Leurent, C , Mallouh, V., Tora, L., and Schultz, P. (1999). Three-dimensional structures of the TAFn-containing complexes TFIID and TFTC. Science 286, 2151-2153. Buratowski, S., Hahn, S., Sharp, R A., and Guarente, L. (1988). Function of a yeast TATA element-binding protein in a mammalian transcription system. Nature 334, 37-42. Buratowski, S., Hahn, S., Guarente, L., and Sharp, R A. (1989). Five intermediate complexes in transcription initiation by RNA polymerase II. Cell 56, 549-561. Buratowski, S., and Zhou, H. (1993). Functional domains of transcription factor TFIIB. Proc. Natl. Acad. Sci. USA. 90, 5633-5637. Burke, T. W., and Kadonaga, J. T. (1997). The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAFn60 of Drosophila. Genes Dev. 11, 3020-3031. Burley, S. K., and Roeder, R. G. (1996). Biochemistry and structural biology of transcription factor IID (TFIID). Annu. Rev. Biochem. 65, 769-799. Bushnell, D. A., and Komberg, R. D. (2003). Complete, 12-subunit RNA polymerase II at 4.1-A resolution: implications for the initiation of transcription. Proc. Natl. Acad. Sci. USA 100, 6969-6973. Bushnell, D. A., Westover, K. D., Davis, R. E., and Komberg, R. D. (2004). Stmctural basis of transcription: an RNA polymerase II-TFIIB cocrystal at 4.5 Angstroms. Science 303, 983-988. Carey, M. (1998). The enhanceosome and transcriptional synergy. Cell 92, 5-8. Carles, C , Treich, I., Bouet, F., Riva, M., and Sentenac, A. (1991). Two additional common subunits, ABClOa and ABClOp, are shared by yeast RNA polymerases. J. Biol. Chem. 266, 24092-24096. Cavallini, B., Huet, J., Plassat, J.-L., Sentenac, A., Egly, J.-M., and Chambon, P. (1988). A yeast activity can substitute for the HeLa cell TATA box factor. Nature 334, 77-80. Chamberlin, M., and Berg, P. (1962). Deoxyribonucleic acid-directed synthesis of ribonucleic acid by an enzyme from Escherichia coli. Proc. Natl. Acad. Sci. USA 48, 81-94. Chambers, R. S., Wang, B. Q., Burton, Z. R, and Dahmus, M. E. (1995). The activity of COOH-terminal domain phosphatase is

38

Section II

regulated by a docking site on RNA polymerase II and by the general transcription factors IIF and IIB. J. Biol. Chem. 270, 14962-14969. Chao, D. M., Gadbois, E. L., Murray, P. J., Anderson, S. R, Sonu, M. S., Parvin, J. D., and Young, R. A. (1996). A mammalian SRB protein associated with an RNA polymerase II holoenzyme. Nature 380, 82-85. Chen, D., Riedl, T., Washbrook, E., Pace, R E., Coombes, R. C , Egly, J.-M., and Ali, S. (2000). Activation of estrogen receptora by SI 18 phosphorylation involves a ligand-dependent interaction with TFIIH and participation of CDK7. Mol. Cell 6, 127-137. Chen, H.-T., and Hahn, S. (2003). Binding of TFIIB to RNA polymerase II: mapping the binding site for the TFIIB zinc ribbon domain within the preinitiation complex. Mol. Cell 72, 437-447. Chen, H.-T., and Hahn, S. (2004). Mapping the location of TFIIB within the RNA polymerase II transcription preinitiation complex: a model for the structure of the PIC. Cell 119, 169-180. Cheong, J., Yi, M., Lin, Y, and Murakami, S. (1995). Human RPB5, a subunit shared by eukaryotic nuclear RNA polymerase, binds human hepatitis B virus X protein and may play a role in X transactivation. EMBO J. 14, 143-150. Chi, T., Lieberman, R, Ellwood, K., and Carey, M. (1995). A general mechanism for transcriptional synergy by eukaryotic activators. Nature 377, l^A-l'bl. Chiang, C.-M., Ge, H., Wang, Z., Hoffmann, A., and Roeder, R. G. (1993). Unique TATA-binding protein-containing complexes and cofactors involved in transcription by RNA polymerases II and III. EMBO J. 12, 2749-2762. Chiang, C.-M., and Roeder, R. G. (1995). Cloning of an intrinsic human TFIID subunit that interacts with multiple transcriptional activators. Science 267, 531-536. Cho, E.-J., Takagi, T., Moore, C. R., and Buratowski, S. (1997). mRNA capping enzyme is recruited to the transcription complex by phosphorylation of the RNA polymerase II carboxy-terminal domain. Genes Dev. 11, 3319-3326. Cho, E.-J., Kobor, M. S., Kim, M., Greenblatt, J., and Buratowski, S. (2001). Opposing effects of Ctkl kinase and Fcpl phosphatase at Ser 2 of the RNA polymerase II C-terminal domain. Genes Dev. 75,3319-3329. Cho, H., Orphanides, G., Sun, X., Yang, X.-J., Ogryzko, V., Lees, E., Nakatani, Y, and Reinberg, D. (1998). A human RNA polymerase II complex containing factors that modify chromatin structure. Mol. Cell. Biol. 18, 5355-5363. Cho, H., Kim, T.-K., Mancebo, H., Lane, W. S., Flores, O., and Reinberg, D. (1999). A protein phosphatase function to recycle RNA polymerase II. Genes Dev. 13, 1540-1552. Chung, W.-H., Craighead, J. L., Chang, W.-H., Ezeokonkwo, C , Bareket-Samish, A., Komberg, R. D., and Asturias, F. J. (2003). RNA polymerase II/TFIIF structure and conserved organization of the initiation complex. Mol. Cell 12, 1003-1013. Clemens, K. E., Graziella, R, Radonovich, M. F., Choi, K. S.,

The Machinery Duvall, J. F., Dejong, J., Roeder, R., and Brady, J. N. (1996). Interaction of the human T-cell lymphotropic virus type 1 Tax transactivator with transcription factor IIA. Mol. Cell. Biol. 16, 4656-4664. Coin, F., Bergmann, E., Tremeau-Bravard, A., and Egly, J. M. (1999). Mutations in XPB and XPD helicases found in xeroderma pigmentosum patients impair the transcription function of TFIIH. EMBO J. 18, 1357-1366. Coin, F., Auriol, J., Tapias, A., Clivio, P., Vermeulen, W., and Egly, J.-M. (2004). Phosphorylation of XPB helicase regulates TFIIH nucleotide excision repair activity. EMBO J. 23, 4835-4846. Coleman, R. A., Taggart, A. K. P., Burma, S., Chicca II, J. J., and Pugh, B. F. (1999). TFIIA regulates TBP and TFIID dimers. Mol. CelU, 451-457. Colgan, J., Wampler, S., and Manley, J. L. (1993). Interaction between a transcriptional activator and transcription factor IIB in vivo. Nature 362, 549-553. Coulombe, B., Li, J., and Greenblatt, J. (1994). Topological localization of the human transcription factors IIA, IIB, TATA box-binding protein, and RNA polymerase II-associated protein 30 on a class II promoter. J. Biol. Chem. 269, 19962-19967. Cramer, P., Bushnell, D. A., Fu, J., Gnatt, A. L., Maier-Davis, B., Thompson, N. E., Burgess, R. R., Edwards, A. M., David, P. R., and Komberg, R. D. (2000). Architecture of RNA polymerase II and implications for the transcription mechanism. Science 288, 640-649. Cramer, R, Bushnell, D. A., and Komberg, R. D. (2001). Stmctural basis of transcription: RNA polymerase II at 2.8 angstrom resolution. Science 2P2, 1863-1876. Cramer, P. (2004). RNA polymerase II stmcture: from core to functional complexes. Curr. Opin. Genet. Dev. 14, 218-226. Crick, F. H. C. (1958). Symp. Soc. Exp. Biol. The Biological Replicationof Macromolecules, XII, 138. Crick, F. H. C. (1970). Central dogma of molecular biology. Nature 227, 561-563. Davis, J. A., Takagi, Y, Komberg, R. D., and Asturias, F. A. (2002). Stmcture of the yeast RNA polymerase II holoenzyme: mediator conformation and polymerase interaction. Mol. Cell 10, 409-415. DeJong, J., and Roeder, R. G. (1993). A single cDNA, hTFIIAa, encodes both the p35 and pl9 subunits of human TFIIA. Genes Dev. 7, 2220-2234. Dikstein, R., Ruppert, S., and Tjian, R. (1996a). TAF„250 is a bipartite protein kinase that phosphorylates the base transcription factor RAP74. Cell 84, 781-790. Dikstein, R., Zhou, S., and Tjian, R. (1996b). Human TAF„105 is a cell type-specific TFIID subunit related to hTAF„130. Cell 87, 137-146. Dion, v., and Coulombe, B. (2003). Interaction of a DNA-bound transcriptional activator with TBP -TFIIA-TFIIB-Promoter quaternary complex. J. Biol. Chem. 278, 11495-11501.

Chapter 02

GTFs and PIC Formation

Douziech, M., Coin, R, Chipoulet, J.-M., Arai, Y., Ohkuma, Y., Egly, J.-M., and Coulombe, B. (2000). Mechanism of promoter melting by the xeroderma pigmentosum complementation group B helicase of transcription factor IIH revealed by protein-DNA photo-cross-linking. Mol. Cell. Biol. 20, 8168-8177. Drane, P., Compe, E., Catez, P., Chymkowitch, P., and Egly, J.-M. (2004). Selective regulation of vitamin D receptor-responsive genes by TFIIH. Mol. Cell 16, 187-197. Drapkin, R., Reardon, J. T., Ansari, A., Huang, J. C , Zawel, L., Ahn, K., Sancar, A., and Reinberg, D. (1994). Dual role of TFIIH in DNA excision repair and in transcription by RNA polymerase 11. Nature 368, 769-772. Dvir, A., Conaway, R. C , and Conaway, J. W. (1997). A role for TFIIH in controlling the activity of early RNA polymerase II elongation complexes. Proc. Natl. Acad. Sci. USA 94, 9006-9010. Dynlacht, B. D., Hoey, T., and Tjian, R. (1991). Isolation of coactivators associated with the TATA-binding protein that mediate transcriptional activation. Cell 66, 563-576. Elsby, L. M., and Roberts, S. G. E. (2004). The role of TFIIB conformation in transcriptional regulation. Biochem. Soc. Trans. 32, 1098-1099. Espinosa, J. M., Verdun, R. E., and Emerson, B. M. (2003). p53 functions through stress- and promoter-specific recruitment of transcription initiation components before and after DNA damage. Mol. Cell 72, 1015-1027. Evans, R., Failey, J. A., and Roberts, S. G. E. (2001). Activator-mediated disruption of sequence-specific DNA contacts by the general transcription factor TFIIB. Genes Dev. 15, 2945-2949. Fairley, J. A., Evans, R., Hawkes, N. A., and Roberts, S. G. E. (2002). Core promoter-dependent TFIIB conformation and a role for TFIIB conformation in transcriptional start site selection. Mol. Cell. Biol. 22, 6697-6705. Faitar, S. L., Brodie, S. A., and PonticelH, A. S. (2001). Promoter-specific shifts in transcription initiation conferred by yeast TFIIB mutations are determined by the sequence in the immediate vicinity of the start sites. Mol. Cell. Biol. 21, 4427-4440. Fang, S. M., and Burton, Z. F. (1996). RNA polymerase Il-associated protein (RAP) 74 binds transcription factor (TF) IIB and blocks TFIIB-RAP30 binding. J. Biol. Chem. 271, 11703-11709. Finkelstein, A., Kostrub, C. F., Li, J., Chavez, D. R, Wang, B. Q., Fang, S. M., Greenblatt, J., and Burton, Z. F. (1992). A cDNA encoding RAP74, a general initiation factor for transcription by RNA polymerase II. Nature 555, 464-467. Flores, O., Maldonado, E., Burton, Z., Greenblatt, J., and Reinberg, D. (1988). Factors involved in specific transcription by mammalian RNA polymerase II. RNA polymerase II-associating protein 30 is an essential component of transcription factor IIF. J. Biol. Chem. 263, 10812-10816.

39

Flores, O., Maldonado, E., and Reinberg, D. (1989). Factors involved in specific transcription by mammalian RNA polymerase II. Factors HE and IIF independently interact with RNA polymerase II. J. Biol. Chem. 264, 8913-8921. Flores, O., Ha, I., and Reinberg, D. (1990). Factors involved in specific transcription by mammalian RNA polymerase IL Purification and subunit composition of transcription factor IIF. J. Biol. Chem. 265, 5629-5634. Flores, O., Lu, H., Killeen, M., Greenblatt, J., Burton, Z. F., and Reinberg, D. (1991). The small subunit of transcription factor IIF recruits RNA polymerase II into the preinitiation complex. Proc. Natl. Acad. Sci. USA 88, 9999-10003. Flores, O., Lu, H., and Reinberg, D. (1992). Factors involved in specific transcription by mammahan RNA polymerase II. Identification and characterization of factor IIH. J. Biol. Chem. 2(57,2786-2793. Fondell, J. D., Guermah, M., Malik, S., and Roeder, R. G. (1999). Thyroid hormone receptor-associated proteins and general positive cofactors mediate thyroid hormone receptor function in the absence of TATA box-binding protein-associated factors of TFIID. Proc. Natl. Acad. Sci. USA 96, 1959-1964. Forget, D., Langelier, M.-F., Therien, C , Trinh, V., and Coulombe, B. (2004). Photo-cross-linking of a purified preinitiation complex reveals central roles for the RNA polymerase II mobile clamp and TFIIE in initiation mechanisms. Mol. Cell. Biol. 24, 1122-1131. Frank, D. J., Tyree, C. M., George, C. R, and Kadonaga, J. T. (1995). Structure and function of the small subunit of TFIIF (RAP30) from Drosophila melanogaster. J. Biol. Chem. 270, 6292-6297. Funk, J. D., Nedialkov, Y A., Xu, D., and Burton, Z.F. (2002). A key role for the al helix of human RAP74 in the initiation and elongation of RNA chains. J. Biol. Chem. 277, 46998-47003. Fyodorov, D. V., and Kadonaga, J. T. (2003). Chromatin assembly in vitro with purified recombinant ACF and NAP-1. Methods Enzymol. 3 71, 499-515. Gaiser, F., Tan, S., and Richmond, T. J. (2000). Novel dimerization fold of RAP30/RAP74 in human TFIIF at 1.7 A resolution. J. Mol. Biol. 302, 1119-1127. Gangloff, Y.-G., Romier, C, Thuault, S., Werten, S., and Davidson, I. (2001). The histone fold is a key structural motif of transcription factor TFIID. Trends Biochem. Sci. 26, 250-257. Garrett, K. P., Serizawa, H., Hanley, J. P., Bradsher, J. N., Tsuboi, A., Arai, N., Yokota, T., Ariai, K., Conaway, R. C , and Conaway, J. W. (1992). The carboxyl terminus of RAP30 is similar in sequence to region 4 of bacterial sigma factors and is require for ftinction. J. Biol. Chem. 267, 23942-23949. Ge, H., and Roeder, R. G. (1994). The high mobility group protein HMGl can reversibly inhibit class II gene transcription by interaction with the TATA-binding protein. J. Biol. Chem. 269, 17136-17140. Ge, H., Martinez, E., Chiang, C.-M., and Roeder, R. G. (1996).

40

Section II

Activator-dependent transcription by mammalian RNA polymerase II: in vitro reconstitution with general transcription factors and cofactors. Methods Enzymol. 274, 57-71. Geiger, J. H., Hahn, S., Lee, S., and Sigler, P. B. (1996). Crystal structure of the yeast TFIIA/TBP/DNA complex. Science 272, 830-836. Ghazy, M. A., Brodie, S. A., Ammerman, M. L., Ziegler, L. M., and Ponticelli, A. S. (2004). Amino acid substitutions in yeast TFIIF confer upstream shifts in transcription initiation and altered interaction with RNA polymerase II. Mol. Cell. Biol. 24, 10975-10985. Giglia-Mari, G., Coin, F., Ranish, J. A., Hoogstraten, D., Theil, A., Wijgers, N., Jaspers, N. G. J., Raams, A., Argentini, M., van der Spek, R J., Botta, E., Stefanini, M., Egly, J.-M., Aebersold, R., Hoeijmakers, J. H. J., and Vermeulen, W. (2004). A new, tenth subunit of TFIIH is responsible for the DNA repair syndrome trichothiodystrophy group A. Nat. Genet. 36, 714-719. Glikin, G. C , Ruberti, I., and Worcel, A. (1984). Chromatin assembly in Xenopus oocytes: in vitro studies. Cell 37, 33-41. Glossop, J. A., Daffom, T. R., and Roberts, S. G. E. (2004). A conformational change in TFIIB is required for activatormediated assembly of the preinitiation complex. Nucleic Acids Res. 32, 1829-1835. Gnatt, A. L., Cramer, P., Fu, J., Bushnell, D. A., and Komberg, R. D. (2001). Structural basis of transcription: an RNA polymerase II elongation complex at 3.3 A resolution. Science 292, 1876-1882. Gong, D.-W., Mortin, M. A., Horikoshi, M., and Nakatani, Y. (1995). Molecular cloning of cDNA encoding the small subunit of Drosophila transcription initiation factor TFIIF. Nucleic Acids Res. 23, 1882-1886. Goodrich, J. A., and Tjian, R. (1994). Transcription factors HE and IIH and ATP hydrolysis direct promoter clearance by RNA polymerase II. Cell 77, 145-156. Grant, P. A., Schieltz, D., Pray-Grant, M. G., Steger, D. J., Reese, J. C , Yates III, J. R., and Workman, J. L. (1998). A subset of TAFiiS are integral components of the SAGA complex required for nucleosome acetylation and transcriptional stimulation. Cell 94, 45-53. Green, M. R. (2000). TBP-associated factors (TAFHS): multiple, selective transcriptional mediators in common complexes. Trends Biochem. Sci. 25, 59-63. Groft, C. M., Uljon, S. N., Wang, R., and Werner, M. H. (1998). Structural homogy between the Rap30 DNA-binding domain and linker histone H5: implications for preinitiation complex assembly. Proc. Natl. Acad. Sci. USA 95, 9117-9122. Grosveld, F. (1999). Activation by locus control regions? Curr. Opin. Genet. Dev. 9, 152-157. Guzman, E., and Lis, J. T. (1999). Transcription factor TFIIH is required for promoter melting in vivo. Mol. Cell. Biol. 19, 5652-5658. Ha, I., Lane, W. S., and Reinberg, D. (1991). Cloning of a human gene encoding the general transcription initiation factor IIB.

The Machinery Nature 352, 689-695. Ha, I., Roberts, S., Maldonado, E., Sun, X., Kim, L. U., Green, M., and Reinberg, D. (1993). Multiple functional domains of human transcription factor IIB: distinct interactions with two general transcription factors and RNA polymerase II. Genes Dev. 7, 1021-1032. Hahn, S., Buratowski, S., Sharp, R A., and Guarente, L. (1989). Isolation of the gene encoding the yeast TATA binding protein TFIID: a gene identical to the SPT15 suppressor of Ty element insertions. Cell 55, 1173-1181. Hahn, S. (1998). The role of TAFs in RNA polymerase II transcription. Cell 95, 579-582. Hahn, S. (2004). Structure and mechanism of the RNA polymerase II transcription machinery. Nat. Struct. Mol. Biol. 11, 394-403. Hai, T., Horikoshi, M., Roeder, R. G., and Green, M. R. (1988). Analysis of the role of the transcription factor ATF in the assembly of a functional preinitiation complex. Cell 54, 1043-1051. Hampsey, M. (1998). Molecular genetics of the RNA polymerase II general transcriptional machinery. Microbiol. Mol. Biol. Rev. 62, 465-503. Han, S., Xie, W., Hammes, S. R., and DeJong, J. (2003). Expression of the germ cell-specific transcription factor ALF in Xenopus oocytes compensates for translational inactivation of the somatic factor TFIIA. J. Biol. Chem. 278, 45586-45593. Hansen, S. K., and Tjian, R. (1995). TAFs and TFIIA mediate differential utilization of the tandem Adh promoters. Cell 82, 565-575. Hawkes, N. A., and Roberts, S. G. E. (1999). The role of human TFIIB in transcription start site selection in vitro and in vivo. J. Biol. Chem. 274, 14337-14343. Hawkes, N. A., Evans, R., and Roberts S. G. E. (2000). The conformation of the transcription factor TFIIB modulates the response to transcriptional activators in vivo. Curr. Biol. 10, 273-276. Hengartner, C. J., Myer, V. E., Liao, S.-M., Wilson C. J., Koh, S. S., and Young, R. A. (1998). Temporal regulation of RNA polymerase II by SrblO and Kin28 cyclin-dependent kinases. Mol. Cell 2,43-53. Henry, N. L., Campbell, A. M., Feaver, W. J., Poon, D., Weil, R A., and Komberg, R. D. (1994). TFIIF-TAF-RNA polymerase II connection. Genes Dev. 8, 2868-2878. Hoey, T., Dynlacht, B. D., Peterson, M. G., Pugh, B. F., and Tjian, R. (1990). Isolation and characterization of the Drosophila gene encoding the TATA box binding protein, TFIID. Cell 61, 1179-1186. Hoey, T., Weinzierl, R. O., Gill, G., Chen, J.-L., Dynlacht, B. D., and Tjian, R. (1993). Molecular cloning and functional analysis of Drosophila TAFllO reveal properties expected of coactivators. Cell 72, 247-260. Hoffmann, A., Chiang, C.-M., Oelgeschlager, T., Xie, X., Burley,

Chapter 02

GTFs and PIC Formation

S. K., Nakatani, Y., and Roeder, R. G. (1996). A histone octamer-like structure within TFIID. Nature 380, 356-359. Hoiby, T., Mitsiou, D. J., Zhou, H., Erdjument-Bromage, H., Tempst, R, and Stunnenberg, H. G. (2004). Cleavage and proteasome-mediated degradation of the basal transcription factor TFIIA. EMBO J. 23, 3083-3091. Holstege, F. C. R, van der Vliet, R C , and Timmers H. T. M. (1996). Opening of an RNA polymerase II promoter occurs in two distinct steps and requires the basal transcription factors HE and IIH. EMBO J. 75,1666-1677. Holstege, R C. R, Fiedler, U., and Timmers, H. T. M. (1997). Three transitions in the RNA polymerase II transcription complex during initiation. EMBO J. 16, 7468-7480. Holstege, R C. R, Jennings, E. G., Wyrick, J. J., Lee, T. I., Hengartner, C. J., Green, M. R., Golub, T. R., Lander, E. S., and Young, R. A. (1998). Dissecting the regulatory circuitry of a eukaryotic genome. Cell 95, 717-728. Horikoshi, M., Hai, T., Lin, Y.-S., Green, M. R., and Roeder, R. G. (1988). Transcription factor ATF interacts with the TATA factor to facilitate establishment of a preinitiation complex. Cell 54, 1033-1042. Horikoshi, M., Wang, C. K., Fujii, H., Cromlish, J. A., Weil, R A., and Roeder, R. G. (1989a). Cloning and structure of a yeast gene encoding a general transcription initiation factor TFIID that binds to the TATA box. Nature 341, 299-303. Horikoshi, M., Wang, C. K., Fujii, H., Cromlish, J. A., Weil, R A., and Roeder, R. G. (1989b). Purification of a yeast TATA box-binding protein that exhibits human transcription factor IID activity. Proc. Natl. Acad. Sci. USA 86,4843-4847. Hou, S. Y, Wu, S.-Y, Zhou, T., Thomas, M. C , and Chiang, C.-M. (2000). Alleviation of human papillomavirus E2-mediated transcriptional repression via formation of a TATA binding protein (or TFIID)-TFIIB-RNA polymerase II-TFIIF preinitiation complex. Mol. Cell. Biol. 20, 113-125. Humbert, S., van Vuuren, H., Lutz, Y, Hoeijmakers, J. H. J., Egly, J.-M., and Moncollin, V. (1994). p44 and p34 subunits of the Btf2/TFIIH transcription factor have homologies with Ssll, a yeast protein involved in DNA repair. EMBO J. 13, 2393-2398. Imbalzano, A. N., Zaret, K. S., and Kingston, R. E. (1994). Transcription factor (TF) IIB and TFIIA can independently increase the affinity of the TATA-binding protein for DNA. J. Biol. Chem. 269, 8280-8286. Inostroza, J. A., Mermelstein, F. H., Ha, I., Lane, W. S., and Reinberg, D. (1992). Drl, a TATA-binding protein-associated phosphoprotein and inhibitor of class II gene transcription. Cell 70, 477-489. Jawhari, A., Laine, J.-R, Dubaele, S., Lamour, V., Poterszman, A., Coin, R, Moras, D., and Egly, J.-M. (2002). p52 mediates XPB function within the transcription/repair factor TFIIH. J. Biol. Chem. 277, 31761-31767. JoUot, v., Demma, M., and Prywes, R. (1995). Interaction with RAP74 subunit of TFIIF is required for transcriptional activation

41

by serum response factor. Nature 373, 632-635. Jones, K. A. (1997). Taking a new TAK on tat transactivation. Genes Dev. 11, 2593-2599. Kamada, K., De Angelis, J., Roeder, R. G., and Burley, S. K. (2001a). Crystal structure of the C-terminal domain of the RAP74 subunit of human transcription factor IIF. Proc. Natl. Acad. Sci. USA. 98, 3115-3120. Kamada, K., Shu, R, Chen, H., Malik, S., Stelzer, G., Roeder, R. G., Meisteremst, M., and Burley, S, K. (2001b). Crystal structure of negative cofactor 2 recognizing the TBP-DNA transcription complex. Cell 70(5, 71-81. Kang, J. J., Auble, D. T., Ranish, J. A., and Hahn, S. (1995). Analysis of yeast transcription factor TFIIA: distinct functional regions and a polymerase II-specific role in basal and activated transcription. Mol. Cell. Biol. 15, 1234-1243. Kang, M. E., and Dahmus, M. E. (1993). RNA polymerases IIA and 110 have distinct roles during transcription from the TATA-less murine dihydrofolate reductase promoter. J. Biol. Chem. 268, 25033-25040. Kao, C. C , Lieberman, R M., Schmidt, M. C , Zhou, Q., Pei, R., and Berk, A. J. (1990). Cloning of a transcriptionally active human TATA binding factor. Science 248, 1646-1650. Kaufmann, J., Ahrens, K., Koop, R., Smale, S. T., and Miiller, R. (1998). CIF150, a human cofactor for transcription factor IID-dependent initiator function. Mol. Cell. Biol. 18, 233-239. Kephart, D. D., Price, M. P., Burton, Z. R, Finkelstein, A., Greenblatt, J., and Price, D. H. (1993). Cloning of a Drosophila cDNA with sequence similarity to human transcription factor RAP74. Nucleic Acids Res. 21, 1319. Keriel, A., Stary, A., Sarasin, A., Rochette-Egly, C , and Egly, J.-M. (2002). XPD mutations prevent TFIIH-dependent transactivation by nuclear receptors and phosphorylation of RAR .Cell 709,125-135. Kershnar, E., Wu, S.-Y, and Chiang, C.-M. (1998). Immunoaffinity purification and functional characterization of human transcription factor IIH and RNA polymerase II from clonal cell lines that conditionally express epitope-tagged subunits of the multiprotein complexes. J. Biol. Chem. 273, 34444-34453. Kettenberger, H., Armache, K.-J., and Cramer, P. (2003). Architecture of the RNA polymerase II-TFIIS complex and impHcations for mRNA cleavage. Cell 114, 347-357. Kettenberger, H., Armache, K.-J., and Cramer, P. (2004). Complete RNA polymerase II elongation complex structure and its interactions with NTP and TFIIS. Mol. Cell 16, 955-965. Khazak, v., Estojak, J., Cho, H., Majors, J., Sonoda, G., Testa, J. R., and Golemis, E. A. (1998). Analysis of the interaction of the novel RNA polymerase II (pol II) subunit hsRPB4 with its partner hsRPB7 and with pol II. Mol. Cell. Biol. 18, 1935-1945. Kim, Y.-J., Bjorklund, S., Li, Y, Sayre, M. H., and Komberg, R. D. (1994). A multiprotein mediator of transcriptional activation and its interaction with the C-terminal repeat domain of RNA

42'

Section II

polymerase II. Cell 77, 599-608. Kimura, M., Suzuki, H., and Ishihama, A. (2002). Formation of a carboxy-terminal domain phosphatase (FCP1)/TFIIF/RNA polymerase II (pol II) complex in Schizosaccharomyces pombe involves direct interaction between Fcpl and the Rpb4 subunit of pol II. Mol. Cell. Biol. 22, 1577-1588. Ko, L. J., and Prives, C. (1996). p53: puzzle and paradigm. Genes Dev. 10, 1054-1072. Kobayashi, N., Boyer, T. G., and Berk, A. J. (1995). A class of activation domains interacts directly with TFIIA and stimulates TFIIA-TFIID-promoter complex assembly. Mol. Cell. Biol. 75, 6465-6473. Kobor, M. S., Simon, L. D., Omichinski, J., Zhong, G., Archambault, J., and Greenblatt, J. (2000). A motif shared by TFIIF and TFIIB mediates their interaction with the RNA polymerase II carboxy-terminal domain phosphatase Fcplp in Saccharomyces cerevisiae. Mol. Cell. Biol. 20, 7438-7449. Koiwa, H., Hausmann, S., Bang, W. Y., Ueda, A., Kondo, N., Hiraguri, A., Fukuhara, T., Bahk, J. D., Yun, D.-J., Bressan, R. A., Hasegawa, R M., and Shuman, S. (2004). Arabidopsis C-terminal domain phosphatase-like 1 and 2 are essential Ser-5-specific C-terminal domain phosphatases. Proc. Natl. Acad. Sci. USA 101, 14539-14544. Kokubo, T., Swanson, M. J., Nishikawa, J.-I., Hinnebusch, A. G., and Nakatani, Y. (1998). The yeast TAF145 inhibitory domain and TFIIA competitively bind to TATA-binding protein. Mol. Cell.Biol. 7(^,1003-1012. Koleske, A. J., and Young, R. A. (1994). An RNA polymerase II holoenzyme responsive to activators. Nature 368, 466-469. Komamitsky, R, Cho, E.-J., and Buratowski, S. (2000). Diflferrent phosphorylated forms of RNA polymerase II and associated mRNA processing factors during transcription. Genes Dev. 14, 2452-2460. Kraemer, S. M., Ranallo, R. T., Ogg, R. C , and Stargell, L.A. (2001). TFIIA interacts with TFIID via association with TATA-binding protein and TAF40. Mol. Cell. Biol. 21, 1737-1746. Krishnamurthy, S., He, X., Reyes-Reyes, M., Moore, C , and Hampsey, M. (2004). Ssu72 is an RNA polymerase II CTD phosphatase. Mol. Cell 14, 387-394. Kugel, J. F., and Goodrich, J. A. (1998). Promoter escape limits the rate of RNA polymerase II transcription and is enhanced by TFIIE, TFIIH, and ATP on negatively supercoiled DNA. Proc. Natl. Acad. Sci. USA. 95, 9232-9237. Kuldell, N. H., and Buratowski, S. (1997). Genetic analysis of the large subunit of yeast transcription factor HE reveals two regions with distinct functions. Mol. Cell. Biol. 17, 5288-5298. Kumar, K. R, Akoulitchev, S., and Reinberg, D. (1998). Promoter-proximal stalling results from the inability to recruit transcription factor IIH to the transcription complex and is a regulated event. Proc. Natl. Acad. Sci. USA. 95, 9767-9772. Kuras, L., Kosa, R, Mencia, M., and Struhl, K. (2000).

The Machinery TAF-containing and TAF-independent forms of transcriptionally active TBP in vivo. Science 288, 1244-1248. Lagrange, T, Kim, T. K., Orphanides, G., Ebright, Y. W., Ebright, R. H., and Reinberg, D. (1996). High-resolution mapping of nucleoprotein complexes by site-specific protein-DNA photocrosslinking: organization of the human TBP-TFIIA-TFIIBDNA quaternary complex. Proc. Natl. Acad. Sci. USA 93, 10620-10625. Langelier, M.-R, Forget, D., Rojas, A., Porlier, Y, Burton, Z. R, and Coulombe, B. (2001). Structural and functional interactions of transcription factor (TF) IIA with TFIIE and TFIIF in transcription initiation by RNA polymerase II. J. Biol. Chem. 276, 38652-38657. Lavigne, A. C , Mengus, G., Ganglofif, Y-G., Wurtz, J.-M., and Davidson, I. (1999). Human TAFn55 interacts with the vitamin D3 and thyroid hormone receptors and with derivatives of the retinoid X receptor that have altered transactivation properties. Mol. Cell. Biol. 19, 5486-5494. Lee, D. K., De Jong, J., Hashimoto, S., Horikoshi, M., and Roeder, R. G. (1992). TFIL\ induces conformational changes in TFIID via interactions with the basic repeat. Mol. Cell. Biol. 12, 5189-5196. Lee, S., and Hahn, S. (1995). Model for binding of transcription factor TFIIB to the TBP-DNA complex. Nature 376, 609-612. Lee, T. I., and Young, R. A. (2000). Transcription of eukaryotic protein-coding genes. Annu. Rev. Genet. 34,11-131. Lehmann, A. R. (2001). The xeroderma pigmentosum group D (XPD) gene: one gene, two functions, three diseases. Genes Dev. 15, 15-23. Lei, L., Ren, D., Finkelstein, A., and Burton, Z. F. (1998). Functions of the N- and C-terminal domains of human RAP74 in transcription initiation, elongation, and recycling of RNA polymerase 11. Mol. Cell. Biol. 18, 2130-2142. Lemon, B., and Tjian, R. (2000). Orchestrated response: a symphony of transcription factors for gene control. Genes Dev. 7^,2551-2569. Leurent, C , Sanders, S., Ruhlmann, C , Mallouh, V., Weil, R A., Kirschner, D. B., Tora, L., and Schultz, P. (2002). Mapping histone fold TAFs within yeast TFIID. EMBO J. 21, 3424-3433. Li, X.-Y, Bhaumik, S. R., and Green, M. R. (2000). Distinct classes of yeast promoters revealed by differential TAF recruitment. ScicncQ 288, 1242-1244. Li, X.-Y, Bhaumik, S. R., Zhu, X., Li, L., Shen, W.-C, Dixit, B. L., and Green, M. R. (2002). Selective recruitment of TAFs by yeast upstream activating sequences. Implications for eukaryotic promoter structure. Curr. Biol. 12, 1240-1244. Lieberman, P. M., and Berk, A. J. (1994). A mechanism for TAFs in transcriptional activation: activation domain enhancement of TFIID-TFIIA-promoter DNA complex formation. Genes Dev. 9, 995-1006. Lieberman, R M., Ozer, J., and Gursel, D. B. (1997). Requirement for transcription factor IIA (TFIIA)-TFIID

Chapter 02

GTFs and PIC Formation

recruitment by an activator depends on promoter structure and template competition. Mol. Cell. Biol. 77, 6624-6632. Liu, Q., Gabriel, S. E., Roinick, K. L., Ward, R. D., and Amdt, K. M. (1999). Analysis of TFIIA function in vivo: Evidence for a role in TATA-binding protein recruitment and gene-specific activation. Mol. Cell. Biol. 19, 8673-8685. Lu, H., Fisher, R. R, Bailey, R, and Levine, A. J. (1997). The CDK7-cycH-p36 complex of transcription factor IIH phosphorylates p53, enhancing its sequence-specific DNA binding activity in vitro. Mol. Cell. Biol. 77, 5923-5934. Ma, D., Watanabe, H., Mermelstein, R, Admon, A., Oguri, K., Sun, X., Wada, T., Imai, T., Shiroya, T., Reinberg, D., and Handa, H. (1993). Isolation of a cDNA encoding the largest subunit of TFIIA reveals functions important for activated transcription. Genes Dev. 7, 2246-2257. Maile, T., Kwoczynski, S., Katzenberger, R. J., Wassarman, D. A., and Sauer, F. (2004). TAFl activates transcription by phosphorylation of serine 33 in histone H2B. Science 304, 1010-1014. Maldonado, E., Shiekhattar, R., Sheldon, M., Cho, H., Drapkin, R., Rickert, R, Lees, E., Anderson, C. W., Linn, S., and Reinberg, D. (1996). A human RNA polymerase II complex associated with SRB and DNA-repair proteins. Nature 381, 86-89. Malik, S., Hisatake, K., Sumimoto, H., Horikoshi, M., and Roeder, R. G. (1991). Sequence of general transcription factor TFIIB and relationships to other initiation factors. Proc. Natl. Acad. Sci. USA 88, 9553-9557. Malik, S., Lee, D. K., and Roeder, R. G. (1993). Potential RNA polymerase Il-induced interactions of transcription factor TFIIB. Mol. Cell. Biol. 13, 6253-6259. Malik, S., Guermah, M., and Roeder, R. G. (1998). A dynamic model for PC4 coactivator Sanction in RNA polymerase II transcription. Proc. Natl. Acad. Sci. USA 95, 2192-2197. Martin, M. L., Lieberman, P. M., and Curran, T. (1996). Fos-Jun dimerization promotes interaction of the basic region with TFIIE-34 and TFIIF. Mol. Cell. Biol. 16, 2110-2118. Martinez, E., Chiang, C.-M., and Roeder, R. G. (1994). TATA-binding protein-associated factor(s) in TFIID function through the initiator to direct basal transcription from a TATA-less class II promoter. EMBO J. 13, 3115-3126. Martinez, E., Ge, H., Tao, Y., Yuan, C.-X., Palhan, V., and Roeder, R. G. (1998). Novel cofactors and TFIIA mediate functional core promoter selectivity by the human TAFnl50-containing TFIID complex. Mol. Cell. Biol. 18, 6571-6583. Matsui, T., Segall, J., Weil, R A., and Roeder, R. G. (1980). Multiple factors required for accurate initiation of transcription by purified RNA polymerase II. J. Biol. Chem. 255, 11992-11996. Matza, D., Wolstein, O., Dikstein, R., and Shachar, I. (2001). Invariant chain induces B cell maturation by activating a TAFnl05-NF-KB-dependent transcription program. J. Biol. Chem. 276, 27203-27206.

43

Maxon, M. E., Goodrich, J. A., and Tjian, R. (1994). Transcription factor HE binds preferentially to RNA polymerase Ila and recruits TFIIH: a model for promoter clearance. Genes Dev. 5,515-524. McCraken, S., and Greenblatt, J. (1991). Related RNA polymerase-binding regions in human RAP30/74 and Escherichia colio^^. Science 253, 900-902. McCracken, S., Fong, N., Yankulov, K., Ballantyne, S., Pan, G., Greenblatt, J., Patterson, S. D., Wickens, M., and Bentley, D. L. (1997). The C-terminal domain of RNA polymerase II couples mRNA processing to transcription. Nature 385, 357-361. McEwan, I. J., and Gustafsson, J. (1997). Interaction of the human androgen receptor transactivation function with the general transcription factor TFIIF. Proc. Natl. Acad. Sci. USA 94, 8485-8490. McKune, K., Moore, P A., Hull, M. W, and Woychik, N. A. (1995). Six human RNA polymerase subunits functionally substitute for their yeast counterparts. Mol. Cell. Biol. 15, 6895-6900. Meinhart, A., Blobel, J., and Cramer, P. (2003). An extended winged helix domain in general transcription factor E/IIEa. J. Biol. Chem. 275,48267-48274. Meisteremst, M., Roy, A. L., Lieu, H. M., and Roeder, R. G. (1991). Activation of class II gene transcription by regulatory factors is potentiated by a novel activity. Cell 66, 981-993. Mellon, I., and Hanawalt, R C. (1989). Induction of the Escherichia coli lactose operon selectively increases repair of its transcribed DNA strand. Nature 342, 95-98. Mencia, M., Moqtaderi, Z., Geisberg, J. V., Kuras, L., and Struhl, K. (2002). Activator-specific recruitment of TFIID and regulation of ribosomal protein genes in yeast. Mol. Cell 9, 823-833. Merika, M., and Thanos, D. (2001). Enhanceosomes. Curr. Opin. Genet. Dev. 77, 205-208. Merino, A., Madden, K. R., Lane, W. S., Champoux, J. J., and Reinberg, D. (1993). DNA topoisomerase I is involved in both repression and activation of transcription. Nature 365, 227-232. Minakhin, L., Bhagat, S., Brunning, A., Campbell, E. A., Darst, S. A., Ebright, R. H., and Severinov, K. (2001). Bacterial RNA polymerase subunit co and eukaryotic RNA polymerase subunit RPB6 are sequence, structural, and functional homologs and promote RNA polymerase assembly. Proc. Natl. Acad. Sci. USA 98, 892-897. Mitsiou, D. J., and Stunnenberg, H. G. (2000). TAC, a TBP-sansTAFs complex containing the unprocessed TFIIAaP precursor and the TFIIAy subunit. Mol. Cell 6, 527-537. Mitsiou, D. J., and Stunnenberg, H. G. (2003). p300 is involved in formation of the TBP-TFIIA-containing basal transcription complex, TAC. EMBO J. 22, 4501-4511. Mitsuzawa, H., and Ishihama, A. (2004). RNA polymerase II transcription apparatus in Schizosaccharomyces pombe Curr. Genet. 44, 287-294. Mizzen, C. A., Yang, X.-J., Kokubo, T., Brownell, J. E.,

'44'

Section II

Bannister, A. J., Owen-Hughes, T., Workman, J., Wang, L., Berger, S. L., Kouzarides, T., Nakatani, Y., and Allis, C. D. (1996). The TAF„250 subunit of TFIID has histone acetyltransferase activity. Cell 87, 1261-1270. Moqtaderi, Z., Bai, Y, Poon, D., Weil, P. A., and Stmhl, K. (1996). TBP-associated factors are not generally required for transcriptional activation in yeast. Nature 383, 188-191. Naar, A. M., Lemon, B. D., and Tjian, R. (2001). Transcriptional coactivator complexes. Annu. Rev. Biochem. 70, 475-501. Nakajima, T., Uchida, C , Anderson, S. R, Parvin, J. D., and Montminy, M. (1997). Analysis of a cAMP-responsive activator reveals a two-component mechanism for transcriptional induction via signal-dependent factors. Genes Dev. 77, 738-747. Nikolov, D. B., Chen, H., Halay, E. D., Usheva, A. A., Hisatake, K., Lee, D. K., Roeder, R. G., and Burley, S. K. (1995). Crystal structure of a TFIIB-TBP-TATA-element ternary complex. Nature 577, 119-128. Oelgeschlager, T., Tao, Y, Kang, Y K., and Roeder, R. G. (1998). Transcription activation via enhanced preinitiation complex assembly in a human cell-free system lacking TAFuS. Mol. Cell 7, 925-931. Ohkuma, Y, Sumimoto, H., Hoffmann, A., Shimasaki, S., Horikoshi, M., and Roeder, R. G. (1991). Structural motifs and potential o homologies in the large subunit of human general transcription factor TFIIE. Nature 354, 398-401. Ohkuma, Y, and Roeder, R. G. (1994). Regulation of TFIIH ATPase and kinase activities by TFIIE during active initiation complex formation. Nature 368, 160-163. Ohkuma, Y, Hashimoto, S., Wang, C. K., Horikoshi, M., and Roeder, R. G. (1995). Analysis of the role of TFIIE in basal transcription and TFIIH-mediated carboxy-terminal domain phosphorylation through structure-function studies of TFIIE-a. Mol. Cell. Biol. 75, 4856-4866. Okamoto, T, Yamamoto, S., Watanabe, Y, Ohta, T, Hanaoka, F., Roeder, R. G., and Ohkuma, Y (1998). Analysis of the role of TFIIE in transcriptional regulation through structure-function studies of the TFIIEp subunit. J. Biol. Chem. 273, 19866-19876. Okuda, M., Watanabe, Y, Okamura, H., Hanaoka, F., Ohkuma, Y, and Nishimura, Y (2000). Structure of the central core domain of TFIIEp with a novel double-stranded DNA-binding surface. EMBOJ. 7P, 1346-1356. Okuda, M., Tanaka, A., Arai, Y, Satoh, M., Okamura, H., Nagadoi, A., Hanaoka, F., Ohkuma, Y, and Nishimura, Y (2004). A novel zinc finger structure in the large subunit of human general transcription factor TFIIE. J. Biol. Chem. 279, 51395-51403. Orphanides, G., Lagrange, T., and Reinberg, D. (1996). The general transcription factors of RNA polymerase II. Genes Dev. 10, 2657-2683. Ossipow, v., Tassan, J.-R, Nigg, E. A., and Schibler, U. (1995). A mammalian RNA polymerase II holoenzyme containing all components required for promoter-specific transcription initiation.

The Machinery Cell 53, 137-146. Ozer, J., Moore, P. A., Bolden, A. H., Lee, A., Rosen, C. A., and Lieberman, P. M. (1994). Molecular cloning of the smally subunit of human TFIIA reveals functions critical for activated transcription. Genes Dev. 8, 2324-2335. Ozer, J., Lezina, L. E., Ewing, J., Audi, S., and Lieberman, P. M. (1998a). Association of transcription factor IIA with TBP is required for transcriptional activation of a subset of promoters and cell cycle progression in S. cerevisiae. Mol. Cell. Biol. 18, 2559-2570. Ozer, J., Mitsouras, K., Zerby, D., Carey, M., and Lieberman, P.M. (1998b). Transcription factor IIA derepresses TATA binding protein (TBP)-associated factor inhibition of TBP-DNA binding. J. Biol. Chem. 273, 14293-14300. Ozer, J., Moore, P. A., and Lieberman, P. M. (2000). A testis-specific transcription factor IIA (TFIIAx) stimulates TATA-binding protein-DNA binding and transcription activation. J. Biol. Chem. 275, 122-128. Pan, G., and Greenblatt, J. (1994). Initiation of transcription by RNA polymerase II is limited by melting of the promoter DNA in the region immediately upstream of the initiation site. J. Biol. Chem. 269, 30101-30104. Pardee, T. S., Bangur, C. S., and Ponticelli, A. S. (1998). The N-terminal region of yeast TFIIB contains two adjacent functional domains involved in stable RNA polymerase II binding and transcription start site selection. J. Biol. Chem. 273, 17859-17864. Parker, C. S., and Topol, J. (1984). A Drosophila RNA polymerase II transcription factor contains a promoter-regionspecific DNA-binding activity. Cell 36, 357-369. Parvin, J. D., and Sharp, P A. (1993). DNA topology and a minimal set of basal factors for transcription by RNA polymerase II. Cell 73, 533-540. Parvin, J. D., Shykind, B. M., Meyers, R. E., Kim, J., and Sharp, P. A. (1994). Multiple sets of basal factors initiate transcription by RNA polymerase II. J. Biol. Chem. 269, 18414-18421. Parvin, J. D., and Young, R. A. (1998). Regulatory targets in the RNA polymerase II holoenzyme. Curr. Opin. Genet. Dev. 8, 565-570. Pei, Y, Hausmann, S., Ho, C. K., Schwer, B., and Shuman, S. (2001). The length, phosphorylation state, and primary structure of the RNA polymerase II carboxy-terminal domain dictate interactions with mRNA capping enzymes. J. Biol. Chem. 276, 28075-28082. Peterson, M. G., Tanese, N., Pugh, B. F., and Tjian, R. (1990). Functional domains and upstream activation properties of cloned human TATA binding protein. Science 248, 1625-1630. Peterson, M. G., Inostroza, J., Maxon, M. E., Flores, O., Admon, A., Reinberg, D., and Tjian, R. (1991). Structure and functional properties of human general transcription factor HE. Nature 354, 369-373. Pham, A.-D., and Sauer, F. (2000). Ubiquitin-activating/

Chapter 02

GTFs and PIC Formation

conjugating activity of TAFii250, a mediator of activation of gene expression in Drosophila. Science 289, 2357-2360. Pinto, I., Ware, D. E., and Hampsey, M. (1992). The yeast SUA7 gene encodes a homolog of human transcription factor TFIIB and is required for normal start site selection in vivo. Cell 68, 977-988. Pinto, I., Wu, W.-H., Na, J. G., and Hampsey, M. (1994). Characterization of sua7 mutations defines a domain of TFIIB involved in transcription start site selection in yeast. J. Biol. Chem. 269, 30569-30573. Poon, D., and Weil, P. A. (1993). Immunopurification of yeast TATA-binding protein and associated factors. Presence of transcription factor IIIB transcriptional activity. J. Biol. Chem. 268, 15325-15328. Prelich, G. (2002). RNA polymerase II carboxy-terminal domain kinases: emerging clues to their function. Eukaryot. Cell 7, 153-162. Pugh, B. F., and Tjian, R. (1990). Mechanism of transcriptional activation by Spl: evidence for coactivators. Cell 61, 1187-1197. Pugh, B. F., and Tjian, R. (1991). Transcription from a TATA-less promoter requires a multisubunit TFIID complex. Genes Dev. 5, 1935-1945. Pugh, B. F. (2000). Control of gene expression through regulation of the TATA-binding protein. Gene 255, 1-14. Ranish, J. A., Lane, W. S., and Hahn, S. (1992). Isolation of two genes that encode subunits of the yeast transcription factor IIA. Science 255, 1127-1229. Ranish, J. A., Yudkovsky, N., and Hahn, S. (1999). Intermediates in formation and activity of the RNA polymerase II preinitiation complex: holoenzyme recruitment and a postrecruitment role for the TATA box and TFIIB. Genes Dev. 13,49-63. Ranish, J. A., Hahn, S., Lu, Y., Yi, E. C , Li, X.-J., Eng, J., and Aebersold, R. (2004). Identification of TFB5, a new component of general transcription and DNA repair factor IIH. Nat. Genet. 5^,707-713. Reid, J., Murray, I., Watt, K., Betney, R., and McEwan, I. J. (2002). The androgen receptor interacts with multiple regions of the large subunit of general transcription factor TFIIF. J. Biol. Chem. 277,41247-41253. Reinberg, D., and Roeder, R. G. (1987). Factors involved in specific transcription by mammalian RNA polymerase II. Purification and functional analysis of initiation factors IIB and HE. J. Biol. Chem. 262, 3310-3321. Reinberg, D., Horikoshi, M., and Roeder, R. G. (1987). Factors involved in specific transcription in mammalian RNA polymerase II. Functional analysis of initiation factors IIA and IID and identification of a new factor operating at sequences downstream of the initiation site. J. Biol. Chem. 262, 3322-3330. Robert, F., Douziech, M., Forget, D., Egly, J.-M., Greenblatt, J., Burton, Z. F., and Coulombe, B. (1998). Wrapping of promoter DNA around the RNA polymerase II initiation complex induced by TFIIF. Mol. Cell. 2, 341-351.

45

Roberts, S. G. E., Ha, I., Maldonado, E., Reinberg, D., and Green, M. R. (1993). Interaction between an acidic activator and transcription factor TFIIB is required for transcriptional activation. Nature 363,1A\-1AA. Robinson, M. M., Yatherajam, G., Ranallo, R. T., Brie, A., Paule, M. R., and Stargell, L. A. (2005). Mapping and functional characterization of the TAFll interaction with TFIIA. Mol. Cell. Biol. 25, 945-957. Rochette-Egly, C , Adam, S., Rossignol, M., Egly, J.-M., and Chambon, P. (1997). Stimulation of RARa activation function AF-1 through binding to the general transcription factor TFIIH and phosphorylation by CDK7. Cell 90, 97-107. Rodriguez, C. R., Cho, E.-J., Keogh, M.-C, Moore, C. L., Greenleaf, A. L., and Buratowski, S. (2000). Kin28, the TFIIH-associated carboxy-terminal domain kinase, facilitates the recruitment of mRNA processing machinery to RNA polymerase IL Mol. Cell. Biol. 2^, 104-112. Roeder, R. G., and Rutter, W J. (1969). Multiple forms of DNA-dependent RNA polymerase in eukaryotic organisms. Nature 224,1'lA-l^l. Roeder, R. G., and Rutter, W J. (1970). Specific nucleolar and nucleoplasmic RNA polymerases. Proc. Natl. Acad. Sci. USA 65, 675-682. Rossignol, M., Kolb-Cheynel, I., and Egly, J.-M. (1997). Substrate specificity of the cdk-activating kinase (CAK) is altered upon association with TFIIH. EMBO J. 16, 1628-1637. Sanders, S. L., Garbett, K. A., and Weil, R A. (2002). Molecular characterization of Saccharomyces cerevisiae TFIID. Mol. Cell. Biol. 22, 6000-6013. Sauer, F., Fondell, J. D., Ohkuma, Y, Roeder, R. G., and Jackie, H. (1995). Control of transcription by Kriippel through interactions with TFIIB and TFIIEp. Nature 375, 162-164. Sawadogo, M., and Roeder, R. G. (1985a). Factors involved in specific transcription by human RNA polymerase II: analysis by a rapid and quantitative in vitro assay. Proc. Natl. Acad. Sci. USA 82,4394-4398. Sawadogo, M., and Roeder, R. G. (1985b). Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box region. Cell 43, 165-175. Schaeffer, L., Roy, R., Humbert, S., Moncollin, V., Vermeulen, W, Hoeijmakers, J. H. J., Chambon, R, and Egly, J.-M. (1993). DNA repair helicase: a component of BTF2 (TFIIH) basic transcription factor. Science 260, 58-63. Schaeffer, L., Moncollin, V., Roy, R., Staub, A., Mezzina, M., Sarasin, A., Weeda, G., Hoeijmakers, J. H. J., and Egly, J.-M. (1994). The ERCC2/DNA repair protein is associated with the class II BTF2/TFIIH transcription factor. EMBO J. 13, 2388-2392. Schroeder, S. C , Schwer, B., Shuman, S., and Bentley, D. (2000). Dynamic association of capping enzymes with transcribing RNA polymerase II. Genes Dev. 14, 435-2440. Selleck, W, Howley, R., Fang, Q., Podolny, V., Fried, M. G.,

46

Section II

Buratowski, S., and Tan, S. (2001). A histone fold TAF octamer within the yeast TFIID transcriptional coactivator. Nat. Struct. Biol. 5, 695-700. Serizawa, H., Conaway, J. W., and Conaway, R. C. (1994). An oligomeric form of the large subunit of transcription factor (TF) HE activates phosphorylation of the RNA polymerase II carboxyl-terminal domain by TFIIH. J. Biol. Chem. 269, 20750-20756. Shao, H., Revach, M., Moshonov, S., Tzuman, Y., Gazit, K., Albeck, S., Unger, T., and Dikstein, R. (2005). Core promoter binding by histone-like TAF complexes. Mol. Cell. Biol. 25, 206-219. Shilatifard, A., Conaway, R. C , and Conaway, J. W. (2003). The RNA polymerase II elongation complex. Annu. Rev. Biochem. 72,693-715. Shim, E. Y., Walker, A. K., Shi, Y, and Blackwell, T. K. (2002). CDK-9/cyclin T (P-TEFb) is required in two postinitiation pathways for transcription in the C. elegans embryo. Genes Dev. 75,2135-2146. Sklar, V. E. F., Schwartz, L. B., and Roeder, R. G. (1975). Distinct molecular structures of nuclear class I, II, and III DNA-dependent RNA polymerases. Proc. Natl. Acad. Sci. USA 72, 348-352. Smale, S. T. (1997). Transcription initiation from TATA-less promoters within eukaryotic protein-coding genes. Biochim. Biophys. Acta 1351, 73-88. Solow, S., Salunek, M., Ryan, R., and Lieberman, R M. (2001). TAFn250 phosphorylates human transcription factor IIA on serine residues important for TBP binding and transcription activity. J. Biol. Chem. 276, 15886-15892. Sopta, M., Carthew, R. W., and Greenblatt, J. (1985). Isolation of three proteins that bind to mammalian RNA polymerase II. J. Biol. Chem. 260, 10353-10360. Sopta, M., Burton, Z. F., and Greenblatt, J. (1989). Structure and associated DNA-helicase activity of a general transcription initiation factor that binds to RNA polymerase II. Nature 341, 410-414. Stargell, L. A., Moqtaderi, Z., Dorris, D. R., Ogg, R. C , and Struhl, K. (2000). TFIIA has activator-dependent and core promoter functions in vivo. J. Biol. Chem. 275, 12374-12380. Sumimoto, H., Ohkuma, Y, Sinn, E., Kato, H., Shimasaki, S., Horikoshi, M., and Roeder, R. G. (1991). Conserved sequence motifs in the small subunit of human general transcription factor TFIIE. Nature 354, 401-404. Sun, X., Ma, D., Sheldon, M., Yeung, K., and Reinberg, D. (1994). Reconstitution of human TFIIA activity from recombinant polypeptides: a role in TFIID-mediated transcription. Genes Dev. 8, 2336-2348. Svejstrup, J. Q., Vichi, R, and Egly, J.-M. (1996). The multiple roles of transcription/repair factor TFIIH. Trends Biochem. Sci. 21, 346-350. Tan, S., Garrett, K. P., Conaway, R. C , and Conaway, J. W.

The Machinery (1994). Cryptic DNA-binding domain in the C terminus of RNA polymerase II general transcription factor RAP30. Proc. Natl. Acad. Sci. USA 91, 9808-9812. Tan, S., Hunziker, Y, Sargent, D. F., and Richmond, T. J. (1996). Crystal structure of a yeast TFIIA/TBP/DNA complex. Nature 381, 127-134. Tan, Q., Linask, K. L., Ebright, R. H., and Woychik, N. A. (2000). Activation mutants in yeast RNA polymerase II subunit RPB3 provide evidence for a structurally conserved surface required for activation in eukaryotes and bacteria. Genes Dev. 14, 339-348. Tanese, N., Pugh, B. F., and Tjian, R. (1991). Coactivators for a proline-rich activator purified from the multisubunit human TFIID complex. Genes Dev. 5, llU-lllA. Tantin, D., and Carey, M. (1994). A heteroduplex template circumvents the energetic requirement for ATP during activated transcription by RNA polymerase II, J. Biol. Chem. 269, 17397-17400. Thomas, M. C , and Chiang, C.-M. (2005). E6 oncoprotein represses p53-dependent gene activation via inhibition of protein acetylation independently of inducing p53 degradation. Mol. Cell 77,251-264. Tora, L. (2002). A unified nomenclature for TATA box binding protein (TBP)-associated factors (TAFs) involved in RNA polymerase II transcription. Genes Dev. 16, 673-675. Tsai, F. T. F., and Sigler, R B. (2000). Structural basis of preinitiation comples assembly on human pol II promoters. EMBO J. 19, 25-36. Ulmasov, T., Larkin, R. M., and Guilfoyle, T. J. (1996). Association between 36- and 13.6-kDa a-like subunits of Arabidopsis thaliana RNA polymerase II. J. Biol. Chem. 277, 5085-5094. Upadhyaya, A. B., Lee, S. H., and DeJong, J. (1999). Identification of a general transcription factor TFIIAa/p homolog selectively expressed in testis. J. Biol. Chem. 274, 18040-18048. Upadhyaya, A. B., Khan, M., Mou, T.-C, Junker, M., Gray, D. M., and DeJong, J. (2002). The germ cell-specific transcription factor ALF. Structural properties and stabilization of the TATA-binding protein (TBP)-DNA complex. J. Biol. Chem. 277, 34208-34216. Van Dyke, M. W., Roeder, R. G., and Sawadogo, M. (1988). Physical analysis of transcriptional preinitiation complex assembly on a class II gene promoter. Science 241, 1335-1338. van Vuuren, A. J., Vermeulen, W., Ma, L., Weeda, G., Appeldoom, E., Jaspers, N. G., van der Eb, A. J., Bootsma, D., Hoeijmakers, J. H. J., and Humbert, S. (1994). Correction of xeroderma pigmentosum repair defect by basal transcription factor BTF2 (TFIIH). EMBO J. 13, 1645-1653. Verrijzer, C. R, Chen, J.-L., Yokomori, K., and Tjian, R. (1995). Binding of TAFs to core elements directs promoter selectivity by RNA polymerase II. Cell 81, 1115-1125. Verrijzer, C. R, and Tjian, R. (1996). TAFs mediate transcriptional activation and promoter selectivity. Trends

Chapter 02

GTFs and PIC Formation

Biochem. Sci. 27, 338-342. Walker, S. S., Reese, J. C , Apone, L. M., and Green, M. R. (1996). Transcription activation in cells lacking TAFnS. Nature 383, 185-188. Walker, S. S., Shen, W.-C, Reese, J. C , Apone, L. M., and Green, M. R. (1997). Yeast TAFnl45 required for transcription of Gl/S cyclin genes and regulated by the cellular growth state. Cell 90, 607-614. Wampler, S. L., and Kadonaga, J. T. (1992). Functional analysis of Drosophila transcnption factor IIB. Genes Dev. 6, 1542-1552. Wang, W, Gralla, J. D., and Carey, M. (1992). The acidic activator GAL4-AH can stimulate polymerase II transcription by promoting assembly of a closed complex requiring TFIID and TFIIA. Genes Dev. 6, 1716-1727. Wang, Z., Svejstrup, J. Q., Feaver, W. J., Wu, X., Komberg, R. D., and Friedberg, E. C. (1994). Transcription factor b (TFIIH) is required during nucleotide-excision repair in yeast. Nature 368, 74-76. Wang, Z., Buratowski, S., Svejstrup, J. Q., Feaver, W. J., Wu, X., Komberg, R. D., Donahue, T. F., and Friedberg, E. C. (1995). The yeast TFBl and SSLl genes, which encode subunits of transcription factor IIH, are required for nucleotide excision repair and RNA polymerase II transcription. Mol. Cell. Biol. 15, 2288-2293. Warfield, L., Ranish, J. A., and Hahn, S. (2004). Positive and negative functions of the SAGA complex mediated through interaction of Spt8 with TBP and the N-terminal domain of TFIIA. Genes Dev. 18, 1022-1034. Watanabe, T., Hayashi, K., Tanaka, A., Furumoto, T, Hanaoka, F., and Ohkuma, Y. (2003). The carboxy terminus of the small subunit of TFIIE regulates the transition from transcription initiation to elongation by RNA polymerase II. Mol. Cell. Biol. 23,2914-2926. Wei, W, Dorjsuren, D., Lin, Y, Qin, W, Nomura, T, Hayashi, N., and Murakami, S. (2001). Direct interaction between subunit RAP30 of the transcription factor IIF (TFIIF) and RNA polymerase subunit 5, which contributes to the association between TFIIF and RNA polymerase II. J. Biol. Chem. 276, 12266-12273. Weil, R A., Luse, D. S., Segall, J., and Roeder, R. G. (1979). Selective and accurate initiation of transcription at the Ad2 major late promotor in a soluble system dependent on purified RNA polymerase II and DNA. Cell 18, 469-484. Weinmann, R., Raskas, H. J., and Roeder, R. G. (1974). Role of DNA-dependent RNA polymerases II and III in transcription of the adenovirus genome late in productive infection. Proc. Natl. Acad. Sci USA 71, 3426-3439. Weinmann, R., and Roeder, R. G. (1974). Role of DNA-dependent RNA polymerase III in the transcription of the tRNA and 5S RNA genes. Proc. Natl. Acad. Sci. USA 71, 1790-1794. Weiss, S., and Gladstone, L. (1959). A mammahan system for the incorporation of cytidine triphosphate into ribonucleic acid. J.

'47

Am. Chem. Soc. 81, 4118-4119. Wilson, C. J., Chao, D. M., Imbalzano, A. N., Schnitzler, G. R., Kingston, R. E., and Young, R. A. (1996). RNA polymerase II holoenzyme contains SWI/SNF regulators involved in chromatin remodeling. Cell 84, 235-244. Wolner, B. S., and Gralla, J. D. (2001). TATA-flanking sequences influence the rate and stability of TATA-binding protein and TFIIB binding. J. Biol. Chem. 276, 6260-6266. Workman, J. L., and Roeder, R. G. (1987). Binding of transcription factor TFIID to the major late promoter during in vitro nucleosome assembly potentiates subsequent initiation by RNA polymerase II. Cell 51, 613-622. Woychik, N. A., Liao, S. M., Kolodziej, P. A., and Young, R. A. (1990). Subunits shared by eukaryotic nuclear RNA polymerases. GenesDev. 4, 313-323. Woychik, N. A., McKune, K., Lane, W S., and Young, R. A. (1993). Yeast RNA polymerase II subunit RPBll is related to a subunit shared by RNA polymerase I and III. Gene Expr. 3, 77-82. Woychik, N. A., and Hampsey, M. (2002). The RNA polymerase II machinery: structure illuminates function. Cell 108, 453-463. Wu, S.-Y, and Chiang, C.-M. (1998). Properties of PC4 and an RNA polymerase II complex in directing activated and basal transcription in vitro. J. Biol. Chem. 273, 12492-12498. Wu, S.-Y, Kershnar, E., and Chiang, C.-M. (1998). TAFii-independent activation mediated by human TBP in the presence of the positive cofactor PC4. EMBO J. 17, 4478-4490. Wu, S.-Y, Thomas, M. C , Hou, S. Y, Likhite, V., and Chiang, C.-M. (1999). Isolation of mouse TFIID and functional characterization of TBP and TFIID in mediating estrogen receptor and chromatin transcription. J. Biol. Chem. 274, 23480-23490. Wu, S.-Y, and Chiang, C.-M. (2001a). TATA-binding proteinassociated factors enhance the recruitment of RNA polymerase II by transcriptional activators. J. Biol. Chem. 276, 34235-34243. Wu, S.-Y, and Chiang, C.-M. (2001b). Expression and purification of epitope-tagged multisubunit protein complexes from mammalian cells. Current Protocols in Molecular Biology, Unit 16.22.1-16.22.17. Wu, S.-Y, Zhou, T., and Chiang, C.-M. (2003). Human mediator enhances activator-facilitated recruitment of RNA polymerase II and promoter recognition by TATA-binding protein (TBP) independently of TBP-associated factors. Mol. Cell. Biol. 23, 6229-6242. Wu, W.-H., and Hampsey, M. (1999). An activation-specific role for transcription factor TFIIB in vivo. Proc. Natl. Acad. Sci. USA 96, 2764-2769. Xie, X., Kokubo, T., Cohen, S. L., Mirza, U. A., Hoffmann, A., Chait, B. T., Roeder, R. G., Nakatani, Y, and Burley, S. K, (1996). Structural similarity between TAFs and the heterotetrameric core of the histone octamer. Nature 380, 316-322. Xing, J., Sheppard, H. M., Comeillie, S. I., and Liu, X. (2001).

48

Section II

p53 stimulates TFIID-TFIIA-promoter complex assembly and p53-T antigen complex inhibits TATA binding protein-TATA interaction. Mol. Cell. Biol. 21, 3652-3661. Yamashita, S., Wada, K., Horikoshi, M., Gong, D.-W., Kokubo, T., Hisatake, K., Yokotani, N., Malik, S., Roeder, R. G., and Nakatani, Y. (1992). Isolation and characterization of a cDNA encoding Drosophila transcription factor TFIIB. Proc. Natl. Acad. Sci. USA 89, 2839-2843. Yamashita, S., Hisatake, K., Kokubo, T., Doi, K., Roeder, R. G., Horikoshi, M., and Nakatani, Y. (1993). Transcription factor TFIIB sites important for interaction with promoter-bound TFIID. Science 2QY 14, 121-141. Gonzalez, M. I., and Robins, D. M. (2001). Oct-1 preferentially interacts with androgen receptor in a DN A-dependent manner that facilitates recruitment of SRC-1. J Biol Chem 276, 6420-6428. Graham, J. D., and Clarke, C. L. (1997). Physiological action of progesterone in target tissues. Endocr Rev 18, 502-519. Graham, J. D., and Clarke, C. L. (2002). Expression and transcriptional activity of progesterone receptor A and progesterone receptor B in mammalian cells. Breast Cancer Res 4, 187-190. Guo, G. L., Lambert, G., Negishi, M., Ward, J. M., Brewer, H. B., Jr., Kliewer, S. A., Gonzalez, F. J., and Sinai, C. J. (2003). Complementary roles of famesoid X receptor, pregnane X receptor, and constitutive androstane receptor in protection against bile acid toxicity. J Biol Chem 278, 45062-45071. Guriek, A., Pittelkow, M. R., and Kumar, R. (2002). Modulation of growth factor/cytokine synthesis and signaling by lalpha,25-dihydroxyvitamin D(3): implications in cell growth and differentiation. Endocr Rev 23, 763-786. Handschin, C , and Meyer, U. A. (2005). Regulatory network of lipid-sensing nuclear receptors: roles for CAR, PXR, LXR, and FXR. Arch Biochem Biophys 433, 387-396. Hertz, R., Magenheim, J., Berman, I., and Bar-Tana, J. (1998). Fatty acyl-CoA thioesters are ligands of hepatic nuclear factor-4alpha. Nature 392, 512-516. Horlein, A. J., Naar, A. M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., Ryan, A., Kamei, Y., Soderstrom, M., Glass, C. K., and et al. (1995). Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor.

The Regulators Nature 377,397-404. Ide, T., Shimano, H., Yoshikawa, T., Yahagi, N., Amemiya-Kudo, M., Matsuzaka, T., Nakakuki, M., Yatoh, S., lizuka, Y, Tomita, S., et al. (2003). Cross-talk between peroxisome proliferatoractivated receptor (PPAR) alpha and liver X receptor (LXR) in nutritional regulation of fatty acid metabolism. IL LXRs suppress lipid degradation gene promoters through inhibition of PPAR signaling. Mol Endocrinol 17, 1255-1267. Issemann, L, and Green, S. (1990). Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature 347, 645-650. Janowski, B. A., Willy, R J., Devi, T. R., Falck, J. R., and Mangelsdorf, D. J. (1996). An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha. Nature 383, 728-731. Jiang, G., Nepomuceno, L., Hopkins, K., and Sladek, F. M. (1995). Exclusive homodimerization of the orphan receptor hepatocyte nuclear factor 4 defines a new subclass of nuclear receptors. Mol Cell Biol 75, 5131-5143. Jones, S. A., Moore, L. B., Shenk, J. L., Wisely, G. B., Hamilton, G. A., McKee, D. D., Tomkinson, N. C , LeCluyse, E. L., Lambert, M. H., Willson, T. M., et al (2000). The pregnane X receptor: a promiscuous xenobiotic receptor that has diverged during evolution. Mol Endocrinol 14, 27-39. Jonk, L. J., de Jonge, M. E., Pals, C. E., Wissink, S., Vervaart, J. M., Schooriemmer, J., and Kruijer, W. (1994). Cloning and expression during development of three murine members of the COUP family of nuclear orphan receptors. Mech Dev 47, 81-97. Juge-Aubry, C. E., Hammar, E., Siegrist-Kaiser, C , Pemin, A., Takeshita, A., Chin, W. W, Burger, A. G., and Meier, C. A. (1999). Regulation of the transcriptional activity of the peroxisome proliferator-activated receptor alpha by phosphorylation of a ligand-independent trans-activating domain. J Biol Chem 27^, 10505-10510. Kadowaki, Y, Toyoshima, K., and Yamamoto, T. (1992). Ear3/COUP-TF binds most tightly to a response element with tandem repeat separated by one nucleotide. Biochem Biophys Res Commun 75J, 492-498. Kastner, P., Krust, A., Turcotte, B., Stropp, U., Tora, L., Gronemeyer, H., and Chambon, R (1990). Two distinct estrogen-regulated promoters generate transcripts encoding the two ftinctionally different human progesterone receptor forms A and B.Embo J 9, 1603-1614. Kato, S., Matsumoto, T., Kawano, H., Sato, T., and Takeyama, K. (2004). Function of androgen receptor in gene regulations. J Steroid Biochem Mol Biol 89-90, 627-633. Kliewer, S. A., Goodwin, B., and Willson, T. M. (2002). The nuclear pregnane X receptor: a key regulator of xenobiotic metabolism. Endocr Rev 23, 687-702. Kliewer, S. A., Moore, J. T., Wade, L., Staudinger, J. L., Watson, M. A., Jones, S. A., McKee, D. D., Oliver, B. B., Willson, T. M., Zetterstrom, R. H., et al (1998). An orphan nuclear receptor

Chapter 16 Actions of Nuclear Receptors activated by pregnanes defines a novel steroid signaling pathway. Cell 92, 73-82. Kliewer, S. A., Sundseth, S. S., Jones, S. A., Brown, P. J., Wisely, G. B., Koble, C. S., Devchand, P., Wahli, W., Willson, T. M., Lenhard, J. M., and Lehmann, J. M. (1997). Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferator-activated receptors alpha and gamma. Proc Natl Acad Sci USA 94, 4318-4323. Kliewer, S. A., Umesono, K., Mangelsdorf, D. J., and Evans, R. M. (1992). Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling. Nature 355, 446-449. Kruszynska, Y. T., McCormack, J. G., and Mclntyre, N. (1990). Effects of non-esterified fatty acid availability on insulin stimulated glucose utilisation and tissue pyruvate dehydrogenase activity in the rat. Diabetologia 33, 396-402. Kuiper, G. G., Lemmen, J. G., Carlsson, B., Corton, J. C , Safe, S. H., van der Saag, P. T., van der Burg, B., and Gustafsson, J. A. (1998). Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor beta. Endocrinology 139, 4252-4263. Kumar, R., and Thompson, E. B. (1999). The structure of the nuclear hormone receptors. Steroids 64, 310-319. Kurokawa, R., DiRenzo, J., Boehm, M., Sugarman, J., Gloss, B., Rosenfeld, M. G., Heyman, R. A., and Glass, C. K. (1994). Regulation of retinoid signalling by receptor polarity and allosteric control of ligand binding. Nature 371, 528-531. Kurokawa, R., Yu, V. C , Naar, A., Kyakumoto, S., Han, Z., Silverman, S., Rosenfeld, M. G., and Glass, C. K. (1993). Differential orientations of the DNA-binding domain and carboxy-terminal dimerization interface regulate binding site selection by nuclear receptor heterodimers. Genes Dev 7, 1423-1435. Lala, D. S., Syka, R M., Lazarchik, S. B., Mangelsdorf, D. J., Parker, K. L., and Heyman, R. A. (1997). Activation of the orphan nuclear receptor steroidogenic factor 1 by oxysterols. Proc Natl Acad Sci USA 94, 4895-4900. Laudet, V. (1997). Evolution of the nuclear receptor superfamily: early diversification from an ancestral orphan receptor. J Mol Endocrinol 19, l^l-ll(i. Laudet, V., Hanni, C , Coll, J., Catzeflis, F., and Stehelin, D. (1992). Evolution of the nuclear receptor gene superfamily. Embo J 77, 1003-1013. Law, S. W., Conneely, O. M., DeMayo, F. J., and O'Malley, B. W. (1992). Identification of a new brain-specific transcription factor, NURRl. Mol Endocrinol 6,1\19-1\Z'5. Lazar, M. A. (2003). Thyroid hormone action: a binding contract. J Clin Invest 112, 497-499. Leid, M., Kastner, R, and Chambon, P. (1992). Multiplicity generates diversity in the retinoic acid signalling pathways. Trends Biochem Sci 17, 427-433. Leonhardt, S. A., Boonyaratanakomkit, V., and Edwards, D. P. (2003). Progesterone receptor transcription and non-transcription

289

signaling mechanisms. Steroids 68,161-110. Lew, J. L., Zhao, A., Yu, J., Huang, L., De Pedro, N., Pelaez, F., Wright, S. D., and Cui, J. (2004). The famesoid X receptor controls gene expression in a ligand- and promoter-selective fashion. J Biol Chem 279, 8856-8861. Li, X., Lonard, D. M., and O'Malley, B. W (2004). A contemporary understanding of progesterone receptor function. Mech Ageing Dev 125, 669-678. Lin, R., and White, J. H. (2004). The pleiotropic actions of vitamin D. Bioessays 26, 21-28. Liu, M. M., Albanese, C , Anderson, C. M., Hilty, K., Webb, R, Uht, R. M., Price, R. H., Jr., Pestell, R. G., and Kushner, R J. (2002). Opposing action of estrogen receptors alpha and beta on cyclin Dl gene expression. J Biol Chem 277, 24353-24360. Luisi, B. R, Xu, W. X., Otwinowski, Z., Freedman, L. P., Yamamoto, K. R., and Sigler, P. B. (1991). Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Nature 352, 497-505. Luo, X., Ikeda, Y, and Parker, K. L. (1994). A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77, 481-490. Lydon, J. R, DeMayo, R J., Funk, C. R., Mani, S. K., Hughes, A. R., Montgomery, C. A., Jr., Shyamala, G., Conneely, O. M., and O'Malley, B. W (1995). Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities. Genes Dev 9, 2266-2278. Mader, S., Leroy, R, Chen, J. Y, and Chambon, R (1993). Multiple parameters control the selectivity of nuclear receptors for their response elements. Selectivity and promiscuity in response element recognition by retinoic acid receptors and retinoid X receptors. J Biol Chem 268, 591-600. Mangelsdorf, D. J., and Evans, R. M. (1995). The RXR heterodimers and orphan receptors. Cell 83, 841-850. Mangelsdorf, D. J., Umesono, K., Khewer, S. A., Borgmeyer, U., Ong, E. S., and Evans, R. M. (1991). A direct repeat in the cellular retinol-binding protein type II gene confers differential regulation by RXR and RAR. Cell 66, 555-561. Matthews, J., and Gustafsson, J. A. (2003). Estrogen signaling: a subtle balance between ER alpha and ER beta. Mol Interv 3, 281-292. McEwan, I. J. (2004). Molecular mechanisms of androgen receptor-mediated gene regulation: structure-function analysis of the AF-1 domain. Endocr Relat Cancer 11, 281-293. McEwan, I. J., Wright, A. R, Dahlman-Wright, K., Carlstedt-Duke, J., and Gustafsson, J. A. (1993). Direct interaction of the tau 1 transactivation domain of the human glucocorticoid receptor with the basal transcriptional machinery. Mol CellBiol 73, 399-407. Mclnemey, E. M., Tsai, M. J., O'Malley, B. W., and Katzenellenbogen, B. S. (1996). Analysis of estrogen receptor transcriptional enhancement by a nuclear hormone receptor coactivator. Proc Natl Acad Sci USA 93, 10069-10073.

290

Section III

McKenna, N. J., Lanz, R. B., and O'Malley, B. W. (1999). Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 2^, 321-344. Menasce, L. R, White, G. R., Harrison, C. J., and Boyle, J. M. (1993). Localization of the estrogen receptor locus (ESR) to chromosome 6q25.1 by FISH and a simple post-FISH banding technique. Genomics 77, 263-265. Mengus, G., May, M., Carre, L., Chambon, R, and Davidson, I. (1997). Human TAF(II)135 potentiates transcriptional activation by the AF-2s of the retinoic acid, vitamin D3, and thyroid hormone receptors in mammalian cells. Genes Dev 11, 1381-1395. Miyata, K. S., McCaw, S. E., Marcus, S. L., Rachubinski, R. A., and Capone, J. R (1994). The peroxisome proliferator-activated receptor interacts with the retinoid X receptor in vivo. Gene 148, 327-330. Moore, J. T., Moore, L. B., Maglich, J. M., and Kliewer, S. A. (2003). Functional and structural comparison of PXR and CAR. Biochim Biophys Acta 1619, 235-238. Moras, D., and Gronemeyer, H. (1998). The nuclear receptor ligand-binding domain: structure and function. Curr Opin Cell Biol 7^, 384-391. Nelson, C. C , Hendy, S. C , Shukin, R. J., Cheng, H., Bruchovsky, N., Koop, B. R, and Rennie, R S. (1999). Determinants of DNA sequence specificity of the androgen, progesterone, and glucocorticoid receptors: evidence for differential steroid receptor response elements. Mol Endocrinol 75,2090-2107. Nilsson, S., Makela, S., Treuter, E., Tujague, M., Thomsen, J., Andersson, G., Enmark, E., Pettersson, K., Warner, M., and Gustafsson, J. A. (2001). Mechanisms of estrogen action. Physiol Rev (^7, 1535-1565. Nolte, R. T., Wisely, G. B., Westin, S., Cobb, J. E., Lambert, M. H., Kurokawa, R., Rosenfeld, M. G., Willson, T. M., Glass, C. K., and Milbum, M. V. (1998). Ligand binding and co-activator assembly of the peroxisome proliferator-activated receptor-ganima. Nature 395, 137-143. Nordeen, S. K., Suh, B. J., Kuhnel, B., and Hutchison, C. D. (1990). Structural determinants of a glucocorticoid receptor recognition element. Mol Endocrinol 4, 1866-1873. Onate, S. A., Tsai, S. Y., Tsai, M. J., and O'Malley, B. W (1995). Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270, 1354-1357. O'Shea, R J., and Williams, G. R. (2002). Insight into the physiological actions of thyroid hormone receptors from genetically modified mice. J Endocrinol 175, 553-570. Paech, K., Webb, R, Kuiper, G. G., Nilsson, S., Gustafsson, J., Kushner, R J., and Scanlan, T. S. (1997). Differential ligand activation of estrogen receptors ERalpha and ERbeta at API sites. Science 277, 1508-1510. Parker, K. L., and Schimmer, B. P. (1997). Steroidogenic factor 1: a key determinant of endocrine development and function.

The Regulators Endocr Rev 75, 361-377. Pereira, R A., Qiu, Y., Tsai, M. J., and Tsai, S. Y (1995). Chicken ovalbumin upstream promoter transcription factor (COUP-TF): expression during mouse embryogenesis. J Steroid Biochem Mol Biol 53, 503-508. Pereira, F. A., Qiu, Y, Zhou, G., Tsai, M. J., and Tsai, S. Y (1999). The orphan nuclear receptor COUP-TFII is required for angiogenesis and heart development. Genes Dev 13, 1037-1049. Perlmann, T., and Jansson, L. (1995). A novel pathway for vitamin A signaling mediated by RXR heterodimerization with NGFI-B and NURRl. Genes Dev 9, 769-782. Pettersson, K., Delaunay, R, and Gustafsson, J. A. (2000). Estrogen receptor beta acts as a dominant regulator of estrogen signaling. Oncogene 19, 4970-4978. Prufer, K., Veenstra, T. D., Jirikowski, G. F., and Kumar, R. (1999). Distribution of 1,25-dihydroxyvitamin D3 receptor immunoreactivity in the rat brain and spinal cord. J Chem Neuroanat 7(5, 135-145. Qiu, Y, Cooney, A. J., Kuratani, S., DeMayo, F. J., Tsai, S. Y, and Tsai, M. J. (1994). Spatiotemporal expression patterns of chicken ovalbumin upstream promoter-transcription factors in the developing mouse central nervous system: evidence for a role in segmental patterning of the diencephalon. Proc Natl Acad Sci USA P7,4451-4455. Qiu, Y, Pereira, F. A., DeMayo, R J., Lydon, J. R, Tsai, S. Y, and Tsai, M. J. (1997). Null mutation of mCOUP-TFI results in defects in morphogenesis of the glossopharyngeal ganglion, axonal projection, and arborization. Genes Dev 77, 1925-1937. Quigley, C. A., De BeUis, A., Marschke, K. B., el-Awady, M. K., Wilson, E. M., and French, F. S. (1995). Androgen receptor defects: historical, clinical, and molecular perspectives. Endocr Rev 75, 271-321. Robyr, D., Wolfife, A. R, and Wahli, W (2000). Nuclear hormone receptor coregulators in action: diversity for shared tasks. Mol Endocrinol 14, 329-347. Roche, P. J., Hoare, S. A., and Parker, M. G. (1992). A consensus DNA-binding site for the androgen receptor. Mol Endocrinol 6, 2229-2235. Roeder, R. G. (1996). The role of general initiation factors in transcription by RNA polymerase II. Trends Biochem Sci 27, 327-335. Ryseck, R. P., Macdonald-Bravo, H., Mattei, M. G., Ruppert, S., and Bravo, R. (1989). Structure, mapping and expression of a growth factor inducible gene encoding a putative nuclear hormonal binding receptor. Embo J 8, 3327-3335. Sadovsky, Y, Crawford, R A., Woodson, K. G., PoHsh, J. A., Clements, M. A., Tourtellotte, L. M., Simburger, K., and Milbrandt, J. (1995a). Mice deficient in the orphan receptor steroidogenic factor 1 lack adrenal glands and gonads but express P450 side-chain-cleavage enzyme in the placenta and have normal embryonic serum levels of corticosteroids. Proc Natl Acad Sci USA 92, 10939-10943.

Chapter 16 Actions of Nuclear Receptors Sadovsky, Y., Webb, P., Lopez, G., Baxter, J. D., Fitzpatrick, P. M., Gizang-Ginsberg, E., Cavailles, V., Parker, M. G., and Kushner, P. J. (1995b). Transcriptional activators differ in their responses to overexpression of TATA-box-binding protein. Mol Cell Biol 75, 1554-1563. Schoenmakers, E., Verrijdt, G., Peeters, B., Verhoeven, G., Rombauts, W., and Claessens, F. (2000). Differences in DNA binding characteristics of the androgen and glucocorticoid receptors can determine hormone-specific responses. J Biol Chem 275, 12290-12297. Schoneveld, O. J., Gaemers, I. C , and Lamers, W. H. (2004). Mechanisms of glucocorticoid signalling. Biochim Biophys Acta

1680,U4-nS. Schrader, M., Nayeri, S., Kahlen, J. R, Muller, K. M., and Carlberg, C. (1995). Natural vitamin D3 response elements formed by inverted palindromes: polarity-directed ligand sensitivity of vitamin D3 receptor-retinoid X receptor heterodimer-mediated transactivation. Mol Cell Biol 75, 1154-1161. Schuetz, J. D., Schuetz, E. G., Thottassery, J. V., Guzelian, R S., Strom, S., and Sun, D. (1996). Identification of a novel dexamethasone responsive enhancer in the human CYP3A5 gene and its activation in human and rat liver cells. Mol Pharmacol 49, 63-72. Schulman, I. G., Chakravarti, D., Juguilon, H., Romo, A., and Evans, R. M. (1995). Interactions between the retinoid X receptor and a conserved region of the TATA-binding protein mediate hormone-dependent transactivation. Proc Natl Acad Sci USA 92, 8288-8292. Segard-Maurel, I., Rajkowski, K., Jibard, N., Schweizer-Groyer, G., BauHeu, E. E., and Cadepond, F. (1996). Glucocorticosteroid receptor dimerization investigated by analysis of receptor binding to glucocorticosteroid responsive elements using a monomer-dimer equilibrium model. Biochemistry 35, 1634-1642. Shao, D., Rangwala, S. M., Bailey, S. T., Krakow, S. L., Reginato, M. J., and Lazar, M. A. (1998). Interdomain communication regulating ligand binding by PPAR-gamma. Nature 396, 377-380. Shibata, H., Ando, T., Suzuki, T., Kurihara, I., Hayashi, K., Hayashi, M., Saito, I., Kawabe, H., Tsujioka, M., Mural, M., and Saruta, T. (1998). Differential expression of an orphan receptor COUP-TFI and corepressors in adrenal tumors. Endocr Res 24, 881-885. Shibata, H., Nawaz, Z., Tsai, S. Y., O'Malley, B. W., and Tsai, M. J. (1997). Gene silencing by chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) is mediated by transcriptional corepressors, nuclear receptor-corepressor (N-CoR) and silencing mediator for retinoic acid receptor and thyroid hormone receptor (SMRT). Mol Endocrinol 77, 714-724. Shinoda, K., Lei, H., Yoshii, H., Nomura, M., Nagano, M., Shiba, H., Sasaki, H., Osawa, Y, Ninomiya, Y, Niwa, O., and et al (1995). Developmental defects of the ventromedial hypothalamic nucleus and pituitary gonadotroph in the Ftz-Fl disrupted mice.

291

Dev Dyn 204, 22-29. Staudinger, J. L., Goodwin, B., Jones, S. A., Hawkins-Brown, D., MacKenzie, K. L, LaTour, A., Liu, Y, Klaassen, C. D., Brown, K. K., Reinhard, J., et al (2001). The nuclear receptor PXR is a lithocholic acid sensor that protects against liver toxicity. Proc Natl Acad Sci USA 98, 3369-3374. Stocklin, E., Wissler, M., Gouilleux, F., and Groner, B. (1996). Functional interactions between Stat5 and the glucocorticoid receptor. Nature 383, 726-728. Sun, J., Meyers, M. J., Fink, B. E., Rajendran, R., Katzenellenbogen, J. A., and Katzenellenbogen, B. S. (1999). Novel ligands that function as selective estrogens or antiestrogens for estrogen receptor-alpha or estrogen receptor-beta. Endocrinology 140, 800-804. Svensson, S., Ostberg, T, Jacobsson, M., Norstrom, C , Stefansson, K., Hallen, D., Johansson, I. C , Zachrisson, K., Ogg, D., and Jendeberg, L. (2003). Crystal structure of the heterodimeric complex of LXRalpha and RXRbeta ligand-binding domains in a fiilly agonistic conformation. Embo J 22, 4625-4633. Swales, K., and Negishi, M. (2004). CAR, driving into the future. Mol Endocrinol 18, 1589-1598. Tanenbaum, D. M., Wang, Y, Williams, S. R, and Sigler, R B. (1998). Crystallographic comparison of the estrogen and progesterone receptor's ligand binding domains. Proc Natl Acad Sci USA P5, 5998-6003. Torchia, J., Glass, C , and Rosenfeld, M. G. (1998). Co-activators and co-repressors in the integration of transcriptional responses. Curr Opin Cell Biol 10, 373-383. Truss, M., and Beato, M. (1993). Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors. Endocr Rev 14, 459-479. Umar, A., Luider, T. M., Berrevoets, C. A., Grootegoed, J. A., and Brinkmann, A. O. (2003). Proteomic analysis of androgen-regulated protein expression in a mouse fetal vas deferens cell line. Endocrinology 144, 1147-1154. Uppenberg, J., Svensson, C , Jaki, M., Bertilsson, G., Jendeberg, L., and Berkenstam, A. (1998). Crystal structure of the ligand binding domain of the human nuclear receptor PPARgamma. J Biol Chem 273, 31108-31112. Vivat-Hannah, V., Bourguet, W., Gottardis, M., and Gronemeyer, H. (2003). Separation of retinoid X receptor homo- and heterodimerization functions. Mol Cell Biol 23,161^-16%^. Voegel, J. J., Heine, M. J., Zechel, C , Chambon, P., and Gronemeyer, H. (1996). TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. Embo J 75, 3667-3675. Wang, J. C, Stafford, J. M., and Granner, D. K. (1998). SRC-1 and GRIPl coactivate transcription with hepatocyte nuclear factor 4. J Biol Chem 273, 30847-30850. Wansa, K. D., Harris, J. M., and Muscat, G. E. (2002). The activation function-1 domain of Nur77/NR4A1 mediates

292

Section III

trans-activation, cell specificity, and coactivator recruitment. J Biol Chem 277, 33001-33011. Watson, M. A., and Milbrandt, J. (1990). Expression of the nerve growth factor-regulated NGFI-A and NGFI-B genes in the developing rat. Development 110, 173-183. Williams, G. T., and Lau, L. F. (1993). Activation of the inducible orphan receptor gene nur77 by serum growth factors: dissociation of immediate-early and delayed-early responses. Mol Cell Biol 73, 6124-6136. Willson, T. M., Cobb, J. E., Cowan, D. J., Wiethe, R. W, Correa, I. D., Prakash, S. R., Beck, K. D., Moore, L. B., Kliewer, S. A., and Lehmann, J. M. (1996). The structure-activity relationship between peroxisome proliferator-activated receptor gamma agonism and the antihyperglycemic activity of thiazolidinediones. J Med Chem 39, 665-668. Wilson, C. J., Chao, D. M., Imbalzano, A. N., Schnitzler, G. R., Kingston, R. E., and Young, R. A. (1996). RNA polymerase II holoenzyme contains SWI/SNF regulators involved in chromatin remodeling. Cell 84, 235-244. Wilson, T. E., Fahmer, T. J., Johnston, M., and Milbrandt, J. (1991). Identification of the DNA binding site for NGFI-B by genetic selection in yeast. Science 252, 1296-1300. Wilson, T. E., Fahmer, T. J., and Milbrandt, J. (1993). The orphan receptors NGFI-B and steroidogenic factor 1 establish monomer binding as a third paradigm of nuclear receptor-DNA interaction. Mol Cell Biol 13, 5794-5804. Wright, A. R, Zilliacus, J., McEwan, I. J., Dahlman-Wright, K., Almlof, T., Carlstedt-Duke, J., and Gustafsson, J. A. (1993). Structure and function of the glucocorticoid receptor. J Steroid BiochemMol Biol 47, 11-19. Xu, H. E., Lambert, M. H., Montana, V. G., Parks, D. J., Blanchard, S. G., Brown, P. J., Stembach, D. D., Lehmann, J. M., Wisely, G. B., Willson, T. M., et al (1999). Molecular recognition of fatty acids by peroxisome proliferator-activated receptors. Mol Cell 3, 397-403. Yamagata, K., Furuta, H., Oda, N., Kaisaki, P. J., Menzel, S., Cox, N. J., Fajans, S. S., Signorini, S., Stoffel, M., and Bell, G. I. (1996). Mutations in the hepatocyte nuclear factor-4alpha gene in

The Regulators maturity-onset diabetes of the young (MODYl). Nature 384, 458-460. Yudt, M. R., and Cidlowski, J. A. (2002). The glucocorticoid receptor: coding a diversity of proteins and responses through a single gene. Mol Endocrinol 16, 1719-1726. Zechel, C , Shen, X. Q., Chambon, P., and Grdnemeyer, H. (1994). Dimerization interfaces formed between the DNA binding domains determine the cooperative binding of RXR/RAR and RXR/TR heterodimers to DR5 and DR4 elements. Embo J 13, 1414-1424. Zelko, I., Sueyoshi, T., Kawamoto, T., Moore, R., and Negishi, M. (2001). The peptide near the C terminus regulates receptor CAR nuclear translocation induced by xenochemicals in mouse liver. Mol Cell Biol 21, 2838-2846. Zenke, M., Munoz, A., Sap, J., Vennstrom, B., and Beug, H. (1990). V-erbA oncogene activation entails the loss of hormone-dependent regulator activity of c-erbA. Cell 61, 1035-1049. Zetterstrom, R. H., Solomin, L., Jansson, L., Hoffer, B. J., Olson, L., and Perlmann, T. (1997). Dopamine neuron agenesis in Nurrl-deficient mice. Science 276, 248-250. Zetterstrom, R. H., Solomin, L., Mitsiadis, T., Olson, L., and Perlmann, T. (1996). Retinoid X receptor heterodimerization and developmental expression distinguish the orphan nuclear receptors NGFI-B, Nurrl, and Norl. Mol Endocrinol 10, 1656-1666. Zhang, P., and Mellon, S. H. (1996). The orphan nuclear receptor steroidogenic factor-1 regulates the cyclic adenosine 3',5'-monophosphate-mediated transcriptional activation of rat cytochrome P450cl7 (17 alpha-hydroxylase/c 17-20 lyase). Mol Endocrinol 10, 147-158. Zhang, Y, Repa, J. J., Gauthier, K., and Mangelsdorf, D. J. (2001). Regulation of lipoprotein lipase by the oxysterol receptors, LXRalpha and LXRbeta. J Biol Chem 276, 43018-43024. Zile, M. H. (2001). Function of vitamin A in vertebrate embryonic development. J Nutr 131, 705-708.

Chapter 17 NFAT and MEF2, Two Families of Calcium-dependent Transcription Regulators Jun O. Liu\ Lin Chen^, Fan Pan^ and James C. Stroud^ Department of Pharmacology, Johns Hopkins School of Medicine, 725 North Wolfe Street, Baltimore, MD 21205 Department of Chemistry and Biochemistry, University of Colorado, Boulder, CO 80309

Key Words: NFAT, MEF2, calcium signaling, T cells, chromatin remodeling The inorganic ion calcium plays a pivotal role in signal transduction throughout biology. How a small metal ion causes such profound changes in chromatin structures and patterns of gene expression in the nucleus has fascinated biologists and chemists alike for decades. A universal sensor protein for intracellular calcium is a small protein known as calmodulin or its homologs. Calmodulin binds to four calcium ions in a cooperative manner, much like hemoglobin senses oxygen. Upon binding to calcium, calmodulin undergoes significant conformational changes and gain the ability to interact with diverse cellular target proteins to transmit the calcium signal. Two common classes of calmodulindependent signaling proteins are calmodulin-dependent kinases and a calmodulin-dependent phosphatase known as calcineurin. Upon activation by calmodulin, the kinases and phosphatase will act on their respective substrates, often transcription factors, to propagate the signal from the cytosol into the nucleus. A surprising finding in recent years was the existence of a direct signaling pathway from calmodulin to nuclear chromatin remodeling proteins to modulate the activity of a family of transcription factors. In this chapter, we will focus on two families of calcium-dependent transcription regulators, the nuclear factor of activated T cells (NFAT) family and the myocyte enhancer factor (MEF2) family. We will focus on the structure and activity of these transcription factors at the molecular and cellular levels without getting into their fiinctions in whole organisms.

By comparing and contrasting these two distinct families of transcription factors which also interact with each other in some cellular processes, the differences in both design and activities of these two families shall become apparent. General Features of NFAT NFAT was named as such, as it was first identified in T cells as a rapidly inducible nuclear transcription factor bound to the distal antigen receptor responsive element of the human IL-2 promoter (Shaw et al., 1988). As we know it today, NFAT is expressed in a number of cell types and is involved in numerous cellular processes. Among all known transcription factors, NFAT is unique in that it is sequestered in the cytoplasm of cells in the absence of calcium signaling and it undergoes nuclear translocation to access the DNA elements of its target genes upon the onset of calcium signaling. To date, NFAT has been shown to play critical roles not only in the immune system, the nervous system for both development and the cognitive fiinctions of adult neurons, but also during embryo development, particularly heart valve formation, and in muscle cell differentiation (Crabtree and Olson, 2002; Graef e^ al, 2001; Rao et al, 1997). NFAT consists of a family of distinct isoforms encoded by distinct genes; most of the NFAT isoforms exist in multiple splice variants. For historic reasons, the different isoforms of NFAT have been given different names. Under one nomenclature system, NFAT is named NFAT 1-5 whereas under another nomenclature system, it is named NFATcl-5. In this review, we will adopt the original names accorded to each isoform of NFAT, with

Corresponding Author: Jun O. Liu, Tel: (410) 955-4619, Fax: (410) 955-4620, E-mail: [email protected]

Section III

294

NFATc (NFAT2 or NFATcl), NFATp (NFATl or NFATc2), NFAT3 (NFATc4), NFAT4 (NFATc3) and NFAT5 (TonEBP) (Hoey et ai, 1995; McCaffrey et al, 1993; Northrop et al., 1994). Most tissues express a subset of NFAT isoforms, some of which appear to play redundant functions. It is also noteworthy that of the five known members of the NFAT family, NFAT5 is distantly related to the other four family members in that it is not responsive to calcium signaling (Lopez-Rodriguez et aL, 1999) and it will not be included in ensuing discussions. NFAT can be divided into several distinct domains, each of which plays a role in its function (Fig. 17.1). Its DNA binding domain, also known as Rel Homology Region (RHR), lies in the middle of the protein. It has two transactivation domains at both the N- and the C-termini, respectively. A large regulatory domain separates the N-terminal transactivation domain and the RHR, which mediates its regulation by the calcium and calmodulin-dependent protein phosphatase calcineurin and its subcellular localization. The rich regulatory domain can be further subdivided into multiple motifs: calcineurin-binding regions mediating the interaction between NFAT and calcineurin, two serine rich regions (SRRl and SRR2) and three SPXX repeats that undergo dephosphorylation by calcineurin; and a nuclear localization sequence that is responsible for nuclear translocation of NFAT upon calcium signaling. The regulatory domain confers to NFAT its most distinct feature—calcium-dependent dephosphorylation by the protein phosphatase calcineurin and its subsequent nuclear import to serve its function as a transcr5)tion regulator.

The Regulatory Domain-1: Regulation of NFAT by Calcineurin In resting T cells (as well as other cell types), TAD

Regulatory Domain

The Regulators

NFAT resides in the cytosol as a hyerphosphorylated protein. There are an estimated total of 13 serine residues that are phosphorylated, five in SRR-1 region, three and four in each of the SP-2 and SP-3 motif and one in SRR-2 that is in close proximity to the nuclear localization region (Okamura et ai, 2000). Upon T cell activation and the accompanying calcium influx, first from intracellular stores via the IP3 receptor and subsequently from the extracellular space through the cacium-release activated calcium channels (CRAC) on the plasma membrane, the cytosolic protein phosphatase calcineurin is activated by calmodulin. Activated calcineurin then dephosphorylates NFAT, exposing its nuclear localization sequence and causing it to translocate into the nucleus (Winslow and Crabtree, 2005) (Fig. 17.2). Unlike other serine/threonine phosphatases such as PPl and PP2A, calcineurin is unique in that it has a built-in calcium switch to turn on its phosphatase activity (Klee et aL, 1998). Calcineurin contains two subunits, a catalytic A subunit and a regulatory B subunit. The regulatory B subunit has been shown to confer structural stability to calcineurin and is likely to participate in substrate recognition, responsible for the relatively narrow substrate specificity of calcineurin (Klee et al., 1998). The catalytic subunit of calcinurin contains two regulatory domains toward its C-terminus, that together form the on-and-off switch for calcineurin. At the very C-terminus of the catalytic subunit of calcineurin is an autoinhibitory domain that serves as a pseudosubstrate and binds to the active site of calcineurin, keeping it inactive in the absence of a calcium signal. Next to the autoinhibitory domain is a cahnodulin-binding domain that mediates the binding of calcium-bound calmodulin, which leads to the dissociation of the autoinhibitory domain from the active site and access of hyperphosphorylated NFAT to the active site of calcineurin. Rel Homolog Region

TAD 928

CNBR-A

SRR-1

SP-1

SP-2 SRR-2 NLS

SP-3

CNBR-B

Fig. 17.1 NFAT domain structures. Different functional domains of NFAT are highlighted with different colors, with the regulatory region expanded to show different regulatory features. Abbreviations: TAD, transactivation domain; CNBR, calcineurin-binding region, SRR, serine-rich region; SP, serine-proline repeat motif; NLS, nuclear localization signal.

Chapter 17 NFAT-and MEF2

295

MHCH-Ag CD28

p59 fyn

...^ X

DAG

C^M

CyP-CsA

NF-AT

N ^

T Oct-l

^ca'-

NF-AT

OAP

M•

U 4^

IL-2

T T T CD-28 AP-1 Oct-l

NF-KB

Fig. 17.2 Calcium signaling pathway leading to the activation of NFAT. NFAT exists as a hyperphosphorylated form in the cytosol in resting T cells. Upon engagement of the TCR complex with MHCII-antigen complex on antigen presenting cells, membrane proximal protein tyrosine kinases including Fyn and Lck are activated, which leads to activation of phospholipase C (PLC))^ that generates the second messenger inositol-1, 4, 5-triphosphate (IP3). IP3 in turn causes release of calcium from intracellular stores that leads to further calcium influx from extracellular space. The second messenger calcium activates calmodulin (CaM) that then activates calcinemii (CAN-CNB). Activated calcineurin dephosphorylates NFAT to enable it to translocate into the nucleus to cause the transcriptional activation of such cytokine genes as IL-2.

To calcineurin, NFAT is not an ordinary substrate. There are a total of 13 phosphoserine residues to be dephosphorylated spanning a region of over 200 amino acids, as opposed to one or a few phosphoserine or phosphothreonine in other known calcineurin substrates such as inhibitor of PPl or the regulatory subunit of protein kinase A (Okamura et al, 2000). The multipUcity of phosphoserines that require dephosphorylation by calcineurin necessitates that NFAT is associated with calcineurin for relatively longer period of time so that phosphoserines at different regions of NFAT can be

efficiently and cooperatively dephosphorylated upon a single encounter with calcineurin. It is likely for this reason that NFAT also contains two calcineurin-binding regions (CNBR) or docking sites flanking the phosphoserine-containing segment. The N-terminal calcineurin docking site contains the consensus sequence PxIxIT, in which x can be any amino acids. While the N-terminal calcineurin docking site share homology with another calcineurin binding protein Cabin 1/Cain, the C-terminal calcineurin binding region is similar to the DSCR/MCIP/calcipressin family of endogenous

296

Section III- The Regulators

calcineurin inhibitors (Fuentes et al., 2000; Jiang et al, 1997; Kingsbury and Cunningham, 2000; Lai et ah, 1998; Liu, 2003; Rothermel et al, 2003; Sun et al, 1998). The PxIxIT calcineurin-docking motif has been studied in great detail (Aramburu et a/., 1998; Aramburu et al, 1999; Li et al, 2004; Liu et al, 2001) whereas the role of the C-terminal calcineurin binding region in NFAT remains to be elucidated. It has been shown that PxIxIT motif of NFAT is likely to associate with the catalytic domain of calcineurin at a site that is conserved between calcineurin and PPl or PP2A and that are used frequently by other PPl regulatory proteins for association (Li et al, 2004). This site, sandwitched by the loops connecting 0 strands, lie in proximity to the metal ion-containing active site of calcineurin, rendering it possible for the adjacent phosposerine residues to gain access to the active site of calcineurin in a pheudo-intramolecular fashion once NFAT is bound through this site to calcineurin. This is consistent with the observation that synthesized oligopeptide containing PxIxIT or its high affinity variants, specifically inhibits dephosphorylation of NFAT, but not other substrates, by calcineurin in vitro (Aramburu et al., 1999), raising the possibility that small molecules bound to this docking site in calcineurin will become substrate-specific inhibitors of calcineurin. Indeed, small molecule inhibitors were identified through a high-throughput screen that selectively blocked NFAT dephosphorylation by calcineurin in vivo and TCR-mediated IL-2 transcription (Roehrl et al., 2004). It is conceivable that these inhibitors, if improved to possess efficacy in vivo, will be have less toxicity than the currently used inhibitors of calcineurin such as cyclosproin A and FK506 in the clinic. The dephosphorylaUon of NFAT by calcineurin results in a major conformational change that masks the nuclear export sequence while revealing the nuclear localization sequence (Zhu and McKeon, 1999). Dephosphorylated NFAT will translocate from the cytosol into the nucleus where it binds, either alone or more often, in complex with other DNA-binding transcription factors, to its cognate recognition sequences. In response to calcium signaling, the nuclear translocation of NFAT is complete within minutes, underlying the relatively rapid conversion of calcium signal in the cytosol into a nuclear transactivation output. The nuclear localization of NFAT requires sustained activation of calcineurin, as inhibition of calcineurin by CsA or FK506, leads to rapid rephosphorylation of NFAT and its return from the nucleus into the cytosol (Zhu and McKeon, 1999). Indeed, NFAT is under dynamic control of cellular kinases that oppose the activity of calcineurin.

The Regulatory Domain-2: Regulation of NFAT by Kinases In the lifetime of NFAT, it has to undergo phosphorylafion on two distinct occasions. First, upon translation, NFAT has to be phosphorylated by cellular kinases to prevent its entry into the nuclear compartment. Second, upon termination of calcium signaling, NFAT is subject to phosphorylation to exit the nucleus. It is unclear whether the same cellular kinases are responsible for post-translational phosphorylation and post-activation phosphorylation of NFAT. A number of candidate enzymes have been identified that are capable of phosphorylating NFAT (Hogan^^ al, 2003; Neilson et al, 2001; Zhu and McKeon, 2000). This is not surprising, as the multiple phosphorylated residues in NFAT reside within completely distinct sequence contexts, suggesting that they are targets for different classes of kinases. It is likely that phosphorylation of NFAT is accomplished by the collaborative action of different kinases. Wherease the kinases responsible for posttranslational phosphorylation of NFAT are likely to be constitutively active enzymes, those responsible for post-activation phosphorylation of NFAT may include signal-activated kinases. Among the putative NFAT kinases identified to date, some, such as casein kinase (CK)1 (Zhu et aL, 1998), are constitutive, while others, such as GSK3 (Beals et al., 1997), cAMP-dependent kinase (Chow and Davis, 2000), MEKK (Zhu et al, 1998), p38 (Gomez del Arco et al, 2000; Yang et aL, 2002) and JNK (Chow et ai, 1997), are subject to signal dependent regulation. It has been shown that for GSK3 to phosphorylate NFAT, a priming phosphorylation by PKA is required (Sheridan et al, 2002), necessitating a collaborative action of those two kinases to phosphorylate NFAT. Due to the difference in the sequences in the regulatory region, different NFAT isoforms are substrates for different, though overlapping, subsets of the kinases. For example, JNKl was shown to phosphorylate NFATc and NFAT4 (Chow et al, 1997). In contrast, p38 is selective for NFATp and NFAT4 (Gomez del Arco et al, 2000; Yang et al, 2002). It is possible that there may exist redundant NFAT kinases in the same cell type and the primary kinase responsible for NFAT phosphorylation will be dependent on which signaling pathways are operative at a given time. It is worth noting that it takes energy to keep NFAT in a multiply phosphorylated state in resting cells. It is more common and economical for cells to keep the basal states of signaling proteins in unphosphorylated form and use phosphorylation cascades to transmit cellular

Chapter 17 NFAT and MEF2

signals. Although calcium and calmodulin-dependent kinases are expressed in T cells and participate in T cell receptor signaling, eventually a dephophosphorylationdependent nuclear translocation was chosen over a phosphorylation-dependent nuclear translocation of NFAT. This may be due to the use of calmodulindependent kinase cascades in regulating other transcription regulators such as CREB and Cabin 1 (F. P., Means, A., and J.O.L., unpublished results), making it difficult to "rewire" calmodulin-dependent kinase cascade to the activation of NFAT. The Rel-homology Domain: Interaction with DNA and other Transcription Factors The NFAT family of proteins shares a highly conserved DNA binding domain that is similar to the Rel homology region/domain (RHR) initially identified in the RCI/NF-KB proteins (Chen, 1998; Ho, 1994). The canonical mode of DNA binding by the RHR has been well characterized in the structures of several N F K B DNA complexes (Chen, 1998; Ghosh, 1995; Muller, 1995): the RHR contains two functionally distinct domains, a N-terminal specificity domain (RHR-N) that makes base-specific DNA contacts, and a C-terminal domain involved in dimer formation and IKB binding (RHR-C) (Huxford, 1998; Jacobs, 1998). Of the five NFAT proteins, NFAT5, also known as TonEBP, shows the highest degree of structural similarity to NFKB, forming a symmetric NFAT5 dimer with a striking resemblance to the N F K B - D N A complex (LopezRodriguez, 2001; Miyakawa, 1999; Stroud, 2003). Unlike the classical Rel proteins and the related NFAT5/TonEBP, NFAT 1-4 exists as monomer in solution (Chen, 1995; Chytil, 1996; Hoey et a/., 1995), and binds DNA as a monomer at its cognate site (Stroud, 2003), as a dimer at KB like sites (Giffin, 2003; Jin, 2003), or in complexes with other transcription factors at composite sites (Chen, 1998). The structures of many of these NFAT complexes have been characterized in the last few years. A: DNA Binding by a NFAT Monomer The crystal structure of the human NFATl RHR bound to DNA as a monomer has recently been solved (Stroud, 2003). In this complex, a DNA recognition loop from the RHR-N binds the core NFAT site GGAA through mechanisms highly conserved in other Rel/DNA complexes (Chen, 1998; Ghosh, 1995; Muller, 1995). The NFATl/DNA binary complex also reveals a novel DNA-binding mode by the NFAT RHR wherein the RHR-C wraps around the DNA and makes extensive contacts to the phosphate backbone (Fig. 17.3A). This

297'

mode of protein-DNA interaction is consistent with the DNA methylation and ethylation footprints of the binary NFAT/DNA complex in solution (Stroud, 2003). Surprisingly, there are four independent NFAT/DNA complexes in the asymmetric unit of the crystal. In all four complexes, the structure of the RHR-N and its interaction with DNA are almost identical, suggesting that the RHR-N/DNA interaction is a conserved feature of the NFAT/DNA complexes. Indeed, in all NFAT complexes characterized so far, including the NFAT monomer/DNA complexes, the NFAT dimer/DNA complex (see below) (Giffin, 2003; Jin, 2003) and the NFAT/Fos-Jun/DNA ternary complex (see below), the interaction between RHR-N and its cognate DNA site is kept constant. However, the RHR-C of each NFAT/DNA complex in the NFATl monomer/DNA complex adopts a different orientation. Thus, it seems that when NFAT binds DNA, its RHR-C constantly cast in space to look for interaction partner. This is reminiscent of DNA binding of Fos-Jun^ which rotates between two distinct orientations until NFAT joins in to bind the ARRE2 site as a stereo-specific NFAT/Fos-Jun/DNA complex (Chen, 1995). The conformational flexibility of the RHR-C is therefore likely a key structural feature of NFAT to allow the assembly of higher-order transcription complexes between NFAT and a variety of partners in different promoter contexts. B: Binding ofKB-like DNA Sites by NFAT Dimes DNA binding by an NFAT dimer has been implicated in the activation of specific subsets of host and viral genes. Two NFAT dimer complexes, bound to KB sites fi-om the IL-8 promoter and the HIV-1 LTR, have been characterized at the structural level (Giffin, 2003; Jin, 2003) (Fig. 17.3B, C). As in the NFAT5 and Rel dimer complexes, the NFATl dimerization is mediated by the RHR-C (Fig. 17.3B, C). However, unlike the symmetric and hydrophobic RHR-C dimer interface seen in NFAT5 and N F K B , the RHR-C dimer interface in NFATl is asymmetric and largely hydrophilic, and involves different residues on the RHR-C. The RHR-C dimer interface is identical in the NFATl dimers bound to the IL-8 and HIV-1 LTR KB sites (compare Fig. 17.3B, C), and mutational and biochemical evidence suggests that the interface also occurs in solution and contributes to cooperative DNA binding by NFATl dimers to the KB sites. Many of the RHR-C interface residues observed in the NFATl dimer are conserved in NFAT2 and NFAT4, suggesting that at least some members of the NFAT family could form homo- or heterodimers on KB-like DNA sites. These studies provide a direct structural explanation for the long-standing puzzle of

Section III

298

how NFAT recognizes the KB sites as a dimer, which are usually bound by preformed dimers of the NF-KB family of proteins. These studies also support a potential mechanism by which HIV-1 exploit host transcription factor (NFAT and NF-KB) for its transcription and replication. Comparison of the NFAT dimer bound to KB sites from the IL-8 promoter and the HIV-1 LTR has also provided a dramatic example of how subtle sequence

The Regulators

variations in the DNA binding site can affect the conformation of bound transcription factor. Since this finding has major implications for how cis-regulatory elements in human genome may gain diverse functions (Leung, 2004), we will discuss this phenomenon further here. The two NFATl dimer complexes on the IL-8 promoter and the HIV-1 LTR differ significantly in their RHR-N interactions and hence their overall conformation (compare Fig. 17.3B, C). The IL-8 and HIV-1 LTR KB

RHR-N

RHR-C

5*-TTGCTGGAAAAATAG -3' 3'- CGACCTTTTTATCAA-5' Fig.l7.3A Systematic structural studies, of NFAT complexes. The proteins are shown in ribbon style, with the RHR-N domain in green and the RHR-C domain in yellow. The DNA is drawn in stick model with its axis perpendicular to the paper. The DNA sequences used in the crystallographic studies are Usted under each structure. The NFAT binding sites are bold and the AP-1 site is underlined in d. Also in panel d, Fos and Jun are colored in red and blue, respectively, {a) NFAT monomer bound to a cognate NFAT site. The four independent NFAT/DNA complexes are shown; (b) The NFATl dimer bound to the KB site from the HIV-1 LTR; (c) The NFATl dimer bound to a KB site similar to that in the human IL-8 promoter, {d) The NFATl/Fos-Jun complex bound to the ARRE2 site from the murine IL-2 promoter.

Chapter 17

NFAT and MEF2

299

RHR-C

RHR-N

5 -AATGGGGACTTTCCA -3' ACCCCTGAAAGGTT -5' rig.l7.3B

RHR-C

RHR-N

5'-TTGAGGAATTTCCA -3' ACCCTTAAAGGTAA-5' Fig.l7.3C

sequences can be viewed as two NFAT sites arranged in a dyad orientation, but separated by 9 or 10 bp respectively (IL-8 KB, G G A A A T T C C : H I V - 1 L T R KB, GGGACTIICC). In the IL-8 KB complex, each consensus NFAT site is bound to the RHR-N of one NFATl monomer; while in the HIV-1 LTR KB complex, the NFATl monomer bound to the 5' end of the site surprisingly binds the lower consensus sequence (GGGACTTTCC) with a 10 bp spacing, instead of binding to the more consensus sequence (GGGACTTTCC) with a 9 bp spacing. As a result, the NFATl dimer on the HIV-1 LTR KB site completely encircles the DNA through E'F loop interactions, in a manner similar to that seen in the NFAT5/DNA complex. The extra

conserved guanine residue at the 5' end of this sequence (GGGACTTTTCC) allows the NFAT dimer to "slip" into the 10 bp binding mode, in which it gains additional stability through E'F loop interactions without significantly losing protein-DNA interactions. By contrast, on the IL-8 KB site, the two NFAT monomers are strictly anchored to the two consensus NFAT sites in a 9 bp spacing mode, resulting in an open conformation that does not permit E'F loop interactions. Notably, the E'F loop is also used in the ternary NFAT/Fos-Jun/DNA complex (Chen, 1998), where it constitutes the major binding site for Fos-Jun (see below), emphasizing the versatility of this protein surface in promoting assembly of distinct NFAT transcription complexes.

300

Section III

C: The NFAT/FoS'Jun/DNA Ternary Complex NFAT cooperates with a myriad of partner transcription factors to regulate distinct transcription programs. This cooperation occurs at composite elements that generally have a consensus site for one member of the complex and a non-consensus site for the other. For instance, the ARRE2 element in the human IL-2 promoter has a consensus NFAT site (GGAA) and a nonconsensus AP-1 site (TGTTTCA) that differs considerably from the consensus (TGACTCA). NFATl-4 proteins form cooperative complexes on such composite DNA elements with the unrelated transcription factor AP-1 (Fos-Jun dimers) (Fig. 17.3D), thereby integrating two different signaling pathways, the calcium/ calcineurin pathway that activates NFAT and the phorbol esterresponsive MAP kinase pathway that promotes the synthesis and activation of Fos and Jun family proteins (Chen, 1999). Since the NFAT/AP-1 complex is not preformed before binding to DNA, the complex must undergo step-wise assembly at the promoter where the conformation of NFAT and the orientation of Fos-Jun on DNA become fixed (see above). The crystal structure of the NFAT/Fos-Jun/DNA complex fornled on the ARRE2 site was solved (Chen, 1998). The NFAT/Fos: Jun complexes contact an -15 basepair stretch of DNA, in which the NFAT and AP-1 elements are precisely apposed to each other. The residues involved in Fos-Jun contact are located largely in the N-terminal RHR domains of NFAT, and form an extensive network of mostly polar interactions with residues in the basicleucine zipper regions of Fos and Jun (Chen, 1998). The interacting residues are almost completely conserved in NFAT 1-4 but are absent from NFAT5 (Lopez-Rodriguez et al., 1999), indicating that the ability to cooperate with Fos and Jun was a restricted to the calcium-responsive members of the NFAT family (NFAT 1-4). D: Complexes with Other Transcription Factors Although NFAT is known to be essential for its target genes, including cytokine genes in T cells in response to antigen receptor activation, its activation alone does not seems to efficient for driving the expression of those genes. As such, NFAT does not belong to the category of master control genes. Consistent with this notion, NFAT often works in concert with other transcription factors to activate gene transcription, which allows for the integration of multiple signals that act on different transcription factors. NFAT engages in direct proteinprotein interactions and/ or influences transcription synergistically with several families of transcription factors. These include the AP-1- like bZIP proteins such as Maf, ICER, (Bodor, 2000; Bower, 2002; Ho, 1996);

The Regulators

the zinc finger proteins GATA and EGR (Decker, 2003; Decker, 1998; Molkentin, 1998); the helix-tum-helix domain proteins Oct, HNF3 and IRF-4 (Bert, 2000; Furstenau, 1999; Hu, 2002); the MADS-box protein MEF2 (Olson, 2000). For transcriptional partners other than AP-1, it is not known whether the synergy with NFAT occurs in the context of true "composite" regulatory elements that have a defined geometry and spatial orientation for cooperative binding of NFAT and these partner proteins. In the future, it will be interesting to analyze the structure and function of distinct NFAT transcription complexes to gain insight into the structural and fiinctional versatility of NFAT.

RHR-N

RHR-C

Fos

Jun

5' TTGGAAAATTTGTTTCATAG 3' CCTTTTAAACAAAGTATCAA 5' Fig.l7.3D

In summary, systematic structural studies of NFAT complexes reveal that NFAT can bind DNA as monomers at cognate (GGAA) sites, as dimers at KB-like response elements, and as cooperative complexes with Fos-Jun at NFAT:AP-1 composite sites. In different complexes, NFAT adopts distinct conformations and its protein surface mediates distinct protein-protein interactions. This diversity of binding modes arises, at least in part, from the fact that NFAT is not an obligate dimer. The remarkable conformational flexibility of NFAT on different DNA sites is likely to facilitate the assembly of NFAT into distinct higher-order complexes containing

Chapter 17 NFAT and MEF2

diverse DNA-binding partners. Studies in the past a few years have expanded the function of the calcineurin/NFAT pathway to many medically important processes. These studies not only broaden the potential clinical application of drugs targeting the calcineurin/NFAT pathway, but also raise the question as to whether specific branches of the calcineurin/NFAT signaling pathway may be targeted for therapeutic benefits. Detailed studies of NFAT complexes to identify unique protein-protein interface in distinct NFAT complexes will help address this important question. The Transactivation Domains: Interaction of NFAT with p300 and CBP A common transactivation domain among all four isoforms of NFAT lies at the N-terminus, consisting of about 100 amino acids. Despite the lack of sequence similarity, contiguous stretches of acidic amino acids are found in the transactivation domains of different NFAT isoforms, which are likely to be involved in the recruitment of the basal transcription machinery to initiate transcription as has been shown for other acidic transactivation domains (Ruden et al, 1991). The C-terminus of NFAT has also been shown to be capable of activating transcription when fused to DNA binding domains of other transcription factors (Luo et al, 1996). In addition, the N-terminal transactivation domain of NFATp has been shown to interact with p300 and CBP for further enhance transcription (Garcia-Rodriguez and Rao, 1998). Thus, NFAT is likely to activate gene transcription by interacting with both chromatin remodeling enzymes and the basal transcription machinery. Unconventional Modes of Transcription Regulation by NFAT as Repressors and Coactivators Although NFAT has been shown to serve as a transcription activator for a number of genes from T cells to muscle cells, several lines of evidence suggest that it may also be involved in repressing gene expression. First, DNA microarray analyses revealed that the activation of the calcineurin-NFAT pathway led to both activation of certain genes and suppression of others, indicating that NFAT is capable of repressing gene expression (Diehn et ai, 2002; Feske et al, 2001). Second, it has been shown that knockout of several isoforms of NFAT led to an enhanced, rather than decreased, production of cytokines genes, consistent with a repressive role of NFAT for gene expression (Hogan et al, 2003). Third, based on analyses of several NFAT-DNA complexes, it has been shown that

301

NFAT is capable of binding to DNA in dramatically different conformations, making it possible for NFAT to switch partners that may be associated with either transcriptional coreppressors or coactivators. It has been unambiguously shown that NFAT is responsible for the repression of cyclin-dependent kinase 4 expression in T cells (Baksh et al, 2002). NFAT binding sites were found in the promoter region of Cdk4. Activation of the calcineurin-NFAT pathway was found to inhibit Cdk4 gene activation, suggesting that NFAT plays a central role in controlling cell cycle during T cell activation. Consistent with this finding, Cdk4 expression was found to be upregulated in mouse embryofibroblasts derived from NFATp and calcineurinAa null animals. That NFAT may serve as a pure coactivator independent of its DNA binding domain was found through the analysis of the activation of the Nur77 promoter during thymocyte apoptosis (Youn and Liu, 2000; Youn et ai, 1999). TCR-dependent Nur77 expression requires calcineurin-NFAT pathway as judged by the sensitivity of Nur77 promoter to FK506 and cyclosporin A, but not rapamycin. Although the Nur77 promoter contains two consensus NFAT binding sites next to each of the two MEF2 binding sites, mutagenesis of the two NFAT-binding sequences had no effect on calcium-dependent Nur77-luciferase reporter gene activation (Youn et al., 2000a). Moreover, mutants of NFAT defective in DNA binding were equally active in causing Nur77 gene activation. These observations strongly suggest that in the context of Nur77 gene activation in thymocytes, NFAT serves as a pure coactivator. Indeed, NFATp was shown to bind to both MEF2, via its C-terminal transactivation domain, and p300, via its N-terminal transactivation domain (vide infra), to stabilize the MEF2-p300 complex, causing full activation of the Nur77 gene to cause thymocyte apoptosis upon calcium signaling. General Features of MEF2 MEF2 is composed of a family of four isoforms encoded by four distinct genes, MEF2A-D (Olson ^^ al, 1995). Similar to NFAT, each MEF2 gene can be expressed as multiple splicing variants. Although MEF2 was originally identified in muscle cells and was shown to play an important role in muscle cell differentiation, it was subsequently found to be ubiquitously expressed with each cell type expressing a subset of MEF2 isoforms. To date, MEF2 has been shown to regulate cell growth, differentiation and death. Like NFAT, MEF2 is also activated upon calcium signaling. Unlike NFAT, however, MEF2 can also be stimulated by a wide

302

Section III

variety of other signals through phosphorylation or ubiquitination. Therefore, MEF2 is not a dedicated to respond to calcium signaling as NFAT. MEF2 belongs to the superfamily of MADS box proteins, MADS being derived from MCMl, Agamous, Deficiens and Serum-response Factor, transcription factors involved in diverse cellular process from yeast to mammals. MEF2 can be divided into two structural domains, an N-terminal domain (MADS/MEF2S) domain and a C-terminal transactivation and regulatory domain. The MADS/MEF2S domain is responsible for DNA binding, dimerization and association with either HDACs or HATs. What distinguish MEF2 from other MADS superfamily members such as serum response factor is that MEF2 contains, immediately next to the MADS domain, a MEF2S extension that is unique and characteristic of MEF2 family members. This MEF2S extension not only eliminates potential interactions of MEF2 from other MADS domain partner proteins but also endowed MEF2 with the ability to interact with both HATs and HDACs, setting up the calcium-responsiveness within the MEF2 family members. Among the four different isoforms of MEF2, the N-terminal MADS/ MEF2S domain is highly conserved. As MEF2 exists as obligatory dimers, this sequence conservation in the MADS/MEF2S domain allows different members of MEF2 expressed within the same cell type to form various combinations of homo- and heterodimers. In contrast to the highly conserved N-terminal MADS/ MEF2S domain, the C-terminal domains are distinct between the different isoforms of MEF2. As the C-terminal domains are recipients of non-calcium signals for MEF2 activation, this allows for integration of other stimulation signals with calcium signaling by MEF2. Interaction of MEF2 with HATs and HDACs It has been shown that p300 binds to the N-terminal MADS/MEF2S domain, enhancing the transcriptional activity of MEF2. Interestingly, a superfamily of transcription corepressors was found to bind the MADS/MEF2S domain of MEF2 as well. They include Cabinl/cain (Lai et al, 1998; Sun et al, 1998), originally identified as a calcineurin-binding protein, and the entire family of class II HDACs (McKinsey et al, 2002). That both HATs and HDACs are capable of binding to the relatively small MADS/MEF2S domain of MEF2 raised the question of whether they bind to the same site in MEF2 and if so, how their binding to MEF2 is regulated under different physiological conditions. Using thymocytes as a model system, it was shown the binding of p300 and Cabin 1 to MEF2 is mutually

The Regulators

exclusive (Youn et al., 2000a). This is consistent with the model that Cabin 1 as well as class II HDACs are associated with MEF2 when its activity is suppressed, and p300 replaces corepressors when MEF2 is activated. Although Cabin 1 does not possess intrinsic HDAC activity, it is capable of recruiting HDACl and 2 via another corepressor mSinS (Youn et ai, 2000b). Thus, Cabin 1 and different members of the class II HDAC family are functionally redundant for suppression of MEF2 activity. Limited genetic and cell biological evidence suggests a cell-type specific role for different members of the MEF2 corepressor family. For example, the expression of Cabin 1 is not seen in muscle cells, where there is abundant expression of class II HDACs, such as HDAC4 and 5. In thymocytes, it appears that Cabin 1 plays negligible role in regulating MEF2dependent expression of Nur77 while it seems to be critical for controlling MEF2 in peripheral T cells (Esau etaL, 2001). Regulation of MEF2/HDAC or HAT Interaction by Calcium Signaling Different fi-om NFAT, which undergoes calcium dependent cytosol-to-nucleus translocation upon calcium signaling, MEF2 is constitutively bound to its target DNA element in the nucleus regardless of activation status as judged by the results of chromatin immunoprecipitationPCR assay (Pan et al, 2004; Youn and Liu, 2000). The calcium-dependent activation of MEF2 is mediated through the modulation of association of MEF2 corepressors and the calcium switches are built into the corepressors, including Cabinl and class II HDACs. There are at least two complementary and distinct mechanisms by which calcium signaling regulates the association of MEF2 with its corepressors. The first mechanism involves the binding of activated calmodulin to Cabinl or class II HDACs and the consequent dissociation of these corepressors fi*om MEF2 as a result of competition between active calmodulin and MEF2 for the corepressors (Liu, 2005) (Fig. 17.4). The mutually exclusive binding of MEF2 and calmodulin to Cabinl or class II HDACs are made possible by conferring to the same overlapping fi*agment of the corepressors the ability to bind to either MEF2 or calmodulin. The calcium-dependent dissociation of corepressors fi-om MEF2 was first demonstrated for Cabinl and was subsequently extended to HDAC4. By sequence comparison, it seems that this mechanism applied to all other members of class II HDAC (Berger et al, 2003; Youn et aL, 2000b). This represents an unprecedented mechanism of direct signaling from

Chapter 17 NFAT and MEF2

303

NFAT.

\///////};\ MEF2

Fig.17.4 Regulation of MEr2 by calcium signal and integration of the calcineurin-NFAT signaling pathway with MEF2. In resting T cells, MEF2 recruits HDAC-containing repressors such as Cabin 1 in the context of the IL2 and Nur77 promoter to repress the expression of the target genes. Upon calcium signaling, nuclear calmodulin directly bind to Cabin 1 or class II HDACs (not shown) to dissociate them from MEF2 and allow for the association of p300. The MEF2-p300 complex can be further stabilized by NFAT, which forms a ternary complex with MEF2 and p300.

calcium to a nuclear chromatin remodeling complex to activate transcription. A second mechanism of calcium-dependent dissociation of corepressors from MEF2 was through the CaM kinase-mediated and 14-3-3-dependent nuclear export of the corepressors. This was originally demonstrated for HDAC4 and HDACS in muscle cells (Lu et al, 2000; McKinsey et al, 2000). Thus, upon calcium signaling, calmudulin-dependent protein kinase II and IV are activated. They are capable of phosphorylating class II HDACs, creating docking sites for 14-3-3. Upon binding of 14-3-3 to class II HDACs, they undergo translocation from the nucleus to the cytosol. More recently, it was shown that Cabin 1, like class II HDACs, also becomes phosphorylated by CaM kinase IV in human T cells upon activation, associates with 14-3-3 and exit the nucleus (F. P, J.O.L., and A. Means, unpublished). Thus, it appears that two independent mechanisms exist that ensures the dissociation of repressors from MEF2 and further exclusion of them away from MEF2 upon egression into the cytosol. In muscle cells, it has been shown that the kinase(s) responsible for class II HDAC nuclear export may not be a calmodulin-dependent kinase, thus allowing for the integration of other cellular signals into MEF2 for its full activation. Once corepressors are removed from MEF2 upon calcium signaling, the vacant binding site on MEF2 for the corepressors will become available for the binding of coactivators such as p300. The switchfromcorepressors

to coactivators is a dynamic yet ordered process, so that there is no aberrant p300 binding to MEF2 in the absence of a stimulation signal. It is extraordinary that the relatively small N-terminal SMADS/MEF2S domain could be responsible for both DNA binding and for interaction with both HATs and HDACs. The secret was revealed upon the attainment of a high-resolution crystal structure of MEF2 in complex with both DNA and the MEF2 binding peptide derived from Cabin 1. The crystal structure of the MADS-box/MEF2S domain of human MEF2B bound to the MEF2-binding motif of Cabin 1 and DNA has been published (Han et al., 2003) (Fig. 17.5A). This structure provides the first view of co-repressor recruitment by MEF2. The crystal structure reveals a stably folded MEF2S domain (hehces H2, H3 and strand S3) on top of the MADS-box (HI, SI and S2). Cabin 1 adopts an amphipathic-helix (red) that binds a hydrophobic groove on the MEF2S domain. The protein surface of MEF2 is made up primarily by the MEF2S domain, which forms a concave hydrophobic pocket resembling the antigen peptide-binding site of the Major Histocompatibility Complex (MHC). This hydrophobic pocket may act a signaling module to bind a variety of protein factors including both co-repressors and co-activators that function in complex with MEF2. More recently, the complex between the MEF2binding motif of class II HDACs and the MADSbox/MEF2S domain of MEF2B has been characterized by structural and biochemical methods (Han et aL, 2005). The crystal structure of an HDAC9/MEF2/DNA

Section III

304

The Regulators

Cabin i

Cabin 1/MEF2 interface S3

HDAC9/MEF2 interface

B

Fig.l7.5B

l)\ \ 5' -AAGCTACTATATTTAGC -3' 3' CGATGATATAAATCGAA-5' Fig.l7.5A Fig. 17.5 The crystal structures of the co-repressor/ MEF2/DNA complex. (A) The overall structure of the Cabin 1/MEF2/DNA complex. The MEF2-binding motif of Cabin 1 (red), MEF2B (monomer A in green, monomer B in blue) and DNA (magenta) in the complex are colored differently. The DNA sequence used in the crystal is listed below, with the MEF2 binding site in Bold. (B) A key difference between the Cabinl/MEF2 (left panel) and the HDAC9/MEF2 (right panel) interface. At the Cabinl/MEF2 interface, Ala2175 does not fill up a hydrophobic pocket of the MEF2 surface, whereas Phel50 in HDAC9 fit snugly into this pocket at the HDAC9/MEF2 interface.

complex reveals that HDAC9 binds to a hydrophobic groove of the MEF2 dimer. The overall binding mode is similar to that seen in the Cabin 1/MEF2/DNA complex. The detailed binding interactions at the HDAC9/MEF2 interface, however, show marked differences from those at the Cabinl/MEF2 interface (Fig.l7.5B). These studies further support a general mechanism by which class II HDACs and possibly other transcriptional co-regulators are recruited by MEF2. On the other hand, the differential binding between MEF2 and its various partners may confer specific regulatory and functional properties to MEF2 in distinct cellular processes. Interaction between MEF2 and other Transcription Factors Similar to NFAT, MEF2 is capable of interacting with a number of unrelated transcription factors to cooperatively drive target gene expression. In muscle cells, it has been shown that MEF2 interacts with myogenic bHLH proteins such as MyoD to induce muscle cell differentiation (Black et al, 1998). As discussed earlier in this chapter, MEF2 also binds NFAT and form a ternary complex with NFAT and p300 on the Nur77 promoter to cause full activation of Nur77

expression during thymocyte apoptosis (Youn et al, 2000a) (Fig. 17.4). Surprisingly, the NFAT-interacting domain was confined to the N-terminal MADS/MEF2S domain, which also interact with both DNA and p300. It will be interesting to see how structurally this relatively small domain accommodates both NFAT and p300 for the formation of a ternary complex on DNA. Function and Regulation of the Transactivation Domain of MEF2 Although the four isoforms of MEF2 diverge in sequence in the C-terminal transactivation domains, some motifs are conserved. Contiguous acidic amino acid stretches characteristic of eukaryotic transactivation domains are found in all forms of MEF2, although they are sometimes spliced out in certain splice isoforms. These acidic blobs are likely to play a part in the transactivation of target genes by MEF2. In addition, the transactivation domains of different isoforms of MEF2 contain the consensus phophsorylation sites for the MAP kinases including p38 and ERK5. It has been shown that phosphorylation by these kinases further enhances the transactivation activity of MEF2. It is interesting to note that the MADS/MEF2S domain

Chapter 17

contains the binding sites for p300. Therefore, it is likely that MEF2-bound p300 will work in concert with the transactivation domain to cause transcriptional activation. Perspectives How the second messenger calcium signals from the cytosol into the nucleus to cause a transcriptional output can be achieved in different ways. Although both NFAT and MEF2 are calcium-responsive transcription factors, the ways they respond to calcium signaling are significantly different, even though both are mediated through the immediate calcium sensor calmodulin. For NFAT, the calcium switch is built into its upstream phosphatase calcineurin. It is the C-terminal autoinhibitory domain and calmodulin-binding domain, which together forms the on-and-off switch for calcium signaling. Once calcineurin is activated, it dephosphorylates NFAT to enable it to translocate into the nucleus. It is through compartmental segregation that NFAT is kept inactive in the absence of calcium signaling. For MEF2, however, the calcium switch is embedded in its associated transcriptional corepressors, be it Cabin 1 or class II HDACs. It is through calcium and calmodulin-dependent dissociation of the HDAC-containing corepressors and the consequent association of HATs that calcium regulates the transcription of MEF2. Although it took different paths to design the two calcium-sensing transcription/chromatin remodeling modules, the same endpoint—calcium-dependent transcriptional activation— was achieved.

References Arambum, J., Garcia-Cozar, F., Raghavan, A., Okamura, H., Rao, A., and Hogan, R G. (1998). Selective inhibition of NFAT activation by a peptide spanning the calcineurin targeting site of NFAT Mol Cell 7, 627-637. Arambum, J., Yafife, M. B., Lopez-Rodriguez, C , Cantley, L. C , Hogan, R G., and Rao, A. (1999). Affinity-driven peptide selection of an NFAT inhibitor more selective than cyclosporin A. Science 255, 2129-2133. Baksh, S., Widlund, H. R., Frazer-Abel, A. A., Du, J., Fosmire, S., Fisher, D. E., DeCaprio, J. A., Modiano, J. F., and Burakoff, S. J. (2002). NFATc2-mediated repression of cyclin-dependent kinase 4 expression. Mol Cell 70, 1071-1081. Beals, C. R., Sheridan, C. M., Turck, C. W., Gardner, R, and Crabtree, G. R. (1997). Nuclear export of NF-ATc enhanced by glycogen synthase kinase-3. Science 2 75, 1930-1934. Berger, L, Bieniossek, C , Schaffitzel, C , Hassler, M., Santelli, E.,

NFATandMEF2

305

and Richmond, T. J. (2003). Direct interaction of Ca2+/calmodulin inhibits histone deacetylase 5 repressor core binding to myocyte enhancer factor 2. J Biol Chem 278, 17625-17635. Bert, A. G., Burrows, J., Hawwari, A., Vadas, M. A., and Cockerill, R N. (2000). Reconstitution of T cell-specific transcription directed by composite NFAT/Oct elements. J Immunol 165, 5646-5655. Black, B. L., Molkentin, J. D., and Olson, E. N. (1998). Multiple roles for the MyoD basic region in transmission of transcriptional activation signals and interaction with MEF2. Mol Cell Biol 18, 69-77. Bodor, J., Bodorova, J., and Gress, R. E. (2000). Suppression of T cell function: a potential role for transcriptional repressor ICER. J Leukoc Biol 67, 774-779. Bower, K. E., Zeller, R. W., Wachsman, W., Martinez, T., and McGuire, K. L. (2002). Correlation of transcriptional repression by p21(SNFT) with changes in DNA.NF-AT complex interactions. J Biol Chem 2 77, 34967-34977. Chen, F. E., Huang, D. B., Chen, Y. Q., and Ghosh, G. (1998). Crystal structure of p50/p65 heterodimer of transcription factor NF-kappaB bound to DNA. Nature 391, 410-413. Chen, L., Oakley, M. G., Glover, J. N., Jain, J., Dervan, R B., Hogan, R G., Rao, A., and Verdine, G. L. (1995). Only one of the two DNA-bound orientations of AP-1 found in solution cooperates with NFATp. Curr Biol 5, 882-889. Chen, L., Rao, A., and Harrison, S. C. (1999). Signal integration by transcription-factor assemblies: interactions of NF-ATl and AP-1 on the IL-2 promoter. Cold Spring Harb Symp Quant Biol ^^,527-531. Chow, C. W., and Davis, R. J. (2000). Integration of calcium and cycHc AMP signaling pathways by 14-3-3. Mol Cell Biol 20, 702-712. Chow, C. W., Rincon, M., Cavanagh, J., Dickens, M., and Davis, R. J. (1997). Nuclear accumulation of NFAT4 opposed by the JNK signal transduction pathway. Science 278, 1638-1641. Chytil, M., and Verdine, G. L. (1996). The Rel family of eukaryotic transcription factors. Curr Opin Struct Biol (5, 91-100. Crabtree, G. R., and Olson, E. N. (2002). NFAT signaling: choreographing the social lives of cells. Cell 109, S67-79. Decker, E. L., Nehmann, N., Kampen, E., Eibel, H., Zipfel, P. R, and Skerka, C. (2003). Early growth response proteins (EGR) and nuclear factors of activated T cells (NFAT) form heterodimers and regulate proinflammatory cytokine gene expression. Nucleic Acids Res 37, 911-921. Decker, E. L., Skerka, C, and Zipfel, R R (1998). The early growth response protein (EGR-1) regulates interleukin-2 transcription by synergistic interaction with the nuclear factor of activated T cells. J Biol Chem 275, 26923-26930. Diehn, M., Alizadeh, A. A., Rando, O. J., Liu, C. L., Stankunas, K., Botstein, D., Crabtree, G. R., and Brown, R O. (2002). Genomic expression programs and the integration of the CD28 costimulatory signal in T cell activation. Proc Natl Acad Sci USA 99, 11796-11801.

306

Section III

Esau, C , Boes, M., Youn, H. D., Tatterson, L., Liu, J. O., and Chen, J. (2001). Deletion of calcineurin and myocyte enhancer factor 2 (MEF2) binding domain of Cabin 1 results in enhanced cytokine gene expression in T cells. J Exp Med 194, 1449-1459. Feske, S., Giltnane, J., Dolmetsch, R., Staudt, L. M., and Rao, A. (2001). Gene regulation mediated by calcium signals in T lymphocytes. Nat Immunol 2, 316-324. Fuentes, J. J., Genesca, L., Kingsbury, T. J., Cunningham, K. W., Perez-Riba, M., Estivill, X., and de la Luna, S. (2000). DSCRl, overexpressed in Down syndrome, is an inhibitor of calcineurinmediated signaling pathways. Hum Mol Genet P, 1681-1690. Furstenau, U., Schwaninger, M., Blume, R., Jendrusch, E. M., and Knepel, W. (1999). Characterization of a novel calcium response element in the glucagon gene. J Biol Chem 274, 5851-5860. Garcia-Rodriguez, C , and Rao, A. (1998). Nuclear factor of activated T cells (NFAT)-dependent transactivation regulated by the coactivators p300/CREB-binding protein (CBP). J Exp Med 7^7,2031-2036. Ghosh, G., van Duyne, G., Ghosh, S., and Sigler, R B. (1995). Structure of NF-kappa B p50 homodimer bound to a kappa B site. Nature 375, 303-310. Giffm, M. J., Stroud, J. C , Bates, D. L., von Koenig, K. D., Hardin, J., and Chen, L. (2003). Structure of NFATl bound as a dimer to the HIV-1 LTR kappa B element. Nat Struct Biol 10, 800-806. Gomez del Arco, P., Martinez-Martinez, S., Maldonado, J. L., Ortega-Perez, I., and Redondo, J. M. (2000). A role for the p38 MAP kinase pathway in the nuclear shuttling of NFATp. J Biol Chem 275, 13872-13878. Graef, I. A., Chen, F., and Crabtree, G. R. (2001). NFAT signaling in vertebrate development. Curr Opin Genet Dev 77, 505-512. Han, A., He, J., Wu, Y., Liu, J. O., and Chen, L. (2005). Mechanism of recruitment of class II histone deacetylases by myocyte enhancer factor-2. J Mol Biol 345, 91-102. Han, A., Pan, F., Stroud, J. C , Youn, H. D., Liu, J. O., and Chen, L. (2003). Sequence-specific recruitment of transcriptional co-repressor Cabin 1 by myocyte enhancer factor-2. Nature 422, 730-734. Ho, I. C , Hodge, M. R., Rooney, J. W., and GUmcher, L. H. (1996). The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell 85, 973-983. Ho, S., Timmerman, L., Northrop, J., and Crabtree, G. R. (1994). Cloning and characterization of NF-ATc and NF-ATp: the cytoplasmic components of NF-AT. Adv Exp Med Biol 365, 167-173. Hoey, T., Sun, Y. L., WilHamson, K., and Xu, X. (1995). Isolation of two new members of the NF-AT gene family and functional characterization of the NF-AT proteins. Immunity 2, 461-472. Hogan, R G., Chen, L., Nardone, J., and Rao, A. (2003). Transcriptional regulation by calcium, calcineurin, and NFAT. Genes Dev 77, 2205-2232.

The Regulators Hu, C. M., Jang, S. Y, Fanzo, J. C , and Pemis, A. B. (2002). Modulation of T cell cytokine production by interferon regulatory factor-4. J Biol Chem 277, 49238-49246. Huxford, T., Huang, D. B., Malek, S., and Ghosh, G. (1998). The crystal structure of the IkappaBalpha/NF-kappaB complex reveals mechanisms of NF-kappaB inactivation. Cell 95, 759-770. Jacobs, M. D., and Harrison, S. C. (1998). Structure of an IkappaBalpha/NF-kappaB complex. Cell 95, 749-758. Jiang, H., Xiong, F., Kong, S., Ogawa, T., Kobayashi, M., and Liu, J. O. (1997). Distinct tissue and cellular distribution of two major isoforms of calcineurin. Mol Immunol 34, 663-669. Jin, L., Sliz, R, Chen, L., Macian, F., Rao, A., Hogan, R G., and Harrison, S. C. (2003). An asymmetric NFATl dimer on a pseudo-palindromic kappa B-like DNA site. Nat Struct Biol 10, 807-811. Kingsbury, T. J., and Cunningham, K. W. (2000). A conserved family of calcineurin regulators. Genes Dev 14, 1595-1604. Klee, C. B., Ren, H., and Wang, X. (1998). Regulation of the calmodulin-stimulated protein phosphatase, calcineurin. J Biol Chem 273,13367-13370. Lai, M. M., Burnett, P. E., Wolosker, H., Blackshaw, S., and Snyder, S. H. (1998). Cain, a novel physiologic protein inhibitor of calcineurin. J Biol Chem 273, 18325-18331. Leung, T. H., Hoffmann, A., and Baltimore, D. (2004). One nucleotide in a kappaB site can determine cofactor specificity for NF-kappaB dimers. Cell 118,453-464. Li, H., Rao, A., and Hogan, P. G. (2004). Structural delineation of the calcineurin-NFAT interaction and its parallels to PPl targeting interactions. J Mol Biol 342, 1659-1674. Liu, J., Arai, K., and Arai, N. (2001). Inhibition of NFATx activation by an oligopeptide: disrupting the interaction of NFATx with calcineurin. J Immunol 167,2677-2687. Liu, J. O. (2003). Endogenous protein inhibitors of calcineurin. Biochem Biophys Res Commun 311, 1103-1109. Liu, J. O. (2005). The yins of T cell activation. Sci STKE 2005, rel. Lopez-Rodriguez, C , Aramburu, J., Rakeman, A. S., and Rao, A. (1999). NFAT5, a constitutively nuclear NFAT protein that does not cooperate with Fos and Jun. Proc Natl Acad Sci USA 96, 7214-7219. Lopez-Rodriguez, C , Aramburu, J., Jin, L., Rakeman, A. S., Michino, M., and Rao, A. (2001). Bridging the NFAT and NFkappaB families: NFAT5 dimerization regulates cytokine gene transcription in response to osmotic stress. Immunity 15, 47-58. Lu, J., McKinsey, T. A., Nicol, R. L., and Olson, E. N. (2000). Signal-dependent activation of the MEF2 transcription factor by dissociation fi-om histone deacetylases. Proc Natl Acad Sci USA 97, 4070-4075. Luo, C , Burgeon, E., and Rao, A. (1996). Mechanisms of transactivation by nuclear factor of activated T cells-1. J Exp Med 75^, 141-147. Macian, R, Lopez-Rodriguez, C , and Rao, A. (2001). Partners in

Chapter 17 transcription: NFAT and AP-1. Oncogene 20, 2476-2489. McCaffrey, P. G., Luo, C , Kerppola, T. K., Jain, J., Badalian, T. M., Ho, A. M., Burgeon, E., Lane, W. S., Lambert, J. N., Curran, T., and et al (1993). Isolation of the cyclosporin-sensitive T cell transcription factor NFATp. Science 262, 750-754. McKinsey, T. A., Zhang, C. L., Lu, J., and Olson, E. N. (2000). Signal-dependent nuclear export of a histone deacetylase regulates muscle differentiation. Nature 408, 106-111. McKinsey, T. A., Zhang, C. L., and Olson, E. N. (2002). MEF2: a calcium-dependent regulator of cell division, differentiation and death. Trends Biochem Sci 27, 40-47. Miyakawa, H., Rim, J. S., Handler, J. S., and Kwon, H. M. (1999). Identification of the second tonicity-responsive enhancer for the betaine transporter (BGTl) gene. Biochim Biophys Acta 1446, 359-364. Molkentin, J. D., Lu, J. R., Antos, C. L., Markham, B., Richardson, J., Robbins, J., Grant, S. R., and Olson, E. N. (1998). A calcineurindependent transcriptional pathway for cardiac hypertrophy. Cell PJ, 215-228. MuUer, C. W., Rey, F. A., Sodeoka, M., Verdine, G. L., and Harrison, S. C. (1995). Structure of the NF-kappa B p50 homodimer bound to DNA. Nature 375, 311-317. Neilson, J., Stankunas, K., and Crabtree, G. R. (2001). Monitoring the duration of antigen-receptor occupancy by calcineurin/glycogensynthase-kinase-3 control of NF-AT nuclear shuttling. Curr Opin Immunol 13, 346-350. Northrop, J. R, Ho, S. N., Chen, L., Thomas, D. J., Timmerman, L. A., Nolan, G. R, Admon, A., and Crabtree, G. R. (1994). NF-AT components define a family of transcription factors targeted in T-cell activation. Nature 369, 497-502. Okamura, H., Aramburu, J., Garcia-Rodriguez, C , Viola, J. R, Raghavan, A., Tahiliani, M., Zhang, X., Qin, J., Hogan, P. G., and Rao, A. (2000). Concerted dephosphorylation of the transcription factor NFATl induces a conformational switch that regulates transcriptional activity. Mol Cell 6, 539-550. Olson, E. N., and Williams, R. S. (2000). Calcineurin signaling and muscle remodeling. Cell 101, 689-692. Olson, E. N., Perry, M., and Schulz, R. A. (1995). Regulation of muscle differentiation by the MEF2 family of MADS box transcription factors. Dev Biol 172, 2-14. Pan, F., Ye, Z., Cheng, L., and Liu, J. O. (2004). Myocyte enhancer factor 2 mediates calcium-dependent transcription of the interleukin-2 gene in T lymphocytes: a calcium signaling module that is distinct from but collaborates with the nuclear factor of activated T cells (NFAT). J Biol Chem 279, 14477-14480. Rao, A., Luo, C , and Hogan, P. G. (1997). Transcription factors of the NFAT family: regulation and function. Annu Rev Immunol 15,101-141.

Roehrl, M. H., Kang, S., Aramburu, J., Wagner, G., Rao, A., and

NFATandMEF2

307'

Hogan, P. G. (2004). Selective inhibition of calcineurin-NFAT signaling by blocking protein-protein interaction with small organic molecules. Proc Natl Acad Sci USA 101, 7554-7559. Rothermel, B. A., Vega, R. B., and Williams, R. S. (2003). The role of modulatory calcineurin-interacting proteins in calcineurin signaling. Trends Cardiovasc Med 13, 15-21. Ruden, D. M., Ma, J., Li, Y., Wood, K., and Ptashne, M. (1991). Generating yeast transcriptional activators containing no yeast protein sequences. Nature 350, 250-252. Shaw, J. R, Utz, R J., Durand, D. B., Toole, J. J., Enamel, E. A., and Crabtree, G. R. (1988). Identification of a putative regulator of early T cell activation genes. Science 241, 202-205. Sheridan, C. M., Heist, E. K., Beals, C. R., Crabtree, G. R., and Gardner, P. (2002). Protein kinase A negatively modulates the nuclear accumulation of NF-ATcl by priming for subsequent phosphorylation by glycogen synthase kinase-3. J Biol Chem 277, 48664-48676. Stroud, J. C , and Chen, L. (2003). Structure of NFAT bound to DNA as a monomer. J Mol Biol 334, 1009-1022. Sun, L., Youn, H. D., Loh, C , Stolow, M., He, W, and Liu, J. O. (1998). Cabin 1, a negative regulator for calcineurin signaling in T lymphoc3^es. Immunity 8, 703-711. Winslow, M. M., and Crabtree, G. R. (2005). Immunology. Decoding calcium signaling. Science 307, 56-57. Yang, T. T., Xiong, Q., Enslen, H., Davis, R. J., and Chow, C. W. (2002). Phosphorylation of NFATc4 by p38 mitogen-activated protein kinases. Mol Cell Biol 22, 3892-3904. Youn, H. D., Chatila, T. A., and Liu, J. O. (2000a). Integration of calcineurin and MEF2 signals by the coactivator p300 during T-cell apoptosis. EMBO J 19, 4323-4331. Youn, H. D., Grozinger, C. M., and Liu, J. O. (2000b). Calcium regulates transcriptional repression of myocyte enhancer factor 2 by histone deacetylase 4. J Biol Chem 275, 22563-22567. Youn, H. D., and Liu, J. O. (2000). Cabinl represses MEF2dependent Nur77 expression and T cell apoptosis by controlling association of histone deacetylases and acetylases with MEF2. Immunity 73, 85-94. Youn, H. D., Sun, L., Prywes, R., and Liu, J. O. (1999). Apoptosis of T cells mediated by Ca2+-induced release of the transcription factor MEF2. Science 286, 790-793. Zhu, J., and McKeon, F. (1999). NF-AT activation requires suppression of Crml-dependent export by calcineurin. Nature 398,256-260. Zhu, J., and McKeon, F. (2000). Nucleocytoplasmic shuttling and the control of NF-AT signaling. Cell Mol Life Sci 57, 411-420. Zhu, J., Shibasaki, R, Price, R., Guillemot, J. C , Yano, T., Dotsch, V, Wagner, G., Ferrara, R, and McKeon, R (1998). Intramolecular masking of nuclear import signal on NF -AT4 by casein kinase I and MEKKl. Cell 93, 851-861.

Chapter 18 Hox Genes S. Steven Potter Division ofDevelopmental Biology, Children's Hospital Medical Center, 3333 Burnet Ave., Cincinnati OH, 45229

Key Words: homeotic transformations,Hox clusters, Hox cofactors, Hox protein functional specificity, Hox gene targets, homeobox

Summary The Hox genes were first found in Drosophila, where mutations in these genes often resulting in dramatic transformations of one body part into another. The Hox genes encode transcription factors with a DNA binding homeodomain carrying a helix-tum-helix motif Several features of Hox genes are well conserved during evolution, including their clustered organization, their encoded homeodomain amino acid sequences, and their colinear expression, with the position of a gene in a cluster reflecting its domain of expression in the embryo. In Drosophila one important function of the Hox genes is to determine segment identity. The Hox encoded proteins, with their similar DNA binding preferences, achieve fiinctional specificity at least in part through interactions with multiple cofactors. Hox genes appear to occupy high level positions in the genetic hierarchy of development. A Brief History of the Homeobox The homeobox genes are among the master switch genetic regulators of development. This was apparent from their initial discovery, when Drosophila geneticists found mutant flies with quite remarkable phenotypes. For example, mutation of the Antennapedia gene can result in a fly with legs found on the head in place of the antennae. In this case the imaginal discs that would normally give rise to antennae go down the wrong developmental pathway and form legs, which now protrude from the head. Other mutations, which clustered

near Antennapedia, also gave dramatic transformations of body parts. These changes in developmental destiny were termed homeotic transformations, because they result in the conversion of the normal structure into a distinct, yet evolutionarily homologous structure. For example, one appendage, the antenna, is transformed into another appendage, the leg. The cloning, and eventual sequencing of multiple homeotic genesfromDrosophila showed that they carried a highly conserved 180 bp block of sequence, which was named the homeobox (McGinnis et al, 1984a). This sequence was conserved among Drosophila homeotic genes, and also phylogenetically. It was used as a probe to rapidly clone orthologous (corresponding) homeobox genes from many species, including frog, mouse and man (McGinnis et al., 1984b). The homeobox was observed to encode the 60 amino acid homeodomain, with a helix-tum-helix DNA binding motif previously observed in prokaryotic transcription factors. These findings began to explain the ability of these genes to control developmental fates. These genes encoded proteins that could regulate other genes, some of which might represent additional regulators. The homeobox genes therefore appeared to occupy high-level positions in the genetic hierarchy of development. At least in some cases they were capable of initiating genetic cascades that could drive the developmental destinies of groups of cells. Groupings of the Homeobox Genes The complete sequence of the mouse genome reveals the presence of several hundred genes with a homeobox. The 39 Antennapedia-like mammalian homeobox genes orthologous to the Drosophila homeotic genes are arranged in four clusters, (A, B, C and D) and are

Corresponding Author: Tel: (513) 636-4850, Fax: (513) 636-4317, E-mail: [email protected]

Section III

310

termed the Hox genes. In addition there are other clusters of homeobox genes. The Rhox cluster of 12 homeobox genes is located on the X chromosome and is expressed in reproductive tissues, including testis, ovary and epididymis, with these genes therefore named reproductive homeobox, or Rhox (Maclean et al, 2005). The Rhox genes encode proteins with divergent DNA binding homeodomains, suggesting that they recognize downstream target genes that are distinct from other homeobox genes. The ParaHox cluster includes Cdx, Xlox and Gsx genes (Pollard and Holland, 2000), while the 93D/E (NKL) cluster has additional homeobox genes. These non-Hox clustered homeobox genes perform diverse functions during development. The homeodomain is often found associated with other functional domains in proteins. For example the POU genes encode proteins with both a homeodomain and a POU domain. Many of the Pax gene encoded proteins have both a Paired domain and a homeodomain. Other proteins carry both a homeodomain and a Lim domain, or a homeodomain and a zinc finger domain. Genes encoding these proteins are most often dispersed in chromosomal position, and the specific genes are often named after their Drosophila orthologs. This chapter is focused on the Hox genes. The Organization and Evolutionary Conservation of the Hox Genes The clustered chromosomal arrangement of the lab

pb

Dfd

Scr

The Regulators

homeotic genes suggested early on that they evolved by tandem duplication of a single original gene, likely by unequal crossing over. In Drosophila the resulting gene cluster has been split, making the Antennapedia and Bithorax complexes. In mammals, however, the fiill cluster has been quadruplicated to give a total of 39 genes in four clusters (A-D) at four different chromosomal locations (Fig. 18.1). The quadruplication of a single initial cluster results in interesting sequence relationships among the Hox genes. A single gene on the original cluster can give rise to four progeny genes on the resulting four clusters. Such genes, derived from a single ancestor, show the most closely related sequences and are termed paralogs. These genes are shown vertically aligned in Fig. 18.1. By examining the sequences of the Hox genes it is possible to divide them into 13 such paralogous groups. The mammalian Hox genes are sensibly named in matrix fashion according to the cluster, A-D, and paralogous group, 1-13. For example, the Hoxa 11 gene isfromparalogous group 11 on cluster A. ThQ Drosophila orthologs, however, from a single split cluster, are all given individual names, labial (lab), proboscopoedia (Pb), deformed (dfd), sex combs reduced (Scr), Antennapedia (Antp), ultrabithorax (Ubx), abdominal A (Abd-A), and abdominal B (Abd-B). While paralogs are most closely related at the sequence level, there is also a strong tendency for genes flanking each other on a cluster to be more closely related than genes more distant. For example, paralogous

Antp I Ubx

Abd-B

Abd-A

10

11

12

13

5 - a9 - | i l # - all

B ^ ^ - c9 - e l i - ell

D

dl0-dn.

Anterior Posterior Transcription 3' 5' Fig.18.1 The mammalian Hox genes. The four clusters are marked A, B, C and D. The 39 Hox genes are divided into 13 paralogous groups, with the numbers shown above the clusters. Genes within each paralogous groups are given a single color, to indicate their close relationship. Individual genes are named according to cluster and paralogous group. Blank ovals represent genes apparently lost during the duplication process. The 5' genes are shown at the right and the 3' cluster genes are shown at the left, according to custom, but reverse of the standard for most genes. The genes are transcribed right to left. The drosophila orthologs are shown at the top. These are divided into two clusters by the vertical line. Mammalian paralogous groups 9-13 are considered Abd-B like. Sequence comparisons of the encoded homeodomains allows the paralogous groups to be subdivided into the more closely related 2,3 and 4,5 and 6-8 and 9-11 and 12,13, as marked by the thin horizontal lines. The figure shown is correct for both mouse and man Hox clusters.

Chapter 18 Hox Genes

groups 9-13 are all classified as Abd-B type, as they are most closely related to the single Abd-B Drosophila gene. There has been an interesting expansion of this group from a single gene in Drosophila to 15 genes in mammals. Hierarchical cluster analysis of sequence relationships, however, shows that within this group the paralogs 9, 10 and 11 are much more closely related to each other than to 12 and 13. Similarly, paralogs 6, 7 and 8 form another closely related subgroup, as do 2 and 3 and also 4 and 5. The most conserved regions of the Hox encoded proteins are the homeodomains. Within paralogous groups this homology is quite strong. For example, the mouse Hoxa 4 homeodomain differs from that of Hoxd 4, Hoxc 4 and Hoxb 4 by only two, three and four amino acids respectively, and the orthologous Drosophila Deformed homeodomain is different at only seven amino acids out of 60. There is also significant conservation of sequence flanking the homeodomain within a paralogous group. For example, the Hoxa 4 and Hoxb 4 encoded proteins show amino acid sequence identity at 19/22 residues immediately amino terminal and at 15/21 residues immediately carboxy terminal of the homeodomain. Outside of these regions the genes show relatively little homology. The mammalian Hox genes are generally quite simple in structure, most often consisting of only two exons separated by a small intron. An entire cluster of approximately 10 Hox genes may comprise only about 150 Kb of DNA. Interestingly, the Hox genes in Drosophila are much larger and more complex in their organization. This is the reverse of what is seen for most genes, where simpler organization m Drosophila is the general rule. There are several other interesting features of the mammalian homeobox clusters to consider, although their importance remains a matter of conjecture. First, transcripts spanning multiple Hox genes have been observed. The presence of such cross-Hox mRNAs suggests that at least in some cases alternate processing can combine exons of different homeobox genes for unique fiinctions. In addition there is a conspicuous absence of repetitive sequences in the homeobox clusters. It appears that almost no insertions of mobile DNA sequences are tolerated in these clusters. This argues for strong fimction for both their intergenic and intronic sequences. This is also suggested by the evolutionary conservation of these noncoding sequences among the mammalian clusters. These observations provide a possible explanation for the conserved clustered organization of the Hox

311

genes. The relative absence of repetitive elements argues that the integrity of even noncoding regions is important, and the break up of a Hox cluster would destroy this integrity. A common interpretation of the data is that Hox genes extensively share cis-regulatory elements dispersed throughout the clusters, and that this results in strong selective pressure to conserve the clustered arrangement. This topic is touched again later in the chapter. It should be noted that in Drosophila the Hox cluster has been split in two, and that in other simpler organisms the Hox clusters have experienced even more severe fragmentation. It is clear that principles that apply to the mammalian Hox genes are not always universally valid on a wider evolutionary scale. Colinearity One of the most interesting evolutionarily conserved features of Hox genes is referred to as colinearity. In Drosophila, mouse and man the position of a Hox gene within a cluster shows a striking colinear relationship to the anterior-posterior expression pattern in the developing embryo. Genes at the more 3' positions in the clusters are expressed at earlier developmental times and at more anterior (rostral) positions. In contrast, genes at more 5' positions in clusters are expressed later in development and show more posterior (caudal) domains of expression. For example, the Abd-B type Hox genes, from paralog groups 9-13, are at the extreme 5' ends of the clusters, and show the most posterior restricted expression. It is also interesting to note that the clustered Hox genes are, with few exceptions, transcribed from the same DNA strand, so they are colinear in this sense as well. Functions of Hox Genes The fiinctions of Hox genes are perhaps best understood in Drosophila. In this organism the actions of genes expressed earlier in development create an anterior-posterior axis and create segments. The Hox genes then act to define segment identities. As noted earlier, mutations in Drosophila Hox genes often result in the development of a segment into the incorrect identity, causing a homeotic transformation of one body part into another. A typical segment will express several of the eight Drosophila Hox genes, and, clearly, more than eight segment and structural identities are specified by the Hox genes. There is not, therefore, a simple one to one relationship between identity and Hox gene expression.

312

Section III

with each Hox gene specifying a single structure. Instead, there is a combinatorial Hox code system at work, where a particular combination of expression of Hox genes determines segment identity (Lewis, 1978). During embryogenesis the Drosophila Hox genes are generally expressed with each having a distinct anterior boundary of robust expression, which then trails off posteriorly. As mentioned, Hox genes more 5' on the clusters have more posterior restricted domains of expression. As a result there is a pattern of overlapping Hox expression with more Hox genes expressed in posterior segments and fewer in anterior segments. A null mutation in a Hox gene removes its function from the most anterior segment of its expression, and thereby typically converts the code of that segment to a pattern normally found more anteriorly. Null Hox mutations therefore normally result in homeotic transformations towards more anterior identities. Interestingly, Hox genes located more 5', with more posterior expression domains, are generally dominant over the more 3' Hox genes. This is referred to as posterior prevalence, or phenotypic suppression. The result is that ectopic anterior expression of the 5' Hox genes will often convert a segment into a more posterior identity. For example, the Antennapedia mutation that causes the formations of legs on the head in place of antennae is the result of a chromosomal rearrangement that brings the Antennapedia coding sequences under the control of a heterologous promoter, driving expression in a more anterior domain than normal, the antennal imaginal discs, and producing the resulting homeotic transformation of antenna to leg. It is interesting to note that in some cases mammalian Hox genes can functionally substitute for their Drosophila orthologues. For example, the mammalian ortholog of the Antennapedia gene can be placed in a transgenic fly under the control of the heat shock promoter, allowing induced ectopic expression (Malicki et al., 1990). The amazing result is that the mammalian Antennapedia like gene can. also drive the homeotic transformation of antennae into legs. The legs that form are fly legs and not mammalian legs, because the Hox gene simply initiates the genetic program, which in the context of the fly would be a fly program. It is also interesting to note that even though the heat shock promoter drives near ubiquitous expression of the transgene, only the antennal imaginal disc is mis-directed to form legs. It appears that a correct combination of other Hox gene and cofactor gene expression is required for this transformation to take place. The ability of some mammalian Hox genes to substitute for their Drosophila orthologs strongly suggests

The Regulators

an evolutionarily conserved function. Nevertheless, this possible conservation has been an area of controversy. The functional equivalence model of Duboule, for example, proposes that Drosophila and Mammalian Hox genes have acquired quite distinct functions (Duboule, 1995). Functional Specificity of Hox Proteins The evolutionary history of the mammalian Hox genes includes the repeated tandem duplication of a single gene to create a cluster, followed by a quadruplication of this ancestral cluster to generate four clusters. The result is a set of 39 Hox genes with closely related homeoboxes and overlapping expression domains. It is therefore not surprising that the Hox genes would show a complex pattern of overlapping functions. Immediately following a gene duplication event the resulting twin copies would have the same sequence and would share identical or very closely related functions. Over evolutionary time the two copies would experience sequence divergence, effecting both expression pattern and encoded protein, and their degree of functional overlap would diminish. The tandem duplication events creating the original cluster preceded the quadruplication to generate the four clusters. The nonparoalogous genes have therefore had more evolutionary time for fiinctional divergence to take place, compared to paralogs. This explains why their sequences and functions are more distinct. How functionally distinct are the Hox proteins? They all carry a 60-aa homeodomain with three a-helices. Helix two and three make up the helix-tum-helix motif, with the third helix termed the recognition helix because of its important role in interaction with the major groove of the target DNA. In addition there are several amino acids throughout the homeodomain that make contact with the phosphate backbone of DNA, and amino acids upstream of helix 1 interact with the minor groove of DNA. The well-conserved nature of the Hox homeodomains suggests they would recognize similar or identical target sequences and the results of in vitro DNA binding assays indicate that this is indeed the case. Most Hox homeodomains appear to recognize a six base sequence with a well-conserved TAAT core. This short target sequence is found randomly approximately once every Kb of DNA throughout the genome, including the cis regulatory regions of most genes, suggesting that additional factors must be involved in generating Hox functional specificity. Despite the apparently common target binding sequences it is nevertheless abundantly clear that the

Chapter 18 Hox Genes

Drosophila Hox genes do have distinct functions. This conclusion derives from a host of both recessive null and dominant ectopic expression studies, with discrete phenotypes usually resulting for different Hox genes. There are, however, a few interesting exceptions, where genetic assays show functional equivalence for the different Drosophila Hox genes. For example, the Drosophila Hox gene labial normally drives the specification of the tritocerebral neuromere. In labial null mutants the cells that would normally make this structure do not acquire neuronal identity, consistent with the idea that labial initiates this developmental genetic program. Hirth et al (Hirth et al, 2001) showed that a null labial mutant could be rescued by a labial transgene using labial central nervous system specific cis-regulatory elements. Surprisingly, they went on to show that using these same cis regulatory elements it was possible to rescue tritocerebral neuromere development using any of the Drosophila Hox genes except for Abd-B. They concluded "...most Hox proteins are functionally equivalent in their ability to replace Labial in the specification of neuronal identity." It is interesting to note that the efficiency of the rescue varied among the Hox genes, with genes closer to Labial on the cluster showing higher efficiency, consistent with their closer sequence relationship. A similar functional overlap has been observed in the development of the haltere, where the Abd-A and Abd-B can substitute for UBX (Casares et al, 1996), as well as in development of the gonads (Greig and Akam, 1993). It must be emphasized, however, that these particular studies illustrating common Hox protein function in Drosophila are the exception and not the rule. Most work has indicated that the Hox genes specify distinct identities along the A-P axis by acting as selector genes, initiating alternative developmental genetic programs (Gellon and McGinnis, 1998; Lawrence and Morata, 1994; Mann and Morata, 2000). The genetic analysis of the functional relationships of the mammalian Hox genes has been much more complex, because the greater number of Hox genes and the weaker genetic tools available. The phenotypes resulting from Hox gene mutations in mammals have been a great deal less dramatic than those seen in Drosophila, with no resulting mice having legs protruding from their heads, for example. Indeed, many of the observed phenotypes have involved structures that are absent or reduced in size. This is consistent with Hox function in initiating a genetic program of development. In the absence of the Hox gene the program would not execute and the resulting structure would not form. It is also consistent with a function in driving cell proliferation.

313

with reduced division giving smaller size. The milder phenotypes observed for mammaUan Hox mutations has resulted in the proposal that mammalian Hox genes have ftmctions that are distinct from their counterparts in Drosophila. Indeed, the functional equivalence model of Duboule proposes that the mammalian Hox proteins all recognize the same, or functionally equivalent downstream targets, which are involved in the regulation of cell proliferation (Duboule, 1995). This model states that the quantity of Hox expression is more important than the quality of Hox expression. That is, the clusters of Hox genes function to provide the precisely correct spatio-temporal Hox dosage during development, but that one Hox protein is functionally interchangeable with another. According to this model apparent homeotic transformations of segment identity that had been observed in mammalian Hox gene mutants are interpreted as changes in the sculpted shapes of the bones resulting from changes in cell proliferation rates (Duboule, 1995). A series of mice with genetically engineered homeobox swaps were made in order to test this model. This represents a fairly mild test of the model, which predicts that the entire coding sequences of the Hox genes, and not just their most highly conserved homeobox regions, should be functionally interchangeable. The results of the homeobox swap experiments were interesting, in that they showed surprising tolerance of homeobox exchange in some aspects of development, as predicted by the functional equivalence model, but in other cases the homeoboxes were shown to be very functionally distinct (Zhao and Potter, 2001; Zhao and Potter, 2002). The axial skeleton, including the bones of the vertebrae and ribs, formed normally when any of three distinct homeoboxes were substituted into the Hoxa 11 gene, as would be predicted by this model. In the case of the female reproductive tract, however, the resuks were quite different. The Hoxa 11 gene is normally expressed in the developing uterus, while the Hoxa 13 gene is expressed in the vagina. A mouse with the Hoxa 11 gene carrying a Hoxa 13 homeobox showed a striking homeotic transformation of the uterus into a vagina. That is, the expression of the Hoxa 11 gene in the developing uterus, only now with the heterologous Hoxa 13 homeobox, converted the uterus into vagina, as measured by altered histology as well as gene expression patterns examined globally by microarray. It is also interesting that this was a dominant effect, with one copy of the homeobox swap gene giving this phenotype, even in the presence of a normal Hoxa 11 gene. It is interesting to note that the Hoxa 13 gene is located 5' of the Hoxa 11 gene, and according to the posterior

314'

Section III

prevalence principle of Hox genes mDrosophila, would be expected to have dominant effects. These results illustrate that Hox proteins are not all functionally equivalent, at least not in all developing structures, and that indeed functionally specificity can track with the homeobox, even though it is the most conserved part of the Hox protein. It now appears that the relatively milder phenotypes of the mammalian Hox mutants are simply the result of the presence of four clusters in mammals instead of the single split cluster in flies. This greater number of genes provides much more opportunity for functional overlap in mammals, which can result in a less dramatic phenotype when a single Hox gene is mutated. There is considerable genetic evidence indicating a very strong functional overlap of Hox genes within a single paralogous group. For example, mutation of either the Hoxa 11 or Hoxd 11 gene gives a relatively minor limb phenotype, with relatively minor malformations of some bones. Mice homozygous for mutations in both genes, however, show a much more dramatic limb phenotype, with an almost complete absence of the zeugopod, or forelimb, with the paw now essentially attached to the elbow (Davis et al, 1995). Similarly, the kidneys of single mutants are relatively normal, while the kidneys of double mutants are dramatically reduced in size, and sometimes absent. Comparable results have been obtained in the genetic analysis of other paralogous groups. For example, mutation of both Hoxa 13 and Hoxd 13 result in almost complete absence of the autopod, or paw (Fromental-Ramain et al, 1996). In another study it was shown that the coding sequences of the genes of paralogous group 3 were functionally interchangeable (Greer et al, 2000), again illustrating the close functional relationships of paralogs. When only one paralog is removed, the remaining genes can often provide adequate, although not complete function. Therefore, in order to define the function of a paralogous group of Hox genes in mammals it is necessary to mutate multiple members of the gene group. Genetic studies have also demonstrated functional overlap of flanking Hox genes, although much less dramatic than observed for paralogs. For example, the relationships of the 10 and 11 paralogous groups have been examined by making Hoxa 10, Hoxa 11 transheterozygotes, with one mutant copy of each gene. The result was a synergistic phenotype not seen in either single mutant (Branford et al., 2000). In addition Hoxd 10, Hoxa 11 double homozygotes show significant evidence of functional overlap between these genes (Favier et al, 1996), and the use of clusters carrying double neo insertions into the 10 and 11 paralogous

The Regulators

groups allowed further dissection of the relationships of these genes (Wellik et al, 2002). The picture that emerges from these genetic studies is that genes within a paralogous group have very strong functional overlap. Nevertheless, they are not identical in function, as mutation of one Hox gene does produce a phenotype, although ofl:en mild, showing that its absence cannot be completely compensated for by the remaining members of the group. This non-identity is presumably the result of differences in expression, and in some groups perhaps the divergence of encoded protein function. Nevertheless, the evolutionarily recent duplication of the Hox cluster has left us with paralogs that are still very closely related in function. There is also some functional overlap of nonparalogous Hox genes, in particular among flanking Hox genes with greater sequence similarity, as discussed above. Mechanisms of Functional Specificity How do the Hox proteins achieve their functional specificity? As previously mentioned, in vitro binding assays indicate that their homeodomains almost all recognize the same core TAAT sequence, which is found by chance in the cis regulatory elements of most genes. Further, since almost all Hox proteins bind to the same DNA sequences this suggests that they recognize the same downstream targets. These observations do not explain the Hox functional specificity observed in genetic assays. Perhaps in vivo there is more target sequence specificity than suggested by in vitro DNA binding assays. Indeed, even in the in vitro assays some variations in target preferences have been observed. In addition it is possible that the different Hox proteins bind to similar sequences, but with different affinities, or strengths (Lamka et al, 1992). This has been proposed as one possible mechanism for posterior prevalence, with more 5' Hox proteins binding to targets more tightly, and thereby able to displace more 3' Hox proteins. It is also possible that different Hox proteins would carry different transcription activation and repression domains, and would therefore have different effects on their targets. These considerations begin to explain Hox functional specificity. Hox Cofactors One main source of Hox functional specificity is thought to reside in their interacting cofactors. The specific milieu of Hox interacting proteins present in a particular cell is thought to play an important role in

Chapter 18 Hox Genes

driving target gene specificity as well as determining the activation or repression effect on target genes. That is, a single Hox protein can regulate different target genes in different cell types. Moreover, a single Hox protein can activate some targets and repress others. Various combinations of cofactors are likely responsible for mediating these differential effects. The best studied binding partners for Hox proteins are the TALE (three amino acid loop extension) proteins Extradenticle (Exd) (Peifer and Wieschaus, 1990) and hemothorax (Hth) (Phelan et al, 1995; Ryoo et al, 1999) in Drosophila, with the mammalian homologs referred to as Pbx (Phelan et al, 1995) and Meis (Moskow et ai, 1995) respectively. These cofactors also include homeodomains which are able to bind DNA. The Pbx interaction with Hox proteins is often mediated through a YPWM motif present on most Hox proteins N-terminal of the homeodomain. There is good evidence that Hox proteins can bind to DNA as monomers, as a duplex with one of these cofactors, or as a trimer consisting of one Hox, one Pbx and one Meis protein. When binding as a multimer the target sequence specificity is greatly increased. In addition to the Hox binding sequence, there must reside a Pbx binding sequence in close proximity, for example, and perhaps a Meis site as well. It is easy to envision subtle differences in target specificities for the different Hox proteins, and the different proteins of the Pbx and Meis families. In addition, distinct interactions of these proteins in forming multimers could result in discrete spacing preferences for the different target sequences. Hence, the interaction of Hox proteins with Pbx and Meis proteins is considered an important mechanism for increasing Hox target specificity (Fig. 18.2). Indeed, several studies have shown that different Hox complexes bind to distinct target DNA sequences, giving rise to the Hox binding selectivity model (Chan and Mann, 1996; Chang et al, 1996; Gebelein et al, 2002; Mann and Chan, 1996). Nevertheless, the number of Pbx and Meis family cofactors available is quite limited (four Pbx and three Meis genes in the mouse), and strong target sequence binding similarities among family members place limits on the specificity attainable. It is interesting to note, however, that the number of possible protein interactions is ever expanding, offering more opportunities for achieving specificity. In Drosophila, for example, it has been shown that the Exd and Hth proteins can interact not only with Hox proteins, but also with a dispersed, non-clustered homeobox gene encoded protein, Engrailed, and thereby repress target genes (Kobayashi et al., 2003). This shows that the Exd

315

and Hom cofactors can interact with other non-Hox transcription factors. It is also true that Hox proteins can interact with non-Exd, non-Hth cofactors.

Fig.18.2 Hox-Cofactor interactions. This diagram shows a HOX protein binding DNA as a part of a complex that includes PBX and MEIS protein. The combined DNA binding domains can contribute to a much more specific target binding sequence than could be achieved by any of the proteins alone. Further specificity can result from differences in preferred interactions of the multiple members of the Hox, Pbx and Meis families, resulting in different combinations of DNA binding domains and distinct spacing. Other factors, such as the ENGRAILED protein shown, can also bind, as a function of the Hox complex, and/or the flanking DNA sequence, and contribute gene activator or repressor function.

In a particularly informative example, the Hox regulation of the target gene Distalless (DU) was carefully dissected (Gebelein et aL, 2004). It was shown that the Ubx Hox protein binds to the Dll promoter as a tetramer, consisting of two Ubx proteins, one Exd and one Hth protein. The Dll promoter carries one bindiiig site for each of these four proteins, in close proximity. If the Antp Hox protein is substituted for Ubx then the resuhing tetramer binds with ten fold lower affinity, clearly demonstrating the presence of Hox specificity although not revealing its mechanistic source. Of interest the Engrailed (En) protein was found to bind to the Dll promoter poorly on its own, but in a strongly cooperative fashion with either the AbdA or Ubx Hox proteins. Since En is a powerftil transcriptional repressor, this interaction of Hox, Exd, Hth and En on the Dll promoter can explain how the Hox protein achieves repression of Dll. Further, this effect can be compartment specific, since En and other possible cofactors show compartment specific expression. This begins to explain how a single Hox protein can activate some targets and repress others, or even effect the activation and repression of a single target in different compartments. Another interesting study showed how Hox proteins can directly influence growth factor signaling pathways. In particular, the 5' HoxD cluster genes in the mouse were shown to be able to modify sonic hedgehog (SHH) signaling. In the absence of SHH signal the Gli3

316

Section III

transcription factor normally activates downstream targets. SHH signal, however, results in cleavage of Gli3 into a form that binds to the same targets but now represses transcription. Surprisingly, it was shown that the proteins encoded by the 5' HoxD genes were capable of directly binding to the truncated Gli3, with no DNA interaction required, and converting the repressor into an activator (Chen et al, 2004). It was also shown that multiple Hox proteins can interact with the protein Geminin (Luo et aL, 2004). This interaction occurred through the homeodomain, and resulted in blocking of the ability of the Hox protein to bind DNA. It is likely that further studies will show that Hox proteins are able to interact with many more proteins, not just Pbx, Exd, En, Gli3 and Geminin. Different specificities for these multiple interactions will contribute greatly to Hox fonctional precision. It is also important to note that at least in some cases Hox proteins bind to target genes as monomers, and not as a complex with cofactors. For example, in Drosophila it has been shown that the Ubx Hox protein regulates the downstream target Spalt gene by binding as a monomer, with no requirement for Exd or Hth (Galant et al, 2002). It was proposed that this mechanism provides some evolutionary advantages, as a simple accumulation of multiple copies of the monomer binding sequence, with a TAAT core, will result in the regulation of Spalt by Ubx. It is easier to imagine the formation of multiple copies of this simple sequence, than the formation by random mutation of a much more complex multimer binding sequence. Downstream of Hox Genes The Hox genes encode transcription factors that function by regulating expression levels of downstream target genes. A direct route to understanding how Hox genes work is to identify the genes they regulate. This has been a difficult area of research, however, with slow progress. Nevertheless, some interesting discoveries have been made that shed light on the fonctional pathways regulated by Hox genes. It is clear that one mechanism sometimes used by Hox genes to sculpt tissue shape is the regulation of cell death, or apoptosis. In Drosophila, it has been shown that the Hox gene Dfd directly regulates the apoptosis gene reaper, thereby maintaining boundaries between developing segments, and that another Hox gene Abd-B, similarly regulates segment boundaries through the activation of apoptosis (Lohmann et al, 2002). Therefore Hox genes are not only important in defining the identities of segments once established, but are also

The Regulators

important in establishing and maintaining segments. In another study Abd-B was also shown to regulate apoptosis in the developing Drosophila nervous system (Miguel-Aliaga and Thor, 2004). Of interest, a connection between Abd-B type Hox genes and apoptosis has also been made in vertebrates, with Hoxa 13 homozygous mutants, for example, showing loss of the apoptosis that normally separates the digits of the developing limbs (Stadlere^a/.,2001). Hox genes have also been implicated in the control of cell proliferation. One phenotype often observed in Hox mutants is a reduction in structure size. For example, the Hoxa 11/Hoxd 11 double homozygous mutant mice show a severe reduction in the size of the forearm, or zeugopod, of the limb (Davis et ai, 1995). As mentioned previously, multiple observations of this sort have suggested to some that a common function of most Hox genes is the regulation of cell proliferation rates (Duboule, 1995). This combined function in the regulation of cell proliferation and cell death can drive the shaping of segments and tissues. Another important group of Hox targets are the Hox genes themselves. In some cases this represents autoregulation, with the Hox gene activating itself, as is seen for the Drosophila Dfd and Lab genes. This is thought to represent a mechanism for maintaining the determined state. Once the Hox gene is activated it keeps itself in the state. There is also cross-regulation among Hox genes, with the Proboscipedia gene regulated by Dfd, for example (Rusch and Kaufman, 2000). It is clear that Hox genes can regulate genes that have important roles in developmental patterning as well as genes that encode terminal differentiation products. Ubx, for example, appears to directly regulate connectin, a homophilic cell adhesion molecule in muscle development (Gould and White, 1992). On the other hand, in mice, Hoxcl3 has been shown to regulate the terminal differentiation hair keratin genes by binding to multiple copies of TAAT and TTAT recognition motifs present in their promoters (Jave-Suarez et al, 2002). Other interesting downstream targets of Hox genes include the Hoxa 2 regulation of the transcription factor Six2 (Kutejova et al, 2005), and Hoxa 13 regulation of BMP2 and BMP7 (Knosp et al, 2004). It is generally thought that each Hox gene regulates a large number of downstream targets. Microarrays offer a technology that allows universal screens, potentially giving the rapid identification of large numbers of genes with transcription levels responsive to the expression of a Hox gene. Microarray approaches have been used to look for targets of Hoxa 11 (Valerius et al., 2002) and Hoxc 8 (Lei et aL, 2005), and Hoxd 10 (Hedlund et al,

Chapter 18 Hox Genes

2004), finding integrin genes, osteopontin and frizzled as target genes, among others. Regulation of Hox Genes What is upstream of the Hox genes? What regulates, these regulators? In this section we will present some of the general concepts that have emerged from many studies in this area. First, it is often proposed that the clustered organization of the Hox genes reflects a required sharing of enhancers. That is, a single enhancer in a Hox cluster could influence the expression of many Hox genes, and the physical break up of the cluster would separate some Hox genes from their required enhancers, resulting in a dramatic and likely lethal change in expression. This sharing of regulatory elements would drive preservation of the clustered arrangement of Hox genes, which is seen in most but not all organisms. It is also interesting to note, once again, that the mammalian Hox clusters are almost entirely devoid of interspersed repeat sequences. These repetitive DNAs, such as the Bl, B2 and LI sequences in the mouse genome, are present in very high copy number, and are usually found every couple of thousand base pairs on average. The relative absence of these mobile sequences in the Hox clusters argues that their insertion in these regions has harmful consequences that are strongly selected against. It is reasonable to suppose that the function of this noncoding DNA in the Hox clusters is regulatory in nature. The Hox genes show an interesting pattern of response to retinoic acid, with the more 3' Hox genes activated by lower levels of retinoic acid, and the more 5' genes more refractory to retinoic acid activation (Simeone et al, 1990). These responses are partly mediated through shared retinoic acid response elements located in the 3/ regions of the Hox clusters. Many upstream transcription factors interact with the Hox promoters/enhancers. The Cdx homeodomain proteins, however, are among the most interesting. Cdx binding sites are found in the promoters of a number of Hox genes and many experiments have indicated that Cdx proteins are direct regulators of Hox transcription (Charite et aL, 1998). Mice with mutations in Cdx genes can display homeotic transformations from the resulting mis-expression of Hox genes. It is particularly interesting to note that the Cdxl gene is itself retinoic acid responsive, with a retinoic acid response element (RARE). Further, targeted mutation of its RARE alters not only Cdxl expression but results in vertebral homeotic transformations caused by alterations in Hox

317'

expression patterns (Houle et al, 2003). This illustrates how retinoic acid can influence Hox expression both directly, through Hox cluster RAREs, and indirectly, through RAREs associated with genes upstream of Hox genes. While the more 3' paralogous groups of Hox genes are more sensitive to retinoic acid, the more 5' Hox genes respond to FGF signaling, and once again there is evidence that this could be mediated at least in part through the Cdx genes (Bel-Vialar et al, 2002; Isaacs e^ a/., 1998). Once a Hox gene expression pattern is established it must be .maintained through an epigenetic memory system mediated through the Polycombs and Trithorax groups of genes. These protein complexes maintain Hox gene expression states through multiple cell divisions. The Polycombs and Trithorax proteins control repressed and active transcriptional states, respectively. Both groups of proteins regulate chromatin accessibility, but additional proteins, including general transcription factors, the RNA polymerase II complex, and perhaps noncoding RNAs contribute to this memory process. Mutations in genes of the Polycombs and Trithorax systems can cause extensive changes in Hox expression, resulting in compound sets of homeotic transformations. Hox Genes and Disease Because Hox genes are known to play an important role in the regulation of cell proliferation it is not surprising to find that they can also play a role in cancer. For most cancers the evidence for a causative role is still relatively weak, with many studies simply showing increased expression of specific Hox genes in cancer tissue. But for the leukemias the evidence is quite convincing that several Hox genes can play an important role. Overexpression of Hoxb8, for example, resulting from insertion of an intracistemal A-particle (lAP) proviral element, can contribute to myeloid leukemia (Perkins et aL, 1990). In another set of studies using the BXH-2 mice, which have a naturally high incidence of myeloid leukemia due to an active endogenous leukemia virus, it was found that three vims integration hotspots in the genome were Hoxa 7, Hoxa 9 and a gene encoding the Hox interacting protein Meisl (Nakamura et aL, 1996). The co-expression of these three genes has also been seen in human leukemias (Lawrence et aL, 1999). Genes encoding other proteins that interact with or regulate Hox genes are also found to be frequently altered in human leukemias, including Pbx and Trithorax genes.

318

Section III

Conclusion The Hox genes encode transcription factors that can sometimes initiate genetic programs that drive segment identity determination. The 39 mammalian Hox genes are located on four clusters and can be divided into 13 paralogous groups. There is considerable functional redundancy among the mammalian Hox genes, making it difficult to dissect out their fiinctions. It is striking, however, that misexpression of the mammalian ortholog of the Drosophila Antennapedia gene can also cause homeotic transformation of antennae to legs, strongly arguing that the functions of these genes are highly conserved during evolution. The sources of the functional specificity of the Hox genes are being discovered. The Hox homeodomains bind to similar sequences in test tube DNA binding assays, suggesting that they might be functionally equivalent. Nevertheless, homeobox swap experiments show that there is indeed functional specificity residing in the homeobox, suggesting the presence of in vivo sequence preferences not detected in the in vitro assays. Additional specificity is achieved through distinct interactions with Pbx, Meis and other cofactors. Ultimately we would like to understand the genetic regulatory networks both upstream and downstream of Hox genes. High throughput strategies would speed this effort. Spotted promoter microarrays can allow the rapid analysis of transcription factor interactions with multiple promoters, and standard oligonucleotide microarrays are being harnessed to identify downstream targets of Hox genes. Accelerating progress will soon define the regulation of the Hox genes and in turn the downstream pathways that they control during development.

References Bel-Vialar, S., Itasaki, N., and Krumlauf, R. (2002). Initiating Hox gene expression: in the early chick neural tube differential sensitivity to FGF and RA signaling subdivides the HoxB genes intwo distinct groups. Development 129, 5103-5115. Branford, W. W., Benson, G. V, Ma, L., Maas, R. L., and Potter, S. S. (2000). Characterization of Hoxa-lO/Hoxa-11 transheterozygotes reveals functional redundancy and regulatory interactions. Dev Biol 224, 373-387. Casares, R, Calleja, M., and Sanchez-Herrero, E. (1996). Functional similarity in appendage specification by the Ultrabithorax and abdominal-A Drosophila HOX genes. Embo J 75, 3934-3942. Chan, S. K., and Mann, R. S. (1996). A structural model for a homeotic protein-extradenticle-DNA complex accounts for the choice of HOX protein in the heterodimer. Proc Natl Acad Sci USA 93, 5223-5228.

The Regulators Chang, C. P., Brocchieri, L., Shen, W. F., Largman, C, and Cleary, M. L. (1996). Pbx modulation of Hox homeodomain amino-terminal arms establishes different DNA-binding specificities across the Hox locus. Mol Cell Biol 16, 1734-1745. Charite, J., de Graaff, W., Consten, D., Reijnen, M. J., Korving, J., and Deschamps, J. (1998). Transducing positional information to the Hox genes: critical interaction of cdx gene products with position-sensitive regulatory elements. Development 125, 43494358. Chen, Y., Knezevic, V., Ervin, V., Hutson, R., Ward, Y, and Mackem, S. (2004). Direct interaction with Hoxd proteins reverses Gli3repressor function to promote digit formation downstream of Shh. Development 131, 2339-2347. Davis, A. R, Witte, D. R, Hsieh-Li, H. M., Potter, S. S., and Capecchi, M. R. (1995). Absence of radius and ulna in mice lacking hoxa-11 and hoxd-11. Nature 3 75, 791 -795. Duboule, D. (1995). Vertebrate Hox genes and proliferation: an alternative pathway to homeosis? Curr Opin Genet Dev 5, 525528. Favier, B., Rijli, F. M., Fromental-Ramain, C, Fraulob, V., Chambon, P., and Dolle, P. (1996). Functional cooperation between the non-paralogous genes Hoxa-10 and Hoxd-11 in the developing forelimb and axial skeleton. Development 122,449-460. Fromental-Ramain, C , Warot, X., Messadecq, N., LeMeur, M., Dolle, R, and Chambon, R (1996). Hoxa-13 and Hoxd-13 play a crucial role in the patterning of the limb autopod. Development 722,2997-3011. Galant, R., Walsh, C. M., and Carroll, S. B. (2002). Hox repression of a target gene: extradenticle-independent, additive action through multiple monomer binding sites. Development 729, 3115-3126. Gebelein, B., Culi, J., Ryoo, H. D., Zhang, W., and Mann, R. S. (2002). Specificity of Distalless repression and limb primordia development by abdominal Hox proteins. Dev Cell 3, 487-498. Gebelein, B., McKay, D. J., and Mann, R. S. (2004). Direct integration of Hox and segmentation gene inputs during Drosophila development. Nature ^57, 653-659. Gellon, G., and McGinnis, W. (1998). Shaping animal body plans in development and evolution by modulation of Hox expression patterns. Bioessays 20, 116-125. Gould, A. R, and White, R. A. (1992). Connectin, a target of homeotic gene control in Drosophila. Development 116,1163-1174. Greer, J. M., Puetz, J., Thomas, K. R., and Capecchi, M. R. (2000). Maintenance of functional equivalence during paralogous Hox gene evolution. Nature 403, 661-665. Greig, S., and Akam, M. (1993). Homeotic genes autonomously specify one aspect of pattern in the Drosophila mesoderm. Nature 362, 630-632. Hedlund, E., Karsten, S. L., Kudo, L., Geschwind, D. H., and Carpenter, E. M. (2004). Identification of a Hoxd 10-regulated transcriptional network and combinatorial interactions with Hoxa 10 during spinal cord development. J Neurosci Res 75, 307-319.

Chapter 18 Hox Genes Hirth, R, Loop, T., Egger, B., Miller, D. R, Kaufman, T. C , and Reichert, H. (2001). Functional equivalence of Hox gene products in the specification of the tritocerebrum during embryonic brain development of Drosophila. Development 128, 4781-4788. Houle, M., Sylvestre, J. R., and Lohnes, D. (2003). Retinoic acid regulates a subset of Cdxl function in vivo. Development 130, 6555-6567. Isaacs, H. V., Pownall, M. E., and Slack, J. M. (1998). Regulation of Hox gene expression and posterior development by the Xenopus caudal homologue Xcad3. Embo J 77, 3413-3427. Jave-Suarez, L. R, Winter, H., Langbein, L., Rogers, M. A., and Schweizer, J. (2002). H0XC13 is involved in the regulation of human hair keratin gene expression. J Biol Chem 277,3718-3726. Kjiosp, W. M., Scott, v., Bachinger, H. R, and Stadler, H. S. (2004). H0XA13 regulates the expression of bone morphogenetic proteins 2 and 7 to control distal Umb morphogenesis. Development 737,4581-4592. Kobayashi, M., Fujioka, M., Tolkunova, E. N., Deka, D., Abu-Shaar, M., Mann, R. S., and Jaynes, J. B. (2003). Engrailed cooperates with extradenticle and homothorax to repress target genes m Drosophila. Development 130, 741-751. Kutejova, E., Engist, B., Mallo, M., Kanzler, B., and Bobola, N. (2005). Hoxa2 downregulates Six2 in the neural crest-derived mesenchyme. Development 132, 469-478. Lamka, M. L., Boulet, A. M., and Sakonju, S. (1992). Ectopic expression of UBX and ABD-B proteins during Drosophila embryogenesis: competition, not a functional hierarchy, explains phenotypic suppression. Development 116, 841-854. Lawrence, H. J., Rozenfeld, S., Cruz, C , Matsukuma, K., Kwong, A., Komuves, L., Buchberg, A. M., and Largman, C. (1999). Frequent co-expression of the H0XA9 and MEISl homeobox genes in human myeloid leukemias. Leukemia 13, 1993-1999. Lawrence, R A., and Morata, G. (1994). Homeobox genes: their function in Drosophila segmentation and pattern formation. Cell 78, 181-189. Lei, H., Wang, H., Juan, A. H., and Ruddle, F. H. (2005). The identification of Hoxc8 target genes. Proc Natl Acad Sci USA 102, 2420-2424. Lewis, E. B. (1978). A gene complex controlling segmentation in Drosophila. Nature 276, 565-570. Lohmann, I., McGinnis, N., Bodmer, M., and McGinnis, W (2002). The Drosophila Hox gene deformed sculpts head morphology via direct regulation of the apoptosis activator reaper. Cell 110, 457-466. Luo, L., Yang, X., Takihara, Y., Knoetgen, H., and Kessel, M. (2004). The cell-cycle regulator geminin inhibits Hox function through direct and poly comb-mediated interactions. Nature 427, 749-753. Maclean, J. A., 2nd, Chen, M. A., Wayne, C. M., Bruce, S. R., Rao, M., Meistrich, M. L., Macleod, C , and Wilkinson, M. R (2005). Rhox: a new homeobox gene cluster. Cell 120, 369-382. Malicki, J., Schughart, K., and McGinnis, W. (1990). Mouse

319

Hox-2.2 specifies thoracic segmental identity in Drosophila embryos and larvae. Cell 63, 961-967. Mann, R. S., and Chan, S. K. (1996). Extra specificity from extradenticle: the partnership between HOX and PBX/EXD homeodomain proteins. Trends Genet 12, 258-262. Mann, R. S., and Morata, G. (2000). The developmental and molecular biology of genes that subdivide the body of Drosophila. Annu Rev Cell Dev Biol 7(5, 243-271. McGinnis, W, Garber, R. L., Wirz, J., Kuroiwa, A., and Gehring, W J. (1984a). A homologous protein-coding sequence in Drosophila homeotic genes and its conservation in other metazoans. Cell 37, 403-408. McGinnis, W., Hart, C. R, Gehring, W J., and Ruddle, F. H. (1984b). Molecular cloning and chromosome mapping of a mouse DNA sequence homologous to homeotic genes of Drosophila. Cell 38, 675-680. Miguel-AHaga, I., and Thor, S. (2004). Segment-specific prevention of pioneer neuron apoptosis by cell-autonomous, postmitotic Hox gene activity. Development 131, 6093-6105. Moskow, J. J., Bullrich, R, Huebner, K., Daar, I. O., and Buchberg, A. M. (1995). Meisl, a PBXl-related homeobox gene involved in myeloid leukemia in BXH-2 mice. Mol Cell Biol 15, 5434-5443. Nakamura, T, Largaespada, D. A., Shaughnessy, J. D., Jr., Jenkins, N. A., and Copeland, N. G. (1996). Cooperative activation of Hoxa and Pbxl-related genes in murine myeloid leukaemias. Nat Genet 72, 149-153. Peifer, M., and Wieschaus, E. (1990). Mutations in the Drosophila gene extradenticle affect the way specific homeo domain proteins regulate segmental identity. Genes Dev 4, 1209-1223. Perkins, A., Kongsuwan, K., Visvader, J., Adams, J. M., and Cory, S. (1990). Homeobox gene expression plus autocrine growth factor production elicits myeloid leukemia. Proc Natl Acad Sci USA 87, 8398-8402. Phelan, M. L., Rambaldi, I., and Featherstone, M. S. (1995). Cooperative interactions between HOX and PBX proteins mediated by a conserved peptide motif Mol Cell Biol 15, 3989-3997. Pollard, S. L., and Holland, R W. (2000). Evidence for 14 homeobox gene clusters in human genome ancestry. Curr Biol 10, 1059-1062. Rusch, D. B., and Kaufman, T. C. (2000). Regulation of proboscipedia in Drosophila by homeotic selector genes. Genetics 75^, 183-194. Ryoo, H. D., Marty, T., Casares, R, Affolter, M., and Mann, R. S. (1999). Regulation of Hox target genes by a DNA bound Homothorax/Hox/Extradenticle complex. Development 126, 5137-5148. Simeone, A., Acampora, D., Arcioni, L., Andrews, P. W, Boncinelli, E., and Mavilio, R (1990). Sequential activation of H0X2 homeobox genes by retinoic acid in human embryonal carcinoma cells. Nature 346, 763-766. Stadler, H. S., Higgins, K. M., and Capecchi, M. R. (2001). Loss

320-

Section III

of Eph-receptor expression correlates with loss of cell adhesion and chondrogenic capacity in Hoxal3 mutant limbs. Development 725,4177-4188. Valerius, M. T., Patterson, L. T., Feng, Y., and Potter, S. S. (2002). Hoxa 11 is upstream of Integrin alpha8 expression in the developing kidney. Proc Natl Acad Sci USA 99, 8090-8095. Wellik, D. M., Hawkes, R J., and Capecchi, M. R. (2002). Hoxl 1

The Regulators paralogous genes are essential for metanephric kidney induction. Genes Dev 76, 1423-1432. Zhao, Y., and Potter, S. S. (2001). Functional specificity of the Hoxal3 homeobox. Development 128, 3197-3207. Zhao, Y, and Potter, S. S. (2002). Functional comparison of the Hoxa 4, Hoxa 10, and Hoxa 11 homeoboxes. Dev Biol 244, 21-36.

Chapter 19 Nuclear Factor-kappa B Keith W, Clem and Y. Tony Ip Program in Molecular Medicine, University of Massachusetts Medical School, 373 Plantation Street, Worcester, MA 01605, USA

Key Words: Drosophila, inflammation, immunity, NFkappa B, signaling. Toll, transcription

Summary The Nuclear Factor-kappa B ( N F - K B ) represents a family of transcription factors that controls a variety of processes related to immunity and development. This family of transcription factors is conserved from insects to humans. Five different proteins, encoded by five different genes, of this family are present in mammals and three related proteins are present in Drosophila. These factors act downstream of many receptors that receive signals from cytokines, microorganisms, and developmental cues. Receptor activation leads to modification of downstream signaling components, and degradation of the cytoplasmic inhibitors that normally act to retain N F - K B proteins in the cytoplasm. Once the N F - K B proteins are freed from the inhibitor complex, they enter the nucleus to regulate gene expression by binding to target KB sites present on many promoters. Misregulation of the NF-KB family of proteins can cause severe developmental defects, inflammatory diseases, and cancers.

sequence had been shown to regulate the transcription of the kappa light chain gene in pre-B cells, thus the identification of the protein factor that interacted with this enhancer was presumed to provide important insights into B cell function. The protein factor that bound to this kappa light chain enhancer was thus named Nuclear Factor-kappa B ( N F - K B ) (Bonizzi and Karin, 2004; Chen and Greene, 2004). Characterization of the N F - K B activity in B cell extracts demonstrated that the factor contained two subunits. The most common combination was a 50 kD subunit and a 65 kD subunit (Baeuerle and Baltimore, 1989). Purification of the binding activity and protein sequencing revealed that both p50 and p65 (now called RelA) subunits have sequence homology to the previously identified avian oncoprotein Rel and the Drosophila developmental regulator Dorsal (Bours et al, 1990; Ghosh et al., 1990; Gilmore, 1990; Kieran et al, 1990; Meyer et al, 1991; Nolan et al., 1991; Steward, 1987). These factors constitute what we now know as the NF-KB/RCI family of transcription factors. The nomenclature of these factors in earlier publications was, understandably, not consistent. Today, most scientists have agreed to call these proteins N F - K B or Rel family. In this review, we will use the term N F - K B to represent this family of transcription factors.

Introduction Nuclear Factor-kappa B was first identified as a DNA binding activity present in nuclear extracts of B cell lines (Sen and Baltimore, 1986). The binding assay used a small piece of genomic DNA fragment that resembled the enhancer sequence present in the kappa light chain gene, which encodes the kappa light chain of the antibody complex produced by B cells. The enhancer

NF-KB

Family of Proteins in Mammals and Insects

Mouse is the most common mammalian model and fruit fly (Drosophila melanogaster) is the most common insect model for experimentations, thus we will focus the discussion of the NF-KB factors in these two organisms. Three NF-KB-related proteins are present in Drosophila, named Dorsal, Dif, and Relish (Fig. 19.1).

Corresponding Author: Y. Tony Ip, Tel: +l-(508) 856-5136, Fax: +l-(508) 856-4289, E-mail: [email protected]

Section III

322

The Regulators

Rel Homology 47 Domain 341 Dorsal

I

Dif Relish

I 678

NWWWWWWWN

NWWWWWWWN NWWWWWWWN

I

667

r:'ll-:-|:M|:|-:'l|-:-|

963

ankyrin repeats p50/pl05(NF-KBl) p52/pl00(NF-KB2) RelA(p65)

I

I IN\N\NN\\\\\\\\S3I I KV\\\\\\\\\\\\\N KVVWWWWWWN

RelB cRel

I

H 969

KV\\\\\V\\\\\\\N

KWWXWWWXWT"

|:::r::||::JI'::|::'l'::|::'l

3 940

I 550 1 558 I 587

Fig.19.1 The NF-KB proteins in mammals and Drosophila. Three NF-KB-related proteins, Dorsal, Dif, and Relish, are present in Drosophila. Five NF-KB proteins are present in mammals, and the nomenclature for these proteins in this review is p50/pl05, p52/pl00, RelA, RelB, and cRel. The names in parenthesis are also used in many publications. All thes e proteins contain the Rel Homology domain, which is approximately 300 amino acids long and the degree of identity varies from 30% to 50%. The ankyrin repeats in pi05, pi00, and Relish act as intramolecular inhibitory domains. Other NF-KB proteins are inhibited by IKB proteins, which also contain ankyrin repeats.

In mouse, the N F - K B family is comprised of five proteins: RelA, RelB, c-Rel, p50/pl05, and p52/pl00 (Bonizzi and Karin, 2004; Chen and Greene, 2004; Gilmore and Ip, 2003). The full-length proteins of the members of the NF-KB family varies from approximately 500 amino acids to approximately 900 amino acids. Most importantly, all N F - K B proteins contain the conserved domain called the Rel Homology (RH) domain (Steward, 1987). The RH domain is located at the N terminus and is approximately 300 amino acids long. Among the known RH domains the degree of homology is approximately 50% identical. The RH domain is required for the formation of dimers, DNA binding, nuclear translocation, and inhibitor binding (Ganchi et al, 1992; Moore et aL, 1993; Ruben et al, 1992). The C-terminal halves of NF-KB proteins are divergent, but the nature of the sequences can be used to divide N F - K B proteins into two groups. The first group includes p50/pl05, p52/plOO, and Relish. The C-termini of these proteins have 7-8 copies of an approximately 30 amino acid sequence, called the ankyrin repeat. Ankyrin repeats serve as protein-protein interaction domain, and in N F - K B proteins these repeats fold back and block DNA binding by the RH domain (Capobianco et al, 1992; Dushay et al, 1996; Hatada et aL, 1992; Rice et al, 1992; Stoven et al, 2003). Therefore, the ankyrin repeat domains must be removed during normal activation to enable the N F - K B proteins to bind to DNA (Betts and Nabel, 1996; Stoven et al., 2000). Thus, this group of N F - K B proteins exist either in long forms (pi05, pi00, or fiill length Relish) that cannot bind to DNA, or as short forms (p50, p52, or Relish-N terminus) that can bind to DNA. The short forms are generated by

proteolytic processing of the C-termini of the long forms. The second group of NF-KB proteins includes RelA, RelB, and c-Rel in mammals, and Dif and Dorsal in Drosophila. The sequences of the C-terminal halves of these proteins are quite divergent, but they all function as transcriptional regulatory domains (Schmitz et al., 1994). These proteins do not require proteolysis to gain the active conformation, but instead must be released from the complex that contains the inhibitor (see below) (Het^QletaL, 1992). All NF-KB proteins are DNA-binding transcriptional regulators (Anrather et al, 2005; Fan et al, 2004; Hou et al, 2003; Xia et al, 2004). They bind DNA as dimers, which can be homodimers or heterodimers (Berkowitz et al., 2002; Chen et aL, 1998; Chen et aL, 2000; Huang et aL, 2001; Liu et al, 1994; Yang and Steward, 1997). In vertebrates, the most common dimer is a p50-RelA (p65) heterodimer, which constitutes the originally identified nuclear binding activity that named N F - K B . All N F - K B dimers can bind to DNA target sites that have similarity to the consensus sequence 5'-GGGRNYYYCC-3' (R is a purine, N is any nucleotide, Y is pyrimidine). These DNA-binding sequences are generically called KB sites, KB sites are usually found upstream of target genes, and the binding of a N F - K B dimer to a KB site usually results in increased transcription of the gene. However, KB sites have been found in introns, and repression can occur if certain combination of dimer is used or a co-repressor is present. Regulation of N F - K B Activity An important characteristic of the NF-KB proteins

Chapter 19 Nuclear Factor-kappa B

is that they are regulated at the level of nuclear translocation (Bonizzi and Karin, 2004; Chen and Greene, 2004). Under most circumstances, NF-KB proteins are located in the cytoplasm, bound to an inhibitor called IKB (Inhibitor of KB binding) (Ganchi et ai, 1992; Hatada et al, 1992; Latimer et al, 1998). Because NF-KB proteins are transcription factors, the cytoplasmic localization renders them inactive. In vertebrates, several IKB proteins (IicBa, IKBP, IKB £ , and Bcl-3) have been identified, and inDrosophila there appears to be a single IKB protein, called Cactus (Bonizzi and Karin, 2004; Chen and Greene, 2004; Gilmore and Ip, 2003). IKB proteins contain a central domain with approximately 6-8 ankyrin repeats, which mediate interaction with the RH domain. As discussed above, the C-terminal ankyrin repeat domains of pi00, pi05 and Relish can also act as intramolecular IKB sequences. Interaction of an NF-KB protein with the ankyrin repeat domain of IKB or of its own C-terminus causes the complex to reside in the cytoplasm, therefore preventing the NF-KB protein from moving into the nucleus where DNA binding can occur. The mechanism by which IKB inhibits NF-KB is masking of the nuclear localization signal on NF-KB, SO that the nuclear import machinery cannot interact with the transcription factor (Ganchi et al, 1992; Hatada et al, 1992; Latimer et al, 1998). The cytoplasmic NF-KB/IKB complex serves as a fast responding sensor to many extracellular stimuli, thus translating the stimulating signal into genetic activities within the cell (Huguet et al, 1991 \ Jacobs and Harrison, 1998; Malek et al, 1998; Ruben et al, 1992; Sun ^^ a/., 1994). Activation of the signal transduction pathway by binding of an extracellular ligand to its cell surface receptor leads to activation of an IKB kinase (IKK) complex (Bonizzi and Karin, 2004; Chen and Greene, 2004; Gilmore and Ip, 2003). The activated IKK complex phosphorylates two closely-spaced serine residues on IKB (Traenckner et al, 1995). The serine phosphorylation serves as a signal for IKB ubiquitination at nearby lysine residues, which then leads to IKB degradation by the 26S proteasome. The NF-KB transcription factor is therefore released from the inhibitor, and allowed to enter the nucleus to bind to the appropriate KB target sites and modulate gene expression. It should be noted that in B cells and several types of cancer cells, NF-KB proteins are constitutively located in the nucleus, due to a high rate of proteolysis of IKB. The IKK complex is composed of at least three polypeptides: IKKa, IKKjJ, and IKKy (Bonizzi and Karin, 2004; Chen and Greene, 2004; Gilmore and Ip, 2003). IKKa and IKKp are catalytically active kinases, while

323

IKKy does not contain kinase activity but serves as a scaffolding protein for the complex. Activation of the IKK kinases requires phosphorylation of two serine residues within the activation loop of IKKa or IKKp. IKKp primarily mediates the phosphorylation and degradation of iKBa complexes, while IKKK controls the phosphorylation and processing of pi00 to p52. In Drosophila, the IKB homologue Cactus is also phosphorylated and degraded upon signal stimulation (Belvin and Anderson, 1996). However, whether an IKK complex is involved in Cactus regulation is still unknown. There is an IKK complex identified m Drosophila. This complex contains at least the homologues of IKKp {ird5 gene product) and IKKy {kenny gene product) (Lu et a/., 2001; Rutschmann et al., 2000; Silverman et al, 2000) The Drosophila IKK complex is required for the proteolytic cleavage and activation of Relish. Many receptors of the innate and acquired immune systems in mammals act upstream in the NF-KB signaling pathways (Fig. 19.2). Receptors of the innate immune system such as the Toll-like receptors (TLR) and receptors for the inflammatory cytokines such as TNF and Interleukin-1 (IL-1) all can activate NF-KB (Beutler, 2004; Gilmore and Ip, 2003). After ligand stimulation, these receptors either multimerize or go through conformational change. The recruitment of adaptor proteins and kinases then stimulate the downstream events, the IKK and IKB as described above. In Drosophila, there are no B cells or T cells, and their antimicrobial response relies solely on the innate immune system (HoflSnann, 2003). The recognition and response to microbial infection in Drosophila depends on the Toll and the Immune deficiency (Imd) signaling pathways (Fig. 19.3). The Toll and Imd pathways in Drosophila are homologous to the TLR and TNFR pathways in mammals, respectively. For example, the mammalian TLR recruits the adaptor protein MyD88 and the kinase IRAK4 to stimulate the IKK complex, while the Drosophila Toll recruits a MyD88 homologue and the kinase Pelle, which is a homologue of IRAK4. In the TNFR pathway, the adaptor protein RIP is recruited to the receptor during activation. In the Imd pathway, the peptidoglycan recognition protein (PGRP)-LC serves as the receptor to recruit Imd, which is a homologue of RIP in Drosophila. Thus, the mechanism of signaling and the molecules involved in the mammalian and Drosophila NF-KB pathways are conserved (Brennan and Anderson, 2004; Gilmore and Ip, 2003).

Section III

324'

The Regulators

Mammalian NF-KB in Inflammatory and Immune Response microbes

1

IL-1

TNF

1 IL-IR

-^-^TNFR

1 TRAF IRAK

\ NF-KB--IKB

1 antimicrobial response

TRAF IRAK IKK

1 NF-KB-IKB

1 inflammatory response

TRAF\ RIP IKK

\ NF-KB--IKB

1 inflammatory response

Fig. 19.2 The mammalian NF-KB pathways. Cytokines such as TNF and Interleukin-1 are potent stimulators of signaling pathways that lead to NF-KB activation. The recognition of microbial compounds by Toll-like receptors (TLR) also leads to activation of NF-KB. These signaling pathways use many common components, and most combinations of the five NF-KB proteins can act downstream of these pathways. Furthermore, stimulation by different pathways leads to induction of distinct and overlapping target genes. The detailed mechanism that governs the signaling specificity and appropriate response through the five mammalian NF-KB proteins is still being investigated. Drosophila ventral signal

i

fungi

\ Toll

G(-) bacteria \ PGRP-LC •—Receptor?

\ ^MyD88 Tube Pelle

DMyD88 Tube . Pelle

Imd ^ TAKl Sml KKP,Y

\

\

\

Dorsal—Cactus

Dif~Cactus

RelishN-C

\ dorsal-ventral development

1 antifungal response

\ antibacterial response

Fig.19.3 The signaling pathways that regulate NF-KB proteins in Drosophila, Dorsal is the key factor in dorsal-ventral embryonic development. Stimulation of the receptor Toll activates the cytoplasmic components and leads to the degradation of Cactus, the IKB homologue in Drosophila. This results in the release of Dorsal to enter the nucleus to regulate genes important for the establishment of ventral cell fate. During innate immune response in adults, essentially the same Toll pathway is used again, but with Dif acting as the key transcription factor. This Toll-Dif pathway responds to Gram-positive bacterial and fungal infections. Relish acts in the separate Imd signaling pathway, which regulates other aspects of innate immune response, primarily Gram-negative bacterial infection.

The NF-KB proteins in mammals play crucial roles in many processes related to inflammation, infection, and immune system activation. While numerous experiments have demonstrated the involvement of NF-KB in these immune-related processes, gene knockout experiments have provided invaluable insights into the in vivo functions of this family of transcription factors (Bonizzi and Karin, 2004; Chen and Greene, 2004; Gilmore and Ip, 2003). Targeted disruption of the genes encoding p50/pl05, p52/pl00, RelA, RelB, or c-Rel all lead to immune system defects. The knockout of c-rel in mice have a reduced immune response primarily because their B cells fail to proliferate in response to antigen (Kontgen et a/., 1995). The knockout oirvfkbl (p50/pl05) in mice caused reduced B cell proliferation and increased apoptosis in response to certain antigens (Sha et ah, 1995), rela (encoding RelA/p65) knockout mice die during embryonic development, due to massive apoptosis in the developing liver (Beg et al, 1995). The RelA protein is required to protect the embryonic liver from tumor necrosis factor (TNF)-induced apoptosis. Genetic suppression experiments performed by crossing TNF mutant together with rela knockout showed that such combination prevented the massive apoptosis in the embryonic liver (Doi et al., 1999). Many NF-KB target genes encode anti-apoptotic proteins, such as Bcl2 family proteins and lAP proteins. Furthermore, some tumor cells have high levels of nuclear NF-KB activity, probably providing resistance of these tumor cells to apoptosis. Overall, the individual knockout experiments demonstrate that each family member of NF-KB has a unique role in immune cell function. To gain further insights into the function of NF-KB proteins, some laboratories combined the individual knockout mice strains and analyzed their phenotypes further. Mice with both the nfkbl (p50/pl05) and rifkb2 (p52/pl00) genes disrupted have defects in B cell, macrophage, spleen, and thymus functions. The double mutants also develop bone defects, namely osteopetrosis, due to a failure of osteoclasts to mature properly (lotsova et al, 1997). Thus, the primary fiinction of NF-KB is in the immune/inflammatory system, while the development of liver, skin, bone, and skeleton also involves these transcription factors. Contrary to the loss-of-function phenotypes, constitutive activation of NF-KB causes or has been associated with certain human disease states, such as inflammatory bowel disease and arthritis. Moreover, some common anti-inflammatory agents, including

Chapter 19 Nuclear Factor-kappa B

aspirin and glucocorticoids, act partly by blocking the activation of N F - K B . Aspirin appears to block the induction of NF-KB by directly inhibiting the IKB kinase, and glucocorticoids acts by a variety of mechanisms, such as blocking nuclear translocation and antagonizing target gene activation by N F - K B . Many folk medicines that have anti-inflammatory or anti-cancer properties may act by inhibiting N F - K B . Biological Functions of Drosophila

NF-KB

Proteins

The three N F - K B proteins in Drosophila have largely independent, though occasionally redundant, functions (Gilmore and Ip, 2003). Dorsal was originally identified as an important gene required for dorsal-ventral patterning in the early embryo (Steward, 1987). The maternally deposited Dorsal proteins forms a nuclear gradient in the ventral cells of the early embryo and this gradient is required to activate and repress many zygotic genes needed for proper embryonic development. This Dorsal gradient is set up by the Toll signaling pathway, which is constituted by components including MyD88, Tube (another adaptor protein), Pelle, and Cactus (Belvin and Anderson, 1996) (Fig. 19.3). Dif was identified as the second NF-KB protein in Drosophila and was named Dorsal-related immunity factor (Ip et ai, 1993). During larval and adult stages, Dif act as the transcription factor downstream of the Toll pathway to stimulate the innate immune response. All the components mentioned above in the embryonic Toll pathway are utilized again in larvae and adults to regulate Dif during immune response (Brennan and Anderson, 2004). The Toll-Dif pathway in adults is stimulated by Gram-positive bacteria and fungi. Such infections activate a series of proteases, which in turn cleave the ligand called Spaetzle. It is noteworthy that the proteases used by the embryo to cleave Spaetzle are different from those used in adult innate immune response. Dif does not have substantial expression in the early embryo. However, if artificially expressed in the early embryo by genetic manipulation, Dif can act similarly to Dorsal by activating many zygotic genes required for dorsal-ventral embryonic development. During innate immune response in larvae. Dorsal and Dif probably have redundant fimctions. However, in adult flies, Dif is the primary factor in the Toll pathway while Dorsal is not essential. Why the requirements of these two NF-KB proteins are different in different developmental stages is still not understood. The third Drosophila N F - K B protein. Relish, acts as the downstream transcription factor for the Imd pathway (Hedengren et al, 1999). As describe above, Imd is an

325

adaptor protein homologous to the mammalian TNFRinteracting protein RIP. The Imd pathway governs the response to Gram-negative bacterial infection. Gramnegative peptidoglycan binds to the receptor PGRP-LC, which then stimulates Imd. Imd relays the signal to downstream components such as TAK-1 and IKK, which probably activate a caspase and lead to the proteolytic processing of Relish. The genetic components involved in the Toll pathway are largely different from those in the Imd pathway. The utilization of the three Drosophila N F - K B proteins is also rather distinct. However, some evidence suggests that there is interaction of the three N F - K B proteins in these two pathways. Double mutants of Dif and Relish have more severe defects in the activation of some downstream target genes. Moreover, some target genes are defective in their expression only when both pathways are blocked at the same time, while other genes are defective when either pathway is blocked (De Gregorio et al, 2002). It has also been demonstrated that heterodimers are formed among the three N F - K B proteins (Han and Ip, 1999). These heterodimers may increase the complexity of the immune response in Drosophila. Conclusion The N F - K B proteins in mammals and insects have evolutionarily conserved structures and functions. These proteins play essential roles in development, immune response, and cancer. An important feature of this family of transcription factors is the cytoplasmic-nuclear translocation in response to stimulation. This mechanism provides a sensitive regulation when the animals face environmental challenges, such as microbial infection. There are multiple signaling pathways that feed into these transcription factors, and the many components involved are also subject to multifaceted modulation. These elaborate mechanisms control not only the finetuning of the system but also the complexity versus the specificity required for the response. How the cells and the whole animals respond to various environmental challenges to generate the appropriate genetic activity is what we are trying to understand.

References Anrather, J., Racchumi, G., and ladecola, C. (2005). cis-acting, element-specific transcriptional activity of differentially phosphorylated nuclear factor-kappa B. J Biol Chem 280, 244-52. Baeuerle, PA., and Baltimore, D. (1989). A 65-kappa D subunit

326

Section III

of active NF-kappa B is required for inhibition of NF-kappa B by I kappa B. Genes Dev. 3, 1689-98. Beg, A.A., Sha, W.C, Bronson, R.T., Ghosh, S., and Baltimore, D. (1995). Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-kappa B. Nature 376, 167-70. Belvin, M.R, and Anderson, K.V. (1996). A conserved signaling pathway: the Drosophila Toll-dorsal pathway. Ann. Rev. Cell Dev. Biol. 72, 393-416. Berkowitz, B., Huang, D.B., Chen-Park, F.E., Sigler, RB., and Ghosh, G. (2002). The x-ray crystal structure of the NF-kappa B p50.p65 heterodimer bound to the interferon beta -kappa B site. J Biol Chem 277, 24694-700. Betts, J.C., and Nabel, G.J. (1996). Differential regulation of NF-kappa B2(pl00) processing and control by amino-terminal sequences. Mol Cell Biol 16, 6363-71. Beutler, B. (2004). Inferences, questions and possibilities in Tolllike receptor signalling. Nature 430, 257-63. Bonizzi, G., and Karin, M. (2004). The two NF-kappa B activation pathways and their role in innate and adaptive immunity. Trends Immunol 25, 280-8. Bours, v., Villalobos, J., Burd, RR., Kelly, K., and Siebenlist, U. (1990). Cloning of a mitogen-inducible gene encoding a kappa B DNA-binding protein with homology to the rel oncogene and to cell-cycle motifs. Nature 348, 76-80. Brennan, C.A., and Anderson, K.V. (2004). Drosophila: the genetics of innate immune recognition and response. Annu Rev Immunol. 22, 457-483. Capobianco, A.J., Chang, D., Mosialos, G., and Gilmore, T.D. (1992). pi 05, the NF-kappa B P50 precursor protein, is one of the cellular proteins complexed with the v-Rel oncoprotein in transformed chicken spleen cells. J Virol 66, 3758-67. Chen, RE., Huang, D.B., Chen, Y.Q., and Ghosh, G. (1998). Crystal structure of p50/p65 heterodimer of transcription factor NF-kappa B bound to DNA. Nature 391, 410-3. Chen, L.-R, and Greene, W.C. (2004). Shaping the nuclear action of NF-kappa B. Nat Rev Mol Cell Biol. 5, 392-401. Chen, Y. Q., Sengchanthalangsy, L. L., Hackett, A., and Ghosh, G. (2000). NF-kappa B p65 (RelA) homodimer uses distinct mechanisms to recognize DNA targets. Structure Fold Des 8,419-28. De Gregorio, E., Spellman, RT., Tzou, P., Rubin, G.M., and Lemaitre, B. (2002). The Toll and Imd pathways are the major regulators of the immune response in Drosophila. EMBO J. 21, 2568-2579. Doi, T.S., Marino, M.W., Takahashi, T., Yoshida, T., Sakakura, T., Old, L.J., and Obata, Y (1999). Absence of tumor necrosis factor rescues RelA-deficient mice from embryonic lethality. Proc Natl Acad Sci USA 96, 2994-9. Dushay, M.S., Asling, B., and Hultmark, D. (1996). Origins of immunity: Relish, a compound Rel-like gene in the antibacterial defense of Drosophila. Proc. Natl. Acad. Sci. USA 93, 10343-10347. Fan, Y, Rayet, B., and Gelinas, C. (2004). Divergent C-terminal transactivation domains of Rel/NF-kappa B proteins are critical determinants of their oncogenic potential in lymphocytes. Oncogene

The Regulators 23, 1030-42. Ganchi, RA., Sun, S.C, Greene, W.C, and Ballard, D.W. (1992). I kappa B/MAD-3 masks the nuclear localization signal of NF-kappa B p65 and requires the transactivation domain to inhibit NF-kappa B p65 DNA binding. Mol Biol Cell 3, 1339-52. Ghosh, S., Gifford, A.M., Riviere, L.R., Tempst, R, Nolan, G.R, and Baltimore, D. (1990). Cloning of the p50 DNA binding subunit of NF-kappa B: homology to rel and dorsal. Cell 62, 1019-29. Gilmore, T.D. (1990). NF-kappa B, KBFl, dorsal, and related matters. CelU2, 841-3. Gilmore, T.D., and Ip, YT. (2003). Signal Transduction Pathways in Development and Immunity: Rel Pathways. In: Nature Encyclopedia of Life Sciences. London: Nature Publishing Group, http://www. els. net/ doi: 10.1038/npg. els. 0002332. Han, Z.S., and Ip, YT. (1999). Interaction and specificity of Rel-related proteins in regulating Drosophila immunity gene expression. J. Biol. Chem. 274, 21355-21361. Hatada, E.N., Nieters, A., Wulczyn, KG., Naumann, M., Meyer, R., Nucifora, G., McKeithan, T.W., and Scheidereit, C. (1992). The ankyrin repeat domains of the NF-kappa B precursor pi05 and the protooncogene bcl-3 act as specific inhibitors of NF-kappa B DNA binding. Proc Natl Acad Sci USA 89, 2489-93. Hedengren, M., Asling, B., Dushay, M.S., Ando, I., Ekengren, S., Wihlborg, M., and Hultmark, D. (1999). Relish, a central factor in the control of humoral but not cellular immunity in Drosophila. Mol. Cell 4, 827-837. Henkel, T., Zabel, U., van Zee, K., Muller, J.M., Fanning, E., and Baeuerle, RA. (1992). Intramolecular masking of the nuclear location signal and dimerization domain in the precursor for the p50 NF-kappa B subunit. Cell 68, 1121-33. Hoffmann, J.A. (2003). The immune response of Drosophila. Nature 426, 33-38. Hou, S., Guan, H., and Ricciardi, R.R (2003). Phosphorylation of serine 337 of NF-kappa B p50 is critical for DNA binding. J Biol Chem 275, 45994-8. Huang, D.B., Chen, Y.Q., Ruetsche, M., Phelps, C.B., and Ghosh, G. (2001). X-ray crystal structure of proto-oncogene product c-Rel bound to the CD28 response element of IL-2. Structure (Camb) 9, 669-78. Huguet, C , Crepieux, R, and Laudet, V. (1997). Rel/NF-kappa B transcription factors and I kappa B inhibitors: evolution from a unique common ancestor. Oncogene 15, 2965-1 A. lotsova, v., Caamano, J., Loy, J., Yang, Y, Lewin, A., and Bravo, R. (1997). Osteopetrosis in mice lacking NF-kappa Bl and NF-kappa B2. Nat Med 3, 1285-9. Ip, YT., Reach, M., Engstrom, Y, Kadalayil, L., Cai, H., Gonzalez-Crespo, S., Tatei, K., and Levine, M. (1993). Dif, a dorsal'TQXdXQd gene that mediates an immune response in Drosophila. Cell 75, 753-763. Jacobs, M.D., and Harrison, S.C. (1998). Structure of an IkappaBalpha/NF-kappa B complex. Cell 95, 749-58.

Chapter 19 Nuclear Factor-kappa B Kieran, M., Blank, V., Logeat, R, Vandekerckhove, J., Lottspeich, R, Le Bail, O., Urban, M.B., Kourilsky, R, Baeuerle, RA., and Israel, A. (1990). The DNA binding subunit of NF-kappa B is identical to factor KBFl and homologous to the rel oncogene product. Cell 62, 1007-18. Kontgen, R, Grumont, R.J., Strasser, A., Metcalf, D., Li, R., Tarlinton, D., and Gerondakis, S. (1995). Mice lacking the c-rel proto-oncogene exhibit defects in lymphocyte proliferation, humoral immunity, and interleukin-2 expression. Genes Dev P, 1965-77. Latimer, M., Ernst, M.K., Dunn, L.L., Drutskaya, M., and Rice, N.R. (1998). The N-terminal domain of IkappaB alpha masks the nuclear locahzation signal(s) of p50 and c-Rel homodimers. Mol Cell Biol 18, 2640-9. Liu, J., Fan, Q.R., Sodeoka, M., Lane, W.S., and Verdine, G.L. (1994). DNA binding by an amino acid residue in the C-terminal half of the Rel homology region. Chem Biol 7, 47-55. Lu, Y., Wu, L.R, and Anderson, K.V. (2001). The antibacterial arm of the Drosophila innate immune response requires an IkappaB kinase. Genes Dev 15, 104-10. Malek, S., Huxford, T., and Ghosh, G. (1998). Ikappa Balpha functions through direct contacts with the nuclear localization signals and the DNA binding sequences of NF-kappa B. J Biol Chem 275, 25427-35. Meyer, R., Hatada, E.N., Hohmann, H.R, Haiker, M., Bartsch, C , Rothlisberger, U., Lahm, H.W., Schlaeger, E.J., van Loon, A.R, and Scheidereit, C. (1991). Cloning of the DNA-binding subunit of human nuclear factor kappa B: the level of its mRNA is strongly regulated by phorbol ester or tumor necrosis factor alpha. Proc Natl Acad Sci USA 88, 966-70. Moore, RA., Ruben, S.M., and Rosen, C.A. (1993). Conservation of transcriptional activation functions of the NF-kappa B p50 and p65 subunits in mammalian cells and Saccharomyces cerevisiae. Mol Cell Biol 73, 1666-74. Nolan, G.R, Ghosh, S., Liou, H.C., Tempst, R, and Baltimore, D. (1991). DNA binding and I kappa B inhibition of the cloned p65 subunit of NF-kappa B, a rel-related polypeptide. Cell 64, 961-9. Rice, N.R., MacKichan, M.L., and Israel, A. (1992). The precursor of NF-kappa B p50 has I kappa B-like functions. Cell 71, 243-53. Ruben, S.M., Klement, J.F., Coleman, T.A., Maher, M., Chen, C.H., and Rosen, C.A. (1992). I-Rel: a novel rel-related protein that inhibits NF-kappa B transcriptional activity. Genes Dev 6, 745-60. Ruben, S.M., Narayanan, R., Klement, J.F., Chen, C.H., and Rosen, C.A. (1992). Functional characterization of the NF-kappa B p65 transcriptional activator and an alternatively spliced derivative. Mol Cell Biol 12, 444-54.

327

Rutschmann, S., Jung, A.C., Zhou, R., Silverman, N., Hoffmann, J.A., and Ferrandon, D. (2000). Role oi Drosophila IKK gamma in a toll-independent antibacterial immune response. Nat Immunol 1, 342-7. Schmitz, M.L., dos Santos Silva, M.A., Altmann, H., Czisch, M., Holak, T.A., and Baeuerle, RA. (1994). Structural and functional analysis of the NF-kappa B p65 C terminus. An acidic and modular transactivation domain with the potential to adopt an alpha-helical conformation. J Biol Chem 269, 25613-20. Sen, R., and Baltimore, D. (1986). Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 46, 705-16. Sha, W.C, Liou, H.C., Tuomanen, E.I., and Baltimore, D. (1995). Targeted disruption of the p50 subunit of NF-kappa B leads to multifocal defects in immune responses. Cell 80, 321-30. Silverman, N., Zhou, R., Stoven, S., Pandey, N., Hultmark, D., and Maniatis, T. (2000). A Drosophila IkappaB kinase complex required for Relish cleavage and antibacterial immunity. Genes Dev 7^, 2461-71. Steward, R. (1987). Dorsal, an embryonic polarity gene in Drosophila is homologous to the vertebrate proto-oncogen, c-rel. Science 258, 692-694. Stoven, S., Ando, I., Kadalayil, L., Engstrom, Y., and Hultmark, D. (2000). Activation of the Drosophila NF-kappa B factor Relish by rapid endoproteolytic cleavage. EMBO Rep 1, 347-52. Stoven, S., Silverman, N., Junell, A., Hedengren-Olcott, M., Erturk, D., Engstrom, Y, Maniatis, T., and Hultmark, D. (2003). Caspase-mediated processing of the Drosophila NF-kappa B factor ReUsh. Proc. Natl. Acad. Sci. USA. 100, 5991-5996. Sun, S.C, Ganchi, RA., Beraud, C , Ballard, D.W., and Greene, W.C. (1994). Autoregulation of the NF-kappa B transactivator RelA (p65) by multiple cytoplasmic inhibitors containing ankyrin motifs. Proc Natl Acad Sci USA 91, 1346-50. Traenckner, E. B., Pahl, H. L., Henkel, R, Schmidt, K. N., Wilk, S., and Baeuerle, P. A. (1995). Phosphorylation of human I kappa B-alpha on serines 32 and 36 controls I kappa B-alpha proteolysis and NF-kappa B activation in response to diverse stimuli. EMBO L 7^, 2876-83. Xia, C , Watton, S., Nagl, S., Samuel, J., Lovegrove, J., Cheshire, J., and Woo, P. (2004). Novel sites in the p65 subunit of NF-kappa B interact with TFIIB to facilitate NF-kappa B induced transcription. FEBS Lett 561, 217-22. Yang, J., and Steward, R. (1997). A multimeric complex and the nuclear targeting of the Drosophila Rel protein Dorsal. Proc Natl Acad Sci USA 94, 14524-9.

Chapter 20 The ATF Transcription Factors in Cellular Adaptive Responses TsonwinHai Department of Molecular and Cellular Biochemistry, Center for Molecular Neurobiology, Ohio State University, Columbus OH, USA

Key Words: bZip proteins, CREB, ATFl, ATF2, ATF3, ATF4, ATF6, stress response, homeostasis

Summary The mammahan ATF/CREB family of transcription factors represents a group of basic region-leucine zipper (bZip) proteins consisted of almost 20 members. The name ATF or CREB was originally defined in the late 1980's by their ability to bind to the consensus ATF/CRE site "TGACGTCA." Over the years, cDNA clones encoding identical or homologous proteins have been isolated. Dendrogram analysis of these proteins on the basis of their amino acid sequences in the bZip region indicates that some of them are more similar to the other bZip proteins-AP-1 (Fos/Jun) and C/EBP than to the other ATF/CREB proteins. Furthermore, members of the ATF/CREB proteins form heterodimers with the AP-1 or C/EBP proteins and the resulting dimers have altered DNA binding specificity. Therefore, the ATF prefix of these bZip proteins reflects the history of discovery, rather than the real similarity between them. In this chapter, I will briefly describe the classification of the ATF/CREB proteins with a historical perspective of their nomenclature, and then briefly review three ATF proteins - ATF3, ATF4 and ATF6. One common feature of these proteins is their involvement in cellular responses to extracellular signals, suggesting a role for these ATF proteins in adaptation and homeostasis.

Introduction A: ATF/CREB Proteins- a Historical Perspective and the Subgroups Activating Transcription Factor (ATF) was first named in 1987 to refer to a putative protein with the activity to bind to the adenovirus early promoters E2, E3 and E4 at sites with a common core sequence "CGTCA" (Lee et al., 1987). cAMP responsive element binding protein (CREB) was named in 1987 to refer to a putative protein with the activity to bind to the cAMP responsive element (CRE) on the somatostatin promoter (Montminy and Bilezsikjian, 1987). The consensus binding site for ATF was later defined as TGACGT(C/A)(G/A) (Lin and Green, 1988), a sequence identical to the CRE consensus (TGACGTCA) (Deutsch et al, 1988 and references therein, for a review see Roesler et al, 1988). The identification of identical consensus sequences on two seemingly different sets of promoters - one on viral promoters and the other one on cellular promoters generated much confiision in the early days and prompted many groups to purify the corresponding binding proteins. After the dust had settled, the names ATF and CREB were used to refer to a group of bZip proteins that conform to the following criteria: (1) they bind to the consensus ATF/CRE sequence "TGACGTCA" in vitro, and (2) they form homo- or heterodimers. Around 20 different mammalian proteins with the prefix ATF or CREB have been described, and can be grouped into subgroups on the basis of their amino acid similarity: the CREB/CREM, CRE-BPl (commonly known as ATF2), ATF3, ATF4, ATF6 and B-ATF subgroups. Proteins within each subgroup share significant similarity both inside and outside the bZip domain. Proteins between

Corresponding Author: Room 148, Rightmire Hall, 1060 Carmack Road, Center for Molecular Neurobiology, Ohio State University, Columbus OH 43210, Tel: (614) 292-2910, Fax: (614) 292-5379, E-mail: [email protected]

Section III The Regulators

330

the subgroups, however, do not share much similarity other than the bZip "motif." Therefore, they should be considered as distinct proteins despite their common prefix (ATF or CREB). Table 20.1 lists the subgroups and their corresponding members (some original references are cited in a previous review, Hai et al, 1999). Table 20.1

The mammalian ATF/CREB family of transcription factors.

Subgroup

Members

CREB

CREB CREM* ATFl CRE-BPl

CRE-BPl

ATF3 ATF4

ATF6 B-ATF

ATFa CREBPA ATF3 JDP2 ATF4 ATF4L1 ATFx ATF6 CREB-RP B-ATF JDPl

Alternative Names CREB-1, CREB-327, ATF-47 ATF-43, TREB, TREB36, TCRATFl ATF2, CREB-2, TCR-ATF2, mXBP, TREB, HB16 ATF7 LRF-1, LRG-21, CRG-5, TI-241 CREB2, TAXREB67, C/ATF, mTR67

mATF4,

hATF5, ATF7 ATF6a ATF6p,CREBLl,G13 p21SNFT,DNAJC12

* The CREM gene also encodes a protein product ICER from an alternative intronic promoter.

B: The Nomenclature of the ATF/CREB Proteins The nomenclature in the literature for this family of proteins has been confusing. Not only alternative names are used to refer to the same proteins (see Table 20.1), in some cases, the same name is used to refer to different proteins. As an example, the term CREB2 has been used to refer to three different proteins: an alternatively spliced CREB , CRE-BPl (ATF2), and ATF4. Another example is ATF5, it could refer to Fos or ATFx, an ATF4-homologous protein. The third example is ATF7, the clone isolated and named as ATF7 in 2001 (Peters et aL, 2001) is the same as ATFx (also called hATFS). Furthermore, ATFa was renamed as ATF7 (Hamard et al., 2005). It is not clear whether either of these two clones has any resemblance to the original ATF7 cDNA isolated in 1989 (Hai et aL, 1989), since the sequence of that clone is not available. For more details on the nomenclature, see (Hai et aL, 1999). Therefore, to ensure the identity of a given protein, the best way is to inspect the amino acid sequence.

C: The ATF/CREB Proteins versus other bZip Proteins Thus far, more than 50 bZip proteins have been identified. Despite the different names for these bZip proteins - ATF/CREB, AP-1 (Fos and Jun proteins), Maf, and C/EBP, several lines of evidence indicate that the distinction between them is blurred. First, dendrogram analysis (Fig. 20.1) of the bZip region indicates that some ATF proteins are more closely related to bZip proteins without the ATF prefix than those with the prefix. As an example, ATF3 is more homologous to the Fos proteins (members of the AP-1 family) than to other subgroups of the ATF/CREB proteins as pointed out previously (Meyer and Habener, 1993). Second, the ATF/CREB consensus binding site (TGACGTCA) has only one nucleotide difference from the AP-1 and Maf consensus binding sites (TGACTCA), and some naturally occurring binding sites are composite sites, such as a composite of half ATF/CRE site and half C/EBP site. Thus, the names of the DNA binding sites (the ATF/CRE, AP-1 and C/EBP sites) do not reflect the intrinsic biological distinctions; rather, they reflect the artificial nature imposed by the researchers who studied them. Third, these bZip proteins can bind to each other's consensus sites and regulate transcription in a manner characteristic of the other family (for specific examples see Hai et aL, 1999). Fourth, overwhehning evidence indicates that the ATF/CREB proteins form selective heterodimers with each other, and with other bZip proteins such as the AP-1 and C/EBP families of proteins. For a list of the heterodimeric partners, see an analysis of bZip association by coil-coil array (Newman and Keating, 2003), and previous reviews (Hai et aL, 1999; Hai and Hartman, 2001). Although the physiological significance of these heterodimers is not clear, the general view is that heterodimer formation can alter DNA binding specificity and transcriptional activities, thus expanding the ability of these bZip proteins to regulate gene expression. Taken together, various names have been used to refer to the mammalian bZip proteins. However, from their amino acids sequences, DNA binding sites, and heterodimer formation preferences, the distinction in their names is arbitrary; it reflects more the history of discovery than the fiindamental biological differences between them. The ATF Proteins Although much remains to be elucidated, one common theme of the ATF proteins is their involvement in responding to extracellular signals. Due to the vast number of papers in the literature, a comprehensive review

Chapter 20

331

ATF Proteins in Adaptive Responses

H: - ^

^ - ^

U^ ^ Fig. 20.1

HLF TEF DBF E4BP4 BAC04846 B-ATF p21SNFT GADD153/CHOP C/EBPy C/EBPa HP8 C/EBP5 C/EBPP C/EBPc Zhangfel CREM-lb ATF-1 CREB CREM-la CREM-la(K324R) OASIS CREB3 CREB-H CREB4 ATF-6 CREBLl XBP-1 JunB cJun JunD NFE2 NFE2L2 NFE2L1 NFE2L3 BACHl BACH2 MafF MafG MafK NRL MafB cMaf MafA CREBPA ATF-2 ATF-7 Fral oFos FosB Fra2 ATF-3 JDP2 ATE-5 ATF-4 ATF-4L1

A dendrogram of bZip proteins based on their amino acid sequences in the bZip region. The ATF proteins listed in

Table 20.1 are highlighted. Some ATF proteins are more closely related to bZip proteins without the ATF prefix than those with the prefix. As an example, ATF3 is more closely related to the Fos protems than to ATFl.

of the ATF/CREB family of transcription factors is not possible. Below, I will only review ATF3, ATF4 and ATF6 to illustrate the above point of their commonality. For reviews on the CREB/ATFl proteins, see (Andrisani, 1999; Daniel et al, 1998; De Cesare et al, 1999; Montminy, 1997; Sassone-Corsi, 1998); for reviews on the ATF2 proteins, see (van Dam and Castellazzi, 2001; Gupta et ai, 1995; Raingeaud et al, 1995; Firestein and Feuerstein, 1998; Fuchs et al, 1997). For the transcriptional activity, interacting proteins and

potential target genes of ATF2, ATF4 and ATF6, see a previous review (Hai and Hartman, 2001). In this chapter, I will focus on their biological functions with an emphasis on stress response. A:ATF3 Al: A Stress-inducible Gene ATF3 was suggested to be a stress-inducible gene based on the observation that its mRNA level greatly increases in various stress models (Chen et al., 1996).

Section III

332

Since then, overwhelming evidence from many laboratories supports the notion that ATF3 is induced by stress signals (a review, Hai et al, 1999). The wide use of the DNA microarray technique added to the long list Table 20.2

The Regulators

of signals that can increase the steady-state mRNA levels of ATF3. Table 20.2 summarizes the signals that have been demonstrated to induce ATF3.

A partial list of the treatments that induce the expression of ATF3 In whole organisms.

In whole organisms Tissues Liver Lung Heart Kidney Skin Muscle Thymus Pancreas Prostate Spinal cord neurons Hypoglossal motor neurons Corticospinal neurons Dentate gyrus Geniculate ganglion Dorsal root ganglion

Treatments Partial hepatectomy, Alcohol, Carbon tetrachloride, Acetaminophen, Cycloheximide, Hepatic ischemia, Lipopolysaccharide (LPS) Ventilation induced acute injury Ischemia, Ischemia-reperflision Ischemia-reperfusion Wounding Eccentric contraction Anti-CD3 e Ischemia-reperfiision, Partial pancreatectomy, Streptozotocin, Caerulein, Taurocholate Ischemia Axotomy Nerve transection Intracortical axotomy Seizure Chorda tympani injury Chronic constriction injury

In cultured cells Cells Hepatocytes Leukemia cells Macrophages Myeloid cells Neuroblastoma PC 12 cells PC6-3 cells (a subline of PC12) MCF7 cells HUVECs Pancreatic (3 cells HeLa cells Cardiomyocytes LPT2 gonadotrope cell line Gastric cancer AGS cells Keratinocytes Hepatoma FaO cells HepG2 cells Mouse embryonic fibroblasts HME87 aTC 1.6 cells Epithelial cells HCT-116cells Peripheral blood monocytes Various cell types

Treatments Cycloheximide, EGF, HGF Doxorubicin Cytokines, LPS, BCG, PMA, A23187 Fas antibody Forskolin,FGF,A23187 Arsenite Depletion of NGF Proteasome inhibitors, Adipokines PPAR activators. Homocysteine, TNF-a, LDL, oxLDL, LPC, A23187, Thapsigargin, Tunicamycin, H2O2, Nitric oxide H2O2, Elevated palmitate, Elevated glucose, Cytokines, Nitric oxide Camptothecin, Adenovirus infection NaCN, Deoxyglucose. Doxorubicin, Adenylylcyclase type VI Gonadotropin-releasing hormone (GnRH) H. pylori infection Diindolylmethane (DIM) TGF-P Amino acid or glucose deprivation, ER stress Amino acid depletion, ER stress benzo[a]pyrene diol epoxide (BPDE) Forskolin/IBMX TGF-P Cox-1 and Cox-2 inhibitors PEG-IFN-a Serum, Anisomycin, El A, Genotoxic agents (ionizing radiation, UV, MMS)

Chapter 20

ATF Proteins in Adaptive Responses

One dramatic feature is that the induction of ATF3 is neither tissue-specific nor stimulus-specific. Furthermore, its induction is not Hmited to a specific species: when data are available, the same stimulus can induce ATF3 in rat, mouse and human. This "non-specificity" is not unique to ATF3. Other genes such as Fos, Jun and Erg-1 are also induced by a variety signals in many different tissues. Interestingly, these inducible genes (known as the immediate early genes) are usually induced in the same cluster as shown by DNA microarray analysis. Therefore, the initial genome response to extracellular signals appears to turn on a set of common genes, irrespective of the nature of the signals or the cell type exposed to the signals. The diversity in the fmal readouts is most likely determined by the context of the cells. A2: An Adaptive-response Gene One common theme of the signals that can induce ATF3 is that, to the first approximation, they all induce cellular damages and can be viewed as stress signals. However, some ATF3-inducing signals do not obviously fit into the category of stress signals. As an example, ATF3 is induced in the MCF-7 breast cancer cells by adipokines (Iyengar et al, 2003), secreted factors firom adipocytes that increase cell growth and migration rather than cellular damage. Furthermore, ATF3 expression is induced in S-phase: microarray analyses of genes in different phases of the cell cycle from HeLa cells or primary human fibroblasts indicated that ATF3 expression is induced in the S-phase (Cho et aL, 2001; van der Meijden et ai, 2002). Since adipokines and S phase transition do not fit the conventional definition of stress signals, their ability to induce ATF3 indicates that the characterization of ATF3 as a stress-inducible gene is overly simplistic. A more complete view is that ATF3 is an "adaptive-response gene," a gene that participates in the processes for the cells to adapt to changesextracellular and/or intracellular changes. In summary, the lesson we learned from the expression pattern of ATF3 is that it is one of the common subset of "adaptive response" genes that plays a role in a variety of cellular processes. Clearly, a key question then arises: what is thefiinctionalsignificance of ATF3 expression? A3: Biological Consequences ofATFS Expression - the Dichotomy ofATFS Although the fiinctions of ATF3 are not wellunderstood, one emerging theme is that it has opposite effects on various biological processes, including cell death and cell cycle machineries. As an example, both pro- and anti-apoptotic effects of ATF3 have been reported. Ectopic expression of ATF3 enhanced the

333

ability of etoposide or camptothecin to induce apoptosis in HeLa cells (Mashima et ai, 2001) and the ability of curcumin, an anti-cancer compound, to induce apoptosis (Yan et ai, 2005), suggesting a pro-apoptotic role of ATF3. Consistently, transgenic mice expressing ATF3 have fiinctional defects in the corresponding tissues: mice expressing ATF3 in the heart have conduction abnormalities and contractile dysfixnction (Okamoto et ai, 2001); Mice expressing ATF3 in the liver and pancreatic ductal epithelium have liver dysfiinction and defects in endocrine pancreas development (AllenJennings et al, 2001; Allen-Jennings et al,, 2002). Furthermore, primary islets derived fi'om ATF3 knockout mice are partially protectedfi-omstress-induced apoptosis (Hartman et ai, 2004), and consistently, antisense approach to inhibit ATF3 suppressed stress-induced apoptosis in endothelial cells (Nawa et al, 2002). Therefore, both gain-of-fimction (ectopic expression) and loss-of-fiinction (knockout or anti-sense) approaches support a pro-apoptotic role of ATF3. However, several reports suggest a protective effect of ATF3. ATF3 was demonstrated to protect neuronal cellsfi-omNGF withdraw-induced death (Nakagomi et ai, 2003) and kainic acid-induced death. Furthermore, ATF3 enhanced c-Jun induced-neurite sprouting in culture (Pearson et al., 2003). Even in cardiac myocytes and endothelial cells, two cell types that ATF3 had been demonstrated to have detrimental effects (see above), ATF3 was demonstrated to have protective roles (Nobori et aL, 2002; Kawauchi et al, 2002). Therefore, ATF3 has a dichotomous role in apoptosis, it can be either proor anti-apoptotic, presumably in a context-dependent manner. TF3 has also been implicated to regulate the cell cycle machinery. Similar to the situation in apoptosis, ATF3 has been demonstrated to have opposite effects: it can either promote or suppress cell cycle progression. Ectopic expression of ATF3 moderately induced DNA synthesis and cyclin Dl gene expression in hepatoma cells (Allan et al,, 2001). Furthermore, ectopic expression of ATF3 partially transformed chick embryo fibroblasts by promoting proliferation under low serum concentration (Perez et al, 2001). These, in combination with its induction by viral transforming proteins adenoviral El A (Hagmeyer et al, 1996) and hepatitis B virus X protein (Tarn et al, 1999), suggest that ATF3 promotes cell proliferation. However, Fan et al reported that ectopic expression of ATF3 suppresses cell cycle progression in HeLa cells (Fan et al, 2002). Therefore, conflicting data exist for the roles of ATF3 in cell cycle regulation. Again, one explanation for the apparent discrepancy is the difference in cellular context.

334

Section III

A4: Does ATF3 Play a Role in Human Diseases Taken together, several lines of evidence described above support the notion that ATF3 contributes to the pathogenesis of some stress-associated diseases. First, it is induced by stress signals and is expressed in the diseases tissues, such as the diabetic islets (Hartman et al, 2004) and atherosclerotic vessels (Nawa et al., 2002). Second, it can be pro-apoptotic by both gain- and loss-of function approaches in cultured cells. Third, transgenic mice expressing ATF3 have dys&nction of the corresponding tissues expressing it. Although further studies are required to prove the causal relationship, these lines of evidence support a role of ATF3 in the pathogenesis of stress-associated diseases. In this context, it is interesting to note that ATF3 was demonstrated to promote cell migration of advanced tumor cells (Ishiguro et al., 2000). Therefore, even in the context that ATF3 is not pro-apoptotic, its expression facilitates the progression of the disease. Does this mean that ATF3 always promotes disease progression? The answer is probably no. The consistent protective effects of ATF3 in the neuronal injury models suggest that ATF3 is likely a pro-regeneration and pro-neurite growth factor in the context of neuronal injuries (in peripheral neurons). A5: A Proposed Model for ATF3 (Fig.20. 2) In summary, ATF3 is an adaptive response gene. Its expression - induced by different stimuli in different cell types - contributes to the modulation of the cell death and/or cell cycle machineries in a context-dependent manner. Thus far, the data support the following speculation: in many cell types, ATF3 contributes to tissue dysfunction and disease progression; however, in the peripheral neurons, ATF3 appears to be beneficial by facilitating neurite outgrowth and regeneration. B:ATF4 Bl: ATF4 Protein Stability ATF4 mRNA is present in all tissues examined thus far. Although its level can be up-regulated by a variety of extracellular signals in different cell types (review, Hai and Hartman, 2001), the mode of regulation for ATF4 is primarily at the translational initiation (see below, ATF4 in stress pathways) and post-translational levels. ATF4 subgroup of proteins (ATF4 and ATFx) interact with components of the proteasome system: ATF4 interacts the PTrCP, an F-box protein of the E3 ubiquitin ligase complex (Lassot et al., 2001), and ATFx interacts with Cdc34, an E2 ubiquitin conjugating enzyme (Pati et al, 1999). A current model is that phosphorylation of ATF4 targets ATF4 to the proteasome system via its interaction with (3TrCP, this

The Regulators

in turn results in the ubiquitination and subsequent degradation of ATF4 (Lassot et al, 2001). Consistent with this model, the half-life of ATF4 is short (between 30 to 60 minutes), and inhibitors of the proteasome system increase its stability (Lassot et al, 2001). ATF4 contains the sequence DSGXXXS, which is similar to the DSGXXS motif found in other pTrCP substrates, p-catenin, iKBa, and HIV-1 Vpu (see Lassot et al, 2001 for references). Significantly, phosphorylation of k B a at this motif by IKKa and IKXp has been demonstrated to target IicBa for degradation by the proteasome system (for a review, see Karin, 1999). Therefore, the stability of ATF4 is regulated in a manner similar to that for the regulation of IKB. Clearly, identification of the kinase(s) and the signals that regulate this process will shed light on the ftinctions of ATF4. Neuronal Injuries

Various Stress Signals

•t JNK, p38 and other signaling pathways Other genes Smad3?

"Km Cell Death & Cell Cycle Machineries

t

Cell Migration

t

Mal-adaptation & Neurite Outgrowth & Metastasis of Development of Diseases Regeneration in Advanced Peripheral Neurons Cancer Cells Fig. 20.2 A proposed model for ATF3 in stress response and adaptation. Two features in the figure are not described in the text: the involvement of the JNK and p38 stress pathways in the induction of ATF3 by stress signals, and the auto-repression of ATF3 gene expression by itself

82: ATF4 as an Integrator for Multiple Stress Pathways ATF4 mRNA contains short upstream open reading frames (uORFs) in its 5' untranslated region (5XJTR). These uORFs confer the regulation of ATF4 protein synthesis in a way much like the one observed for the yeast protein GCN4: translational initiation from the coding AUG is repressed under unstressed condition, but is facilitated under stressed conditions that result in eIF2-a phosphorylation (Harding et al, 2000). Since various stress conditions including endoplasmic reticulum (ER) stress, nutrient starvation, viral infection, and oxidative stress, can result in eIF2-a phosphorylation (a review, Clemens, 2001), ATF4 serves as an integration point for various stress responses (reviews, Rutkowski and Kaufman, 2003; Ron, 2002). Because it is a transcription factor, ATF4 fimctions as a master switch

Chapter 20

ATF Proteins in Adaptive Responses

to regulate downstream gene expression, presumably to help the cells to cope with the stress. Identification of ATF4 target genes shed some light on the potential roles of ATF4 in these stress responses. Using cDNA microarray analysis to compare wild type and ATF4 knockout fibroblasts exposed to ER stress, Harding et al. identified potential ATF4 target genes (Harding et al, 2003). Among these are the genes involved in amino acid metabolism, amino acid transporter, and redox chemistry. They proposed the following logic for the activation of these genes during ER stress. The main functions of ER are to fold proteins and to initiate protein secretion. These processes result in the loss of reducing equivalents (due to oxidative protein folding) thus an increase in oxidants, and the loss of amino acids (due to secretion of proteins to the extracellular milieu). They proposed that ER stress represents an extra burden of losing reducing equivalents and amino acids. By activating genes for antioxidant and amino acid metabolism, ATF4 helps to cope with ER stress. Other ATF4 target genes include transcription factors, signaling molecules and membrane proteins (Harding et al, 2003). Of particular interest to this chapter is the identification of ATF3 as a target gene of ATF4 (Jiang et al, 2004); ATF3 in turn regulates Gaddl53/CHOP10 (Chen et al, 1996), a bZip protein in the C/EBP family of transcription factors, indicating a cascade of transcriptional program involving various bZip proteins in response to stress signals. B3: ATF4 in Redox Homeostasis The up-regulation of genes involved in redox chemistry by ATF4 deserves a special discussion. In addition to the report by Harding et al, ATF4 has been demonstrated to dimerize with the bZip proteins NF-E2 related factor 1 (Nrfl, also called NF-E2L1) and Nrf2 (NF-E2L2), and the resulting dimers can bind to the antioxidant responsive element (ARE), TGA(C/T) NNNGC (reviewed in Hayes and McMahon, 2001), which contains a half ATF/CRE site (TGAC). Although the physiological significance of the dimerization between ATF4 and Nrf proteins is not clear, the importance of ARE in regulating antioxidant genes is well accepted. The AREs are present in the promoters of many antioxidant genes, such as NAD(P) Hiquinone oxidoreductase, glutathione S-transferase, heme oxygenase, and glutathione synthetase (a review, Hayes and McMahon, 2001). Thus, various clues point to a role of ATF4 in regulating the redox state of the cells. In this context, it is interesting to note that ATF4 protein is stabilized by anoxia in human cancer cells (Ameri et al, 2004), further supporting a role of ATF4 in redox

335

homeostasis. Functionally, ectopic expression of ATF4 was demonstrated to accelerate apoptosis in mammary epithelium (Bagheri-Yarmand et al, 2003). However, ectopic expression of ATFx-an ATF4 homologous protein with -55% identity-was found to repress apoptosis in hematopoietic cells (Persengiev et al, 2002; a review Persengiev and Green, 2003). The opposite effect may be due to the differences in their amino acid sequences, or the differences in the experimental paradigms, or both. Clearly, much remains to be elucidated for the functionality of ATF4 and its homologous protein. B4: ATF4 in Neuronal Plasticity Some unexpected results from the studies of the yaminobutyric acid (GABA) receptors suggested that ATF4 may play a role in modulating neuronal plasticity. Using the Rl subunit of the GABAB receptor as a bait, three laboratories independently isolated cDNA encoding ATF4 by the yeast two hybrid screen (Nehring et al, 2000; Vernon et al, 2001; White et al, 2000). The interaction between GABAB Rl and ATF4 was confirmed by co-immunoprecipitation, in situ co-distribution and in vitro pull down assay; however, the consequence of this interaction is controversial and not well understood. On the one hand, ATF4 was demonstrated to translocate from the cytoplasmic membrane to the nucleus upon the activation of the receptors (White et al, 2000); on the other hand, it was demonstrated to translocate from the nucleus to the cytoplasm (Vernon et al, 2001). Therefore, much work is required to clarify the cellular consequence of this GABAB RI-ATF4 interaction. However, this interaction is intriguing in light of the following work. Using gain-of-function (via ectopic expression) and loss-of-fiinction (using dominant negative molecule or RANi knockdown) approaches in mouse or Aplysia model, researchers suggested that ATF4 suppresses long-term facilitation, synaptic plasticity and hippocampal-based spatial memory (Bartsch^r a/., 1995; Chen et al, 2003; Lee et al, 2003). Since GABAB receptors are present in both pre- and post-synaptic neurons and are widely recognized to play a role in neurotransmission and synaptic plasticity (Bowery and Enna, 2000), the GABAB RI-ATF4 interaction may provide a mechanistic basis for the above learning and memory studies. By directly binding to the receptor, ATF4 may function as a switch to directly couple (versus indirectly via various signaling cascades) neuronal activity to gene expression, a key step for long-term changes, thus affecting learning and memory. B5: A Proposed Model for ATF4 Function (Fig.20.3) Taken together, ATF4 is an integrator for multiple

Section III

336

stress responses. Upon stimulation, its expression is upregulated primarily by increased translation or increased protein stability. By up-regulating genes involved in redox chemistry and amino acid metabolism, ATF4 helps the cells to cope with stress. In neuronal cells, ATF4 is most likely involved in modulating neuronal plasticity by coupling receptor activity to gene expression. Neuro transmitters

Expression Long-term Facilitation Synaptic Plasticity Learning & Memory

ER stress

Nutrient depletion

Oxidative Stress

Other Stress

Amino acid metabolism & Redox chemistry Adaptive Responses Apoptosis?

Fig.20.3 A proposed model for ATF4 in various stress responses and neuronal plasticity.

C:ATF6 cDNA encoding ATF6 was isolated independently by three experimental approaches addressing different questions. It was isolated as a protein that weakly binds to the ATF/CRE consensus sequence (Hai et al., 1989), a protein that interacts with the serum response factor (SRF, Zhu et al, 1997), or a protein that binds to the ER stress response element (ERSE, Yoshida et al, 1998). Although ATF6 was isolated based on its ability to bind to the palindromic ATF/CRE consensus (Hai et al, 1989) and was demonstrated to bind to the ATF/CRE site (Wang et al, 2000), a report by Mori and colleagues demonstrated that ATF6 prefers to bind to the ERSE which contains a half ATF/CRE site (in a NF-Y-dependent manner) than to the consensus ATF/CRE site (Yoshida et al, 2001). This again illustrates the arbitrary nature of the nomenclature of these bZip proteins as discussed in the beginning of this chapter. Below, I will review the roles of ATF6 in cellular responses to ER stress, the best documented function of ATF6 thus far. CI: ATF6 in Unfolded Protein Response (UPR) In response to ER stress, the cells respond by up-regulating genes encoding the chaperone proteins to facilitate protein folding and by down-regulating translational initiation of most mRNAs (except a few mRNAs, such as ATF4 mRNA discussed above) to reduce the ER load. These responses are collectively referred to as the unfolded protein response (UPR) (reviews, Kaufman, 1999; Mori, 2000; Urano et al.

The Regulators

2000). The first clue for the role of ATF6 in UPR came from the cloning of ATF6 cDNA based on its ability to bind to the ERSE (Yoshida et al, 1998), a site found in many ER-induced chaperone genes. Although the cDNA encodes a 90-kDa protein (Zhu et al, 1997; Yoshida et al, 1998), upon ER stress the protein is converted to around 50 kDa (Yoshida et al, 1998). Immunofluorescent and cell fractionation experiments indicated that ATF6 locates in the ER and translocates to the nucleus upon ER stress (Haze et al, 1999). This translocation from ER to nucleus coupled with protein cleavage is reminiscent of the regulation of sterol regulatory element binding proteins (SREBPs) which are cleaved by two proteases: Site-1 protease (SIP) and Site-2 protease (S2P) (a review. Brown et al, 2000). This, in combination with the presence of the SIP-like and S2P-like sites in ATF6, led to the discovery that ATF6 is regulated by the same proteases that process SREBPs (Ye et al, 2000; Chen et al, 2002; Shen and Prywes, 2004). Three key observations added important pieces of the puzzle and revealed an intricate role of ATF6 in UPR. First, in an attempt to address how ATF6 is anchored at the ER before stress induction, Prywes and colleagues (Shen et al, 2002) investigated ATF6interacting proteins by co-immunoprecipitation and found that ATF6 interacts with the ER chaperone Bip/grp78. Importantly, upon ER stress, ATF6 dissociates from Bip/grp78 and translocates to Golgi where the proteases SIP and S2P reside. Thus, this observation provided a mechanistic understanding of ATF6 retention in ER. Second, in their investigation of XBP-1, another ERSE binding protein (Yoshida et al, 1998), Mori and colleagues discovered that the XBP-1 mRNA is spliced by IREl (Yoshida et al, 2001), a protein well-known for its important role in UPR (reviews, Kaufman, 1999; Mori, 2000; Urano et al, 2000). Importantly, the amount of the XBPl mRNA appears to be low and must be elevated first via the activation of its corresponding promoter by ATF6 (Yoshida et al, 2001). Therefore, to produce sufficient amount of XBPl protein, two pathways are required: up-regulation of the gene by ATF6 and splicing of the mRNA by IREl. Third, although ATF6 plays an important role in up-regulating many ER chaperone genes, it can also down-regulate gene expression: it binds to the sterol regulatory element-binding protein 2 (SREBP2) and represses the target genes of SREBP2, resulting in the attenuation of the lipogenic effects of SREBP2 (Zeng et al, 2004). This action has significant physiological implications, since prolonged nutrient deprivation, such as amino acid or glucose deficiency, induces ER stress. By activating

Chapter 20

ATF Proteins in Adaptive Responses

ATF6, the cells reduce the lipogenic effect of SREBP2, and thus save energy sources to withstand the stress. Therefore, ATF6 coordinates stress response with energy homeostasis. C2: A Current Model for ATF6 (Fig. 20.4) In summary, ATF6 is synthesized as a precursor protein, which binds to the ER chaperone Bip/grp78 and localizes on the ER membrane. During ER stress, ATF6 dissociates from Bip/grp78 and translocates to the Golgi where it is cleaved by proteases to liberate its active N' terminal domain (ATF6N or p50). ATF6N is then translocated to the nucleus and up-regulates its target genes, including those encoding ER chaperone proteins and XBPl which also activates various ER chaperone genes. However, ATF6 can also suppress SREBP2mediated gene expression bv directlv interacting with it.

' 337

Although sharing the bZip motif, these proteins are vastly divergent in their amino acid sequences. Intriguingly, their binding sites are relatively similar, suggesting that the DNA binding sites are conserved through the evolution to impart genomic responses to extracellular signals. The diversity of the proteins that can bind to these sites allows multifaceted and divergent biological responses. Acknowledgement I thank Chris Wolford for making the dendrogram and Dan Lu for making Table 20.2. Supports from the National Institute of Health (DK59605) and the American Diabetes Association (to T.H.). Abbreviation ATF, activating transcription factor; CREB, cAMP responsive element binding; bZip, basic region leucine zipper

IREl

ATF6N SREPB2 Lipogenic genes

I Energy Homeostasis

References

C^^^^ /}^ffmo^,ff!^ XBP-1 and Other ER ^ chaperone genes XBP-1 unspliced . ^ mRNA

••> •

XBP-1 spliced mRNA -•XBPl

J ^

Unfolded Protein Response

Fig. 20.4 A proposed model for ATF6 in cellular responses to ER stress.

Concluding Remarks hi conclusion, all three ATF proteins reviewed above (ATF3, ATF4 and ATF6) are modulated by extracellular signals: ATF3 is induced by transcriptional activation, ATF4 by translational initiation and protein stabilization, and ATF6 by proteolytic cleavage. Although not reviewed in this chapter, ATFl, CREB and ATF2 are regulated primarily by post-translational modifications: phosphorylation by various kinases. Thus, one common theme of the ATF proteins is their involvement in responding to extracellular signals. Interestingly, AP-1 (Fos/Jun) and C/EBP bZip proteins are also regulated by intraVextra-cellular signals (see the chapter on API in this book and some previous reviews: Darlington et al, 1995; Yeh and McKnight, 1995; Karin et a/., 1997; Xanthoudakis and Curran, 1996), suggesting a common function for these bZip proteins.

Allan, A. L., Albanese, C , Pestell, R. G., and LaMarre, J. (2001). Activating transcription factor 3 induces DNA synthesis and expression of cyclin Dl in hepatocytes. J Biol Chem 276, 2727227280. Allen-Jennings, A. E., Hartman, M. G., Kociba, G. J., and Hai, T. (2001). The roles of ATF3 in glucose homeostasis: A transgenic mouse model with liver dysfunction and defects in endocrine pancreas. J Biol Chem 276, 29507-29514. Allen-Jennings, A. E., Hartman, M. G., Kociba, G. J., and Hai, T. (2002). The roles of ATF3 in liver dysfunction and the regulation of phosphoenolpyruvate carboxykinase gene expression. J Biol Chem 277, 20020-20025. Ameri, K., Lewis, C. E., Raida, M., Sowter, H., Hai, T, and Harris, A. L. (2004). Anoxic induction of ATF-4 through HIF-1-independent pathways of protein stabilization in human cancer cells. Blood 103, 1876-1882. Andrisani, O. M. (1999). CREB-mediated transcriptional control. Crit Rev Euk Gene Exp P, 19-32. Bagheri-Yarmand, R., Vadlamudi, R. K., and Kumar, R. (2003). Activating transcription factor 4 overexpression inhibits proliferation and differentiation of mammary epithelium resulting in impaired lactation and accelerated involution. J Biol Chem 278, 1742117429. Bartsch, D., Ghirardi, M., Skehel, R A., Karl, K. A., Herder, S. R, Chen, M., Bailey, C. H., and Kandel, E. R. (1995). Aplysia CREB2 represses long-term facilitation: Relief of repression converts transient facilitation into long-term functional and structural change. Cell 83, 979-992.

338

Section III

Bowery, N. G., and Enna, S. J. (2000). Gamma-aminobutyric acid(B) receptors: first of the functional metabotropic heterodimers. J Pharmacol Exp Ther 292, 2-7. Brown, M. S., Ye, J., Rawson, R. B., and Goldstein, J. L. (2000). Regulated intramembrane proteolysis: a control mechanism conservedfi-ombacteria to humans. Cell 100, 391-398. Chen, A., Muzzio, I. A., Malleret, G., Bartsch, D., Verbitsky, M., Pavlidis, P., Yonan, A. L., Vronskaya, S., Grody, M. B., Cepeda, I., et al (2003). Inducible enhancement of memory storage and synaptic plasticity in transgenic mice expressing an inhibitor of ATF4 (CREB-2) and C/EBP proteins. Neuron 39, 655-669. Chen, B. R C , Wolfgang, C. D., and Hai, T. (1996). Analysis of ATF3: a transcription factor induced by physiological stresses and modulated by gaddl53/ChoplO. Mol Cell Biol 16, 1157-1168. Chen, X., Shen, J., and Prywes, R. (2002). The luminal domain of ATF6 senses endoplasmic reticulum (ER) stress and causes translocation of ATF6fi-omthe ER to the Golgi. J Biol Chem 277, 13045-13052. Cho, R. J., Huang, M., Campbell, M. J., Dong, H., Steinmetz, L., Sapinoso, L., Hampton, G., Elledge, S. J., Davis, R. W., and Lockhart, D. J. (2001). Transcriptional regulation and fimction during the human cell cycle. Nat Genet 27,48-54. Clemens, M. J. (2001). Initiation factor eIF2 alpha phosphorylation in stress responses and apoptosis. Prog Mol Subcell Biol 27, 57-89. Daniel, R B., Walker, W. H., and Habener, J. F. (1998). Cyclic AMP signaling and gene regulation. Annu Rev Nutr 18, 353-383. Darlington, G. J., Wang, N., and Hanson, R. W (1995). C/EBPa: a critical regulator of genes governing integrative metabolic processes. Curr Opin Genet Dev 5, 565-570. De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. (1999). Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci 24, 281-285. Deutsch, P. J., Hoeffler, J. P., Jameson, J. L., Lin, J. C , and Habener, J. F. (1988). Structural determinants for transcriptional activation by c AMP-responsive DNA elements. J Biol Chem 263, 18466-18472. Fan, F., Jin, S., Amundson, S. A., Tong, T., Fan, W, Zhao, H., Zhu, X., Mazzacurati, L., Li, X., Petrik, K. L., et al (2002). ATF3 induction following DNA damage is regulated by distinct signaling pathways and over-expression of ATF3 protein suppresses cells growth. Oncogene 21, 7488-7496. Firestein, R., and Feuerstein, N. (1998). Association of activating transcription factor (ATF2) with the ubiquitin-conjugating enzyme hUBC9. J Biol Chem 273, 5892-5902. Fuchs, S. Y, Xie, B., Adler, V., Fried, V. A., Davis, R. J., and Ronai, Z. (1997). c-Jun NH2-terminal kinases target the ubiquitination of their associated transcription factors. J Biol Chem 272, 32163-32168. Gupta, S., Campbell, D., Derijard, B., and Davis, R. J. (1995). Transcription factor ATF2 regulation by the JNK signal

The Regulators transduction pathway. Science 2 — ^ — E K J H U I I I i NTS2

NTSl^ !

rig.25.2 Organization of rRNA genes (5S and 35S), nontranscribed spacers (NTS), replication origin or autonomous replication sequence (ARS) and replication fork barrier (RFB) site of rDNA repeats in S, cerevisiae. The arrows of the boxes for rRNA genes indicate the directions of transcription.

Fobl represents a class of replication/transcription termination proteins called contrahelicases that also include Tus in E. coli (Mulugu et al, 2001) and TTF-1 in mammals (Evers and Grummt, 1995; Putter and Grummt, 2002). TTF-1 was originally identified for termination of transcription by RNA polymerase I. Recently it has been shown TTF-1 can also block replication (Gerber et al, 1997). In mice, TTF-1 binds to the Sal box found downstream of the 3' end of the rRNA coding region, arresting replication forks moving in the direction opposite to transcription (Lopez-estrano et al, 1998). Similar results were obtained using an SV40-based cell free replication system which showed that binding of TTF-1 to Sal box 2 is required for replication fork arrest and, like yeast, RFB activity occurs independent of transcription (Gerber et al, 1997; Putter and Grummt, 2002). Taken together, the existence of RFB sites and contrahelicases across species demonstrate the importance of protecting actively transcribed genes from disruption by replication. Biological Consequences of Replication-transcription Collisions It appears that whereas co-directional transcription and replication is permitted by cells from bacteria to

The Genome

mammals, the two processes occurring head to head should be prevented or modulated. The latter results in head-on collisions between the replication apparatus and the RNA polymerase complex. Such collisions, if not timely resolved, slow down replication and/or cause abortion of transcription. Also, when a collision takes place, it provides a hot spot for recombination. In yeast, collisions were detected when cells with reduced copy number of rDNA lacked Fobl. Notably, these cells had increased production of extrachromosomal rDNA circles (ERCs) and variation of rDNA copy numbers, both indicating chromosomal re-arrangement or recombination (Takeuchi et al, 2003). A more recent study using yeast plasmids showed that transcription by RNA polymerase II heading against the direction of replication induced a significant increase in recombination while transcription co-directional with replication had little effect on recombination (Prado and Aguilera, 2005). These results further demonstrate that replication-transcription collisions not only affect the genes being transcribed but also the stability of genome as a whole. Part III: DNA Damage Modulates Transcription: (Ying and Yang) The genetic material of all organisms is constantly challenged by DNA damaging agents from endogenous sources, such as the byproducts of respiration and from exogenous sources, such as UV radiation and environmental toxicants. In addition, during every S phase a number of the replication forks stall or collapse invoking mechanisms under study today to reactivate the fork or fix the damage resulting from the collapsed fork. Accurate transmission of chromosomes to each daughter cell requires that cells do not begin anaphase until all chromosomes have been completely replicated and correctly aligned on the spindle. Similarly, cells that have incurred DNA damage in Gl delay DNA replication until the damage has been repaired. Cells that have incurred damage in S phase slow down DNA replication and repair damage before they progress through mitosis (Clarke and Gimenez-Abian, 2000; Hartwell and Weinert, 1989; Lowndes and Murguia, 2000). In addition to cell cycle delay the response to DNA damage also has a key role in the regulation of transcription, which involves both down-regulation of large numbers of transcripts by control of large transcriptional networks as well as up-regulation of key genes that are important for both cell cycle arrest, DNA metabolism and DNA repair. In metazoans the latter category also includes genes that regulate cell death or apoptosis. Genetic analyses in yeast have shown that

Chapter 25

Transcription and Genomic Integrity

checkpoint pathways regulate cell cycle transitions in response to perturbations and also mount a transcriptional response. One of the key players in this response in metazoans, the tumor suppressor p53, has been covered in a separate chapter, so here we will focus on the lessons learned from the studies in yeast. The S-phase and DNA Damage Checkpoints. The Genetic Screens that Uncovered the Signal Transduction Pathways that up Regulate Transcription Following Gentoxic Stress A: The Rad Screen By the late 1960s, many groups had carried out screens to identify yeast mutants that were sensitive to ionizing radiation, ultraviolet radiation, or both, these mutants were named rad mutants. Brian Cox, John Game and Robert Mortimer, among others, identified a collection of radiation sensitive mutants (Cox and Parry, 1968). In 1970 scientists came to an agreement that mutations that conferred sensitivity to ionizing radiation would continue to be named rad mutants, numbered from RAD50 upward, and they would be loci separate from those identified in screens for UV sensitive mutants. There are at least three explanations as to why mutations would lead to a radiation-sensitive phenotype. The mutated gene could encode a protein that is required in order for the cell to 1) repair DNA damage; 2) stop the cell cycle before a critical transition (i.e. mitosis) in order to allow DNA repair or 3) regulate the increased expression of proteins involved in DNA repair or cell cycle arrest. Mutation in the second class of genes usually confers sensitivity to both types of radiation, although this cannot be used as the only criterion for assigning them to the cell cycle arrest category. B: The Mec Screen Although many groups embarked on studies of the rad mutants that affected repair of the UV- and IR-induced lesions, Lee Hartwell and Ted Weinert analyzed the rad mutants for their ability to stop the cell cycle in G2 in response to DNA damage and called the surveillance mechanism responsible for monitoring the successful completion of cell cycle events checkpoints. Investigators had long noted that yeast cells delayed cell cycle progression in response to DNA damage (refs in (Weinert et al, 1994)), but the genes required for the G2/M arrest had not been uncovered. Ted Weinert, while working with Lee Hartwell, characterized the rad

419

mutations that were required for cell cycle arrest following a DNA damage signal. He also carried out a screen that would identify mutations in additional genes involved in this checkpoint response and named them mec mutants (mitotic entry checkpoint). Using cdc mutants that accumulate damage lesions in G2 at the restrictive temperature, Weinert showed that a rad9 mutation (originally identified as a UV-sensitive mutant (Cox and Parry, 1968)) and subsequently mutations in RAD 17 and RAD24 allowed cells to go through mitosis in the presence of DNA damage. Weinert then used a genetic screen with the damage-inducing cdc mutants and identified the mecl, mec2 and mec3 mutants as defective for the G2/M checkpoint (Weinert, 1992). C: The Sad, Dun and Crt Screens Meanwhile Stephen Elledge's group carried out a screen to identify mutants that were defective for the S-phase checkpoint-induced arrest (Sad= S phase arrest defective) that would lead to catastrophic mitosis of unreplicated chromosomes. That screen identified S^£)7 and SAD3 as essential components for this response (Allen et al, 1994). The Elledge lab also carried out a screen for mutants that failed to tum on the transcriptional response as measured by the upregulation of ribonucleotide reductase 3 mRNA {RNR3). These mutants were called dun (DNA damage uninducible) and led to the identification of DUNl and DUN2 as genes required for the transcriptional response following replication blocks and DNA damage (Navas et a/., 1995; Zhou and Elledge, 1993). RNR3 transcription is induced by DNA damage and replication blocks, therefore, Zheng Zhou and Stephen Elledge also carried out a screen for mutants that had constitutive RNR expression (Constitutive RNR transcription, CRT mutants) in order to identify the factors that regulated RNR transcription. At around the same time, Kato and Ogawa characterized a mutant named esrl, which showed sensitivity to the alkylating agent methyl methanesulfonate (MMS) and to UV radiation (Kato and Ogawa, 1994). In addition, the esrl mutants displayed meiotic defects. David Stem's group took a biochemical approach and isolated Spklp in a screen that used a bacterial system to identify dual specificity kinases (kinases that can phosphorylate proteins on serines/threonine and tyrosine residues) from yeast (Zheng et aL, 1993). When all of the genes mutated in these strains were cloned it turned out that many alleles of the same genes had been identified in the different screens and this pointed not only to their important role in various responses but also provided hints as to their biochemical

420

Section IV

functions. RAD53 encoded an essential kinase that is required for the cell to arrest not only in response to DNA damage but also when DNA replication is slowed down or blocked (Allen et al, 1994; Weinert et al, 1994; Zheng et al, 1993). RAD53 alleles were identified not only in the rad screens but also in the sad {sadl) and mec {mec2) screens, and Rad53p was the kinase identified in David Stem's screen for dual specificity kinases (Spklp). Another essential kinase that regulates this response is Meclp, and it was identified in the mec screen, sad screen (sad3) and in Ogawa's screen as the gene mutated in esrL Dunlp turned out to be another kinase (Zhou and EUedge, 1993) that shared phospho-peptide recognition domains (FHA forkhead-associated domains (Hofmann and Bucher, 1995)) with Rad53p outside of the kinase domain. Dun2p is the catalytic subunit of DNA polymerase epsilon (Navas et al, 1995). The fact that a component of DNA polymerase showed defects in a checkpoint response sparked enthusiasm and speculation that the DNA polymerase complexes, by the nature of their function, made attractive candidates for sensors and scanning machines (Navas et al., 1996). Three kinases had been identified that are required in order to signal DNA damage and replication blocks. Many groups began to organize the rad, mec, and sad mutants (and other mutants that displayed sensitivity to agents that damage DNA or cause replication blocks) into the DNA Repair category or as components of signal transduction pathways that signal the presence of these lesions. As we mentioned in the first section of this chapter, two such proteins, Rad26p and Rad28p, have roles in TCR. There were several criteria and several readouts that were used by many laboratories in order to piece together the checkpoint signal transduction pathways. The readouts included the effect of mutations on 1) the cell's ability to delay cell cycle progression when encountering damage at different stages of the cell cycle; 2) the activation of the kinases by phosphorylation, and 3) the up-regulation of RNR3 mRNA and other damage-inducible gene transcripts. Using these readouts, proteins required for the checkpoint response with similarity to proteins involved in DNA replication (DNA polymerase or polymerase associated proteins) or lesion processing (proteins with homology to nucleases or other DNA associated complexes) were considered to act as sensors that would trigger the response. Proteins that acted by regulating phosphorylation status of targets, such as protein kinases, were assigned the role of transducers due to their biochemical function. The proteins phosphorylated by the kinases (and presumably

The Genome

also regulated by phosphatases) were considered as effectors. These turned out to be crude assignments since most signal transduction pathways involve feedback loops that cause the kinases to phosphorylate upstream components. Nevertheless, at the time, it was a good plan of attack. One role for the checkpoint pathways is the transcriptional induction of genes encoding products involved in DNA metabolism and DNA repair. The ribonucleotide reductase (RNR) genes are transcriptional targets of the S-phase and DNA damage checkpoints that have been studied extensively in yeast and are conserved in mammals. The Rnr proteins catalyze the rate-limiting step of DNA synthesis, which is the generation of the deoxyribonucleotide pools. The S-phase and DNA damage checkpoint mediated by Meclp, Rad53p and Dunlp controls the transcriptional upregulation of the RNR genes in yeast (Huang et ah, 1998; Zhao et al, 1998; Zhou and Elledge, 1993). Two of the effectors for the checkpoint-induced upregulation of Rnr activity are the transcriptional repressor Crtlp and the Rnr regulatory subunit Smllp (Zhao et al, 1998; Zhou and Elledge, 1992). In response to DNA damage or stalled replication forks, Crtlp is hyperphosphorylated in a Dunlp-dependent manner and released from the DNA allowing transcription of the RNR genes (Huang et al, 1998). In addition, phosphorylation of Smllp in a Dunlp-dependent fashion allows the activation of ribonucleotide reductase, presumably by mediating the degradation of Smllp (Zhao and Rothstein, 2002). The genes encoding the RNRps are regulated by upstream repressor sequences and damage-responsive elements. These sequences are bound by the damage-responsive transcription factor Crtlp, which recruits the co-repressor proteins Tuplp-Ssn6p to the promoter of the RNR genes (Huang et al, 1998). Following checkpoint activation by DNA damage or replication blocks, Dunlp-dependent phosphorylation of Crtlp results in reduced binding of Crtlp to thQRNR promoters assayed by chromatin immunoprecipitation (Chip) (Huang et al, 1998). The CRTl promoter also has a binding site for Crtlp, therefore CRTl expression is also increased after DNA damage. This allows re-establishment of repression once the DNA damage has been repaired or the replication blocks have been resolved (Fig.25.3) (Huang et aL, 1998). Work from Joseph Reese's laboratory mapped out the events that occurred at the chromatin level to elucidate the molecular mechanism by which Crtl along with the transcriptional machinery regulated de-repression of the RNR3 gene in budding yeast (Li and Reese, 2000; Li and Reese, 2001; Sharma et al, 2003; Zhang and

Chapter 25

Transcription and Genomic Integrity

421

DNA damage

Replication block

sm,&tti

\y^^:'^-/m^ ii'iTl»fit.'fifaiii.ii.,».ii*rilirir.i*nrtit.H«hi*.

mk^csTi Fig.25.3 Regulation of DNA damage-inducible genes by the25,3 checkpoint pathway involves phosphorylation of the transcriptional repressor Crtl, which has been proposed to cause loss of interaction with the promoter element. BOTTOM: Crtl is thought to repress transcription of these genes by recruiting the co-repressor complex containing Tupl (T) and Ssn6 (S) to the promoter of DNA damage-inducible genes.

422

Section IV

Reese, 2004a; Zhang and Reese, 2004b). Reese and co-workers showed that Tuplp-Ssn6p recruitment to chromatin established a nucleosomal array at the RNR3 promoter, which was disrupted when RNR3 was de-repressed by a checkpoint signal (Li and Reese, 2001). Furthermore, Reese's lab used the RNR3 model to examine the relative contributions of general transcription factors, RNA polymerase II (RNAPII), and acetylation to the nucleosome remodeling and recruitment of the SWI/SNF complex. Their studies suggested that remodeling of the RNR3 promoter in vivo in response to DNA damage required both the general transcription factors TAFl, TAF12 (TFIID) and the large subunit of RNAPII. However, acetylation of histone H3 did not require TFIID or RNAPII (Sharma et al., 2003). These studies underscore the power of the yeast genetic model system for dissecting the events that regulate gene expression. Global Downregulation of Transcription of Ribosomal Genes Following Different Forms of Stress including DNA Damage Another level of transcriptional regulation following genotoxic stress is the downregulation of genes involved in ribosome synthesis and biogenesis. By the year 2001, not only had the yeast genome been sequenced, but there was a collection of deletion mutants in every non-essential yeast gene which has been used in screens to identify genes involved in several physiological processes, including DNA repair. Michael Resnick's group, who had identified some of the original RAD genes in standard genetic screens, used this collection of deletion mutants to identify additional genes involved in the response to ionizing radiation (Bennett et al, 2001). This screen uncovered old favorites and new mutants that had varying degrees of sensitivity to ionizing radiation and to other agents that damage DNA or block DNA replication. The sensitive strains had mutations in genes that encode proteins involved in DNA repair, cell cycle arrest, transcription, chromatin remodeling, nuclear architecture and endocytosis. In these studies the budding yeast system proved once again to be a powerful genetic tool for the identification of proteins that function in pathways that regulate cell cycle progression and genomic stability by regulating gene expression. One such mutant identified in the genomewide screen was in the gene that encodes for the transcription factor S^lp (Bennett et al, 2001; Xu and Norris, 1998). Curiously SFPl had been identified by Mike Tyer's group as a whi mutant that was defective in regulating cell size and further showed to be involved in

The Genome

the regulation of ribosomal gene expression (Jorgensen et aL, 2002). Recently, the Tyers, O'Shea, Hall, Warner, Shore and Struhl among other groups carried out beautiful studies to address the mechanism by which so many signals including nutrient availability and genotoxic stress converged on SQ)lp-regulated genes. The best understood role for S^lp is coordination of cell size with nutrient availability by controls of translation and ribosome biogenesis. Three pathways that respond to nutrients, TOR, AKT and PKA, converged on Si^lp and the affiliated transcription factors Fhllp and Ifhlp by regulating their protein-protein interactions and cellular distribution (Jorgensen et aL, 2004; Marion et aL, 2004; Martin et aL, 2004; Schawalder et aL, 2004; Wade et aL, 2004). While nutrient conditions are favorable SQ)lp is bound to chromatin directing expression of Ribosomal protein genes (RP); however, when the nutrients are removed or unavailable, S^lp no longer associates with chromatin and is excluded from the nucleus. Sfplp in turn regulates the nuclear localization of Fhllp and Ifhlp, both of which bind to RP gene promoters (Jorgensen et aL, 2004; Marion et aL, 2004; Martin et aL, 2004; Schawalder et aL, 2004; Wade et aL, 2004). An interesting find from these studies which could explain why SFPl was identified in the Resnick rad screen was that S^lp nuclear localization was also regulated by other stress signals including oxidative stress and treatment with the alkylating agent MMS, both of which cause DNA damage (Jorgensen et aL, 2004; Marion et aL, 2004). The localization of Sfplp in response to DNA damage did not require the known pathways that regulated its localization in response to nutrients. Important questions that remain to be addressed are the implications of regulating RP gene transcription and/or cell size in response to genotoxic stress. It could be that transient down-regulation of transcription would prevent activation of TCR by preventing the formation of blocked RNA polymerase complexes (see section I). Furthermore, future studies will determine whether the checkpoint pathways also regulate the localization of Sfplp (and other related factors) in order to downregulate expression of RP genes (Wade et aL, 2004). Conclusion In this chapter we have highlighted several mechanisms that impinge on the transcriptional machinery in order to maintain genomic integrity. First, we discussed mechanisms that the cell utilizes to repair damaged templates that are being actively transcribed;

Chapter 25

Transcription and Genomic Integrity

second, we discussed the coordination of DNA replication and transcription to control collisions between the DNA and RNA polymerase complexes; and third, we discussed how the transcriptional machinery itself is regulated to modulate expression of genes that coordinate the response to DNA damage and similar stressors. Finally, we would like to end by indicating that these studies underscore the critical role that model organisms such as yeast have played and continue to play in our understanding of gene expression and homeostasis. Acknowledgement We are grateful to members of the Sanchez lab for helpful comments and discussions. Work in our laboratory is funded in part by NIH/NCI ROl CA84463, the Department of Defense DAMD 17-01-1-020, and the Pew Scholars Program in the Biomedical Sciences to YS, and by grants P30 ES06096 and UOl ESI 1038 Comparative Mouse Genomics Centers Consortium from the National Institute of Environmental Health Sciences, NIH. J.P. is a recipient of the University Distinguished Graduate Fellowship. Key abbreviations used in this chapter 6-4 PP BER cdc CHO CPD CRT CS DHFR ERC FHA G2/M GGR HuF2 MEC MMS NER N-TEF NTS RFB RFP RNAP RP RNR SAD TCR

6-4 photoproduct base excision repair cell division cycle Chinese hamster ovary cyclobutane pyrimidine dimer constitutive RNR transcription Cockayne syndrome dihydrofolate reductase extrachromosomal rDNA circle forkhead-associated G2/mitosis global genomic repair human factor 2 mitotic entry checkpoint methyl methanesulfonate nucleotide excision repair negative transcription elongation factor nontranscribed spacer replication fork barrier replication fork pause RNA polymerase ribosomal protein ribonucleotide reductase S phase arrest defective transcription-coupled repair

'423

TFIIS or SII transcription elongation factor SII TRCF transcription-repair coupling factor

References Allen, J. B., Zhou, Z , Siede, W., Friedberg, E. C , and Elledge, S. J. (1994). The SAD1/RAD53 protein kinase controls multiple checkpoints and DNA damage-induced transcription in yeast. Genes Dev 5, 2401-2415. Barnes, D. E., Tomkinson, A. E., Lehmann, A. R., Webster, A. D., and Lindahl, T. (1992). Mutations in the DNA ligase I gene of an individual with immunodeficiencies and cellular hypersensitivity to DNA-damaging agents. Cell 69, 495-503. Batty, D., Rapic'-Otrin, V., Levine, A. S., and Wood, R. D. (2000). Stable binding of human XPC complex to irradiated DNA confers strong discrimination for damaged sites. J Mol Biol 300, 275-290. Beaudenon, S. L., Huacani, M. R., Wang, G., McDonnell, D. P., and Huibregtse, J. M. (1999). Rsp5 ubiquitin-protein ligase mediates DNA damage-induced degradation of the large subunit of RNA polymerase II in Saccharomyces cerevisiae. Mol Cell Biol 19, 6972-6979. Bennett, C. B., Lewis, L. K., Karthikeyan, G., Lobachev, K. S., Jin, Y. H., Sterling, J. R, Snipe, J. R., and Resnick, M. A. (2001). Genes required for ionizing radiation resistance in yeast. Nat Genet 29, 426-434. Bhatia, P. K., Verhage, R. A., Brouwer, J., and Friedberg, E. C. (1996). Molecular cloning and characterization oi Saccharomyces cerevisiae RAD28, the yeast homolog of the human Cockayne syndrome A (CSA) gene. J Bacteriol 178, 5977-5988. Blattner, F. R., Plunkett, G., 3rd, Bloch, C. A., Pema, N. T., Burland, V., Riley, M., Collado-Vides, J., Glasner, J. D., Rode, C. K., Mayhew, G. F., et al (1997). The complete genome sequence oi:Escherichia coliK-12. Science 277, 1453-1474. Bohr, V. A., Smith, C. A., Okumoto, D. S., and Hanawalt, R C. (1985). DNA repair in an active gene: removal of pyrimidine dimers from the DHFR gene of CHO cells is much more efficient than in the genome overall. Cell 40, 359-369. Boiteux, S., and Guillet, M. (2004). Abasic sites in DNA: repair and biological consequences in Saccharomyces cerevisiae. DNA Repair (Amst) 3, 1-12. Bregman, D. B., Halaban, R., van Gool, A. J., Henning, K. A., Friedberg, E. C , and Warren, S. L. (1996). UV-induced ubiquitination of RNA polymerase II: a novel modification deficient in Cockayne syndrome cells. Proc Natl Acad Sci USA 95,11586-11590. Brewer, B. J. (1988). When polymerases collide: replication and the transcriptional organization of the E. coli chromosome. Cell 53, 679-686. Brewer, B. J., and Fangman, W L. (1988). A replicafion fork barrier at the 3' end of yeast ribosomal RNA genes. Cell 55,

424

Section IV

637-643. Brewer, B. J., Lockshon, D., and Fangman, W. L. (1992). The arrest of repHcation forks in the rDNA of yeast occurs independently of transcription. Cell 77, 267-276. Brooks, P. J., Wise, D. S., Berry, D. A., Kosmoski, J. V., Smerdon, M. J., Somers, R. L., Mackie, H., Spoonde, A. Y., Ackerman, E. J., Coleman, K., et al (2000). The oxidative DNA lesion 8,5'-(S)-cyclo-2'-deoxyadenosine is repaired by the nucleotide excision repair pathway and blocks gene expression in mammalian cells. J Biol Chem 275, 22355-22362. Buschta-Hedayat, N., Buterin, T., Hess, M. T., Missura, M., and Naegeli, H. (1999). Recognition of nonhybridizing base pairs during nucleotide excision repair of DNA. Proc Natl Acad Sci USA 96, 6090-6095. Carreau, M., and Hunting, D. (1992). Transcription-dependent and independent DNA excision repair pathways in human cells. Mutat Res 27^,57-64. Chen, Y. H., and Bogenhagen, D. F. (1993). Effects of DNA lesions on transcription elongation by T7 RNA polymerase. J Biol Chem 268, 5849-5855. Choi, D. J., Marino-Alessandri, D. J., Geacintov, N. E., and Scicchitano, D. A. (1994). Site-specific benzo[a]pyrene diol epoxide-DNA adducts inhibit transcription elongation by bacteriophage T7 RNA polymerase. Biochemistry 33, ISO-lSl. Christians, F. C , and Hanawalt, R C. (1992). Inhibition of transcription and strand-specific DNA repair by alpha-amanitin in Chinese hamster ovary cells. Mutat Res 274, 93-101. Christians, F. C , and Hanawalt, R C. (1993). Lack of transcription-coupled repair in mammalian ribosomal RNA genes. Biochemistry J2, 10512-10518. Christians, F. C , and Hanawalt, P. C. (1994). Repair in ribosomal RNA genes is deficient in xeroderma pigmentosum group C and in Cockayne's syndrome cells. Mutat Res 323, 179-187. Citterio, E., Van Den Boom, V, Schnitzler, G., Kanaar, R., Bonte, E., Kingston, R. E., Hoeijmakers, J. H., and Vermeulen, W. (2000). ATP-dependent chromatin remodeling by the Cockayne syndrome B DNA repair-transcription-coupling factor. Mol Cell Biol 20, 7643-7653. Clarke, D. J., and Gimenez-Abian, J. F. (2000). Checkpoints controlling mitosis. Bioessays 22, 351-363. Cline, S. D., Riggins, J. N., Tomaletti, S., Mamett, L. J., and Hanawalt, P. C. (2004). Malondialdehyde adducts in DNA arrest transcription by T7 RNA polymerase and mammalian RNA polymerase II. Proc Natl Acad Sci USA 101, 7275-7280. Conconi, A., Bespalov, V. A., and Smerdon, M. J. (2002). Transcription-coupled repair in RNA polymerase I-transcribed genes of yeast. Proc Natl Acad Sci USA 99, 649-654. Cooper, P. K., Nouspikel, T., Clarkson, S. G., and Leadon, S. A. (1997). Defective transcription-coupled repair of oxidative base damage in Cockayne syndrome patients from XP group G. Science 275, 990-993. Corda, Y, Job, C , Anin, M. F., Leng, M., and Job, D. (1993).

The Genome Spectrum of DNA~platinum adduct recognition by prokaryotic and eukaryotic DNA-dependent RNA polymerases. Biochemistry 32, 8582-8588. Cox, B. S., and Parry, J. M. (1968). The isolation, genetics and survival characteristics of ultraviolet light-sensitive mutants in yeast. Mutat Res 6, 37-55. Cullinane, C , Mazur, S. J., Essigmann, J. M., Phillips, D. R., and Bohr, V. A. (1999). Inhibition of RNA polymerase II transcription in human cell extracts by cisplatin DNA damage. Biochemistry 38, 6204-6212. Dammann, R., and Pfeifer, G. P. (1997). Lack of gene- and strand-specific DNA repair in RNA polymerase III-transcribed human tRNA genes. Mol Cell Biol 77, 219-229. de Boer, J., and Hoeijmakers, J. H. (2000). Nucleotide excision repair and human syndromes. Carcinogenesis 27, 453-460. de Laat, W. L., Appeldoom, E., Sugasawa, K., Weterings, E., Jaspers, N. G., and Hoeijmakers, J. H. (1998). DNA-binding polarity of human replication protein A positions nucleases in nucleotide excision repair. Genes Dev 72, 2598-2609. de Laat, W. L., Jaspers, N. G., and Hoeijmakers, J. H. (1999). Molecular mechanism of nucleotide excision repair. Genes Dev 13, 768-785. Deshpande, A. M., and Newlon, C. S. (1996). DNA replication fork pause sites dependent on transcription. Science 272, 1030-1033. Donahue, B. A., Fuchs, R. P., Reines, D., and Hanawalt, P. C. (1996). Effects of aminofluorene and acetylaminofluorene DNA adducts on transcriptional elongation by RNA polymerase II. J Biol Chem 277, 10588-10594. Donahue, B. A., Yin, S., Taylor, J. S., Reines, D., and Hanawalt, P. C. (1994). Transcript cleavage by RNA polymerase II arrested by a cyclobutane pyrimidine dimer in the DNA template. Proc Natl Acad Sci USA 91, 8502-8506. Drapkin, R., Reardon, J. T., Ansari, A., Huang, J. C , Zawel, L., Ahn, K., Sancar, A., and Reinberg, D. (1994). Dual role of TFIIH in DNA excision repair and in transcription by RNA polymerase II. Nature 368, 769-772. Eisen, J. A., Sweder, K. S., and Hanawalt, R C. (1995). Evolution of the SNF2 family of proteins: subfamilies with distinct sequences and fiinctions. Nucleic Acids Res 23, 2715-2723. Elias-Amanz, M., and Salas, M. (1997). Bacteriophage phi29 DNA replication arrest caused by codirectional collisions with the transcription machinery. Embo J 16, 5775-5783. Elias-Amanz, M., and Salas, M. (1999). Resolution of head-on collisions between the transcription machinery and bacteriophage phi29 DNA polymerase is dependent on RNA polymerase translocation. Embo J 18, 5675-5682. Evans, E., Moggs, J. G., Hwang, J. R., Egly, J. M., and Wood, R. D. (1997). Mechanism of open complex and dual incision formation by human nucleotide excision repair factors. Embo J 16, 6559-6573. Evers, R., and Grummt, I. (1995). Molecular coevolution of

Chapter 25

Transcription and Genomic Integrity

mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I. Proc Natl Acad Sci USA 92,5827-5831. Feaver, W. J., Svejstrup, J. Q., Bardwell, L., Bardwell, A. J., Buratowski, S., Gulyas, K. D., Donahue, T. R, Friedberg, E. C , and Komberg, R. D. (1993). Dual roles of a multiprotein complex from S. cerevisiae in transcription and DNA repair. Cell 75, 1379-1387. French, S. (1992). Consequences of replication fork movement through transcription units in vivo. Science 258, 1362-1365. Frit, P., Bergmann, E., and Egly, J. M. (1999). Transcription factor IIH: a key player in the cellular response to DNA damage. Biochimie 81 27-38. Fritz, L. K., and Smerdon, M. J. (1995). Repair of UV damage in actively transcribed ribosomal genes. Biochemistry 34, 13117-13124. Gerber, J. K., Gogel, E., Berger, C , WalHsch, M., Muller, F., Grummt, I., and Grummt, F. (1997). Termination of mammalian rDNA replication: polar arrest of replication fork movement by transcription termination factor TTF-I. Cell 90, 559-567. Gu, W., Powell, W., Mote, J., Jr., and Reines, D. (1993). Nascent RNA cleavage by arrested RNA polymerase II does not require upstream translocation of the elongation complex on DNA. J Biol Chem 2^5,25604-25616. Hanawalt, P., and Mellon, I. (1993). Stranded in an active gene. Curr Biol 5, 67-69. Hanawalt, P. C. (1994). Transcription-coupled repair and human disease. Science 266, 1957-1958. Kara, R., Selby, C. R, Liu, M., Price, D. H., and Sancar, A. (1999). Human transcription release factor 2 dissociates RNA polymerases I and II stalled at a cyclobutane thymine dimer. J Biol Chem 274, 24779-24786. Hartwell, L. H., and Weinert, T. A. (1989). Checkpoints: controls that ensure the order of cell cycle events. Science 246, 629-634. Hatahet, Z., Purmal, A. A., and Wallace, S. S. (1994). Oxidative DNA lesions as blocks to in vitro transcription by phage T7 RNA polymerase. Ann N Y Acad Sci 726, 346-348. Henning, K. A., Li, L., Iyer, N., McDaniel, L. D., Reagan, M. S., Legerski, R., Schultz, R. A., Stefanini, M., Lehmann, A. R., Mayne, L. V., and Friedberg, E. C. (1995). The Cockayne syndrome group A gene encodes a WD repeat protein that interacts with CSB protein and a subunit of RNA polymerase II TFIIH. Cell 82, 555-564. Hofmann, K., and Bucher, P. (1995). The FHA domain: a putative nuclear signalling domain found in protein kinases and transcription factors. Trends Biochem Sci 20, 347-349. Huang, M., Zhou, Z., and Elledge, S. J. (1998). The DNA replication and damage checkpoint pathways induce transcription by inhibition of the Crtl repressor. Cell 94, 595-605. Ivessa, A. S., Lenzmeier, B. A., Bessler, J. B., Goudsouzian, L. K., Schnakenberg, S. L., and Zakian, V. A. (2003). The Saccharomyces cerevisiae helicase Rrm3p facilitates replication

past

nonhistone

protein-DNA

'425 complexes.

Mol

Cell

12,

1525-1536. Iyer, N., Reagan, M. S., Wu, K. J., Canagarajah, B., and Friedberg, E. C. (1996). Interactions involving the human RNA polymerase II transcription/nucleotide excision repair complex TFIIH, the nucleotide excision repair protein XPG, and Cockayne syndrome group B (CSB) protein. Biochemistry 35, 2157-2167. Izban, M. G., and Luse, D. S. (1992). The RNA polymerase II ternary complex cleaves the nascent transcript in a 3'—5' direction in the presence of elongation factor SII. Genes Dev 6, 1342-1356. Jorgensen, P., Nishikawa, J. L., Breitkreutz, B. J., and Tyers, M. (2002). Systematic identification of pathways that couple cell growth and division in yeast. Science 297, 395-400. Jorgensen, P., Rupes, I., Sharom, J. R., Schneper, L., Broach, J. R., and Tyers, M. (2004). A dynamic transcriptional network communicates growth potential to ribosome synthesis and critical cell size. Genes Dev 18, 2491-2505. Kalogeraki, V. S., Tomaletti, S., and Hanawalt, R C. (2003). Transcription arrest at a lesion in the transcribed DNA strand in vitro is not affected by a nearby lesion in the opposite strand. J Biol Chem 278, 19558-19564. Kato, R., and Ogawa, H. (1994). An essential gene, ESRl, is required for mitotic cell growth, DNA repair and meiotic recombination in Saccharomyces cerevisiae. Nucleic Acids Res 22,3104-3112. Kim, C , Snyder, R. O., and Wold, M. S. (1992). Binding properties of replication protein A from human and yeast cells. Mol Cell Biol 12, 3050-3059. Kobayashi, T. (2003). The replication fork barrier site forms a unique structure with Foblp and inhibits the replication fork. Mol Cell Biol 23, 9178-9188. Kobayashi, T., Heck, D. J., Nomura, M., and Horiuchi, T. (1998). Expansion and contraction of ribosomal DNA repeats in Saccharomyces cerevisiae. requirement of replication fork blocking (Fobl) protein and the role of RNA polymerase I. Genes Dev 72, 3821-3830. Kobayashi, T., Hidaka, M., Nishizawa, M., and Horiuchi, T. (1992). Identification of a site required for DNA repHcation fork blocking activity in the rRNA gene cluster in Saccharomyces cerevisiae. Mol Gen Genet 233, 355-362. Krokan, H. E., Standal, R., and Slupphaug, G. (1997). DNA glycosylases in the base excision repair of DNA. Biochem J 325

(Ptl),\-\6. Kubota, Y., Nash, R. A., Klungland, A., Schar, P., Barnes, D. E., and Lindahl, T. (1996). Reconstitution of DNA base excision-repair with purified human proteins: interaction between DNA polymerase beta and the XRCCl protein. Embo J 75, 6662-6670. Le Page, F., Kwoh, E. E., Avrutskaya, A., Gentil, A., Leadon, S. A., Sarasin, A., and Cooper, P. K. (2000). Transcription-coupled repair of 8-oxoguanine: requirement for XPG, TFIIH, and CSB

426

Section IV

and implications for Cockayne syndrome. Cell 101, 159-171. Leadon, S. A., Barbee, S. L., and Dunn, A. B. (1995). The yeast RAD2, but not RADl, gene is involved in the transcription-coupled repair of thymine glycols. Mutat Res 337, 169-178. Leadon, S. A., and Cooper, P. K. (1993). Preferential repair of ionizing radiation-induced damage in the transcribed strand of an active human gene is defective in Cockayne syndrome. Proc Natl Acad Sci USA 90, 10499-10503. Leadon, S. A., and Lawrence, D. A. (1992). Strand-selective repair of DNA damage in the yeast GAL7 gene requires RNA polymerase IL J Biol Chem 267, 23175-23182. Lee, K. B., Wang, D., Lippard, S. J., and Sharp, R A. (2002). Transcription-coupled and DNA damage-dependent ubiquitination of RNA polymerase II in vitro. Proc Natl Acad Sci USA 99, 4239-4244. Li, B., and Reese, J. C. (2000). Derepression of DNA damage-regulated genes requires yeast TAF(II)s. Embo J 79, 4091-4100. Li, B., and Reese, J. C. (2001). Ssn6-Tupl regulates RNR3 by positioning nucleosomes and affecting the chromatin structure at the upstream repression sequence. J Biol Chem 276, 33788-33797. Lindahl, T., Karran, R, and Wood, R. D. (1997). DNA excision repair pathways. Curr Opin Genet Dev 7, 158-169. Liu, B., and Alberts, B. M. (1995). Head-on collision between a DNA replication apparatus and RNA polymerase transcription complex. Science 257, 1131-1137. Liu, B., Wong, M. L., Tinker, R. L., Geiduschek, E. P., and Alberts, B. M. (1993). The DNA replication fork can pass RNA polymerase without displacing the nascent transcript. Nature 366, 33-39. Liu, M., Xie, Z., and Price, D. H. (1998). A human RNA polymerase II transcription termination factor is a SWI2/SNF2 family member. J Biol Chem 273, 25541-25544. Ljungman, M., and Zhang, F. (1996). Blockage of RNA polymerase as a possible trigger for u.v. light-induced apoptosis. Oncogene 73, 823-831. Lopez-estrano, C , Schvartzman, J. B., Krimer, D. B., and Hernandez, P. (1998). Co-localization of polar repHcation fork barriers and rRNA transcription terminators in mouse rDNA. J Mol Biol 277, 249-256. Lowndes, N. F., and Murguia, J. R. (2000). Sensing and responding to DNA damage. Curr Opin Genet Dev 10, 17-25. Luo, Z., Zheng, J., Lu, Y., and Bregman, D. B. (2001). Ultraviolet radiation alters the phosphorylation of RNA polymerase II large subunit and accelerates its proteasome-dependent degradation. Mutat Res 486, 259-21 A. Ma, L., Siemssen, E. D., Notebom, H. M., and van der Eb, A. J. (1994). The xeroderma pigmentosum group B protein ERCC3 produced in the baculovirus system exhibits DNA helicase activity. Nucleic Acids Res 22, 4095-4102.

The Genome MacAlpine, D. M., Rodriguez, H. K., and Bell, S. R (2004). Coordination of replication and transcription along a Drosophila chromosome. Genes Dev 18, 3094-3105. Marion, R. M., Regev, A., Segal, E., Barash, Y., Koller, D., Friedman, N., and O'Shea, E. K. (2004). Sfpl is a stress- and nutrient-sensitive regulator of ribosomal protein gene expression. Proc Natl Acad Sci USA 101, 14315-14322. Marshall, N. F., Peng, J., Xie, Z., and Price, D. H. (1996). Control of RNA polymerase II elongation potential by a novel carboxylterminal domain kinase. J Biol Chem 277, 27176-27183. Martin, D. E., Soulard, A., and Hall, M. N. (2004). TOR regulates ribosomal protein gene expression via PKA and the Forkhead transcription factor FHLl. Cell 77P, 969-979. Matsumoto, Y, and Kim, K. (1995). Excision of deoxyribose phosphate residues by DNA polymerase beta during DNA repair. Science 269, 699-702. McKay, B. C , Ljungman, M., and Rainbow, A. J. (1998). Persistent DNA damage induced by ultraviolet light inhibits p21wafl and bax expression: implications for DNA repair, UV sensitivity and the induction of apoptosis. Oncogene 77, 545-555. Mei Kwei, J. S., Kuraoka, I., Horibata, K., Ubukata, M., Kobatake, E., Iwai, S., Handa, H., and Tanaka, K. (2004). Blockage of RNA polymerase II at a cyclobutane pyrimidine dimer and 6-4 photoproduct. Biochem Biophys Res Commun 320, 1133-1138. Mello, J. A., Lippard, S. J., and Essigmann, J. M. (1995). DNA adducts of cis-diamminedichloroplatinum(II) and its trans isomer inhibit RNA polymerase II differentially in vivo. Biochemistry 34, 14783-14791. Mellon, I., Bohr, V. A., Smith, C. A., and Hanawah, R C. (1986). Preferential DNA repair of an active gene in human cells. Proc Natl Acad Sci USA 83, 8878-8882. Mellon, I., and Champe, G. N. (1996). Products of DNA mismatch repair genes mutS and mutL are required for transcription-coupled nucleotide-excision repair of the lactose operon in Escherichia coli. Proc Natl Acad Sci USA 93, 1292-1297. Mellon, I., and Hanawalt, R C. (1989). Induction of the Escherichia coli lactose operon selectively increases repair of its transcribed DNA strand. Nature 342, 95-98. Mellon, I., Rajpal, D. K., Koi, M., Boland, C. R., and Champe, G. N. (1996). Transcription-coupled repair deficiency and mutations in human mismatch repair genes. Science 272, 557-560. Mellon, I., Spivak, G., and Hanawalt, R C. (1987). Selective removal of transcription-blocking DNA damage from the transcribed strand of the mammalian DHFR gene. Cell 51, 241-249. Memisoglu, A., and Samson, L. (2000). Base excision repair in yeast and mammals. Mutat Res ^57, 39-51. Mirkin, E. V., and Mirkin, S. M. (2005). Mechanisms of transcription-replication collisions in bacteria. Mol Cell Biol 25, 888-895.

Chapter 25

Transcription and Genomic Integrity

Mu, D., and Sancar, A. (1997). Model for XPC-independent transcription-coupled repair of pyrimidine dimers in humans. J Biol Chem 272, 7570-7573. Mulugu, S., Potnis, A., Shamsuzzaman, Taylor, J., Alexander, K., and Bastia, D. (2001). Mechanism of termination of DNA replication of Escherichia coli involves helicase-contrahelicase interaction. Proc Natl Acad Sci USA 98, 9569-9574. Nath, S. T., and Romano, L. J. (1991). Transcription by T7 RNA polymerase using benzo[a]pyrene-modified templates. Carcinogenesis 72, 973-976. Navas, T. A., Sanchez, Y., and Elledge, S. J. (1996). RAD9 and DNA polymerase epsilon form parallel sensory branches for transducing the DNA damage checkpoint signal in Saccharomyces cerevisiae. Genes Dev 10, 2632-2643. Navas, T. A., Zhou, Z., and Elledge, S. J. (1995). DNA polymerase epsilon links the DNA replication machinery to the S phase checkpoint. Cell 80, 29-39. Nguyen, V. T., Giannoni, R, Dubois, M. R, Seo, S. J., Vigneron, M., Kedinger, C , and Bensaude, O. (1996). In vivo degradation of RNA polymerase II largest subunit triggered by alpha-amanitin. Nucleic Acids Res 24, 2924-2929. Nicholl, I. D., Nealon, K., and Kenny, M. K. (1997). Reconstitution of human base excision repair with purified proteins. Biochemistry 36, 7557-7566. Nudler, E., Goldfarb, A., and Kashlev, M. (1994). Discontinuous mechanism of transcription elongation. Science 265, 793-796. O'Donovan, A., Davies, A. A., Moggs, J. G., West, S. C , and Wood, R. D. (1994). XPG endonuclease makes the 3' incision in human DNA nucleotide excision repair. Nature 371, 432-435. Olavarrieta, L., Hernandez, P., Krimer, D. B., and Schvartzman, J. B. (2002). DNA knotting caused by head-on coUision of transcription and replication. J Mol Biol 322, 1-6. Park, J. S., Marr, M. T., and Roberts, J. W. (2002). E. coli Transcription repair coupling factor (Mfd protein) rescues arrested complexes by promoting forward translocation. Cell 109, 757-767. Perlow, R. A., Kolbanovskii, A., Hingerty, B. E., Geacintov, N. E., Broyde, S., and Scicchitano, D. A. (2002). DNA adducts from a tumorigenic metabolite of benzo[a]pyrene block human RNA polymerase II elongation in a sequenceand stereochemistry-dependent manner. J Mol Biol 321, 29-47. Plosky, B., Samson, L., Engelward, B. P., Gold, B., Schlaen, B., Millas, T., Magnotti, M., Schor, J., and Scicchitano, D. A. (2002). Base excision repair and nucleotide excision repair contribute to the removal of N-methylpurines from active genes. DNA Repair (Amst) 1, 683-696. Prado, R, and Aguilera, A. (2005). Impairment of replication fork progression mediates RNA polll transcription-associated recombination. Embo J 24, 1267-1276. Putter, v., and Grummt, R (2002). Transcription termination factor TTF-I exhibits contrahelicase activity during DNA replication. EMBO Rep 3, 147-152.

427'

Ratner, J. N., Balasubramanian, B., Corden, J., Warren, S. L., and Bregman, D. B. (1998). Ultraviolet radiation-induced ubiquitination and proteasomal degradation of the large subunit of RNA polymerase II. Implications for transcription-coupled DNA repair. J Biol Chem 273, 5184-5189. Rocha, E. P., and Danchin, A. (2003). Essentiality, not expressiveness, drives gene-strand bias in bacteria. Nat Genet 34, 311-31S,

Roth, R. B., Amin, S., Geacintov, N. E., and Scicchitano, D. A. (2001). Bacteriophage T7 RNA polymerase transcription elongation is inhibited by site-specific, stereospecific benzo[c]phenanthrene diol epoxide DNA lesions. Biochemistry 40,5200-5201. Samkurashvili, L, and Luse, D. S. (1996). Translocation and transcriptional arrest during transcript elongation by RNA polymerase II. J Biol Chem 277, 23495-23505. Schaeffer, L., Moncollin, V., Roy, R., Staub, A., Mezzina, M., Sarasin, A., Weeda, G., Hoeijmakers, J. H., and Egly, J. M. (1994). The ERCC2/DNA repair protein is associated with the class IIBTF2/TFIIH transcription factor. Embo J 13, 2388-2392. Schaeffer, L., Roy, R., Humbert, S., Moncollin, V., Vermeulen, W., Hoeijmakers, J. H., Chambon, R, and Egly, J. M. (1993). DNA repair helicase: a component of BTF2 (TFIIH) basic transcription factor. Science 260, 58-63. Scharer, O. D., and Jiricny, J. (2001). Recent progress in the biology, chemistry and structural biology of DNA glycosylases. Bioessays 23, 270-281. Schawalder, S. B., Kabani, M., Howald, I., Choudhury, U., Werner, M., and Shore, D. (2004). Growth-regulated recruitment of the essential yeast ribosomal protein gene activator Ifhl. Nature ^52, 1058-1061. Schinecker, T. M., Perlow, R. A., Broyde, S., Geacintov, N. E., and Scicchitano, D. A. (2003). Human RNA polymerase II is partially blocked by DNA adducts derived from tumorigenic benzo[c]phenanthrene diol epoxides: relating biological consequences to conformational preferences. Nucleic Acids Res 31, 6004-6015. Schubeler, D., Scalzo, D., Kooperberg, C , van Steensel, B., Delrow, J., and Groudine, M. (2002). Genome-wide DNA replication profile for Drosophila melanogaster. a link between transcription and replication timing. Nat Genet 32, 438-442. Selby,C P., and Sancar, A. (1997a). Cockayne syndrome group B protein enhances elongation by RNA polymerase II. Proc Natl Acad Sci USA 94, 11205-11209. Selby, C. P., and Sancar, A. (1997b). Human transcription-repair coupling factor CSB/ERCC6 is a DNA-stimulated ATPase but is not a helicase and does not disrupt the ternary transcription complex of stalled RNA polymerase II. J Biol Chem 272, 1885-1890. Sharma, V. M., Li, B., and Reese, J. C. (2003). SWI/SNFdependent chromatin remodeling of RNR3 requires TAF(II)s and the general transcription machinery. Genes Dev 77, 502-515.

'428 '

Section IV

Shi, Y. B., Gamper, H., and Hearst, J. E. (1988). Interaction of T7 RNA polymerase with DNA in an elongation complex arrested at a specific psoralen adduct site. J Biol Chem 263, 527-534. Shivji, M. K., Podust, V. N., Hubscher, U., and Wood, R. D. (1995). Nucleotide excision repair DNA synthesis by DNA polymerase epsilon in the presence of PCNA, RFC, and RPA. Biochemistry 34, 5011-5017. Sijbers, A. M., de Laat, W. L., Ariza, R. R., Biggerstaff, M., Wei, Y. R, Moggs, J. G., Carter, K. C , Shell, B. K., Evans, E., de Jong, M. C, et al (1996). Xeroderma pigmentosum group F caused by a defect in a structure-specific DNA repair endonuclease. Cell 86, 811-822. Smerdon, M. J., and Thoma, F. (1990). Site-specific DNA repair at the nucleosome level in a yeast minichromosome. Cell 61, 675-684. Smith, C. A., Baeten, J., and Taylor, J. S. (1998). The ability of a variety of polymerases to synthesize past site-specific cis-syn, trans-syn-II, (6-4), and Dewar photoproducts of thymidylyl-(3'->5')-thymidine. J Biol Chem 273, 21933-21940. Spivak, G. (2004). The many faces of Cockayne syndrome. Proc Natl Acad Sci USA 101, 15273-15274. Srivastava, D. K., Berg, B. J., Prasad, R., Molina, J. T., Beard, W A., Tomkinson, A. E., and Wilson, S. H. (1998). Mammalian abasic site base excision repair. Identification of the reaction sequence and rate-determining steps. J Biol Chem 273, 21203-21209. Sugasawa, K., Ng, J. M., Masutani, C , Iwai, S., van der Spek, P. J., Eker, A. P., Hanaoka, F., Bootsma, D., and Hoeijmakers, J. H. (1998). Xeroderma pigmentosum group C protein complex is the initiator of global genome nucleotide excision repair. Mol Cell 2, 223-232. Sung, R, Bailly, V., Weber, C , Thompson, L. H., Prakash, L., and Prakash, S. (1993). Human xeroderma pigmentosum group D gene encodes a DNA helicase. Nature 365, 852-855. Svejstrup, J. Q. (2002). Mechanisms of transcription-coupled DNA repair. Nat Rev Mol Cell Biol 3, 21-29. Svejstrup, J. Q. (2003). Rescue of arrested RNA polymerase II complexes. J Cell Sci 116, 447-451. Svejstrup, J. Q., Vichi, R, and Egly, J. M. (1996). The multiple roles of transcription/repair factor TFIIH. Trends Biochem Sci 21, 346-350. Sweder, K. S., and Hanawalt, R C. (1992). Preferential repair of cyclobutane pyrimidine dimers in the transcribed strand of a gene in yeast chromosomes and plasmids is dependent on transcription. Proc Natl Acad Sci USA 89, 10696-10700. Takeuchi, Y, Horiuchi, T., and Kobayashi, T. (2003). Transcription-dependent recombination and the role of fork colHsion in yeast rDNA. Genes Dev 77, 1497-1506. Tantin, D. (1998). RNA polymerase II elongation complexes containing the Cockayne syndrome group B protein interact with a molecular complex containing the transcription factor IIH components xeroderma pigmentosum B and p62. J Biol Chem

The Genome 273, 27794-27799. Tijsterman, M., Verhage, R. A., van de Putte, P., Tasseron-de Jong, J. G., and Brouwer, J. (1997). Transitions in the coupling of transcription and nucleotide excision repair within RNA polymerase Il-transcribed genes of Saccharomyces cerevisiae. Proc Natl Acad Sci USA 94, 8027-8032. Tomaletti, S., Donahue, B. A., Reines, D., and Hanawalt, P. C. (1997). Nucleotide sequence context effect of a cyclobutane pyrimidine dimer upon RNA polymerase II transcription. J Biol Chem 272, 31719-31724. Tomaletti, S., and Hanawalt, R C. (1999). Effect of DNA lesions on transcription elongation. Biochimie 81, 139-146. Tomaletti, S., Maeda, L. S., Lloyd, D. R., Reines, D., and Hanawalt, P. C. (2001). Effect of thymine glycol on transcription elongation by T7 RNA polymerase and mammalian RNA polymerase II. J Biol Chem 276, 45367-45371. Tomaletti, S., Patrick, S. M., Turchi, J. J., and Hanawak, P. C. (2003). Behavior of T7 RNA polymerase and mammalian RNA polymerase II at site-specific cisplatin adducts in the template DNA. J Biol Chem 278, 35791-35797. Tomaletti, S., Reines, D., and Hanawalt, R C. (1999). Stmctural characterization of RNA polymerase II complexes arrested by a cyclobutane pyrimidine dimer in the transcribed strand of template DNA. J Biol Chem 274, 24124-24130. Troelstra, C , van Gool, A., de Wit, J., Vermeulen, W, Bootsma, D., and Hoeijmakers, J. H. (1992). ERCC6, a member of a subfamily of putative helicases, is involved in Cockayne's syndrome and preferential repair of active genes. Cell 71, 939-953. Tu, Y, Bates, S., and Pfeifer, G. R (1997). Sequence-specific and domain-specific DNA repair in xeroderma pigmentosum and Cockayne syndrome cells. J Biol Chem 272, 20747-20755. van Gool, A. J., Citterio, E., Rademakers, S., van Os, R., Vermeulen, W, Constantinou, A., Egly, J. M., Bootsma, D., and Hoeijmakers, J. H. (1997). The Cockayne syndrome B protein, involved in transcription-coupled DNA repair, resides in an RNA polymerase Il-containing complex. Embo } 16, 5955-5965. van Gool, A. J., Verhage, R., Swagemakers, S. M., van de Putte, P., Brouwer, J., Troelstra, C , Bootsma, D., and Hoeijmakers, J. H. (1994). RAD26, the functional S. cerevisiae homolog of the Cockayne syndrome B gene ERCC6. Embo J 13, 5361-5369. Van Hoffen, A., Natarajan, A. T., Mayne, L. V, van Zeeland, A. A., Mullenders, L. H., and Venema, J. (1993). Deficient repair of the transcribed strand of active genes in Cockayne's syndrome cells. Nucleic Acids Res 21, 5890-5895. Venema, J., Mullenders, L. H., Natarajan, A. T., van Zeeland, A. A., and Mayne, L. V. (1990a). The genetic defect in Cockayne syndrome is associated with a defect in repair of UV-induced DNA damage in transcriptionally active DNA. Proc Natl Acad Sci USA 57, 4707-4711. Venema, J., van Hoffen, A., Natarajan, A. T., van Zeeland, A. A., and Mullenders, L. H. (1990b). The residual repair capacity of

Chapter 25

Transcription and Genomic Integrity

xeroderma pigmentosum complementation group C fibroblasts is highly specific for transcriptionally active DNA. Nucleic Acids Res 18, 443-448. Verhage, R. A., Van de Putte, R, and Brouwer, J. (1996). Repair of rDNA in Saccharomyces cerevisiae. RAD4-independent strand-specific nucleotide excision repair of RNA polymerase I transcribed genes. Nucleic Acids Res 24, 1020-1025. Volker, M., Mone, M. J., Karmakar, R, van Hoffen, A., Schul, W., Vermeulen, W., Hoeijmakers, J. H., van Driel, R., van Zeeland, A. A., and Mullenders, L. H. (2001). Sequential assembly of the nucleotide excision repair factors in vivo. Mol Cell 8, 213-224. Vos, J. M., and Wauthier, E. L. (1991). Differential introduction of DNA damage and repair in mammalian genes transcribed by RNA polymerases I and II. Mol Cell Biol 11, 2245-2252. Wade, J. T., Hall, D. B., and Struhl, K. (2004). The transcription factor Ifhl is a key regulator of yeast ribosomal protein genes. Nature ^52, 1054-1058. Wang, D., Meier, T. I., Chan, C. L., Feng, G., Lee, D. N., and Landick, R. (1995). Discontinuous movements of DNA and RNA in RNA polymerase accompany formation of a paused transcription complex. Cell 81, 341-350. Wang, Z., Svejstrup, J. Q., Feaver, W. J., Wu, X., Komberg, R. D., and Friedberg, E. C. (1994). Transcription factor b (TFIIH) is required during nucleotide-excision repair in yeast. Nature 368, 74-76. Weinert, T. A. (1992). Dual cell cycle checkpoints sensitive to chromosome replication and DNA damage in the budding yeast Saccharomyces cerevisiae. Radiat Res 132, 141-143. Weinert, T. A., Kiser, G. L., and Hartwell, L. H. (1994). Mitotic checkpoint genes in budding yeast and the dependence of mitosis on DNA replication and repair. Genes Dev 8, 652-665. Wind, M., and Reines, D. (2000). Transcription elongation factor SII. Bioessays 22, 327-336. Wood, R. D. (1999). DNA damage recognition during nucleotide excision repair in mammalian cells. Biochimie 81, 39-44. Woudstra, E. C , Gilbert, C , Fellows, J., Jansen, L., Brouwer, J., Erdjument-Bromage, H., Tempst, R, and Svejstrup, J. Q. (2002). A Rad26-Defl complex coordinates repair and RNA pol II proteolysis in response to DNA damage. Nature 415, 929-933. Xie, Z., and Price, D. H. (1996). Purification of an RNA polymerase II transcript release factor from Drosophila. J Biol Chem 277, 11043-11046.

429'

Xu, Z., and Norris, D. (1998). The SFPl gene product of Saccharomyces cerevisiae regulates G2/M transitions during the mitotic cell cycle and DNA-damage response. Genetics 150, 1419-1428. You, Z., Feaver, W. J., and Friedberg, E. C. (1998). Yeast RNA polymerase II transcription in vitro is inhibited in the presence of nucleotide excision repair: complementation of inhibition by Holo-TFIIH and requirement for RAD26. Mol Cell Biol 18, 2668-2676. Yu, A., Fan, H. Y, Liao, D., Bailey, A. D., and Weiner, A. M. (2000). Activation of p53 or loss of the Cockayne syndrome group B repair protein causes metaphase fragility of human Ul, U2, and 5S genes. Mol Cell 5, 801-810. Zhang, Z., and Reese, J. C. (2004a). Redundant mechanisms are used by Ssn6-Tupl in repressing chromosomal gene transcription in Saccharomyces cerevisiae. J Biol Chem 279, 39240-39250. Zhang, Z., and Reese, J. C. (2004b). Ssn6-Tupl requires the ISW2 complex to position nucleosomes in Saccharomyces cerevisiae. Embo J 23, 2246-2257. Zhao, J. (2004). Coordination of DNA synthesis and histone gene expression during normal cell cycle progression and after DNA damage. Cell Cycle 3, 695-697. Zhao, X., Muller, E. G., and Rothstein, R. (1998). A suppressor of two essential checkpoint genes identifies a novel protein that negatively affects dNTP pools [In Process Citation]. Mol Cell 2, 329-340. Zhao, X., and Rothstein, R. (2002). The Dunl checkpoint kinase phosphorylates and regulates the ribonucleotide reductase inhibitor Smll. Proc Natl Acad Sci USA 99, 3746-3751. Zheng, R, Fay, D. S., Burton, J., Xiao, H., Pinkham, J. L., and Stem, D. F. (1993). SPKl is an essential S-phase-specific gene of Saccharomyces cerevisiae that encodes a nuclear serine/threonine/tyrosine kinase. Mol Cell Biol 13, 5829-5842. Zhou, Z., and Elledge, S. J. (1992). Isolation of crt mutants constitutive for transcription of the DNA damage inducible gene RNR3 in Saccharomyces cerevisiae Genetics 131, 851-866. Zhou, Z., and Elledge, S. J. (1993). DUNl encodes a protein kinase that controls the DNA damage response in yeast. Cell 75, 1119-1127.

Chapter 26 Cell Death and Transcription Jianhua Zhang^ and Wei-Xing Zong^ ^Department of Pathology, 961 Sparks Center, 1530 3rd Ave S, University of Alabama at Birmingham, Birmingham, AL 35294-0017 ^Abramson Cancer Research Institute, University of Pennsylvania, BRB II/III, Room 445, 421 Curie Blvd, Philadelphia, PA 19104-6160

Key Words: transcription, cell death, Bcl-2, death receptor, caspase, p53, E2F, NF-KB, chromatin remodeling

Summary Cell death is required for development and tissue homeostasis of all multicellular organisms. Cell death regulation is highly dependent on cell types and the physiological, pharmacological and pathological stimuU and can take distinctive forms. One mechanism that is conserved from C. elegans to humans to ensure desired cell death and to avoid unwanted cell death is through transcriptional regulation of cell death genes. Transcription regulation may be conferred by specific transcription factors or at a global level by chromatin remodeling activities. Introduction All living organisms experience growth by multiplication of cell numbers and undergo renewal by replacing mutated, infected, damaged, excessive, old, or outdated cells. Normal development of multicellular organisms needs appropriate cell death to carve out hollow structures, to eliminate supernumerary cells, and to ensure useful cells to survive the growth and differentiation environment (Kerr et aL, 1972; Vaux and Korsmeyer, 1999; Kuan et al, 2000). Excessive cell death can lead to human diseases including neurodegeneration and immunodeficiency, whereas insufficient cell death can contribute to autoimmunity

and cancer (Thompson, 1995; Opferman and Korsmeyer, 2003; Okada and Mak, 2004). To ensure appropriate timing and extent of cell death in developing and mature organisms, the majority of cells die through intrinsically controlled programs that are largely conserved during evolution (Horvitz, 1999; Danial and Korsmeyer, 2004). Understanding regulation of programmed cell death in different developmental and cell type contexts, in response to different physiological, pharmacological and pathological stimuli is crucial for prevention, and management of human diseases. In C. elegans and in Drosophila, a prominent mechanism of cell death regulation is at the level of transcription. In higher organisms, significant pre- and post-transcriptional mechanisms add to the complexity of regulation of cell death. These include epigenetics, translation, protein modification, sequestration, and degradation. Extensive reviews exist that cover many of these aspects. This chapter examines how transcription and programmed cell death are coupled and discusses implications of current observations. Other related recent comments and reviews can be found in Tran et ah (2004), and Kumar and Cakouros (2004). Cell Death Pathways Cell death takes distinctive forms in response to different intracellular and extracellular signals. The most extensively studied form of programmed cell death is termed apoptosis, which typically refers to cell death with characteristic morphological changes including cell and nuclear shrinkage, chromatin condensation, and the formation of apoptotic bodies (Kerr, 1972; Vaux and

Corresponding Author: Jianhua Zhang, Tel: (205) 996-5153, Fax: (205) 934-6700, E-mail: [email protected]

Section IV

432

Korsmeyer, 1999). One of the biochemical hallmarks of apoptosis is the cleavage of chromosomal DNA into oligonucleosomal-sized fragments (Wyllie, 1980). The dying cells are phagocytosed by scavenger cells (Henson et aL, 2001). The genetic program of apoptosis is highly conserved from C. elegans to humans (Fig. 26.1) (Horvitz, 1999; Wang, 2001; Hay et al, 2004; Danial and Korsmeyer, 2004). In mammals, apoptosis is executed through two general molecular pathways. The intrinsic pathway involves the activation of multi-BH (Bcl-2 homology) domain proteins Bax and Bak, which results in the release of cytochrome c from the mitochondrial intermembrane space into the cytosol in response to a wide variety of death signals including growth factor deprivation and DNA damage (Lindsten et al., 2000; Wei et al, 2001; Adams and Cory, 2001; Wang, 2001; Danial and Korsmeyer, 2004). The translocation of cytochrome c triggers a cascade of reaction, beginning with the activation of the apoptosome that contains Apaf-1 and caspase-9, proceeding to the activation of downstream caspases that leads to the cleavage of proteins essential for normal cell fimction and survival (Li et aL, 1997; Zou et al, 1997; Wang, 2001). One of these proteins is DNA fragmentation factor 45 (DFF45, also called the inhibitor of caspase-activated DNase, or ICAD). Cleavage of DFF45 results in the activation of DFF40 (also called caspase-activated DNase or CAD) that degrades chromosomal DNA in a massive scale (Nagata, 2000; Zhang and Xu, 2002). In addition, several other apoptogenic factors such as Smac, apoptosis-inducing factor (AIF), and endonuclease G (endoG) also translocate from mitochondria into different subcellular compartments to facilitate apoptosis. The latter two are of particular interest as they may induce DNA fragmentation and cell death in a caspase-independent manner (Wang, 2001). Inhibitor of apoptosis (lAP) family proteins keep caspases in check

C.elegans: D.melanogaster:

EGL-I—|

CED-9

The Genome

by inhibition of their activities (Salvesen and Duckett, 2002). A second apoptosis pathway, the extrinsic pathway, is important for cell death regulation under many physiological conditions, especially during the development, homeostasis, and for the proper fiinction of the immune system. The extrinsic pathway involves interaction of death ligand molecules with their respective receptors on the cell surface, such as the binding of FasL to Fas or TNF to the TNF receptor. Ligand binding leads to the oligomerization of the death receptors, the formation of the Death-InducingSignaling Complex (DISC), and subsequently the activation of caspase-8 (Muzio et ai, 1996). Intracellular signal transduction such as the MAP kinase- and the NF-icB-mediated mechanisms play an important role in modulating the extrinsic cell death pathway (Baud and Karin, 2001; Deng et ai, 2003; Varfolomeev and Ashkenazi, 2004). The extrinsic apoptosis pathways are less well defined in C. elegans and Drosophila compared to mammals. The Bcl-2 family proteins play pivotal roles in regulating apoptosis. As Bcl-2 family proteins function primarily at mitochondria, they also coordinate the cross-talk of death signaling among intracellular compartments including the mitochondrion, the nucleus and the endoplasmic reticulum (Gross et ah, 1999; Adams and Cory, 2001; Zong et aL, 2003; Scorrano et al, 2003). In addition to its central role in mediating intrinsic cell death, the mitochondria-mediated pathway can also amplify death signals from the extrinsic pathway through a Bid-mediated mechanism (Li et aL, 1998; Luo et aL, 1998; Yin et al, 1999). Apoptosis in response to DNA damage is accompanied by an up-regulation of p53, followed by p53-mediated transcription of Puma, Noxa and Bax (Haupt et ai, 2003).

—| CEEM —^^ CED-3

\^^

Debcl/Bufify ~*r Dfflk —^ Dronc/Drice — • Apoptosis

Mammals: BH-3-only —| Bcl-2 femily T Apaf-1 — • Caspases

/

Fig.26.1 The conserved apoptosis machinery. Caspases are cmcial mediators of apoptosis in C. elegans, D. melanogaster as well as in mammals. Caspase (CED-3, Dronc/Drice) activation is promoted by adaptor molecules CED-4, Dark, or Apaf-1. Upstream Bcl-2 homologs (Debcl/Buffy, CED-9) regulate functions of Apaf-1. The Bcl-2 homologous proteins can be further divided into BH3-only proteins (EGL-1 in C elegans), as well as multi-domain pro- and anti-apoptotic proteins. The function of Drosophila Bcl-2 family members, Debcl and Buflfy, has not been firmly established in apoptosis regulation.

Chapter 26

Cell Death and Transcription

Protein cleavage and degradation are an imperative aspect of apoptosis. More than a dozen caspases mediate apoptosis by cleaving downstream molecules (Fischer et al, 2003). The activities of the lysosomal cysteine protease, cathepsins B, D, and L also contribute to the intrinsic apoptotic pathway (Guicciardi et al, 2000; Ferri and Kroemer, 2001; Jaattela and Tschopp, 2003; Guicciardi et al, 2004). Deficiencies and overabundances of these regulators and executioners of apoptosis can lead to various developmental abnormalities and tissue homeostasis phenotypes in mice and humans (Ranger e^ a/., 2001). Cells may die by alternative paths distinctive from the typical apoptotic route, depending on death stimuli, nutrient availability and whether the canonical apoptosis pathway are blocked at the levels of activation of Bax and Bak or caspases (Ferrari et al, 1998; Los et al, 2002; Schwab et al, 2002; Zong et al, 2004). In the shortage of ATP, or in response to profound pathological damage or physical insults, cells may commit to necrotic cell death characteristic of cell body swelling and cellular membrane ruptures (Zeiss, 2003; Proskuryakov et al, 2003; Nelson and White, 2004). Necrosis was thought to be solely a passive response to extracellular physical and chemical damage. Contrary to the conventional wisdom, recent work has found that necrosis can be regulated by not only extracellular signals but also intracellular signals. Understanding the regulation of necrosis is particularly relevant to cancer therapy, because most cancers have acquired mutations that confer resistance to apoptosis. Furthermore, the pro-inflammatory response triggered by necrosis may also elicit systemic reactions to cancer therapy and thereby contribute to cancer regression. Notably, because cancer cells are proliferating cells highly dependent on glycolysis to generate cellular energy, they are more susceptible to poly(ADP-ribose) polymerase (PARP)mediated NAD depletion, which leads to necrosis, in response to DNA-alkylating damage {Zonget al, 2004). When deprived of growth factors or nutrient source, or in response to certain cellular stress, eukaryotic cells may also start to form double membrane vesicles termed autophagosomes that enclose the excessive or damaged organelles and macromolecules. The autophagosomes fuse with lysosomes, and the enclosed intracellular materials are digested to provide the cell with energy and molecular components to sustain the minimal cellular function and survival. This "self-eating" process is termed autophagy. Although considered a cell survival mechanism under nutrient starvation and other stress, autophagy results in cell death under extensive self-digestion (Nelson and White, 2004; Levine and

433

KHonsky, 2004; Levine, 2005; Klionsky, 2005). Autophagic cell death appears to be coordinated with apoptotic cell death by the PI3K and mTOR pathways that sense nutrient availability (Shintani and Klionsky, 2004; Asnaghi et al, 2004). Transcription Factors in Regulating Invertebrate Cell Death In C elegans, developmental cell death involves an invariant number and preset lineage of cells. Of 1090 somatic cells generated through cell division in the entire lifespan of the hermaphrodites, 131 die through programmed cell death (Horvitz, 1999). The neurosecretory motor neuron (NSM) sister cells undergo lineage-invariant developmental cell death. In NSM sister cell death, the expression of EGL-1, the homolog of the mammalian BH3-only proteins, is regulated at the level of transcription by coordinated functions of CES-1, CES-2, HLH-2 and HLH3 (Thellmann et al, 2003). EGL-1 can also be regulated by transcription factor TRA-1 to mediate death of hermaphrodite-specific neurons (HSNs) in the males (Conradt and Horvitz, 1999). Genotoxic stress induces EGL-1 expression to regulate germline cell death in a manner that is dependent on CEP-1, a p53 homolog (Hofmann et al, 2002). Other transcription factors may also regulate programmed cell death in C. elegans. For example, PAG-3 mutation results in extra cell corpses due to reiterated neuroblast cell death. However, the target genes and the mechanisms of how PAG-3 influences cell death are unknown (Cameron et al, 2002). Additionally, the EOR-1 putative transcription factor may be involved in chromatin remodeling and influence cell death (Hoeppner et al, 2004). Over all, many of the decisions of programmed cell death can be regulated at the level of transcription in C elegans (Fig.26.2). In Drosophila, one key point of apoptosis regulation is at the transcription level for Reaper, Hid, Grim (RHG) family of pro-apoptotic proteins that also include Sickle and JAFRAC2. Up-regulation of RHG proteins can initiate apoptosis by disrupting the inhibition of caspase activities (Dronc/Drice) by the inhibitors of apoptosis (DIAP) (Fig. 26.3) (Bergmann^^ a/., 1998; Hay et aL, 2004). During development, the steroid ecdysone induces a two-step cell death program in the larval midgut and the salivary gland (Thummel, 1996; Baehrecke, 2000). Ecdysone can bind to the EcR and Usp {ultraspiracle, a RXR homolog) heterodimeric receptor and transcriptionally regulate the expression of Broad-Complex (BR-C), E74 and D75. BR-C (a zinc

434

Section IV

finger transcription factor), E74 (an ETS-like transcription factor) and E75 (an orphan nuclear receptor transcription factor) can then regulate Reaper, Hid, Dark, and Drone expression to modulate the hormone-induced developmental cell death (Fig. 26.3) (Hall and Thummel, 1998; Jiang et ai, 2000; Lee et al., 2000; Lee et al., 2002; Cakouros et al, 2002; Kilpatrick et a/., 2005). Other transcription factors, such as dfos, can modulate the induction of Reaper and Hid to ensure the proper timing of larval salivary gland cell death (Lehmann et al, 2002). To maintain maxillary and mandibular segment boundaries, transcriptional activation

The Genome

of Reaper by the Hox gene, Deformed (Dfd), occurs to ensure the location-specific cell death (Lohmann et al., 2002). Abdominal segment boundary cell death is stimulated by transcriptional activation of Reaper by the Hox gene, Abdominal B (Abd-B) (Lohmann et ai, 2002). Recent findings suggest that Abd-B also has an anti-apoptotic role in preventing pioneer neuronal cell death in posterior segments by repressing Reaper and Grim expression (Miguel-Aliaga and Thor, 2004). Abdominal A (Abd-A) is important for neuroblast cell death, although which of the RHG genes is regulated by

NSM sister cells

CES-2HCES-2—|JLJ];3

\

HSN neurons in hermaphrodites ^ TRA-1—I EGL-1 —I CED-9 — | CED-4 -*- CED-3 — • apoptosis Germline cells in response to DNA damage CEP-1 Fig.26.2 Decisions of programmed cell death can be regulated at the level of transcription in C elegans. In neurosecretory motor neuron (NSM) sister cells, EGL-1 expression is regulated at the level of transcription by coordinate functions of transcription factor CES-1, CES-2, HLH-2 and HLH3. In hermaphrodite-specific neurons (HSNs) in the males, EGL-1 can be regulated by transcription factor TRA-1 to mediate HSN cell death. During germline cell death in response to DNA damage, EGL-1 expression is regulated by a p53 homolog, CEP-1. Transcription regulation of apoptotic genes is indicated by red lines. Transcription factors are in green. Cell death genes that are regulated at the level of transcription are in orange. Boundary of abdominal segment Abd-B

Pioneer neuron death Abd-B

Neuroblasts Abd-A

Maintenance of maxillary and mandibular boundaries Dfd

Ecdysone triggered cell death EcR/Usp Broad-compiex,E74A,E93 Dfos Debcl/Buffy

DNA damage p53

- • Dark -^-Drone Dnce-

apoptosis

Fig.26.3 Transcriptional regulation of apoptosis in D. melanogaster. In Drosophila, a key point of apoptosis regulation is mediated at the transcriptional level for RHG family of pro-apoptotic proteins: Reaper, Hid, Grim, Sickle and JAFRAC2. Up-regulation of RHG proteins disrupts the inhibition of caspases (Dronc/Drice) by DIAR The ecdysone-induced larval midgut and salivary gland cell death is mediated by EcR/Usp heterodimeric transcription factor and downstream transcription factors, BR-C, E74 and D75. dfos modulates the proper timing of larval salivary gland cell death via regulation of Reaper and Hid expression. Cell death in maxillary and mandibular segment boundaries is controlled by transcriptional activation of Reaper by Dfd. Cell death in abdominal segment boundaries is controlled by transcriptional activation of Reaper by Abd-B. Abd-B also has an anti-apoptotic role in preventing pioneer neuron cell death in posterior segments by repressing Reaper and Grim expression. Abd-A is important for neuroblast cell death, although which of the RHG gene is regulated by Abd-A is currently unclear. Midline glia cell death is controlled by Hid through a RAS-MAPK-dependent mechanism. DNA damage caused by y-irradiation is mediated by up-regulation of Reaper, Hid, Sickle via a p53-dependent pathway, whereas UV induced Dark expression is dependent on E2F. Transcription regulation of apoptotic genes is indicated by red lines. Transcription factors are in green. Cell death genes that are regulated at the level of transcription are in orange.

Chapter 26

Cell Death and Transcription

Abd-A is currently unclear (Bello et al, 2003). Hid regulation, either transcriptionally or post-translationally by the RAS-MAPK pathway, is important in initiating midline glia cell death (Bergmann et al, 1998; Kurada and White, 1998; Bergmann et al, 2002). Furthermore, dMyc-induced cell competition and neighboring cell death is associated with Hid mRNA up-regulation (de la Cova et al, 2004; Moreno and Basler, 2004). Interestingly, DNA damage caused by y-irradiation induces cell death by up-regulating Reaper, Hid, Sickle via a p53-dependent pathway (Sogame et a/., 2003; Brodsky et a/., 2004), whereas UV-induced Dark expression is dependent on E2F (Zhou and Steller, 2003). Transcriptional Regulation of Cell Death in Mammals A: Transcriptional Regulation of the Core Components of the Apoptosis Machinery Transcriptional regulation of the core components of the apoptosis machinery also provides an important mechanism for controlling cell death in mammals. Transcriptional regulation of Bcl-2 family proteins is a conserved mechanism from C elegans to humans. As discussed above, Bcl-2 family proteins play an important role in regulating mitochondrial membrane permeabilization, the initiation of apoptosis from

435

multiple intracellular compartments, as well as the cross-talk from the extrinsic to the intrinsic apoptotic pathways. Three classes of Bcl-2 family proteins exist. One class is the pro-apoptotic BH3-only proteins that are homologs of C elegans protein EGL-1. This class includes Bad, Bik/Nbk, Bim/Bok, Bmf, Bnip3/Nix, Noxa, Puma, and Bid that act upstream of the multi-BH domain proteins. The second class includes proapoptotic "BH1-3-multi-domain" proteins, such as Bax, Bak, and Bok. The third class includes anti-apoptotic BHl-4-multi-domain proteins such as Bcl-xL, Bcl-w, Bcl-2, Mcl-l, Al/Bfl-1, and Boo/Diva (Adams and Cory, 2001; Danial and Korsmeyer, 2004). Correlating with their crucial roles in regulating cell death and survival, the expression of the Bcl-2 family proteins is controlled by multiple factors at multiple levels and fluctuates under different developmental, differentiation and environmental contexts (Fig.26.4) (Mayo et aL, 1999; Margue et al, 2000; Ha et al, 2001; Sevilla et al, 2001; Russell et al, 2002; Heckman et al, 2003; Vickers et al., 2004; Soleymanlou et aL, 2005; Meller et al., 2005). Dysregulated or unbalanced expression of pro-and anti-apoptotic Bcl-2 family proteins has been noted in many human diseases including cancers (Coultas and Strasser, 2003; Shacka and Roth, 2005).

— methylation Icytoskeleton

Ets2 PAX3 TEL E2F1

CREBI C/EBPJ

-*- neuronal cell death signals

NF-KB*

NF-KB-dependent enhanceosome proteasome

h-HIF-lg — methylation ovary-specific anti-apoptotic

uncontrolled growth

reproductive tissue-specific factors oxidative stress, serum starvation pro-apoptotic

homeostasis

tissue degeneration

Fig.26.4 Regulation of Bcl-2 family proteins in mammals. The relative expression levels of the Bcl-2 family proteins determine the balance between cell death and survival. Three classes of Bcl-2 family proteins exist. One class is the pro-apoptotic BH3-only proteins that are homologs of C elegans protein EGL-1. This class includes: Bim/Bok, Bmf, Bad, Bik/Nbk, Bid, Noxa, Puma, and Bnip3/Nix. The second class includes pro-apoptotic BH1-BH3-domain-containing proteins, such as Bax, Bak and Bok. The third class includes anti-apoptotic multi-BH domain proteins such as Bcl-xL, Bcl-w, Bcl-2, Mcl-l, Al/Bfl-1 and Boo/Diva. Bid, Puma, Noxa, Bax are direct p53 targets, whereas the expression of anti-apoptotic Bcl-2 gene is inhibited by p53. Bcl-xl, Bcl-w, Bcl-2 and Al/Bfl-1 are regulated by NF-KB. Mcl-l, pro-apoptotic Bim, DPS, Noxa and Puma are regulated by E2F-1. HIE-la regulates the expression of Noxa, Bid, Bnip3/Nix and NF-KB. Methylation and histone acetylation also regulate the expression of some of the Bcl-2 family genes. Additional levels of regulation are provided by phosphorylation for Bad and Bik, and by sequestration to cytoskeletal structures for Bim and Bmf. Mcl-l is regulated by proteasome-mediated degradation in response to UV.

436

Section IV

Of particular interest, transcription factors p53 plays an important role in regulating the expression of a number of Bcl-2 family proteins. The pro-apoptotic BH3-only members Bid, Puma and Noxa, and the pro-apoptotic BHl-3 protein Bax, are direct p53 transactivation targets, whereas the expression of the anti-apoptotic Bcl-2 protein is inhibited by p53 (Fig. 26.4) (Puthalakath and Strasser, 2002; Koutsodontis and Kardassis, 2004; Gu et al, 2004; Schuler and Green, 2005). The altered expression of these proteins correlates with p53-mediated cell death in response to DNA damage. As transcriptional control of Bcl-2 family genes by p53 is of requisite importance in determining cell fate, caution needs to be made in interpreting experimental results demonstrating cell death regulation through p53 activation, because an alternative route of p53 function may be through transcription-independent, mitochondrial translocation-dependent mechanisms (Marchenko et al., 2002; Mihara et al, 2003; Erster et aL, 2004; Leu et al, 2004; Chipuk et al, 2004). Transcriptional regulation of Bcl-2 family proteins can couple with several other signaling pathways. The expression of several anti-apoptotic Bcl-2 family members, such as Bcl-xL, Bcl-w, Bcl-2 and Al/Bfl-1, is regulated by NF-KB transcription factors, correlating with the cell survival-promoting activity of NF-KB (Zong et al., 1999; Lee et al, 1999; Grumont et al, 1999; Chen et al, 2000; Kurland et al, 2001; Varfolomeev and Ashkenazi, 2004; Tran et al, 2005). In response to hypoxia conditions, such as neurons and cardiomyocytes in cerebral and myocardial ischemia, cells in the center of solid tumors, and neutrophils exiting from the circulatory system to combat inflammation, hypoxia-inducible factor a (HIF-la) regulates the expression of Bnip3/Nix (Bruick, 2000; Sowter et al, 2001), Noxa (Kim et al, 2004), Bid (Erler et aU 2004) and NF-KB (Walmsley et al, 2005), thereby modulating cell survival and cell death. Cancer cells acquire dysregulated cell cycle regulation to sustain their abnormal proliferation. The transcription factors controlling cell cycle may be involved in the regulation of apoptosis. The expression of anti-apoptotic Bcl-2 is positively regulated by the retinoblastoma protein (Rb) (Decary et al, 2002). The expression of the anti-apoptotic Mcl-l is repressed, and that of the pro-apoptotic Bim, DP5, Noxa, and Puma is up-regulated by E2F-1 respectively (Croxton et al, 2002; Hershko and Ginsberg, 2004). Because the Rb-E2F pathway monitors normal cell cycle progression, as well as cell proliferation in response to DNA damage by regulating genes involved in cell cycle and DNA replication, the ability for Rb and E2F to

The Genome

regulate apoptotic gene expression enables a coordination of cell cycle and apoptosis control. The up-regulation of pro-apoptotic proteins by E2F may render the fast cycling cancer cells lower threshold in tolerating apoptosis and therefore the susceptibility to chemotherapeutic treatments. Transcriptional regulation also affects the expression of apoptotic factors in the extrinsic death pathway in mammals. The expression of the Fas ligand in the immune system is regulated by a large number of transcription factors, including AP-1, NF-KB, Egr, and NF-AT (Li-Weber and Krammer, 2003). The expression of Fas is regulated by p53, c-Jun and Stat3 (Owen-Schaub et aL, 1995; Ivanov et ai, 2001). The expression of the TNF receptor associated factor (TRAF), is regulated by NF-KB (Poppelmann et aL, 2005). The expression of caspase-8 inhibitor FLIP is regulated by F0X03a, NF-KB, and c-Myc (Micheau et al, 2001; Gerondakis S, Strasser A, 2003; Skurt et al, 2004; Ricci et al, 2004). TRAIL receptor DR5, as well as caspase-8 are also regulated by p53 (Owen-Schaub et ai, 1995; Wu et al, 1997; Haupt et aL, 2003; Schuler and Green, 2005). Other key components of the apoptosis pathway subject to transcriptional control include Apaf-1, caspases and inhibitors of apoptosis (lAPs). Apaf-1 and caspase-6 are activated, whereas an lAP family member, survivin, is repressed by p53 and may contribute to p53-mediated apoptosis in response to DNA damage (Moroni et al, 2001; MacLachlan and El-Deiry, 2002; Hoffman et aL, 2002; Shishodia and Aggarwal, 2004). Apaf-1 and caspases 3,7,8,9 are regulated by E2F, and thereby providing a mechanism for coupling cell proliferation to sensitization to apoptosis (Moroni et aL, 2001; Nahle et al 2002). Appropriate coupling of S phase entry and cell death sensitization may be crucial for limiting the transforming potential of oncogene activation or tumor suppressor gene inactivation, as well as sensing and responding to DNA damage (Evan and Vousden, 2001; Lin and Lowe, 2001; Nahle et al 2002; Stevens et al, 2003). lAP family proteins, c-IAPl and C-IAP2, are activated by NF-KB and may facilitate the protective role of NF-KB against TNF-a-induced apoptosis (Chu et al, 1997; Wang et al, 1998). B: Transcriptional Regulation of Cell Death by Chromatin Remodeling From the fruitful investigation of the transcription mechanisms in eukaryotes, it became clear that transcription is regulated by co-activators, co-repressors, histone modification enzymes, as well as by sequencespecific transcription factors. These mechanisms turn

Chapter 26

Cell Death and Transcription

et ai, 1983; Chiarugi, 2002). PolyADP-ribose polymerase-1 (PARP-1), the enzyme that catalyzes polyADP-ribosylation of histones and other chromatin binding proteins involved in DNA repair and transcriptional regulation, is activated in response to DNA damage and has been demonstrated to be involved in the regulation of both apoptosis and necrosis (Berger, 1985; Wang et al. 1997; Ha and Snyder 1999; Yu et al 2002; Chiaguri, 2002; Zong et al, 2004). PARP-1 is also a critical regulator of N F - K B activity, and is involved in cell death mediated by AIF (D'Amours ^^ a/., 1999, Oliver et al, 1999; Yu et al, 2002).

out to also play important roles in regulating cell death (Fig.26.5). First, histone phosphorylation and histone export from the nucleus may have significant impact on transcription as well as serve as signals for cell death induction (Konishi et al, 2003; Femandez-Capetillo et al, 2004; Ahn et al, 2005). Second, histone acetylation and deacetylation affect condensation of nucleosome structure, and histone acetylase and histone deacetylases can act as transcriptional coactivators and corepressors (Grunstein, 1997; Gregory et al, 2001). Inhibition of histone deacetylase induces cell death by regulating gene expression in multiple cell death pathways. To take advantage of these findings, inhibitors of histone deacetylase are being developed as potential cancer therapeutic agents (Peart et aL, 2005; Duan et ai, 2005). Third, transcription of a number of genes involved in apoptosis, such as Bad, Bak, Bik, and Bax are suppressed by DNA methylation (Pompeia et ai, 2004). Epigenetic silencing of apoptotic gene transcription may contribute to chemoresistance of cancer cells. Chromatin remodeling and transcriptional regulation by co-activators or co-repressors play a crucial role in cell death regulated by p53 and N F - K B (Lill et ai, 1997; Thomas and White, 1998; Yamit-Hezi and Dikstein, 1998; Shikama et al, 1999; Yamit-Hezi et al, 2000; Mujtaba et al, 2004; Banerjee et aL, 2004; Hoberg et ai, 2004). DNA damage-induced transcription blockade and subsequent pausing of RNA polymerase II may play a causative role to p53 modification, loss of nuclear export of RNA, and preferential inhibition of transcription of survival genes that coincidently have large gene sizes (Ljungman and Lane, 2004). Global transcription can be modulated by chromatin condensation or histone polyADP- ribosylation (Slattery Histone acetylation

'437

C: Are Necrosis and Autophagy Regulated at the Transcription Level? Transcription regulation of necrotic and autophagic cell death is not well studied. Nonetheless, many of the players involved in apoptotic regulation also participate in necrotic cell death, including TNF receptor family, Bcl-2 family, caspases, MAPK and JNK pathways, and PARP (Proskuryakov et al, 2003). The transcription regulation of these molecules will predictably influence the susceptibility of necrotic cell death. In addition, factors that are specifically involved in necrotic cell death, such as glutamate receptors in neurons, calcium binding proteins in a variety of cell types, components of the mitochondrial respiratory chain, and necrosisspecific DNases, may be regulated at the transcription level (Proskuryakov et al, 2003). Future work is necessary to establish the role of transcription in regulating necrosis. Autophagy is concurrently regulated with apoptosis, transcription, translation and posttranslational protein modification by Akt- and mTOR-mediated signaling

Histone and DNA methylation

Histone Histone and HMG phosphorylation polyADP-ribosylation

State of the chromatin

General transcription Transcription of cell death genes Bcl-2, Bax etc. Cell death Fig.26.5 Chromatin remodeling influences global and cell death-specific gene transcription. Chromatin structure can be affected by histone acetylation, histone phosphorylation, DNA methylation as well as histone polyADP-ribosylation. Chromatin structure and other RNA polymerase II coactivators and corepressors can influence transcription of genes that play important roles in cell death.

'438

Section IV

pathways in response to nutrient deprivation (Datta et al., 1999; Cardenas et aL, 1999; Chan et al, 2001; Vivanco and Sawyers, 2002; Baehrecke, 2003; Rohde and Cardenas, 2003; Rohde et al, 2004; Hay and Sonenberg, 2004). Akt regulates apoptosis through phosphorylation of factors involved in transcriptional regulation such as Foxo, IKKs, and p53 (Vivanco and Sawyers, 2002). mTOR modulates transcription of rRNA by RNA Pol I, transcription of ribosomal protein by RNA Pol II, and transcription of tRNA and 5S RNA by RNA Pol III (Tsang et al, 2003; Hay and Sonenberg, 2004). How these transcription events play a role in regulating autophagic cell death needs further investigation. Unresolved Issues Understanding of cell type-specific and stimulusspecific regulation of transcription of various apoptotic factors is still incomplete. Even more so are the epigenetic and biochemical mechanisms of transcription activities on promoters of the apoptotic factors. Although many studies demonstrate a concerted activation of pro- apoptotic genes with inhibition of anti-apoptotic genes, examples do exist when pro- and anti-apoptotic genes are activated at the same time. Conceivably, at the apical point of any death initiation process, two dividing forces are provoked into action, to fight for life or to give it up for good. Complete transcription shutdown may speed up the death process. Prolonged caspase activation results in degradation of many factors influencing transcription, thereby playing a role in shutting down transcription in anticipation of death (Fischer et al, 2003). However, transient activation of caspase-3 without DNA fragmentation results in cell survival as evidenced in ischemic pre-conditioning in neurons, perhaps by preserving DNA integrity and transcription (Tanaka et al, 2004). The ultimate cell fate obviously depends on the tug-of-war between the two competing forces. Although at the completion of cell death, DNA is destroyed to eliminate any new RNA synthesis, it remains unclear whether any concurrent transcription activity continues during DNA fragmentation. Gene expression by de novo mRNA synthesis can serve as the first line of defense in determining cell death and survival. Still, post-transcriptional regulatory strategies supply speedy response to death stimuli in many occasions (Clemens et aL, 2000; Salvesen and Duckett, 2002; Fischer et aL, 2003; Tran et aL, 2004; Holcik and Sonenberg, 2005; Vaux and Silke, 2005). Whether and how transcriptional regulation of cell

The Genome

death coordinates with post-transcriptional mechanisms is still unclear. Concluding Remarks Cell death is a highly regulated biological process. Transcriptional control of specific cell death factors is an evolutionarily conserved mechanism observed in different cell types in distant species. Transcriptional regulation of certain cell death/survival factors is a prerequisite in many death-associated situations. In addition to transcriptional control of the core cell death factors, global modulation of transcription also contributes to whether, when, and how cells die. Global transcription levels seem to be reduced by chromatin modification such as histone acetylation, methylation, phosphorylation, ubiquitination, or polyADP-ribosylation, while at the same time specific cell death factors are synthesized. Disjointed cell death and transcription regulation may contribute to developmental, proliferative, and degenerative diseases, such as tumorigenesis, acute, and chronic neurodegeneration, and immunological diseases (Fridman and Lowe, 2003; Kucharczak et aL, 2003; Shacka and Roth, 2005). Delivery of transcription factors such as p53, and use of inhibitors of histone deacetylation, targeting NF-KB, E2F-1 or PARP to treat cancer or neurodegeneration, are being investigated (Virag and Szabo, 2002; Fang and Roth, 2003; Lin and Karin, 2003; Wang et aL, 2003; Marks et aL, 2004; Bell and Ryan, 2005; Fischer and Schulze-Osthoff, 2005). These strategies target multiple downstream cell death pathways to switch on or off cell death, therefore may help overcome the limitation of single target therapeutic strategies that may not be effective in cells defective in certain cell death pathways. Challenges remain to understand the sophistication and impact of coupling regulation of transcription and cell death, and to devise effective strategies to treat diseases. Acknowledgment We thank Drs. Jun Ma, Johanna Meij, and Xiao-Ming Yin for discussions and critical reading of this chapter. J.Z. is supported by NIH, DOD, Lupus Research Institute, Epilepsy Foundation, Ohio ACS, University of Cincinnati Dean's Discovery Fund, and University of Cincinnati Center for Environmental Genetics. W.X.Z. is supported by the Leukemia and Lymphoma Society.

Chapter 26

Cell Death and Transcription

References Adams, J.M., and Cory, S. (2001). Life-or-death decisions by the Bcl-2 protein family. Trends Biochem Sci 26, 61-66. Ahn, S.H., Cheung, W.L., Hsu, J.Y., Diaz, R.L., Smith, M.M., and AUis, CD. (2005). Sterile 20 kinase phosphorylates histone H2B at serine 10 during hydrogen peroxide-induced apoptosis in S. cerevisiae. Cell 120, 25-36. Baehrecke, E. H. (2000). Steroid regulation of programmed cell death during Drosophila development. Cell Death Differ 7, 1057 -1062. Baehrecke, E.H. (2003). Autophagic programmed cell death in Drosophila. Cell Death Differ 10, 940-945. Banerjee, S., Kumar, B.R., and Kundu, T.K. (2004). General transcriptional coactivator PC4 activates p53 function. Mol Cell Biol 24, 2052-2062. Baud, v., and Karin, M. (2001). Signal transduction by tumor necrosis factor and its relatives. Trends Cell Biol 77, 372-327. Bell, H.S., and Ryan, K.M. (2005). Intracellular signalling and cancer: complex pathways lead to multiple targets. Eur J Cancer ^7,206-215. Bello, B.C., Hirth, R, and Gould, A.R (2003). A pulse of the Drosophila Hox protein Abdominal-A schedules the end of neural proliferation via neuroblast apoptosis. Neuron 37, 209-219. Berger, N.A. (1985). Poly(ADP-ribose) in the cellular response to DNA damage. Radiat Res 101, 4-15. Bergmann, A., Agapite, J., McCall, K.A., and Steller, H. (1998). The Drosophila gene hid is a direct molecular target of Ras-dependent survival signaling. Cell 95, 331-341. Bergmann, A., Tugentman, M., Shilo, B.Z., and Steller, H. (2002). Regulation of cell number by MAPK-dependent control of apoptosis: a mechanism for trophic survival signaling. Dev Cell 2, 159-170. Brodsky, M.H., Weinert, B.T., Tsang, G., Rong, Y.S., McGinnis, N.M., Golic, K.G., Rio, D.C., and Rubin, G.M. (2004) .Drosophila melanogaster MNK/Chk2 and p53 regulate multiple DNA repair and apoptotic pathways following DNA damage. Mol Cell Biol 2^, 1219-1231. Bruick, R.K. (2000). Expression of the gene encoding the proapoptotic Nip3 protein is induced by hypoxia. PNAS 97, 9082-9087. Cakouros, D., Daish, T., Martin, D., Baehrecke, E.H., and Kumar, S. (2002). Ecdysone-induced expression of the caspase DRONC during hormone-dependent programmed cell death in Drosophila is regulated by Broad-Complex. J Cell Biol 757, 985-995. Cameron, S., Clark, S.G., McDermott, J.B., Aamodt, E., and Horvitz, H.R. (2002). PAG-3, a Zn-fmger transcription factor, determines neuroblast fate in C. elegans. Development 129, 1763-1774. Cardenas, M.E., Cutler, N.S., Lorenz, M.C., Di Como, C.J., and

439

Heitman, J. (1999). The TOR signaling cascade regulates gene expression in response to nutrients. Genes Dev 13, 3271-3279. Chan, T.R, Bertram, RG., Ai, W., and Zheng, X.R (2001). Regulation of APG14 expression by the GATA-type transcription factor Gln3p. J Biol Chem 276, 6463-6467. Chen, C , Edelstein, L.C., and Gelinas, C. (2000). The Rel/NF-kappa B family directly activates expression of the apoptosis inhibitor Bcl-xL. Mol Cell Biol 20, 2687-2695. Chiarugi, A. (2002). Poly(ADP-ribose) polymerase: killer or conspirator? The 'suicide hypothesis' revisited. Trends Pharmacol Sci 23, 122-129. Chipuk, J.E., Kuwana, T., Bouchier-Hayes, L., Droin, N.M., Newmeyer, D.D., Schuler, M., and Green, D.R. (2004). Direct activation of Bax by p53 mediates mitochondrial membrane permeabilization and apoptosis. Science 303, 1010-1014. Chu, Z.L., McKinsey, T.A., Liu, L., Gentry, J.J., MaHm, M.H., and Ballard, D.W. (1997). Suppression of tumor necrosis factor-induced cell death by inhibitor of apoptosis C-IAP2 is under NF-kappaB control. PNAS 94, 10057-10062. Clemens, M.J., Bushell, M^., Jeffrey, I.W., Pain, V.M., and Morley, S.J. (2000). Translation initiation factor modifications and the regulation of protein synthesis in apoptotic cells. Cell Death Differ 7, 603-615. Conradt, B., and Horvitz, H.R. (1999). The TRA-IA sex determination protein of C. elegans regulates sexually dimorphic cell deaths by repressing the egl-1 cell death activator gene. Cell 98,317-321. Coultas, L., and Strasser, A. (2003). The role of the Bcl-2 protein family in cancer. Semin Cancer Biol 13, 115-123. Croxton, R., Ma, Y., Song, L., Haura, E.B., and Cress, W.D. (2002). Direct repression of the Mcl-l promoter by E2F1. Oncogene 27, 1359-1369. D'Amours, D., Desnoyers, S., D'Silva, I., and Poirier, G.G. (1999). Poly(ADP-ribosyl)ation reactions in the regulation of nuclear functions. Biochem J 342, 249-268. Danial, N.N., and Korsmeyer, S.J. (2004). Cell Death: Critical Control Points. Cell 77 6, 205-219. Datta, S.R., Brunet, A., and Greenberg, M.E. (1999). Cellular survival: a play in three Akts. Genes Dev 13, 2905-2927. de la Cova, C , Abril, M., Bellosta, P., Gallant, P., and Johnston, L. (2004). Drosophila myc regulates organ size by inducing cell competition. Cell 777, 107-116. Decary, S., Decesse, J.T., Ogryzko, V., Reed, J.C, Naguibneva, I., Harel-Bellan, A., and Cremisi, C.E. (2002). The retinoblastoma protein binds the promoter of the survival gene bcl-2 and regulates its transcription in epithelial cells through transcription factor AP-2. Mol Cell Biol 22, 7877-7888. Deng, Y, Ren, X., Yang, L., Lin, Y, and Wu, X. (2003). A JNK-dependent pathway is required for TNFa-induced apoptosis. Cell 775,61-70. Duan, H., Heckman, C.A., and Boxer, L.M. (2005). Histone deacetylase inhibitors down-regulate bcl-2 expression and induce

440"

Section IV

apoptosis in t(14;18) lymphomas. Mol Cell Biol 25, 1608-1619. Erler, J.T., Cawthome, C.J., Williams, K.J., Koritzinsky, M., Wouters, B.G., Wilson, C , Miller, C , Demonacos, C , Stratford, I.J., and Dive, C. (2004). Hypoxia-mediated down-regulation of Bid and Bax in tumors occurs via Hypoxia-Inducible Factor 1-dependent and -independent mechanisms and contributes to drug resistance. Mol Cell Biol 24, 2875-2889. Erster, S., Mihara, M., Kim, R.H., Petrenko, O., and Moll, U.M. (2004). In vivo mitochondrial p53 translocation triggers a rapid first wave of cell death in response to DNA damage that can precede p53 target gene activation. Mol Cell Biol 24, 6728-6741. Evan, G.I., and Vousden, K.H. (2001). Proliferation, cell cycle and apoptosis in cancer. Nature 411, 342-348. Fang, B., and Roth, J.A. (2003). Tumor-suppressing gene therapy. Cancer Biol Ther (4 Suppl 1), S115 -121. Femandez-Capetillo, O., Allis, CD., and Nussenzweig, A. (2004). Phosphorylation of histone H2B at DNA double-strand breaks. J Exp Med 199, 1671-1677. Ferrari, D., Stepczynska, A., Los, M., Wesselborg, S., and Schulze-Osthofif, K. (1998). Differential regulation and ATP requirement for caspase-8 and caspase-3 activation during CD95and anticancer drug-induced apoptosis. J Exp Med 188, 979-984. Ferri, K.F., and Kroemer, G. (2001). Organelle-specific initiation of cell death pathways. Nat Cell Biol 3, E255-263. Fischer, U., Janicke, R.U., and Schulze-OsthofF, K. (2003). Many cuts to ruin: a comprehensive update of caspase substrates. Cell Death Differ 7 (?, 76-100. Fischer, U., and Schulze-Osthoff, K. (2005). Apoptosis-based therapies and drug targets. In press. Fridman, J.S., and Lowe, S.W. (2003). Control of apoptosis by p53. Oncogene 22, 9030-9040. Gerondakis, S., and Strasser, A. (2003). The role of Rel/NF-kappaB transcription factors in B lymphocyte survival. Semin Immunol 15, 159-166. Gregory, RD., Wagner, K., and W. Horz. (2001). Histone acetylation and chromatin remodeling. Exp Cell Res 265, 195-202. Gross, A., McDonnell, J.M., and Korsmeyer, S.J. (1999). BCL-2 family members and the mitochondria in apoptosis. Genes Dev 13, 1899-1911. Grumont, R.J., Rourke, I.J., and Gerondakis, S. (1999). Rel-dependent induction of Al transcription is required to protect B cells from antigen receptor ligation-induced apoptosis. Genes Dev 73,400-411. Grunstein, M. (1997). Histone acetylation in chromatin structure and transcription. Nature 389, 349-352. Gu, J., Zhang, L., Swisher, S.G., Liu, J., Roth, J.A., and Fang, B. (2004). Induction of p53-regulated genes in lung cancer cells: implications of the mechanism for adenoviral p53-mediated apoptosis. Oncogene 23, 1300-1307. Guicciardi, M.E., Deussing, J., Miyoshi, H., Bronk, S.F., Svingen, RA., Peters, C , Kaufmann, S.H., and Gores, G.J. (2000).

The Genome Cathepsin B contributes to TNF-alpha-mediated hepatocyte apoptosis by promoting mitochondrial release of cytochrome c. J Clin Invest 7^^, 1127-3117. Guicciardi, M.E., Leist, M., and Gores, G.J. (2004). Lysosomes in cell death. Oncogene 23, 2881-2890. Ha, H.C., and Snyder, S.H. (1999). Poly(ADP-ribose) polymerase is a mediator of necrotic cell death by ATP depletion. Proc Natl Acad Sci 9^, 13978-13982. Ha, S.H., Lee, S.R., Lee, T.H., Kim, Y.M., Baik, M.G., and Choi, Y.J. (2001). The expression of Bok is regulated by serum in HCll mammary epithelial cells. Mol Cells 12, 368-371. Hall, B.L., and Thummel, C.S. (1998). The RXR homolog ultraspiracle is an essential component of the Drosophila ecdysone receptor. Development 725,4709-4717. Haupt, S., Berger, M., Goldberg, Z., and Haupt, Y. (2003). Apoptosis - the p53 network. J Cell Sci 116,4077-4085. Hay, B.A., Huh, J.R., and Guo, M. (2004). The genetics of cell death: approaches, insights and opportunities in Drosophila. Nat Rev Genet 5,911-922. Hay, N., and Sonenberg, N. (2004). Upstream and downstream of mTOR. Genes Dev 18, 1926-1945. Heckman, C.A., Wheeler, M.A., and Boxer, L.M. (2003). Regulation of Bcl-2 expression by C/EBP in t(14;18) lymphoma cells. Oncogene 22, 7891-7899. Henson, RM., Bratton, D.L., and Fadok, V.A. (2001). Apoptotic cell removal. Curr Biol 77, R795-805. Hershko, T., and Ginsberg, D. (2004). Up-regulation of Bcl-2 homology 3 (BH3)-only proteins by E2F1 mediates apoptosis. J Biol Chem 279,8627-8634. Hoberg, J.E., Yeung, F., and Mayo, M.W. (2004). SMRT derepression by the IkappaB kinase alpha: a prerequisite to NF-kappaB transcription and survival. Mol Cell 16, 245-255. Hoeppner, D.J., Spector, M.S., Ratliff, T.M., Kinchen, J.M., Granat, S., Lin, S.C, Bhusri, S.S., Conrad,t B., Herman, M.A., and Hengartner, M.O. (2004). eor-1 and eor-2 are required for cell-specific apoptotic death in C. elegans. Dev Biol 274, 125-138. Hoffman, W.H., Biade, S., Zilfou, J.T., Chen, J., and Murphy, M. (2002). Transcriptional repression of the anti-apoptotic survivin gene by wild type p53. J Biol Chem 277, 3247-3257. Hofmann, E.R., Milstein, S., Boulton, S.J., Ye, M., Hofmann, J.J., Stergiou, L., Gartner, A., Vidal, M., and Hengartner, M.O. (2002). Caenorhabditis elegans HUS-1 is a DNA damage checkpoint protein required for genome stabihty and EGL-1-mediated apoptosis. Curr Biol 19, 1908-1918. Holcik, M., and Sonenberg, N. (2005). Translational control in stress and apoptosis. Nat Rev Mol Cell Biol 6, 318-327. Horvitz, H.R. (1999). Genetic control of programmed cell death in the nematode Caenorhabditis elegans. Cancer Res 59, 170 Is-1706s. Ivanov, V.N., Bhoumik, A., Krasilnikov, M., Raz, R., OwenSchaub, L.B., Levy, D., Horvath, CM., and Ronai, Z. (2001).

Chapter 26

Cell Death and Transcription

Cooperation between STATS and c-Jun suppresses Fas transcription. Molecular Cell 7, 517-528. Jaattela,M., and TschoppJ. (2003). Caspase-independent cell death in T lymphocytes. Nat Immunol 4, 416-423. Jiang, C , Lamblin, A.-F.J., Steller, H., and Thummel, C.S. (2000). A steroid-triggered transcriptional hierarchy controls salivary gland cell death during Drosophila metamorphosis. Mol Cell 5, 445-455. Kerr, J.F.R., Wyllie, A.H., and Currie, A.R. (1972). Apoptosis: a basic biological phenomenon with wide-ranging implication in tissue kinetics. Br J Cancer 26, 239-257. Kilpatrick, Z.E., Cakouros, D., and Kumar, S. (2005). Ecdysonemediated up-regulation of the effector caspase DRICE is required for hormone-dependent apoptosis in Drosophila cells. J Biol Chem250, 11981-11986. Kim, J.Y., Ahn, H.J., Ryu, J.H., Suk, K., and Park, J.H. (2004). BH3-only protein Noxa is a mediator of hypoxic cell death induced by hypoxia-inducible factor la. J Exp Med 199, 113-124. Kim, M.Y., Mauro, S., Gevry, N., Lis, J.T., and Kraus, W.L. (2004). NAD+-dependent modulation of chromatin structure and transcription by nucleosome binding properties of PARP-1. Cell 779,803-814. KHonsky, D.J. (2005). The molecular machinery of autophagy: unanswered questions. J Cell Sci 118, 7-18. Konishi, A., Shimizu, S., Hirota, J., Takao, T., Fan, Y., Matsuoka, Y, Zhang, L., Yoneda, Y, Fujii, Y, Skoultchi, A.I., and Tsujimoto, Y (2003). Involvement of histone HI.2 in apoptosis induced by DNA double-strand breaks. Cell 77^, 673-688. Koutsodontis, G., and Kardassis, D. (2004). Inhibition of p53-mediated transcriptional responses by mithramycin A. Oncogene 23, 9190-9200. Kuan, C.Y, Roth, K.A., Flavell, R.A., and Rakic, R (2000). Mechanisms of programmed cell death in the developing brain. Trends Neurosci 23, 291-297. Kucharczak, J., Simmons, M.J., Fan, Y, and Gelinas, C. (2003). To be, or not to be: NF-kappaB is the answer-role of Rel/NF-kappaB in the regulation of apoptosis. Oncogene 22, 8961-8982. Kumar, S., and Cakouros, D. (2004). Transcriptional control of the core cell-death machinery. Trends Biochem Sci 29, 193-199. Kurada, R, and White, K. (1998). Ras promotes cell survival in Drosophila by downregulating hid expression. Cell 95, 319-329. Kurland, J.F., Kodym, R., Story, M.D., Spurgers, K.B., McDonnell, T.J., and Meyn, R.E. (2001). NF-kappaBl (p50) homodimers contribute to transcription of the bcl-2 oncogene. J Biol Chem 276, 45380-45386. Lee, C.Y, Wendel, D.R, Reid, R, Lam, G., Thummel, C.S., and Baehrecke, E.H. (2000). E93 directs steroid-triggered programmed cell death in Drosophila. Mol Cell 6, 433-443. Lee, C.Y, Simon, C.R., Woodard, C.T., and Baehrecke, E.H. (2002). Genetic mechanism for the stage- and tissue-specific

441

regulation of steroid-triggered programmed cell death in Drosophila. Dev Biol 252, 138-148. Lee, H.H., Dadgostar, H., Cheng, Q., Shu, J. and Cheng, G. (1999). NF- B-mediated up-regulation of Bcl-x and Bfl-l/Al is required for CD40 survival signaling in B lymphocytes. Proc Natl Acad Sci P^, 9136-9141. Lehmann, M., Jiang, C , Ip, Y.T., and Thummel, C.S. (2002). AP-1, but not NF-kappa B, is required for efficient steroid-triggered cell death in Drosophila. Cell Death Differ 9, 581-590. Leu, J.I.J., Dumont, P., Hafey, M., Murphy, M.E., and George, D.L. (2004). Mitochondrial p53 activates Bak and causes disruption of a Bak-McU complex. Nat Cell Biol 6, 443-450. Levine, B. (2005). Eating oneself and uninvited guests: autophagy-related pathways in cellular defense. Cell 120, 159-162. Levine, B., and Klionsky, D.J. (2004). Development by self-digestion: molecular mechanisms and biological functions of autophagy. Dev Cell 6, 463-477. Li, P., Nijhawan, D., Budihardjo, L, Srinivasula, S.M., Ahmad, M., Alnemri, E.S., and Wang, X. (1997). Cytochrome c and dATP-dependent formation of Apaf-l/caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479-489. Li, H., Zhu, H., Xu, C.J. and Yuan, J. (1998). Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 94, 491-501. Lill, N.L., Grossman, S.R., Ginsberg, D., DeCaprio, J., and Livingston, D.M. (1997). Binding and modulation of p53 by p300/CBP coactivators. Nature 387, 823-827. Lin, A., and Karin, M. (2003). NF- K B in cancer: a marked target. Semin Cancer Biol 13, 107-114. Lin, A.W, and Lowe, S.W (2001). Oncogenic ras activates the ARF-p53 pathway to suppress epithelial cell transformation. Proc Natl Acad Sci USA 98, 5025-5030. Lindsten, T., Ross, A.J., King, A., Zong, W.X., Rathmell, J.C, Shiels, H.A., Ulrich, E., Waymire, K.G., Mahar, R, Frauwirth, K. et al, (2000). The combined functions of pro-apoptotic Bcl-2 family members bak and bax are essential for normal development of multiple tissues. Mol Cell 6, 1389-1399. Liu, X., Kim, C.N., Yang, J., Jemmerson, R., and Wang, X. (1996). Induction of apoptotic program in cell-free extracts: requirement for dATP and cytochrome c. Cell 86, 147-157. Li-Weber, M., and Krammer, P.H. (2003). Function and regulation of the CD95 (APO-1/Fas) ligand in the immune system. Semin Immunol 15, 145-157. Ljungman, M., and Lane, D.R (2004). Transcription - guarding the genome by sensing DNA damage. Nat Rev Cancer 4, 121-131.

Lohmann, I., McGinnis, N., Bodmer, M., and McGinnis, W. (2002). The Drosophila Hox gene deformed sculpts head morphology via direct regulation of the apoptosis activator reaper. Cell 77a 457-466.

442

Section IV

Los, M., Mozoluk, M., Ferrari, D., Stepczynska, A., Stroh, C , Renz, A., Herceg, Z., Wang, Z.Q., and Schulze-Osthoff, K. (2002). Activation and caspase-mediated inhibition of PARP: a molecular switch between fibroblast necrosis and apoptosis in death receptor signaling. Mol Biol Cell 13, 978-988 Luo, X., Budihardjo, I., Zou, H., Slaughter, C. and Wang, X. (1998). Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell 94, 481-490. MacLachlan, T.K., and El Deiry, WS. (2002). Apoptotic threshold is lowered by p53 transactivation of caspase-6. PNAS 99, 9492-9497. Marchenko, N.D., Zaika, A., and Moll, U.M. (2000). Death signal-induced localization of p53 protein to mitochondria, a potential role in apoptotic signaling. J Biol Chem 275, 16202-16212. Margue, CM., Bemasconi, M., Barr, F.G., and Schafer, B.W. (2000). Transcriptional modulation of the anti-apoptotic protein BCL-XL by the paired box transcription factors PAX3 and PAX3/FKHR. Oncogene 19, 2921-2929. Marks, RA., Richon, V.M., Miller, T., Kelly, W.K. (2004). Histone deacetylase inhibitors. Adv Cancer Res 91, 137-168. Mayo, M.W, Wang, C.Y., Drouin, S.S., Madrid, L.V., Marshall, A.F., Reed, J:C., Weissman, B.E., and Baldwin, A.S. (1999). WTl modulates apoptosis by transcriptionally upregulating the bcl-2 proto-oncogene. EMBO J 18, 3990-4003. Meller, R., Minami, M., Cameron, J.A., Impey, S., Chen, D., Lan, J.Q., Henshall, D.C., and Simon, R.R (2005). CREB-mediated Bcl-2 protein expression after ischemic preconditioning. J Cereb Blood Flow Metab 25, 234-246. Micheau, O., Lens, S., Gaide, O., Alevizopoulos, K., and Tschopp, J. (2001). NF- B signals induce the expression of c-FLIR Mol Cell Biol 21, 5299-5305. Mihara, M., Erster, S., Zaika, A., Petrenko, O., Chittenden, T., Pancoska, R, and Moll, U.M. (2003). p53 has a direct apoptogenic role at the mitochondria. Molecular Cell 11, 577-590. Moreno, E., and Basler, K. (2004). dMyc transforms cells into super-competitors. Cell 117, 117-129. Moroni, M.C., Hickman, E.S., Denchi, E.L., Caprara, G., Colli, E., Cecconi, R, Muller, H., and Helin, K. (2001). Apaf-1 is a transcriptional target for E2F and p53. Nat Cell Biol 3, 552-558. Miguel-Aliaga, I., and Thor, S. (2004). Segment-specific prevention of pioneer neuron apoptosis by cell-autonomous, postmitotic Hox gene activity. Development 131, 6093-6105. Mujtaba, S., He, Y., Zeng, L., Yan, S., Plotnikova, O., Sachchidanand, Sanchez, R., Zeleznik-Le, N.J., Ronai, Z., and Zhou, M.M. (2004). Structural mechanism of the bromodomain of the coactivator CBP in p53 transcriptional activation. Mol Cell 75,251-263. Muzio, M., Chinnaiyan, A.M., Kischkel, F.C., O'Rourke, K., Shevchenko, A., Ni, J., Scaffidi, C , Bretz, J.D., Zhang, M.,

The Genome Gentz, R. et al (1996). FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death-inducing signaling complex. Cell 85, 817-827. Nagata, S. (2000). Apoptotic DNA fragmentation. Exp. Cell Res. 256, 12-18. Nahle, Z., Polakofif, J., Davuluri, R.V., McCurrach, M.E., Jacobson, M.D., Narita, M., Zhang, M.Q., Lazebnik, Y, Bar-Sagi, D., and Lowe, S.W (2002). Direct coupling of the cell cycle and cell death machinery by E2R Nat Cell Biol 4, 859-864. Nelson, D.A., and White, E. (2004). Exploiting different ways to die. Genes Dev 18, 1223-1226. Nijhawan, D., Fang, M., Traer, E., Zhong, Q., Gao, W, Du, R, and Wang, X. (2003). Elimination of Mel-1 is required for the initiation of apoptosis following ultraviolet irradiation. Genes Dev 77, 1475-1486. Okada, H., and Mak, T.W (2004). Pathways of apoptotic and non-apoptotic death in tumour cells. Nat Rev Cancer 4, 592-603. Oliver, F.J., Menissier-de Murcia, J., Nacci, C , Decker, P., Andriantsitohaina, R., Muller, S., de la Rubia, G., Stoclet, J.C., and de Murcia, G. (1999). Resistance to endotoxic shock as a consequence of defective NF-kappa B activation in poly (ADP-ribose) polymerase-1 deficient mice. EMBO J. 18, 4446-4454. Opferman, J.T., and Korsmeyer, S.J. (2003). Apoptosis in the development and maintenance of the immune system. Nat Immunol^, 410-415. Owen-Schaub, L.B., Zhang, W, Cusack, J.C, Angelo, L.S., Santee, S.M., Fujiwara, T., Roth, J.A., Deisseroth, A.B., Zhang, W.W, and Kruzel, E. (1995). Wild-type human p53 and a temperature-sensitive mutant induce Fas/APO-1 expression. Mol Cell Biol 15, 3032-3040. Peart, M.J., Smyth, G.K., van Laar, R.K., Bowtell, D.D., Richon, V.M., Marks, P.A., Holloway, A.J., and Johnstone, R.W. (2005) .Identification and functional significance of genes regulated by structurally different histone deacetylase inhibitors. Proc Natl Acad Sci 102, 3697-3702. Pompeia, C , Hodge, D.R., Plass, C , Wu, Y.Z., Marquez, V.E., Kelley, J.A., and Farrar, WL. (2004). Microarray analysis of epigenetic silencing of gene expression in the KAS-6/1 multiple myeloma cell line. Cancer Res 64, 3465-3473. Poppelmann, B., Klimmek, K., Strozyk, E., Voss, R., Schwarz, T., and Kulms, D. (2005). NF K B-dependent down-regulation of Tumor Necrosis Factor Receptor-associated proteins contributes to Interleukin-1-mediated enhancement of ultraviolet B-induced apoptosis. J Biol Chem 280, 15635-15643. Proskuryakov, S.Y., Konoplyannikov, A.G., and Gabai, V.L. (2003). Necrosis: a specific form of programmed cell death? Exp Cell Res 253, 1-16. Puthalakath, H., and Strasser, A. (2002). Keeping killers on a tight leash: transcriptional and post-translational control of the pro-apoptotic activity of BH3-only proteins. Cell Death Differ 9, 505-512.

Chapter 26

Cell Death and Transcription

Ranger, A.M., Malynn, B.A., and Korsmeyer, S.J. (2001). Mouse models of cell death. Nat Genet 28, 113-118. Ricci, M.S., Jin, Z., Dews, M., Yu, D., Thomas-Tikhonenko, A., Dicker, D.T., and El Deiry, W.S. (2004). Direct repression of FLIP expression by c-myc is a major determinant of TRAIL sensitivity. Mol Cell Biol 24, 8541-8555. Rohde, J.R., Campbell, S., Zurita-Martinez, S.A., Cutler, N.S., Ashe, M., and Cardenas, M.E. (2004). TOR controls transcriptional and translational programs via Sap-Sit4 protein phosphatase signaling effectors. Mol Cell Biol 24, 8332-8341. Rohde, J.R., and Cardenas, M.E. (2003). The tor pathway regulates gene expression by linking nutrient sensing to histone acetylation. Mol Cell Biol 23, 629-635. Russell, H.R., Lee, Y., Miller, H.L., Zhao, J., and McKinnon, RJ. (2002). Murine ovarian development is not affected by inactivation of the bcl-2 family member diva. Mol Cell Biol 22, 6866-6870. Salvesen, G.S., and Duckett, C.S. (2002). lAP proteins: blocking the road to death's door. Nat Rev Mol Cell Biol i, 401 -410. Schuler, M., and Green, D.R. (2005). Transcription, apoptosis andp53: catch-22. Trends Genet 27, 182-187. Schwab, B.L., Guerini, D., Didszun, C , Bano, D., Ferrando-May, E., Fava, E., Tam, J., Xu, D., Xanthoudakis, S., Nicholson, D.W., et al. (2002). Cleavage of plasma membrane calcium pumps by caspases: a link between apoptosis and necrosis. Cell Death Differ 9,818-831 Scorrano, L., Oakes, S.A., Opferman, J.T., Cheng, E.H., Sorcinelli, M.D., Pozzan, T., and Korsmeyer, S.J. (2003). BAX and BAK regulation of endoplasmic reticulum Ca2+: a control point for apoptosis. Science 300, 135-139. Sevilla, L., Zaldumbide, A., Pognonec, P., and Boulukos, K.E. (2001). Transcriptional regulation of the bcl-x gene encoding the anti-apoptotic Bcl-xL protein by Ets, Rel/NFkappaB, STAT and API transcription factor families. Histol Histopathol 7(5, 595-601. Shacka, J.J., and Roth, K.A. (2005). Regulation of neuronal cell death and neurodegeneration by members of the Bcl-2 family: therapeutic implications. Curr Drug Targets CNS Neurol Disord 4, 25-39. Shikama, N., Lee, C.W., France, S., Delavaine, L., Lyon, J., Krstic-Demonacos, M., and La Thangue, N.B. (1999). A novel cofactor for p300 that regulates the p53 response. Mol Cell 4, 365-76. Shishodia, S., and Aggarwal, B.B. (2004). Guggulsterone inhibits NF-KB and IicBa kinase activation, suppresses expression of anti-apoptotic gene products, and enhances apoptosis. J Biol Chem 279, 47148-47158. Shintani, T., and Klionsky, D.J. (2004). Autophagy in health and disease: a double-edged sword. Science 306, 990-995. Skurk, C , Maatz, H., Kim, H.S., Yang, J., Abid, M.R., Aird, W.C, and Walsh, K. (2004). The Akt-regulated forkhead transcription factor F0X03a controls endothelial cell viability through modulation of the caspase-8 inhibitor FLIP. J Biol Chem

443

279, 1513-1525. Slattery, E., Dignam, J.D., Matsui, T., and Roeder, R.G. (1983) .Purification and analysis of a factor which suppresses nick-induced transcription by RNA polymerase II and its identity with poly(ADP-ribose) polymerase. J Biol Chem 258, 5955-5959. Sogame, N., Kim, M., and Abrams, J.M. (2003). Drosophila p53 preserves genomic stability by regulating cell death. Proc Natl Acad Sci 700,4696-4701. Soleymanlou, N., Wu, Y, Wang, J.X., Todros, T., letta, F., Jurisicova, A., Post, M., and Caniggia, I. (2005). A novel Mtd splice isoform is responsible for trophoblast cell death in pre-eclampsia. Cell Death Differ 1-12. Sowter, H.M., Ratcliffe, RJ., Watson, R, Greenberg, A.H., and Harris, A.L. (2001). HIF-1-dependent regulation of hypoxic induction of the cell death factors BNIP3 and NIX in human tumors. Cancer Res 61, 6669-6673. Stevens, C , Smith, L., and La Thangue, N.B. (2003). Chk2 activates E2F-1 in response to DNA damage. Nat Cell Biol 5, 401-409. Tanaka, H., Yokota, H., Jover, T., Cappuccio, I., Calderone, A., Simionescu, M., Bennett, M.V., and Zukin, R.S. (2004). Ischemic preconditioning: neuronal survival in the face of caspase-3 activation. J Neurosci 24, 2750-2759. Thellmann, M., Hatholz, J., and Conradt, B. (2003). The Snail-like Ces-1 protein of C. elegans can block the expression of the BH3-only cell-death activator gene egl-1 by antagonizing the function of basic HLH proteins. Development 130, 4057-4071. Thomas, A., and White, E. (1998). Suppression of the p300-dependent mdm2 negative-feedback loop induces the p53 apoptotic function. Genes Dev 72, 1975-1985. Thompson, C.B. (1995). Apoptosis in the pathogenesis and treatment of disease. Science 267, 1456-1462 Thummel, C.S. (1996). Flies on stQYoids-Drosophila metamorphosis and the mechanisms of steroid hormone action. Trends Genet 72, 306-310. Tran, N.L., McDonough, W.S., Savitch, B.A., Sawyer, T.R, Winkles, J.A., and Berens, M.E. (2005). The tumor necrosis factor-like weak inducer of apoptosis (TWEAK)-fibroblast growth factor-inducible 14 (Fnl4) signaling system regulates glioma cell survival via NFkappaB pathway activation and BCL-XL/BCL-W expression. J Biol Chem 250, 3483-3492. Tran, S.E., Meinander, A., and Eriksson, J.E. (2004). Instant decisions: transcription-independent control of deathreceptor-mediated apoptosis. Trends Biochem Sci 29, 601-608. Tsang, C.K., Bertram, RG., Ai, W, Drenan, R., and Zheng, X.F. (2003). Chromatin-mediated regulation of nucleolar structure and RNA Pol I locahzation by TOR. EMBO J 22, 6045-6056. Varfolomeev, E.E., and Ashkenazi, A. (2004). Tumor necrosis factor: an apoptosis JuNKie? Cell 776, 491 -497. Vaux, D.L., and Korsmeyer, S.J. (1999). Cell death in development. Cell 96, 245-254.

'444

Section IV

Vaux, D.L., and Silke, J. (2005). lAPs, RINGs and ubiquitylation. Nat Rev Mol Cell Biol 6, 2^1-291. Vickers, E.R., Kasza, A., Aksan-Kumaz, I., Seifert, A., Zeef, L., O'Donnell, A., Hayes, A., and Sharrocks, A.D. (2004). Ternary complex factor-serum response factor complex-regulated gene activity is required for cellular proliferation and inhibition of apoptotic cell death. Mol Cell Biol 24, 10340-10351. Virag,L., and Szabo,C. (2002). The Therapeutic Potential of Poly(ADP-Ribose) Polymerase Inhibitors. Pharmacol Rev 54, 375-429. Vivanco, I., and Sawyers, C.L. (2002). The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer 2, 489-501. Wahsser, J.A., and Thies, R.L. (1999). Poly(ADP-ribose) polymerase inhibition in oxidant-stressed endothelial cells prevents oncosis and permits caspase activation and apoptosis. Exp Cell Res 257, 401-413. Walmsley, S.R., Print, C , Farahi, N., Peyssonnaux, C , Johnson, R.S., Cramer, T., Sobolewski, A., Condliffe, A.M., Cowbum, A.S., Johnson, N. et ai, (2005). Hypoxia-induced neutrophil survival is mediated by HIF-la-dependent NF-KB activity. J Exp Med 207, 105-115. Wang, C.Y., Mayo, M.W., Komeluk, R.G., Goeddel, D.V., and Baldwin, A.S.Jr. (1998). NF-KB antiapoptosis: induction of TRAFl and TRAF2 and c-IAPl and C-IAP2 to suppress caspase-8 activation. Science 281, 1680-1683. Wang, W., Rastinejad, F., and El-Deiry, W.S. (2003). Restoring p53-dependent tumor suppression. Cancer Biol Ther 2(4 Suppl 1), S55-63. Wang, X. (2001). The expanding role of mitochondria in apoptosis. Genes Dev 75, 2922-2933. Wang, Z.Q., Stingl, L., Morrison, C , Jantsch, M., Los, M., Schulze-OsthofF, K., and Wagner, E.F. (1997). PARP is important for genomic stability but dispensable in apoptosis. Genes Dev 77, 2347-2358. Wei, M.C., Zong, WX., Cheng, E.H., Lindsten, T., Panoutsakopoulou, V., Ross, A.J., Roth, K.A., MacGregor, G.R., Thompson, C.B., and Korsmeyer, S.J. (2001). Pro-apoptotic BAX and BAK: a requisite gateway to mitochondrial dysfunction and death. Science 292, 727-730. Wu, G.S., Bums, T.F., McDonald, E.R., Jiang, W, Meng, R., Krantz, I.D., Kao, G., Gan, D.D., Zhou, J.Y., Muschel, R. et ai (1997). KILLER/DR5 is a DNA damage-inducible p53-regulated

The Genome death receptor gene. Nat Genet 17, 141-143. Wyllie, A.H. (1980). Glucocorticoid induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature 284, 555-556. Yamit-Hezi, A., and Dikstein, R. (1998). TAFII105 mediates activation of anti-apoptotic genes by NF-kappa B. EMBO J 77, 5161-5169. Yamit-Hezi, A., Nir, S., Wolstein, O., and Dikstein, R. (2000). Interaction of TAFII105 with selected p65/RelA dimers is associated with activation of subset of NF-kappa B genes. J Biol Chem 275, 18180-18187. Yin, X.M., Wang, K., Gross, A., Zhao, Y, Zinkel, S., Klocke, B., Roth, K.A., and Korsmeyer, S.J. (1999). Bid-deficient mice are resistant to Fas-induced hepatocellular apoptosis. Nature 400, 886-891. Yu, S.W, Wang, H., Poitras, M.F., Coombs, C , Bowers, W.J., Federoff, H.J., Poirier, G.G., Dawson, T.M., and Dawson, V.L. (2002). Mediation of poly(ADP-ribose) polymerase-1-dependent cell death by apoptosis-inducing factor. Science 297, 259-263. Zeiss, C.J. (2003). The apoptosis-necrosis continuum: insights from genetically altered mice. Vet Pathol 40, 481-495. Zhang, J, and Xu, M. (2002). Apoptotic DNA degradation and tissue homeostasis. Trends Cell Biol 12, 84-89. Zhou, L., and Steller, H. (2003). Distinct pathways mediate UV-induced apoptosis in Drosophila embryos. Dev Cell 4, 599-605. Zong, W.X., Ditswo doplasmic reticulum to initiate apoptosis. J Cell Biol 162, 59-69. rth, D., Bauer, D.E., Wang, Z.Q., and Thompson, C.B. (2004). Alkylating DNA damage stimulates a regulated form of necrotic cell death. Genes Dev 18, 1272-1282. Zong, W X., Edelstein, L.C., Chen, C , Bash, J., and Gelinas, C. (1999). The prosurvival Bcl-2 homolog Bfl-l/Al is a direct transcriptional target of NF-KB that blocks TNFa-induced apoptosis. Genes Dev 13, 382-387. Zong, W X., Li, C , Hatzivassiliou, G., Lindsten, T., Yu, Q.C., Yuan, J., and Thompson, C.B. (2003). Bax and Bak can localize to the endoplasmic reticulum to initiate apoptosis. J Cell Biol 162, 59-69. Zou, H., Henzel, WJ., Liu, X., Lutschg, A., and Wang, X. (1997). Apaf-1, a human protein homologous to C. elegans CED-4, participates in cytochrome c-dependent activation of caspase-i. Cell 90, 405-413.

Section V Special Topics

Chapter 27 Pre-mRNA Splicing in Eukaryotic Cells Xiang-Dong Fu Department of Cellular and Molecular Medicine, University of California, San Diego, 9500 Oilman Drive, La Jolla, CA 92093-0651

Key Words: the RNA world, coding and non-coding RNA, mRNA processing, alternative splicing, RNA stability and transport, transcription-RNA processing coupling in the nucleus

Summary Gene expression in eukaryotic cells is a collective outcome of transcription, RNA processing, and protein translation. In this chapter, I focus on the mechanism and regulation of gene expression at the level of RNA metabolism. I begin with the introduction of different kinds of RNA expressed in mammalian cells, including mRNAs, rRNAs, tRNAs, small RNAs, miRNAs, and RNAs of unknown function. Realizing that the RNA world is a big topic, which is beyond the scope of a single chapter, I am forced to concentrate on the pathway and regulation of pre-mRNA processing, which is arguably the most important step in gene expression and regulation. Readers are referred to outstanding reviews on other RNA categories for detailed information. Key features in this chapter also include the discussion on integration of RNA processing with other critical nuclear events and on genomics of splicing in the current post-genome era. Most of the information covered here is a condensed version of a number of lectures given annually to graduate students in Beijing and Shanghai as part of the Molecular and Cell Biology course contributed by members of the Ray Wu society. Overview of the RNA World The central dogma in gene expression is the flow of genetic information from DNA to RNA to protein. DNA serves to store and pass on genetic information.

but cannot function as an enzyme during the expression and replication of genetic information. Proteins, on the other hand, are enzymes and structural components of cells and organisms, but do not have the capacity to store genetic information. RNA is the bridge between DNA and protein. Remarkably, RNA is capable of carrying genetic information and processing catalytic functions much like protein enzymes, a property suspected to represent the eariiest form of Hfe (Cech, 1985). A: Synthesis and Processing of the Major Three RNA Classes Traditionally, RNAs are roughly divided into three major classes, which are transcribed by one of the three RNA polymerases in the cell. rRNAs are transcribed by Pol I, mRNAs by Pol II, and tRNAs by Pol III respectively. rRNAs are transcribed as a long 45s precursor transcript, which is then processed into 28s, 18s, and 5.8s rRNAs by a large number of proteins, including endo- and exo-nucleases and specificity factors (Lafontaine and Tollervey, 1995). A separate 5s rRNA gene, however, is transcribed by Pol III. Many sites within rRNAs are modified (i.e. methylation, pesudouridination, etc.), which is essential for their functions in translation. tRNAs are individually transcribed as pre-tRNA precursors. The 5'-end sequence is removed by RNase P, which is a ribozyme consisting of a catalytic RNA component and a structural protein component (Kirsebom, 2002). The 3'-end of pre-tRNA is first processed by RNase-mediated cleavage followed by CCA tri-nucleotide addition, which is catalyzed in the absence of a template (Schurer et al, 2001). A subclass of tRNAs also contains a short intron, which is removed by concerted actions of endonucleases and ligases

Corresponding Author: Tel: (858) 534-4937, Fax: (858) 534-8549, E-mail: [email protected]

448

Section V

(Deutscher, 1984). tRNAs are extensively modified to become competent for amino acid charging by aminoacyl-tRNA synthetases (Martinis e? a/., 1999). mRNAs are first transcribed as intron-containing pre-mRNAs. A pre-mRNA is processed into a mature and functional mRNA in three steps: (1) capping, (2) splicing, and (3) polyadenylation. Capping takes place co-transcriptionally during which a monomethylated guanylate (G) is linked to the first nucleotide at the 5' end via a 5'-5' phosphodiester bond (Shatkin and Manley, 2000). SpHcing occurs in the spliceosome, a multi-component complex, to remove intervening sequences (or introns), which is the main topic of this chapter. Polyadenylation initiates with (1) the recognition of the polyadenylation signal (AAUAA), which is approximately 30 nt upstream of the ploy(A) tail, by cleavage and polyadenylation specificity factors (CPSFs), (2) and binding of the GU-rich sequences downstream of the poly(A) site by cleavage stimulation factors (CstFs) (Keller and Minvielle-Sebastia, 1997). The poly(A) polymerase, with the aid of poly(A) binding protein II, which keeps the length of the poly(A) tail relatively constant, catalyzes the addition of approximately 200 adenosines. Splicing and polyadenylation can take place co-transcriptionally or after the precursor transcript is released fi'om the chromatin to the nucleoplasm (Minvielle-Sebastia and Keller, 1999). B: Non-coding RNAs Besides the three major RNA classes, many small non-coding RNAs are expressed in eukaryotic cells, and their diverse biological roles are being increasingly recognized and appreciated. Small nuclear RNAs (or snRNAs) have been extensively studied as part of the RNA processing machinery (see further details below), snoRNAs are a special class of small RNAs localized in the nucleolus. These snoRNAs, which may be transcribed from individual genes or part of introns in pre-mRNAs, play important roles in guiding site-specific modifications of rRNAs and snRNAs (Decatur and Foumier, 2003). More recently, the world of microRNAs (miRNAs) was brought forward as a class of-21 nt small RNAs involved in a variety of gene expression paradigms (Novina and Sharp, 2004). miRNAs are found in intragenic regions or within introns of other genes. The organization and transcription of miRNAs are poorly understood, although recent evidence suggests that they are transcribed by Pol II (Lee et al, 2004). miRNAs are the final products processed fi'om transcribed precursors in two key steps: (1) The initial transcripts, known as primary miRNAs (pri-miRNAs), are processed by the

Special Topics

Drosha-containing complex (Drosha is a RNase) into pre-miRNAs, which all have a similar stem-loop structure, and (2) pre-miRNAs are processed by Dicer (another RNase) into the final single-stranded miRNAs (CuUen, 2004). Mature miRNAs are incorporated into the RISC complex (RNA induced silencing complex) to mediate target degradation (if a miRNA base-pairs perfectly with a target, similar to the action of RNAi) or in most cases translational repression (if a miRNA forms partial base-pairing with its target). The ftinction of miRNAs has been implicated in the regulation of development, cell proUferation, and apoptosis (Hartmann

etal.imA), Another class of small RNAs is referred to as small heterogeneous RNAs (or shRNAs) because their lengths are not as confined as miRNAs. This class of non-coding RNAs is mostly transcribed fi'om repeat-containing intragenic regions. shRNAs help eliminate transposable elements (an innate cellular defense mechanism against genomic instability) and induce the formation of heterochromatin, a mechanism thought to be critical in programming cell differentiation (Mochizuki et al., 2002; Tavema et ai, 2002; Volpe et ah, 2002, 2003;Volpe et al, 2003; Volpe et al„ 2002). C: TUFs: A Large Number of RNAs to be Understood Sequencing the genome of many model organisms, has brought attention to the observation that the number of genes in individual genomes cannot explain the complexity and functional diversity of these organisms. In fact, it is difficult to determine the total number of genes encoded in a given genome. For example, a tiling array analysis of total RNA fi-om human cells detected a far higher gene count than previously reported (Kapranov et al, 2002). Some of these "extra" counts may be pseudogenes. However, many clearly correspond to previously unrecognized genes, some of which show the multi-exon arrangement typical of a eukaryotic gene. In a recent genome-decoding consortium meeting, these unknown transcripts were named transcripts of unknown functions (TUFs) (The ENCODE Project Consortium). It will be interesting to learn how many of these TUFs actually correspond to real genes and whether some of them represent new classes of genes that have escaped recognition by conventional molecular biology. Pre-mRNA Splicing: Pathway and Factors Pre-mRNA splicing has been extensively studied in the past three decades, beginning with the discovery of "split genes" in the 70s (Sharp, 1994). The development of the in vitro splicing system and the

Chapter 27

Pre-mRNA Splicing in Eukaryotic Cells

'449

majority of introns, conveniently referred to as major introns. In addition to major introns, there exists a minor class of introns, which is characterized by the A: Consensus Splicing Signals and the Splicing Pathway conserved AT and AC dinucleotide at the 5' and 3' splice site, respectively (Burge et al, 1998). The major In the majority of eukaryotic genes, exons are class is thus referred to as GT-AG introns and the minor relatively short in length, typically ranging from 100 to class to AT-AC introns. The major and minor classes 300 nts, whereas introns are relatively long and variable utilize both overlapping and distinct factors to build the in length, with lengths up to 100 kb. Key splicing signals spliceosome (see below). mostly reside in the intron side of the exon/intron junction. As shown in Fig.27.1, the 5' spUce site is The major and minor classes of introns follow the composed of an invariant GT dinucleotide flanked by same chemical pathway for intron removal. As shown conserved nucleotides, with the most important one in Fig.27.2, the splicing reaction proceeds in two steps. being a G in the fifth position in the intron side. The 3' In the first step, the 5' exon is cleaved in a nucleophilic splice site is more complicated and can be divided into attack by the 2'-0H group of the branchpoint nucleotide three important regions: the branchpoint sequence, the (adenosine being the most common one), resulting in polypyrimidine tract, and the 3' invariant AG dinucleotide the release of the first exon and the formation of a lariat (Sharp and Burge, 1997). These splicing signals are intermediate. In the second step, the 3' exon is cleaved loosely conserved in mammalian genes. In yeast, during the second nucleophilic attack by the 2'-0H however, the splicing signals are much more conserved group of the last nucleotide of the released 5' exon, and the branchpoint sequence shows no variation. The resuhing in a lariat intron and ligated exons. The lariat consensus sequence shown in Fig.27.1 represents the intron is quickly degraded (with the aid of a debranching power of yeast genetics allowed for the dissection of the splicing mechanism.

5' splice site

3' splice site branchpoint

A/CAG

GURAGU-

-YNYURAY-Yi,

ESE

ESS

-YAG

polypyrimidine tract

exon

Fig.27.1

intron

exon

R: Purine Y:Pyriniidine N: Any base Consensus splicing signals. Shown are consensus splicing signals for the major class of introns. ESE: exonic splicing

enhancer; ESS: exonic splicing silencer.

2'A HO \ Pre-mRNA

[] Step 1:5' splice site cleavage and branch formation

Lariat intermediate

pA

r

OH Step 11: 3' splice site cleavage and exon ligation

Ligated exons

]P: Fig.27.2

pA-

-3 HO

Released lariat intron

Chemical steps in pre-mRNA splicing.

450'

Section V

enzyme) in the nucleus and the ligated exons are exported from the nucleus after the removal of all intronsfi-omthe pre-mRNA. B: Exon Definition In mammalian systems, exons are short whereas introns are long in length, and splicing signals flanking each exon are recognized first by the exon definition mechanism (Berget, 1995). hiteractions between specific factors binding independently at the 3' and the downstream 5' splice sites result in each exon being recognized as a unit. As predicted from the exon definition model, a fiinctional downstream 5' splice site was found to stimulate the upstream splicing event (Hoffman and Grabowski, 1992). Interactions between specific factors at the two splice sites are limited by the physical distance between the factors; therefore the length of the exon has a major impact. In addition to the mechanism of exon definition, splicing factors can also interact across an intron if the intron length is short enough (intron definition). This two mechanisms work in parallel, where small exons are recognized by exon definition whereas small introns are recognized by intron definition. C: SnRNP and Non-snRNP Splicing Factors Besides consensus splicing signals at the 5' and the y splice sites, other sequence elements within exons and introns can positively and negatively influence the splicing efficiency. Exonic sequences that can stimulate or inhibit splicing are referred to as exonic splicing enhancers (ESEs) or exonic splicing silencers (ESSs) respectively. Likewise, intronic sequences that have positive or negative affects on splicing are called intronic splicing enhancers (ISEs) or intronic splicing silencers (ISSs), respectively. Small nuclear ribonucleoprotein particles (snRNPs) and non-snRNP protein factors mediate the recognition of consensus splicing signals and regulatory sequences (Kramer, 1996). Many non-snRNP protein factors play essential roles during splicing while others are only involved in alternative splicing. Splicing of major introns is mediated by Ul, U2, U4/6, and U5 snRNPs, while splicing of minor introns is mediated by Ull, U12, U4atac/6atac, and U5 (Tarn and Steitz, 1997; Patel and Steitz, 2003). Thus, only U5 snRNP is common to both classes of introns. Individual snRNPs consist of one uridine-rich small nuclear RNA (snRNA) and a group of associated proteins with the exception of U4/6 and U4atac/6atac di-snRNPs. They consist of two snRNAs packed in one snRNP particle because of extensive base-pairing between the two snRNAs, which

Special Topics

is disrupted during splicing to establish a RNA-based catalytic core (see below). Non-snRNP splicing factors are individual protein factors that are not part of snRNP complexes. Many essential non-snRNP splicing factors are RNA binding proteins while others are RNA helicases. The family of SR proteins, which is characterized by one or two RNA Recognition Motifs (RRM) at the N-terminus and an arginine/serine dipeptide repeat (RS domain) at the Cterminus (Fu, 1995; Graveley, 2000), are wellcharacterized non-snRNPs. RNA helicases play a central role in RNA rearrangement along the splicing pathway (Staley and Guthrie, 1998). Mass spectrometry has successfiilly identified proteins associated with purified spliceosomes and subspliceosomal complexes (Gottschalk et al., 1999; Stevens, 2000; Zhou et al, 2002). Many newly identified spliceosome associated proteins, however, remain to befiinctionallycharacterized. D: Spliceosome Assembly Splicing takes place in the spliceosome, which is assembled in a step-wise manner as illustrated in Fig.27.3. RNA binding proteins rapidly bind to RNA when an RNA is mixed with nuclear extracts, forming heterogeneous ribonucleoprotein particles known as hnRNPs (or H complex). Ul snRNP base-pairs with the 5' splice site, forming the E complex (E for early) (Michaud and Reed, 1993). The E complex is a commitment complex, meaning that the pre-mRNA in the complex is committed to the splicing pathway in an irreversible manner. In the next step, U2 snRNP joins the E complex by base-pairing with the branchpoint sequence, resulting in the formation of the A complex. The mechanism for A complex assembly is more complicated than the formation of the E complex and requires several key factors. First, U2AF, a heterodimer, binds to the 3' splice site (Zamore and Green, 1991). The large subunit U2AF65 binds to the polypyrimdine tract while the small subunit U2AF35 touches the conserved AG dinucleotide (Wu et al., 1999). A number of other protein factors (SFl, SF3, and a number of spliceosome associated proteins or SAPs) are also important for 3' splice site specification. SFl, which was later renamed as the branchpoint binding protein BBP, directly binds to the branchpoint sequence (Abovich and Rosbash, 1997; Berglund et aL, 1998). In contrast to Ul binding to the 5' splice site, U2 base-pairing with the branchpoint is an ATP-dependent process. The requirement for ATP likely reflects the essential role of the RNA helicase UAP56 in facilitating U2 binding to the branchpoint sequence (Fleckner et al, 1997; Kistler and Guthrie, 2001).

Chapter 27

Pre-mRNA Splicing in Eukaryotic Cells

Ul I Exonl~ |-

H Exon2 1

451

(Commitment Complex)

(Pre-spliceosome)

B (spliceosome)

(Activated Spliceosome)

mRNA Fig.27.3 The spliceosome assembly pathway for the removal of the major class of introns. The spliceosome assembly for minor introns are slightly different: Ul is replaced by U l l ; U2 is replaced by U12; U4/6 is replaced by U4atac/6atac. Furthermore, UU and U12 may jointly recognize the 5' and 3' splice site during spliceosome assembly.

The A complex, containing Ul and U2, is conditioned for ftirther spliceosome assembly via the addition of the U4/6.U5 tri-snRNPs, resulting in the formation of the B complex known as the mature spliceosome. U4 and U6 are extensively base-paired and jointly packaged into a di-snRNP particle. U5, however, can exist as a single snRNP particle, and before joining the spliceosome, it forms a complex with U4/6 to generate a tri-snRNP particle. Ul is released from the A complex during the joining of the tri-snRNP particle to the spliceosome in which the tri-snRNP interacts with the pre-mRNA and U2, thereby forming an RNA-based catalytic core. A number of RNA helicases are involved in this process. As a result, U4 is released from the spliceosome, giving rise to the formation of the active spliceosome or the C complex (Ares and Weiser, 1995; Staley and Guthrie, 1998). The two-step splicing reaction than takes place in the C complex. In the end, U2/5/6 snRNPs are released with the lariat intron, thereby allowing ligated exons to dissociatefromsnRNPs in preparation for nuclear export. E: Role ofSR Proteins in Constitutive Splicing Highlight of protein factors involved in spliceosome assembly has been briefly described above. The family of SR proteins deserves further attention. In baking yeast, intron-containing genes account for approximately 5% of the total number of genes encoded

in the genome with the vast majority containing a single intron. Fewer protein factors are needed for the recognition of yeast splice sites because they are strongly conserved. As a result, SR proteins are not present in yeast, except for a few SR-like RNA binding proteins. Thus, SR proteins are specialized factors for splicing in higher eukaryotic cells. The participation of SR proteins in a number of critical steps during constitutive splicing leads to the conclusion that they are essential splicing factors (Fu, 1995). It is interesting that, although SR proteins are collectively essential, the majority of splicing events can take place in the presence of just one SR protein. This built-in functional redundancy may allow vast constitutive splicing events to proceed in different cell types and under a variety of growth conditions where SR proteins are differentially expressed. SR proteins become essential at the very earliest step of spliceosome assembly. In fact, SR proteins are sufficient to commit pre-mRNAs to the splicing pathway (Fu, 1993). Although SR proteins are not essential for Ul binding to the 5' splice site, they were found to facilitate efficient and accurate selection of fimctional 5' splice sites and avoid cryptic 5' splice sites frequently found in intronic sequences. During the formation of the A complex, SR proteins play an important role in the recruitment of U2 to the 3' splice site (Fu and Maniatis, 1992). This is mediated by the interaction between SR

452 '

Section V

proteins and the U2AF heterodimer (Wu and Maniatis, 1993). The joining of U4/6.5 tri-snRNPs to the A complex also depends on SR proteins (Roscigno and Garcia-Blanco, 1995). SR protein-dependent snRNP recruitment is likely mediated by the RS domain-mediated protein-protein interactions (Yeakley et al., 1999). Interestingly, the mammalian orthologs of RNA helicases involved in splicing all carry an RS domain. More recent studies suggest that the RS domain of SR proteins may also interact with RNA in assembled spliceosomes (Shen et al, 2004). Phosphorylation is essential for SR proteins to function during spliceosome assembly (Mermoud et al, 1992; Mermoud et al, 1994). SR proteins are phosphorylated by two families of SR protein specific kinases known as SRPKs and Clks (Gui et al, 1994b; Colwill et aL, 1996a; Colwill et aL, 1996b). During splicing in the assembed spliceosome, however, SR proteins are dephosphorylated. Prevention of SR protein dephosphorylation blocks splicing, suggesting that dephosphorylation of SR proteins is essential for spliceosome resolution (Tazi et aL, 1993; Xiao and Manley, 1998; Prasad et al, 1999). It is important to point out here that a foil phosphorylation/dephosphorylation cycle in a single SR protein may not be essential to carry out the splicing reaction: a particular phosphorylated SR protein may be used to initiate spliceosome assembly while another different SR protein, upon dephosphorylation, may drive the splicing reaction to completion (Xiao and Manley, 1998). At the cellular level, phosphorylation appears to mediate SR protein trafficking from "storage" sites within the nucleus to nascent transcripts whereas dephosphorylation seems to be responsible for the reversal of this process (Gui et al., 1994a;MisteH^ra/., 1998). F: RNA Catalysis During spliceosome assembly and within folly assembled spliceosome, RNA elements in pre-mRNA and in snRNPs engage in base-pairing and non-Watson/ Crick interactions to establish a core for RNA-based catalysis. This concept has yet to receive foil experimental proof However mounting evidence points in this direction. One piece of such evidence comes from the similar splicing pathways for group II introns and pre-mRNAs (Sharp, 1994). Group II introns are self-splicing introns found mostly in low eukaryotic cells, such as nematodes and trypanosomes, and in mitochondrial and chloroplasts of higher eukaryotic cells. Splicing of group II introns, which can take place in the absence of protein factors, follows a two-step chemical reaction identical to that of pre-mRNA splicing, lending

Special Topics

a strong support for an RNA-based catalytic core in both the splicing pathways. Further evidence for RNA-based catalysis comes from elegant yeast genetics combined with biochemical approaches, such as induced RNA-RNA cross-linking and mapping of cross-linked sites. These approaches led to the elucidation of conserved and fonctionally important RNA-RNA interactions in the spliceosome (Guthrie, 1991; Guthrie, 1994). For example, as illustrated in Fig.27.4, the Ul-5' splice site base pairing established initially in early splicing complexes are later disrupted, giving ways for base- pairing between U6 and the 5' splice site. U2 remains bound at the branchpoint sequence, and after U4 is released from the spliceosome, part of U2 RNA is then engaged in base-pairing with the U6 RNA. Thus, the 5' splice site and the 3' splice site are linked through a network of RNA-RNA interactions. These interactions are forther strengthened by a conserved loop in the U5 RNA via its base-pairing with the 5' splice site in one side and with the 3' splice site in the other. This final core structure closely resembles the minimal catalytic core in group II introns, strongly suggesting that both types of the splicing reaction use the same catalytic mechanism. Finally, attempts have been made to reconstitute the entire splicing or at least part of the process in vitro using synthetic RNAs resembling different regions of pre-mRNA and snRNAs (Valadkhan and Manley, 2001; Valadkhan and Manley, 2003). This would provide the ultimate proof for the RNA-based catalytic mechanism. Alternative Splicing: Mechanisms and Regulation Unlike yeast, splice sites in higher eukaryotic cells are considerably more variable. As a result, a pre-mRNA may give rise to more than one mRNA product via alternative splicing. In some dramatic cases, a pre-mRNA can, in theory, produce thousands of mRNAs, indicating that alternative splicing has the potential to significantly enlarge the proteome (Black, 2000; Black, 2003). Alternative splicing is a widespread phenomenon in eukaryotic genomes such that more than half of the genes in humans are alternatively spliced (Modrek and Lee, 2002; Johnson et ai, 2003). Thus, alternative splicing has become more a rule rather than an exception. This provides additional dimensions to the regulation of gene expression as different mRNA isoforms may have distinct half-lives, follow different export pathways, and interact with different factors for intracellular targeting and regulated translation (Black, 2003). Due to its scale and complexity, altemative spUcing has become a major challenge in post-genome research.

Chapter 27

Pre-mRNA Splicing in Eukaryotic Cells

o

I

e=

O II ()

=0 -UCCAU^CAUA I I I I I II AGGUA GU

^

AUGAUGU^ II III \ UACUA, C — AG GU

Exon 1

O

JL

iSSS^" Lnr%>#^J^

453

A: Multiple Ways to Splice Alternatively A pre-mRNA may be alternatively spliced in many different ways. As illustrated in Fig.27.5, commonly found alternative splicing modes include (1) alternative 5' choices, (2) alternative 3' choices, (3) intron retention, (4) exon skipping, (5) mutually selected exons, and (6) combinatory exons. In addition, alternative splicing may also be paired with alternative promoters or the use of altemative polyadenylation sites. Examples of these modes can be found in the UCSC Genome Browser (http://genome. ucsc.edu), which is a compilation of cloned cDNAs aligned with their corresponding genomic loci.

CGUUUUACAAAGAGAUUUAUUUCGUUUU I I I II I I I I I I G G UUUUCCGUUUCUCUAAGCA

Domain 5

Domain 6

Fig.27.4 Catalytic core for RNA splicing. A. Binding of Ul to the 5' splice site and U2 to the branchpoint via base-pairing with the conserved splicing signals. B. Intra-snRNP base-pairing between U4 and U6. C. Deduced RNA-RNA interactions in the spliceosome. D. The catalytic core of a group II self-splicing intron. The core is structurally related to the RNA network within the spliceosome, which provides a strong support for a related, RNA-based chemical mechanism in pre-mRNA splicing.

Section V

454

Key questions in the study of alternative splicing include (1) how alternative splicing is regulated and (2) what is the function of individual mRNA isoforms. The understanding of splicing regulation requires the identification of cis-acting regulatory elements and trans-acting factors. Table 27.1 lists some well-studied splicing regulators, most of which were identified by biochemical approaches on model systems. More recently, a large-scale RNAi screening against RNA binding proteins and splicing factors revealed the involvement of many previously conceived constitutive splicing factors in alternative splicing (Favket aL, 2004). Thus, our knowledge on regulated splicing is quite limited, despite intensive research in the last two decades. Given the prevalence of mRNA isoforms in mammalian cells, it is a great challenge to determine which isoforms are functionally important and which ones are just noise in gene expression as a reflection of defects in the RNA processing machinery.

Special Topics

B: Sex Determination in the Fly: the Best Understood Case The most understood alternative splicing pathway, in terms of functionality and regulatory mechanisms, is the sex determination pathway mDrosophila (Fig. 27.6). A series of powerful genetic studies has helped in the dissection of the pathway (Baker, 1989), while elegant biochemical experiments have contribute to the elucidation of the molecular mechanisms involved (Maniatis and Tasic, 2002). In this pathway, the sex lethal gene (Sxl) is expressed only in females. Sxl, a RNA binding protein, regulates alternative splicing of its own RNA by binding to intronic sequences upstream the alterative exon, resulting in skipping of the exon. The skipped exon contains a stop coden, therefore, skipping of this exon in females leads to the production of a functional Sxl protein, whereas in males to the expression of a non-fimctional truncated Sxl protein. This pathway helps decrease the chance of accidental expression of Sxl in males. The Sxl protein also acts on a key downstream

Intron retention

Mutually exclusive exons

-^v^y^^^^r-y- - Q i ^ ^ i r t i ^ Combinatory exon selections

Alternative 5 ' choices

-a

~CD

\/ Alternative promoter and splicing

Alternative 3 ' choices

^a'

3

&«^^^?II>-

V.X

Exon inclusion/skipping

I

^

Alternative splicing & polyadenylation

TD Fig. 27.5 Table 27.1 Family Name SR Proteins

Modes of alternative splicing.

RNA binding proteins involved in the regulation of alternative splicing.

Examples SC35,ASF/SF2,9G8,hTar2-P,hTra2-p,

Key Domain

Essential Splicing Factrors?

RRM and RS

Yes No

SRp20,30c,40,46,54,SRp55,75,86 HnRNPs

HnRNP A/B,hnRNP F,hnRNP H,hnRNP

RRM,some with

I/PTB,Nptb,TIA-1 ,Eiva,Fox-1,2,3

RGG boxes

KH-type

KSRP,Nova-l,2,PSI

KH

CELF Factors

CUG-BP1 ,CUG-BP2/ETR-3,NAPOR

RRM

No

MBNL

MBNL-1,2,3

C3H zinc finger

No

No

Chapter 27

Pre-mRNA Splicing in Eukaryotic Cells

target, the transformer gene (Tra). Sxl binds to an intronic regulatory element within Tra, thereby blocking the usage of a nearby 3' spUce site and shifting the splicing donor to the next 3' splice site. This leads to the expression of a full-length Tra protein (instead of a truncated one) in females. Tra then forms a heterdimer with Tra-2 protein expressed in a non-sex specific manner, which together bind to an exonic regulatory element in the downstream doublesex (Dsx) pre-mRNA. This binding event, together with other cellular splicing factors, is responsible for the activation of an upstream 3' splice site, thereby giving rise to a female-specific Dsx protein. In the absence of Tra/Tra2 binding, a downstream 3' splice site is used, thereby giving rise to a male-specific Dsx protein. Thus, both alternative products of Dsx result in functional proteins. The female Dsx protein negatively regulates genes involved in male differentiation whereas the male Dsx protein negatively regulates genes involved in female differentiation. This pathway illustrates the importance of regulated splicing in a crucial biological process. X: A ratio:

2:2

^

1:2 ^

1 p - Sxl

1

+Sxl ^''stob^^ 2

4

Sxl off

^"-Sxl

^1

1

-Sxl ^-'^v. stop

Tra

1

Tra-2 - - ^

2

Tra(tnmcated)

+Sxl

' ? Dsx

455

positively regulating splicing are referred to as exonic splicing enhancers (ESEs) whereas those negatively regulating splicing are called exonic splicing silencers (ESSs). Interestingly, ESEs and ESSs are not unique to alternative exons; these regulatory elements are also widely found within constitutive exons (Schaal and Maniatis, 1999). The ESE/ESS ratio, in addition to other intronic regulatory elements, may be the distinguishing characteristics between alternative and constitutive exons (Fu, 2004). In general, ESEs are recognized by SR proteins whereas ESSs are recognized by hnRNP proteins (Fig. 27.7). In this sense, Tra-2 is a SR protein. In fact, Tra-2 contains two RNA recognition motifs and two RS domains (one at the C-terminus, like a typical SR protein, and the other at the N-terminus). Tra is also a SR-like protein because it contains a RS domain, but not RRM. The binding of SR proteins to ESEs results in the recruitment of Ul to a nearby downstream 5' splice site and U2 binding to a nearby upstream 3' splice site during exon definition. The recruitment of U2 is accomplished by U2AF binding at the 3' splice site. Because both U2AF subunits also have a RS domain, it is believed that the Ul and U2 recruitment is facilitated by RS domain-mediated protein-protein interactions (Wu and Maniatis, 1993). In addition to the recruitment of spliceosome components, SR proteins are also able to antagonize the interaction of hnRNP proteins with ESSs, which prevents the recruitment of Ul and U2 to their target splice sites during spliceosome assembly (Zhu et al, 2001).

Tra/Tra-2

o'Dsx

Interactions across exon Interactions across intron Interactions across intron Ul

Negative regulator of male differentiation genes

Negative regulator of female differentiation genes Fig.27.6 The sex determination pathway in Drosophila. Fly sex phenotype is determined by the X chromosome to Autosome ratio (2:2 for female and 1:2 for male). This ratio dictates Sxl expression in early development. The female phenotype is maintained by a cascade of regulated splicing. Intronic regulatory elements regulate Sxl and Tra splicing whereas exonic regulatory elements regulate the splicing of Dsx.

C: ESEs and ESSs and Their Effectors The Drosophila sex determination pathway provides a road map to the understanding of regulated splicing in mammalian systems. Many cis-acting elements involved in splicing regulation have been identified through mutagenesis and functional studies in in vitro splicing or in transfected cells. Exonic sequences

3'SS

5'SS

Fig.27.7 Positive and negative regulation of splicing via exonic regulatory elements. SR proteins bind to ESEs, thereby promoting the binding of Ul to the downstream 5' spHce site and recruiting U2 to the upstream 3' splice site. HnRNP proteins antagonize the action of SR proteins by binding to ESSs in this process. Protein interactions across the exon are part of the early exon definition process. After that, protein interactions are established across the intron to initiate spliceosome assembly.

D: ISEs and ISSs and Their Effectors Intron sequences also harbor splicing regulatory elements. Intronic splicing enhancers (ISEs) and silencers (ISSs) are not as well understood as ESEs and ESSs. The c-src model, where a small exon (N) is only

456'

Section V

included in neurons and is skipped in most other cell types, represents the most understood case. Extensive mutagenesis studies have revealed intronic control elements in both sides of the alternative exon (Fig.27.8). Here, the definition of ISEs and ISSs becomes a little fiizzy. An ISE in one cell type may be an ISS in another. Intronic sequences downstream of the N exon are important for the inclusion of the exon in neuronal cells, therefore these would be considered neuron specific ISEs. However, in non-neuronal cells, the same sequences serve to prevent the selection of the splice sites flanking the N exon. Thus, those sequences are ISSs in non-neuronal cells. Many protein factors have been shown to interact ISEs and ISSs. PTB was originally characterized as a polypyrimidine tract binding protein with strong preference for U-rich sequences, which shares some sequence binding specificity with U2AF65 (GarciaBlanco et al, 1989). PTB is not required for spHcing, and thus, it is not an essential splicing factor. Because of its competitive binding with U2AF, PTB is regarded as a negative regulator for splicing. In non-neuronal cells, PTB binds to both sides of the N exon, resulting in the formation of a multi-component complex, which shields the N-exon from the splicing machinery. In neuronal cells, on the other hand, the multi-component complex has a different composition. One of the key molecules is a neuron-specific PTB homologue known as nPTB. nPTB appears sensitive to an ATP-dependent process, which opens up the inhibitory complex and converts the ISS into ab ISE resulting in the inclusion of the N exon (Chan and Black, 1997; Modafiferi and Black, 1999). The identification of tissue specific splicing regulators has been a major goal in the splicing field. The first successfiil example is fi-om the study of a disease gene known as Nova (Jensen et al., 2000a). The Nova family of RNA binding proteins is characterized by a signature KH domain, which is also present in many other RNA binding proteins (Table 27.1). Via in vitro selection for high aflfinity RNA elements. Nova was found to interact with YCAY (Y being U or C) elements in pre-mRNA (Jensen et al., 2000b). Multiple copies of this consensus sequence are frequently found in introns of many neuron-specific genes (Dredge and Darnell, 2003). Biochemical and mutagenesis studies demonstrate that the Nova family of RNA binding proteins act through these RNA motifs to regulate neuron-specific alternative splicing events (Ule et ai, 2003). However, it is important to note that Nova binding can activate splicing in some cases and inhibit

Special Topics

splicing in others. The mechanism of either regulatory pathway remains elusive. Nova RNA binding protein knock-out mice have provided the strongest evidence for its role in neuron-specific splicing regulation (Jensen et al, 2000a). The phenotype of the knock-out mouse mimics the human disease and shows the mis-regulation of many neuron-specific genes. Because many alternative splicing events are altered in the knockout, it is presently unclear which genes directly contribute to the neuronal disorders in mice and humans. E: Recursive Splicing As mentioned earlier, introns vary dramatically in length, some being 100 kb or longer. The ability of the splicing machinery to correctly identify functional splice sites within a boundless sea of highly related intronic sequences remains unsolved. The ratio of ESE/ESS has been suggested to aid this process. In addition, recent evidence suggests that splice site selection may be a co-transcriptional event in vivo, such that a functional splice site may be recognized right after its emergencefi*omthe Pol II complex, which then waits for the appearance of its downstream pair. In the past several years, a new cellular mechanism, recursive splicing, has been shown to deal with splice site selection within long introns in Drosophila (LopQz, 1998). Recursive splicing may simply be viewed as multiple splicing events within the same intron, which eventually results in the removal of the long intron (Fig. 27.9). In this process, the 5' splice site finds a downstream 3' splice site to begin the initial splicing reaction. After the removal of the first piece of the intron, the resultant spliced product has a reconstituted 5' splice site. This allows the next splicing event to take place. After all splicing reactions are finished in the long intron, the end product appears to have been a result of direct splicing of the upstream and downstream exons. This mechanism not only illustrates a solution to the removal of long introns, but may also explain some puzzling splicing products carrying one or a few nucleotide insertions between two exon sequences. It is suspected that these short nucleotide insertions may result from a recursive splicing situation where the 3' splice site is followed by one or a few nucleotides before connecting to the downstream consensus 5' splice site. This would create so-called "mini exons" in the length range of zero (a case where there are no nucleotides separating the upstream 3' splice site and the downstream 5' splice site) to a few nucleotides.

Chapter 27

Pre-mRNA Splicing in Eukaryotic Cells

457

Non-neuronal cells (Nl skipping)

Neuronal cells (Nl inclusion)

Fig.27.8 Positive and negative regulation of splicing via intronic regulatory elements. Example of PTB-regulated alternative splicing of c-src. PTB interacts with both up- and downstream intronic elements (ISS) in non-neuronal cells. In neurons, nPTB may be responsible for the reorganization of the suppression complex (an ATP-dependent process) therefore allowing the inclusion of the N exon. Other factors binding to a downstream intronic splicing enhancer element (ISE) also play a crucial role in the inclusion of the N exon in neuronal cells.

5'ss

3'ss 5'ss

3'ss

5'ss

3'ss

Fig.27.9 Removal of long introns by recursive splicing. The 5' splice site is spliced to a downstream 3' splice site within the long intron. After the splicing reaction, a 5' splice site is reconstituted and ready to pair with a subsequent downstream 3' splice site. Recursive splicing has been reported in the Ubx gene in Drosophila. Recursive splicing has not yet been reported in mammalian systems.

F: Regulated Splicing in Development and Disease This is a big topic, which has been recently reviewed (Cartegni et al, 2002; Faustino and Cooper, 2003). In Drosophila, the role of both isoform expression and trans-acting splicing regulators in development has been well documented, with the sex determination pathway being best understood. Relatively little is known about the role of alternative splicing in development in mammalian systems. This may be largely due to the difficulty of conducting large-scale forward genetic studies in mammals. In a few reported cases, reverse genetic approaches (knock-out or knock-in) have been used to determine the function of specific isoforms or specific splicing regulators. For

example, inactivation of WTl isoform expression led to kidney failure (Hammes et al, 2001) and inactivation of FGFR2 isoforms caused abnormal limb development (De Moerlooze et al, 2000; Hajihosseini et al, 2001). Furthermore, knock-out of a number of SR proteins resulted in early embryonic lethality (Jumaa et al, 1999; Wang et al, 2001; Ding et al, 2004). More recently, it was shown that conditional ablation of prototypical SR proteins SC35 and ASF/SF2 in the heart had no effect on heart development, but caused a typical heart disease known as dilated cardiomyopathy (Ding et al, 2004; Xu et al, 2005). Interestingly, ASF/SF2 was found to be a critical regulator in a postnatal splicing reprogramming pathway, which is essential for heart remodeling during

458'

Section V

Special Topics

the juvenile to adult transition (Xu et al, 2005). These studies demonstrate the importance of regulated splicing in animal development. The examples reported thus far only mark the beginning in understanding the biology of alternative splicing in mammalian systems. The impact of splicing defects on diseases has long been recognized. An early survey indicates that about 15% of disease-causing mutations are because of mutations in exon/intron splicing signals in a wide range of cellular genes (Krawczak et aL, 1992; Stenson et al, 2003). More recently, it was found that silent, mis-sense, and even non-sense mutations can contribute to disease phenotype because of induced splicing defects by the mutations (Cartegni et al., 2002). Previously, disease phenotype associated with mis-sense and non-sense mutations was thought to be a result of impaired protein functions. It is now clear that many of these mutations result in mis-splicing and/or accelerated RNA decay, thereby mimicking the effect of null mutations. Two possible mechanisms exist for this effect. First, point mutations within exons may disrupt existing ESEs or create new ESSs, resulting in abnormal splicing. Second, non-sense mutations may trigger non-sense mediated decay (NMD), resulting in dramatic down-regulation of the affected transcript. The first mechanism explains the observation that point mutations causing Duchenne muscular dystrophy are associated with a more severe disease phenotype than deletion mutants (Fillers et al., 1999). In contrast to mutations in cis-acting regulatory elements, little is known about the effect of trans-acting splicing regulators in disease. The most well-known example is the survival motor neuron (SMN) gene. Mutations in SMN cause spinal muscular atrophy (SMA) (Lefebvre et al., 1997). Biochemical studies revealed that SMN fiinctions in snRNF recycling and therefore plays a role in pre-mRNA splicing in mammalian cells (Fellizzoni et al., 1998). However it is unclear why motor neurons are particularly sensitive to mutations in the SMN gene. Genetic mapping also revealed the role of several essential splicing factors (Frp3, Frp8, and Frp31) in retinitis pigmentosa (Hims et al., 2003). Mutations in these genes selectively cause aberrant splicing of a small number of genes, such as rhodopsin, which is critical for viability of retina cells (Yuan et al., 2005). Reverse genetics has also contributed to the elucidation of the roles of other trans-acting splicing regulators in disease. As previously mentioned. Nova was shown to induce neurological disorders in knock-out mice similar to those seen in human patients carrying mutations in Nova (Jensen et al., 2000a).

Recently, knock-out mice of a gene named Muscleblind, which encodes for a RNA binding protein, gave rise to the same muscular atrophy phenotype as found in humans (Kanadia et al., 2003). These studies show the relevance of splicing regulators in human disease. Broadly speaking, alternative splicing may be widely associated with human diseases, such as cancer, either directly contributing to a specific disease phenotype or indirectly accompanying the progression of a disease. A recent computational analysis suggests that many mRNA isoforms may be specifically induced during cellular transformation (Modrek and Lee, 2002). Therefore, understanding of the mechanism and regulation of alternative splicing is fundamental to disease research. Coupling of Splicing with Other Nuclear Events RNA splicing is not an isolated event in the nucleus, rather it is orchestrated with upstream transcriptional activities and downstream nuclear export steps. Understanding these integrated mechanisms will help to uncover regulated gene expression networks in higher eukaryotic cells. This topic has been recently reviewed (Maniatis and Reed, 2002). A: Transcription-splicing Integration EM visualization of co-transcriptional processing of pre-mRNA in spread chromosomes was the first to show the temporal integration of transcription and splicing (Beyer and Osheim, 1988; Beyer and Osheim, 1991). RT-FCR analysis of mRNAs associated with dissected chromosomes or those released into the nucleoplasm was further used to prove the case (Bauren and Wieslander, 1994). Results showed that upstream introns were removed before the completion of transcription (chromosome-associated) and downstream introns could be spliced either before or after transcription (only a fraction of spliced mRNA was chromosome-associated). Furthermore, in situ hybridization using specific Qxon-Qxon junction probes revealed the co-localization of spliced RNA with nascent transcripts at the gene locus in the nucleus (Zhang et al., 1994). Together, these observations strongly support the idea that splicing is temporally paired with transcription in the nucleus, keeping in mind the possibility that some splicing events may be initiated during transcription but not completed until after the release of the transcript into the nucleoplasm. Promoter use and transcription elongation have been shown to have some impact on splice site selection, further supporting the integration of transcription and

Chapter 27

Pre-mRNA Splicing in Eukaryotic Cells

Splicing in the nucleus. In transfected cells, it was first recognized that alternative splicing of certain genes may be affected by the choice of promoters to drive the expression of a reporter gene (Cramer et al, 1999; Cramer et al., 2001). It was suggested that different promoters may drive gene expression through distinct mechanisms by using different sets of transcription factors. These factors may result in differential recruitment of splicing factors responsible for the recognition of the emerging splice sites during transcription. One can ftirther image that the transcription elongation rate may play a role in splice site selection. A slow polymerase would give an emerging weak splice site more time to be recognized and paired with the upstream splice site, forming a committed splicing complex before the appearance of a stronger downstream splice site. However, with a fast polymerase, the emergence of a strong downstream splice site may be faster, therefore not giving a weaker upstream splice site a chance to be recognized before the emergence of the stronger downstream splice site. According to this model, alternative splicing events may be modulated by the elongation rate of the Pol II complex. This was recently shown to be the case when a slower Pol II (due to a point mutation in the polymerase) was compared with wt Pol II (Kadener et al, 2002). It is important to note that the models for differential promoter loading and variations in Pol II kinetics may not be mutually exclusive. Transcription elongation rates may directly be dependent on the promoter used and the co-factors recruited. Factors involved in the integration of transcription and splicing remain to be characterized. SR proteins have been found to able to interact with the C-terminal domain (CTD) of Pol II in a phosphorylation dependent manner (Misteli and Spector, 1999). Interestingly, phosphorylated Pol II was able to stimulate splicing in vitro, even though it is not an essential splicing factor (Hirose et al, 1999). A number of other RNA processing factors are also associated with the CTD of Pol II, including enzymes involved in capping and polyadenylation, suggesting that RNA processing events ranging from capping to intron removal to polyadenylation are largely co-transcriptional in vivo (Proudfoot, 2000; Proudfoot et al, 2002). CTD may be a crucial docking site for many different processing factors. However, other factors functioning in transcription elongation, such as protein kinases and phosphatases, may dictate the affinity of various processing factors for CTD. At this point, most mechanisms proposed for the integration of transcription and splicing remain largely speculative and wait for

459

further experimental evidence. B: Coupling of Splicing with Nuclear Export It has long been observed that unprocessed pre-mRNA cannot be exported out of the nucleus, suggesting the existence of a RNA quality control mechanism. Initially, it was thought that the RNA processing machinery might be localized near the nuclear pore complex to spatially and temporally integrate splicing with RNA export. However this is clearly not the case. Instead, it has been found that transcription factors are able to recruit splicing factors, which then recruit export factors (Reed, 2003). As shown in Fig.27.10, the transcription export complex (TREX), which is part of the transcription elongation complex, appears to directly interact with specific RNA binding proteins, such as UAP65, which plays an important role in mediating U2 binding to the branchpoint sequence during spliceosome assembly. As part of the spliceosome, UAP65 then recruits a small protein called Aly, which is a key component of the complex deposited onto every exon-exon junctions (known as the EJC complex, see below) after splicing. Aly then directly interacts with TAP, a critical mediator involved in RNA export, which in turn interacts with nuclear pore complex. Through this cascade of protein-protein interactions, transcription is apparently integrated with splicing and then with export.

EJC Nucleus

Cytoplasm Fig.27.10 Integration of splicing with RNA export. The TREX complex plays a role in the co-transcriptional recruitment of UAP56 to pre-mRNA. During splicing, UAP56 recruits Aly, which then becomes a component of EJC. Aly directly interacts with TAP to initiate RNA export. TAP may also be independently recruited by dephosphorylated SR proteins associated with spliced mRNAs as described in the text.

Section V

460

Other RNA binding proteins, such as the cap binding protein CBP80/20 and SR proteins, also seem to contribute to RNA export (Huang et a/., 2003). A subset of SR proteins have been shown to shuttle between the nucleus and the cytoplasm, suggesting a role for shuttling SR proteins during RNA export (Caceres et ai, 1998). In addition, shuttling SR proteins may also play a role in translation (Sanford et aL, 2004) (see below). C: Integration of Splicing and Regulation of RNA Stability A key complex involved in various integration events is the so-called EJC complex, which consist of a group of proteins deposited onto the exon-exon junction after a splicing reaction (Le Hir et al, 2000). The EJC complex connects RNA splicing to RNA export as described above. The EJC complex also plays a role in non-sense mediated RNA decay (NMD) (Le Hir et al, 2001). This is accomplished by the recruitment of Upf proteins, which in turn recruits the decapping enzyme Dcpl. RNA decapping is one of the major pathways for regulated RNA degradation in eukaryotic cells (Hilleren and Parker, 1999). Two positional rules have come to light in recent years, regarding the influence of upstream RNA processing events on RNA stability. As illustrated in Fig. 27.11, the first positional rule states that activation of the NMD pathway is triggered by a premature stop codon located more than 50 to 55 nt upstream of an exon-exon junction. The second rule states that EJC is deposited on exon sequences 20 to 24 nt upstream of each exon-exon junction as a result of the splicing reaction. A. The 50-55 nts rule for NMD Stop

A

Exon-exon junction

+ D: >50-55 nts:NMD EJC :

EJC

TAP

(A)n

TAP

Nucleus

mmmh

jiiiSW Upf

461

Upf ,,„p

Cap;;}-;EJC-:;..-^EJC;,;;;j • .- (A)^ cap .

UpfstoB stop Upf EJC . . ' EJC-

Cytoplasm Stop

(A)„

..r

r Ribosome stop Cap

Dcpl (A)„ Cap

Translation

stop P \ EJC

stop ..(A),

Degradation

Fig.27.12 Integration of splicing with RNA stability. EJCs, which are deposited onto exon-exon junctions after splicing, play an important role in RNA export. Right after export, ribosomes engage in the first round of translation. During this first round cf translation, scanning ribosomes removes EJCs fi-om the mRNA. However, if a pre-mature stop codon is present, it will induce the release of ribosome and all subsequent EJCs will remain on the mRNA. The remaining EJC complexes will recruit Upf proteins to initiate RNA degradation in the cytoplasm. Other sequence specific RNA binding proteins may also interact with mRNA in the cytoplasm to regilate RNA stability, which is independent of EJCs as described in the text.

Other export pathways, which requires the RanGTP gradient created by the nucleus-localized RCCl (a Ran exchange factor to generate RanGTP) and a cytoplasmlocalized RanGAP (a Ran activation protein to catalyze GTP hydrolysis to produce RanGDP) (Weis, 2002). Genomics of RNA Splicing Like everything else, RNA splicing has become global in the post-genome era. The term "-omics" is used to describe the whole collection of a group, such as proteomics (for proteins), kinomics (for kinases), etc. As discussed earlier, alternatively spliced mRNA isoforms are widespread in higher eukaryotic cells. This presents new opportunities and challenges in understanding the new dimension of gene expression. In the last section of the chapter, features of what one may refer to as RNAomics are briefly depicted.

produced in a diseased state. Individual mRNA isoforms from a given gene may encode distinct protein products, be differentially localized in cells or embryos, or have unique half-lives. Therefore, alternative splicing may contribute to the complexity and diversity of the proteome in eukaryotic cells and provide points of differential gene expression regulation. It should be stressed that the functional importance of a given mRNA isoform may not correlate with its abundance. This thus points to a specific problem in the field because most studies focus on the most abundant isoform for functional dissection.

B: Features ofAlternatively Spliced Regions Analysis of altematively spliced genes reveals both expected and unexpected features. Generally speaking, splice sites involved in alternative exons are relatively weaker (more divergent from the consensus sequence) than constitutive splice sites. Weaker splice sites may A: Scale ofAlternative Splicing in Eukaryotic Genomes allow the splicing machinery to regulate and control As described earlier, alternative splicing now their usage. Alternative exons are shorter than appears to be more the rule rather than the exception. constitutive exons, suggesting that short exons may be About half of the genes in human and mouse express subject to alternative splicing because of a reduced ESE multiple mRNA isoforms. Some of these isoforms may frequency. Interestingly, skipped exons maintain the be regulated and thus functionally important whereas reading frame (length is a multiple of 3 nts) of a others may reflect splicing errors or the products transcript more frequently than constitutive ones. This

462

Section V

property allows preservation of the protein structure encoded by downstream constitutive exons. Surprisingly, sequences surrounding alternative splice sites (both in the exon and the intron sides) seem to be more conserved across different species than constitutive exons (Sorek and Ast, 2003). This finding argues against the assumption that weak splice sites are sites which have not yet fully evolved. Instead this suggests that alternative splicing signals (weaker splice sites) may be preserved on purpose during evolution, and thus are functionally important. These sequence features form a basis for the development of ab initio computational tools to predict alternative splicing. The evolution of alternative splicing is an interesting and open research area. It is postulated that mutually exclusive exons might result from exon duplication events therefore explaining the sequence similarities between pairs of mutually exclusive exons. A fraction of skipped exons, on the other hand, appears to have evolved from intronic sequences carrying Alu elements ("exonization" of Alu elements) (Sorek et al., 2002; Lev-Maor et ai, 2003). A more recent analysis indicates that "exonization" of multiple types of transposable elements may also contribute to the evolution of alternative splicing skipped exons (Zheng etal., 2005). C: Development of Splicing Arrays Given the abundance of alternative splicing in higher eukaryotic cells, robust isoform-sensitive microarray systems would aid in the understanding of regulated splicing in development and disease. Three basic microarray platforms have been developed. One platform uses short oligonucleotides (40-mer) to detect individual exon-exonjunctions (Clarke^a/., 2002). This strategy has been used to fabricate a high-density array, targeting exon-exon (mostly constitutive exons) junctions in -10,000 human transcripts (Johnson et al, 2003). More recently, this strategy has been used to interrogate several thousand skipped exons in the mouse (Pan et al, 2004). One major concern with the use of exon-exon probes is the so-called "half-hybridization" phenomenon where half of each exon-exon probe will hybridize to all competing isoforms containing a common donor or acceptor. The second splicing array platform, the "all-exon" array, is under development at Aflfymetrix. In constructing this array, all potential exons were identified with the help of several gene prediction programs. This strategy involves design of four oligonucleotides for each exon. Potential alternative portions of an exon are considered as separate exon or exonic regions, therefore four oligonucleotides are also designed for the exon portion.

Special Topics

An advantage of this "all-exon" array approach is the ability to conduct an unbiased search for regulated splicing. However, an obvious disadvantage is the lack of exon-exon linkage information. The third platform is based on a molecular barcode strategy (Yeakley et aL, 2002). In this approach, a total of three oligonucleotides are used to detect two alternative isoforms. One oligonucleotide targets the common exon site (donor or acceptor) of an alternative event and is linked to a universal primer-landing site. Two additional oligonucleotides are separately synthesized to target the alternative exonic regions. These two oligonucleotides are each linked to a unique 20-mer sequence (called zipcodes) followed by another universal primer landing site. These zip codes are printed on a universal array, which are later used to detect different isoforms. The splicing profile experiment begins with a RNA annealing reaction in which total RNA is mixed with pooled oligonucleotides and biotinylated oligo-dT under denaturing and annealing conditions. Annealed oligonucleotides are selected for on streptavidin oligo-dT beads (solid selection phase). During the solid selection phase, the beads capture all polyA mRNAs along with annealed oHgonucleotides. Free oligonucleotides are washed away and T4 DNA ligase is then used to ligate adjacent oligonucleotides bridged by the mRNAs. This process converts half amplicons to full amplicons. Only ligated oligonucleotides can be amplified by PCR via the pair of universal primers. One of the primers is end-labeled with a fluorescent dye. Thus the PCR products can be directly applied to the universal zipcode array. Each zipcode reports one mRNA isoform according to the oligonucleotide design. This approach has aided in the discovery of targets for specific splicing factors, alternative splicing events regulated in various signal transduction pathways, and tumor specific mRNA isoform biomarkers (Li et aL, 2005). D: Contributions of Splicing to Biology: Opportunities and Challenges Given the degree to which we understand the basic mechanisms and various regulatory strategies for alternative splicing, the research in this posttranscriptional step of gene expression is at its infancy. For example, we know little about the biological functions of the majority of isoforms and how alternative splicing may be regulated in development and disease. Understanding the integration of splicing and various upstream and downstream events are still in preliminary stages. As many are chasing fundamental questions on processing and regulation of "regular"

Chapter 27

Pre-mRNA Splicing in Eukaryotic Cells

RNAs in this field, the mysterious world of microRNAs has recently surfaced. In light of these recent advances, this chapter may better be viewed as a call for the next generation of scientists to pursue a career in RNA research rather than a summation of what has been accomplished thus far in the world of RNA. Acknowledgement Work in the Fu lab is supported by grants from National Institutes of Health, USA.

References Abovich, N., and Rosbash, M. (1997). Cross-intron bridging interactions in the yeast commitment complex are conserved in mammals. Cell 89, 403-412. Ares, M., Jr., and Weiser, B. (1995). Rearrangement of snRNA structure during assembly and ftinction of the spliceosome. Prog Nucleic Acid Res Mol Biol 50, 131-159. Baker, B. S. (1989). Sex in flies: the splice of life. Nature 340, 521-524. Bauren, G., and Wieslander, L. (1994). Splicing of Balbiani ring 1 gene pre-mRNA occurs simultaneously with transcription. Cell 76, 183-192. Berget, S. M. (1995). Exon recognition in vertebrate splicing. J Biol Chem 27^, 2411-2414. Berglund, J. A., Abovich, N., and Rosbash, M. (1998). A cooperative interaction between U2AF65 and mBBP/SFl facilitates branchpoint region recognition. Genes Dev 12, 858-867. Beyer, A. L., and Osheim, Y. N. (1988). Splice site selection, rate of splicing, and alternative splicing on nascent transcripts. Genes Dev 2, 754-765. Beyer, A. L., and Osheim, Y. N. (1991). Visualization of RNA transcription and processing. Semin Cell Biol 2, 131-140. Black, D. L. (2000). Protein diversity from alternative splicing: a challenge for bioinformatics and post-genome biology. Cell 103, 367-370. Black, D. L. (2003). Mechanisms of alternative pre-messenger RNA splicing. Annu Rev Biochem 72, 291 -336. Burge, C. B., Padgett, R. A., and Sharp, P A. (1998). Evolutionary fates and origins of U12-type introns. Mol Cell 2, 773-785. Caceres, J. F., Screaton, G. R., and Krainer, A. R. (1998). A specific subset of SR proteins shuttles continuously between the nucleus and the cytoplasm. Genes Dev 72, 55-66. Cartegni, L., Chew, S. L., and Krainer, A. R. (2002). Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet 3, 285-298. Cech, T. R. (1985). Self-spHcing RNA: implications for evolution.

463

Int Rev CytolP5, 3-22. Chan, R. C , and Black, D. L. (1997). The polypyrimidine tract binding protein binds upstream of neural cell-specific c-src exon Nl to repress the splicing of the intron downstream. Mol Cell Biol 7 7, 4667-4676. Chen, C. Y, Gherzi, R., Ong, S. E., Chan, E. L., Raijmakers, R., Pruijn, G. J., Stoecklin, G., Moroni, C , Mann, M., and Karin, M. (2001). AU binding proteins recruit the exosome to degrade ARE-containing mRNAs. Cell 107, 451-464. Clark, T. A., Sugnet, C. W., and Ares, M., Jr. (2002). Genomewide analysis of mRNA processing in yeast using sphcing-specific microarrays. Science 296, 907-910. Colwill, K., Feng, L. L., Yeakley, J. M., Gish, G. D., Caceres, J. F., Pawson, T., and Fu, X. D. (1996a). SRPKl and Clk/Sty protein kinases show distinct substrate specificities for serine/arginine-rich splicing factors. J Biol Chem 271, 24569-24575. Colwill, K., Pawson, T., Andrews, B., Prasad, J., Manley, J. L., Bell, J. C , and Duncan, P I. (1996b). The Clk/Sty protein kinase phosphorylates SR splicing factors and regulates their intranuclear distribution. EMBO J 75, 265-275. Cramer, P., Caceres, J. F., Cazalla, D., Kadener, S., Muro, A. F., Baralle, F. E., and Komblihtt, A. R. (1999). Coupling of transcription with alternative splicing: RNA pol II promoters modulate SF2/ASF and 9G8 effects on an exonic splicing enhancer. Mol Cell 4, 251-258. Cramer, P., Srebrow, A., Kadener, S., Werbajh, S., de la Mata, M., Melen, G., Nogues, G., and Komblihtt, A. R. (2001). Coordination between transcription and pre-mRNA processing. FEBS Lett ^P5, 179-182. Cullen, B. R. (2004). Transcription and processing of human microRNA precursors. Mol Cell 7 ^, 861 -865. De Moerlooze, L., Spencer-Dene, B., Revest, J., Hajihosseini, M., Rosewell, I., and Dickson, C. (2000). An important role for the Illb isoform of fibroblast growth factor receptor 2 (FGFR2) in mesenchymal-epithelial signalling during mouse organogenesis. Development 127, 483-492. Decatur, W. A., and Foumier, M. J. (2003). RNA-guided nucleotide modification of ribosomal and other RNAs. J Biol Chem 278, 695-698. Deutscher, M. P. (1984). Processing of tRNA in prokaryotes and eukaryotes. CRC Crit Rev Biochem 77, 45-71. Ding, J. H., Xu, X., Yang, D., Chu, P H., Dalton, N. D., Ye, Z., Yeakley, J. M., Cheng, H., Xiao, R. R, Ross, J., et al (2004). Dilated cardiomyopathy caused by tissue-specific ablation of SC35 in the heart. EMBO J 23, 885-896. Dredge, B. K., and Darnell, R. B. (2003). Nova regulates GABA(A) receptor gamma2 alternative splicing via a distal downstream UCAU-rich intronic splicing enhancer. Mol Cell Biol 23, 4687-4700. Faustino, N. A., and Cooper, T. A. (2003). Pre-mRNA splicing and human disease. Genes Dev 17, 419-437.

464

Section V

Fleckner, J., Zhang, M., Valcarcel, J., and Green, M. R. (1997). U2AF65 recruits a novel human DEAD box protein required for the U2 snRNP-branchpoint interaction. Genes Dev 77, 1864-1872. Fu, X. D. (1993). Specific commitment of different pre-mRNAs to splicing by single SR proteins. Nature 365, 82-85. Fu, X. D. (1995). The superfamily of arginine/serine-rich splicing factors. RNA 7, 663-680. Fu, X. D. (2004). Towards a splicing code. Cell 77P, 736-738. Fu, X. D., and Maniatis, T. (1992). The 35-kDa mammalian splicing factor SC35 mediates specific interactions between Ul and U2 small nuclear ribonucleoprotein particles at the 3' splice site. Proc Natl Acad Sci USA 89, 1725-1729. Garcia-Blanco, M. A., Jamison, S. F., and Sharp, R A. (1989). Identification and purification of a 62,000-dalton protein that binds specifically to the polypyrimidine tract of introns. Genes Dev 5, 1874-1886. Gherzi, R., Lee, K. Y., Briata, R, Wegmuller, D., Moroni, C , Karin, M., and Chen, C. Y. (2004). A KH domain RNA binding protein, KSRP, promotes ARE-directed mRNA turnover by recruiting the degradation machinery. Mol Cell 14, 571-583. Gilbert, W., and Guthrie, C. (2004). The Glc7p nuclear phosphatase promotes mRNA export by facilitating association of Mex67p with mRNA. Mol Cell 13, 201-212. Gottschalk, A., Neubauer, G., Banroques, J., Mann, M., Luhrmann, R., and Fabrizio, R (1999). Identification by mass spectrometry and functional analysis of novel proteins of the yeast [U4/U6.U5] tri-snRNR Embo J 18, 4535-4548. Graveley, B. R. (2000). Sorting out the complexity of SR protein functions. RNA 6, 1197-1211. Gui, J. R, Lane, W. S., and Fu, X. D. (1994a). A serine kinase regulates intracellular localization of splicing factors in the cell cycle. Nature 369, 678-682. Gui, J. R, Tronchere, H., Chandler, S. D., and Fu, X. D. (1994b). Purification and characterization of a kinase specific for the serine- and arginine-rich pre-mRNA splicing factors. Proc Natl Acad Sci USA 91, 10824-10828. Guthrie, C. (1991). Messenger RNA splicing in yeast: clues to why the spliceosome is a ribonucleoprotein. Science 253, 157-163. Guthrie, C. (1994). The spliceosome is a dynamic ribonucleoprotein machine. Harvey Lect 90, 59-80. Hajihosseini, M. K., Wilson, S., De Moerlooze, L., and Dickson, C. (2001). A spHcing switch and gain-of-function mutation in FgfR2-IIIc hemizygotes causes Apert/Pfeiffer-syndrome-like phenotypes. Proc Natl Acad Sci USA 98, 3855-3860. Hammes, A., Guo, J. K., Lutsch, G., Leheste, J. R., Landrock, D., Ziegler, U., Gubler, M. C , and Schedl, A. (2001). Two splice variants of the Wilms' tumor 1 gene have distinct functions during sex determination and nephron formation. Cell 106, 319-329. Hartmann, C , Corre-Menguy, F., Boualem, A., Jovanovic, M.,

Special Topics and Lelandais-Briere, C. (2004). (MicroRNAs: a new class of gene expression regulators). Med Sci (Paris) 20, 894-898. Hilleren, R, and Parker, R. (1999). Mechanisms of mRNA surveillance in eukaryotes. Annu Rev Genet 33, 229-260. Hims, M. M., Diager, S. R, and Ingleheam, C. R (2003). Retinitis pigmentosa: genes, proteins and prospects. Dev Ophthalmol 37, 109-125. Hirose, Y, Tacke, R., and Manley, J. L. (1999). Phosphorylated RNA polymerase II stimulates pre-mRNA splicing. Genes Dev 13, 1234-1239. Hoffman, B. E., and Grabowski, R J. (1992). Ul snRNP targets an essential splicing factor, U2AF65, to the 3' splice site by a network of interactions spanning the exon. Genes Dev 6, 2554-2568. Huang, Y, Gattoni, R., Stevenin, J., and Steitz, J. A. (2003). SR splicing factors serve as adapter proteins for TAP-dependent mRNA export. Mol Cell 77, 837-843. Jensen, K. B., Dredge, B. K., Stefani, G., Zhong, R., Buckanovich, R. J., Okano, H. J., Yang, Y Y, and Darnell, R. B. (2000a). Nova-1 regulates neuron-specific alternative splicing and is essential for neuronal viability. Neuron 25, 359-371. Jensen, K. B., Musunuru, K., Lewis, H. A., Burley, S. K., and Darnell, R. B. (2000b). The tetranucleotide UCAY directs the specific recognition of RNA by the Nova K-homology 3 domain. Proc Natl Acad Sci USA 97, 5740-5745. Johnson, J. M., Castle, J., Garrett-Engele, P., Kan, Z., Loerch, P. M., Armour, C. D., Santos, R., Schadt, E. E., Stoughton, R., and Shoemaker, D. D. (2003). Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays. Science 5^)2,2141-2144. Jumaa, H., Wei, G., and Nielsen, R J. (1999). Blastocyst formation is blocked in mouse embryos lacking the splicing factor SRp20. Curr Biol 9, 899-902. Kadener, S., Fededa, J. P., Rosbash, M., and Komblihtt, A. R. (2002). Regulation of alternative splicing by a transcriptional enhancer through RNA pol II elongation. Proc Nati Acad Sci USA PP, 8185-8190. Kanadia, R. N., Johnstone, K. A., Mankodi, A., Lungu, C , Thornton, C. A., Esson, D., Timmers, A. M., Hauswirth, W W, and Swanson, M. S. (2003). A muscleblind knockout model for myotonic dystrophy. Science 3(?2, 1978-1980. Kapranov, P., Cawley, S. E., Drenkow, J., Bekiranov, S., Strausberg, R. L., Fodor, S. R, and Gingeras, T. R. (2002). Large-scale transcriptional activity in chromosomes 21 and 22. Science 296, 916-919. Keller, W., and Minvielle-Sebastia, L. (1997). A comparison of mammalian and yeast pre-mRNA 3'-end processing. Curr Opin Cell Biol 9, 329-336. Kirsebom, L. A. (2002). RNase P RNA-mediated catalysis. Biochem Soc Trans 30, 1153-1158. Kistier, A. L., and Guthrie, C. (2001). Deletion of MUD2, the yeast homolog of U2AF65, can bypass the requirement for sub2,

Chapter 27

Pre-mRNA Splicing in Eukaryotic Cells

an essential spliceosomal ATPase. Genes Dev J 5, 42-49. Kramer, A. (1996). The structure and function of proteins involved in mammalian pre-mRNA splicing. Annu Rev Biochem 65, 367-409. Krawczak, M., Reiss, J., and Cooper, D. N. (1992). The mutational spectrum of single base-pair substitutions in mRNA spHce junctions of human genes: causes and consequences. Hum Genet 90,41-54. Lafontaine, D., and Tollervey, D. (1995). Trans-acting factors in yeast pre-rRNA and pre-snoRNA processing. Biochem Cell Biol 73, 803-812. Lai, M. C , Lin, R. L, and Tarn, W. Y. (2001). Transportin-SR2 mediates nuclear import of phosphorylated SR proteins. Proc Natl Acad Sci USA 98, 10154-10159. Lai, M. C, and Tarn, W. Y. (2004). Hypophosphorylated ASF/SF2 binds TAP and is present in messenger ribonucleoproteins. J Biol Chem 2 79,31745-31749. Le Hir, H., Gatfield, D., Izaurralde, E., and Moore, M. J. (2001). The exon-exon junction complex provides a binding platform for factors involved in mRNA export and nonsense-mediated mRNA decay. EMBO J 20, 4987-4997. Le Hir, H., Moore, M. J., and Maquat, L. E. (2000). Pre-mRNA splicing alters mRNP composition: evidence for stable association of proteins at exon-exon junctions. Genes Dev 14, 1098-1108. Lee, Y, Kim, M., Han, J., Yeom, K. H., Lee, S., Baek, S. H., and Kim, V. N. (2004). MicroRNA genes are transcribed by RNA polymerase IL EMBO J 23, 4051-4060. Lefebvre, S., Burlet, R, Liu, Q., Bertrandy, S., Clermont, O., Munnich, A., Dreyfuss, G., and Melki, J. (1997). Correlation between severity and SMN protein level in spinal muscular atrophy. Nat Genet 16, 265-269. Lev-Maor, G., Sorek, R., Shomron, N., and Ast, G. (2003). The birth of an alternatively spliced exon: 3' sphce-site selection in Alu exons. Science 300, 1288-1291. Li, H-R., Yeakley, J.M., Nair, T.M., Kwon, YS., Bibikova, M., Zhou, L., Zheng, C , Downs, T., Wang-Rodriguz, J., Fu, X-D., and Fan, J-B. (2005). Two-dimensional transcriptome profiling: Identification of novel prostate cancer biomarkers from archived parafiFm-embedded cancer specimens. Submitted. Lopez, A. J. (1998). Alternative sphcing of pre-mRNA: developmental consequences and mechanisms of regulation. Annu Rev Genet 32, 279-305. Maniatis, T., and Reed, R. (2002). An extensive network of coupling among gene expression machines. Nature 416, 499-506. Maniatis, T., and Tasic, B. (2002). Alternative pre-mRNA splicing and proteome expansion in metazoans. Nature 418, 236-243. Martinis, S. A., Plateau, R, Cavarelli, J., and Florentz, C. (1999). Aminoacyl-tRNA synthetases: a new image for a classical family. Biochimie 81, 683-700. Mermoud, J. E., Cohen, P, and Lamond, A. L (1992).

465

Ser/Thr-specific protein phosphatases are required for both catalytic steps of pre-mRNA splicing. Nucleic Acids Res 20, 5263-5269. Mermoud, J. E., Cohen, P T, and Lamond, A. I. (1994). Regulation of mammalian spliceosome assembly by a protein phosphorylation mechanism. EMBO J 13, 5679-5688. Michaud, S., and Reed, R. (1993). A functional association between the 5' and 3' splice site is established in the earliest prespliceosome complex (E) in mammals. Genes Dev 7, 1008-1020. Minvielle-Sebastia, L., and Keller, W. (1999). mRNA polyadenylation and its coupling to other RNA processing reactions and to transcription. Curr Opin Cell Biol 11, 352-357. Misteli, T, Caceres, J. F., Clement, J. Q., Krainer, A. R., Wilkinson, M. E, and Spector, D. L. (1998). Serine phosphorylation of SR proteins is required for their recruitment to sites of transcription in vivo. J Cell Biol 143, 297-307. Misteh, T., and Spector, D. L. (1999). RNA polymerase II targets pre-mRNA splicing factors to transcription sites in vivo. Mol Cell 3, 697-705. Mochizuki, K., Fine, N. A., Fujisawa, T., and Gorovsky, M. A. (2002). Analysis of a piwi-related gene implicates small RNAs in genome rearrangement in tetrahymena. Cell 110, 689-699. Modafferi, E. F., and Black, D. L. (1999). Combinatorial control of a neuron-specific exon. RNA 5, 687-706. Modrek, B., and Lee, C. (2002). A genomic view of alternative splicing. Nat Genet 30, 13-19. Novina, C. D., and Sharp, P A. (2004). The RNAi revolution. Nature ^30, 161-164. Pan, Q., Shai, O., Misquitta, C, Zhang, W., Saltzman, A. L., Mohammad, N., Babak, T., Siu, H., Hughes, T. R., Morris, Q. D., et al (2004). Revealing global regulatory features of mammalian alternative splicing using a quantitative microarray platform. Mol Cell 7(5, 929-941. Park, J. W., Parisky, K., Celotto, A. M., Reenan, R. A., and Graveley, B. R. (2004). Identification of alternative splicing regulators by RNA interference in Drosophila. Proc Natl Acad Sci USA 707, 15974-15979. Patel, A. A., and Steitz, J. A. (2003). Splicing double: insights from the second spliceosome. Nat Rev Mol Cell Biol 4, 960-970. Pellizzoni, L., Kataoka, N., Charroux, B., and Dreyfuss, G. (1998). A novel function for SMN, the spinal muscular atrophy disease gene product, in pre-mRNA spHcing. Cell 95, 615-624. Pillers, D. M., Fitzgerald, K. M., Duncan, N. M., Rash, S. M., White, R. A., Dwinnell, S. J., Powell, B. R., Schnur, R. E., Ray, P N., Cibis, G. W., and Weleber, R. G. (1999). Duchenne/Becker muscular dystrophy: correlation of phenotype by electroretinography with sites of dystrophin mutations. Hum Genet 105, 2-9. Prasad, J., Colwill, K., Pawson, T., and Manley, J. L. (1999). The protein kinase Clk/Sty directly modulates SR protein activity: both hyper- and hypophosphorylation inhibit splicing. Mol Cell

466

Section V

Biol 7P, 6991-7000. Proudfoot, N. (2000). Connecting transcription to messenger RNA processing. Trends Biochem Sci 25, 290-293. Proudfoot, N. J., Furger, A., and Dye, M. J. (2002). Integrating mRNA processing with transcription. Cell 108, 501-512. Reed, R. (2003). Coupling transcription, splicing and mRNA export. Curr Opin Cell Biol 75, 326-331. Roscigno, R. R, and Garcia-Blanco, M. A. (1995). SR proteins escort the U4/U6.U5 tri-snRNP to the spliceosome. RNA 7, 692-706. Sanford, J. R., Gray, N. K., Beckmann, K., and Caceres, J. F. (2004). A novel role for shuttling SR proteins in mRNA translation. Genes Dev 18, 755-768. Schaal, T. D., and Maniatis, T. (1999). Multiple distinct splicing enhancers in the protein-coding sequences of a constitutively spliced pre-mRNA. Mol Cell Biol 7P, 261-273. Schurer, H., Schififer, S., Marchfelder, A., and Mori, M. (2001). This is the end: processing, editing and repair at the tRNA 3'-terminus. Biol Chem 382, 1147-1156. Sharp, R A. (1994). Split genes and RNA splicing. Cell 77, 805-815. Sharp, R A., and Burge, C. B. (1997). Classification of introns: U2-type or U12-type. Cell 91, 875-879. Shatkin, A. J., and Manley, J. L. (2000). The ends of the affair: capping and polyadenylation. Nat Struct Biol 7, 838-842. Shen, H., Kan, J. L., and Green, M. R. (2004). Arginine-serine-rich domains bound at splicing enhancers contact the branchpoint to promote prespliceosome assembly. Mol Cell 13, 367-376. Sorek, R., and Ast, G. (2003). Intronic sequences flanking alternatively spliced exons are conserved between human and mouse. Genome Res 13, 1631-1637. Sorek, R., Ast, G., and Graur, D. (2002). Alu-containing exons are alternatively spliced. Genome Res 12, 1060-1067. Staley, J. R, and Guthrie, C. (1998). Mechanical devices of the spliceosome: motors, clocks, springs, and things. Cell 92, 315-326. Stenson, R D., Ball, E. V., Mort, M., Phillips, A. D., Shiel, J. A., Thomas, N. S., Abeysinghe, S., Krawczak, M., and Cooper, D. N. (2003). Human Gene Mutation Database (HGMD): 2003 update. Hum Mutat 27, 577-581. Stevens, S. W. (2000). Analysis of low-abundance ribonucleoprotein particles from yeast by affinity chromatography and mass spectrometry microsequencing. Methods Enzymol 318, 385-398. Tarn, W. Y., and Steitz, J. A. (1997). Pre-mRNA splicing: the discovery of a new spliceosome doubles the challenge. Trends Biochem Sci 22, 132-137. Tavema, S. D., Coyne, R. S., and Allis, C. D. (2002). Methylation of histone h3 at lysine 9 targets programmed DNA elimination in tetrahymena. Cell 770, 701-711. Tazi, J., Komstadt, U., Rossi, F., Jeanteur, P., Cathala, G., Brunei, C , and Luhrmann, R. (1993). Thiophosphorylation of U1-70K protein inhibits pre-mRNA splicing. Nature 363, 283-286.

Special Topics Ule, J., Jensen, K. B., Ruggiu, M., Mele, A., Ule, A., and Darnell, R. B. (2003). CLIP identifies Nova-regulated RNA networks in the brain. Science 302, 1212-1215. Valadkhan, S., and Manley, J. L. (2001). SpHcing-related catalysis by protein-free snRNAs. Nature 413,101-107. Valadkhan, S., and Manley, J. L. (2003). Characterization of the catalytic activity of U2 and U6 snRNAs. RNA P, 892-904. Volpe, T., Schramke, V., Hamilton, G. L., White, S. A., Teng, G., Martienssen, R. A., and Allshire, R. C. (2003). RNA interference is required for normal centromere function in fission yeast. Chromosome Res 77, 137-146. Volpe, T. A., Kidner, C , Hall, I. M., Teng, G., Grewal, S. I., and Martienssen, R. A. (2002). Regulation of heterochromafic silencing and histone H3 lysine-9 methylation by RNAi. Science 297, 1833-1837. Wang, H. Y., Xu, X., Ding, J. H., Bermingham, J. R., Jr., and Fu, X. D. (2001). SC35 plays a role in T cell development and alternative sphcing of CD45. Mol Cell 7, 331-342. Weis, K. (2002). Nucleocytoplasmic transport: cargo trafficking across the border. Curr Opin Cell Biol 14, 328-335. Wu, J. Y, and Maniatis, T. (1993). Specific interactions between proteins implicated in splice site selection and regulated alternative splicing. Cell 75, 1061 -1070. Wu, S., Romfo, C. M., Nilsen, T. W, and Green, M. R. (1999). Functional recognition of the 3' splice site AG by the splicing factor U2AF35. Nature 402, 832-835. Xiao, S. H., and Manley, J. L. (1998). Phosphorylationdephosphorylation differentially affects activities of splicing factor ASF/SF2. EMBO J 77, 6359-6367. Xu, X., Yang, D., Ding, J. H., Wang, W, Chu, R H., Dalton, N. D., Wang, H. Y, Bermingham, J. R., Jr., Ye, Z., Liu, R, et al. (2005). ASF/SF2-regulated CaMKIIdelta alternative splicing temporally reprograms excitation-contraction coupling in cardiac muscle. Cell 72^ 59-72. Yeakley, J. M., Fan, J. B., Doucet, D., Luo, L., Wickham, E., Ye, Z., Chee, M. S., and Fu, X. D. (2002). Profiling alternative splicing on fiber-optic arrays. Nat Biotechnol 20, 353-358. Yeakley, J. M., Tronchere, H., Olesen, J., Dyck, J. A., Wang, H. Y, and Fu, X. D. (1999). Phosphorylation regulates in vivo interaction and molecular targeting of serine/arginine-rich pre-mRNA splicing factors. J Cell Biol 7-^5, 447-455. Yuan, L., Kawada, M., Havlioglu, N., Tang, H., and Wu, J. Y (2005). Mutations in PRPF31 inhibit pre-mRNA splicing of rhodopsin gene and cause apoptosis of retinal cells. J Neurosci 25, 14S-151.

Yun, C. Y, and Fu, X. D. (2000). Conserved SR protein kinase fiinctions in nuclear import and its action is counteracted by arginine methylation in Saccharomyces cerevisiae. J Cell Biol 750,707-718. Yun, C. Y, Velazquez-Dones, A. L., Lyman, S. K., and Fu, X. D. (2003). Phosphorylation-dependent and -independent nuclear import of RS domain-containing splicing factors and regulators. J

Chapter 27

Pre-mRNA Splicing in Eukaryotic Cells

Biol Chem 278, 18050-18055. Zamore, P. D., and Green, M. R. (1991). Biochemical characterization of U2 snRNP auxiliary factor: an essential pre-mRNA splicing factor with a novel intranuclear distribution. EMBO J 70, 207-214. Zhang, G., Taneja, K. L., Singer, R. H., and Green, M. R. (1994). Localization of pre-mRNA splicing in mammalian nuclei. Nature 572,809-812. Zheng, C , Fu, X-D., and Gribskov, M. (2005). Characteristics and regulatory elements defming constitutive splicing and different

467

modes of alternative splicing in mouse and human. RNA, in press. Zhou, Z., Licklider, L. J., Gygi, S. R, and Reed, R. (2002). Comprehensive proteomic analysis of the human spliceosome. Nature 479,182-185. Zhu, J., Mayeda, A., and Krainer, A. R. (2001). Exon identity established through differential antagonism between exonic splicing silencer-bound hnRNP Al and enhancer-bound SR proteins. Mol Cell 5, 1351-1361.

Chapter 28 Genome Organization: The Effects of Transcription-driven DNA Supercoiling on Gene Expression Regulation Chien-Chung Chen and Hai-Young Wu Department of Pharmacology, Wayne State University, School ofMedicine, Detroit, Michigan, 48201 USA

Key Words: DNA supercoiling, chromosome architecture, heterochromatin, boundary element, Gene silencing, leuO

Summary The transcriptional outputs of genes are often dependent on their chromosomal localizations. Such positional effects suggest that the architecture of chromatin structures play roles in gene expression regulation. The molecular mechanisms that underlie the position effects of gene expression regulation remain unclear. In particular, the role of DNA supercoiling that plays in this level of transcriptional control is absent. The fact that the transcription process itself generates DNA supercoiling has further complicated the issue and has led to a hypothesis that DNA supercoiling may be involved in coordinating the expression of multiple genes in a region via modulating the chromosomal architecture or directly altering the structures of the DNA elements. This possibility has been built upon the existence of unconstrained DNA supercoiling on the chromosome. Chromosomal DNAs are under Torsional Stress Several lines of evidence unambiguously supported that DNA of prokaryotic cells is torsionally constrained. Studies using the DNA photo-crosslinking reagent psoralen demonstrate that prokaryotic DNAs are under negative superhelical tension (Sinden^/a/., 1980). With the known gyration activity of prokaryotic DNA topoisomerase II, the existence of negative DNA superhelicity in prokaryotes has been commonly

accepted. The gyration activity of the bacterial DNA topoisomerase II was evidenced in numerous in vitro studies (reviewed in Gellert, 1981; Menzel and Gellert, 1994). The in vivo evidences are also compelling. When Escherichia coli cells were treated with coumermycin, an inhibitor of DNA gyrase, the superhelical density of DNA was found to be reduced 80%-90% relative to DNA purified from untreated cells. No decrease in the superhelical density of the DNA was observed if DNA was extracted from bacterial strains resistant to coumermycin (Drlica and Snyder, 1978). In contrast, the existence of unconstrained DNA supercoiling in eukaryotes had been a matter of debate in the past several decades. The overall torsional stress in the chromosome of HeLa and Drosophila cells was undetectable in the psoralen-DNA crosslinking experiments (SindQn etal., 1980). However, Weintraub's DNase I hypersensitivity studies suggested the presence of localized superhelical tension in eukaryotic DNA since DNase I-hypersensitive sites were found in the active chromatin domains of chicken nuclei (Groudine and Weintraub, 1982; Larsen and Weintraub, 1982). The conflicting data raised questions about the presence of un-constrained torsional stress on the eukaryotic chromosome. The lack of gyration activity of the eukaryotic DNA topoisomerase has been a strong point of argument for the absence of DNA supercoiling in eukaryotes. The eukaryotic DNA topoisomerases are known to cause only relaxation of DNA supercoiling (Wang, 1996). The debate remained as the twin-domain model of transcription was proposed (Liu and Wang, 1987) and experimentally proven in both prokaryotes and eukaryotes (Brill and Stemglanz, 1988; Dunaway and Ostrander, 1993; Giaever and Wang, 1988; Tsao et

Corresponding Author: Hai-Young Wu, Tel: (313) 577-1584, Fax: (313) 577-6739, E-mail: [email protected]

470

Section V

al, 1989; Wu et al, 1988). The DNA supercoiling driven by transcription provides a different view of the source of unconstrained torsional stress in cellular DNAs. Based on the transient, local, and directional nature of transcription-driven DNA supercoiling, the superhelical state of chromosomal DNA is expected to be very dynamic. At a given chromosomal location, the superhelical tension of DNA is dependent on the relative directionaHties and activities of the neighboring transcriptional units. Given the abundance of transcriptional activity on chromosomes, transcription-driven DNA supercoiling is likely to be the major source of DNA supercoiling changes on chromosomes. Indeed, using photoactivated 4'-hydroxymethyl-4, 5', 8-trimethylpsoralen (HMT) as a probe, localized torsional stress was detected upstream of active, transcribing genes while other regions in the human genome were relatively free of torsional stress (Ljungman and Hanawalt, 1992; Ljungman and Hanawalt, 1995). HMT is known to cross-link DNA at a much faster rate compare with that of the earlier psoralen compound. The fast-acting HMT must have detected the transient, local DNA supercoiling dynamic on the chromosome, as compared with the earlier psoralen compound that failed to detect these changes. The new cross-linking data is consistent with the DNase I hypersensitivity found in Weintraub's studies. This is because the detected torsional stress is associated with transcriptional activities in eukaryotic chromosomes (Ljungman and Hanawalt, 1995). The consistent view now is that both prokaryotic and eukaryotic DNAs are under torsional stress and that the local, transient and high degree DNA supercoiling driven by transcription shall be the relevant "DNA supercoiling" for the regulation of DNA-based biological processes. DNA Supercoiling and Gene Expression Regulation Most of the DNA-based biological processes are potentially affected by the chromosomal DNA supercoiling dynamics, including replication (Baker and Komberg, 1988), recombination (Droge, 1993), and transcription (Pruss and Drlica, 1989). In terms of gene expression regulation, the relationship between the expression level of genes and DNA supercoiling has been well established. The herpes simplex vims thymidine kinase gene on circular plasmids appeared to be transcribed at least 500 times more efficiently than the same gene on linear plasmids after both plasmids were injected into Xenopus oocytes (Harland et ai, 1983). In prokaryotes, perturbation of DNA supercoiling, either caused by mutations of topoisomerase genes or by the

Special Topics

inhibition of topoisomerase inhibitors, is capable of altering the expression of many genes (reviewed in Pruss and Drlica, 1989; Wang, 1996). Biochemical studies revealed that negative DNA supercoiling affects the transcriptional initiation by either 1) directly modulating the binding of RNA polymerase itself at the promoter (Amouyal and Buc, 1987), or 2) indirectly modulating the binding of upstream transcriptional regulators (Baliga and Dassarma, 2000; Davis et al, 1999), and/or the abundant nucleoid proteins (Travers et ai, 2001). These events eventually affect the open complex formation at the promoter. While the correlation between the overall changes of the superhelicity of cellular DNA and the expression of genes is generally true for most promoters, there are, however, some contradictory observations in vitro and in vivo. For example, the expression of gyrA is activated upon a decrease of negative superhelicity on the DNA template (Menzel and Gellert, 1987). However, the expression of gyrA in the chromosomal DNA context increased whereas the expression of a gyrA promoterfused galK gene on a plasmid decreased in the oxolinic acid-treated bacterial cells despite that the negative superhelicity of either chromosomal or plasmid DNA was raised to the same extent (Franco and Drlica, 1989). Contradictory results have also been found in the studies of the DNA supercoiling effect on the expression of bacterial bgl operon and the mutant leu-500 promoter (Higgins et al., 1988; Richardson et ai, 1988). The aberrant correlation between overall DNA supercoiling and gene expression is not limited to prokaryotic models since the expression of ribosomal genes from injected ribosomal DNA plasmids and the expression of endogenous ribosomal genes were also observed to respond differently to the same degree of DNA topological constraint in Xenopus oocytes (Pruitt and Reeder, 1984). Most of these contradictions were raised when genes were relocated (e.g. the promoter was moved from its chromosomal location to a site on the plasmid DNA context). Hence, we speculated that rather than the correlation with the DNA supercoiling changes, in most of gene expression cases, the variation of DNA supercoiling at a local site may in fact be directly relevant in transcriptional control. Transcription-driven DNA Coordinated Gene Expression

Supercoiling

and

Transcriptional elongation is known to generate positive supercoiling ahead of, and negative supercoiling behind, the moving RNA polymerase complex (Liu and Wang, 1987). Transcription-driven DNA supercoiling

Chapter 28

Transcription-driven DNA Supercoiling

has been evidenced in both prokaryotes (Tsao et ah, 1989; Wu et al, 1988) and eukaryotes (Brill and Stemglanz, 1988; Dunaway and Ostrander, 1993; Giaever et al, 1988; Giaever and Wang, 1988; Krebs and Dunaway, 1996). The effect of local DNA supercoiling changes driven by transcriptional activity has been observed in the regulation of a number of DNA-based cellular processes including recombination, replication and transcription (Droge, 1993; Droge, 1994). The most fascinating effects are those involving transcriptional regulation since the transcription process itself generates DNA supercoiling that may reciprocally affect its own regulation (Chen and Wu, 2003). Hence, the effect of transcription-driven DNA supercoiling on gene expression regulation has been the main focus of our research in the past decade. In particular, we are interested in the possibility that transcription-driven DNA supercoiling may serve as signals in coordinating the expression of multiple genes in a region. The coordination of the expression of a group of functionally related genes (gene cluster) shall be an efficient way of using the limited genomic information. Based on the fact that transcriptional activity generates torsional stress on the DNA template, the superhelical state of chromosomal DNA is expected to be non-static. Such chromosomal DNA supercoiling dynamics are capable of affecting transcriptional regulation (reviewed in Pruss and Drlica, 1989; Wang, 1996). Because negative DNA supercoiling is generated behind the transcribing RNA polymerase complex during transcription, the DNA located immediately upstream of an active transcriptional unit is under the influence of a high degree of negative DNA supercoiling. A transient increase in negative DNA supercoiling upstream of a promoter would facilitate the DNA flexibility and the melting of the DNA duplex in that region. Subsequently a variety of DNA secondary structures, due to local denaturation, transitions to Z-form and to H-form, and formations of cruciform extrusions, etc may be stabilized (Htun and Dahlberg, 1989; Kowalski et al, 1988 and reviewed in (Dai and Rothman-Denes, 1999)). The transcription-driven DNA supercoiling-dependent DNA structural transitions may then affect transcription by altering the proper binding of RNA polymerase, by allowing or disrupting interaction between RNA polymerase and regulator proteins, by aiding in isomerization from closed to open promoter complexes and by nucleating the formation of higher order structures leading to activation and repression (reviewed in Dai and Rothman-Denes, 1999). In addition, the binding of transcription factors upstream of the promoter may also be modulated by the

'471

formation of alternative DNA structures, resulting in changes in gene expression. Alternatively, negative superhelicity was proposed to be able to destabilize the DNA duplex at specific locations distally from the promoter, and the free energy generated from the DNA denaturation will be transmitted to the target promoter, leading to an increase in transcriptional activity by reducing the energy required for open complex formation that has been demonstrated in the regulation of the E. coli ilvYC operon and the human c-myc gene (Levens ^^ a/., 1997; Sheridan e^ a/., 1999). Such reciprocal DNA supercoiling effects may explain the observation that the relative orientation between a pair of transcribing genes is crucial in the regulation of expression in either one or both of the genes (Opel et al, 2001; Opel and Hatfield, 2001). It appears that the coordinated expression and fiinctional relationship of divergently arrayed genes may be dependent on the effect of transcription-driven DNA supercoiling. Indeed, an increasing number of head-tohead divergently expressed gene pairs have been found (Trinklein et al, 2004; Whitehouse et a/., 2004), including al and a2 collagen genes, dihydrofolate reductase and human homologue of bacterial MutS, murine surf-l and surf-2, Wilm's tumor Wtl and wit-1 and brcal and nbrl genes. Understanding the transcriptional regulation of genes by transcriptiondriven DNA supercoiling would provide a detailed view of complex gene-gene communication that is presently ill-defined. The gene locations on chromosomes are not random, rather the genome is organized in a manner for efficient use of the limited genomic information. Genome research has revealed that the total number of genes in the human genome is similar with the number of genes in Caenorhabditis elegans (International Human Genome Sequencing Consortium, 2004). The sophisticated human physiology must be dependent on the efficiency of using the same number of genes. Noteworthy to mention is that the expression of multiple fiinctionally related genes may be coordinated in as sequential manner so that proper levels of gene expression will be spatially and temporally executed with precision required for optimal physiology. The Positional Effect of Gene Expression The coordinated expression of genes from a native chromosomal context indicates the importance of the relative position of functionally related genes. Once a gene is moved to a foreign DNA context, its expression is disturbed, as demonstrated in an early study of

'472

Section V

position-effect color variegation on mouse coats. This chromosomal position effect in which the rearrangement breakpoint removes one gene from its normal euchromatic location to the proximity of a heterochromatic region can cause transcriptional repression of the normally active gene. Moreover, activation (derepression) of the silent gene could be observed when it is moved away from the heterochromatic domain (Allshire et al, 1994; Butner and Lo, 1986; Gottschling et al, 1990; Hazehigg et al, 1984). Changes in expression states of genes due to gene re-location strongly suggest that the chromatin structure plays a crucial role in the establishment of complex gene regulation throughout cell differentiation. Indeed, it has been demonstrated that the formation of heterochromatin or a heterochromatin-like structure is responsible for the inactivation of X chromosome in mammals, the position-effect variegation in Drosophila, and the repression of the yeast mating-type loci (reviewed in Lewin, 1998). Chromatin architectural changes may determine the position effect of gene expression via modulating the distribution of local DNA supercoiling, e.g. the segregation of supercoiled DNA driven by genes located between different chromosomal domains. Chromosome Architecture and Gene Expression It has become clear that modulation of chromatin structures plays an important role in the transcriptional regulation in eukaryotes since transcriptional regulators must overcome the chromatin barrier to gain access to their sites in order to affect transcription. Some transcription factors manage to bind to nucleosomes and to subsequently recruit enzymes (histone acetyltransferase and SWI/SNF-related ATPase), which not only alter chromatin in a way that permits assembly of the basal transcriptional machinery, but also facilitate the binding of other factors (Di Croce et al, 1999). In some other cases, where there is no obstacle to inhibit access to the critical regulatory elements that are positioned between nucleosomes, chromatin rearrangement triggered by these chromatin-bound factors permits binding of additional regulators to nearby nucleosomes and/or assembly of the basal transcriptional machinery (Agalioti et al., 2000). It is worthy nothing that stable alterations in nucleosome structure are critical ways to create an altered chromatin state by which gene expression is regulated. Recent studies have further identified a large group of proteins whose primary function is to assist active transcription by altering chromatin so that its DNA sequence becomes more accessible to the transcriptional apparatus. Conversely, different proteins

Special Topics

help repress transcription by making chromatin less accessible (reviewed in Workman and Kingston, 1998). Taken together, these reports support a model that the expression of genes is mainly determined by the open state of euchromatin structures, which is regulated by numerous functional protein factors, while the remaining heterochromatin usually represents transcriptionally inactive chromosome domains. Transcriptionally Repressive Heterochromatin and Gene Silencing Heterochromatin is a specialized chromatin structure that persists throughout the cell cycle to limit access to DNA by machineries that transcribe or recombine the cell's genetic information, which may be inherited by daughter cells following cell division. Thus, some gene loci on the highly compact chromosomal regions that form heterochromatin structures, including centromeres and telomeres, have had periodically inactive expression to ensure that the genetic information is accurate and conserved. Indeed, heterochromatin plays important roles in the maintenance of 1) the differentiated states of cells by consistently repressing gene expression, and 2) chromosome stability by inhibiting hyper-recombination in highly repetitive chromosomal regions (Loo and Rine, 1994; Lustig, 1998). The formation of heterochromatin is involved in the constitutively transcriptional repression of genes, named gene silencing. Generally, gene silencing can be observed at both a molecular and a chromosomal level. It has been proposed that cz5-spreading of the heterochromatin structure from the heterochromatin-euchromatin junction is required for the repression of proximal genes. Indeed, a gene rearrangement event that displaces the white eye color gene of Drosophila from its normal euchromatic location to the vicinity of heterochromatin causes the heritable position-effect variegation of eye color (Wakimoto, 1998). It has also been postulated that at a chromosomal scale, the heterochromatin structure can block access of the transcriptional machinery, resulting in gene silencing. The effect of heterochromatin structure on gene silencing remains less clear at a molecular level due to the complexity of higher eukaryotic systems, despite the fact that heterochromatin has been cytologically defined. The yeast model system provides the genetic and molecular approaches for dissecting the effect of heterochromatin structures on gene silencing. The involvement of heterochromatin structures in the transcriptional repression of genes at mating-type loci of Saccharomyces cerevisiae and Schizosaccharomyces

Chapter 28

Transcription-driven DNA Supercoiling

pombe has been extensively studied (Gartenberg, 2000; Laurenson and Rine, 1992). Establishing and maintaining repression at the loci requires a number of trans-acting protein factors and two cz.s-acting regulatory elements as silencers. The extensive interactions among transacting protein factors support the current model for gene silencing in which the silencer-binding proteins nucleate at the silencers and recruit other silent information repressor proteins to form a protein complex, which propagates along the neighboring nucleosomes, forming a heterochromatin-like structure. In bacteria, a similar "heterochromatin-like" nucleoprotein structure has also been proposed for gene silencing at sites adjacent to the PI phage and F plasmid centromeres, which functions similar to centromeric gene silencing in eukaryotes (Kim and Wang, 1999; Rodionov et al., 1999). Centromere-bound proteins (ParB and SopB) recognize their cognate binding sites (parS and sopQ and spread along DNA as far as 10 kb away, resulting in genes at adjacent DNA regions being silenced and inaccessible to dam methylase and DNA gyrase (Lynch and Wang, 1995; Rodionov et al, 1999). The E. coli bgl operon is another classical example used to study the effect of transcriptionally repressive nucleoprotein structures on gene expression. The bgl promoter is silent under cell homeostasis so that wild-type E.coli cannot metabolize P-glucoside (Schaefler, 1967). Studies have shown that not only is the bgl promoter silent in its normal context, but other promoters exchanged for the bgl promoter become silenced at the bgl locus (Schnetz, 1995). This result is consistent with the fact that both c/5-acting elements located upstream and downstream of the bgl promoter and two ^m«^-acting protein factors: the histone-like nucleoid structuring protein (H-NS) and factor for inversion stimulation (FIS) are required for bgl silencing (Defez and De Felice, 1981; Ueguchi et al., 1996). In this respect, H-NS, an abundant nucleoidassociated protein, was shown to bind to an ~100-bp AT-rich sequence upstream of the promoter, forming a nucleoprotein structure that spreads along the neighboring region via protein-protein interactions, resulting in a heterochromatin-like feature of the promoter that is unfavorable for transcription (Schnetz, 1995; Ueguchi et aL, 1996). One of the reasons why this region was designated as a "silencer element", and not an operator, was the observation that bgl silencing was not significantly relieved either by a point mutation within it or even by small internal insertions (Caramel and Schnetz, 1998). Moreover, there is flexibility as to the orientation of and distance of the silencer element from the promoter, because its silencing activity is not diminished when

'473

moved to a fiirther location, 150 bp upstream (Schnetz, 1995; Schnetz and Rak, 1992). The mechanistic similarity of H-NS-mediated bgl silencing with eukaryotic silencing mediated by heterochromatin or heterochromatin-like structure suggests that certain microdomains affected by the organization of the chromosome play an important role in gene function. The Relief of Heterochromatin-mediated

Gene

Silencing As described above, the same gene inserted into different sites in the genome can exhibit markedly different levels of expression. This position effect on gene expression may reflect local differences in chromatin structure as well as the particular distribution of regulatory elements through the genome. If heterochromatin repressive domains are not restricted in some fashion, essential genes in neighboring domains may be inappropriately repressed. It raises the question of what prevents the repressed regionsfromextending indefinitely. Regional transcriptional silencing in the matingtype loci, centromere, and telomere of yeast provides a model to understand as to how to delimit the silent chromatin. At HMR loci and subtelomeric regions, the flanking boundary elements limit the propagation of repressed heterochromatin (Donze et al., 1999; Fourel et al., 1999). However, the flanking silencers at the HML loci impose silencing in a directional manner over a limited distance, thereby repressing only those genes that reside between them (Bi et al., 1999). It suggests that boundary elements may recruit a large multiprotein complex to block the spreading of silencer-bound proteins along the chromatin and that the differences of relative availability and binding affinity between the silencer-bound proteins may also determine the directionality of gene silencing. Two different models have been suggested for restricting silenced domains in yeast: the chromatin-modifying model (Donze and Kamakaka, 2002) and topological domain model (Ishii et al, 2002). According to the chromatin-modifying model, barrier proteins bound to DNA create regions of open chromatin that prevent the propagation of silenced chromatin. These boundary proteins are believed to fiinction by recruiting chromatin-modifying enzymes that in turn modify nucleosomes and alter the chromatin substrate to a state that is unfavorable for binding of the silencer-bound proteins. The topological domain model, on the other hand, states that boundary elements tether DNA to a nuclear substructure, which then forms a "road block" to the spreading heterochromatin. While these two models are mechanistically distinct, the

474'

Section V

outcome of both is the creation and maintenance of adjacent chromatin domains with opposing transcriptional activities. In bacteria, since c/5'-spreading of the H-NS nucleoprotein complex causes transcriptional silencing at some promoters (and thus shares mechanistic similarity with heterochromatin type of gene silencing in eukaryotes), one can expect that a protein-DNA complex located between a H-NS nucleation site and the target promoter may block the propagation of the transcriptionallyrepressive nucleoprotein complex. Indeed, the result demonstrated that the integration of insertion elements within AT-rich regions can alleviate bgl silencing, but not if the coding sequence is deleted (Reynolds et al, 1986). Furthermore, lac and X operator-repressor complexes situated within the upstream silencer, but far away from the RNA polymerase, can also relieve silencing in a phase-independent manner (Caramel and Schnetz, 1998). It suggested that extensive protein-DNA interaction could abolish silencing by prevention of the H-NS-associated nucleoprotein structure from reaching RNA polymerase, as if it were located at the cisspreading path between the silencer and the target promoter. For example: The overexpressions ofihtbgU and leuO genes are known to cause activation of the bgl promoter (Giel et al, 1996; Ueguchi et ai, 1998). Similar regulation has also been found in ompSl and ade genes, but detailed mechanisms underlying the transcriptional repression and derepression of gene expression remain elusive. The proteins that play such roles in a native DNA context need yet to be explored. The Sequential Activation of Genes in the S. typhimurium ilvIH-leuO-leuABCD Gene Cluster The activation of the mutant leu-500 promoter of the leucine operon in Salmonella typhimurium topA mutants is one of the best examples available for discerning the complexity of DNA supercoilingdependent transcriptional activation. The leu-500 mutation is an A to G transition in the -10 region of the promoter of the S. typhimurium leuABCD operon, which abolishes the promoter activity and results in leucine auxotrophy (Gemmill et al, 1984; Margolin and Mukai, 1966). Later, a second-site mutation at the DNA topoisomerase I gene, topA, was shown to suppress the leu-500 mutation and restore leucine prototrophy (Margolin and Mukai, 1966; Margolin et al, 1985; Trucksis and Depew, 1981). The A to G transition in the leu-500 promoter is expected to increase the free energy requirement for the open complex formation of the mutant promoter. Since the hyper-negative DNA

Special Topics

supercoiling caused in topA mutants is believed to provide extra free energy to overcome such an energy barrier, the transcriptional activity of the leu-500 promoter was thought to correlate with the level of negative superhelicity on the DNA template. However, suppression of the leu-500 mutation {leu-500 activation) only correlated with the absence of topA but not the overall negative DNA superhelicity that was measured in various top A and gyr mutant series (Richardson et al, 1988). Hence, it was suggested that local rather than global DNA supercoiling was important for leu-500 activation (Lilley and Higgins, 1991; Richardson ^^ a/., 1988). To understand the effect of DNA supercoiling on leu-500 activation, various laboratories have tested the hypothesis that transcription-mediated negative DNA supercoiling may be the missing regulatory factor responsible for activation of the leu-500 promoter with atop.4"background.Our research group has demonstrated that in a topA~ mutant, the minimal leu-500 promoter (positions -80 to +87 of leuABCD operon) on plasmid DNA can be activated by a lac promoter that transcribed divergently, but not convergently towards it (Tan et ah, 1994). In addition, with the insertion of random DNA sequences into the region between divergent leu-500 and lac promoters, the negative DNA supercoilingdependent leU'-500 activation is limited within 250-450 bp. Hence, the effect was named the short-range promoter-promoter interaction (Tan et al., 1994). Both Dr. Lilley's and Dr. Bossi's groups also detected the activation of the plasmid-bome leu-500 promoter within a similar distance by the transcriptional units transcribing away from the leu-500 promoter (Chen et al, 1992; Chen et al, 1994; Chen et al, 1993; Spirito and Bossi, 1996). The negative DNA supercoiling dependence of leu-500 activation on the plasmid DNA, however, may not reflect the chromosomal situation that was observed in the study of the reversion of leucine phenotype in the S. typhimurium topA' strain (Margolin and Mukai, 1966). Based on the discrepancy discussed in the papers (Lilley and Higgins, 1991; Richardson ^^ al, 1988) that some missing DNA elements may account for the ^/7v4-dependent activation of the leu-500 promoter on a plasmid. J Bacteriol 176, 3757-3764. Chen, D., Bowater, R. R, and Lilley, D. M. (1993). Activation of the leu-500 promoter: a topological domain generated by divergent transcription in a plasmid. Biochemistry 32, 13162-13170. Dai, X., and Rothman-Denes, L. B. (1999). DNA structure and transcription. Curr Opin Microbiol 2, 126-130. Davis, N. A., Majee, S. S., and Kahn, J. D. (1999). TATA box DNA deformation with and without the TATA box-binding protein. J Mol Biol 291, 249-265. Defez, R., and De Felice, M. (1981). Cryptic operon for beta-glucoside metabolism in Escherichia coli K12: genetic evidence for a regulatory protein. Genetics 97, 11-25. Di Croce, L., Koop, R., Venditti, R, Westphal, H. M., Nightingale, K. R, Corona, D. R, Becker, R B., and Beato, M. (1999). Two-step synergism between the progesterone receptor and the DNA-binding domain of nuclear factor 1 on MMTV minichromosomes. Mol Cell 4, 45-54. Donze, D., Adams, C. R., Rine, J., and Kamakaka, R. T. (1999). The boundaries of the silenced HMR domain in Saccharomyces cerevisiae. Genes Dev 13, 698-708. Donze, D., and Kamakaka, R. T. (2002). Braking the silence: how heterochromatic gene repression is stopped in its tracks. Bioessays 24, 344-349. Drlica, K., and Snyder, M. (1978). Superhelical Escherichia coli DNA: relaxation by coumermycin. J Mol Biol 120, 145-154. Droge, R (1993). Transcription-driven site-specific DNA recombination in vitro. Proc Natl Acad Sci USA 90, 2759-2763. Droge, P. (1994). Protein tracking-induced supercoiling of DNA: a tool to regulate DNA transactions in vivo? Bioessays 16,91-99. Dunaway, M., and Ostrander, E. A. (1993). Local domains of supercoiling activate a eukaryotic promoter in vivo. Nature 361,

Special Topics 746-748. Falconi, M., Higgins, N. P., Spurio, R., Pon, C. L., and Gualerzi, C. O. (1993). Expression of the gene encoding the major bacterial nucleotide protein H-NS is subject to transcriptional auto-repression. Mol Microbiol 10, 273-282. Fang, M., Majumder, A., Tsai, K. J., and Wu, H. Y (2000). ppGpp-dependent leuO expression in bacteria under stress. Biochem Biophys Res Commun 276, 64-70. Fang, M., and Wu, H. Y (1998a). A promoter relay mechanism for sequential gene activation. J Bacteriol 180, 626-633. Fang, M., and Wu, H. Y (1998b). Suppression of leu-500 mutation in topA^ Salmonella typhimurium strains. The promoter relay at work. J Biol Chem 273, 29929-29934. Fourel, G., Revardel, E., Koering, C. E., and Gilson, E. (1999). Cohabitation of insulators and silencing elements in yeast subtelomeric regions. Embo J 18, ISll-lSlil. Franco, R. J., and Drlica, K. (1989). Gyrase inhibitors can increase gyrA expression and DNA supercoiling. J Bacteriol 171, 6573-6579. Gartenberg, M. R. (2000). The Sir proteins of Saccharomyces cerevisiae: mediators of transcriptional silencing and much more. Curr Opin Microbiol 3, 132-137. Gellert, M. (1981). DNA topoisomerases. Annu Rev Biochem 50, 879-910. Gemmill, R. M., Tripp, M., Friedman, S. B., and Calvo, J. M. (1984). Promoter mutation causing catabolite repression of the Salmonella typhimurium leucine operon. J Bacteriol 158, 948-953. Giaever, G. N., Snyder, L., and Wang, J. C. (1988). DNA supercoiling in vivo. Biophys Chem 29, 7-15. Giaever, G. N., and Wang, J. C. (1988). Supercoiling of intracellular DNA can occur in eukaryotic cells. Cell 55, 849-856. Giel, M., Desnoyer, M., and Lopilato, J. (1996). A mutation in a new gene, bgU, activates the bgl operon in Escherichia co//K-12. Genetics 143, 627-635. Gottschling, D. E., Aparicio, O. M., Billington, B. L., and Zakian, V. A. (1990). Position effect at S. cerevisiae ioiomQVQs: reversible repression of Pol II transcription. Cell 63, 751-762. Groudine, M., and Weintraub, H. (1982). Propagation of globin DNAase I-hypersensitive sites in absence of factors required for induction: a possible mechanism for determination. Cell 30, 131-139. Harland, R. M., Weintraub, H., and McKnight, S. L. (1983). Transcription of DNA injected into Xenopus oocytes is influenced by template topology. Nature 302, 38-43. Hazelrigg, T., Levis, R., and Rubin, G. M. (1984). Transformation of white locus DNA in drosophila: dosage compensation, zeste interaction, and position effects. Cell 36, 469-481. Higgins, C. R, Dorman, C. J., Stirling, D. A., Waddell, L., Booth, I. R., May, G., and Bremer, E. (1988). A physiological role for DNA supercoiling in the osmotic regulation of gene expression in

Chapter 28

Transcription-driven DNA Supercoiling

S. typhimurium and E. coli. Cell 52, 569-584. Ishii, K., Arib, G., Lin, C , Van Houwe, G., and Laemmli, U. K. (2002). Chromatin boundaries in budding yeast: the nuclear pore connection. Cell 109, 551-562. Kim, S. K., and Wang, J. C. (1999). Gene silencing via protein-mediated subcellular localization of DNA. Proc Natl Acad Sci USA 96, 8557-8561. Krebs, J. E., and Dunaway, M. (1996). DNA length is a critical parameter for eukaryotic transcription in vivo. Mol Cell Biol 16, 5821-5829. Larsen, A., and Weintraub, H. (1982). An altered DNA conformation detected by S1 nuclease occurs at specific regions in active chick globin chromatin. Cell 29, 609-622. Laurenson, P., and Rine, J. (1992). Silencers, silencing, and heritable transcriptional states. Microbiol Rev 56, 543-560. Levens, D., Duncan, R. C , Tomonaga, T., Michelotti, G. A., Collins, L, Davis-Smyth, T., Zheng, T., and Michelotti, E. F. (1997). DNA conformation, topology, and the regulation of c-myc expression. Curr Top Microbiol Immunol 224, 33-46. Lewin, B. (1998). The mystique of epigenetics. Cell 93, 301-303. Lilley, D. M., and Higgins, C. F. (1991). Local DNA topology and gene expression: the case of the leu-500 promoter. Mol Microbiol 5, 779-783. Liu, L. F., and Wang, J. C. (1987). Supercoiling of the DNA template during transcription. Proc Natl Acad Sci USA 84, 7024-7027. Ljungman, M., and Hanawalt, P. C. (1992). Localized torsional tension in the DNA of human cells. Proc Natl Acad Sci USA 89, 6055-6059. Ljungman, M., and Hanawalt, P. C. (1995). Presence of negative torsional tension in the promoter region of the transcriptionally poised dihydrofolate reductase gene in vivo. Nucleic Acids Res 23, 1782-1789. Loo, S., and Rine, J. (1994). Silencers and domains of generalized repression. Science 2(54, 1768-1771. Lustig, A. J. (1998). Mechanisms of silencing in Saccharomyces cerevisiae. Curr Opin Genet Dev 8, 233-239. Lynch, A. S., and Wang, J. C. (1995). SopB protein-mediated silencing of genes linked to the sopC locus o^ Escherichia coli F plasmid. Proc Natl Acad Sci USA 92, 1896-1900. Majumder, A., Fang, M., Tsai, K. J., Ueguchi, C , Mizuno, T., and Wu, H. Y. (2001). LeuO expression in response to starvation for branched-chain amino acids. J Biol Chem 276, 19046-19051. Margolin, R, and Mukai, F. H. (1966). A model for mRNA transcription suggested by some characteristics of 2-aminopurine mutagenesis in Salmonella. Proc Natl Acad Sci USA 55, 282-289. Margolin, P., Zumstein, L., Stemglanz, R., and Wang, J. C. (1985). The Escherichia coli supXXocu^ is topA, the structural gene for DNA topoisomerase L Proc Natl Acad Sci USA 82, 5437-5441. Menzel, R., and Gellert, M. (1987). Modulation of transcription

479

by DNA supercoiling: a deletion analysis of the Escherichia coli gyrA and gyrB promoters. Proc Natl Acad Sci USA 84, 4185-4189. Menzel, R., and Gellert, M. (1994). The biochemistry and biology of DNA gyrase. Adv Pharmacol 29A, 39-69. Opel, M. L., Arfm, S. M., and Hatfield, G. W. (2001). The effects of DNA supercoiling on the expression of operons of the ilv regulon of Escherichia coli suggest a physiological rationale for divergently transcribed operons. Mol Microbiol 39, 1109-1115. Opel, M. L., and Hatfield, G. W (2001). DNA supercoiling-dependent transcriptional coupling between the divergently transcribed promoters of the ilvYC operon of Escherichia coli is proportional to promoter strengths and transcript lengths. Mol Microbiol 39, 191-198. Pruitt, S. C , and Reeder, R. H. (1984). Effect of topological constraint on transcription of ribosomal DNA in Xenopus oocytes. Comparison of plasmid and endogenous genes. J Mol Biol 174, 121-139. Pruss, G. J., and Drlica, K. (1989). DNA supercoiling and prokaryotic transcription. Cell 5(5, 521-523. Reynolds, A. E., Mahadevan, S., LeGrice, S. F., and Wright, A. (1986). Enhancement of bacterial gene expression by insertion elements or by mutation in a CAP-cAMP binding site. J Mol Biol 191, 85-95. Richardson, S. M., Higgins, C. F., and Lilley, D. M. (1988). DNA supercoiling and the leu-500 promoter mutation of Salmonella typhimurium. Embo J 7, 1863-1869. Rimsky, S. (2004). Structure of the histone-like protein H-NS and its role in regulation and genome superstructure. Curr Opin Microbiol 7, 109-114. Rodionov, O., Lobocka, M., and Yarmolinsky, M. (1999). Silencing of genes flanking the PI plasmid centromere. Science 283, 546-549. Schaefler, S. (1967). Inducible system for the utiHzation of beta-glucosides in Escherichia coli. I. Active transport and utilization of beta-glucosides. J Bacteriol 93, 254-263. Schnetz, K. (1995). Silencing oi Escherichia coli Z?g/promoter by flanking sequence elements. Embo J 14, 2545-2550. Schnetz, K., and Rak, B. (1992). IS5: a mobile enhancer of transcription in Escherichia coli. Proc Natl Acad Sci USA 89, 1244-1248. Sheridan, S. D., Benham, C. J., and Hatfield, G. W (1999). Inhibition of DNA supercoiling-dependent transcriptional activation by a distant B-DNA to Z-DNA transition. J Biol Chem 274,8169-8174. Sinden, R. R., Carlson, J. O., and Pettijohn, D. E. (1980). Torsional tension in the DNA double helix measured with trimethylpsoralen in living E. coli cells: analogous measurements in insect and human cells. Cell 21,113-1^3. Spirito, F., and Bossi, L. (1996). Long-distance effect of downstream transcription on activity of the supercoiling-sensitive leu-500 promoter in a topA mutant of Salmonella typhimurium. J

480'

Section V

Bacteriol 775, 7129-7137. Spurio, R., Falconi, M., Brandi, A., Pon, C. L., and Gualerzi, C. O. (1997). The oligomeric structure of nucleoid protein H-NS is necessary for recognition of intrinsically curved DNA and for DNA bending. Embo J 16, 1795-1805. Tan, J., Shu, L., and Wu, H. Y. (1994). Activation of the leu-500 promoter by adjacent transcription. J Bacteriol 176, 1077-1086. Travers, A., Schneider, R., and Muskhelishvili, G. (2001). DNA supercoiling and transcription in Escherichia colt The FIS connection. Biochimie 83, 213-217. Trinklein, N. D., Aldred, S. F., Hartman, S. J., Schroeder, D. I., Otillar, R. R, and Myers, R. M. (2004). An abundance of bidirectional promoters in the human genome. Genome Res 14, 62-66. Trucksis, M., and Depew, R. E. (1981). Identification and localization of a gene that specifies production of Escherichia coli DNA topoisomerase I. Proc Natl Acad Sci USA 78, 2164-2168. Tsao, Y. R, Wu, H. Y, and Liu, L. R (1989). Transcription-driven supercoiling of DNA: direct biochemical evidence from in vitro studies. Cell 5(5, 111-118. Ueguchi, C , Ohta, T., Seto, C , Suzuki, T., and Mizuno, T. (1998). The leuO gene product has a latent ability to relieve bgl silencing in Escherichia coli. J Bacteriol 180, 190-193. Ueguchi, C , Suzuki, T., Yoshida, T, Tanaka, K., and Mizuno, T. (1996). Systematic mutational analysis revealing the functional domain organization of Escherichia co//nucleoid protein H-NS. J Mol Biol 265, 149-162.

Special Topics Van Ulsen, P., Hillebrand, M., Zulianello, L., van de Putte, P., and Goosen, N. (1996). Integration host factor alleviates the H-NS-mediated repression of the early promoter of bacteriophage Mu. Mol Microbiol 21, 567-578. Wakimoto, B. T. (1998). Beyond the nucleosome: epigenetic aspects of position-effect variegation in Drosophila. Cell 93, 321-324. Wang, J. C. (1996). DNA topoisomerases. Annu Rev Biochem 65, 635-692. White-Ziegler, C. A., Angus Hill, M. L., Braaten, B. A., van der Woude, M. W, and Low, D. A. (1998). Thermoregulation of Escherichia coli pap transcription: H-NS is a temperature-dependent DNA methylation blocking factor. Mol Microbiol 25, 1121-1137. Whitehouse, C , Chambers, J., Catteau, A., and Solomon, E. (2004). Brcal expression is regulated by a bidirectional promoter that is shared by the Nbrl gene in mouse. Gene 326, 87-96. Workman, J. L., and Kingston, R. E. (1998). Alteration of nucleosome structure as a mechanism of transcriptional regulation. Annu Rev Biochem 67, 545-579. Wu, H. Y, Shyy, S. H., Wang, J. C , and Liu, L. R (1988). Transcription generates positively and negatively supercoiled domains in the template. Cell 53, 433-440. Wu, H. Y, Tan, J., and Fang, M. (1995). Long-range interaction between two promoters: activation of the leu-500 promoter by a distant upstream promoter. Cell 82, 445-451. Yarmolinsky, M. (2000). Transcriptional silencing in bacteria. Curr Opin Microbiol J, 138-143.

Chapter 29 The Biogenesis and Function of MicroRNAs Yan Zeng and Bryan R. CuUen Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, NC27710

Key Words: microRNA, RNA interference, post transcriptional gene regulation RNA processing

Summary MicroRNAs are a large family of approximately 22 nucleotide long, non-coding RNAs processed from stemloop secondary structures. Current evidence indicates that miRNAs negatively regulate the expression of their target genes in plants and animals. Introduction and History In addition to rRNA, mRNA, and tRNA, the three major classes of RNAs responsible for information flow from DNA to protein, there are other types of noncoding RNAs that play important catalytic, structural, and regulatory roles in cells. Examples include RNase P RNA, 7S signal recognition particle RNA, tmRNA involved in bacterial protein degradation, small nucleolar RNAs involved in modification and maturation of rRNAs and other RNAs, spliceosomal RNAs, telomerase RNA, antisense transcripts, and many other RNAs involved in dosage compensation, imprinting, modulating RNA polymerase activity, and stress responses. Some of these RNAs are discussed in other chapters in this volume. In this chapter we will focus on a group of-22 nucleotide (nt) long RNAs called microRNAs (miRNAs). The first miRNA was reported in 1993 as the result of an effort to clone the lin-4 gene, mutation of which caused developmental timing defects in C elegans. More than three years of hard work established that lin-4 encoded not a protein, but a 21 nt RNA (Lee et al, 1993; Lee et al, 2004a). Although some regulatory

RNAs were known at the time, their mechanisms of action were not well understood, and lin-4 RNA seemed incredibly small. Fortunately, a target of lin-4, lin-14, was already known, and it was soon realized that the 3' untranslated region (3' UTR) of lin-14 mRNA contained seven sequence elements partially complementary to lin-4, giving credence to the notion that the small RNA was indeedfiinctional(Lee et al, 1993; Wightman et aL, 1993; Ruvkun et aL, 2004). A mechanism was fiirther proposed that through RNA:RNA hybridization, the lin-4 noncoding RNA inhibited lin-14 mRNA translation. The identification of a second miRNA, let-7, was reported in 2000, also from C elegans (Pasquinelli, et aL, 2000; Reinhart et aL, 2000). Unlike lin-4, let-7 homologs and their potential targets could be readily identified in the genomes of other species, including mammals, which suggested that these small RNAs might not be just developmental oddities in worms after all. Around the same time, RNA interference (RNAi) was drawing great attention to the realm of small RNAs. A gene silencing phenomenon, RNAi was first conclusively demonstrated in 1998, when the introduction of long double-stranded (ds) RNAs into C elegans was shown to cause the degradation of homologous mRNAs (Fire et aL, 1998). Analogous observations had previously been documented in other organisms, including plants (Baulcombe, 2004). It was then discovered that in plants undergoing gene silencing, -25 nt long RNAs accumulated that corresponded to the silencing triggers in sequence (Hamilton and Baulcombe, 1999). This result was confirmed and extended in animal systems, as these small RNAs were cloned and turned out to be the processed products of the initial long dsRNAs and the eventual effectors of RNAi, hence the name small interfering RNAs or siRNAs (Yang et aL, 2000; Zamore

Corresponding Author: Bryan R. Cullen, Duke University Medical Center, Box 3025, Durham, NC USA. Tel: (919) 684-3369, Fax: (919) 681-8979, E-mail: [email protected]

482

Section V

Special Topics

et al, 2000; Elbashir et aL, 2001). Significantly, when cloning methods were applied to naive cells, dozens of endogenous -22 nt RNAs were identified, revealing a world of tiny RNAs, with lm-4 and let-7 being the founding members (Lagos-Quintana et al, 2001; Lau et al, 2002; Lee and Ambros, 2001). There are also virus-encoded miRNAs expressed in virus-infected cells (Pfeffer et a/., 2004). Since then, RNA cloning and bioinformatic search efforts have shown that these tiny RNAs, termed miRNAs, are numerous and widespread, and have potentially prevalent ftmctions in multicellular eukaryotes.

internal loops. The characteristics of such a secondary structure have allowed computational methods to predict new miRNAs on a genome-wide basis (reviewed by Bartel, 2004). Prediction also made use of phylogenetic conservation. Thus, most C elegans stem-loop miRNA features should also be present in the closely related species C briggsae, and a predicted miRNA from Arabidopsis is likely a bona fide one if it is also found in rice or maize. Such approaches have estimated that there are hundreds of miRNA genes, constituting -0.5-1% of the predicted genes in plant and animal genomes (Bartel, 2004). An online miRNA registry (http://www.sanger.ac.uk/Software/Rfam/mima/) has been established to catalog all the miRNAs in various organisms with links to their genomic DNA information (Ambros et a/., 2003a). So far, no miRNA has been found in unicellular eukaryotes such as budding yeast and fission yeast. Both animals and plants express miRNAs, but no homology is apparent between hundreds of animal miRNAs and plant miRNAs (Bartel, 2004). There is, however, conservation among animal miRNAs or among plant miRNAs. For example, - 3 0 % of C. elegans miRNAs have homologs in vertebrates, although their target mRNAs may have diverged. These observations suggest that miRNA genes arose independently and early in the two lineages leading up to animals and plants. Considering that fission yeast has a simplified RNAi apparatus (Volpe et al., 2002), which is also used for the biogenesis and fiinctions of miRNAs in higher eukaryotes, perhaps the expansion of genome size and demand for more complicated developmental and metabolic regulation led to the appearance of miRNAs, processed and used by the more ancient and extant RNAi pathway.

How Many miRNAs are There? Most miRNAs are 20 nt to 25 nt in length. Their sequences are diverse, although a majority have a U residue at their 5' end (Lau et al, 2001). Some miRNAs are expressed relatively broadly, while others have tissuespecific or developmental stage-specific expression patterns. As a result, the abundance of any particular miRNA may vary greatly depending on cell type. The copy number of highly expressed miRNAs can be more than 10 per cell, a number on a par with that of U6 snRNA and much higher than those of mRNAs (Lim et aU 2003). A salient feature of miRNAs is that they are located within stretches of sequences that are predicted by computer folding programs to form stem-loop structures, with the mature miRNA residing within one arm of the stem (Fig.29.1). The miRNA stem-loop structures in plants (Fig.29.1B) tend to be more variable and longer than those in animals (Fig.29.1 A). Unlike the long, perfectly complementary dsRNAs that are the precursors of siRNAs, the stem regions of the hairpin structures that eventually give rise to miRNAs (see below) are much shorter and contain bulges and/or

G 5' - - C C G

Ul' CCUG

CXX

U C A U U (lAGA CVCA CiUCHJGAG GUA-C A

Mi I I I I I I I I I II II I I I I I I I I I I I I I y --GGC GGAC GGG CUCU GGGU CACACUU-CGU G U A CAU C C C A U B UG 5' --AAGAA-GA-G AGAG I I II i M I I I II 3' —UUCUU CU U U C U C U

Fig.29.1

AGU

U

G C C C C GAAC U CGCUGGA GCAG GGUU AUCGAUOJ U U C U G U ACAU A M I II II I I I I I I I I I I I I i I I I I I I I I I MM A GCCJAC C U CCiU (XAA IJACKlJAGA AAG A C G UGUA A

CGUUU

A

D

A

U

U

AAAA

A

miRNA-encoding hairpin structures predicted by computer programs. Mature miRNA sequences are indicated in red. (A)

C elegans lin-4. (B) Arabidopsis

miRI62a. There are two miR162 loci, a and b, and both encode identical miRNAs.

Chapter 29

The Biogenesis and Function of MicroRNAs

'483

Transcription

plant pri-miRNA

animal pri-miRNA

A)

^iiii iiiintii i m i ^ DCLl

Drosha/DGCR8 in imi^Q pre-miRNA

III inimii i i m ^

i

Exp5/Ran-GTP

nucleus cytoplasm

DCLl

xacmzdjQ

1 ^^^^

I Dicer III mil

RISC

miRNAimiRNA*

nucleus cytoplasm

"Exp5/Ran-GTP miRNA:miRNA*

mature miRNA RISC

Fig.29.2

mature miRNA

miRNA biogenesis pathways in animals (A) and plants (B).

How are mlRNAs Made? The biogenesis of miRNAs follows these stages: transcription, nuclear processing, export, and cytoplasmic processing (Fig.29.2) (Bartel, 2004; Cullen, 2004). There are some differences between the maturation of animal miRNAs (Fig. 29.2A) and that of plant miRNAs (Fig. 29.2B), as will be noted below. A: Transcription miRNAs are first transcribed as part of a much longer primary transcript (pri-miRNA, Lee et al., 2002). According to genome sequence information, many miRNAs are located within the intronic regions of annotated protein-coding or non-protein-coding genes (Rodriguez et aL, 2004). These miRNAs could therefore use their host gene transcripts as carriers, although the possibility still exists that some are actually transcribed separately. Other miRNAs have their own transcriptional regulatory elements and thus constitute independent transcription units, miRNA transcription is reminiscent of the transcription of another class of RNAs, snoRNAs, snoRNAs are either transcribed independently or encoded by introns of protein-coding host genes (Maxwell and Foumier, 1995). The primary transcripts of a few miRNAs have been experimentally analyzed (reviewed by Cullen, 2004). Usually their full length versions are quite long

(>1 kb) and have a 5' 7-methyl guanosine cap and a 3' poly(A) tail. These are the characteristics of RNA polymerase II (Pol II) transcripts. Since the expression of many miRNAs is temporally or spatially regulated, another hallmark of Pol II transcription, those miRNAs are also likely transcribed by Pol II. Available evidence, therefore, indicates that most, if not all, miRNAs are Pol II products, although the involvement of other RNA polymerases (such as Pol III) in the transcription of certain miRNAs cannot be entirely excluded. B: Cleavage Steps Like other RNAs in the eukaryotic cells, once transcribed, miRNAs also go through a maturation process. An enzyme called Drosha catalyzes a key reaction whereby a 60-70 nt hairpin RNA (precursor miRNA, or pre-miRNA) containing the mature miRNA is excised from the pri-miRNA in mammals (Fig.29.2A) (Lee et al., 2003). Drosha belongs to a class of RNase III type endonucleases (Fig.29.3A), which generate duplex RNA products containing a 5' phosphate and a 3'-0H, with usually a 2 nt overhang at the 3' end. To promote pre-miRNA excision, Drosha requires at least one extra protein partner, DGCR8 in humans, whose gene is often monoallelically deleted in DiGeorge Syndrome (Shiohama et al., 2003; Denli et ai, 2004; Gregory et al, 2004; Han et al, 2004). DGCR8 is evolutionarily conserved and contains two double-

Section V

484

Stranded RNA binding domains (Fig.29.3A). This property likely helps Drosha to recognize the right substrates and to cut at the desired positions within pri-miRNAs, while ignoring a large background of other hairpin RNA structures in vivo. In addition, because pri-miRNAs are different in sequence and structural details, some RNAs might be better Drosha substrates than others. What pri-miRNA features then does the Drosha holoenzyme (Drosha for short) recognize? Both cell culture experiments and in vitro Drosha pri-miRNA cleavage assays have shown that, for processing to occur, a few extra paired residues are required outside the eventual pre-miRNA product (Lee et aL, 2003; Zeng and Cullen, 2003). The local structure/sequence surrounding the excision sites may also affect the positions where Drosha cleaves (Zeng et aL, 2005). Because this region must fit into the active site of Drosha, these requirements perhaps reflect the preference by Drosha for a substrate in a largely helical state before catalysis and the fact that a slight distortion of the RNA helix might alter how individual nucleotides interact with amino acid residues in the catalytic center of the RNase III domains. At the other side of the hairpin, a large terminal loop (usually >10 nt) is also needed for processing (Zeng et aL, 2005). Although commonly used computer folding programs tend to predict much smaller terminal loops for premiRNAs, mutations that artificially stabilize those small loops compromise Drosha cleavage of pri-miRNAs. Thus, it appears that the structure of the terminal loop region may be inherently flexible, and that Drosha selects the one with a more open conformation. Furthermore, the loop may be an important anchor for Drosha to orient and position its catalytic residues near the bottom of the stem. The region in the middle of the stem-loop structure that includes the mature miRNA is not a major discriminator for Drosha, as long as it

Special Topics

maintains a predominantly dsRNA backbone (Zeng and Cullen, 2003). Recognition by Drosha does not require the 5' and 3' end structures of a completely synthesized primiRNA, which implies that miRNA processing could take place automatically following transcription. Consistent with this hypothesis, miRNAs can be artificially expressed from irrelevant Pol II and Pol III promoters in animal cells (Zeng et aL, 2002, 2005; Chen et aL, 2004). It also suggests that differential transcription is likely the main reason for the differential expression of most miRNAs, because if Drosha cleavage or any other downstream event is disrupted in a particular cell type, these cells will make little or no miRNAs at all. Instead, different cell types produce some but not the entire miRNA repertoire encoded by the same genome. On the other hand, just as there is coupling between mRNA transcription and mRNA splicing, a connection between miRNA transcription and processing remains possible. Drosha is primarily a nuclear protein. For premiRNAs produced by Drosha to reach Dicer, which is cytoplasmic in mammaUan cells (Billy et aL, 2001), pre-miRNAs must exit the nucleus. This step is fulfilled by Exportin 5 (Exp5) and its Ran-GTP cofactor (Yi et aL, 2003; Bohnsack et aL, 2004; Lund et aL, 2004). Exp5 is a member of the karyopherin family that mediates macromolecule transport across the nuclear envelope. Exp5 is specialized at binding to minihelixcontaining RNAs with a 3' overhang (Gwizdek et al, 2003), such as adenovirus VAl RNA, tRNAs, and pre-miRNAs. Exp5 needs Ran-GTP to bind to its cargo, once in the cytoplasm and stimulated by the RanGTPaseactivating protein, Ran-GTP is converted to Ran-GDP, leading to the release of the RNA cargo by Exp5. Dicer would then have access to pre-miRNAs. Dicer is another RNase Ill-type enzyme (Fig. 29.3B)

Drosha

iProline-rich

[03[

DGCR8

Dicer

Argonaute2 Fig. 29.3 domain.

Domain structures of human Drosha and DGCR8 (A), Dicer (B), and Argonaute2 (C). R: double-stranded RNA binding

Chapter 29

The Biogenesis and Function of MicroRNAs

that excises mature miRNAs from pre-miRNAs (Grishok et al, 2001; Hutvagner et ai, 2001; Ketting et al, 2001; Provost et al, 2002; Zhang et aL, 2002). Most Dicer proteins possess an -'130-amino-acid-long PAZ domain, which preferentially binds single-stranded 3' ends of nucleic acids (reviewed by Lingel and Izaurralde, 2004). It has been proposed that human Dicer recognizes a pre-miRNA with an ~2 nt 3' overhang via its PAZ domain, and then cleaves the double-stranded region '-20 nt away, with a single catalytic center formed intramolecularly by the two RNase III domains (Zhang et al., 2004). The result is a miRNAimiRNA* duplex containing ~ 2 nt overhangs at both 3' ends (Fig. 29.2). Similarly, human Dicer chews from the free ends of a long dsRNA in a stepwise fashion to generate a series of siRNAs. Interestingly, although mammals and C elegans encode only one Dicer, Drosophila has two Dicer proteins, Dcr-1 and Dcr-2, with relatively specialized fiinctions (Liu et al, 2003; Lee et al, 2004c; Pham et al, 2004). Dcr-1 directs miRNA biogenesis, whereas Dcr-2 is the major enzyme that produces siRNAs from long dsRNAs. At the sequence level, Dcr-2 has a functional helicase domain, but lacks a PAZ domain, the opposite is true for Dcr-1. Such an intrinsic difference may explain why Dcr-1 and Dcr-2 prefer different substrates. Furthermore, Dcr-1 and Dcr-2 may recruit different protein partners to aid in theirfiinctionsin vivo. The plant Arabidopsis thaliana encodes four Dicerlike enzymes (DCL1-DCL4), but no Drosha (Bartel, 2004). DCLl is responsible for generating RNA intermediates from pri-miRNAs, leading to the eventual production of mature miRNAs (Reinhart et al, 2002; Papp et a/., 2003; Kurihara and Watanabe, 2004). It has been demonstrated that DCLl first cuts near the bottom of an extensive stem-loop structure in a pri-miRNA (Fig. 29.2B) (Kurihara and Watanabe, 2004). This releases a long hairpin RNA, which is similar to a long dsRNA. DCLl then duly trims --21 nt from the free ends progressively into the stem. As DCLl is localized in the nucleus, miRNA:miRNA* duplexes are also produced in the nucleus, unlike the situation in mammals. Plants do express Exp5 and Ran orthologs, which likely mediate the nuclear export of miRNA duplexes (Bartel, 2004).

485

of "miRNA*" has been used to represent the strand that is underrepresented or even "lost" in the final products (Lau et aL, 2001; Lim et al, 2003). Such polarity is set after Dicer cleavage but before the incorporation of miRNA into RISC (RNA-induced silencing complex, see below) or a similar functional complex, during which the miRNA:miRNA* duplex is unwound, and the strand (by definition, the miRNA strand) with less stable hydrogen bonding at its 5' end within the original duplex is retained, while the complementary strand, miRNA*, is released and degraded (Khvorova et al, 2003; Schwarz et al, 2003). The selection procedure thus determines the ratio of final miRNA products by comparing the thermodynamic stability at opposite ends of a -22 nt long miRNAimiRNA* duplex. This property may partly explain why most miRNAs have a U residue at their 5' ends, for a U:G base pair is less stable than a U:A pair, which in turn is less stable than a G:C pair. Being incorporated into protein complexes may stabilize mature miRNAs as well. If hydrogen bonds at both ends have similar strength, then miRNA* can also accumulate, which was indeed observed as more miRNAs were cloned and sequenced. The same principle likewise governs the way siRNAs are utilized in vivo. In Drosophila extracts, the establishment of asymmetry depends on the differential binding to the two individual siRNA strands by Dcr-2 and R2D2, a Dcr-2 interacting protein, and the participation of a helicase(s) (Tomari et al, 2004b). Dicer would then interact with, and therefore transfer, the active siRNA strand to RISC. By restricting the sequences of the ultimate, functional miRNAs, the miRNA asymmetry rule imposes an additional layer of quality control over miRNA expression. Because the hairpin structure encoding a miRNA has a longer stem than the miRNAimiRNA* intermediate, and because Drosha and/or Dicer may be intrinsically flexible enzymes and may cleave different RNA conformers at slightly different positions, one pri-miRNA sequence can conceivably produce several slightly shifted and therefore distinct miRNAimiRNA* duplexes. Since these duplexes have different 5' and/or 3' ends, they would contribute different sequences and strands to the eventual stable products. By eliminating half of the miRNAs in the duplexes, the selection process thus suppresses the "noise" of miRNA C: Cytoplasmic Selection of the Mature miRNA Strand expression, yet in rare cases it can also lead to a complete switch of strand bias. When the first batch of endogenous miRNAs was biochemically cloned, it was noted that one precursor almost invariably gives rise to only one strand of mature What can miRNAs do? miRNA, which resides on either the 5' or 3' side, but not A: Basic Mechanisms both sides, of the hairpin (Lagos-Quintana et al., 2001; There are two appreciated modes of action by Lau et al, 2002; Lee and Ambros, 2001). The notation

Section V

486

miRNAs, both involving basepairing between miRNAs and their target RNAs (mostly, if not exclusively, mRNAs) that guides the relevant effector protein complex(es) to inhibit the expression of target genes (Bartel, 2004) The first method is to repress the translation of mRNA targets. This mechanism was initially put forwards to explain how lin-4 negatively regulates its target, lin-14 mRNA, based on the observation that lin-4 expression leads to the reduction of LIN-14 protein but not mRNA levels (Lee et a/., 1993; Wightman et al, 1993). The 3' UTR of lin-14 mRNA confers lin'4 responsiveness through seven sequence elements (referred to as target sites hereafter) that are partially complementary to lin-4 (Fig. 29.4A). The presence of multiple sites could allow for a strong and sensitive response to changes in lin-4 miRNA levels, i.e., cooperativity of lin-4 regulation.

lin-14 mK^\

3' UTR

II III II UUC-UAC

III

III

•AAAAA

CUCAGGGAAC

llllllllll

-UGAGUGUGAACUCCAGAGUCCCUUG—

lin-4

DCLl mRNA

GAGCUGGAUGCAGAGGUAUUAUCGAUGU

illlllllllllll

lllllll

3'~GACCUACGUCUCCA-AAUAGCU—5'

miR162

Fig.29.4 Complementarity between miRNAs and targets. (A) The 3' UTR of C. elegans lin-14 mRNA contains seven sequence elements (depicted by black boxes) partial complementary to lin-4. Sequence of the fifth element is shown below (Wightman et al., 1993). (B) The protein coding region of Arabidopsis DCLl mRNA contains a near perfect match to miR162. Cleavage site on the mRNA is indicated by an arrow (Xie et al, 2003).

Following the paradigm of the lin-4:lin-14 pair, subsequent research has indicated that, in the majority of the cases, animal miRNA target sites on mRNAs (experimentally confirmed or computer predicted) contain multiple mismatches, therefore relatively low

Special Topics

complementarity, to their respective miRNAs, and that the target sites are located in the 3' UTR of mRNAs (Bartel, 2004). Reporter assays have indeed demonstrated the ability of animal miRNAs to downregulate the expression of their targets (Zeng et al, 2002; Lewis et al, 2003). How miRNAs inhibit translation, however, has remained obscure. The polysome profile of lin-14 mRNA does not change significantly whether lin-4 is present or not (Olsen and Ambros, 1999). Thus, lin-4 does not block translation initiation of the bulk of lin-14 mRNA. It has also been observed that the 5' half of a miRNA contributes more to target selection than the 3' half does (Lewis et al, 2003; Stark et al, 2003; Doench and Sharp, 2004). This raises an important question as to how the specificity of target recognition by miRNAs is achieved, because a miRNA might be able to target an mRNA after forming a loose duplex with fewer than 10 bp. Such a weak interaction is expected to affect mRNA expression at best modestly, but if several miRNAs could target the same mRNA, then the effect might be significant. Regardless of the details, translation repression is likely the predominant mechanism by which animal miRNAs exert their functions. The second means by which miRNAs inhibit gene expression is to initiate RNA cleavage and degradation via the canonical RNAi pathway. RNAi and related phenomena are conservedfromfixngito higher eukaryotes and triggered by dsRNAs that are either endogenously expressed or exogenously introduced into cells. These triggers may be long, perfectly or near perfectly matched dsRNAs that are virus-encoded or arise due to bi-directional transcription from opposite promoters, cellular ssRNAs that form extended foldback structures, or products of RNA-dependent RNA polymerases. Dicer then converts long dsRNAs into -21 nt siRNA duplexes. In at least certain organisms siRNAs have been shown to have multifaceted functions (Lippman and Martienssen, 2004): they are involved in genome rearrangement, DNA methylation, heterochromatin formation, and mRNA degradation, the last being the best studied example of RNAi. The RNA-induced silencing complex (RISC) is the effector for RNAi-mediated mRNA degradation (Hammond et al, 2000). A RISC-bound single stranded siRNA would anneal to a highly homologous mRNA target and guide the protein components of RISC to hydrolyze the linkage in the mRNA at a position corresponding to between nt 10 and 11 of the siRNA as measured from its 5' end (Elbashir et al, 2001). The cleaved mRNA is no longer functional and is subsequently degraded by other cellular RNases, such as XRN4 in Arabidopsis (Souret et al, 2004). Because the biogenesis

Chapter 29

The Biogenesis and Function of MicroRNAs

487

of miRNAs and that of siRNAs overlap, and because miRNAs are chemically indistinguishable from siRNAs, miRNAs can also enter the RNAi pathway to degrade mRNA targets, provided that the targets have high levels of complementary to the miRNA. In general, plant miRNAs and their target sites are perfectly or nearly perfectly complementary (0-3 mismatches, Fig. 29.4B). Several plant miRNAs have been experimentally confirmed to mediate the cleavage of their respective target mRNAs (Bartel, 2004; Baulcombe, 2004). The cleavage site is not restricted to the 3' UTR, it can be in the coding region, for instance. RNAi-led degradation permanently changes the fate of a mRNA molecule, therefore if there is any prior effect on translation, it will be masked. One should note that it is still at least theoretically possible for plant miRNAs to inhibit the translation of mRNAs with weaker homology, as in the case of most animal miRNAs. Conversely, if an animal miRNA is presented with a perfect target, the miRNA is also capable of triggering target cleavage through RNAi (Zeng et al, 2002, 2003; Hutvagner and Zamore, 2002; Doench et al, 2003; Yetka et al, 2004).

endonuclease activity resides within the PIWI domain of Ago2 (Liu et al, 2004; Song et al, 2004). Interestingly, although human Agol through Ago4 all have the ability to bind siRNAs and miRNAs, only Ago2 has the nuclease activity (Liu et al., 2004; Meister et al, 2004). Perhaps Ago proteins with different primary structures have different biochemical properties and form distinctive RISC-like entities. In addition, they may be differentially expressed in different tissues and at different developmental stages. Related to their functions, one can imagine that they might have different RNA substrates and elicit different biological outcomes, such as RNA degradation, translation repression, and changes in DNA and chromatin structures. Besides Ago family members, many other proteins also contribute to RNAi and related mechanisms. As mentioned above, fly Dcr-2 and R2D2 help load siRNAs onto RISC (Tomari et ah, 2004b). Additional examples include a RNA-dependent RNA polymerase, helicases, and numerous RNA-binding proteins (Sijen^^ al, 2001; Caudy et al, 2002; Hutvagner and Zamore, 2002; Ishizuka et al, 2002; Tabara et al, 2002; Cook et al, 2004; Tomari et al, 2004a).

B: Protein Cofactors Genetic and biochemical studies have identified many proteins involved in executing the functions of miRNAs and siRNAs. A family of conserved Argonaute (Ago) proteins turn out to play a pivotal role in this process (Carmell et al, 2002). Present in archaebacteria, unicellular eukaryotes, worms,flies,plants, and mammals. Ago genes encode -100 kD, highly basic proteins that contain an N-terminal PAZ domain (the same domain as in human Dicer), and a C-terminal ~ 200-amino-acidlong PIWI domain (Fig.29.3C). Ago proteins perform a variety of functions that include stem cell maintenance, DNA elimination, developmental regulation, transcriptional and post-transcriptional gene silencing. The molecular details of how Ago proteins accomplish their tasks are still being worked out, but a common scheme has emerged that they bind RNA and likely act through RNA-related mechanisms. This revelation has come, in part, from studies of RNAi and miRNAs. At least some Ago family members associate with miRNAs and siRNAs and are required for miRNA accumulation and function in vivo (Hutvagner and Zamore, 2002; Mourelatos et a/., 2002; Liu et al, 2004; Meister et al, 2004; Okamura et al, 2004; Shi et al, 2004; Vaucheret et al, 2004). Furthermore, they constitute the core component of RISC, and mammalian Ago2 protein serves as the active endonuclease that cleaves target mRNAs (Hammond et al, 2001; Liu et al, 2004). The

C:Examples of miRNA Function The cellular machinery that generates and utilizes miRNAs is highly conserved in multicellular organisms. In both plant and animal kingdoms, mutations in Argonaute family members. Dicer, Drosha, and DGCR8 tend to cause pleiotropic developmental defects, even embryonic lethality, suggesting that en masse miRNAs and endogenous siRNAs play crucial biological roles (Bohmert et ai, 1998; Grishok et al, 2001; Harris and Macdonald, 2001; Kataoka et al, 2001; Ketting et al, 2001; Knight and Bass, 2001; Reinhart et al, 2002; Williams and Rubin, 2002; Bernstein et al, 2003; Denh et al., 2004; Lee et al, 2004c; Liu et al, 2004). Below we describe some of the cases to provide a glimpse into the complex cellular regulatory networks enforced by individual miRNAs.C elegans lin-4 as the prototypic miRNA has two known target mRNAs, lin-14 and lin-28, that regulate developmental timing (Fig. 29.5A) (Lee et al, 1993; Wightman et al, 1993; Moss et al, 1997). There are three developmental stages in a worm life cycle: embryonic, larval, and adult stages. The larval (L) stage can be further sub-divided into LI, L2, L3, and L4 stages. Although the exact mechanisms remain unknown, the gene product encoded by lin-14 activates LI-specific events but inhibits later events, and lin-28 inhibits L3-specific events. Consequently, progression from LI to L2 requires downregulating lin-14 expression, and progression from L2 to L3

Section V

488

requires lin-28 downregulation. The miRNA encoded by lin-4 starts to accumulate during the LI stage and persists afterwards. By binding to target sites present in the 3'UTRs oflin-14 and lin-28 mRNAs, lin-4 miRNA inhibits their expression to clear the way for the appropriate developmental transitions to proceed. Mutations of lin-4 target sites allow lin-14 or lin-28 to bypass the regulatory relationship, so does mutation of lin-4 itself There are seven lin-4 complementary sites in lin-14 3'UTR (Fig.29.4A). The other lin-4 target mRNA, lin-28, however, has only one complementary site, so it is not always necessary to have multiple target sites for a single miRNA. An intriguing possibility remains that there is combinatorial regulation by more than one distinct miRNA (Seggerson et al., 2002).

B miR-273 — | die-1 •• lys-6 1 cog-1 In ASEL: miR-273 i ,then cog-1 \ In ASER:

miR-273 t ,then cog-1 t

Fig.29.5 Examples of miRNA function. (A) C. elegans lin-4 inhibits the expression of lin-14 to promote transition from LI to L2 stages. In addition, lin-4 inhibits lin-28 to promote L2 to L3 transition (Moss et al, 1997). (B) miRNAs control cell fate determination of ASEL and ASER in C elegans. Dashed arrow indicates the relationship between die-1 and lyS'6 can be direct or indirect.

Another example of miRNA function is neuronal cell fate determination in C elegans. Two worm taste receptor neurons, ASE left (ASEL) and ASE right (ASER), while morphologically similar, express separate chemoreceptors and respond differently to different chemicals. The cog-1 gene encodes one of the transcription factors specifying ASEL vs ASER: cog-1 is active in ASER, but not in ASEL (Fig.29.5B) (Robert, 2004). The 3' UTR of cog-1 mRNA contains a sequence partially complementary to a miRNA called lys-6 (Johnston and Robert, 2003). It has been shown that lys-6 is both necessary and sufficient for the repression of cog-1. Based on a reporter assay, lys-6 miRNA is expressed in perhaps only 9 neurons in a whole animal, including ASEL, but not ASER. How, then, is lys-6 miRNA restricted to ASEL? In ASEL, another transcription factor encoded by the die-1 gene is necessary for lys-6 expression, whereas in ASER, die-1

Special Topics

expression is repressed at least partly due to another miRNA, miR-273 (Chang et al., 2004). There are two miR-273 complementary elements in the 3' UTR of die-1 mRNA, and both are essential for die-1 downregulation. For some yet-to-be-determined reason, there is less miR-273 in ASEL, a distinction leading to a cascade that ultimately gives rise to two functionally asymmetric neurons (Fig. 29.5B). In Drosophila, the bantam gene encodes a miRNA that enhances cell proliferation and inhibits apoptosis (Brennecke et al, 2003). Thus, reduced bantam expression leads to smaller organs and animals. One identified target for bantam is the proapoptotic gene hid. In the 3' UTR of hid mRNA, there are five potential bantam binding sites that enable bantam miRNA to repress hid mRNA translation. Other bantam targets likely exist to fully explain the function of bantam miRNA. Identification of animal miRNA targets has been hampered by the generally low homology between miRNAs and their putative targets that is not easily distinguishable from that stemming from chance. The situation is better in plants, as the homology can be much higher (--90%-100%). Quite a few plants miRNAs have firmly established targets (Bartel, 2004; Baulcombe, 2004). For example, fht Arabidopsis JAWXOQUS yields a miRNA, miR-JAW, which negatively regulates the expression of several TCP family transcription factors (Palatnik et al, 2003). RNAi-triggered mRNA cleavage seems to be the predominant mechanism, as predicted mRNA cleavage intermediates are stable and can be identified. JAW mutations affect leaf morphogenesis, which is rescued by constitutive production of TCP2 or TCP4. Expressing a mutant TCP4 that supposedly escapes the regulation by miR-JAW causes plants to arrest at the seedling stage, indicating that miRNAmediated suppression of TCP expression is important for plant development. Also in Arabidopsis, DCLl is necessary for miRNA biogenesis and is itself subject to negative feedback control by a miRNA, as its mRNA is the target of w/i^i62-mediated cleavage (Fig. 29.4B) (Xie et al, 2003). Such a feedback mechanism involving miRNAs is likely widespread to help maintaining a dynamic balance of gene expression in vivo. Of hundreds of miRNAs, currently we know only a handful with defined functions. Continuing genetic and bioinformatics analyses will teach us more about the targets and pathways that miRNAs regulate in cells, It is imaginable, however, based on available data, that miRNAs represent a class of transacting regulators of gene expression similar to transcription factors or RNA binding proteins that control the fate of mRNAs

Chapter 29

The Biogenesis and Function of MicroRNAs

transcriptionally or post-transcriptionally. Thus, lessons learned from the studies of transcription factors (Robert, 2004) and RNA binding proteins (Keene and Tenenbaum, 2002) could easily be transplanted to miRNAs. For example, just as a transcription factor regulates the transcription of multiple genes, and any single gene is controlled by several transcription factors in vivo, a single miRNA could potentially influence the expression of numerous mRNAs, and a single mRNA molecule might be under the collective control of several identical or distinct miRNA molecules. The ability of miRNAs to bind to mRNAs with only limited homology, while posing a problem for computational miRNA target prediction, may actually illuminate the complexity in vivo. In any given cell, only a subset of miRNAs are made, but they will affect the expression of a much larger number of genes. Even if any individual miRNA only contributes marginally, due to its weak base pairing to its target, the synergistic effort by an assembly of miRNAs could have a profound effect on mRNA expression. miRNAs, siRNAs, and other Small RNAs We will end this chapter with a reminder that, besides miRNAs, there are other 20-30 nt long RNA species in an eukaryotic cell. An obvious class is the endogenous siRNAs, processed by Dicer from long dsRNAs. There are siRNAs corresponding to repetitive DNA elements in certain species, and many small antisense RNAs exist that are likely processed from duplexes formed due to bi-directional transcription or that represent RNAi intermediates. Several plant RNAs initially classified as miRNAs are actually siRNAs, for they are derived from long dsRNAs instead of from hairpin-containing transcripts (Vazquez et al, 2004), siRNAs have been shown to participate in processes such as mRNA degradation, DNA methylation, heterochromatin formation, and/or genome rearrangement (Lippman and Martienssen, 2004). Plant siRNAs through RNAi can also protect cells from viruses and transposons (Baulcombe, 2004). It will be interesting to determine if miRNAs can multitask as siRNAs. Cloning and sequencing endeavors have also uncovered other small RNAs of largely unknown origins and fimctions (Ambros et al, 2003b; Kuwabara et al., 2004). One better-studied example is the -21 bp NRSE dsRNA (Kuwabara et al, 2004). This dsRNA does not fimction through the conventional siRNA/miRNA pathways, instead, it appears to interact with the neuronal transcription machinery to induce gene expression. The discovery of small RNAs including miRNAs has undoubtedly

'489

enhanced our understanding of the integrated circuitry that regulates gene expression.

References Ambros, V., Bartel, B., Bartel, D.P., Burge, C.B., Carrington, J.C., Chen, X., Dreyfuss, G., Eddy, S.R., Griffiths-Jones, S., Marshall, M., Matzke, M., Ruvkun, G., and Tuschl, T. (2003a). A uniform system for microRNA annotation. RNA 9,277-279. Ambros, V., Lee, R.C., Lavanway, A., Williams, P.T., and Jewell, D. (2003b). MicroRNAs and other tiny endogenous RNAs in C. elegans. Curr. Biol. 73,807-818. Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 77(5,281-297. Baulcombe, D. (2004). RNA silencing in plants. Nature 431, 356-363. Bernstein, E., Kim, S.Y., Carmell, M.A., Murchison, E.P., Alcorn, H., Li, M.Z., Mills, A.A., Elledge, S.J., Anderson, K.V., and Hannon, G.J. (2003). Dicer is essential for mouse development. Nat. Genet. 55,215-217. Billy, E., Brondani, V., Zhang, H., Muller, U., and Filipowicz, W. (2001). Specific interference with gene expression induced by long, double-stranded RNA in mouse embryonal teratocarcinoma cell lines. Proc. Natl. Acad. Sci. U.S.A. 95,14428-14433. Bohmert, K., Camus, I., Bellini, C , Bouchez, D., Caboche, M., and Benning, C. (1998). AGOl defines a novel locus of Arabidopsis contxoWmg leaf development. EMBO J. 77,170-180. Bohnsack, M.T., Czaplinski, K., and Gorlich, D. (2004). Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA 10, 185-191. Brennecke, J., Hipfher, D.R., Stark, A., Russell, R.B., and Cohen, S.M. (2003). bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 773,25-36. Carmell, M.A., Xuan, Z., Zhang, M.Q., and Hannon, G.J. (2002). The Argonaute family: tentacles that reach into RNAi, developmental control, stem cell maintenance, and tumorigenesis. Genes Dev. 7(5,2733-2742. Caudy, A.A., Myers, M., Hannon, G.J., and Hammond, S.M. (2002). Fragile X-related protein and VIG associate with the RNA interference machinery. Genes Dev. 16, 2491-2496. Chang, S., Johnston, R.J.Jr., Frokjaer-Jensen, C , Lockery, S., and Hobert, O. (2004). MicroRNAs act sequentially and asymmetrically to control chemosensory laterality in the nematode. Nature 430, 785-789. Chen, C.Z., Li, L., Lodish, H.F., and Bartel, D.P (2004). MicroRNAs modulate hematopoietic lineage differentiation. Science 303, 83-86. Cook, H.A., Koppetsch, B.S., Wu, J., and Theurkauf, W.E. (2004). The Drosophila SDE3 homolog armitage is required for oskar mRNA silencing and embryonic axis specification. Cell 116,

490'

Section V

817-829. Cullen, B.R. (2004). Transcription and processing of human microRNA precursors. Mol. Cell 7(5,861-865. Denli, A.M., Tops, B., Plasterk, R.H.A., Ketting, R.F., and Hannon, G.J. (2004). Processing of pri-microRNAs by the microprocessor complex. Nature 432,231-235. Doench, J.G., Petersen, C.P., and Sharp, RA. (2003). siRNAs can function as miRNAs. Genes Dev. 77,438-442. Doench, J.G., and Sharp, RA. (2004). Specificity of microRNA target selection in translational repression. Genes Dev. 2004 7(5,504-511. Elbashir, S.M., Lendeckel, W., and Tuschl, T. (2001). RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 75,188-200. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 397,806-811. Gregory, R.I., Yan, K.P., Amuthan, G., Chendrimada, T., Doratotaj, B., Cooch, N., and Shiekhattar, R. (2004). The Microprocessor complex mediates the genesis of microRNAs. Nature 432,235-240. Grishok, A., Pasquinelli, A.E., Conte, D., Li, N., Parrish, S., Ha, I., Baillie, D.L., Fire, A., Ruvkun, G., and Mello, C.C. (2001). Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106, 23-34. Gwizdek, C , Ossareh-Nazari, B., Brownawell, A.M., Doglio, A., Bertrand, E., Macara, I.G., and Dargemont, C. (2003). Exportin-5 mediates nuclear export of minihelix-containing RNAs. J. Biol. Chem. 275,5505-5508. Hamilton, A.J., and Baulcombe, D.C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286,950-952. Hammond, S.M., Bernstein, E., Beach, D., and Hannon, G.J. (2000). An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404,293-296. Hammond, S.M., Boettcher, S., Caudy, A.A., Kobayashi, R., and Hannon, G.J. (2001). Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293, 1146-1150. Han, J., Lee, Y., Yeom, K.H., Kim, Y.K., Jin, H., and Kim, V.N. (2004). The Drosha-DGCR8 complex in primary microRNA processing. Genes Dev. 7(5,3016-3027. Harris, A.N., and Macdonald, P.M. (2001). Aubergine encodes a Drosophila polar granule component required for pole cell formation and related to eIF2C. Development 725,2823-2832. Hobert, O. (2004). Common logic of transcription factor and microRNA action. Trends Biochem. Sci. 2P,462-468. Hutvagner, G., McLachlan, J., Pasquinelli, A.E., Balint, E., Tuschl, T., and Zamore, P.D. (2001). A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 293, 834-838.

Special Topics Hutvagner, G., and Zamore, P.D. (2002). A microRNA in a multiple-turnover RNAi enzyme complex. Science 297,2056-2060. Ishizuka, A., Siomi, M.C., and Siomi, H. (2002). A Drosophila fi-agile X protein interacts with components of RNAi and ribosomal proteins. Genes Dev. 16, 2497-2508. Johnston, R.J., and Hobert, O. (2003). A microRNA controlling left/right neuronal asymmetry in Caenorhabditis elegans. Nature 42(5,845-849. Kataoka, Y, Takeichi, M., and Uemura, T. (2001). Developmental roles and molecular characterization of a Drosophila homologue of Arabidopsis Argonautel, the founder of a novel gene superfamily. Genes Cells. (5,313-325. Keene, J.D., and Tenenbaum, S.A. (2002). Eukaryotic mRNPs may represent posttranscriptional operons. Mol. Cell P, 1161 -1167. Ketting, R.F., Haverkamp, T.H., van Luenen, H.G., and Plasterk, R.H.A. (2001). Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes Dev. 15, 2654-2659. Knight, S.W., and Bass, B.L. (2001). A role for the RNase III enzyme DCR-1 in RNA interference and germ line development in Caenorhabditis elegans. Science 293,2269-2271. Khvorova, A., Reynolds, A., and Jayasena, S.D. (2003). Functional siRNAs and miRNAs exhibit strand bias. Cell 775, 209-216. Kurihara, Y, and Watanabe, Y (2004). Arabidopsis micro-RNA biogenesis through Dicer-like 1 protein functions. Proc. Natl. Acad. Sci. U.S.A. 707,12753-12758. Kuwabara, T., Hsieh, J., Nakashima, K., Taira, K., and Gage, F.H. (2004). A small modulatory dsRNA specifies the fate of adult neural stem cells. Cell 776,779-793. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., and Tuschl, T. (2001). Identification of novel genes coding for small expressed RNAs. Science 294, 853-858. Lau, N.C., Lim, L.R, Weinstein, E.G., and Bartel, D.P (2001). An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294, 858-862. Lee, R.C., and Ambros, V. (2001). An extensive class of small RNAs in Caenorhabditis elegans. Science 294, 862-864. Lee. R.C., Feinbaum, R.L., and Ambros, V. (1993). The C elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, 843-854. Lee, R.C., Feinbaum, R.L., and Ambros, V. (2004a). A short history of a short RNA. Cell 116, S89-S92. Lee, Y, Jeon, K., Lee, J.T., Kim, S., and Kim, V.N. (2002) .MicroRNA maturation: stepwise processing and subcellular localization. EMBO J. 27, 4663-4670. Lee, Y, Ahn, C , Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, R, Radmark, O., Kim, S., and Kim, V.N. (2003). The nuclear RNase III Drosha initiates microRNA processing. Nature 425,415-419. Lee, Y, Kim, M., Han, J., Yeom, K.H., Lee, S., Back, S.H., and Kim, VN. (2004b). MicroRNA genes are transcribed by RNA

Chapter 29

The Biogenesis and Function of MicroRNAs

polymerase 11. EMBO J. 25,4051 -4060. Lee, Y.S., Nakahara, K., Pham, J.W., Kim, K., He, Z., Sontheimer, E.J., and Carthew, R.W. (2004c). Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell 777,69-81. Lewis, B.R, Shih, I.H., Jones-Rhoades, M.W., Bartel, D.R, and Burge, C.B. (2003). Prediction of mammalian microRNA targets. Cell 775,787-798. Lim, L.P., Lau, N.C., Weinstein, E.G., Abdelhakim, A., Yekta, S., Rhoades, M.W., Burge, C.B., and Bartel, D.R (2003). The microRNAs of Caenorhabditis elegans. Genes Dev. 77, 991-1008. Lingel, A., and Izaurralde, E. (2004). RNAi: finding the elusive endonuclease. RNA 70,1675-1679. Lippman, Z., and Martienssen, R. (2004). The role of RNA interference in heterochromatic silencing. Nature 431, 364-370. Liu, J., Carmell, M.A., Rivas, F.V., Marsden, C.G., Thomson, J.M., Song, J.J., Hammond, S.M., Joshua-Tor, L, and Hannon, G.J. (2004). Argonaute2 is the catal)^ic engine of mammalian RNAi. Science 3^)5,1437-1441. Liu, Q., Rand, TA., Kalidas, S., Du, R, Kim, H.E., Smith, D.R, and Wang, X. (2003). R2D2, a bridge between the initiation and effector steps of the Drosophila RNAi pathway. Science 301, 1921-1925. Lund, E., Giittinger, S., Calado, A., Dahlberg, J.E., and Kutay, U. (2004). Nuclear export of microRNA precursors. Science 303, 95-98. Maxwell, E.S., and Foumier, M.J. (1995). The small nucleolar RNAs. Annu. Rev. Biochem. 64, 897-934. Meister, G., Landthaler, M., Patkaniowska, A., Dorsett, Y., Teng, G., and Tuschl, T. (2004). Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol. Cell 75, 185-197. Moss, E.G., Lee, R.C., and Ambros, V. (1997). The cold shock domain protein LIN-28 controls developmental timing in C. elegans and is regulated by the lin-4 RNA. Cell 88, 637-646. Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L., Rappsilber, J., Mann, M., and Dreyfuss, G. (2002). miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev. 16, 720-728. Okamura, K., Ishizuka, A., Siomi, H., and Siomi, M.C. (2004). Distinct roles for Argonaute proteins in small RNA-directed RNA cleavage pathways. Genes Dev. 18, 1655-1666. Olsen, RH., and Ambros, V. (1999). The lin-4 regulatory RNA controls developmental timing in Camnenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation. Dev. Biol. 216, 671-680. Palatnik, J.F., Allen, E., Wu, X., Schommer, C , Schwab, R., Carrington. J.C, and Weigel, D. (2003). Control of leaf morphogenesis by microRNAs. Nature 425, 257-263. Papp, I., Mette, M.F., Aufsatz, W., Daxinger, L., Schauer, S.E., Ray, A., van der Winden, J., Matzke, M., and Matzke, A.J. (2003).

491

Evidence for nuclear processing of plant microRNA and short interfering RNA precursors. Plant Physiol. 132, 1382-1390. Pasquinelli, A.E., Reinhart, B.J., Slack, R, Martindale, M.Q., Kuroda, M.I., Mailer, B., Hayward, D.C., Ball, E.E., Degnan, B., Muller, P., Spring. J., Srinivasan, A., Fishman, M., Finnerty, J., Corbo, J., Levine, M., Leahy, P., Davidson, E., and Ruvkun, G. (2000). Conservation of the sequence and temporal expression of /g/-7heterochronic regulatory RNA. Nature 408, 86-89. Pfeffer, S., Zavolan, M., Grasse, RA., Chien, M., Russo, J.J., Ju, J., John, B., Enright, A.J., Marks, D., Sander, C , and Tuschl, T. (2004). Identification of virus-encoded microRNAs. Science 304, 734-736. Pham, J.W., Pellino, J.L., Lee, YS., Carthew, R.W., and Sontheimer, E.J. (2004). A Dicer-2-dependent SOS complex cleaves targeted mRNAs during RNAi in Drosophila. Cell 77 7, 83-94. Provost, P., Dishart, D., Doucet, J., Frendewey, D., Samuelsson, B., and Radmark, O. (2002). Ribonuclease activity and RNA binding of recombinant human Dicer. EMBO J. 21, 5864-5874. Reinhart, B.J., Slack, F.J., Basson, M., Pasquinelli, A.E., Bettinger, J.C, Rougvie, A.E., Horvitz, H.R., and Ruvkun, G. (2000). The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403, 901-906. Reinhart, B.J., Weinstein, E.G., Rhoades, M.W., Bartel, B., and Bartel, D.R (2002). MicroRNAs in plants. Genes Dev. 16, 1616-1626. Rodriguez, A., Griffiths-Jones, S., Ashurst, J.L., and Bradley, A. (2004). Identification of mammalian microRNA host genes and transcription units. Genome Res. 7 ^, 1902-1910. Ruvkun, G., Wightman, B., and Ha, I (2004). The 20 years it took to recognize the importance of tiny RNAs. Cell 116, S93-S96. Schwarz, D.S., Hutvagner, G., Du, T., Xu, Z., Aronin, N., and Zamore, P.D. (2003). Asymmetry in the assembly of the RNAi enzyme complex. Cell 775, 199-208. Seggerson, K., Tang, L., and Moss, E.G. (2002). Two genetic circuits repress the Caenorhabditis elegans heterochronic gene lin-28 after translation initiation. Dev. Biol. 243, 215-225. Shi, H., Djikeng, A., Tschudi, C , and Ullu, E. (2004). Argonaute protein in the early divergent eukaryote Trypanosoma brucer. control of small interfering RNA accumulation and retroposon transcript abundance. Mol. Cell. Biol. 24, 420-427. Shiohama, A., Sasaki, T., Noda, S., Minoshima, S., and Shimizu, N. (2003). Molecular cloning and expression analysis of a novel gene DGCR8 located in the DiGeorge syndrome chromosomal region. Biochem. Biophys. Res. Commun. 304, 184-190. Sijen, T., Fleenor, J., Simmer, R, Thijssen, K.L., Parrish, S., Timmons, L., Plasterk, R.H., and Fire, A. (2001). On the role of RNA amplification in dsRNA-triggered gene silencing. Cell 107, 465-476. Song, J.J., Smith, S.K., Hannon, G.J., and Joshua-Tor, L. (2004). Crystal structure of Argonaute and its implications for RISC sheer activity. Science 305, 1434-1437.

492

Section V

Souret, F.F., Kastenmayer, J.R, and Green, P.J. (2004). AtXRN4 degrades mRNA in Arabidopsis and its substrates include selected miRNA targets. Mol. Cell 75, 173-183. Stark, A., Brennecke, J., Russell, R.B., and Cohen, S.M. (2003). Identification of Drosophila MicroRNA targets. PLoS Biol. 7, 397-409. Tabara, H., Yigit, E., Siomi, H., and Mello, C.C. (2002). The dsRNA binding protein RDE-4 interacts with RDE-1, DCR-1, and a DExH-box helicase to direct RNAi in C. elegans. Cell 109, 861-871. Tomari, Y., Du, T., Haley, B., Schwarz, D.S., Bennett, R., Cook, H.A., Koppetsch, B.S., Theurkauf, W.E., and Zamore, RD. (2004a). RISC assembly defects in the Drosophila RNAi mutant armitage. Cell 175, 831-841. Tomari, Y., Matranga, C , Haley, B., Martinez, N., and Zamore, P.D. (2004b). A protein sensor for siRNA asymmetry. Science 306, 1377-1380. Vaucheret, H., Vazquez, R, Crete, R, and Bartel, D.R (2004). The action of ARGONAUTEl in the miRNA pathway and its regulation by the miRNA pathway are crucial for plant development. Genes Dev.7^, 1187-1197. Vazquez, R, Vaucheret, H., Rajagopalan, R., Lepers, C , Gasciolli, v., Mallory, A.C., Hilbert, J.L., Bartel, D.R, and Crete, R (2004). Endogenous trans-acting siRNAs regulate the accumulation of Arabidopsis mKHA^. Mol. Cell 16, 69-79. Volpe, T.A., Kidner, C , Hall, I.M., Teng, G., Grewal, S.L, and Martienssen, R.A. (2002). Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science 2P7,1833-1837. Wightman, B., Ha, I., and Ruvkun, G. (1993). Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 75, 855-862. Williams, R.W., and Rubin, G.M. (2002). ARGONAUTEl is required for efficient RNA interference in Drosophila embryos. Proc. Natl. Acad. Sci. U.S.A. 99, 6889-6894.

Special Topics Xie, Z., Kasschau, K.D., and Carrington, J.C. (2003). Negative feedback regulation of Dicer-Likel in Arabidopsis by microRNA-guided mRNA degradation. Curr. Biol. 73,784-789. Yang, D., Lu, H., and Erickson, J.W. (2000). Evidence that processed small dsRNAs may mediate sequence-specific mRNA degradation during RNAi in Drosophila embryos. Curr. Biol. 10, 191-1200. Yekta, S., Shih, I.H., and Bartel, D.R (2004). MicroRNA-directed cleavage of H0XB8 mRNA. Science 304, 594-596. Yi, R., Qin, Y, Macara, I.G., and Cullen, B.R. (2003). Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev. 17, 3011-3016. Zamore, RD., Tuschl, T., Sharp, RA., and Bartel, D.R (2000). RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101, 25-33. Zeng, Y, and Cullen BR (2003). Sequence requirements for microRNA processing and function in human cells. RNA 9, 112-123. Zeng, Y, Wagner, E.J., and Cullen, B.R. (2002). Both natural and designed microRNAs can inhibit the expression of cognate mRNAs when expressed in human cells. Mol. Cell 9, 1327-1333. Zeng, Y, Yi, R., Cullen, B.R. (2003). MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proc. Natl. Acad. Sci. U.S.A. 100, 9779-9784. Zeng, Y, Yi, R., and Cullen, B.R. (2005). Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha. EMBO J. 24, 138-148. Zhang, H., Kolb, RA., Brondani, V, Billy, E., and Filipowicz, W (2002). Human Dicer preferentially cleaves dsRNAs at their termini without a requirement for ATR EMBO J. 21, 5875-5885. Zhang, H., Kolb, RA., Jaskiewicz, L., Westhof, E., and Filipowicz, W. (2004). Single processing center models for human Dicer and bacterial RNase III. Cell 118, 57-68.

Chapter 30 Transcription Factor Dynamics Gordon L. Hager and Akhilesh K. Nagaich Laboratory of Receptor Biology and Gene Expression, Building 41, B602, 41 Library Dr, National Cancer Institute, NIH, Bethesda, MD 20892-5055

Key Words: nuclear receptors, transcription dynamics, chromatin remodeling, laser crosslinking

Summary The regulation of gene transcription in eukaryotic systems involves a large number of factors. These proteins have been argued to form large, relatively long lived, multi-protein complexes on promoter elements during the process of transcription initiation and elongation. Recent advances in imaging technology have permitted for the first time a dissection of transcription events in real time. Using arrays of gene reporter elements and transcripiton factors tagged with the green fluorescent protein, it is now possible to observe targeting of a regulatory protein to response elements in living cells. Application of photobleaching technology to these systems allows a direct analysis of the rate at which factors are moving in the nucleoplasmic space, and the timing of their interactions with various intranuclear structures, including DNA regulatory sites. These technical breakthroughs have led to the unexpected finding that most transcription factors interact very briefly with promoter elements, and cycle on and off genes at relatively high rates. These findings stand in dramatic contrast to the classic view of large, static initiation complexes, and reveal a level of dynamic action not previously suspected in the process of transcriptional regulation. Introduction Transcription factors modulate rates of transcription

at target genes both through protein- protein interactions with basal transcription factors and by the recruitment of a variety of factors referred to as coactivators, or corepressors. Some of these interacting proteins serve as bridging factors to other components of the soluble transcription apparatus, while others either harbor intrinsic chromatin modifying activities (such as acetylation or methylation (Berger, 1999; Spencer ^^ a/., 1997; Hassig et al, 1997; Chen et al., 1999; Bannister et al., 2002; Selker, 1990; Strahl and AUis, 2000)), or interact with other chromatin remodeling activities (including the Swi/Snf family of nucleosome remodeling proteins (Fryer and Archer, 1998; Becker and Horz, 2002; Komberg and Lorch, 2002; Francis and Kingston, 2001). The dynamic process by which transcription factors recruit these various activities is poorly understood. The classic view (Fig.30.1) is that a sequence-specific DNA-binding protein binds to a recognition site, and remains at the site for significant periods of time (Becker et al., 1984). Alternatively, the factor may interact only transiently with a response element, recruiting a secondary set of factors that in turn form a stable complex at the regulatory site. This type of mechanism has been referred to as "hit and run", and has been proposed both for steroid receptors (Hager, 2001; Rigaud et al., 1991; Truss et al., 1992; Rigaud et al., 1991), and for enhancer function in general (Suen et al., 1998). The major difficulty in addressing these issues resides in the indirect methods used to detect transcription factor DNA-binding and function. Most techniques currently in use, including the widely utilized chromatin immunoprecipitation (ChlF) approach, would not be sensitive to rapid interactions.

Corresponding Author: Gordon L. Hager, Tel: (301) 496-9867, Fax: (301) 496-4951, E-mail: [email protected]

Section V

'494

Chromatin

Special Topics

^ *

TF-directed initiation of multiple factor binding events

Protein-protein interactions stabilize complex Chromatin remodeling Swi/Snf complex Covalent chromatin modification

"open'' chromatin

Bound factor complex serves as platform for Pol 2 recruitment and cycling

Fig30.1 "Classic" view of initiation complex assembly.Transcription factors have been classicaly viewed as nucleating the formation of large, stable complexes on the template, involving many coactivators and coregulators. These complexes in turn stimulate the recruitment of members of the general transcription apparatus, and eventually catalyze RNA Pol II initiation events.

Protein Movement and Localization in Living Cells Use of the green fluorescent protein (GFP) and its derivatives has revolutionized the study of protein mobility in living cells (Prasher, 1995; Cubitt et al, 1995; Heim and Tsien, 1996; Htun et a/., 1996; Hager, 1999). Real time characterization of the subcellular localization and inter-compartment movement of factors becomes uniquely possible when the proteins are expressed directly as fiision-chimeras with one of the growing family offluorescentproteins. The redistribution of fluorescent tagged proteins through techniques such as time-lapse microscopy becomes an attractive methodology to determine targets and interaction sites for a protein of interest. The technique of greatest utility, however, for studying actual rates of movement in real time is fluorescence recovery after photobleaching, or FRAP (Fig.30.2). By concentrating an intense beam of defined wavelength laser energy on a specific target, the fluorescence associated with that domain can be rapidly extinguished. Subsequent observations on the rate of recovery of the fluorescence provide a unique approach to determine the rates of exchange for the labeled proteins with the target of interest.

FRAP

Factor is statically bound

Factor fluorescence associated with gene array

Time

Rate of exchange Time

— •

Fig.30.2 FRAP analysis of protein movement. Fluorescence recovery after photobleaching (FRAP) provides a technique to characterize factor interactions with targets in intact cells. If an amplifed copy of a given gene promoter is stably present in one of the cell chromosomes (indicated in the cell nucleus), GFPlabeled factors can be observed to bind to these elements in living cells. Recovery of fluorescence after photobleaching can then be analyzed to determined residence times on the template.

In principle, photobleaching studies carried out with a sequence-specific DNA-binding protein, such as a

Chapter 30

Transcription Factor Dynamics

transcription factor, would provide information concerning the interaction of the factor with its regulatory target. Applying this technique to single copy genes in eucaryotic cells, however, is beyond the sensitivity and resolving power of current imaging systems. Usually many thousands of fluorescent molecules will be present in the nucleus for a given factor, resolving a single complex in this large background cannot be achieved with current techniques. For amplified genes, however, this approach would offer promise if the number of binding sites contained in the amplified set were of sufficient density (Fig.30.2). Visualizing Transcription in Real Time Three systems have now been developed, however, that allow visualization of binding events on repeated genetic elements. Two employ artificially developed gene arrays (Kramer et al, 1999; Walker et al, 1999; Belmont et al., 1999), and a third utilizes the naturally occurring repeated ribosomal DNA sequences (Dundr^^ al, 2002). Andrew Belmont and colleagues have generated artificial arrays containing the lac operator sequence, to which the lac repressor binds with a high affinity. After amplification in a bacterial plasmid to a copy number of 256 sites, the array was co-inserted in Chinese hamster ovary cells with the Dhfi- gene, and fiirther amplified through methotrexate selection, generating cell lines with very large copy numbers (Belmont et al., 1999). Visualization of GFP-lac repressor targeting to these arrays is dramatic, showing bright concentrations of repressor at the chromosomal integration sites. Protein mobility studies have not been described for the lac repressor itself; however, using fusions of the estrogen receptor (ER) to lac repressor, Stenoien et al. (Stenoien et al., 2001a) demonstrated very rapid exchange between a receptor coactivator (SRC-1), or a general coregulator (CBP), and the ER-lac repressor chimera bound to the chromosomal array. These experiments open the way to the study of real time dynamics of protein-protein interactions, although the artificial aspect of the gene targeting element remains an issue for interpretation of the experiments. More recent variations of this system (Janicki et al., 2004) offer reporters with direct read-out of gene activity in living cells. Steroid Receptors and Cofactors Exchange Rapidly on Response Elements An altemate gene targeting approach was developed by Hager and colleagues for the glucocorticoid receptor (GR)(Fig. 30.3). This system utilized a cell line (3134)

495

that contains a large tandem array of an MMTV/LTR/vHa-ras reporter (Kramer et al., 1999; Walker et al., 1999). The repeat structure arose from the spontaneous chromosomal integration of a 9 kb bovine papilloma virus (BPV) multi-copy episome, creating a head-to-tail array of 1.8 x 10^ base pairs (Fig. 30.4). This structure contains approximately 200 copies of the LTR, and thus includes 800-1200 binding sites for GR. Derivatives of this cell line were subsequently developed with a GFPtagged version of GR expressed fi:om a chromosomal locus under control of the tetracycline repressible promoter (Walker et al., 1999). GFP-GR expressed in these cell lines after removal of tetracycline is resident in the cytoplasm in the absence of ligand, translocation to the nucleus is easily detected by direct live-cell epifluorescence within 10 minutes after addition of hormone. Using this system, direct binding of GR to genomic regulatory elements could be demonstrated (Fig.30.3A)(McNally et al., 2000); unexpectedly, it was found that the receptor exchanges rapidly with the chromosomal regulatory sites, with a residence time of around 10 sec. Although this system also relies on a tandem array, it offers a more physiological target in that the repeated element includes a complete promoter structure with associated regulatory elements. This approach was extended by Becker et al. (Becker et al, 2002) to an analysis of the dynamics for GRIPl, a well known steroid receptor coactivator, and RNA Pol II, using cells containing the ampHfied MMTV promoter array (Fig.30.3B). The results indicated that upon hormone induction GR and RNA Pol II both rapidly load on to the promoter array. GRIPl, which directly associates with GR, also showed rapid exchange on the promoter, virtually identical to that of GR (tl/2, 5 seconds)(Fig. 30.3B) whereas RNA Pol II showed biphasic recovery kinetics. An initial rapid recovery phase was followed by a much slower complete recovery within 12-15 minutes. The initial rapid recovery of Pol II was ascribed to the abortive initiation events associated with transcription, whereas slower recovery phase of the curve was assigned to elongating polymerase molecules. The results indicated that complete recovery of Pol II is only achieved when elongating polymerases finish transcription and clear the template. The authors fiirther confirmed this interpretation by treating the cells with actinomycin D, a known intercalator of DNA (Becker e^ al., 2002). Using several variants of the FRAP methodology such as I-FRAP, these investigators showed that the presence of actinomycin D completely immobilized the RNA Pol II on the MMTV array. Therefore, the slower recovery phase of the curve is associated with the block of the RNA Pol II during the

496

Section V

Special Topics

Centromere Gene Transcription in Real Time

A Structure of Gene Array

GFP-GR binds specifically to GRE 's in array

B FRAP Analysis 1.0 >

0 20 40 60 0 200 400 Fig.30.3 A system to study gene transcription in real time.A) In cell line 3134, 200 copies of the MMTV promoter resides as a perfect head-to-tail tandem array near the centromere of chromosome 4. OR can be observed to bind to this structure in living cells.B) Photobleaching analysis measures the mobility of transcription factors on the target gene. Both glucocorticoid (OR) and its co-activator GRIPl have very short resident times (t 1/2 - 5 seconds), whereas RNA Pol II requires 13 minutes for complete recovery.

elongation stage. These results confirmed the expected behavior of RNA Pol2 on a transcribing gene, and provided an essential control for the mobility of the transcription factors. It was therefore evident that steroid receptors and cofactors exchange rapidly on response elements in living cells (Hager et ai, 2004; Nagaich et al., 2004a; Hager et al, 2002). In a separate study, Kimura et al (Kimura et al, 2002), using FRAP methodology and GFP-Pol II showed that, in transcriptionally active CHO cells, RNA Pol II is present in two kinetic pools: onefi*actionis highly mobile while the other is transiently immobile. As with the gene-specific MMTV observations (Becker et ai, 2002), these authors provided evidence that immobilization is due to engagement in transcription, and further showed that the equilibrium between the

pools shifts completely toward the mobilefi-actionafter treatment with the transcription inhibitor DRB, likely due to release of RNA Pol II fi*om the template. In addition, after incubation with actinomycin D, RNA Pol II is almost completely immobile due to stalling of the polymerases at sites where the drug has intercalated. Mancini and coworkers have used fluorescence recovery after photobleaching (FRAP) to examine the intranuclear dynamics of estrogen receptor (ER) (Stenoien et al., 2001b). After bleaching, unliganded ER exhibited high mobility (recovery tm < 1 s) while agonist (oestradiol; E2) or partial antagonist (4-hydroxytamoxifen) exhibited slower ER recovery {tm 5-6 s). Interestingly, ER liganded with the pure antagonist (ICI 182,780) showed an almost total loss of mobility, indicating that the receptors ability to exchange with nuclear targets was

Chapter 30

Transcription Factor Dynamics

497

In vivo Remodeling Region

T T T T T i

If i

GRE6 GRE5 " 1 — I — I — I — I — I — I — I — I — \ — I — r

[-400 L[[

-350

NuclC Family AlwNI

jf If T i

T T TT

GRE3 GRE2 NFl OTFOTF

GRE4

W^

-300

i

GREl

3 -250

[-200

J]]

[[[

-150 Nucl B Family Sacl

BPVMMTVLTR

-100 ] -50

J]]

BPV

Chromosome 4

^ s ^ ^ ^ Array

200 copies

Spontaneous integration of BPV episome into chromosome 4

Fig.30.4 Transcription factor binding sites in the MMTV promoter array.The gene array was developed by integration and amplification of an episomal MMTV structure present in cell line 904.1. Each copy of the 9 kb MMTV repeat in the chromosome 4 gene array contains a complete promoter structure. Six GR binding sites (shown in blue) are found in this promoter, and hypersensitive access to the Sac I and Alwn I restriction enzyme sites is induced upon treatment of cells harboring the gene array. Location of positioned nucleosomes B & C is shown in relation to the transcription factor binding sites.

compromised when activated with this ligand. Rayasam et. al (Rayasam et al., 2005) studied the dynamics of progesterone receptor (PR) with a natural target promoter in hving cells, and also found rapid exchange strongly modulated by ligand specific effects. PR in the presence of the agonist R5020 exhibited rapid exchange with the MMTV promoter. Two PR antagonists, RU486 and ZK95299, showed opposite effects on receptor dynamics in vivo. In the presence of RU486, PR showed slower exchange rate than the agonist-activated receptor. In contrast, PR bound to ZK98299 did not localize to the promoter and exhibited higher mobility in the

nucleoplasm than the agonist-bound receptor. These experiments suggest that steroid receptors liganded with different agonists and antagonists recruit alternate sets of cofactors and chromatin remodelers to affect transcription and mobility of steroid receptor on target binding sites. Rapid Dynamics -A Common Feature of Transcription Factor Action A similarly rapid dynamic behavior has been characterized for RNA Pol I transcripiton factors.

498

Section V

Misteli and colleagues utilized the natural amplification of the rRNA genes to examine the dynamics of Pol I and associated factors (Dundr et al, 2002). The nucleolus can be regarded as the archetype of a "transcription factory". Within this structure, which is dedicated to a high rate of rRNA production, multiple ribosomal genes are located in fibrillar centers containing RNA polymerase I transcription factors. The product rRNA is subsequently assembled into ribosomal precursors. A variety of GFP-tagged RNA Polymerase I components (including preinitiation and assembly factors and different subunits of the RNAPl complex) were characterized and introduced into mammalian cells. The recruitment to, and residence times at, nucleolar RNAPl-dependent genes was then monitored by several live cell imaging methods including FRAP. The authors observed that each of the RNAPl factor displayed a different initial rate of fluorescence recovery within the photobleached nucleolus, indicating that the majority of the subunits reach promoters separately and do not reside in preassembled holo-complexes, contrary to the generally accepted view of the Pol I complex as a large, ready-to-use holo-enzyme. In addition to the rapid recovery of RNAPl associated factors, FRAP analysis showed secondary slower recovery kinetics of GFP-tagged polymerase subunits but not of the initiation factors. The authors argue that this slower recovery reflects the association of RNAPl with active rRNA genes. A mathematical model was developed describing nucleolar entry and exit rates, promoter on and off rates, and elongation rates of each analyzed component. This approach presented a global view on the reaction kinetics of RNAPl transcription within the context of living cells. The residence time of elongating RNAPl was 2-3 min, which indeed corresponds to previously calculated elongation rates of RNAPl. In general, complex assembly was inefficient as judged from the probability of each factor to associate with the promoter and to actually initiate transcription, and fitted well to a kinetic model based on standard principles of chemical reaction kinetics. Several labs have now combined kinetic modeling with photobleaching experiments to analyze the binding dynamics of a wide range of proteins in the nucleus of living cells (Rayasam et al, 2005; Elbi et al, 2004; Hager et al, 2004; Nagaich et al., 2004a; Phair et ai, 2004; Sprague and McNally, 2005; Carrero et ai, 2004). This approach has led to the determination of the basic biophysical properties such as on/off rates and residence time of several chromatin related proteins such as steroid receptors and coactivators, chromatin remodeling

Special Topics

complexes, nucleosomal binding protein HMG-17, histone HI, heterochromatin protein (HPl), pre-mRNA splicing factor SF2/ASF and rRNA processing protein fibrillarin. These experiments show that nuclear proteins are highly mobile in the nuclear compartments and engage with binding sites only transiently with residence time in the order of few seconds. Proteins move rapidly through out the entire nucleus, providing the opportunity for factors to explore many regulatory sites in a relatively short time. Dynamic Behavior of Factors during DNA Repair To study the nuclear organization and dynamics of nucleotide excision repair (NER), Houtsmuller, used FRAP methodology (Hoogstraten ^/ ai, 2002; Houtsmuller et ai, 1999) to monitor the mobility of endonuclease ERCCl/XPF and the DNA helix opener TFIIH interactions with chromatin in living Chinese hamster ovary cells. In the absence of DNA damage, the complex moved freely through the nucleus with a diffusion coefficient consistent with its molecular size. DNA damage caused transient dose-dependent immobilization of ERCCl/XPF, likely due to engagement of the complex in the repair events. After 4 minutes of the UV DNA damage, the complex regained mobility. These results suggested that nucleotide excision repair, as for the Pol I and Pol II transcription process, operates by assembly of individual NER factors at the site of DNA damage, rather than by pre-assembly of holo-complexes. The data also suggested that ERCCl/XPF participates in repair of DNA damage in a distributive fashion rather than by processive scanning of genome. The ratio between free and damage bound NER factors was UV dose dependent, in spite of an excessive amount of damage, suggesting that assembly of NER complexes is inefficient, similar to the RNAP 1 and 2 transcription systems. Interestingly, TFIIH appeared to be capable of readily switching between RNAP2 transcription complexes, NER complexes, and nucleolar RNAPl transcription complexes, showing that stochastic exchange also occurs between common proteins involved in different DNA transactions. Mechanisms of Factor Movement Most nuclear proteins reside on a specific chromatin site only for seconds or less. The hit-and-run model of transcriptional control (Hager et al, 2004; McNally et al, 2000) maintains that transcription complexes are assembled in a stochastic fashion from freely diffusible proteins. This is in contrasts to the models involving stepwise assembly of stable holo-complexes. However,

Chapter 30

Transcription Factor Dynamics

the chances of forming a productive complex improve if the binding of one factor promotes the binding of its interacting partners. Two paradigms dominate our thinking: the well-estabHshed enhanceosome model and the relatively novel idea that most protein-DNA and protein-protein interactions in the nucleus are vefy dynamic and highly reversible. The enhanceosome model is based on the concept of context-dependent interactions among transcription factors, which promote their cooperative assembly on DNA and endow the complex with exceptional stability (Kim and Maniatis, 1997; Thanos and Maniatis, 1995). This is compatible with the high affinity of NF -KB for its DNA binding sites within the interferon-^ enhancer (the model enhanceosome) and follows naturally from considerations on the physicochemical equilibria between multiple interacting macromolecules. In fact, in vitro measurements confirm the stability of the enhanceosome, and chromatin immunoprecipitation (ChIP) experiments suggest a stepwise recruitment of proteins to chromatin. Although highly successful in explaining the specificity of transcriptional control, and theoretically intuitive, the classical enhanceosome model clashes with the observation that transient and dynamic binding is a common property of all chromatin proteins with the exception of core histones. Li the "hit-and-run" model, transcriptional activation reflects the probability that all components required for activation will meet at a certain chromatin site. The concept of interaction-dependent stabilization of the complex, central to the enhanceosome paradigm, can apply to transient interactions as well. Stability and affinity are thermodynamic concepts that are related to the amount of free energy liberated during complex assembly, and there is no direct constraint on the time frame involved in the interaction. There is however an indirect constraint: aflfinity is defined as the ratio between the on rate (binding) and the off rate (unbinding), thus, if affinity increases, either the on rate becomes faster or the off rate becomes slower (or both). These rates can be fast (as in a hit-and-run model) or slow (as in a classical enhanceosome model), it is the change in their ratio that brings about a change in stability. High Resolution Observation of Factor Dynamics An alternative approach to the study of protein movement involves an in vitro analysis of factor interactions with the DNA templates, particularly during the processes of chromatin reorganization and chromatin remodeling. Several lines of evidence suggest that

499

protein mobility in the nucleus and the dynamic exchange of factors with binding sites on chromatin is controlled both by diffiision and by the action of factors that hydrolyze ATP (Rayasam et al, 2005; Fletcher et al., 2002; Fletcher et al, 2000). To dissect the mechanisms involved in the dynamic mobility and exchange of steroid receptors in chromatin, a new approach involving laser UV crosslinking was developed to follow factor interaction with chromatin in real time (Nagaich et al, 2004b; Nagaich and Hager, 2004). A laser UV Hght source has several advantages over conventional light sources. UV laser mediated crosslinking is highly efficient, proceeds via a biphotonic mechanism, and the crosslinking of proteins to DNA is completed within 1 |is. This approach was applied to study the interaction of glucocorticoid receptor and the chromatin remodeling complex with the MMTV chromatin template during chromatin remodeling. It was found that GR interactions with the template during remodeling process are highly transient and periodic (Fig. 30.5). A sharp peak in laser detected binding is observed 5 minutes after initiation of the reaction, followed by equally rapid loss of receptor (Nagaich et ai, 2004b). This cycle repeats periodically, with a cycle time of 5 minutes. A similar cycle of binding was also found for the Swi/Snf complex, although the detailed binding profile was different. There appears to be loss of Swi/Snf interaction as GR binding increases, with a return to the basal level of interactions as GR leaves the template. Laser detected interactions of core histones with the template were also periodic, but more complex. Histones H2A and H2B each manifested a sharp peak during interaction, but these transitions were out of phase with each other. These findings led to the proposal of a dynamic model for GR and chromatin remodeling complex interaction with the template (Fig. 30.6). The model suggests that rapid GR binding results from the initial recruitment of Swi/Snf complex. At this stage nucleosome remodeling opens the structure and increases the number of available GRE response elements. This local perturbed chromatin stage is transient, and the remodeling protein is lost from the template after completion of the remodeling event. This would lead in turn to the collapse of the remodeled nucleosome state. As this ground state is incompatible to with binding of multiple GR homodimers, the receptor would be rapidly ejectedfi-omthe template. Thus, the receptor is hypothesized to interact dynamically with the template during the remodeling reaction. These observations offer a potential mechanism for ATP dependent mobility in the living cell.

500

Section V

Special Topics

5 min. Fig.30.5 Periodic binding of glucocorticoid receptor and the Swi/Snf complex during chromatin remodeling.The profile of laser induced crosslinking during a 15 min. in vitro chromatin remodeling reaction is presented schematically for GR (black) and the Swi/Snf remodeling complex (orange). Each complex manifests a transient binding and displacement phase, followed by similar, repetitive events. Transient High Energy State Multiple remodeled states

Initial Weak binding by GR

CNucl

BNucl

r

Cooperative Binding of Multiple GR's to Remodeled States

Nucl's Revert to Ground StateIncompatible with GR BindingCooperative Loss of Receptor

Fig.30.6 Model for the transient, periodic binding behavior of GR and Swi/Snf.Rapid binding of GR results from the initial recruitment of the Swi/Snf complex (step 2). At this stage, nucleosome remodeling "opens" the structure and increases the number of available GR binding sites (steps 2 and 3) (there are a total of six potential binding sites in the B/C region (Fletcher et al., 2000)). We suggest that this local perturbed chromatin state is transient, leading to subsequent loss of the remodeling complex (note in Fig. 30.5 that Swi/Snf binding is significantly reduced after the initial GR loading). Progression of the remodeling process would lead in turn to collapse of the high-energy-state (steps 3 and 4) and return of the local chromatin domain to the ground state (step 4). As this state is incompatible with binding of multiple GR homodimers, GR would be rapidly lost. Thus GR is actively ejected from the chromatin structure as a direct result of the progression of the remodeling process.

Chapter 30 Transcription Factor Dynamics

Conclusion A large number of proteins have now been analyzed using live cell imaging techniques such as FRAP. The accumulated body of experimental evidence obtained using real time live cell imaging analysis suggests that the cell nucleus is a highly dynamic environment and the classical approach of describing the nuclear function in terms of a network of interacting proteins is inadequate. An overview of the recent studies favors an alternative image of the nucleus as dynamic integrated system of inter-connected and interdependent metastable molecular organizations realized through stochastic interactions and self organization. Some of these processes rely only on diffusion, but energy dependent mechanisms such as chromatin remodeling are also involved in the observed dynamic movements.

References Bannister,A.J., Schneider,R., and Kouzarides,T. (2002). Histone methylation: dynamic or static? Cell 109, 801-806. Becker,M., Baumann,C.T., John,S., Walker,D., Vigneron,M., McNallyJ.G., and Hager,G.L. (2002). Dynamic behavior of transcription factors on a natural promoter in living cells. EMBO Reports J, 1188-1194. Becker,?., Renkawitz,R., and Schutz,G. (1984). Tissue-specific DNasel hypersensitive sites in the 5'-flanking sequences of the tryptophan oxygenase and the tyrosine aminotransferase genes. EMBO J. 5, 2015-2020. Becker,P.B. and Horz,W. (2002). ATP-dependent nucleosome remodeling. Annu. Rev. Biochem. 77, 247-273. Belmont,A.S., Li,G., Sudlow,G., and Robinett,C. (1999). Visualization of large-scale chromatin structure and dynamics using the lac operator/lac repressor reporter system. Methods Cell Biol. 58:203-22, 203-222. Berger,S.L. (1999). Gene activation by histone and factor acetyltransferases. Curr. Opin. Cell Biol. 11, 336-341. Carrero,G., Crawford,E., Th'ng,J., de Vries,G., and Hendzel,M.J. (2004). Quantification of protein-protein and protein-DNA interactions in vivo, using fluorescence recovery after photobleaching. Methods Enzymol. 375, 415-442. Chen,D., Ma,H., Hong,H., Koh,S.S., Huang,S.M., Schurter,B.T., Aswad,D.W., and Stallcup,M.R. (1999). Regulation of transcription by a protein methyltransferase. Science 284, 2174-2177. Cubitt,A.B., Heim,R., Adams,S.R., Boyd,A.E., Gross,L.A., and Tsien,R.Y. (1995). Understanding, improving and using green fluorescent proteins. Trends. Biochem. Sci. 20,448-455. Dundr,M., Hoffhiarm-Rohrer,U., Hu,Q., Grummt,!., Rothblum,L.I., Phair,R.D., and Misteli,T. (2002). A kinetic framework for a mammalian RNA polymerase in vivo. Science

501

298, 1623-1626. Elbi,G., Walker,D.A., Romero,G., Sullivan,W.R, Toft,D.O., Hager,G.L., and DeFranco,D.B. (2004). Molecular chaperones function as steroid receptor nuclear mobility factors. Proc. Natl. Acad. Sci. USA 101, 2876-2881. Fletcher,T.M., Ryu,B.-W., Baumann,C.T., Wan-en,B.S., Fragoso,G., John,S., and Hager,G.L. (2000). Structure and dynamic properties of the glucocorticoid receptor-induced chromatin transition at the MMTV promoter. Mol. Cell. Biol. 20, 6466-6475. Fletcher,T.M., Xiao,N., Mautino,G., Baumann,C.T., Wolford,R.G., Warren,B.S., and Hager,G.L. (2002). ATP-dependent mobilization of the glucocorticoid receptor during chromatin remodeling. Mol. Cell. Biol. 22, 3255-3263. Francis,N.J. and Kingston,R.E. (2001). Mechanisms of transcriptional memory. Nat. Rev. Mol. Cell Biol. 2,409-421. Fryer,C.J. and Archer,T.K. (1998). Chromatin remodeling by the glucocorticoid receptor requires the BRGl complex. Nature 393 , 88-91. Hager,G.L. (2001). Understanding nuclear receptor function: From DNA to chromatin to the interphase nucleus. Prog. Nucleic Acid. Res. Mol. Biol. 66, 279-305. Hager,G.L. (1999). Studying nuclear receptors with GFP fusions. Methods Enzymol. 302, 73-84. Hager,G.L., Elbi,C.C., and Becker,M. (2002). Protein dynamics in the nuclear compartment. Curr. Opin. Genet. Dev. 12, 137-141. Hager,G.L., Nagaich,A.K., Johnson,T.A., Walker,D.A., and John,S. (2004). Dynamics of nuclear receptor movement and transcription. Biochim. Biophys. Acta 1677,46-51. Hassig,C.A., Fleischer,T.C., Billin,A.N., Schreiber,S.L., and Ayer,D.E. (1997). Histone deacetylase activity is required for full transcriptional repression by mSin3A. Cell 89, 341-347. Heim,R. and Tsien,R.Y. (1996). Engineering green fluorescent protein for improved brightness, longer wavelengths and fluorescence resonance energy transfer. Curr. Biol. 6, 178-182. Hoogstraten,D., Nigg,A.L., Heath,H., Mullenders,L.H., van,D.R., Hoeijmakers,J.H., Vermeulen,W., and Houtsmuller,A.B. (2002). Rapid switching of TFIIH between RNA polymerase I and II transcription and DNA repair in vivo. Mol. Cell 70, 1163-1174. Houtsmuller,A.B., Rademakers,S., Nigg,A.L., Hoogstraten,D., Hoeijmakers,J.H., and Vermeulen,W. (1999). Action of DNA repair endonuclease ERCCl/XPF in living cells. Science 284, 958-961. Htun,H., Barsony,J., Renyi,I., Gould,D.J., and Hager,G.L. (1996). Visualization of glucocorticoid receptor translocation and intranuclear organization in living cells with a green fluorescent protein chimera. Proc. Nafl. Acad. Sci. USA 93, 4845-4850. Janicki,S.M., Tsukamoto,T., Salghetti,S.E., Tansey,W.R, Sachidanandam,R., Prasanth,K.V., Ried,T., Shav-Tal,Y., Bertrand,E., Singer,R.H., and Spector,D.L. (2004). From silencing to gene expression: real-time analysis in single cells. Cell 116, 683-698. Kim,T.K., and Maniatis,T. (1997). The mechanism of

502

Section V

transcriptional synergy of an in vitro assembled interferon-beta enhanceosome. Mol. Cell 7, 119-129. Kimura,H., Sugaya,K., and Cook,RR. (2002). The transcription cycle of RNA polymerase II in living cells. J. Cell Biol. 159, 111-1^2.

Komberg,R.D., and Lorch,Y. (2002). Chromatin and transcription: where do we go from here. Curr. Opin. Genet. Dev. 72, 249-251. Kramer,?., Fragoso,G., Pennie,W.D., Htun,H., Hager,G.L., and Sinden,R.R. (1999). Transcriptional state of the mouse mammary tumor virus promoter can effect topological domain size in vivo. J. Biol. Chem. 274, 28590-28597. McNally,J.G., Mueller, W.G., Walker,D., Wolford,R.G., and Hager,G.L. (2000). The glucocorticoid receptor: Rapid exchange with regulatory sites in living cells. Science 287, 1262-1265. Nagaich,A.K., and Hager,G.L. (2004). UV laser cross-linking: A real-time assay to study dynamic protein/DNA interactions during chromatin remodeling. Sci. STKE 256, PL13. Nagaich,A.K., Rayasam,G.V., Martinez,E.D., Johnson,T.A., Elbi,C., John,S., and Hager,G.L. (2004a). Subnuclear trafficking and gene targeting by nuclear receptors. Ann. N. Y. Acad. Sci. Vol 1024,2\?>-220. Nagaich,A.K., Walker,D.A., Wolford,R.G., and Hager,G.L. (2004b). Rapid periodic binding and displacement of the glucocorticoid receptor during chromatin remodeling. Mol. Cell 14, 163-174. Phair,R.D., Gorski,S.A., and Misteli,T. (2004). Measurement of dynamic protein binding to chromatin in vivo, using photobleaching microscopy. Methods Enzymol. 375, 393-414. Prasher,D.C. (1995). Using GFP to see the light. Trends Genet. / / , 320-323. Rayasam,G.V., Elbi,C., Walker,D.A., Wolford,R.G., Fletcher,T.M., Edwards,D.P., and Hager,G.L. (2005). Ligand specific dynamics of the progesterone receptor in living cells and during chromatin remodeling in vitro. Mol Cell Biol 25, 2406-2418. Rigaud,G., Roux,J., Pictet,R., and Grange,T. (1991). In vivo footprinting of rat TAT gene: dynamic interplay between the

Special Topics glucocorticoid receptor and a liver-specific factor. Cell 67, 977-986. Selker,E.U. (1990). DNA methylation and chromatin structure: A view from below. Trends Biochem. Sci. 15, 103-107. Spencer,T.E., Jenster,G., Burcin,M.M., Allis,C.D., Zhou,J., Mizzen,C.A., McKenna,N.J., Onate,S.A., Tsai,S.Y., Tsai,M.J., and 0'Malley,B.W. (1997). Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389, 194-198. Sprague,B.L. and McNally,J.G. (2005). FRAP analysis of binding: proper and fitting. Trends Cell Biol. 15, 84-91. Stenoien,D.L., Nye,A.C., Mancini,M.G., Patel,K., Dutertre,M., 0'Malley,B.W., Smith,C.L., Belmont,A.S., and Mancini,M.A. (2001a). Ligand-mediated assembly and real-time cellular dynamics of estrogen receptor alpha-coactivator complexes in living cells. Mol. Cell Biol. 21, 4404-4412. Stenoien,D.L., Patel,K., Mancini,M.G., Dutertre,M., Smith,C.L., 0'Malley,B.W., and Mancini,M.A. (2001b), FRAP reveals that mobility of oestrogen receptor-alpha is ligand- and proteasome-dependent. Nat. Cell Biol. 3, 15-23. Strahl,B.D. and Allis,C.D. (2000). The language of covalent histone modifications. Nature 403,41-45. Suen,C.S., Berrodin,T.J., Mastroeni,R., Cheskis,B.J., Lyttle,C.R., and Frail,D.E. (1998). A transcriptional coactivator, steroid receptor coactivator-3, selectively augments steroid receptor transcriptional activity. J. Biol. Chem. 273, 27645-27653. Thanos,D., and Maniatis,T. (1995). Virus induction of human IFN beta gene expression requires the assembly of an enhanceosome. Cell 83, 1091-1100. Truss,M., Chalepakis,G., and Beato,M. (1992). Interplay of steroid hormone receptors and transcription factors on the mouse mammary tumor virus promoter. J. Steroid Biochem. Molec. Biol. 43, 365-378. Walker,D., Htun,H., and Hager,G.L. (1999). Using inducible vectors to study intracellular trafficking of GFP-tagged steroid/nuclear receptors in living cells. Methods (Companion to Methods in Enzymology) 19, 386-393.

Chapter 31 Actin, Actin-Related Proteins and Actin-Binding Proteins in Transcriptional Control Wilma A. Hofmann and Primal de LaneroUe Department of Physiology and Biophysics, University ofIllinois at Chicago, Chicago, IL 60612

Key Words: nuclear actin, nuclear actin-related protein (ARP), nuclear actin-binding protein (ABP), nuclear myosin I (NMI), gelsolin

Summary Actin is one of the major proteins of the cytoskeleton where, among other fiinctions, it is important for cell movement, defining cell shape, intracellular transport, and muscle contraction. Even though it has been known for many years that conventional actin and actin-related proteins (Arps) are also present in the nucleus, their nuclear functions remained mostly unknown. In recent years, however, it has become clear that actin and Arps are involved in a variety of nuclear processes, especially in transcriptional regulation. It is now apparent that the roles of actin and Arps during transcription are multifaceted and complex ranging from chromatin remodeling to the basic transcription process by RNA polymerases. Furthermore, a number of actin-binding proteins (ABPs) have been identified as transcriptional regulators or co-activators, emphasizing the fundamental role of actin in the nucleus. This chapter specifically addresses the present understanding of actin and Arp function in chromatin remodeling, the role of actin and the actin-binding protein nuclear myosin I in basic transcription, and the role of several other actin-binding proteins as transcriptional co-activators. Introduction A: Cytoplasmic Actin Actin was first purified in Albert Szent-Gyorgyi's

lab in Hungary in 1942 (Szent-Gyorgyi, 1945). It was initially purified from skeletal muscle and is still best known as filamentous protein that is involved in muscle contraction. Actin is a highly conserved, widely distributed protein that has been found in all eukaryotic cell types and an ancient form of actin has recently been discovered in bacteria (Jones et al, 2001). It is also one of the most abundant proteins comprising from 1-15% of the total protein in eukaryotic cells. The 43kD protein is expressed in six different isoforms that show >90% amino acid homology. The isoform expression occurs in a tissue and development dependent pattern (McHugh et al, 1991; Vandekerckhove et al., 1986). Four of the isoforms, a-skeletal actin (a-SKA), a-cardiac actin (a-CAA), a-smooth muscle actin (a-SMA), and y-smooth muscle actin (y-SMA), are restricted to muscle tissue while p-actin and y-actin are ubiquitous. In the cytoplasm actin exists in two forms, as a monomer called G-actin and in a filamentous form called F-actin. Atomic structure determination of the actin molecule shows that it is folded into two large domains each consisting of 2 sub-domains (Otterbein et al, 2001). Monomeric actin has a low ATPase activity and the ATP binding pocket, as well as a high affinity binding site for a divalent cation, is located in a deep cleft, called the actin fold, that is formed by the two large domains (Fig.31.1). Actin is organized into relatively stable filaments, known as thin filaments, in muscle cells. Actin monomers in the cytoplasm of non-muscle cells also readily polymerize in an ATP dependent process to form polarized actin filaments, known as microfilaments. However, in contrast to thin filaments in muscle cells

Corresponding Author: Primal de Lanerolle, Department of Physiology and Biophysics, University of Illinois at Chicago, 835 S. Wolcott, Chicago, IL 60612, Tel: (312) 996-5430, E-mail: [email protected]

504

Section V

that are very stable, microfilaments are double stranded helical structures that are highly dynamic in nature. That is, they have the ability to rapidly form, deform, and reform. Dynamic actin filaments are necessary for defining cell shape in non-muscle cells. They also play crucial roles in cell motility, cell division and intracellular transport. Thus, actin is involved in a host of cellular functions.

subdomain4

subdomain2

^ iMK # subdomainl Fig.31.1 The structure of muscle actin. Actin monomer ribbon structure of uncomplexed rabbit skeletal muscle actin in the ADP state at 1.54 A resolution (Otterbein et al, 2001). Actin is composed of two domains. Each of the major domains is subdivided into two additional domains that are termed subdomain 1-4. ATP/ADP and a divalent cation bind within a deep cleft between subdomain 2 and 4. This cleft is called the ATP-binding pocket or the actin fold. A divalent cation (in this case Ca^"^) that is bound adjacent to the ATP/ADP site is shown as a red sphere. Three additional bound calcium ions are also shown. TMR (Tetramethylrhodamine-5-maleimide) is a fluorescently labeled probe that was covalently attached to the actin molecule and used to crystallize monomeric actin.

The numerous forms and functions of actin in the cytoplasm are regulated by a vast array of actin-binding proteins (ABPs). To date, between 60-100 types of ABPs have been identified (dos Remedios et al., 2003). ABPs can be roughly divided into two groups. One group regulates assembly and disassembly of actin filaments as well as the length, stability, and form of the actin filaments. They also regulate interactions between actin filaments and other components of the cytoskeleton. The other group consists of the superfamily of molecular motors called myosins that bind to actin and use the energy of ATP hydrolysis to generate force and move unidirectionally along actin filaments.

Special Topics

B: Nuclear Actin The presence of actin in the nucleus was first suggested over 30 years ago by Lane (Lane, 1969). Other early studies suggested that actin might be part of the nuclear matrix (Jockusch et al., 1974; Nakayasu and Ueda, 1983). Subsequently, Jokusch and her colleagues reported that a protein that co-purified with RNA polymerase II from Physarum polycephalum was actin (Smith et al, 1979), though no functional role for actin was suggested. These initial studies were followed by numerous others that reported the occurrence of actin within the nucleus (De Boni, 1994). During the last few years there have been quite a few reports of actin in the nucleus. These studies have suggested various and diverse functions for nuclear actin, from a role in transcription to RNA biogenesis and RNA transport to a role in nuclear envelope assembly (Bettinger et al, 2004; Pederson and Aebi, 2002). Curiously, partly due to the fact that actin is one of the best characterized cytoplasmic proteins, early work on nuclear actin was met by skepticism and the very presence of actin in the nucleus was questioned for many years. One of the main problems was the detection of actin in the nucleus by immunofluorescence. Most of the known functions of actin in the cytoplasm involve polymerization into filaments, which can be stained by fluorescent phalloidin, a specific immunocytochemical probe for actin filaments. However, under normal conditions, nuclei of cells cannot be stained by phalloidin. Therefore, actin detected in isolated nuclei or subnuclear fi-actions was thought to represent a cytoplasmic contaminant due to the high amount of actin protein in the cytoplasm. Finally, however, highly pure, hand isolated nuclei from amphibian oocytes that contained none or minimal cytoplasmic contamination clearly revealed the presence of intranuclear actin at concentrations of 3-4 mg/ml (Clark and Merriam, 1977; Clark and Rosenbaum, 1979). Subsequently, actin was detected in nuclei of somatic cells by immunoelectron microscopy studies (Nakayasu and Ueda, 1985). Furthermore, in vitro cross-linking studies showed that actin is associated with DNA (Miller et al, 1991). Recently an anti-actin antibody was developed that, in immunofluorescence microscopy, does not recognize F-actin but recognizes a conformational state of actin that seems to be nucleusspecific (Gonsior et a/., 1999). Therefore, it is now generally accepted that actin is present not only in oocyte nuclei but also in interphase nuclei of somatic cells. Moreover, several lines of evidence suggest that in contrast to the cytoplasm, where a significant fraction of the actin is filamentous, most of the nuclear actin is

Chapter 31 Actin, Arps and ABPs

either in monomeric form or organized into very short filaments that are not stained by phalloidin (Ankenbauer et al, 1989; Scheer et al, 1984). Nevertheless, nuclear actin is capable of polymerizing into filaments and usually does so when the nuclear envelope is ruptured. The entry and exit of actin into and from the nucleus seems to be complex and highly regulated. Even though actin does not contain a known nuclear localization signal, it translocates to the nucleus bound to another small actin-binding protein, cofilin, via the classical importin-P import pathway (Pendleton et al, 2003). Actin is exported from the nucleus by at least two different export pathways. Actin possesses two classical leucin-rich nuclear export signals that are functional and necessary for the export of actin via the export receptor Exportin 1 (Wadae^ al, 1998). Recently an additional export pathway has been identified. The export receptor Exportin 6 seems to be responsible for the nuclear export of actin that is bound in a complex with the small actin-binding protein profilin (Stuven et al, 2003). C: The History of Actin in Transcription Actin first appeared in connection with transcription in 1979 when Smith et al. identified a protein that co-purified with RNA polymerase II from the slime mold Physarum polycephalum as actin. Though no fimctional implications were made at that time, it was suggested that similar proteins found in RNA polymerase II preparations from other species might also be actin. Subsequently, actin was discovered in transcriptionally active extracts from human HeLa cells and from calf thymus (Egly et al, 1984). This study indicated that actin might act as a co-activator for transcription, especially at the level of transcription initiation. The first clear evidence for a direct role of actin in transcription was provided by Scheer et al. (1984) in the same year. They showed that microinjecting antibodies directed against actin, as well as actin-binding proteins like fragmin, into the nuclei of amphibian oocytes, led to a retraction of chromosome loops, sites at which active transcription takes place (Scheer et al, 1984). Even though these experiments gave strong evidence for a fimction for actin in transcription, no clear role at the molecular level was defined. This is partly due to the fact that transcription of DNA into RNA is an extraordinarily complex, highly regulated process. Gene transcription depends on a complex molecular machine consisting of more than 100 proteins. It is turned on and off by the exquisitely orchestrated interplay of these proteins with each other

505

and with regulatory DNA elements. Transcription requires chromatin remodeling, the binding of transcription factors to regulatory regions of DNA, the formation of pre-initiation complexes (PICs), and the recruitment of RNA polymerase complexes to the PICs. Ultimately, large transcriptional complexes consisting of a RNA polymerase and other proteins translocate relative to equally large DNA molecules, remodeling chromatin and synthesizing RNA as transcription proceeds. As recent studies have elucidated the role of actin in transcription, it has become obvious that actin is involved in the process of transcription in more than one way. Actin is found in complex with RNA polymerase I, II, and III where it plays specific roles in basic transcription. Furthermore, actin and members of the actin-related proteins (Arps) arefimctionalcomponents of large multiprotein complexes that alter chromatin structure and appear to be involved in the process of chromatin remodeling. In addition, a number of actinbinding proteins (ABPs), such as myosin I, have been identified in the nucleus. It is becoming obvious that these ABPs play an important role in the mechanics of transcription processes and the regulation of individual steps of transcription. In the following sections we will sequentially describe in detail the involvement of actin, Arps and ABPs in transcription. Nuclear Actin and Basic Transcription During the basic process of transcription DNA is used as a template by RNA polymerases to generate different types of RNA. Eukaryotic cells contain 3 distinct classes of RNA polymerases that are termed RNA polymerase I, II, and III. Each polymerase synthesizes specific RNAs. RNA polymerase I is located in a specific nuclear compartment, the nucleolus, where it is responsible for ribosomal RNA (rRNA) synthesis (except 5S rRNA). RNA polymerase II is located in the nucleoplasm and responsible for the transcription of all protein genes into messenger RNA (mRNA) and for transcription of most small nuclear RNAs (snRNA). RNA polymerase III is also localized in the nucleoplasm, transcribing 5S rRNA, transfer RNA (tRNA), and some snRNA genes. Each of the RNA polymerase holoenzymes is a multiprotein complex that comprises two large subunits and 12-15 smaller subunits. Mechanistically the process of transcription by all three types of RNA polymerases is similar and occurs roughly in three steps: initiation, elongation, and termination. During transcription initiation a pre-initiation complex consisting of several transcription factors assembles at the promoter region of the gene to be transcribed. After binding of the RNA

Section V

506

polymerase the pre-initiation complex is complete and transcription of the gene is initiated. In transcription elongation the RNA polymerase travels along the DNA and assembles ribonucleotides into an RNA strand. When transcription is complete, the RNA is released from the polymerase and the RNA polymerase dissociates from the DNA (transcription termination). A series of recent studies have now shown that P-actin is associated with all three types of RNA polymerases and directly involved in the basic transcriptional process. The results obtained from studies of each of the polymerases is discussed next. A: RNA Polymerase II As mentioned above, early studies on actin in the nucleus suggested a function for actin in transcription by RNA polymerase II. A recent study by Hofinann et al. (2004) investigated the role of actin in transcription by RNA polymerase II in detail. It was shown that P-actin tightly associates with RNA polymerase II in mammalian cells. In fact even highly purified RNA polymerase II contains trace amounts of p-actin, suggesting that p-actin might be a subunit of the RNA polymerase II holoenzyme. The significance of this association has been demonstrated by using a minimal in vitro transcription system that consists of the general transcription factors TFIIB, TFIIF, TBP, and purified RNA polymerase II. This minimal set of factors is able

Special Topics

to form a pre-initiation complex at the promoter region of a DNA template that contains the Adenovirus major late promoter (AdMLP), a well studied and typical promoter. This set of factors is also sufficient to promote transcription and RNA production from this DNA template (Kugel and Goodrich, 2000). However, transcription in this system can be inhibited by using antibodies to P-actin. Moreover, accumulation of RNA can be stimulated almost 8-fold by adding exogenous P-actin. This suggests that actin like TFIIB, TFIIF, and TBP is a general transcription factor that constitutively associates with RNA polymerase II (Fig.31.2). The data obtained from in vitro experiments was confirmed in vivo using chromatin immunoprecipitation assays to demonstrate the association of actin with the promoter region of transcribing genes. All of these data indicate that actin might be involved during early stages of transcription. This role for P-actin during transcription initiation was supported by a subsequent study that showed that P-actin interacts with the ribonucleoprotein particle U (hnRNP U) and that both bind to initiation competent RNA polymerase II (Kukalev et al, 2005). The importance of p-actin in pre-initiation complex assembly was conclusively demonstrated when it was found that depleting actin from a nuclear extract prevented the integration of the RNA polymerase II into the developing pre-initiation complex (Hofmann et al., 2004).

negatively supercoiled DAN template

Fig.31.2 Pre-initiation complex assembly at the AdML promoter. This model depicts pre-initiation complex (PIC) formation on the Adenovirus major late (AdML) promoter. In vitro transcription from a negatively supercoiled DNA template containing the AdML promoter requires a minimal set of transcription factors consisting of purified TBP, TFIIF, and TFIIB and purified RNA polymerase II (Kao et al, 1990; Peterson et al, 1990). The first step of transcription is the binding of the TATA-binding protein (TBP) to the TATA box in the promoter region. Next, the transcription factors TFIIB and TFIIF assemble in a complex with TBP around the TATA box. These factors then help to recruit the RNA polymerase II to the forming PIC. Hofmann et al (2004) have shown that purified RNA polymerase II contains another factor, namely actin, and that actin is necessary for the integration of RNA polymerase II into the assembling PIC. A combination of protein-protein interaction assays and in vitro PIC-formation assays have demonstrated that actin is crucial for the recruitment and binding of the RNA polymerase II to the TBP-TFIIF-TFIIB-complex at the TATA box.

Chapter 31 Actin, Arps and ABPs

B: RNA Polymerase I Actin has been shown to locaHze not only in the nucleoplasm but also in the nucleolus, the place of rRNA transcription by RNA polymerase I, in both mammalian oocytes and somatic cells (Nowak et al, 1997; Fomproix and Percipalle, 2004; Funaki et al., 1995). Philimonenko et al. (2004) demonstrated the physical association of actin with the RNA polymerase I core-enzyme by co-immunoprecipitation assays. Microinjection experiments and in vitro transcription assays showed that antibodies to P-actin inhibit transcription by RNA polymerase I in vivo as well as in vitro, demonstrating a functional role for actin in RNA polymerase I transcription. Furthermore, a physical association of actin with the promoter region as well as with the elongation region of rRNA genes in vivo, was shown. These data indicate that actin might play a functional role during the early (initiation) as well as the later (elongation) stages of transcription by RNA polymerase I (Philimonenko et al., 2004). C: RNA Polymerase III Hu et al. (2004) have shown that p-actin tightly associates with purified RNA polymerase III. Moreover, in vivo experiments demonstrated that P-actin is present at the promoter region of the actively transcribing U6 snRNA gene, an association that is lost when transcription is inhibited. In addition it was shown that after inhibition of transcription P-actin partly dissociates from the RNA polymerase III complex, which leads to an inactive form of RNA polymerase III. Furthermore, in an in vitro assay, adding exogenous actin to this inactive RNA polymerase III activates transcription, demonstrating a crucial role for actin in transcription by RNA polymerase III (Hu et al., 2004). Based on these studies on the three eukaryotic RNA polymerases, one can draw the surprising conclusion that actin is a transcription factor that is necessary for transcription by all three RNA polymerases. Moreover, the function of P-actin in transcription shows some striking similarities. In all three cases p-actin seems to be tightly associated with the polymerase core enzyme and this association seems to be crucial for the basal transcriptional activity of the respective polymerase. Interestingly, actin interacts with three RNA polymerase III subunits and two of these subunits are common to all three polymerases (Schramm and Hernandez, 2002). One or both of these subunits could present a common binding site for actin in transcription complexes. Furthermore, actin can be found at the promoter region of transcribing genes from all three RNA polymerases in

507

vivo which also supports the idea of a general role for actin in transcription. It has also been explicitly shown that actin is necessary for the start of transcription by RNA polymerase II because pre-initiation complexes cannot assemble at the promoter in the absence of actin. Experiments on RNA polymerase I and III, while not as explicit, clearly demonstrate that actin is also necessary either for transcription initiation or transcription elongation or both. Even though detailed studies are necessary to elucidate the concrete role of actin in transcription by RNA polymerase I and III, actin indeed appears to be a fundamental factor for cellular transcription in general. This suggestion is strengthened by studies on viral replication in mammalian cells. Transcription of the negative-strand RNA virus RSV (human respiratory syncytical virus) is carried out by the RNA dependent viral RNA polymerase L and transcription of the viral RNA is dependent on the presence of the cellular host protein actin (Burke et al, 1998; Huang e^fl/., 1993). Actin and Actin-related Proteins in Chromatin Remodeling Actin-related proteins (Arps) constitute a group of proteins that share 24-60% homology with conventional actin and are considered an evolutionary conserved ancient class of eukaryotic proteins. Even though all Arps share sequence homology, members of the Arp family are quite diverse among themselves and are divided into 11 classes, termed Arpl-Arpll, in mammals. A common structural feature between Arps and conventional actin is the so-called actin fold that contains the ATP/ADP binding site (Fig.31.1). However, only Arpl and Arp4 have been shown to bind and hydrolyze ATP. Moreover, several studies have demonstrated substantial differences in the surface structure of individual Arps, suggesting that Arps are functionally distinct (Frankel and Mooseker, 1996). Of the various Arp classes, Arpl-Arp3 and Arp 11 seem to localize exclusively in the cytoplasm while Arp4-Arpl0 are also found in the nucleus. In the cytoplasm Arps are mainly involved in nucleation and branching of actin filaments and in microtubule based movement of vesicles. In the nucleus Arps and conventional actin can be found in complexes with a wide variety of chromatin remodeling and modifying complexes (Boyer and Peterson, 2000). As outlined in detail elsewhere in this book, the structure of chromatin and histones is of extreme importance in regulating gene transcription. A certain

Section V

508

Special Topics

group of multiprotein complexes are involved in transcription regulation by modifying histones or altering the chromatin structure. Basically these complexes can be divided into two groups, chromatin remodeling and chromatin modifying complexes. The chromatin remodeling complexes are ATP-dependent complexes that use the energy of ATP hydrolysis to remodel chromatin by locally disrupting or altering the association of histones with DNA. The chromatin modifying complexes, on the other hand, are the histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes. They regulate the transcriptional activity of genes by altering the level of acetylation of nucleosomal histones associated with the genes. Actin and Arps were first identified as integral components of the mammalian SWI/SNF chromatin remodeling complex by Zhao et al (1998). To date actin and Arps are found in a wide variety of chromatin remodeling and modifying complexes. Table 31.1 lists complexes from yeast to mammals in which actin and actin-related proteins have been identified. Most of the information we have about the fiinction of Arps in chromatin remodeling have come from studies in yeast because it is relatively easy to manipulate the yeast genome and to produce null mutants or point mutations of proteins. The importance of Arps was demonstrated by studies with Arp null mutants in yeast. Arp null mutants, like null mutants of other components of the chromatin remodeling complex, show a reduced viability

and defects in chromatin structure and replication (Cairns et al, 1998; Shen et al, 2003). This indicates that Arps are essential components of specific chromatin remodeling complexes and are necessary for proper function. Even though the exact role of actin and Arps in these complexes remains to be established, there are several suggested functions for Arps in chromatin remodeling (Fig.31.3). Interestingly, Arps appear to have a structural rather than enzymatic role because point mutations in the ATP-binding pocket had no effect on chromatin remodeling (Cairns et al, 1998; Shen et al, 2003). For instance, Arps could play a role in the assembly of chromatin altering complexes (Fig.31.3A). This is supported by studies on the yeast INO80 complex that showed that Arp4 and Arp5, as well as Arp8, are necessary for proper complex formation (Galameau et al, 2000; Jonsson et al, 2004; Shen et al, 2003). Another possibility is that Arps could anchor the chromatin altering complexes either to DNA or the nuclear matrix (Fig.31.3B). In vitro studies have demonstrated that Arp4 and Arp8 are able to directly bind to core histones, which means that Arp4 and Arp8 could have a role in targeting and/or binding remodeling complexes to certain areas of the chromatin (Galameau et al, 2000; Harata et al, 1999; Harata et al, 2002; Shen et al, 2003). Furthermore, it was shown that actin and Arps in the mammalian BAF complex are important for nuclear matrix association (Zhao et al, 1998).

Table 31.1 Name

Organism

Actin subfamUy

Comments and References

Chromatin remodeler SWRl INO80

Yeast Yeast

actin, Arp4, Arp6 actin, Arp4, Arp5, Arp8

Yeast Yeast

Arp7, Arp9 Arp7, Arp9

(Krogan et al, 2003; Mizuguchi et al., 2004) Aip5 and Arp8 deletion have effect on the complex integrity and show defects in the complex activity, DNA binding and nuclesome mobilization ArpS deletion leads to absence of actin and Arp4 in the complex (Jonsson et al, 2004; Shen et al., 2000; Shen et al., 2003) Deletion of Arp7 and Arp9 leads to defect in structural integrity of RSC and SWI/SNF complex (Cairns et al., 1998; Peterson et al., 1998)

Drosophila Mammals

actin, Arp4 actin, Arp4

Mammals

actin, Arp4

Mammals

actin, Arp4

(Fuchs era/., 2001)

Yeast Mammals

actin, Arp4 actin, BAF53

Arp4 is required for complex integrity (Galameau et al, 2000) (Cai et al, 2003; Ikura et al, 2000)

Chromatin modifier NuA4 Tip60

(Papoulas^M/., 1998) Actin and Arp4 play a role in signal mediated binding of the BAF and PBAF complex to chromatin and/or matrix (Zhao et al, 1998)

Chapter 31

Actin, Arps and ABPs

509

1. Assembly of Chromatin Altering Complex

Chromatin Altering Complex

Actin or Arp 2. Interaction of Chromatin Altering Complexes with Histones

3. Targeting of Chromatin Altering Complexes to Specific DNA Sites through Interaction with ABPs

Fig.31.3 Possible functions of actin and actin-related proteins (Arps) in chromatin reniodeling.A) Assembly of the chromatin altering complex. Studies in yeast have shown that null and point mutations in certain Arps (namely Arp4, Arp5, and Arp8) can lead to improper or incomplete assembly of chromatin altering complexes. These data suggest that Arps are structural components of chromatin ahering complexes that facilitate binding between certain other components of the complex and act to stabilize the complex. B) Interaction of chromatin altering complexes with histones. The main feature of chromatin altering complexes is that they change the structure of the chromatin. In vitro as well as in vivo experiments have shown that Arps can bind directly to or are associated with core histones or heterochromatin regulating factors. This could indicate that Arps possess histone chaperone functions and/or could recruit or anchor the chromatin altering complexes to the chromatin. C) Targeting of chromatin altering complexes to specific DNA sites through interaction with ABPs. This model clearly depicts the complexity of transcriptional regulation. As described in the text, transcription factors, like hormone receptors, function as regulators by recruiting chromatin altering complexes to certain regions of the DNA. The exact mechanism on how they do this is not known. However, it is known that hormone receptors bind to actin-binding proteins (ABP). As the name implies, actin-binding proteins bind to actin and some also bind to actin-related proteins. Therefore the ABPs could bind to Arps or actin present in chromatin altering complexes. These interactions, in turn, could recruit chromatin altering complexes to regions of the DNA.

Actin-Binding Proteins in Transcription Regulation Numerous actin-binding proteins have been identified in the nucleus. Some of them are involved in basic transcription and transcriptional regulation. The most important of these are the members of the myosin and gelsolin families and they are discussed below. A:Nuclear Myosin I Myosin was first identified in the early part of the

last century and, in a classic paper, the husband and wife team of Engelhardt and Ljubimova reported in 1939 that myosin was an ATP hydrolase (Engelhardt and Lyubimova, 1939). It is now known that they purified myosin II and that myosin II is one member of a superfamily of actin based motors. Myosin II is still the best known member of this superfamily and myosin II, itself, represents a sub-family of the myosin superfamily with separate myosin II isoforms found in

Section V

510'

cardiac, skeletal, smooth, and non-muscle cells. Myosin II is ubiquitously distributed and it is not found only in red blood cells. All forms of myosin II are hexameric proteins that contain two heavy chains and 4 light chains (Fig.31.4). The N-terminals of the heavy chains fold to form globular head regions that contain actin-binding domains and sites of ATP hydrolysis. Light chains, which are associated with regulation, are associated with the head. Much of the heavy chain forms a coiled-coil helix that, through intermolecular interactions, results in the formation of filaments. The ability of myosin II to form filaments is crucial to our understanding of myosin function in cells. Muscles contract because thick (i.e.: myosin II) filaments pull on thin (i.e.: mainly actin) filaments that are eventually attached to the cell membrane. The movement of actin filaments past myosin filaments, called the SlidingFilament Model, is fundamental to how we visualize the way actin and myosin work inside cells. Moreover, myosin II is known as a "conventional myosin" because it forms filament. For the better part of 50 years it was thought that there was only one type of myosin (ie: myosin II) and that this was a conventional myosin with two heads and a long coiled-coiled tail that associated into filaments. However, in 1973, Pollard and Kom changed muscle biology by publishing a seminal paper in which they demonstrated the presence of a single headed myosin that had a short tail that did not form filaments. They called this protein myosin I because it has only 1 head (Pollard and Kom, 1973). Because this myosin looked remarkably like a myosin II head, it was initially thought that myosin I was a proteolytic fragment of myosin II that had been hydrolyzed between the head and the tail. However, the cloning of the myosin I gene globular head with motor domain light chains

Special Topics

(Jung et al, 1989; Lee et aU 1999) established without doubt that myosin I is a separate gene product and not a proteolytic fragment. It has become very clear since 1975 that myosin II is but one member of a large superfamily of proteins that are defined as actindependent or activated ATPases. It has also become clear that most of the members of the myosin superfamily are "unconventional" in the sense that they do not form filaments. Sequence comparison has shown that the myosin heads are highly conserved among all myosins but that the tail regions are quite diverse and appear to be involved in targeting myosins, and thereby, specifying their functions. There have been a number of suggestions of myosin or myosin like proteins in the nucleus (Berrios and Fisher, 1986; Berrios et al, 1991; Hagen et aL, 1986; Hauser et al, 1975; Milankov and De Boni, 1993). However, the genes for these proteins were not cloned and the proteins themselves were not purified. Consequently, the functional significance of these proteins in the nucleus remained unclear. The first convincing demonstration of a myosin in the nucleus was the discovery of an unique isoform of myosin I, called nuclear myosin I to distinguish it from the myosin I isoform found in the cytoplasm (cytoplasmic myosin I), in the nucleus (Nowak et al., 1997). Nuclear myosin I is a member of the myosin I sub-family of the myosin superfamily. Nuclear myosin I, like other myosin I molecules, consists of a single heavy chain and a globular head that is very similar to the myosin II head because it too contains sites that bind actin and hydrolyze ATP. However, myosin I proteins have a very short tail and they are unable to self-associate into filaments (Fig.31.3).

a-helical coiledcoil domain

actin-binding site

globular head with motor domain and actin-binding site light chains

heavy chain Myosin II Fig.31.4 Schematic depicting Myosin II and Myosin I structure.Myosin II (left) is a hexamer and consists of two heavy chains and four light chains. The two heavy chains are organized into a globular head at the N-terminus. The head domain contains the actii-binding site and the ATP-binding site and is therefore also considered the motordomain. The C-terminal region of each heavy chain, calfed the tail region, consists of a a-helix. The tail regions of the two heavy chains coil around each other to form a coiled-coil domain. Myosin II molecules self-assemble into filaments under the appropriate conditions by intermolecular association of tail domains. The four light chains are each wrapped around the neck region of each heavy chain. Myosin I (right) has only one heavy chain with a short tail As with myosin II, the globular head domain is at the N-terminus and contains the actin-binding site and the ATP-binding site. The light chains, made of calmodulin molecules, are also wrapped around the neck region.

Chapter 31 Actin, Arps and ABPs

Nuclear myosin I contains a unique N-terminal extension that is not found in any other myosin. This extension was discovered by analyzing the myosin I gene and by microsequencing. Analysis of the gene structure revealed the presence of an upstream exon (exon -1) that contains another ATG that is associated with a weak Kozak sequence. The 3' end of exon -1 and the 5' end of exon 1 combine to code an additional 48 base pairs that are attached to the 5' region of the mRNA for cytoplasmic myosin I (Pestic-Dragovich et al, 2000). Microsequencing of nuclear myosin I immunoprecipitated from nuclei confirmed the presence of a unique 16-amino acid N-terminus. This extension does not have sequence homology with any known nuclear localization signal and it does not direct cytoplasmic proteins to the nucleus. Nevertheless, it is required for the nuclear entry or nuclear retention of nuclear myosin I because removing the N-terminal extension results in complete retention of nuclear myosin I in the cytoplasm (Pestic-Dragovich et al, 2000). hnmunofluorescence and immunoelectron microscopy showed that nuclear myosin I co-localizes with RNA polymerase I and II. The localization with RNA polymerase II appears to depend on active transcription because specifically inhibiting transcription by RNA polymerase II results in a loss of the co-localization of nuclear myosin I with RNA polymerase II. The functional association of nuclear myosin I with RNA polymerase II was further supported by the demonstration that nuclear myosin I and RNA polymerase II co-immunoprecipitate. These data suggested that nuclear myosin I might be involved in transcription by RNA polymerase II. An important functional role for nuclear myosin I in transcription was firmly established by the demonstration that antibodies to nuclear myosin I inhibit transcription by RNA polymerase II in an in vitro transcription assay using HeLa cell nuclear extract (Pestic-Dragovich et al., 2000). Nuclear myosin I was also identified in nucleolar structures that transcribe ribosomal genes (Nowaket al., 1997). Subsequently, it was demonstrated that nuclear myosin I associates with RNA polymerase I and transcribing ribosomal genes (Fomproix and Percipalle, 2004; Philimonenko et al, 2004). Specifically, Philimonenko et al showed that nuclear myosin I associates with initiation-competent RNA polymerase I complexes through an interaction with the basal transcription factor TIF-IA. Previous studies have shown that only a fraction of the RNA polymerase I is capable of assembling into transcription initiation complexes and supporting rDNA transcription (Miller et

511

al, 2001; Schnapp et al, 1990; Tower and Sollner-Webb, 1987) and this initiation-competent RNA polymerase I is associated with TIF-IA (Grummt, 2003). TIF-IA interacts with RNA polymerase I and this interaction is required to recruit RNA polymerase I to the rDNA promoter (Miller et al, 2001; Yuan et al, 2002). Thus the interaction of nuclear myosin I with RNA polymerase I through TIF-IA suggests that nuclear myosin I might be involved during transcription initiation. This is also supported by in vitro transcription experiments in which antibodies to nuclear myosin I inhibited the synthesis of the first nucleotides during rRNA transcription. Because all myosins are actin-activated ATP hydrolases and acto-myosin complexes function as molecular motors to power muscle contraction, cell motility and cell division, it is logical to predict that actin and nuclear myosin I also act together in the nucleus. Transcription, like many other nuclear processes, involves mechanical work. That is, large transcriptional complexes consisting of many different proteins have to move relative to equally large DNA molecules. This form of "motility" is analogous to muscle contraction. In the heart and other muscles, the energy released when actin and myosin hydrolyze ATP is used to move actin filaments relative to myosin filaments. Similarly, the movement of polymerase complexes relative to DNA suggests a role for molecular motors in transcription. However, the polymerase has been shown to have a powerstroke and to generate a great deal of force (Wang et al, 1998; Yin et al, 1995). Whether the motor function of actin and nuclear myosin I are also required for transcription, when and how they are involved and how they interact with polymerases to power transcription remain major questions that need to be answered. Even though these initial studies on transcription show that both actin and nuclear myosin I are necessary for the basal transcriptional activity of RNA polymerase I, they also demonstrate that, at least at the initiation stage of transcription, actin and nuclear myosin I have subtly different roles. While actin associates with RNA polymerase I regardless of the transcriptional state, nuclear myosin I only associates with initiationompetent RNA polymerase I complexes through an interaction with the basal transcription factor TIF-IA (Philimonenko et al, 2004). This is potentially important because actin and myosin work together and the possibility that actin and nuclear myosin I are separately involved in individual steps of transcription is very novel. In addition, whether actin and nuclear myosin I also play roles in the later stages of

512

Section V

Special Topics

certain point mutations in the Flil gene lead to defects in the flight muscle and to the inability to fly (de Couet et al, 1995). Further studies in mouse and Drosophila have shown that it is essential for early development B:Gelsolin Family (Campbell et ai, 2002; Straub et aL, 1996). Flil can be The gelsolins consist of a class of proteins that are found in the nucleus as well as in cytoplasm (Davy et found from lower eukaryotes to mammals. Members of al, 2000) but the mechanisms of translocation are not the gelsolin family share 3-6 repeats of a conserved known. domain and are responsible for capping and/or severing Although supervillin was first identified in actin filaments in the cytoplasm (Burtnick et a/., 2001; neutrophils, it is expressed in large amounts in muscle Way and Weeds, 1988). Several members of the (Pestonjamasp et aL, 1997). Supervillin binds directly to gelsolin family, namely gelsolin, CapG, supervillin, and myosin II (Chen et aL, 2003) and to F-actin and it is Flil have recently been identified in the nucleus where found at sites of cell-cell adhesions, suggesting that it they have roles as transcriptional co-regulators. might be involved in anchoring the cytoskeleton to the Gelsolin is the best studied member of the family plasma membrane (Pope et aL, 1998). In contrast to and it was first identified in macrophages (Yin and other members of the gelsolin family, supervillin is the Stossel, 1979; Yin and Stossel, 1980). Gelsolin contains only protein in which a fiinctional nuclear localization three actin binding sites, two of which can bind actin signal has been identified so far (Wulfkuhle et aL, monomers while the third one binds to F-actin (Bryan, 1999). 1988; Pope et al, 1995), and comprises multiple actin binding and regulatory features. Gelsolin binds two A series of studies has now independently actin monomers in the presence of calcium and gelsolin identified CapG, gelsolin, supervillin, and Flil as can stimulate actin filament nucleation (Yin et al, 1981). transcriptional co-activators or repressors for several On the other hand, gelsolin also severs F-actin and caps nuclear hormone receptors. GapG was recently shown filaments (Way et al, 1992). How gelsolin translocates to modulate transcriptional activity in an reporter assay to and from the nucleus is not known but it may do so in (De Corte et aL, 2004), supervillin (Ting et aL, 2002), a complex with the androgen receptor. Androgen and gelsolin, itself (Nishimura et aL, 2003) were shown receptors translocate to the nucleus following androgen to interact with the androgen receptor and enhance the stimulation. Studies have shown that gelsolin co-localizes transcriptional activity of the androgen receptor as well with the androgen receptor in the cytoplasm following as other nuclear hormone receptors. Another study androgen stimulation and it is possible that gelsolin showed that Flil can associate directly with the estrogen enters the nucleus in complex with the androgen receptor and the thyroid hormone receptor as well as receptor (Nishimura et al, 2003). with other co-activators of nuclear hormone receptors thereby enhancing their transactivation (Lee et aL, In contrast to gelsolin, CapG binds and caps actin 2004). Activated nuclear hormone receptors translocate filaments but does not sever them (Yu et al., 1990). to the nucleus and bind to response elements on specific CapG shows the closest similarities to Dictyostelium discoideum severin and Physarum polycephalum fragminP.genes. Regulation of gene expression then occurs through the recruitment of chromatin remodeling CapG, severin and fragminP have been shown to factors. localize to the nucleus (Onoda et ai, 1993). However, How exactly actin-binding proteins enhance or while severin and fragminP contain a classical repress the transcriptional activity of the different leucin-rich nuclear export signal that leads to nuclear hormone receptors is not known. The major fimction of localizations only under certain conditions, CapG does gelsolin family members in the cytoplasm is to regulate not contain a classical nuclear export signal and is actin dynamics by severing and capping actin filament found predominantly in the nucleus (Van Impe et al., but the gelsolins are also able to bind actin monomers or 2003). How CapG enters the nucleus is not known dimers. Interestingly, besides binding to nuclear because it does not contain a known nuclear localization receptors or co-activators of nuclear receptors, Flil was signal. It has been suggested, however, that also shown to bind to Arp4 (BAF53), the actin-related phosphorylation of the protein might play a role in its protein present in several chromatin remodeling nuclear import (Onoda et al, 1993). complexes (Lee et aL, 2004). Therefore, one can Flightless I (Flil) is a highly conserved member of speculate that actin-binding proteins regulate the gelsolin family but its fimction in the cytoplasm is transcription by providing a link and connecting the not well understood. The name flightless I comes from nuclear receptor transcription complex to actin or studies in Drosophila melanogaster showing that transcription, such as transcription elongation, remains to be investigated.

Chapter 31 Actin, Arps and ABPs

actin-related proteins in chromatin altering complexes (Fig.35.3C). Depending on the chromatin altering complex that is recruited, the DNA around the nuclear receptor binding site would then be either altered towards a more accessible form which would enhance transcription, or towards a more closed form which would repress transcription. Concluding Remarks Recent publications have presented incontrovertible evidence for the presence of actin, Arps and ABPs, especially myosin I, in the nucleus. They have also demonstrated that those proteins play important roles in the mechanics of transcription by RNA polymerase I, II, and III as well as in transcriptional regulation. These papers have changed the landscape and the pertinent question currently is how, exactly, are they involved in transcription? One issue that has not been addressed is the form of nuclear actin that is required to support transcription. As discussed above, actin can exist as a monomer (G-actin) or it can associate to form a filament (F-actin). Virtually everything we know about actin suggests that polymerization in one form or another is essential for actin to have biological functions (Pollard et al, 2000; Pollard et al., 2001). However, there is very little evidence for filamentous actin in the nucleus. Gonsoir et al. (1999) have used the monoclonal 2G2 antibody to actin to suggest the presence of actin aggregates in the nucleus. Based on the X-ray diffraction studies, the 2G2 recognizes an epitope that is buried in the F-actin structure. Thus, this antibody is unlikely to recognize classical actin filaments. Most importantly, the sine-qua-non for the presence of actin filaments is phalloidin staining, which specifically binds to F-actin with a minimum filament size of 7 monomers (Visegrady et al, 2005). But there is no convincing evidence for phalloidin staining in the nucleus and this has been part of the basis for questioning a role for nuclear actin. If polymeric actin is indeed present in the nucleus, it seems unlikely that its conformation is similar to classical F-actin partly based on the reasons stated above. In addition, P-actin contains 2 nuclear export sequences and the nucleus contains cofilin (Ohta et ah, 1989) and profilin (Skare et al, 2003), proteins that regulate actin polymerization (Pollard et al, 2000), and the nuclear import (Pendleton et al, 2003) and export (Stuven et al, 2003) of actin. Moreover, given steric considerations within the nuclear complexes containing actin (i.e. the chromatin altering complexes or the

513

pre-initiation complexes), it is difficult to visualize a role for long actin filaments in them. When one considers all the available data, there appear to be important conformational differences between nuclear and cytoplasmic actin and the implication is that either monomeric actin (G-actin) or short actin filaments, too short to be stained by phalloidin, are involved in transcription. Whether this is correct remains to be determined experimentally. One of the most intriguing issue regarding nuclear actin is whether actin, along with its binding partner nuclear myosin I, act as a molecular motor to power transcription and if so, how do they act at the molecular level? All motors have to be anchored to generate force. In the cytoplasm actin and myosin II are polymerized into filaments that are eventually attached to the cell membrane. When cells contract, actin filaments slide past myosin filaments and cells shorten and muscles contract (Kad et al, 2003). In fact, it is important to emphasize that the sliding of actin filaments past myosin filaments is central to our understanding of how actin and myosin act as a molecular motor. Here, again, the question whether G- or F-actin is involved in transcription is an important issue. The situation with nuclear myosin I is even more complicated because "unconventional" myosins do not form filaments (UQumWetal, 1998). How, then, are actin and nuclear myosin I involved in transcription? Or, more specifically, what do they bind to in order to generate force? Transcription complexes are composed of a large number of proteins (Lemon and Tjian, 2000) and identifying proteinprotein interactions is crucial if we are to understand the details of transcription. Actin binds to all 3 polymerases and nuclear myosin I binds to TIF-IA (Philimonenko et al, 2004). The binding of nuclear myosin I to TIF-IA is especially important because it appears to be necessary for the activation of RNA polymerase I. Does myosin have a similar function with respect to RNA polymerase I and III? In addition, Hofmann et al (2004) have shown that actin is necessary for the formation of pre-initiation complexes. What actin binds to, in addition to RNA polymerase II, to stabilize or promote the formation of pre-initiation complexes has not been defined. It is technically feasible to build pre-initiation complexes in vitro using an immobilized DNA template, purified transcription factors and purified RNA polymerase II. Therefore, it should be possible, by using antibodies to actin and specific transcription factors and mutant forms of them, to tease out what actin binds to as pre-initiation complexes are formed. The organization of actin and nuclear myosin I in

514'

Section V

elongating complexes also remains to be established. We know that P-actin binds to the large subunit of RNA polymerase II (Hofmann et ah, 2004). This appears to be a general characteristic because actin also binds to RNA polymerase I (Philimonenko et ah, 2004) and III (Hu et ah, 2004). Nuclear myosin I, on the other hand, could bind to DNA. Myosin IC is thought to move cargoes and extend the leading edge of cells by simultaneously binding to negatively charged lipids via a positively-charged domain in the tail and actin filaments via the actin-binding domain on the head (Mermall et ah, 1998). The DNA backbone is highly negatively charged and nuclear myosin I could bind to DNA via the same positively charged domain in the tail. It could then generate force during transcription by binding to P-actin, which itself is bound to the polymerase. One issue with such a model is whether the affinity of nuclear myosin I for the DNA is high enough to accommodate force generation. That is, the binding of nuclear myosin I to DNA has to be stronger than the force nuclear myosin I and actin generate during transcription. One possibility is that specific DNA binding proteins stabilize this interaction, another reason to define what proteins actin and nuclear myosin I bind to in the nucleus. While the possible roles of actin and nuclear myosin I in the mechanics of transcription are intriguing, roles for actin and nuclear myosin I in other aspects of transcription should not be ignored. The demonstration of actin and Arps in chromatin altering complexes and the involvement of several actin-binding proteins in regulating transcription indicates that the forms and functions of actin and actin-related proteins in the nucleus might be as complex as in the cytoplasm. The abundance of actin-related proteins and actin-binding proteins in the nucleus also suggest that they are involved in complex and specific ways in regulating transcription. One important point to remember is that these proteins, along with actin and nuclear myosin I, are involved in increasing the efficiency of transcription and/or regulating gene activation. In conclusion, we have summarized what is known about actin, actin-related proteins and actin-binding proteins in the nucleus. Important papers that have been published in the last few years have clearly established roles for actin, actin-related proteins and actin-binding proteins in chromatin remodeling, RNA transport and transcription. These papers have opened the door to a new and exciting area of study, namely the role of what have been considered cytoplasmic structural proteins in transcription.

Special Topics

Acknowledgement Supported, in part, by grants from the National Institutes of Health (GM 596489) and the National Science Foundation (INT 0079298) to PdeL.

References Ankenbauer, T., Kleinschmidt, J. A., Walsh, M. J., Weiner, O. H., and Franke, W. W. (1989). Identification of a widespread nuclear actin binding protein. Nature 342, 822-825. Berrios, M., and Fisher, P. A. (1986). A myosin heavy-chain-like polypeptide is associated with the nuclear envelope in higher eukaryotic cells. J Cell Biol 103, 711-724. Berrios, M., Fisher, P. A., and Matz, E. C. (1991). Localization of a myosin heavy chain-like polypeptide to Drosophila nuclear pore complexes. Proc Nad Acad Sci USA 88, 219-223. Bettinger, B. T., Gilbert, D. M., and Amberg, D. C. (2004). Actin up in the nucleus. Nat Rev Mol Cell Biol 5,410-415. Boyer, L. A., and Peterson, C. L. (2000). Actin-related proteins (Arps): conformational switches for chromatin-remodeling machines? Bioessays 22, 666-672. Bryan, J. (1988). Gelsolin has three actin-binding sites. J Cell Biol 106, 1553-1562. Burke, E., Dupuy, L., Wall, C , and Barik, S. (1998). Role of cellular actin in the gene expression and morphogenesis of human respiratory syncytial virus. Virology 252,137-148. Burtnick, L. D., Robinson, R. C , and Choe, S. (2001). Structure and function of gelsolin. Results Probl Cell Differ 32, 201 -211. Cai, Y., Jin, J., Tomomori-Sato, C , Sato, S., Sorokina, I., Parmely, T. J., Conaway, R. C , and Conaway, J. W. (2003). Identification of new subunits of the multiprotein mammalian TRRAP/TIP60-containing histone acetyltransferase complex. J Biol Chem 278,42733-42736. Cairns, B. R., Erdjument-Bromage, H., Tempst, P., Winston, F , and Romberg, R. D. (1998). Two actin-related proteins are shared functional components of the chromatin-remodeling complexes RSC and SWI/SNF. Mol Cell 2, 639-651. Campbell, H. D., Fountain, S., McLennan, I. S., Berven, L. A., Crouch, M. F , Davy, D. A., Hooper, J. A., Waterford, K., Chen, K. S., Lupski, J. R., et ah (2002). Fliih, a gelsolin-related cytoskeletal regulator essential for early mammalian embryonic development. Mol Cell Biol 22, 3518-3526. Chen, Y., Takizawa, N., Crowley, J. L., Oh, S. W, Gatto, C. L., Kambara, T., Sato, O., Li, X. D., Ikebe, M., and Luna, E. J. (2003). F-actin and myosin II binding domains in supervillin. J Biol Chem 278,46094-46106. Clark, T. G., and Merriam, R. W (1977). Diffusible and bound actin nuclei of Xenopus laevis oocytes. Cell 12, 883-891. Clark, T. G., and Rosenbaum, J. L. (1979). An actin filament matrix in hand-isolated nuclei of X. laevis oocytes. Cell 18, 1101-1108.

Chapter 31 Actin, Arps and ABPs Davy, D. A., Ball, E. E., Matthaei, K. L, Campbell, H. D., and Crouch, M. F. (2000). The flightless I protein localizes to actin-based structures during embryonic development. Immunol Cell Biol 78, 423-429. De Boni, U. (1994). The interphase nucleus as a dynamic structure. Int Rev Cytol 150, 149-171. De Corte, V., Van Impe, K., Bruyneel, E., Boucherie, C , Mareel, M., Vandekerckhove, J., and Gettemans, J. (2004). Increased importin-beta-dependent nuclear import of the actin modulating protein CapG promotes cell invasion. J Cell Sci 117, 5283-5292. de Couet, H. G., Fong, K. S., Weeds, A. G., McLaughlin, P. J., and Miklos, G. L. (1995). Molecular and mutational analysis of a gelsolin-family member encoded by the flightless I gene of Z)ro50»p^//a melanogaster. Genetics 141, 1049-1059. dos Remedios, C. G., Chhabra, D., Kekic, M., Dedova, I. V., Tsubakihara, M., Berry, D. A., and Nosworthy, N. J. (2003). Actin binding proteins: regulation of cytoskeletal microfilaments. Physiol Rev 83, 433-473. Egly, J. M., Miyamoto, N. G., Moncollin, V., and Chambon, P. (1984). Is actin a transcription initiation factor for RNA polymerase B? Embo J 3, 2363-2371. Engelhardt, V. A., and Lyubimova, M. N. (1939). Myosin and adenosinetriphosphatase. Nature 144, 668. Fomproix, N., and Percipalle, P. (2004). An actin-myosin complex on actively transcribing genes. Exp Cell Res 294, 140-148. Frankel, S., and Mooseker, M. S. (1996). The actin-related proteins. Curr Opin Cell Biol 8, 30-37. Fuchs, M., Gerber, J., Drapkin, R., Sif, S., Ikura, T., Ogryzko, V., Lane, W. S., Nakatani, Y., and Livingston, D. M. (2001). The p400 complex is an essential ElA transformation target. Cell 106, 297-307. Funaki, K., Katsumoto, T, and lino, A. (1995). hnmunocytochemical localization of actin in the nucleolus of rat oocytes. Biol Cell 84, 139-146. Galameau, L., Nourani, A., Boudreauh, A. A., Zhang, Y., Heliot, L., Allard, S., Savard, J., Lane, W. S., Stillman, D. J., and Cote, J. (2000). Multiple links between the NuA4 histone acetyltransferase complex and epigenetic control of transcription. Mol Cell 5, 927-937. Gonsior, S. M., Platz, S., Buchmeier, S., Scheer, U., Jockusch, B. M., and Hinssen, H. (1999). Conformational difference between nuclear and cytoplasmic actin as detected by a monoclonal antibody. J Cell Sci 112 (Pt 6), 797-809. Grummt, I. (2003). Life on a planet of its own: regulation of RNA polymerase I transcription in the nucleolus. Genes Dev 17, 1691-1702. Hagen, S. J., Kiehart, D. R, Kaiser, D. A., and Pollard, T. D. (1986). Characterization of monoclonal antibodies to Acanthamoeba myosin-I that cross-react with both myosin-II and low molecular mass nuclear proteins. J Cell Biol 103, 2121-2128. Harata, M., Oma, Y, Mizuno, S., Jiang, Y W., Stillman, D. J.,

515

and Wintersberger, U. (1999). The nuclear actin-related protein of Saccharomyces cerevisiae, Act3p/Arp4, interacts with core histones. Mol Biol Cell 10, 2595-2605. Harata, M., Zhang, Y, Stillman, D. J., Matsui, D., Oma, Y, Nishimori, K., and Mochizuki, R. (2002). Correlation between chromatin association and transcriptional regulation for the Act3p/Arp4 nuclear actin-related protein of Saccharomyces cerevisiae. Nucleic Acids Res 30, 1743-1750. Hauser, M., Beinbrech, G., Groschel-Stewart, U., and Jockusch, B. M. (1975). LocaHsation by immunological techniques of myosin in nuclei of lower eurkaryotes. Exp Cell Res 95, 127-135. Hofmann, W. A., Stojiljkovic, L., Fuchsova, B., Vargas, G. M., Mavrommatis, E., Philimonenko, V., Kysela, K., Goodrich, J. A., Lessard, J. L., Hope, T. J., et al (2004). Actin is part of pre-initiation complexes and is necessary for transcription by RNA polymerase II. Nat Cell Biol 6, 1094-1101. Hu, P., Wu, S., and Hernandez, N. (2004). A role for beta-actin in RNA polymerase III transcription. Genes Dev 18,3010-3015. Huang, Y Q., Li, J. J., Moscatelli, D., Basilico, C , Nicolaides, A., Zhang, W. G., Poiesz, B. J., and Friedman-Kien, A. E. (1993). Expression of int-2 oncogene in Kaposi's sarcoma lesions. J Clin Invest 91, 1191-1197. Ikura, T., Ogryzko, V. V, Grigoriev, M., Groisman, R., Wang, J., Horikoshi, M., Scully, R., Qin, J., and Nakatani, Y (2000). Involvement of the TIP60 histone acetylase complex in DNA repair and apoptosis. Cell 102,463-473. Jockusch, B. M., Becker, M., Hindennach, I., and Jockusch, E. (1974). Slime mould actin: homology to vertebrate actin and presence in the nucleus. Exp Cell Res 89, 241-246. Jones, L. J., Carballido-Lopez, R., and Errington, J. (2001). Control of cell shape in bacteria: helical, actin-like filaments in Bacillus subtiUs. Cell 104, 913-922. Jonsson, Z. O., Jha, S., Wohlschlegel, J. A., and Dutta, A. (2004). Rvblp/Rvb2p recruit Arp5p and assemble a functional Ino80 chromatin remodeling complex. Mol Cell 16, 465-477. Jung, G., Schmidt, C. J., and Hammer, J. A., 3rd. (1989). Myosin I heavy-chain genes of Acanthamoeba castellanii: cloning of a second gene and evidence for the existence of a third isoform. Gene 82, 269-280. Kad, N. M., Rovner, A. S., Fagnant, R M., Joel, P B., Kennedy, G. G., Patlak, J. B., Warshaw, D. M., and Trybus, K. M. (2003). A mutant heterodimeric myosin with one inactive head generates maximal displacement. J Cell Biol 162,481-488. Kao, C. C , Lieberman, P M., Schmidt, M. C , Zhou, Q., Pei, R., and Berk, A. J. (1990). Cloning of a transcriptionally active human TATA binding factor. Science 248, 1646-1650. Krogan, N. J., Keogh, M. C , Datta, N., Sawa, C , Ryan, O. W., Ding, H., Haw, R. A., Pootoolal, J., Tong, A., Canadien, V, et al. (2003). A Snf2 family ATPase complex required for recruitment of the histone H2A variant Htzl. Mol Cell 12, 1565-1576. Kugel, J. F., and Goodrich, J. A. (2000). A kinetic model for the early steps of RNA synthesis by human RNA polymerase II. J

516

Section V

Biol Chem 275,40483-40491. Kukalev, A., Nord, Y., Palmberg, C , Bergman, T., and Percipalle, P. (2005). Actin and hnRNP U cooperate for productive transcription by RNA polymerase II. Nat Struct Mol Biol 12, 238-244. Lane, N. J. (1969). Intranuclear fibrillar bodies in actinomycin D-treated oocytes. J Cell Biol 40, 286-291. Lee, W. L., Ostap, E. M., Zot, H. G., and Pollard, T. D. (1999). Organization and ligand binding properties of the tail of Acanthamoeba myosin-IA. Identification of an actin-binding site in the basic (tail homology-1) domain. J Biol Chem 274, 35159-35171. Lee, Y. H., Campbell, H. D., and Stallcup, M. R. (2004). Developmentally essential protein flightless I is a nuclear receptor coactivator with actin binding activity. Mol Cell Biol 24, 2103-2117. Lemon, B., and Tjian, R. (2000). Orchestrated response: a symphony of transcription factors for gene control. Genes Dev 14, 2551-2569. McHugh, K. M., Crawford, K., and Lessard, J. L. (1991). A comprehensive analysis of the developmental and tissue-specific expression of the isoactin multigene family in the rat. Dev Biol 148, 442-458. Mermall, V., Post, R L., and Mooseker, M. S. (1998). Unconventional myosins in cell movement, membrane traffic, and signal transduction. Science 279, 527-533. Milankov, K., and De Boni, U. (1993). Cytochemical localization of actin and myosin aggregates in interphase nuclei in situ. Exp Cell Res 209, 189-199. Miller, C. A., 3rd, Cohen, M. D., and Costa, M. (1991). Complexing of actin and other nuclear proteins to DNA by cis-diamminedichloroplatinum(II) and chromium compounds. Carcinogenesis 12, 269-276. Miller, G., Panov, K. I., Friedrich, J. K., Trinkle-Mulcahy, L., Lamond, A. I., and Zomerdijk, J. C. (2001). hRRN3 is essential in the SLl-mediated recruitment of RNA Polymerase I to rRNA gene promoters. Embo J 20, 1373-1382. Mizuguchi, G., Shen, X., Landry, J., Wu, W. H., Sen, S., and Wu, C. (2004). ATP-driven exchange of histone H2AZ variant catalyzed by SWRl chromatin remodeling complex. Science 303, 343-348. Nakayasu, H., and Ueda, K. (1983). Association of actin with the nuclear matrix from bovine lymphocytes. Exp Cell Res 143, 55-62. Nakayasu, H., and Ueda, K. (1985). Association of rapidlyabelled RNAs with actin in nuclear matrix from mouse L5178Y cells. Exp Cell Res 160, 319-330. Nishimura, K., Ting, H. J., Harada, Y, Tokizane, T., Nonomura, N., Kang, H. Y, Chang, H. C , Yeh, S., Miyamoto, H., Shin, M., et ah (2003). Modulation of androgen receptor transactivation by gelsolin: a newly identified androgen receptor coregulator. Cancer Res 63, 4888-4894.

Special Topics Nowak, G., Pestic-Dragovich, L., Hozak, P., Philimonenko, A., Simerly, C , Schatten, G., and de Lanerolle, R (1997). Evidence for the presence of myosin I in the nucleus. J Biol Chem 272, 17176-17181. Ohta, Y, Nishida, E., Sakai, H., and Miyamoto, E. (1989). Dephosphorylation of cofilin accompanies heat shock-induced nuclear accumulation of cofilin. J Biol Chem 264, 16143-16148. Onoda, K., Yu, F. X., and Yin, H. L. (1993). gCap39 is a nuclear and cytoplasmic protein. Cell Motil Cytoskeleton 26, 227-238. Otterbein, L. R., Gracefifa, R, and Dominguez, R. (2001). The crystal structure of uncomplexed actin in the ADP state. Science 293,708-711. Papoulas, O., Beek, S. J., Moseley, S. L., McCallum, C. M., Sarte, M., Sheam, A., and Tamkun, J. W. (1998). The Drosophila trithorax group proteins BRM, ASHl and ASH2 are subunits of distinct protein complexes. Development 125, 3955-3966. Pederson, T., and Aebi, U. (2002). Actin in the nucleus: what form and what for? J Struct Biol 140, 3-9. Pendleton, A., Pope, B., Weeds, A., and Koffer, A. (2003). Latrunculin B or ATP depletion induces cofilin-dependent translocation of actin into nuclei of mast cells. J Biol Chem 278, 14394-14400. Pestic-Dragovich, L., Stojiljkovic, L., Philimonenko,. A. A., Nowak, G., Ke, Y, Settlage, R. E., Shabanowitz, J., Hunt, D. R, Hozak, P., and de Lanerolle, P. (2000). A myosin I isoform in the nucleus. Science 290, 337-341. Pestonjamasp, K. N., Pope, R. K., Wulfkuhle, J. D., and Luna, E. J. (1997). Supervillin (p205): A novel membrane-associated, F-actin-binding protein in the villin/gelsolin superfamily. J Cell Biol 139, 1255-1269. Peterson, C. L., Zhao, Y, and Chait, B. T. (1998). Subunits of the yeast SWI/SNF complex are members of the actin-related protein (ARP) family. J Biol Chem 273, 23641-23644. Peterson, M. G., Tanese, N., Pugh, B. R, and Tjian, R. (1990). Functional domains and upstream activation properties of cloned human TATA binding protein. Science 248, 1625-1630. Philimonenko, V. V., Zhao, J., Iben, S., Dingova, H., Kysela, K., Kahle, M., Zentgraf, H., Hofinann, W. A., de Lanerolle, P., Hozak, P., and Grummt, I. (2004). Nuclear actin and myosin I are required for RNA polymerase I transcription. Nat Cell Biol 6, 1165-1172. Pollard, T. D., Blanchoin, L., and Mullins, R. D. (2000). Molecular mechanisms controlling actin filament dynamics in nonmuscle cells. Annu Rev Biophys Biomol Struct 29, 545-576. Pollard, T. D., Blanchoin, L., and Mullins, R. D. (2001). Actin dynamics. J Cell Sci 114, 3-4. Pollard, T. D., and Kom, E. D. (1973). Acanthamoeba myosin. I. Isolation from Acanthamoeba castellanii of an enzyme similar to muscle myosin. J Biol Chem 248,4682-4690. Pope, B., Maciver, S., and Weeds, A. (1995). Localization of the calcium-sensitive actin monomer binding site in gelsolin to segment 4 and identification of calcium binding sites.

Chapter 31 Actin, Arps and ABPs Biochemistry 34, 1583-1588. Pope, R. K., Pestonjamasp, K. N., Smith, K. R, Wulfkuhle, J. D., Strassel, C. R, Lawrence, J. B., and Luna, E. J. (1998). Cloning, characterization, and chromosomal localization of human superillin (SVIL). Genomics 52, 342-351. Scheer, U., Hinssen, H., Franke, W. W., and Jockusch, B. M. (1984). Microinjection of actin-binding proteins and actin antibodies demonstrates involvement of nuclear actin in transcription of lampbmsh chromosomes. Cell 39, 111 -122. Schnapp, A., Pfleiderer, C , Rosenbauer, H., and Grummt, I. (1990). A growth-dependent transcription initiation factor (TIF-IA) interacting with RNA polymerase I regulates mouse ribosomal RNA synthesis. Embo J 9, 2857-2863. Schramm, L., and Hernandez, N. (2002). Recruitment of RNA polymerase III to its target promoters. Genes Dev 16, 2593-2620. Shen, X., Mizuguchi, G., Hamiche, A., and Wu, C. (2000). A chromatin remodelling complex involved in transcription and DNA processing. Nature 406, 541-544. Shen, X., Ranallo, R., Choi, E., and Wu, C. (2003). Involvement of actin-related proteins in ATP-dependent chromatin remodeling. Mol Cell 12, 147-155. Skare, R, Kreivi, J. R, Bergstrom, A., and Karlsson, R. (2003). Profilin I colocalizes with speckles and Cajal bodies: a possible role in pre-mRNA splicing. Exp Cell Res 286, 12-21. Smith, S. S., Kelly, K. H., and Jockusch, B. M. (1979). Actin co-purifies with RNA polymerase II. Biochem Biophys Res Commun86, 161-166. Straub, K. L., Stella, M. C , and Leptin, M. (1996). The gelsolin-related flightless I protein is required for actin distribution during cellularisation in Drosophila. J Cell Sci 109 (Pt 1), 263-270. Stuven, T., Hartmann, E., and Gorlich, D. (2003). Exportin 6: a novel nuclear export receptor that is specific for profilin.actin complexes. Embo J 22, 5928-5940. Szent-Gyorgyi, A. (1945). Studies on muscle. Acta Physiol Scandinav 9 (suppl.25). Ting, H. J., Yeh, S., Nishimura, K., and Chang, C. (2002). Supervillin associates with androgen receptor and modulates its transcriptional activity. Proc Natl Acad Sci USA 99, 661 -666. Tower, J., and Sollner-Webb, B. (1987). Transcription of mouse rDNA is regulated by an activated subform of RNA polymerase I. Cell 50, 873-883. Van Impe, K., De Corte, V., Eichinger, L., Bruyneel, E., Mareel, M., Vandekerckhove, J., and Gettemans, J. (2003). The Nucleo-cytoplasmic actin-binding protein CapG lacks a nuclear export sequence present in structurally related proteins. J Biol Chem 278, 17945-17952. Vandekerckhove, J., Bugaisky, G., and Buckingham, M. (1986). Simultaneous expression of skeletal muscle and heart actin proteins in various striated muscle tissues and cells. A quantitative determination of the two actin isoforms. J Biol Chem 261, 1838-1843.

517'

Visegrady, B., Lorinczy, D., Hild, G., Somogyi, B., and Nyitrai, M. (2005). A simple model for the cooperative stabilisation of actin filaments by phalloidin and jasplakinolide. FEBS Lett 579, 6-10. Wada, A., Fukuda, M., Mishima, M., and Nishida, E. (1998). Nuclear export of actin: a novel mechanism regulating the subcellular localization of a major cytoskeletal protein. Embo J 17,1635-1641. Wang, M. D., Schnitzer, M. J., Yin, H., Landick, R., Gelles, J., and Block, S. M. (1998). Force and velocity measured for single molecules of RNA polymerase. Science 282, 902-907. Way, M., Pope, B., and Weeds, A. G. (1992). Evidence for functional homology in the F-actin binding domains of gelsolin and alpha-actinin: implications for the requirements of severing and capping. J Cell Biol 119, 835-842. Way, M., and Weeds, A. (1988). Nucleotide sequence of pig plasma gelsolin. Comparison of protein sequence with human gelsolin and other actin-severing proteins shows strong homologies and evidence for large internal repeats. J Mol Biol 203, 1127-1133. Wulfkuhle, J. D., Donina, I. E., Stark, N. H., Pope, R. K., Pestonjamasp, K. N., Niswonger, M. L., and Luna, E. J. (1999). Domain analysis of supervillin, an F-actin bundling plasma membrane protein with functional nuclear localization signals. J Cell Sci 112 (Pt 13), 2125-2136. Yin, H., Wang, M. D., Svoboda, K., Landick, R., Block, S. M., and Gelles, J. (1995). Transcription against an applied force. Science 270, 1653-1657. Yin, H. L., Hartwig, J. H., Maruyama, K., and Stossel, T. P. (1981). Ca2+ control of actin filament length. Effects of macrophage gelsolin on actin polymerization. J Biol Chem 256, 9693-9697. Yin, H. L., and Stossel, T. P. (1979). Control of cytoplasmic actin gel-sol transformation by gelsolin, a calcium-dependent regulatory protein. Nature 281, 583-586. Yin, H. L., and Stossel, T. P. (1980). Purification and structural properties of gelsolin, a Ca2+-activated regulatory protein of macrophages. J Biol Chem 255, 9490-9493. Yu, R X., Johnston, R A., Sudhof, T. C , and Yin, H. L. (1990). gCap39, a calcium ion- and polyphosphoinositide-regulated actin capping protein. Science 250, 1413-1415. Yuan, X., Zhao, J., Zentgraf, H., Hoffmann-Rohrer, U., and Grummt, I. (2002). Multiple interactions between RNA polymerase I, TIF-IA and TAF(I) subunits regulate preinitiation complex assembly at the ribosomal gene promoter. EMBO Rep 3, 1082-1087. Zhao, K., Wang, W., Rando, O. J., Xue, Y, Swiderek, K., Kuo, A., and Crabtree, G. R. (1998). Rapid and phosphoinositol-dependent binding of the SWI/SNF-like BAF complex to chromatin after T lymphocyte receptor signaling. Cell 95, 625-636.

Chapter 32 Wnt Signaling and Transcriptional Regulation Xinhua Lin Division of Developmental Biology, Cincinnati Children s Hospital Medical Center, The University of Cincinnati College ofMedicine, Cincinnati, OH 45229, USA

Key Words: Wnt, signaling transduction, beta-catenin, transcriptional regulation

Summary Cell-cell interactions controlled by the highly conserved Wnt family of secreted proteins play essential roles in embryonic patterning and adult homeostasis. One of the major Wnt signaling pathways, namely Wnt canonical pathway, is mediated by P-catenin whose activity is required for both cell-cell adhesion and for Wnt signaling mediated transcription. Over the past decades, genetic and biochemical analyses in various model systems have uncovered many essential components required for transducing Wnt signaling from the cell surface into transcription events in the nucleus. Multiple extracellular, cytoplasmic, and nuclear regulators are involved in modulating p-catenin levels, its subcellular localizations and its transcriptional activity. Furthermore, de-regulated cell-cell adhesion caused by other signaling pathways can also lead to alteration of p-catenin levels which could subsequently activate transcription of Wnt-target genes. Wnts are required for adult tissue maintenance, and deregulated Wnt signaling events promote both human degenerative diseases and cancers. A fiill understanding of molecular mechanism(s) of Wnt signaling is likely to shed new lights into rational design of drugs which can cure diseases associated with deregulated Wnt signaling. Introduction During development, formation of multi-cellular organisms requires combined actions of several

developmental signaling pathways that control patterning of various organs and complex body structures. These signaling pathways, commonly called morphogen signaling pathways, include Wnt/Wingless (Wg), Hedgehog (Hh), transforming growth factor-P (TGF-P), and fibroblast growth factor (FGF). Secreted morphogen molecules relay their signals through their distinct intracellular signaling pathways which ultimately activate transcription of specific genes required for patterning of complex body structures. In the previous chapters, we have discussed transcriptional regulation mediated by TGF-p, Jak/STATs, and NF-KB pathways. Here, I will discuss Wnt signaling pathway and its role in transcription regulation. I will mainly focus on the canonical Wnt signaling pathway mediated by p-catenin. The Wnt Signal Transduction Pathway: Components and Their Actions A:Overview of Wnt Signal Transduction Pathways The Wnt family of secreted signaling molecules are highly conserved and are involved in numerous developmental processes and adult homeostasis in both vertebrates and invertebrates (Logan and Nusse, 2004; Moon, 2005; Wodarz and Nusse, 1998). Wnt-1, the first member of Wnt family protein was initially identified independently as a Drosophila segment polarity gene Wingless (Wg) and the murine protooncogene Int-1 (Rijsewijk et ah, 1987). The term Wnt was derived from a combination of Wingless and Int-1. Since the discovery of Wnt-1, multiple Wnt members have been found throughout the animal kingdom and the human genome encodes 19 Wnt members (Logan and Nusse, 2004; Moon, 2005). Intensive studies by Drosophila geneticists, vertebrate

Corresponding Author: Tel: (513) 636-2144, Fax: (513) 636-4317, E-mail: linyby ©cchmc.org

520

Section V

developmental biologists and molecular biologists have identified essential components of signaling pathways by which Wnt proteins relay their signals into intracellular responses (Logan and Nusse, 2004; Moon, 2005; Wodarz and Nusse, 1998). Wnt proteins can transduce their signaling through distinct intracellular routes which can be mainly divided into two pathways. The most well-studied Wnt signaling pathway is the canonical Wnt pathway which is mediated by p-catenin (Logan and Nusse, 2004; Moon, 2005; Wodarz and Nusse, 1998). Wnts can also relay their signals via the planar polarity pathway or Wnt/Ca^^ pathway and these are referred as 'non- anonical' pathways (Moon, 2005; Strutt, 2003; Veeman et ai, 2003). The major canonical Wnt signaling (I will call the Wnt signaling hereafter) components and their actions are illustrated in Fig.32.1. The central player in this pathway is P-catenin whose stability is regulated by a destruction complex which minimally consists of the serine/threonine kinases casein kinase Ia(CK la) and glycogen synthase-3p (GSK-3P) bound to a scaffolding complex of the tumour-suppressor gene products Axin

•'•"^

^^ ^

^

and adenomatous polyposis coli (APC). In the absence of Wnt signaling, the cytosolic P-catenin is maintained at low levels since it is phosphorylated at its N-terminal region and targeted for ubiquitination and degradation in the 26S proteosome by the destruction complex. Activation of Wnt signaling through its receptor complex, which consists of a serpentine receptor of the Frizzled (Fz) family and a member of the LDL receptor family related protein (LRP), leads to inhibition of the destruction complex resulting in accumulation of unphosphorylated cytoplasmic P-catenin. As a consequence, accumulated cytoplasmic p-catenin translocates into the nucleus where it binds to the HMG-box transcription factor protein T cell factor (TCF) and activates transcription of Wnt-target genes (Fig.32.1). Thus, the key event in Wnt signaling is P-catenin stabilization and accumulation in the cytoplasm. Like Wnts, the components of the canonical Wnt signaling pathway are highly conserved among animal species. Below, I will discuss the components of Wnt signaling and their actions in transducing Wnt signaling in more details. With Wnt signaling

Without Wnt signaling LRP

Special Topics

Frizzled

degradation of p-catenin

^ = ^

^ : .

^^^=.

rcF Inhibition of downstream genes

Activation of downstream genes

Fig.32.1 The canonical Wnt signaling pathway. In the absence of Wnt signalling (left panel), cytoplasmic P-catenin gets phosphorylated and targeted for degradation through its interaction with the destruction complex consisting of tumor supressors Axin, APC and the protein kinase GSK3-P and C K l a . Wnt proteins (right panel) bind to the Frizzled/LRP receptor complex at the cell surface. These receptors transduce a signal to Dsh which inhibits the activity of the destruction complex. As a consequence, p-catenin is uncoupled from the destruction complex and translocates to the nucleus, where its binds to the TCF transcription factor and activates transcritpion of Wnt-target genes.

Chapter 32

Wnt Signaling and Transcriptional Regulation

B: Cell Surface Receptors and Modulators The initiation of Wnt canonical signaling pathway begins with the interaction of Wnt proteins with their receptors on the cell surface (Fig.32.1). The first identified Wnt receptors are the Fz family members of seven-pass transmembrane proteins (Bhanot et al, 1996). Fz family members are serpentine receptors closely related to G protein-coupled receptors (Logan and Nusse, 2004; Moon, 2005; Wodarz and Nusse, 1998). Multiple members of Fz proteins are identified in animal kingdom and 10 Fz members are encoded in the human genome. In addition to Fz proteins, the canonical Wnt signaling pathway requires LRP as a co-receptor. LRPs are single-span transmembrane proteins. Both vertebrate Lrp5 and Lrp6 and their Drosophila ortholog Arrow have been shown to act co-receptors for Wnt signaling (He et ai, 2004; Pinson et al., 2000; Tamai et al., 2000; WehrH et al., 2000). Studies in Drosophila have demonstrated that Fz proteins act as receptors for Wnt proteins by directly interacting with Wnt proteins with high aflfmity through their extracellular cysteine-rich domain (CRD) (Bhanot et al, 1996; RuHfson et al, 2000; Wu and Nusse, 2002). Experimental results from nematodes, Xenopus and mammalian cells also support this view (He e^ al, 1997; Hsieh et al, 1999; Sawa et al, 1996; Yang-Snyder et al, 1996). However, although co-immunoprecipitation experiments suggest that vertebrate Lrp5 and Lrp6 can bind to Wnt proteins (Kato et al, 2002; Mao et al, 2001; Tamai et al, 2000), a biochemical study showed that Drosophila Arrow fails to bind to Wg (Wu and Nusse, 2002). Thus, additional experiments will be needed to further substantiate any Wnt-LRPs interaction. What's the mechanism for Wnt signal initiation? Current data support a model in which Wnt initiates its signaling event by forming a complex with Fz and LRP proteins. The formation of Wnt-Fz-LRP complex brings the LRP intracellular domain to the intracellular domain(s) of Fz proteins thereby activating Wnt downstream signaling. Consistent with this model, ectopic expression of Dfz2-Arrow fusion protein in which the Arrow intracellular domain is fiised with the Dfz2 cytoplasmic tail, can activate Wnt signaling in Wnt ligand-independent manner (Tolwinski et al, 2003). In addition to Fz and LRP proteins, the cell surface heaparan sulfate proteoglycan can also modulate Wnt signaling by acting as a co-receptor(s) in some developmental contexts (Lin, 2004). Studies in Drosophila have shown that glypican members of heaparan sulfate proteoglycans are required for Wnt

521

signaling (Baeg et al, 2001; Han et al, 2005; Lin and Perrimon, 1999; Tao et al, 2005; Tsuda et al, 1999). HSPGs can modulate Wnt signaling by either facilitating Wnt-receptor interaction or preventing Wnt fi-om being degraded on the cell surface (Lin, 2004). C: Dishevelled (Dsh) and G Proteins: Two Wnt Signaling Components Immediately Downstream of Wnt Receptors Genetic studies in Drosophila have identified Dsh as a Wnt signaling component downstream of Wnt receptor. Dsh proteins are multi-module proteins which contain several essential functional domains including a Dix domain, a PDZ domain, and a DEP domain. The Dix domain is similar to a domain located in Axin (See below) and may promote interaction between these two proteins (Hsu et al, 1999). While Drosophila contains only Dsh protein, human genome encodes three Dsh members (DVLl, DVL2, DVL3). Despite intensive studies of the function of Dsh in Wnt signaling, the exact mechanism of action of Dsh is not known. Current data have shown that Dsh may interact with a number of Wnt downstream molecules including Casein Kinase 1 (Peters et al, 1999; Sakanaka ^^ al, 1999) and GBP/Fratl (Farr et al, 2000; Li et al, 1999; Salic et al, 2000). A current model is that interactions of Dsh with Axin as well as GBP/Fratl and GSKSp may be required for inactivation of P-catenin destruction complex (Fig. 32.1) thereby transducing Wnt signaling. Fz proteins are closely related to G protein-coupled receptors which signal to downstream effectors through an associated trimeric G protein complex. Are G proteins involved in Wnt signaling? Several studies have provided evidence for this. Expression of a chimeric rat Fz protein in cultured cells showed that heterotrimeric G proteins may play a role in Fz-stimulated transcriptional response (Liu et al, 2001). Very recently, Katanaev et al further demonstrated that a Drosophila Gao subunit plays a role in Wnt signaling (Katanaev et al, 2005). Drosophila genome encodes six Ga genes. Mutations in Gao 47A mimic the phenotypes of mild loss of Wnt signaling while overexpression of Gao mimics the effects of Wnt gain of function in embryonic patterning. Genetic epistasis experiments further argue that Gao is an immediate transducer of Fz and acts upstream of dsh. Thus, Gao is likely part of a trimeric G protein complex that directly transduces Fz signalsfi^omthe membrane to downstream components. These results suggest that Fz receptors act as a guanine nucleotide exchange factors to activate Gao and promote downstream events (Katanaev et al, 2005).

Section V

522'

D: The fi-catenin Destruction Complex: Roles of GSKSPy CKIa, Axin andAPC in Regulating Levels of fi-catenin The elevated level of cytoplasmic P-catenin is a hallmark of Wnt canonical pathway activation. In the absence of Wnt signaling, P-catenin directly interacts with Axin and APC (Hart et al., 1998; Kishida et al., 1998) and is recruited into the destruction complex which contains two serine/threonine kinases, GSK-3P (Yost et al, 1996) and CKIa (Amit et al, 2002; Liu et al, 2002; Yanagawa et al, 2002). p-catenin is phosphorylated by CKla and GSK3p in a sequential manner on four conserved amino (N)-terminal serine and threonine residues (Fig.32.2). The phosphorylated P-catenin is subsequently recognized by P-TrCP, targeted for ubiquitination, and degraded by the proteosome (Aberle et al, 1997; Latres et al, 1999; Liu et al, 1999) (Fig.32.2). Wnt signaling causes elevated P-catenin by disrupting of p-catenin destruction complex through a number of mechanisms.

33

37

41

45

LDSGIHSGATTTAPSLS

Fig.32.2 The p-catenin destruction complex and the action of P-catenin phosphorylation. In the p-catenin destruction complex consisting of CKIa, GSK-3p, APC and Axin and p-catenin, CKIa and GSK-3P each bind a different domain of Axin. CKIa phosphorylation of S45 allows GSK-3 to phosphorylate T41, then S37 and S33. Phosphorylation of S37 and S33 creates the recognition site for P-Trcp. Wnt signaling disrupts the P-catenin degradation complex and inhibits GSK-3 p phosphorylation of T41, S3 7, and S3 3. It remains to be determined how CKIa phosphorylation of S45 is regulated.

Dl: GSK-Sp GSK-3 p is the first identified serine/threonine kinase involved in Wnt signaling. Initial genetics studies in Drosophila isolated GSK-3p (also called shaggy or zeste-white 3 in Drosophila) as a negative regulator in Wg signaling (Siegfi-ied et al, 1992; Siegfried and Perrimon, 1994; Siegfried et al, 1994).

Special Topics

Genetic epitasis analyses showed that GSK-3 p acts upstream of p-catenin, suggesting its role in regulating the activity of p-catenin (Siegfried et al, 1994). Consistent with this view, studies in Xenopus showed that expression of dominant-negative forms of GSK-3p can lead to constitutive activation of Wnt pathways through P-catenin (Dominguez et al, 1995; He et al, 1995; Pierce and Kimelman, 1995). Together, these data lead to a model where Wnt acts to negatively regulate GSK-3P kinase. The simplest model would suggest that GSK-3p directly phosphorylates P-catenin leading to the degradation of p-catenin (Aberle et al, 1997). There are four potential GSK-3P phosphorylation sites (S33, S37, T41 and S45) in the N-terminal portion of P-catenin that are conserved among different species (Fig. 32.2 and 32.3). Deletions or point mutations in these sites result in stabilization and constitutive activation of P-catenin (Pai et al, 1997; Zecca et al, 1996). These mutant proteins are no longer sensitive to GSK-3P regulation (Pai et al, 1997; Yost et al, 1996). GSK-3p can also phosphorylate P-catenin in vitro in the presence of Axin protein, suggesting further a negative role of GSK-3 P in directly phosphorylating P-catenin. D2: CKIa In addition to GSK-3 P, CKIa is also involved in phosphorylating P-catenin and inducing P-catenin degradation (Amit et al, 2002; Liu et al, 2002; Yanagawa et al, 2002) (Fig 32.2). Depletion of CKIa inhibits P-catenin phosphorylation and degradation and causes abnormal embryogenesis associated with excessive Wnt/p-catenin signaling 'm Drosophila (Liu etal, 2002). GSK-3 P and CKIa bind to different regions of Axin (Fig.32.2). Overexpression of mutant forms of Axin incapable of binding GSK can still stimulate the phosphorylation of S45 at P-catenin. CKIa induce the phosphorylation of S45 at p-catenin, which precedes and is obligatory for subsequent GSK3 phosphorylation at other sites (Liu et al, 2002). A current model is that CKIa phosphorylation of P-catenin at S45 allows GSK-3P to phosphorylate at T41, S37, and S33 (Liu et al, 2002) (Fig.32.2). The phosphorylation of S37 and S33 generates the recognition sites for P-Trcp (Fig.32.2). D3: Axin Axin is a negative intracellular regulator in Wnt signaling (Ikeda et al, 1998; Itoh et al, 1998; Sakanaka et al, 1998; Zeng et al, 1997). In vertebrates, there are two Axins, Axinl and Axin 2, both of which act as negative regulators for Wnt signaling. Axin serves as a scaffolding protein that contains multiple interaction domains capable of directly interacting with P-catenin,

Chapter 32 Wnt Signaling and Transcriptional Regulation

523 '

GSK-Sp, CKIa, and APC proteins as well as its upstream regulator Dsh and LRPs. Mutations in Axin result in activation of Wnt signaling while overexpression of Axin destabilizes p-catenin and blocks the axisduplicating activity of XWnt-8 in Xenopus embryos (Itoh et ai, 1998; Zeng et al, 1997). Phosphorylation of p-catenin by GSK3p and CKIa is promoted in the complex between Axin and GSK3 or CKIa (Ikeda et al, 1998; Liu et al, 2002; Sakanaka et al, 1998) (Fig.32.2). Several studies suggest that Wnt signaling allows Wnt co-receptor LRP to associate with Axin through its cytoplasmic tail, thereby removing Axin from the destruction complex (Mao et al, 2001; Tolwinski et ai, 2003). Consistent with this view, a recent study showed that Axin can bind preferentially to a phosphorylated form of the LRP tail, which is induced by Wnt signaling (Tamai et al, 2004).

12 imperfect repeats (Arm repeats) flanked by unique N- and C-terminal domains (Peifer ^^ of., 1994; Peifer et al, 1992). As mentioned above (Fig.32.2), the N-terminal region domain of p-catenin contains four serine/threonine sites which can be phosphorylated by a combined action of CKIa and GSK-3 p (Fig.32.2 and Fig.32.3). Therefore, the N-terminal domain is responsible for its degradation in the absence of Wnt signaling. The center region containing Arm repeats can interact with a number of essential regulators including TCF, APC, E-cadherin, and a-catenin. The C-terminal domain can function as a transcription activation domain (Fig.32.3). P-catenin contains multiple domains that allow it to bind to various transcription factors, co-activators and other adaptor proteins as well as negative regulators, all of which contribute ultimately the transcriptional activity of p-catenin (Fig.32.3).

D4:APC The APC gene was originally discovered in a hereditary cancer syndrome termed familiar adenomatous polyposis (FAP). APC is a large protein that plays many essential cellular functions. In the Wnt signaling pathway, APC acts as a negative regulator by promoting p-catenin degradation (Bienz, 2003; Bienz and Hamada, 2004; Nathke, 2004; Polakis, 1997). APC interacts directly with Axin and P-catenin (Spink et ai, 2000)(Fig.32.2). The ability of APC to promote degradation of P-catenin depends on APC's interactions with both Axin and P-catenin since APC mutations incapable of interacting with either Axin or P-catenin failed to induce degradation of P-catenin (Kawahara et al, 2000). There are two human and two Drosophila APC molecules. In human, APC is a tumor suppressor gene. Loss of function mutations in APCl is associated with colorectal cancer (Bienz, 2003; Bienz and Hamada, 2004; Nathke, 2004). Tumor cell lines producing truncated forms of APC protein have high levels of cytosolic P-catenin (Rubinfeld et al., 1996) while expression of wild-type APC in cancer cell lines results in a pronounced reduction of cytoplasmic P-catenin levels (Munemitsu et ai, 1995). Drosophila APCl and APC2 play redundant role in Wnt signaling both in embryos and in other tissues (Ahmed et al, 2002; Akong et al, 2002).

E2: TCFs: Nuclear Partners for P-catenin Activity in the Wnt Signaling The main nuclear partners for p-catenin activity are TCF factors. There are four members of TCF factors in human and one member in Drosophila (Logan and Nusse, 2004; Moon, 2004; Wodarz and Nusse, 1998). TCFs are HMG box transcription factors and bind to specific DNA sequences with similar specificity. There are usually multiple TCF binding sites located in the promoter/enhancer regions of Wnt-target genes. In addition to P-catenin, TCF also interacts with other nuclear proteins which can regulate the transcriptional activity of TCF. In the absence of the Wnt signal, TCF fiinctions as a repressor of Wnt target genes (Bienz, 1998; Brannon et al, 1997; Lin et al, 1998; Riese et al, 1997) (Fig.32.4). The repression activity of TCFs is mediated by interacting with the transcription co-repressor Groucho, C-terminal binding protein (CtBP), histone deacetylases (Cavallo et al, 1998; Chen et al, 1999), and Osa-containing Brahma chromatin remodeling complexes (Collins and Treisman, 2000) (Fig. 32.4). In the present of Wnt signaling, Wnt signaling permits accumulated p-catenin to translocate to the nucleus where binding of TCF with p-catenin converts TCF from a transcription repressor into a transcriptional activator, thereby activating the expression of Wnt-target genes (Nusse, 1999) (Fig. 32.4).

E: Wnt Signaling Event in the Nucleus: fi-cateninmediated Transcription Regulation El: P-catenin The key mediator of the canonical Wnt pathway is P-catenin which is the vertebrate orthologue of the Drosophila protein Armadillo. P-catenin is composed of

E3: Adaptors and Co-activators: Pygopus and Legless/ BCL9 Pygopus (Pygo) and Legless (Lgl) are two essential positive players for P-catenin activity and were initially identified from genetic screens in Drosophila (Belenkaya et al, 2002; Kramps et al, 2002; Parker et

Section V Special Topics

524

Arm repeats Interacting with APC, TCF ang E-cadherin and others APC Brg-l Y-412

TCF 1 rans-acti\ atioi

* * * S T Phosphorylation sites, Lgl/BCL9 mutated in tumors orBLC9-2 a-catenin— E-cadherin

ICAT CBP/P300

Fig.32.3 Structure of p-catenin and its interacting domains with various regulators, p-catenin is composed of 12 imperfect Arm repeats flanked by unique N- and C-terminal domains. The N-terminal region of P-catenin contains serine/threonine sites which can be phosphorylated by the destruction complex and targeted it for degradation. The C-terminal domain can function as a transcription activation domain, p-catenin contains multiple domains that can interact with various factors which regulates the its transcriptional activity.

^=^=^

c:^

' ^ ^

Inhibition of downstream genes

Activation of downstream genes Fig.32.4 Nuclear factors involved in regulating p-catenin activity. In the absence of nuclear P-catenin (left panel), TCF binds to DNA elements to repress transcription of Wnt-target genes. This is achieved through its interaction with transcription co-repressors such as Groucho. Wnt signaling leads to elevated nuclear P-catenin which interacts with TCF and converts TCF from a repressor to an activator, thereby activating the expression of Wnt-target gene (right panel). BCL9 (Legless in Drosophila) can directly link p-catenin to Pygopus which can also act as a transcriptional co-activator. An alternative model is that BCL9 and Pygopus are involved in P-catenin nuclear import or retention, p-catenin also binds to other positive regulators such as CBP and chromatin remodeling factor Brgl. P-catenin can be negatively regulated by two nuclear factors Chibby and ICAT, both of which bind directly to P-catenin protein and inhibit its interaction with TCF factors in the nuclei. al, 2002; Thompson et al, 2002). Pygopus is a nuclear protein containing a PHD finger domain which is required for its activity in promoting p-catenin activity. In Drosophila, loss of function studies using pygo mutants have demonstrated that Pygo is required for Wnt signaling in a variety of developmental processes (Belenkaya et ai, 2002; Kramps et aL, 2002; Parker et al., 2002; Thompson et aL, 2002). There are two Pygo (Pygol and Pygo 2) homologues in vertebrates. Loss of Pygo2 in frog leads to reduced Wnt signaling arguing

that Pygo-2 is required for Wnt signaling during development (Belenkaya et aL, 2002). In colon cancer cells, removal of either Pygol or Pygo2 by RNA interference (RNAi) showed reduced Wnt signaling while expression of Pygol can restore Wnt signaling defects resulting from reduced levels of Pygol or Pygo 2. This data suggests that Pygol and Pygo2 may be fiinctionally redundant in Wnt signaling in vertebrate cells (Thompson et aL, 2002). Lgl is a large cytoplasmic protein which regulates

Chapter 32

Wnt Signaling and Transcriptional Regulation

p-catenin signaling activity by linking P-catenin to Pygo. Lgl contains both p-catenin and Pygo interacting domains, mutations of which cause Wnt signaling defects in Drosophila (Kramps et al., 2002). Consistent with a role as an adaptor protein, expression of a deleted form of Lgl protein containing p-catenin and Pygo interacting domains can folly restore Wnt signaling in Drosophila lgl mutants (Kramps et al., 2002). Recently studies showed that Lgl is kept in the nucleus through its interaction with the nuclear protein Pygopus (Townsley et al., 2004). BCL-9 (Kramps et al., 2002) and BCL-9-2 (Adachi et al., 2004; Brembeck et al., 2004) are two vertebrate homologues of Drosophila Lgl and contain conserved domains that are involved in interacting with P-catenin and Pygo proteins. BCL9 is implicated in human B cell lymphomas (Kramps et al., 2002; Willis et al., 1998). Interestingly, although BCL-9 is a cytoplasmic protein and its nuclear localization depends on its interaction with Pygo (Kramps et al., 2002), BCL-9-2 contains its own nuclear import signal and can translocate into nuclei independent of its interaction with Pygo proteins (Adachi et al., 2004; Brembeck et al., 2004). While earlier studies have demonstrated that Pygo proteins act as transcription co-activators for P-catenin, recent work suggests that Pygo proteins regulate p-catenin signaling activity by controlling its nuclear localization (Townsley et al., 2004). In Drosophila, P-catenin level is reduced in Pygo mutant embryos (Townsley et al., 2004). These results suggest two models for roles of Pygo and BCL9/BCL-9-2 in p-catenin signaling. The first model is that Pygo targets P-catenin from cytoplasm into nuclei through Lgl/BCL9. This is likely the case for Drosophila as well as for many developmental processes in vertebrates. In a second model, BCL9-2 can interact with cytoplasm p-catenin and directly targets it into nuclei (Adachi et al., 2004; Brembeck et al., 2004). Thus, BCL-9-2 provides additional levels of complexity in P-catenin regulation. The detailed mechanisms of BCL-9 and BCL-9-2 mediated Wnt signaling need to await loss of fonctional studies in mice. E4: Other Positive Regulators for P-catenin Signaling Activity in the Nucleus In addition to the positive regulators mentioned above, P-catenin also interacts with several other transcriptional co-activators through its C-terminal activation domain, which include CBP (Hecht et al, 2000; Takemaru and Moon, 2000; Wolf et al, 2002) and the chromatin remodeling factor Brg-1 (Barker et

525

al, 2001; Chi et al, 2003) (Fig. 32.4). E5: Negative Regulators for p-catenin Signaling Activity in the Nucleus p-catenin can also interact with various factors that can negatively regulate its nuclear activity. Two negative regulators for p-catenin were identified in attempts to isolate P-catenin interacting proteins by yeast two-hybrid screen approaches (Tago et al, 2000; Takemaru et al, 2003). Inhibitor of beta-catenin and TCF-4 (ICAT) is a 9-kDa nuclear protein and binds to the Armadillo (Arm) repeats of P-catenin (Tago et al, 2000). Although there is no homology in Drosophila, ICAT is conserved among vertebrates. Overexpression of ICAT can block Wnt signaling in cultured cells and in Xenopus embryos, suggesting that ICAT acts as an inhibitor for P-catenin. Consistent with a role as a negative regulator for P-catenin, knockout of ICAT in mice yields a gain-of-fonction Wnt signaling phenotype during posterior neural cell fate specification (Satoh et al, 2004). Recent crystal structure of ICAT and p-catenin revealed that ICAT inhibits p-catenin activity by blocking the binding of p-catenin to TCFs (Daniels and Weis, 2002; Graham et al, 2002). Chibby (Cby) is another nuclear protein that negatively regulates P-catenin signaling activity (Takemaru et al, 2003). Cby is conserved between Drosophila and vertebrates. Cby acts as an antagonist to P-catenin signaling activity by binding to it and preventing it from interacting with TCF. Loss of fonction of Cby in Drosophila leads to constitutively activation of Wnt signaling pathway, forther indicating that Cby fonctions as a repressor. Regulation of Wnt Signaling by other Cell Adhesion Molecules In addition to being an essential transcription co-activator for Wnt-target genes, p-catenin also fonctions as a cytoplasmic protein critical for adherens junctions (Nelson and Nusse, 2004). In fact. The P-catenin was initially discovered for its role in cell adhesion (Kemler, 1993). As a component of adherens junctions, p-catenin tightly binds to the intracellular domain of the transmembrane protein cadherin, a Ca ^-dependent homotypic adhesion molecule, and bridges it to the actin cytoskeleton through the adaptor protein a-catenin (Fig.32.5). The adherens junctions provide another level of regulation for Wnt signaling. Cadherin molecules can act as negative regulators for Wnt signaling as they bind p-catenin at the cell surface and thereby can sequesterit

526

Section V

from being available for Wnt signaling. Indeed, studies in both Xenopus and Drosophila embryos demonstrated that overexpression of cadherins reduced the availability of P-catenin by sequestering it at the plasma membrane and thereby made it unavailable for Wnt signaling to the nucleus (Heasman et al, 1994; Sanson et al., 1996). On the other hand, alterations of adherens junctions by other signaling pathways or developmental processes can also control P-catenin levels thereby indirectly regulating Wnt signaling. In general, unlike a soluble cytoplasmic P-catenin pool that is highly unstable in the absence of Wnt signaling, the membrane-associated p-catenin is stable. However, Wnt signaling can be coupled to a loosening of adhesion between epithelial cells during epithelial-mesenchymal transitions and other developmental processes (Perez-Moreno et al., 2003) as well as during cancer whose progression depends on inappropriate cell signaling and loss of cadherin-mediated adhesion (Birchmeier et al., 1995). There are several levels of regulation. First, the structural and functional integrity of the cadherin-catenin complex is regulated by phosphorylation. Serine/ threonine phosphorylation of p-catenin (Bek and Kemler, 2002) or epithelial cadherin(E-cadherin) (Lickert et al., 2000) cause increased stability of the cadherin-catenin complex. However, tyrosine phosphorylation of P-catenin by tyrosine kinases can results in a loss of cadherin-mediated cell-cell adhesion and an increase in the level of cytoplasmic p-catenin (Piedra et al., 2001; Roura et al., 1999) (Fig.32.5). Different tyrosine kinases can affect cadherin-catenin complex by different mechanisms. For example, tyrosine phosphorylation of p-catenin at Tyr-142 by cytoplasmic kinase Fer and Fyn disrupts binding of P-catenin to a-catenin (Piedra et al., 2001; Piedra et al., 2003), whereas phosphorylation of p-catenin at Tyr-654 by Src Kinase or the epidermal growth factor (EGF) receptor (Roura et al., 1999) blocks binding of P-catenin to cadherin (Fig. 32.5). In contrast, de-phosphorylation at tyrosine residues by activation of PTPases can stabilize the cadherin-catenin complex and result in increased cadherin-mediated cell-cell adhesion (Balsamo et al., 1998; Hellberg et al., 2002; Nawroth et al., 2002). Recent data demonstrated that phosphorylation of p-catenin by a tyrosine kinase cMET, the receptor for hepatocyte growth factor, can also directly facilitate its nuclear translocation thereby enhancing its signaling in the nucleus (Bienz, 2005; Brembeck et al., 2004; Danilkovitch-Miagkova et al., 2001). Activated cMET kinase can cause P-catenin phosphorylation at Tyr-142. Interestingly, p-catenin phosphorylation at Tyr-142 can be effectively bound by BCL 9-2 (Bienz, 2005;

Special Topics

Brembeck et al., 2004). The interaction of phosphorylated P-catenin with BCL 9-2 allows pcatenin to be effectively translocated into nucleus by BCL 9-2 which contains a strong nuclear importing signal (Brembeck et al., 2004). Thus, p-catenin phosphorylation at Tyr-142 both disrupts its association with a-catenin thereby adhesion junction and induce its nuclear import though BCL 9-2. The coupling of P-catenin phosphorylation and its nuclear import may occur in both developmental processes and during oncogenesis.

jQo-catenii) atcin filaments

Cell-cell adhesion low high Cytoplasmic p-catenin high low Fig.32.5 Cell adhesion and regulation of p-catenin activity. p-catenin is involved in the formation of cell adhesion by forming the cadherin-catenin complex. The integrity of this complex is regulated by the balance of tyrosine kinase and phosphatase activities. The cadherin-catenin complex is negatively regulated by phosphorylation of P-catenin through tyrosine kinase (TK) including receptor tyrosine kinases (RTKs) and cytoplasmic tyrosine kinases (Fer, Fyn, Yes, and Src). These kinases phosphorylate specific tyrosine residues in P-catenin (Y654, Y142) leading to dissociation of the cadherin-catenin complex, thereby elevating levels of cytoplasmic p-catenin. De-phosphorylation of p-catenin by protein tyrosine phosphatases (PTP) can stabilize the cadherin-catenin complex, leading to reduced levels of cytoplasmic p-catenin.

Wnt Signaling in Cancers and other Human Diseases Given the essential functions of Wnt signaling in development and in adult homeostasis, it is not surprising that de-regulated Wnt signaling can cause various human diseases and cancers. Constitutive activation of Wnt signaling is implicated in various cancers (Giles et al., 2003), in particular colon cancer (Bienz and Clevers, 2000). The best-known example of this is mutations in tumor suppressor APC. Inactivation

Chapter 32

Wnt Signaling and Transcriptional Regulation

mutations in APC, which cause constitutive Wnt signaling activation, are associated with familial adenomatous polyposis (FAP), an autosomal, dominantly inherited disease in which patients display hundreds or thousands of polyps in the colon and rectum (Kinzler et al, 1991; Nishisho et a/., 1991). Constitutively activated forms of P-catenin mutations and loss of function APC mutations have also been identified in sporadic colon cancers and a large variety of other tumors (Giles et aL, 2003). Furthermore, mutations in human Axin 1 have also been found in hepatocellular carcinomas (Satoh et ai, 2000) and mutations in human Axin2 predispose to colon cancer (Lammi et al, 2004). Together, these data demonstrate that uncontrolled p-catenin regulation caused by mutations in the Wnt signaling pathway can lead to many cancers. De-regulated Wnt signaling is also implicated in a variety of human genetic disorders. Various mutations in human LRP5 are found to be associated with defects in bone formation. While a gain of function mutation in LRP5 causes increased bone density at defined locations (Boyden et a/., 2002), loss of function mutations result in reduced bone mass (Gong et al., 2001). These data suggest that Wnt signaling is essential for maintenance of normal bone density. The LRP5 loss of function mutations are also associated with vasculature defects in the eye (osteoperosispseudoglioma syndrome or OPPG) (Gong et a/., 2001). Furthermore, another hereditary disorder called familial exudative vitreopathy (FEVR), which causes defective vasculogenesis in the peripheral retina, is associated with mutations in both LRP5 and the Fz4 receptor (Robitaille et al, 2002; Toomes et al, 2004). In summary, it has become increasingly recognized that like other essential signaling pathways, mutations associated de-regulated Wnt signaling can cause various cancers and other human diseases. It is anticipated that further genetic studies will help to uncover other human diseases resulted fi-om mutations or de-regulated Wnt signaling. Understanding Wnt signaling pathway will provide insights into the design of therapeutic drugs which can potentially cure related diseases. Concluding Remarks Intensive studies in the past decades have uncovered most of the intracellular signaling component involved in Wnt signaling. Analysis of Wnt signaling components and their functions has also implicated the involvement of Wnt signaling in development and in adult tissue maintenance. It is now well estabUshed that de-regulation of Wnt signaling can cause various human diseases, in

527

particular human cancers. However, Wnt signaling is a complex and tightly regulated pathway. The mechanisms of several essential processes during Wnt signaling are still unclear and need to be resolved. These include the processes of how Wnt binding to the Fz/LRP complex transduces a signal to Dsh, how proteins within the P-catenin degradation complex are regulated, and how p-catenin interacts with various positive and negative regulators to integrate Wnt signaling input as well as other signaling inputs to selectively activate the transcription of its target genes. With development of new technology and experimental approaches such as RNAi screens for components of Wnt signaling in various model systems and detailed structural studies of Wnt components (Dasgupta et al, 2005), we will gain a more complete picture of the Wnt signaling pathway. Further, screens for small molecules that can modulate the activity of essential signaling components such as p-catenin will help translate directly our knowledge of Wnt signaling into intervention for curing diseases related with de-regulated Wnt signaling such as cancers (Clevers, 2004; Lepourcelet et al, 2004). Acknowledgment I apologize to many investigators whose articles could not be cited due to space constraints. I thank American Heart Association, March of Dime foundation and the National Institutes of Health for support of our research.

References Aberle, H., Bauer, A., Stappert, J., Kispert, A., and Kemler, R. (1997). beta-catenin is a target for the ubiquitin-proteasome pathway. Embo J 7(5, 3797-804. Adachi, S., Jigami, T., Yasui, T., Nakano, T., Ohwada, S., Omori, Y, Sugano, S., Ohkawara, B., Shibuya, H., Nakamura, T., et al (2004). Role of a BCL9-related beta-catenin-binding protein, B9L, in tumorigenesis induced by aberrant activation of Wnt signaling. Cancer Res 64, 8496-501. Ahmed, Y, Nouri, A., and Wieschaus, E. (2002). Drosophila Apcl and Apc2 regulate Wingless transduction throughout development. Development 72P, 1751-62. Akong, K., McCartney, B. M., and Peifer, M. (2002). Drosophila APC2 and APCl have overlapping roles in the larval brain despite their distinct intracellular localizations. Dev Biol 250, 71-90. Amit, S., Hatzubai, A., Birman, Y, Andersen, J. S., Ben-Shushan, E., Mann, M., Ben-Neriah, Y, and Alkalay, I. (2002). Axin-mediated CKI phosphorylation of beta-catenin at Ser 45: a

528

Section V

molecular switch for the Wnt pathway. Genes Dev 16, 1066-76. Baeg, G. H., Lin, X., Khare, N., Baumgartner, S., and Perrimon, N. (2001). Heparan sulfate proteoglycans are critical for the organization of the extracellular distribution of Wingless. Development 128, 87-94. Balsamo, J., Arregui, C , Leung, T., and Lilien, J. (1998). The nonreceptor protein tyrosine phosphatase PTPIB binds to the cytoplasmic domain of N-cadherin and regulates the cadherin-actin linkage. J Cell Biol 143, 523-32. Barker, N., Hurlstone, A., Musisi, H., Miles, A., Bienz, M., and Clevers, H. (2001). The chromatin remodelling factor Brg-1 interacts with beta-catenin to promote target gene activation. Embo J 20, 4935-43. Bek, S., and Kemler, R. (2002). Protein kinase CKII regulates the interaction of beta-catenin with alpha-catenin and its protein stability. J Cell Sci 115, 4743-53. Belenkaya, T. Y., Han, C , Standley, H. J., Lin, X., Houston, D. W., and Heasman, J. (2002). pygopus Encodes a nuclear protein essential for winglessAVnt signaling. Development 129, 4089-101. Bhanot, R, Brink, M., Samos, C. H., Hsieh, J. C , Wang, Y., Macke, J. R, Andrew, D., Nathans, J., and Nusse, R. (1996). A new member of the frizzled family from Drosophila fimctions as a Wingless receptor. Nature 382, 225-30. Bienz, M., (1998). TCP: transcriptional activator or repressor? Curr Opin Cell Biol 10, 366-72. Bienz, M., (2003). Ape. Curr Biol 13, R215-6. Bienz, M. (2005). beta-Catenin: a pivot between cell adhesion and Wnt signalling. Curr Biol 15, R64-7. Bienz, M., and Clevers, H. (2000). Linking colorectal cancer to Wnt signaling. Cell 103, 311-20. Bienz, M., and Hamada, F. (2004). Adenomatous polyposis coli proteins and cell adhesion. Curr Opin Cell Biol 16, 528-35. Birchmeier, W, Hulsken, J., and Behrens, J. (1995). Adherens junction proteins in tumour progression. Cancer Surv 24, 129-40. Boyden, L. M., Mao, J., Belsky, J., Mitzner, L., Farhi, A., Mitnick, M. A., Wu, D., Insogna, K., and Lifton, R. R (2002). High bone density due to a mutation in LDL-receptor-related protein 5. N Engl J Med 346, 1513-21. Brannon, M., Gomperts, M., Sumoy, L., Moon, R. T., and Kimelman, D. (1997). A beta-catenin/XTcf-3 complex binds to the siamois promoter to regulate dorsal axis specification in Xenopus, Genes Dev 11, 2359-70. Brembeck, F. H., Schwarz-Romond, T., Bakkers, J., Wilhelm, S., Hammerschmidt, M., and Birchmeier, W (2004). Essential role of BCL9-2 in the switch between beta-catenin's adhesive and transcriptional frmctions. Genes Dev 18, 2225-30. Cavallo, R. A., Cox, R. T., Moline, M. M., Roose, J., Polevoy, G. A., Clevers, H., Peifer, M., and Bejsovec, A. (1998). Drosophila Tcf and Groucho interact to repress Wingless signalling activity. Nature 395, 604-8. Chen, G., Fernandez, J., Mische, S., and Courey, A. J. (1999). A

Special Topics fimctional interaction between the histone deacetylase Rpd3 and the corepressor groucho in Drosophila development. Genes Dev 75,2218-30. Chi, T. H., Wan, M., Lee, R R, Akashi, K., Metzger, D., Chambon, R, Wilson, C. B,. and Crabtree, G. R. (2003). Sequential roles of Brg, the ATPase subunit of BAF chromatin remodeling complexes, in thymocyte development. Immunity 19, 169-82. Clevers, H. (2004). Wnt breakers in colon cancer. Cancer Cell 5, 5-6. Collins, R. T., and Treisman, J. E. (2000). Osa-containing Brahma chromatin remodeling complexes are required for the repression of wingless target genes. Genes Dev 14, 3140-52. Daniels, D. L., and Weis, W. L (2002). ICAT inhibits beta-catenin binding to TcfT.ef-family transcription factors and the general coactivator p300 using independent structural modules. Mol Cell 10, 573-84. Danilkovitch-Miagkova, A., Miagkov, A., Skeel, A., Nakaigawa, N., Zbar, B., and Leonard, E. J. (2001). Oncogenic mutants of RON and MET receptor tyrosine kinases cause activation of the beta-catenin pathway. Mol Cell Biol 21, 5857-68. Dasgupta, R., Kaykas, A., Moon, R. T., and Perrimon, N. (2005). Functional Genomic Analysis of the Wnt-Wingless Signaling Pathway. Science. Dominguez, L, Itoh, K., and Sokol, S. Y. (1995). Role of glycogen synthase kinase 3 beta as a negative regulator of dorsoventral axis formation in Xenopus embryos. Proc Natl Acad Sci USA 92, 8498-502. Farr, G. H., 3rd, Ferkey, D. M., Yost, C , Pierce, S. B., Weaver, C , and Kimelman, D. (2000). Interaction among GSK-3, GBP, axin, and APC m Xenopus axis specification. J Cell Biol 148, 691-702. Giles, R. H., van Es, J. H., and Clevers, H. (2003). Caught up in a Wnt storm: Wnt signaling in cancer. Biochim Biophys Acta 1653, 1-24. Gong, Y, Slee, R. B., Fukai, N., Rawadi, G., Roman-Roman, S., Reginato, A. M., Wang, H., Cundy, T., Glorieux, F. H., Lev, D., et al. (2001). LDL receptor-related protein 5 (LRP5) affects bone accrual and eye development. Cell 107, 513-23. Graham, T. A., Clements, W K., Kimelman, D., and Xu, W (2002). The crystal structure of the beta-catenin/ICAT complex reveals the inhibitory mechanism of ICAT. Mol Cell 76/, 563-71. Han, C , Yan, D., Belenkaya, T. Y, and Lin, X. (2005). Drosophila glypicans Dally and Dally-like shape the extracellular Wingless morphogen gradient in the wing disc. Development 132, 667-79. Hart, M. J., de los Santos, R., Albert, I. N., Rubinfeld, B., and Polakis, P. (1998). Downregulation of beta-catenin by human Axin and its association with the APC tumor suppressor, beta-catenin and GSK3 beta. Curr Biol 8, 573-81. He, X., Saint-Jeannet, J. P., Wang, Y, Nathans, J., Dawid, I. and Varmus, H., (1997). A member of the Frizzled protein family mediating axis induction by Wnt-5A. Science 275, 1652-4.

Chapter 32

Wnt Signaling and Transcriptional Regulation

He, X., Saint-Jeannet, J. P., Woodgett, J. R., Varmus, H. E., and Dawid, I. B. (1995). Glycogen synthase kinase-3 and dorsoventral patterning in Xenopus embryos. Nature 374, 617-22. He, X., Semenov, M., Tamai, K., and Zeng, X. (2004). LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way. Development 7 i i , 1663-77. Heasman, J., Crawford, A., Goldstone, K., Gamer-Hamrick, R, Gumbiner, B., McCrea, R, Kintner, C , Noro, C. Y., and Wylie, C. (1994). Overexpression of cadherins and underexpression of beta-catenin inhibit dorsal mesoderm induction in early Xenopus embryos. Cell 7P, 791-803. Hecht, A., Vleminckx, K., Stemmler, M. R, van Roy, R, and Kemler, R. (2000). The p300/CBP acetyltransferases function as transcriptional coactivators of beta-catenin in vertebrates. Embo J 19, 1839-50. Hellberg, C. B., Burden-Gulley, S. M., Pietz, G. E., and Brady-Kalnay, S. M. (2002). Expression of the receptor protein-tyrosine phosphatase, PTPmu, restores E-cadherindependent adhesion in human prostate carcinoma cells. J Biol Chem 277, 11165-73. Hsieh, J. C , Rattner, A., Smallwood, P. M., and Nathans, J. (1999). Biochemical characterization of Wnt-frizzled interactions using a soluble, biologically active vertebrate Wnt protein. Proc Natl Acad Sci USA 96, 3546-51. Hsu, W, Zeng, L., and Costantini, R (1999). Identification of a domain of Axin that binds to the serine/threonine protein phosphatase 2A and a self-binding domain. J Biol Chem 274, 3439-45. Ikeda, S., Kishida, S., Yamamoto, H., Murai, H., Koyama, S., and Kikuchi, A. (1998). Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3beta and betacatenin and promotes GSK-3beta-dependent phosphorylation of beta-catenin. Embo J17, 1371-84. Itoh, K., Krupnik, V. E., and Sokol, S. Y. (1998). Axis determination in Xenopus involves biochemical interactions of axin, glycogen synthase kinase 3 and beta-catenin. Curr Biol 8, 591-4. Katanaev, V. L., Ponzielli, R., Semeriva, M., and Tomlinson, A. (2005). Trimeric G protein-dependent frizzled signaling in Drosophila. Cell 120, 111-22. Kato, M., Patel, M. S., Levasseur, R., Lobov, I., Chang, B. H., Glass, D. A., 2nd, Hartmann, C , Li, L., Hwang, T. H., Brayton, C. R, et al (2002). Cbfal-independent decrease in osteoblast proliferation, osteopenia, and persistent embryonic eye vascularization in mice deficient in Lrp5, a Wnt coreceptor. J Cell Biol 757, 303-14. Kawahara, K., Morishita, T., Nakamura, T., Hamada, R, Toyoshima, K., and Akiyama, T. (2000). Down-regulation of beta-catenin by the colorectal tumor suppressor APC requires association with Axin and beta-catenin. J Biol Chem 275, 8369-74. Kemler, R. (1993). From cadherins to catenins: cytoplasmic

529

protein interactions and regulation of cell adhesion. Trends Genet 9,317-21. Kinzler, K. W, Nilbert, M. C , Su, L. K., Vogelstein, B., Bryan, T. M., Levy, D. B., Smith, K. J., Preisinger, A. C , Hedge, R, McKechnie, D., et al. (1991). Identification of FAP locus genes from chromosome 5q21. Science 253, 661-5. Kishida, S., Yamamoto, H., Ikeda, S., Kishida, M., Sakamoto, I., Koyama, S., and Kikuchi, A. (1998). Axin, a negative regulator of the wnt signaling pathway, directly interacts with adenomatous polyposis coli and regulates the stabilization of beta-catenin. J Biol Chem 275,10823-6. Kramps, T., Peter, O., Brunner, E., Nellen, D., Froesch, B., Chatterjee, S., Murone, M., Zullig, S., and Basler, K. (2002). Wnt/wingless signaling requires BCL9/legless-mediated recruitment of pygopus to the nuclear beta-catenin-TCF complex. Cell 109, 47-60. Lammi, L., Arte, S., Somer, M., Jarvinen, H., Lahermo, P., Thesleff, I., Pirinen, S., and Nieminen, R (2004). Mutations in AXIN2 cause familial tooth agenesis and predispose to colorectal cancer. Am J Hum Genet 74, 1043-50. Latres, E., Chiaur, D. S., and Pagano, M. (1999). The human F box protein beta-Trcp associates with the Cull/Skpl complex and regulates the stability of beta-catenin. Oncogene 18, 849-54. Lepourcelet, M., Chen, Y. N., France, D. S., Wang, H., Crews, P., Petersen, R, Bruseo, C , Wood, A. W, and Shivdasani, R. A. (2004). Small-molecule antagonists of the oncogenic Tcf1)eta-catenin protein complex. Cancer Cell 5, 91-102. Li, L., Yuan, H., Weaver, C. D., Mao, J., Farr, G. H., 3rd, Sussman, D. J., Jonkers, J., Kimelman, D., and Wu, D. (1999). Axin and Fratl interact with dvl and GSK, bridging Dvl to GSK in Wnt-mediated regulation of LEF-1. Embo J18, 4233-40. Lickert, H., Bauer, A., Kemler, R., and Stappert, J. (2000). Casein kinase II phosphorylation of E-cadherin increases E-cadherin^eta-catenin interaction and strengthens cell-cell adhesion. J Biol Chem 275, 5090-5. Lin, R., Hill, R. J., and Priess, J. R. (1998). POP-1 and anterior-posterior fate decisions in C. elegans embryos. Cell 92, 229-39. Lin, X. (2004). Functions of heparan sulfate proteoglycans in cell signaling during development. Development 131, 6009-21. Lin, X., and Perrimon, N. (1999). Dally cooperates with Drosophila Frizzled 2 to transduce Wingless signalling. Nature 400, 2U A. Liu, C , Kato, Y, Zhang, Z., Do, V. M., Yankner, B. A., and He, X. (1999). beta-Trcp couples beta-catenin phosphorylation-degradation and regulates Xenopus axis formation. Proc Natl Acad Sci USA 96, 6273-8. Liu, C , Li, Y, Semenov, M., Han, C , Baeg, G. H., Tan, Y, Zhang, Z., Lin, X., and He, X. (2002). Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell 108, ^2>1A1. Liu, T., DeCostanzo, A. J., Liu, X., Wang, H., Hallagan, S., Moon,

530

Section V

R. T., and Malbon, C. C. (2001). G protein signaling from activated rat frizzled-1 to the beta-catenin-Lef-Tcf pathway. Science 2P2, 1718-22. Logan, C. Y., and Nusse, R. (2004). The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol 20, 781-810. Mao, J., Wang, J., Liu, B., Pan, W., Farr, G. H., 3rd, Flynn, C, Yuan, H., Takada, S., Kimeknan, D., Li, L., et al (2001). Low-density lipoprotein receptor-related protein-5 binds to Axin and regulates the canonical Wnt signaling pathway. Mol Cell 7, 801-9. Moon, R. T. (2004). Teaching resource. Beta-catenin signaling and axis specification. Sci STKE 2004, tr6. Moon, R. T. (2005). Wnt/beta-catenin pathway. Sci STKE 2005, cml. Munemitsu, S., Albert, L, Souza, B., Rubinfeld, B. and Polakis, P. (1995). Regulation of intracellular beta-catenin levels by the adenomatous polyposis coli (APC) tumor-suppressor protein. Proc Natl Acad Sci USA 92, 3046-50. Nathke, L S. (2004). The adenomatous polyposis coli protein: the Achilles heel of the gut epithelium. Annu Rev Cell Dev Biol 20, 337-66. Nawroth, R., Poell, G., Ranft, A., Kloep, S., Samulowitz, U., Fachinger, G., Golding, M., Shima, D. T., Deutsch, U., and Vestweber, D. (2002). VE-PTP and VE-cadherin ectodomains interact to facilitate regulation of phosphorylation and cell contacts. Embo J 21,4885-95. Nelson, W. J., and Nusse, R. (2004). Convergence of Wnt, beta-catenin, and cadherin pathways. Science 303, 1483-7. Nishisho, L, Nakamura, Y., Miyoshi, Y, Miki, Y, Ando, H., Horii, A., Koyama, K., Utsunomiya, J., Baba, S., and Hedge, P. (1991). Mutations of chromosome 5q21 genes in FAP and colorectal cancer patients. Science 253, 665-9. Nusse, R. (1999). WNT targets. Repression and activation. Trends Genet 75, 1-3. Pai, L. M., Orsulic, S., Bejsovec, A., and Peifer, M. (1997). Negative regulation of Armadillo, a Wingless effector in Drosophila, Development 124,2255-66. Parker, D. S., Jemison, J,, and Cadigan, K. M. (2002). Pygopus, a nuclear PHD-finger protein required for Wingless signaling in Drosophila. Development 129, 2565-76. Peifer, M., Berg, S., and Reynolds, A. B. (1994). A repeating amino acid motif shared by proteins with diverse cellular roles. Cell 75, 789-91. Peifer, M., McCrea, P. D., Green, K. J., Wieschaus, E., and Gumbiner, B. M. (1992). The vertebrate adhesive junction proteins beta-catenin and plakoglobin and the Drosophila segment polarity gene armadillo form a multigene family with similar properties. J Cell Biol 118, 681-91. Perez-Moreno, M., Jamora, C , and Fuchs, E. (2003). Sticky business: orchestrating cellular signals at adherens jimctions. Cell 112, 535-48.

Special Topics Peters, J. M., McKay, R. M., McKay, J. P, and Graff, J. M. (1999). Casein kinase I transduces Wnt signals. Nature 401, 345-50. Piedra, J., Martinez, D., Castano, J., Miravet, S., Dunach, M., and de Herreros, A. G. (2001). Regulation of beta-catenin structure and activity by tjTosine phosphorylation. J Biol Chem 276, 20436-43. Piedra, J., Miravet, S., Castano, J., Palmer, H. G., Heisterkamp, N., Garcia de Herreros, A., and Dunach, M. (2003). pi20 Catenin-associated Fer and Fyn tyrosine kinases regulate beta-catenin Tyr-142 phosphorylation and beta- catenin- alphacatenin Interaction. Mol Cell Biol 23,2287-97. Pierce, S. B., and Kimelman, D. (1995). Regulation of Spemann organizer formation by the intracellular kinase Xgsk-3. Development 121, 755-65. Pinson, K. L, Brennan, J., Monkley, S., Avery, B. J., and Skames, W. C. (2000). An LDL-receptor-related protein mediates Wnt signalling in mice. Nature 407, 535-8. Polakis, P. (1997). The adenomatous polyposis coli (APC) tumor suppressor. Biochim Biophys Acta 1332, F127-47. Riese, J., Yu, X., Munnerl)^, A., Eresh, S., Hsu, S. C, Grosschedl, R., and Bienz, M. (1997). LEF-1, a nuclear factor coordinating signaling inputs from wingless and decapentaplegic. Cell 88,111-%!. Rijsewijk, F., Schuermann, M., Wagenaar, E., Parren, P., Weigel, D., and Nusse, R. (1987). The Drosophila homolog of the mouse mammary oncogene int-1 is identical to the segment polarity gene wingless. Cell 50, 649-57. Robitaille, J., MacDonald, M. L., Kaykas, A., Sheldahl, L. C, Zeisler, J., Dube, M. P., Zhang, L. H., Singaraja, R. R., Guernsey, D. L., Zheng, B., et al. (2002). Mutant fiizzled-4 disrupts retinal angiogenesis in familial exudative vitreoretinopathy. Nat Genet 32, 326-30. Roura, S., Miravet, S., Piedra, J., Garcia de Herreros, A., and Dunach, M. (1999). Regulation of E-cadherin/Catenin association by tyrosine phosphorylation. J Biol Chem 274, 36734-40. Rubinfeld, B., Albert, L, Porfiri, E., Fiol, C, Munemitsu, S., and Polakis, R (1996). Binding of GSK3beta to the APC-beta-catenin complex and regulation of complex assembly. Science 272, 1023-6. RuHfson, E. J., Wu, C. H., and Nusse, R. (2000). Pathway specificity by the biftinctional receptor frizzled is determined by affinity for wingless. Mol Cell 6,117-26. Sakanaka, C, Leong, P., Xu, L., Harrison, S. D., and Williams, L. T. (1999). wCasein kinase iepsilon in the wnt pathway: regulation of beta-catenin function. Proc Natl Acad Sci USA 96, 12548-52. Sakanaka, C , Weiss, J. B., and Williams, L. T. (1998). Bridging of beta-catenin and glycogen synthase kinase-3beta by axin and inhibition of beta-catenin-mediated transcription. Proc Natl Acad Sci USA P5, 3020-3. Salic, A., Lee, E., Mayer, L., and Kirschner, M. W (2000). Control of beta-catenin stability: reconstitution of the

Chapter 32

Wnt Signaling and Transcriptional Regulation

c)^oplasmic steps of the wnt pathway in Xenopus egg extracts. Mol Cell 5, 523-32. Sanson, B., White, P., and Vincent, J. P. (1996). Uncoupling cadherin-based adhesion from wingless signalling in Drosophila. Nature 383, 627-30. Satoh, K., Kasai, M., Ishidao, T., Tago, K., Ohwada, S., Hasegawa, Y., Senda, T., Takada, S., Nada, S., Nakamura, T., et al. (2004). Anteriorization of neural fate by inhibitor of beta-catenin and T cell factor (ICAT), a negative regulator of Wnt signaling. Proc Natl Acad Sci USA 101, 8017-21. Satoh, S., Daigo, Y, Furukawa, Y, Kato, T., Miwa, N., Nishiwaki, T., Kawasoe, T., Ishiguro, H., Fujita, M., Tokino, T., et al. (2000). AXINl mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virus-mediated transfer of AXINl. Nat Genet 2^, 245-50. Sawa, H., Lobel, L., and Horvitz, H. R. (1996). The Caenorhabditis elegansgQUQ lin-17, which is required for certain asymmetric cell divisions, encodes a putative seven-transmembrane protein similar to the Drosophila frizzled protein. Genes Dev 10, 2189-97. Siegfried, E., Chou, T. B., and Perrimon, N. (1992). wingless signaling acts through zeste-white 3, the Drosophila homolog of glycogen synthase kinase-3, to regulate engrailed and establish cell fate. Cell 77, 1167-79. Siegfried, E., and Perrimon, N. (1994). Drosophila wingless: a paradigm for the ftmction and mechanism of Wnt signaling. Bioessays 16, 395-404. Siegfried, E., Wilder, E. L., and Perrimon, N. (1994). Components of wingless signalling in Drosophila. Nature 367, 76-80. Spink, K. E., Polakis, R, and Weis, W I. (2000). Structural basis of the Axin-adenomatous polyposis coli interaction. Embo ] 19, 2270-9. Strutt, D. (2003). Frizzled signalling and cell polarisation in Drosophila and vertebrates. Development 130,4501-13. Tago, K., Nakamura, T., Nishita, M., Hyodo, J., Nagai, S., Murata, Y, Adachi, S., Ohwada, S., Morishita, Y, Shibuya, H., et al. (2000). Inhibition of Wnt signaling by ICAT, a novel beta-catenin-interacting protein. Genes Dev 7^, 1741-9. Takemaru, K., Yamaguchi, S., Lee, Y S., Zhang, Y, Carthew, R. W, and Moon, R. T. (2003). Chibby, a nuclear beta-catenin-associated antagonist of the WntAVingless pathway. Nature 422,905-9. Takemaru, K. I., and Moon, R. T. (2000). The transcriptional coactivator CBP interacts with beta-catenin to activate gene expression. J Cell Biol 149,249-54. Tamai, K., Semenov, M., Kato, Y, Spokony, R., Liu, C , Katsuyama, Y, Hess, F., Saint-Jeannet, J. P., and He, X. (2000). LDL-receptor-related proteins in Wnt signal transduction. Nature 407, 530-5. Tamai, K., Zeng, X., Liu, C , Zhang, X., Harada, Y, Chang, Z., and He, X. (2004). A mechanism for Wnt coreceptor activation. Mol Cell 13, 149-56.

531

Tao, Q., Yokota, C , Puck, H., Kofron, M., Birsoy, B., Yan, D., Asashima, M., Wylie, C. C , Lin, X., and Heasman, J. (2005). Maternal wnt 11 activates the canonical wnt signaling pathway required for axis formation in Xenopus embryos. Cell 120, 857-71. Thompson, B., Townsley, F., Rosin-Arbesfeld, R., Musisi, H., and Bienz, M. (2002). A new nuclear component of the Wnt signalling pathway. Nat Cell Biol 4, 367-73. Tolwinski, N. S., Wehrli, M., Rives, A., Erdeniz, N., DiNardo, S., and Wieschaus, E. (2003). WgAVnt signal can be transmitted through arrow/LRP5,6 and Axin independently of Zw3/Gsk3beta activity. Dev Cell 4,407-18. Toomes, C , Bottomley, H. M., Jackson, R. M., Towns, K. V., Scott, S., Mackey, D. A., Craig, J. E., Jiang, L., Yang, Z., Trembath, R., et al. (2004). Mutations in LRP5 or FZD4 underlie the common familial exudative vitreoretinopathy locus on chromosome llq. Am J Hum Genet 74, 721-30. Townsley, F. M., Cliffe, A., and Bienz, M. (2004). Pygopus and Legless target Armadillo/beta-catenin to the nucleus to enable its transcriptional co-activator ftinction. Nat Cell Biol 6, 626-33. Tsuda, M., Kamimura, K., Nakato, H., Archer, M., Staatz, W, Fox, B., Humphrey, M., Olson, S., Futch, T., Kaluza, V., et al. (1999). The cell-surface proteoglycan Dally regulates Wingless signalling in Drosophila. Nature^6/0, 276-80. Veeman, M. T., Axelrod, J. D., and Moon, R. T. (2003). A second canon. Functions and mechanisms of beta-catenin-independent Wnt signaling. Dev Cell 5, 367-77. Wehrli, M., Dougan, S. T., Caldwell, K., O'Keefe, L., Schwartz, S., Vaizel-Ohayon, D., Schejter, E., Tomlinson, A., and DiNardo, S. (2000). Arrow encodes an LDL-receptor-related protein essential for Wingless signalling. Nature 407, 527-30. Willis, T. G., Zalcberg, I. R., Coignet, L. J., Wlodarska, I., Stul, M., Jadayel, D. M., Bastard, C , Treleaven, J. G., Catovsky, D., Silva, M. L., et al. (1998). Molecular cloning of translocation t(l;14)(q21;q32) defines a novel gene (BCL9) at chromosome lq21. Blood 97,1873-81. Wodarz, A., and Nusse, R. (1998). Mechanisms of Wnt signaling in development. Annu Rev Cell Dev Biol 14, 59-88. Wolf, D., Rodova, M., Miska, E. A., Calvet, J. P., and Kouzarides, T. (2002). Acetylation of beta-catenin by CREB-binding protein (CBP). J Biol Chem 277, 25562-7. Wu, C. H., and Nusse, R. (2002). Ligand receptor interactions in the Wnt signaling pathway in Drosophila. J Biol Chem 277, 41762-9. Yanagawa, S., Matsuda, Y, Lee, J. S., Matsubayashi, H., Sese, S., Kadowaki, T., and Ishimoto, A. (2002). Casein kinase I phosphorylates the Armadillo protein and induces its degradation in Drosophila. Embo J 27, 1733-42. Yang-Snyder, J., Miller, J. R., Brown, J. D., Lai, C. J., and Moon, R. T. (1996). A frizzled homolog ftinctions in a vertebrate Wnt signaling pathway. Curr Biol 6, 1302-6. Yost, C , Torres, M., Miller, J. R., Huang, E., Kimelman, D., and

532 '

Section V

Moon, R. T. (1996). The axis-inducing activity, stability, and subcellular distribution of beta-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev 10, 1443-54. Zecca, M., Easier, K., and Struhl, G. (1996). Direct and long-range action of a wingless morphogen gradient. Cell 87, 833-44.

Special Topics Zeng, L., Fagotto, R, Zhang, T., Hsu, W., Vasicek, T. J., Perry, W. L., 3rd, Lee, J. J., Tilghman, S. M., Gumbiner, B. M., and Costantini, F. (1997). The mouse Fused locus encodes Axin, an inhibitor of the Wnt signaling pathway that regulates embryonic axis formation. CQ\\90, 181-92.

Chapter 33 Regulatory Mechanisms for Floral Organ Identity Specification in Arabidopsis thaliana Zhongchi Liu Dept. of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD 20742

Key Words: ABCE model, flower development, floral organ identity, LEAFY (LEY), APETALAl (API), APETALA2 (AP2), WUSCHEL (WUS), AGAMOUS (AG), APETALA3 (AP3), PISTALLATA (PI), SEPALLATA (SEP), LEUNIG (LUG), SEUSS (SEU), UNUSUAL FLORAL ORGAN (UFO), miR172 microRNA, MADSbox genes, AP2-domain, floral meristem, shoot apical meristem (SAM), meristem determinancy, homeotic transformation

provided molecular insights into how floral organs are evolved from leaves. Introduction

As indicated by other chapters of this book, pioneering work on regulatory mechanisms of gene expression was performed in yeast, Drosophila, and mammalian cells. The establishment of Arabidopsis thaliana as a model plant and the development of various molecular and genetic tools such as the Summary availability of the entire genome sequence, easy and rapid transformation protocol, and the large number of In the past decade, a major milestone in plant Transfer-DNA (T-DNA) and transposon insertion developmental biology is the elucidation of the molecular mutations make Arabidopsis thaliana an attractive genetic basis underlying floral organ identity specification. system to study gene regulation. In the past decade, a Based on the genetic characterization of floral homeotic major milestone in plant developmental biology has mutants in Arabidopsis thaliana and Antirrhinum majus, been the elucidation of the molecular genetic mechanism a simple and elegant ABC model was established to underlying floral organ identity specification. The explain how the four types of floral organs (sepals, ABCE model for floral organ identity specification petals, stamens, and carpels) are specified by A, B, and provides a framework and molecular genetic tools for C classes of floral homeotic genes. Reverse genetics uncovering regulatory mechanisms that are unique to later led to the discovery of the E class genes, and the plants or common to both plants and animals. In this ABC model was renamed the ABCE model. To date, chapter, I will highlight these regulatory mechanisms. I both transcriptional and post-transcriptional mechanisms will focus on research results obtained from studying for the domain-specific expression of A, B, and C class Arabidopsis thaliana and will discuss those findings genes are being revealed. In addition to transcriptional considered to be most central to the understanding of activation of the ABC genes by a plant specific floral organ identity specification. (Please see Jack, regulatory protein LEAFY and its co-regulators, positive 2004, for a more comprehensive review of flower autoregulation appears to refine and maintain ABCE development). Insights from studying floral organ gene expression. Additional regulatory mechanisms identity specification should broaden our understanding include microRNA-mediated translational block, the of regulatory mechanisms in all living organisms. recruitment of transcription co-repressors, and the ubiquitin-mediated protein degradation. These discoveries Corresponding Author: Tel: (301) 405-1586, Fax: (301) 314-9082, E-mail: [email protected]

534

Section V

The ABC Model for Flower Development The Arabidopsis flower is typical of many angiosperm flowers. Four types of floral organs are arranged in four concentric circles or whorls (Fig.33.1A and 33.2A). Sepals and petals comprise the outer two whorls (whorls 1, 2), while the reproductive organs stamens and carpels make up the inner two whorls (whorls 3, 4). Despite dramatic variation in the number, color and shape of floral organs in different species, this arrangement of sepal, petal, stamen, and carpel from the outer-most whorl to the inner-most whorl is fixed in the majority of the angiosperm species. This cross-species similarity suggests that the molecular genetic systems responsible for patterning of floral organs are similar in the majority offloweringplants.

Whorls

i i i i i i i i p F ^ W2:PETAir Fig.33.1 The ABCE model forfloralorgan identity specification. (A) A diagram of an Arabidopsis flower showing four sepals in whorl 1, four petals in whorl 2, six stamens in whorl 3, and two fused carpels in whorl 4. (B) The domains of the A, B, and C activities in a wild type flower. Class A activity is provided by API and AP2 in whorls 1-2; class B activity is provided by AP3 and PI in whorls 2-3; class C activity is provided by a single gene ^G in whorls 3-4. Wl to W4 indicate whorl 1 to whorl 4. (C) A revised ABCE model incorporating the SEP protein in tetrameric complexes.

Special Topics

The ABC model for flower development explains how three classes of genes (A, B, C classes) direct the development of these four types of floral organs (Coen and Meyerowitz, 1991; Weigel and Meyerowitz, 1994). The model was established based on genetic characterization oiArabidopsis thaliana and Antirrhinum majus floral homeotic mutants. Mutations in these "floral homeotic genes" result in the substitutions or replacement of one organ type by another organ type (Fig. 33.2B, 33.2C, and 33.2D). The ABC model places floral homeotic mutants and the corresponding genes into three classes: A, B, or C (Fig. 33.IB). In wild type, class A activity.is present in whorls 1-2, class B activity is restricted to whorls 2-3, and class C activity is only present in whorls 3-4. In whorl 1, the class A activity specifies sepal development. In whorl 2, where both A and B class genes are active, petal identity is specified. In whorl 3, B and C together specify stamen identity, and in whorl 4, C activity alone specifies carpel development. In addition, the model predicts that the A and C activities are antagonistic to each other. A function inhibits C function in whorls 1-2, whereas C function inhibits A function in whorls 3-4. Since the primary function of the ABC genes is to specify floral organ identity, the ABC class floral homeotic genes are also termed the "organ identity genes". APETALAl (API) and APETALA2 (AP2) are both class A genes as they are both required to specify sepal and petal identity (Fig. 33.IB) (Bowman et al, 1989; Bowman et al, 1991). However, apl and ap2 mutants exhibit different phenotypes. In apl mutants, C function is still restricted to whorls 3-4, and apl flowers develop leaf-like organs in whorl 1, no organ formation in whorl 2, but normal stamens and carpels in whorls 3 and 4. In contrast, in ap2 mutants, C activity is spread to all four whorls resulting in a flower with carpels in whorl 1, stamens in whorls 2 and 3, and carpels in whorl 4 (Fig. 33.2B). This difference in phenotype indicates that^P2 plays a predominant role in the antagonistic function predicted by the ABC model. APETALA3 (APS) and PISTILLATA (PI) are the Arabidopsis B class genes (Fig. 33.IB). Mutations in either AP3 or PI cause similar homeotic transformations in whorls 2-3 such that whorl 2 organs develop as sepals, and whorl 3 organs develop as carpels (Fig. 33.2C) (Bowman et aL, 1989). APS and P/both encode MADS domain proteins that have been shown to bind DNA only as AP3/PI heterodimers (Goto and Meyerowitz, 1994; Jack et al., 1992; Riechmann et al, 1996a; Riechmann et al., 1996b). Obligatory heterodimer formation explains why both APS and PI are required for the B activity.

Chapter 33

Transcriptional Regulation of Floral Homeotic Genes

535

Fig.33.2 Phenotypes and expression patterns of ABC genes. (A) A wild-type flower with four sepals in whorl 1, four petals in whorl 2, six stamens in whorl 3, and two fused carpels in whorl 4. (B) A class A floral homeotic mutant, ap2-2. All whorl 1 organs develop as carpels. All whorl 2 organs and most of whorl 3 stamens are absent. The whorl 4 carpels are similar to wild-type. (C) A class B floral homeotic mutant, p/-7. Organs in the outer two whorls are sepals. Organs in the inner two whorls are carpels. (D) A class C mutant, ag-1, consisting of four whorl 1 sepals, four whorl 2 petals, six whorl 3 petals, and a new flower in whorl 4. (E) Class A gene API expression pattern revealed by RNA in situ hybridization. API mRNA is detected in the entire floral meristem at stage 2. However, API mRNA is restricted to the emerging sepal primordia and absent from the inner whorl meristem cells at stage 3. Petal primordia are not yet formed at this stage. Number indicates the stage of floral meristems. See Smyth et al. (1990) for a description of Ambidopsis floral stages. (F) APS expression revealed by RNA in situ hybridization. APS is expressed in the region between developing sepals and carpels indicated by S and C respectively. (G) AG mRNA expression revealed by RNA in situ hybridization. AG mRNA is detected in the developing stamen and carpel primordium in a flower. (H) A flower from a transgenic plant containing SSSwAPS and S5S::PL Two outer whorls of petals and two inner whorls of stamens are formed in this flower. (I) A flower from a transgenic plant containing S5S::APS, 35iS.^P/and S5S::AG. The flower develops stamens in all four whorls. (J) A sepl sep2 sepS triple mutant flower. Sepals or sepaloid organs are formed in whorls 1-3 and a new flower repeating this same pattern is formed in whorl 4. (K) Three-week-old S5S::PI; S5S::APS; S5S::SEPS transgenic plant. The two embryonic leaves called cotyledons are normal, true leaves are however transformed into petaloid organs. Numbers indicate the order of leaf development, s, stamens; c, Cotyledons; TF, terminal flower. Photos in J and K are reprinted with permission from Nature Publishing Group.

AGAMOUS (AG) was the first C class gene identified and molecularly isolated (Bowman et al, 1989; Bowman et al, 1991; Yanofsky et al, 1990). AG plays a key role both in specifying stamen and carpel identity and in the antagonistic function against class A genes (Fig.33.1B). In ag loss-of-fUnction mutants, the class A activity is expanded into whorls 3-4. As a result, stamens are replaced by petals, and carpels are replaced by a new flower (Fig.33.2D). The new flower repeats the same pattern of "sepal, petal, petal", leading to the "flower within a flower" phenotype. This reveals a third role of ^G in maintaining the determinacy of the floral

meristem. In summary, AG has at least three functions: repressing class A activity in whorls 3-4, specifying stamen and carpel organ identity, and maintaining the determinacy of floral meristems. Over 200 years ago, Johann Wolfgang von Goethe proposed that the floral organs are modified leaves. What controls the difference between a floral organ and a leaf? Triple mutants combining mutations in all A, B, and C classes resulted in the formation of flowers with leaf-like organs in all floral whorls (Bowman et al, 1991). This result suggests that leaves are being transformed into floral organs by the action of ABC

536'

Section V

Special Topics

Fig.33.3 Diagrams of MADS box and AP2 domain proteins. (A) The domain structure of MADS box proteins. API, APS, PI, AG, and SEPl, SEP2, SEP3 all encode members of this gene family. The MADS box domain is the most conserved domain required for DNA binding and dimerization. The intervening (I) region between MADS box and K box is important for dimerization specificity. TheK-Box domain is important for dimerization, and the C-terminal domain (COOH) is highly divergent among different MADS box proteins and possesses transcription activation function in API and SEP. (B) The domain structure of the AP2 protein. AP2-R1 and AP2-R2 are the two conserved and homologous domains which function in DNA binding. The single hatched box is the binding site of a microRNA, miR172.

genes, lending strong supports for von Goethe's theory. All Floral Homeotic Genes Encode DNA-Binding Transcription Factors With the exception of ^P2, all ABC {API, AP3, PI and AG) genes encode members of a multi-gene family called the MADS-box gene family (Fig.33.3 A) (Riechmann and Meyerowitz, 1997b). The name of the MADS-domain was derived from the four founding members: MCMl, yeast; AG, Arabidopsis; DEFICIENS (DEF), Antirrhinum; and SRF, human. The basic domain structure of MADS box proteins is illustrated in Fig.33.3A. The N-terminal half of the MADS domain is essential for DNA binding and the C-terminal half of the MADS domain is required for dimerization (Riechmann et al., 1996b). In the majority of plant MADS domain-containing proteins, a second conserved domain, the K box, was identified because of its similarity to the coiled-coil domain of keratin (Maet al., 1991). The distinctive feature of the K box is the disposition of hydrophobic residues with a spacing that permits the formation of amphipathic a-helices (Ma et al, 1991; Pnueli et a/., 1991). Between the MADS domain and the K box is a less strictly conserved Intervening (I) region. Amino acids in the I region and the K box have been shown to be important for the partner specificity in dimer formation (Riechmann et al., 1996a). Finally, the C-terminal domain of the MADS box proteins is highly divergent. While the C-terminal domain of API exhibited transcription activation function, the C-terminal domain of APS, PI, and^G did not exhibit such an activity (Honma and Goto, 2001). MADS-domain proteins function as dimers and bind to a core consensus site CC(A/T)6GG which is known as the CArG-box (Huang et al, 1996; SchwarzSommer et al, 1992; Shiraishi et al, 1993; Wyime and Treisman, 1992). Nevertheless, functional specificity (i.e. distinct organ identity activity) of the MADS-box proteins is independent of their DNA-binding specificity.

For example, hybrid genes were generated by swapping the amino terminal half of the MADS domain of the Arabidopsis proteins API, AP3, PI, and AG with the corresponding portion of human MEF2A or SRF proteins. Such hybrid proteins, having acquired the in vitro binding specificity of MEF2A or SRF, are able to perform the specific functions of the corresponding Arabidopsis genes in transgenic plants (Krizek and Meyerowitz, 1996b; Riechmann and Meyerowitz, 1997a). Thus, interactions between these MADS proteins with additional cofactors are probably crucial for the specific organ identity function. AP2 is unique in that it encodes a member of the AP2/EREBP transcription factor family (Jofuku et al, 1994; Riechmann and Meyerowitz, 1998). The AP2/ EREBP transcription factors have one or two copies of a conserved 68 amino acid region dubbed the AP2 domain (Fig. 33.3B). Previous studies with EREBPs (ethylene-responsive element binding proteins) with a single AP2 domain demonstrated that the AP2 domain recognizes and binds to DNA specifically in an 11-bp sequence (TAAGAGCCGCC), the GCC box (OhmeTakagi and Shinshi, 1995). However, ^P2 and another floral regulator AINTEGUMENTA (ANT) encode two AP2 domains (EUiott et al, 1996; Klucher et al, 1996; Krizek et al, 2000). Using an in vitro selection procedure, the DNA binding specificity of ANT was found to be 5'-gCAC(A/G)N(A/T)TcCC(a/g) ANG(c/t)3' (Nole-Wilson and Krizek, 2000). Neither single AP2 domain of ANT was capable of binding to the selected sequences, suggesting that both AP2 domains make DNA contacts. Therefore, AP2/ANT proteins with two AP2 domains exhibit different DNA-binding properties from the EREBPs. Most A, B, and C Class Genes are Regulated at Transcription Level The ABC model gave very specific predictions about where the A, B and C genes are functioning

Chapter 33

Transcriptional Regulation of Floral Homeotic Genes

within a flower. Are these ABC genes only expressed in the floral whorls in which their functions are required? RNA in situ hybridization revealed that the mRNA expression domains of ABC genes largely coincided with the domains of their function predicted by the ABC model (Fig. 33.2E, 33.2F, and 33.2G) (Drews et al, 1991; Goto and Meyerowitz, 1994; Jack^^ a/., 1992; Mandel et al, 1992b). For example, the class A gene API is expressed in whorls 1-2 (Fig. 33.2E), the class B gene APS is expressed in whorls 2-3 (Fig. 33.2F), and the class C gene AG is expressed in whorls 3-4 (Fig. 33.2G). Furthermore, ^G mRNA is expanded to all four whorls in ap2 mutants (Drews et aL, 1991). Hence, the spatially restricted function of the ABC genes is regulated either at the transcription level or at the RNA stability level. AP2 is the only gene whose mRNA expression does not coincide with the domain of its fiinction. AP2 mRNA is expressed in all floral whorls although its function is limited to whorls 1-2 (Jofuku^^ a/., 1994). AP2 was later shown to be regulated at translational level mediated by a microRNA (Aukerman and Sakai, 2003; Chen, 2004) One way to distinguish if the regulation is at transcription level or post-transcriptional (such as RNA stability) level is to utilize reporter genes. GUS (^-glucuronidase) is a reporter gene commonly used in plant research (Jefferson et al, 1987). The GUS gene was fused to the promoter or intron sequences of the ABC genes. The reporter gene was then transformed into Arabidopsis to generate stable transgenic plants. The expression pattern of class B genes (such as APS) monitored by the reporter GUS was similar to mRNA expression pattern revealed by in situ hybridization (Jack et al, 1994; Krizek and Meyerowitz, 1996a). This indicates that the expression oiAPS is regulated at the transcriptional level rather than at post-transcriptional level. Interestingly, the cis-regulatory element of ^G resides in the second intron of ^G. The second intron of AG directed GUS expression in a pattern similar to the endogenous AG mRNA (Busch et al, 1999; Deyholos and Sieburth, 2000; Sieburth and Meyerowitz, 1997). This suggests that the inner whorl-specific activity of ^G is regulated at transcription level. If the ABC genes are regulated at the transcription level, one should be able to design and engineer the structure of flowers in a predictable manner simply by altering the mRNA expression domain of the ABC genes. Several studies demonstrated that, indeed, one could ectopically express B and C genes in different genetic backgrounds to generate flowers consisting of, for example, all stamens or all petals. The 35S promoter from the cauliflower mosaic virus {CaMV) is frequently

537

used to drive the constitutive and ectopic expression of plant genes. Ectopic expression of the class C gene^G under the 35S promoter caused homeotic conversion from sepals to carpels and petals to stamens (Mandel et al, 1992a; Mizukami and Ma, 1992). Thus,^G is both necessary and sufficient for the specification of stamen and carpel identity within aflower.Transgenic plants that constitutively and simultaneously express both class B genes AP3 and PI (i.e. 35S::AP3; 35S::PI) develop flowers that have petals in whorls 1-2 and stamens in whorls 3-4 (Fig.33.2H) (Krizek and Meyerowitz, 1996a). When the 35S::AP3 and 35S::PI transgenes were crossed into class A mutant ap2, these 35S::AP3, 35S::Pl ap2 plants develop flowers consisting of all stamens (Fig.33.2I) (Krizek and Meyerowitz, 1996a). These experiments not only validated the ABC model but also provided the first example of novel floral varieties through genetic engineering of ABC genes. The Discovery of E Class Genes Led to a Revised ABC Model One interesting observation from above ectopic studies is that leaves from the 35S::B or 35S::C transgenic plants remain, to a large extent, leaves (Krizek and Meyerowitz, 1996a). Thus, the B and C genes are necessary and sufficient for their function only within the context of a flower. Why can't the ectopic expression of B or C genes change a leaf into a floral organ? One possibility is that another floralspecific factor is required for the floral organ specification and this factor is not expressed in leaves. Alternatively, a floral organ can only be formed after a lateral organ is first turned into aflower.The discovery of class E genes, SEPALLATAl (SEPl), SEP2, and SEP3 supports the first possibility. The SEP genes were previously named AGAMOUSLIKE2 {AGL2\ AGL4 and AGL9 respectively (Krizek and Meyerowitz, 1996a; Ma et al., 1991; Mandel and Yanofsky, 1998), as they all encode highly similar MADS-box proteins. The role of the SEP genes in fioral organ identity specification was first revealed by reverse genetics (Pelaz et al, 2000). Targeted knockouts or screens for T-DNA insertion mutations in individual SEP genes revealed only subtle phenotypes in single sep mutants. However, sepl sep2 sep3 triple mutants displayed a striking phenotype: all floral organs in the first three whorls were sepals or sepal-like organs and the fourth whorl was converted into a new flower that repeats this same floral pattern (Fig. 33.2J) (Pelaz et al, 2000). The phenotype displayed by the sepl sep2 sep3 triple mutant is very similar to "be'' double mutants

538

Section V

(such as pi ag or ap3 ag) suggesting that SEPl, SEP2 and SEP3 are required for the B and C gene expression or for the B and C activity. A direct physical interaction between the SEP gene products and the B and C class gene products (Fan et al, 1997; Honma and Goto, 2001) supports the idea that the SEP proteins may be present in the same protein complex as the B or C proteins. Like API, the C-terminal domain of the SEP proteins exhibited transcription activation activity (Honma and Goto, 2001). The formation of higher order protein complexes involving SEP proteins may provide a transcription activation function to these protein complexes. The discovery of SEP genes led to a revised ABC model, which is now termed the ABCE model (Goto et al, 2001; Theissen, 2001; Theissen and Saedler, 2001). The ABCE model postulates that sepals are specified by A genes (perhaps with the help of an as yet unidentified factor), petals are specified by A, B, and E genes, stamens are determined by B, C, and E genes, and carpels are determined by C and E (Fig.33.1C). If SEP proteins are the missing components that are behind a lack of leaf-to-floral transformation in 35S::B and 35S::C transgenic plants, one can now directly test this hypothesis by ectopically expressing SEP genes together with the 35S::B or 35S::C. Indeed, when SEP3 was expressed ectopically together with 35S::B, both rosette and cauline leaves were converted to organs that resembled petals (Fig.33.2K) (Honma and Goto, 2001; Pelaz et al, 2001). Because both^P7 and SEP encode a C-terminal domain capable of transcription activation, over expression of SEP3 by 35S promoter appeared to bypass the requirement for API. In transgenic plants containing 35S::SEP, 35S::B, 35S::Q the cauline leaves were converted to organs that resembled stamens (Honma and Goto, 2001). These studies demonstrated that the E class genes together with the ABC genes are sufficient to specify floral organ identity in leaves and that floral organs can form independently of flower formation. The discovery of E class genes would not be possible in the absence of reverse genetics. Reverse genetics refers to a variety of techniques that can be used to generate mutations in a particular gene whose sequence is known. In the past several years, the Arabidopsis research community has benefited tremendously from significant advances in reverse genetic tools such as the T-DNA (Transfer-DNA) or transposon insertion lines, and the Targeted Induced Local Lesions In Genomes (TILLING) facility (Alonso et al, 2003; McCallum et a!., 2000; Sessions et al, 2002; Sundaresan et al, 1995; Young et al, 2001), making Arabidopsis one of the best systems for reverse

Special Topics

genetics. Reverse genetic approaches are now more frequently employed and, as demonstrated here, are crucial to illuminate gene function. Floral Meristem Identity Genes LFY and

API

Activate the Floral Program Now that the ABCE model provides a framework for floral organ formation, one might step back and ask the question how is the decision to flower first made? Insights into this most important developmental switch in higher plants will have profound impact on agriculture, because new strategies in manipulating and controlling plant reproduction are of significant agronomical importance. Regulation of flowering time is the subject of much research. Several regulatory pathways that convey environmental, physiological, and developmental signals control this crucial switch (Hayama and Coupland, 2003; Henderson and Dean, 2004; Jack, 2004; Nilsson and Weigel, 1997; Simpson and Dean, 2002). Two genes, LEAFY (LFY) and API, are the ultimate targets of various regulatory pathways controlling flowering time and are both necessary and sufficient for this vegetative to reproductive switch (Bowman et al., 1993; Irish and Sussex, 1990; Mandel and Yanofsky, 1995; Weigel et al, 1992; Weigel and Nilsson, 1995). This chapter will focus on how LFY and ylPi switch on the flower program and activate the ABCE genes for floral organ identity specification. Loss-of-fiinction mutations in these two genes cause the conversion (to varying degrees) from flowers to secondary shoots. Ify apl double mutants exhibit synergistic genetic interactions, where all flowers are replaced by shootike structures (Weigel et al, 1992). Conversely, constitutive expression of either LFY or API causes the conversion from shoots to flowers (Mandel and Yanofsky, 1995; Weigel and Nilsson, 1995). ThusZFF and API are referred to as "meristem identity genes" and they play partially redundant roles in floral meristem identity specification. LFY encodes a plant-specific protein that exhibits no strong sequence similarity to other known families of DNA-binding proteins (Weigel et aL, 1992). LFY can bind DNA in a sequence specific manner (Parcy et ai, 1998) and may directly or indirectly activate the expression of the ABCE genes. Consistent with its role as an activator of ABCE genes, LFY RNA and protein expression precedes the transcriptional activation of ABCE genes (Parcy et al. 1998). API, a MADS box protein described in the previous section as a class A gene, also possesses the function of a meristem identity gene. The dual roles of API as a meristem identity gene

Chapter 33

Transcriptional Regulation of Floral Homeotic Genes

and a class A organ identity gene correlate well with its two phases of expression. API is initially expressed in the entire floral meristem and later becomes restricted to the first two whorls (Fig. 33.2E) (Bowman et al, 1993; Gustafson-Brown^^a/., 1994; Mandel^^a/., 1992b). Although LFY and API are both meristem identity genes, API appears to function downstream of LFY. Specifically, the flower promoting effect of 35S::LFY was blocked in apl mutants, but the flower promoting effect of 35S::API was not blocked by Ify mutants (Mandel and Yanofsky, 1995; Weigel and Nilsson, 1995). To test if API is the direct transcriptional target of LFY, an inducible form of I F F was made (Wagner et al, 1999). This construct {35S::LFY-GR) uses the J55 promoter to express the LFY coding sequence that has been fused to a glucocorticoid receptor (GR) hormone binding domain. In the absence of the steroid hormone dexamethasone (DEX), the LFY-GR fusion protein is held in the cytoplasm and is non-functional. In the presence of DEX, the LFY-GR fusion protein moves to the nucleus and is able to perform its function as a transcriptional activator. As the translocation of the LFY-GR protein into the nucleus does not depend on protein synthesis, a direct effect of LFY on its target gene transcription can be evaluated in the presence of cyclohexamide (a protein synthesis inhibitor). The LFY-GR protein was able to rescue defects of API expression at early stages even in the presence of cyclohexamide, indicating that LFY directly activates API at early stages. However the ability of LFY-GR to rescue defects of API expression during later stages of floral development is dependent on protein synthesis, suggesting different regulatory mechanisms for the later phase of API activation. The Floral Program Terminates WUS Expression via AG Flowers are formed from lateral meristems which are produced by the shoot apical meristem (SAM). Floral meristem and SAM are homologous stem cell systems that are regulated by a similar set of genes (Sharma and Fletcher, 2002). In Arabidopsis floral meristem and SAM, stem cells are specified by signals from an underlying cell group, the organizing center that expresses the WUSCHEL (WUS) homeobox gene (Laux et ai, 1996; Mayer et al, 1998). Mutations in WUS result in premature termination of SAMs as well as floral meristems after forming a few organs. However, floral meristems and SAMs differ fundamentally in that the SAMs are indeterminate, they can produce lateral organs continuously. In contrast, floral meristems are

539'

determinate, their meristem activity is terminated after a fiill set of floral organs is initiated. The determinate nature of floral meristems must be somehow controlled hy LFY din& APL The flrst hint of how the floral meristems become determinate is the pattern of WUS expression. During flower development, WUS is expressed in the presumptive organizing center of floral meristems until the initiation of fourth whorl organs (Mayer et al, 1998), suggesting that a downregulation of WUS expression could terminate floral meristem proliferation. Second, the indeterminate floral phenotype in ag loss-of-function mutants indicates a possible role of ^ G in the negative regulation of WUS. Indeed, WUS expression remained in the center of ag mutant flowers (Lenhard et al, 2001; Lohmann et al., 2001). Additionally, wus loss of fimction mutations could suppress the indeterminate floral phenotype of ag. These results provided molecular insights into the fundamental difference between floral meristems and SAMs. In SAMs, a lack of LFY and API activity correlates with an absence of AG expression. As a result, WUS is continuously expressed in the organizing center of SAM and maintains stem cell population. In floral meristems, LFY and API activate AG expression, which subsequently leads to a downregulation of WUS and a determinate floral meristem. The mechanism of how ^ G negatively regulates WUS is still unknown. The repression of WUS hy AG was thought to be indirect (Lenhard et aL, 2001; Lohmann et al, 2001). Many of the most beautifiil flowers, including hybrid tea roses, double camellias, and carnations, have many extra whorls of petals. These so-called double flowers were selected from their plain relatives that have only a single whorl of petals. Theophrastus first described double roses more than 2000 years ago, and in the centuries that have followed, numerous descriptions of double flowers occur in the literature (Meyerowitz et al, 1989). By prolonging WUS expression or repressing AG activity, one may create new double flower varieties without having to depend on naturally occurring mutations. WUS is a Co-regulator of LFY for AG Expression If LFY and API are responsible for activating ABCE genes in floral meristems, what determines the activation of B and C class genes only in a subset of floral meristem cells? Clearly, other factors must act in concert with LFY and API to properly activate B and C class genes in spatially restricted patterns. WUS and UFO appear to encode such co-regulators of LFY and

540

Section V

they function to provide domain-specific co-activator activities. Several lines of evidence indicated a direct and positive regulatory role of LFY for AG. First, AG mRNA expression was delayed and reduced in strong Ify mutants (Weigel and Meyerowitz, 1993). Second, two LFY binding sites are present near the 3' end of the AG second intron. This intron contains cis-regulatory elements both necessary and sufficient for AG expression (Busch et al, 1999; Deyholos and Sieburth, 2000; Sieburth and Meyerowitz, 1997). Electrophoretic Mobility Shift Assay (EMSA) confirmed the binding of LFY to these two binding sites within the y AG enhancer (Busch et al, 1999). Mutations in the LFY binding sites that abolished in vitro binding of LFY largely eliminated the in vivo activity of the 3' ^ G enhancer. Finally, LFY-VP16, a hyperactive form of LFY, can induce ectopic AG expression. When LFY-VP16 was driven by the 35S promoter, AG was activated in seedlings even in the absence of flower formation (Parcy et al., 1998). However, wild type LFY could not activate AG ectopically indicating the need for additional co-activators. Adjacent to the two LF7binding sites in the 3' AG enhancer are two consensus binding sites for homeobox proteins. Since JVUS encodes a homeobox protein and WUS is only expressed in a few cells in the center of the floral meristem (beneath the whorls 3-4 precursor cells), WUS became an excellent candidate co-activator of LFY. To test this possibility, a trimer of a 91 bp fi-agment that includes the two LFY binding sites and two putative WUS binding sites was used to drive reporter LacZ expression in yeast. While the reporter lacZ could not be activated by LFY nor WUS alone, coexpression of LFY and WUS resulted in robust activation of reporter LacZ (Lohmann et ai, 2001). EMSA experiments further confirmed the binding of WUS protein to these two putative binding sites. LFY and WUS appeared to bind to the ^ G 3' enhancer independently and may each enhance AG transcription via independent contacts with transcriptional machineries (Lohmann et ai, 2001). The importance of WUS binding sites for 3' AG enhancer activity was subsequently verified in transgenic plants (Lohmann et al., 2001). Further, when WUS is ectopcally expressed under the control of LFY or AP3 promoters, ectopic AG expression as well as homeotic transformation of floral organs was observed (Lohmann, et a/., 2001). In flowers, WUS was apparently co-opted as a region-specific transcription activator. WUS, combined with LFY produces a flower- and region-specific pattern of ^ G expression.

Special Topics

UFO is a Co-regulator of LFY for APS Expression Evidence that LFY is important for the initial activation of AP3 comes fi*om the observation that both domain and the level of AP3 expression are reduced in / ^ mutants (Weigel and Meyerowitz, 1993). Positive regulation of AP3 by ZFFmay be direct, because LFY binds in vitro to a LFY binding site located in an AP3 promoter element that directs the establishment of AP3 expression during early floral stages (Hill et al, 1998). However, mutation of this LFY binding site does not disrupt LFY activation of AP3 (Lamb et al, 2002) suggesting other redundant LFY activation elements in the AP3 promoter. Activation of AP3 by LFY apparently relies on additional co-activators as 35S::LFYox 35S::LFY-VP16 failed to activate ^ P i ectopically (Parcy et al, 1998). A candidate co-activator of AP3 is UNUSUAL FLORAL ORGANS (UFO). Mutants of ufo exhibited a reduced petal and stamen numbers, which correlated with a reduction in the level of AP3 RNA during early floral stages (Levin and Meyerowitz, 1995; Wilkinson and Haughn, 1995). UFO is expressed in second and third whorl primordia during floral stages 3 and 4 (Ingram et al., 1995; Laufs et al, 2003). Ectopic expression of UFO (35S: UFO) results in the partial conversion of first whorl sepals to petals and fourth whorl carpels to stamens (Lee et al., 1997). Additionally, transgenic plants containing both 35S::UFO and 35S::LFY expressed AP3::GUS reporters in seedlings, demonstrating that L F 7 and UFO together are sufficient to activate AP3 (Parcy et al., 1998). UFO encodes an F-box protein (Ingram et al., 1995; Samach et al, 1999). F-box proteins have been shown to be components of a complex, named the SKPl-cullinF-box (SCF) complex that selects substrates for ubiquitin-mediated protein degradation. UFO functions as a component of a SCF complex (Ni et al, 2004; Wang et a/., 2003). However, the protein target (or targets) of S C F ^ ^ is unknown. The favored model is that UFOediated positive activation of AP3 occurs as a result of the SCF^^-mediated degradation of a repressor of AP3 expression. B, C, and E Genes Maintain Their Own Expression via Autoregulatory Loops Careful examination of in situ hybridization data indicated that AP3 and PI are not initially expressed in identical domains. AP3 mRNA is detected in whorls 2-3 plus in a small number of cells at the base of the first whorl (Tilly et al., 1998; Weigel and Meyerowitz, 1993)

Chapter 33

Transcriptional Regulation of Floral Homeotic Genes

while PI RNA is detected in whorls 2-4 (Goto and Meyerowitz, 1994). At later stages offlowerdevelopment, the expression of both genes is restricted to petals and stamens. Maintenance of this later expression in petals and stamens requires the activity of both ^P5 andP/. In ap3 and pi mutants, both AP3 and PI late phase expression is reduced while the early phase expression is unaffected (Goto and Meyerowitz, 1994; Jack et al, 1994). Therefore, at late stages of flower development, AP3 and PI positively regulate their own expression, leading to similar expression domains. Three CArG boxes were identified between -90 to -180 of the AP3 promoter (Hill et al, 1998; Tilly et al, 1998). AP3/PI heterodimers can bind to CArG box 1 and 3 in vitro in a sequence specific manner (Hill et ai, 1998; Tilly et al, 1998). In addition, AP3-GR can induce AP3 expression in the absence of de novo protein synthesis (Honma and Goto, 2000). Thus, direct interaction between AP3/PI and AP3 promoter maintains late phase AP3 transcription. Interestingly, the promoter or intron sequences of P / do not contain any CArG box. Using a similar AP3-GR system, the ability of AP3/PI heterodimer to activate PI transcription requires de novo protein synthesis (Honma and Goto, 2000), suggesting that autoregulation of P/transcription by AP3/PI is indirect. Recently, the autoregulatory mechanism is emerging as a general theme for B, C, and E gene expression. The Arabidopsis ATHl high-density oligonucleotide array (Affymetrix) in combination with the 35S::AG-GR was used to identify early targets of^G (Gomez-Mena et ai; 2005). AG-GR wdis introduced into the apl-l cal-1 double mutants, which accumulate indeterminate lateral meristems (Kempin et al, 1995). Upon DEX treatment, AG-GR, apl-1, cal-1 plants induced stamen and carpel formation in a synchronized fashion. Twelve genes were identified that were activated at multiple time points after a single DEX treatment. Surprisingly, among these twelve genes are AP3, AG, and SEP3. EMSA and chromatin immunoprecipitation (ChIP) confirmed a direct interaction between AG protein and cis-regulatory elements of AP3, AG and SEP3. This study revealed a requirement of AG in the autoregulation of its own expression as well as its role in the positive regulation of class B and E genes. This finding, however, is consistent with the ABCE model that^G is part of the AP3/PI complex involved in the positive autoregulatory loop. The emerging theme is that the expression of ABCE genes is initiated by one mechanism involving LFY and other domain-specific regulators such as WVS and UFO but their later expression is maintained by positive autoregulatory loops (Fig.33.4).

541

Stamen development Fig.33.4 Autoregulatory loops maintain B, C, and E gene expression. In stamen, AG, APS, PI and SEP3 are initially activated independently (grey arrows). LFY and WUS are responsible for the initial activation of AG, while LFY and UFO are responsible for the initial activation ofAP3 and PL The AG, APS, PI, and SEPS proteins (circles) function together in a complex to promote stamen development and to amplify and maintain their own expression. Solid black arrows indicate direct interactions supported by chromatin immunoprecipitation assays. Feedback activation of PI may be indirect and is indicated by a dashed arrow. This figure is based on Gomez-Mena et al (2005) and is reprinted with permission from the Company of Biologists Ltd.

AP2 is Regulated by a MicroRNA AP2 is unique in that it does not encode a MADS box protein but encodes a member of the AP2 domain containing transcription factor family (Joftiku et al, 1994). In addition, AP2 mRNA is expressed in all floral whorls although its ftmction is only present in whorls 1-2. Two recent reports demonstrated thai AP2 is under post-transcriptional regulation by microRNA (miRNA) (Aukerman and Sakai, 2003; Chen, 2004). miRNAs are -21-nucleotide noncoding RNAs that have been identified in both animals and plants (Carrington and Ambros, 2003). Complementary pairing of miRNA with their target mRNA either results in specific cleavage or translational inhibition of their target mRNAs (Carrington and Ambros, 2003; Llave et ai, 2002; Olsen and Ambros, 1999). Many miRNAs and their putative targets were identified in Arabidopsis (Park et aL, 2002; Reinhart et ai, 2002; Rhoades et al, 2002). One miRNA, miRl 72, was found to be complementary to a single sequence located near the 3' end of the AP2 open reading frame (Fig. 33.3B). To test if miRl 72 regulates AP2, miRl 72 was ectopically expressed from the 35S promoter. These 35S::miR172 flowers exhibited an ap2 phenotype (Fig.33.5B and 33.5C), suggesting that miR172 downregulates AP2 activity (Chen, 2004). Surprisingly, the

542 '

Section V

AP2 mRNA level was unaffected in the 35S:miR172 plants but the AP2 protein level was reduced, suggesting that miR172 inhibits AP2 function by preventing its translation. In situ hybridization revealed that miRl 72 is expressed at highest levels in whorls 3-4 of wild type flowers, supporting the idea that AP2 translation is specifically inhibited in whorls 3-4 (Aukerman and Sakai, 2003; Chen, 2004). To test if the putative miRl 72 binding site within AP2 mRNA subjects AP2 to miRl 72 regulation, mutations were introduced into the putative binding site of miRl 72 within AP2. These mutations do not alter the amino acid sequence of AP2 protein but render the mutant AP2 mRNA immune to miRl 72 regulation. When wild type AP2 and a mutant AP2 with six mismatches to miRl 72 (AP2ml) were fused to the 35S promoter and introduced into wild type Arabidopsis, these two types of transgenic plants gave very different phenotypes. While 35S::AP2 flowers exhibited a wild-type phenotype, 35S::AP2ml plants exhibited an ag-l\kQ phenotype including stamen-to-petal transformations and loss of floral determinacy (Fig. 33.5D). Although the AP2 mRNA levels were comparable between 35S::AP2 normal flower plants and 35S::AP2ml plants, the levels of AP2 proteins were elevated in 35S::AP2ml but not in 35S::AP2 (Chen, 2004). These experiments strongly support that AP2 translation is inhibited by miRl 72 present in whorls 3-4 (Chen, 2004). Transcription Co-repressors Participate in the Class A Antagonistic Function One important aspect of the ABCE model is that the class A and C genes not only specify sepal/petal or stamen/carpel identities, but also negatively regulate each other's activity (Bowman et al, 1991; Coen and Meyerowitz, 1991). What is the molecular mechanism

Special Topics

underlying this antagonistic interaction? Genetic screens for floral mutants that exhibit partial or complete homeotic transformation from sepal to carpel-like organs led to the identification of a large number of genes including AP2, LEUNIG (LUG), SEUSS (SEU), BELLRINGER (BLR), ANT, STERILE APETALA (SAP), and FILAMENTOUS FLOWER (FIL) (Bao et al, 2004; Byzova et al, 1999; Elliott et al, 1996; Franks et al, 2002; Jofiiku et a/., 1994; Klucher et al, 1996; Krizek et a/., 2000; Liu and Meyerowitz, 1995; Sawa et al., 1999). Their mutant phenotype and ectopic AG expression in outer floral whorls suggest that these genes all participate in the negative regulation of AG transcription. Among the genes mentioned about, LUG and SEU are the most extensively studied, lug and seu mutants both exhibit homeotic transformations similar to, but less severe than, ap2 mutants (Franks et al, 2002; Liu and Meyerowitz, 1995). in situ hybridization experiments revealed that both ectopic and precocious ^ G RNA was present in lug or seu single and double mutants. Removing AG in ag lug or ag seu double mutants restored sepal and petal identity suggesting that LUG and SEU are required for proper repression of AG but are not required for the specification of sepal or petal identity. Hence, LUG and SEU were considered "cadastral" genes analogous to the "gap" genes of Drosophila (Liu and Meyerowitz, 1995). In addition, lug and seu mutants exhibit pleiotropic phenotypes including defects associated with vegetative tissues, indicating that LUG and SEU mdcy have a more general role in plant development (Franks et al., 2002; Liu et al., 2000; Liu and Meyerowitz, 1995). LUG encodes a nuclear protein that has an overall domain structure similar to a class of functionally related transcriptional co-repressors including Tupl of yeast and Groucho (Gro) of Drosophila (Conner and

Fig.33.5 Regulation of AP2 by mlRl 72 during Arabidopsis flower development. (A) A wild-type flower. (B) An ap2-9 mutant flower with first-whorl organs transformed into carpels and a severe reduction of whorl 2 and whorl 3 stamens. (C) A 35S::miR172a-l flower that closely resembles the ap2-9 flower (D) A 35S::AP2ml flower with numerous petals and loss of floral determinacy, a phenotype resembling ag loss-of-function mutants (Chen, 2004). Reprinted with permission from Chen, 2004. Copy right (2004) AAAS.

Chapter 33

Transcriptional Regulation of Floral Homeotic Genes

Liu, 2000; Hartley et al, 1988; Williams and Trumbly, 1990). LUG possesses a conserved N-terminal 88 amino acid domain called the LUFS domain, which is both necessary and sufficient for the direct physical interaction with SEU (Sridhar et a/., 2004). SEU encodes a glutamine (Q)-rich protein with a conserved domain that is similar to the dimerization domain of LIM-Domaininding (Ldb) family of transcriptional co-regulators such as the Ldbl in mouse and Chip in Drosophila (Franks et al, 2002). The direct LL^G-^S^'17 interaction is supported by a parallel study in Drosophila and mouse, where the LUFS domain of Single Strand DNA-binding Protein (SSDP) was shown to directly associate with the mouse Ldbl or Drosophila Chip (Chen et ai, 2002; van Meyel et al, 2003). LUG-GAL4BD or SEU-GAL4BD chimeric genes were tethered to the promoters that directed GUS or luciferase reporter gene expression in transient expression assays with Arabidopsis protoplasts. While SEUGAL4BD did not exhibit any repressor activity in the absence of LUG, LUG-GAL4BD exhibited strong repressor activity (Sridhar et al., 2004). However the repressor activity of LUG was eliminated when trichostatin A, a Histone Deacetylase (HDAC) inhibitor, was added to the transient expression assay suggesting that LUG represses transcription possibly by recruiting HDACs (Sridhar et al, 2004). The Tupl or Gro co-repressors are global transcriptional repressors that are recruited by different DNA-binding transcription factors to repress different target genes (Chen and Courey, 2002). Since neither LUG nor SEU encodes a DNA-binding motif, the LUG/SEU co-repressors must depend on other DNAbinding transcription factors that bind to the AG cis-elements. Since both LUG and SEU mRNAs are detected everywhere in a plant (Conner and Liu, 2000; Franks et ai, 2002), their outer whorl-specific repressor activities may depend on their interaction with other outer whorl-specific factors. The class A genes API and AP2 are excellent candidate partners for the LUG/SEU co-repressors. First, API mRNA and possibly AP2 proteins are expressed in whorls 1-2, at stages when the floral organ identities are being specified. Second, although the ability of API or AP2 to hind AG intronic sequences has not been demonstrated, several CArG boxes and a putative AP2 domain binding site are present in the AG second intron and can serve as the binding sites for API and AP2 (Deyholos and Sieburth, 2000; Nole-Wilson and Krizek, 2000; Hong et ai, 2003). Finally, while apl single mutants did not exhibit ectopic AG expression in flowers, apl lug and apl sen double mutants showed much enhanced homeotic

543

transformation of floral organs, indicating enhanced ^ G mis-expression (Liu and Meyerowitz, 1995; V.V. Sridhar and Z. Liu, unpublished data). In addition, apl exhibited dominant genetic interactions with lug and sen (Liu and Meyerowitz, 1995; Franks et al, 2002). Yeast two hybrid assays suggested a direct interaction between SEU and API (V. V. Sridhar and Z. Liu, unpublished). Therefore, SEU appears to bridge the interaction between the LUG co-repressor and the domain-specific DNA-binding factors encoded by the class A genes (Fig. 33.6). Together, they repress ^ G in the outer two whorls of a flower.

Fig.33.6 A model for the repression of ^G by transcription co-repressors and class A genes. The LUG co-repressor represses AG hy recruiting Histone Deacetylases (HDACs). SEU, an adaptor protein, bridges the interaction between LUG and the DNA-binding transcription factors encoded by the class A genes API and AP2. Y represents unidentified component(s) of the co-repressor complex. The question mark indicates a putative roleofAP2.

Concluding Remarks Molecular genetic analyses of homeotic mutations in Drosophila melanogaster indicated that the homeotic genes encode master regulatory proteins that switch on or off specific developmental programs in specific segments of the fruit fly (Gehring and Hiromi, 1986). The characterization of floral homeotic mutants and the identification of corresponding genes indicated that the floral homeotic genes also encode master regulatory proteins that act to switch on organ-specific developmental programs. While the Drosophila homeotic genes encode the homeobox proteins, plant homeotic genes (the ABCE genes) encode a different type of transcription factor, the MADS box proteins. Flower is an evolutionary novelty that characterizes the most successful group of vascular plants, the angiosperms that first appeared merely 130 million years ago (Crane, 1993). The origin of floral organs was proposed more than 200 years ago by Johann Wolfgang von Goethe to arise from "metamorphosis" of leaves. The radiation and diversification of plant MADS box genes may underlie this floral evolution. The leaf-like floral organs in aba

544

Section V

triple loss-of-fiinction mutants and the petaloid and staminoid leaves in transgenic plants over-expressing ABCE genes provided answers in molecular terms to the metamorphosis of floral organs. Acknowledgement I would like to thank Beth Krizek for Fig 33.2H and 33.21. Alan Kirschner for proofreading the manuscript. Z.L. is supported by a NSF grant IBN 0212847.

References Alonso, J. M., Stepanova, A. N., Leisse, T. J., Kim, C. J., Chen, H., Shinn, P., Stevenson, D. K., Zimmerman, J., Barajas, P., Cheuk, R., et al. (2003). Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301, 653-657. Aukerman, M. J., and Sakai, H. (2003). Regulation of flowering time and floral organ identity by a MicroRNA and its APETALA2-like target genes. Plant Cell 75, 2730-2741. Bao, X., Franks, R. G., Levin, J. Z., and Liu, Z. (2004). Repression of AGAMOUS by BELLRINGER in floral and inflorescence meristems. Plant Cell 16, 1478-1489. Bowman, J. L., Alvarez, J., Weigel, D., Meyerowitz, E. M., and Smyth, D. R. (1993). Control of flower development in Arabidopsis thaliana by APETALAl and interacting genes. Development 119, 721-743. Bowman, J. L., Smyth, D. R., and Meyerowitz, E. M. (1989). Genes directing flower development in Arabidopsis. Plant Cell 7, 37-52. Bowman, J. L., Smyth, D. R., and Meyerowitz, E. M. (1991). Genetic interactions among floral homeotic genes of Arabidopsis. Development 112, 1-20. Busch, M. A., Bomblies, K., and Weigel, D. (1999). Activation of a floral homeotic gene m Arabidopsis. Science 285, 585-587. Byzova, M. V., Franken, J., Aarts, M. G., de Almeida-Engler, J., Engler, G., Mariani, C , Van Lookeren Campagne, M. M., and Angenent, G. C. (1999). Arabidopsis STERILE APETALA, a multifunctional gene regulating inflorescence, flower, and ovule development. Genes Dev 13, 1002-1014. Carrington, J. C , and Ambros, V. (2003). Role of microRNAs in plant and animal development. Science 301, 336-338. Chen, G., and Courey, A. J. (2000). Groucho/TLE family proteins and transcriptional repression. Gene 249, 1-16. Chen, L., Segal, D., Hukriede, N. A., Podtelejnikov, A. V., Bayarsaihan, D., Kennison, J. A., Ogryzko, V. V., Dawid, L B., and Westphal, H. (2002). Ssdp proteins interact with the LIM-domain-binding protein Ldbl to regulate development. Proc Nafl Acad Sci USA 99, 14320-14325. Chen, X. (2004). A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science 303,

Special Topics 2022-2025. Coen, E. S., and Meyerowitz, E. M. (1991). The war of the whorls: genetic interactions controlling flower development. Nature 355, 31-37. Conner, J., and Liu, Z. (2000). LEUNIG, a putative transcriptional corepressor that regulates AGAMOUS expression during flower development. Proc Nafl Acad Sci USA 97, 12902-12907. Crane, PR. (1993). Time for the angiosperms. Nature 336, 631-632 Deyholos, M. K., and Sieburth, L. E. (2000). Separable whorl-specific expression and negative regulation by enhancer elements within the AGAMOUS second intron. Plant Cell 12, 1799-1810. Drews, G. N., Bowman, J. L., and Meyerowitz, E. M. (1991). Negative regulation of the Arabidopsis homeotic gene AGAMOUS by the APETALA2 product. Cell 65, 991-1002. Elliott, R. C , Betzner, A. S., Huttner, E., Oakes, M. R, Tucker, W. Q., Gerentes, D., Perez, P., and Smyth, D. R. (1996). AINTEGUMENTA, an APETALA2-like gene of Arabidopsis with pleiotropic roles in ovule development and floral organ growth. Plant Cell 8, 155-168. Fan, H. Y., Hu, Y., Tudor, M., and Ma, H. (1997). Specific interactions between the K domains of AG and AGLs, members of the MADS domain family of DNA binding proteins. Plant J 72, 999-1010. Franks, R. G., and Liu, Z. (2001). Floral homeotic gene regulation. Horticultural Reviews 27, 41-77. Franks, R. G., Wang, C , Levin, J. Z., and Liu, Z. (2002). SEUSS, a member of a novel family of plant regulatory proteins, represses floral homeotic gene expression with LEUNIG. Development 129, 253-263. Gehring, W. J., and Hiromi, Y. (1986). Homeotic genes and the homeobox. Annu Rev Genet 20, 147-173. Gomez-Mena, C , de Folter, S., Costa, M. M., Angenent, G. C , and Sablowski, R. (2005). Transcriptional program controlled by the floral homeotic gene AGAMOUS during early organogenesis. Development 132, 429-438. Goto, K., Kyozuka, J., and Bowman, J. L. (2001). Turning floral organs into leaves, leaves into floral organs. Curr Opin Genet Dev 77, 449-456. Goto, K., and Meyerowitz, E. M. (1994). Function and regulation of the Arabidopsis floral homeotic gene PISTILLATA. Genes Dev 5, 1548-1560. Gustafson-Brown, C , Savidge, B., and Yanofsky M. F. (1994). Regulation of the arabidopsis floral homeotic gene APETALAl. Cell 76,131-143. Hartley, D. A., Preiss, A., and Artavanis-Tsakonas, S. (1988). A deduced gene product from the Drosophila neurogenic locus, enhancer of split, shows homology to mammalian G-protein beta subunit. Cell 55, 785-795. Hayama, R., and Coupland, G. (2003). Shedding light on the circadian clock and the photoperiodic control of flowering. Curr

Chapter 33

Transcriptional Regulation of Floral Homeotic Genes

Opin Plant Biol 5, 13-19. Henderson, I. R., and Dean, C. (2004). Control of Arabidopsis flowering: the chill before the bloom. Development 131, 3829-3838. Hill, T. A., Day, C. D., Zondlo, S. C , Thackeray, A. G., and Irish, V. F. (1998). Discrete spatial and temporal cis-acting elements regulate transcription of the Arabidopsis floral homeotic gene APETALA3. Development 725, 1711-1721. Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D. (2003). Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing. Plant Cell 75, 1296-1309. Honma, T., and Goto, K. (2000). The Arabidopsis floral homeotic gene PISTILLATA is regulated by discrete cis-elements responsive to induction and maintenance signals. Development 727,2021-2030. Honma, T., and Goto, K. (2001). Complexes of MADS-box proteins are sufficient to convert leaves into floral organs. Nature 409, 525-529. Huang, H., Tudor, M., Su, T., Zhang, Y., Hu, Y., and Ma, H. (1996). DNA binding properties of two Arabidopsis MADS domain proteins: binding consensus and dimer formation. Plant Cell 5, 81-94. Ingram, G. C, Goodrich, J., Wilkinson, M. D., Simon, R., Haughn, G. W., and Coen, E. S. (1995). Parallels between UNUSUAL FLORAL ORGANS and FIMBRIATA, genes controlling flower development in Arabidopsis and Antirrhinum. Plant Cell 7, 1501-1510. Irish, V. F., and Sussex, I. M. (1990). Function of the apetala-1 gene during Arabidopsis floral development. Plant Cell 2, 741-753. Jack, T. (2004). Molecular and genetic mechanisms of floral control. Plant Cell 16 Suppl, Sl-17. Jack, T., Brockman, L. L., and Meyerowitz, E. M. (1992). The homeotic gene APETALA3 of Arabidopsis thaliana encodes a MADS box and is expressed in petals and stamens. Cell 68, 683-697. Jack, T., Fox, G. L., and Meyerowitz, E. M. (1994). Arabidopsis homeotic gene APETALA3 ectopic expression: transcriptional and posttranscriptional regulation determine floral organ identity. Cell 76, 703-716. Jefferson, R. A., Kavanagh, T. A., and Bevan, M. W. (1987). GUS fusions: beta-glucuronidase as a sensitive and versatile gene ftision marker in higher plants. Embo J 6, 3901-3907. Jofuku, K. D., den Boer, B. G., Van Montagu, M., and Okamuro, J. K. (1994). Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant Cell 6, 1211-1225. Kempin, S. A., Savidge, B., and Yanofsky, M. F. (1995). Molecular basis of the cauliflower phenotype in Arabidopsis. Science 267, 522-525. Klucher, K. M., Chow, H., Reiser, L., and Fischer, R. L. (1996).

545

The AINTEGUMENTA gene of Arabidopsis required for ovule and female gametophyte development is related to the floral homeotic gene APETALA2. Plant Cell 8, 137-153. Krizek, B. A., and Meyerowitz, E. M. (1996a). The Arabidopsis homeotic genes APETALA3 and PISTILLATA are sufficient to provide the B class organ identity function. Development 722, 11-22. Krizek, B. A., and Meyerowitz, E. M. (1996b). Mapping the protein regions responsible for the functional specificities of the Arabidopsis MADS domain organ-identity proteins. Proc Natl Acad Sci USA 93, 4063-4070. Krizek, B. A., Prost, V., and Macias, A. (2000). AINTEGUMENTA promotes petal identity and acts as a negative regulator of AGAMOUS. Plant Cell 72, 1357-1366. Lamb, R. S., Hill, T. A., Tan, Q. K., and Irish, V. F. (2002). Regulation of APETALA3 floral homeotic gene expression by meristem identity genes. Development 129, 2079-1086. Laufs, P., Coen, E., Kronenberger, J., Traas, J., and Doonan, J. (2003). Separable roles of UFO during floral development revealed by conditional restoration of gene function. Development 130, 785-796. Laux, T., Mayer, K. F., Berger, J., and Jurgens, G. (1996). The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development 722, 87-96. Lee, I., Wolfe, D. S., Nilsson, O., and Weigel, D. (1997). A LEAFY co-regulator encoded by UNUSUAL FLORAL ORGANS. Curr Biol 7, 95-104. Lenhard, M., Bohnert, A., Jurgens, G., and Laux, T. (2001). Termination of stem cell maintenance in Arabidopsis floral meristems by interactions between WUSCHEL and AGAMOUS. Cell 7^5, 805-814. Levin, J. Z., and Meyerowitz, E. M. (1995). UFO: din Arabidopsis gene involved in both floral meristem and floral organ development. Plant Cell 7, 529-548. Liu, Z., Franks, R. G., and Klink, V. P (2000). Regulation of gynoecium marginal tissue formation by LEUNIG and AINTEGUMENTA. Plant Cell 72, 1879-1892. Liu, Z., and Meyerowitz, E. M. (1995). LEUNIG regulates AGAMOUS expression in Arabidopsis flowers. Development 727,975-991. Llave, C , Xie, Z., Kasschau, K. D., and Carrington, J. C. (2002). Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science 297, 2053-2056. Lohmann, J. U., Hong, R. L., Hobe, M., Busch, M. A., Parcy, F., Simon, R., and Weigel, D. (2001). A molecular link between stem cell regulation and floral patterning in Arabidopsis. Cell 105, 793-803. Ma, H., Yanofsky, M. F., and Meyerowitz, E. M. (1991). AGL1-AGL6, an Arabidopsis gene family with similarity to floral homeotic and transcription factor genes. Genes Dev 5, 484-495. Mandel, M. A., Bowman, J. L., Kempin, S. A., Ma, H., Meyerowitz,

546 '

Section V

E. M., and Yanofsky, M. F. (1992a). Manipulation of flower structure in transgenic tobacco. Cell 7/, 133-143. Mandel, M. A., Gustafson-Brown, C , Savidge, B., and Yanofsky, M. F. (1992b). Molecular characterization of the Arabidopsis floral homeotic gene APETALAl. Nature 360, 273-277. Mandel, M. A., and Yanofsky, M. F. (1995). A gene triggering flower formation in Arabidopsis. Nature 377, 522-524. Mandel, M. A., and Yanofsky, M. F. (1998). IhbQ Arabidopsis AGL9 MADS box gene is expressed in young flower primordia. Sexual Plant Reproduction 77, 22-28. Mayer, K. F., Schoof, H., Haecker, A., Lenhard, M., Jurgens, G., and Laux, T. (1998). Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell 95, 805-815. McCallum, C. M., Comai, L., Greene, E. A., and Henikoff, S. (2000). Targeting induced local lesions IN genomes (TILLING) for plant functional genomics. Plant Physiol 123, 439-442. Meyerowitz, E. M., Smyth, D. R., and Bowman, J. L. (1989). Abnormal flowers and pattern formation in floral. Development 70(5,209-217. Mizukami, Y, and Ma, H. (1992). Ectopic expression of the floral homeotic gene AGAMOUS in transgenic Arabidopsis plants alters floral organ identity. Cell 77, 119-131. Ni, W., Xie, D., Hobbie, L., Feng, B., Zhao, D., Akkara, J., and Ma, H. (2004). Regulation of flower development in Arabidopsis by SCF complexes. Plant Physiol 134, 1574-1585. Nilsson, O., and Weigel, D. (1997). Modulating the timing of flowering. Curr Opin Biotechnol 8, 195-199. Nole-Wilson, S., and Krizek, B. A. (2000). DNA binding properties of the Arabidopsis floral development protein AINTEGUMENTA. Nucleic Acids Res 28, 4076-4082. Ohme-Takagi, M., and Shinshi, H. (1995). Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element. Plant Cell 7, 173-182. Olsen, R H., and Ambros, V. (1999). The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation. Dev Biol 216, 671-680. Parcy, F., Nilsson, O., Busch, M. A., Lee, I., and Weigel, D. (1998). A genetic framework for floral patterning. Nature 395, 561-566. Park, W., Li, J., Song, R., Messing, J., and Chen, X. (2002). CARPEL FACTORY, a Dicer homolog, and HENl, a novel protein, act in microRNA metabolism in Arabidopsis thaliana. Curr Biol 72, 1484-1495. Pelaz, S., Ditta, G. S., Baumann, E., Wisman, E., and Yanofsky, M. F. (2000). B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature 405, 200-203. Pelaz, S., Tapia-Lopez, R., Alvarez-Buy 11a, E. R., and Yanofsky, M. F. (2001). Conversion of leaves into petals in Arabidopsis. Curr Biol 77, 182-184. Pnueli, L., Abu-Abeid, M., Zamir, D., Nacken, W., SchwarzSommer, Z., and Lifschitz, E. (1991). The MADS box gene

Special Topics family in tomato: temporal expression during floral development, conserved secondary structures and homology with homeotic genes from Antirrhinum din& Arabidopsis. Plant J 7, 255-266. Reinhart, B. J., Weinstein, E. G., Rhoades, M. W., Bartel, B., and Bartel, D. R (2002). MicroRNAs in plants. Genes Dev 16, 1616-1626. Rhoades, M. W., Reinhart, B. J., Lim, L. R, Burge, C. B., Bartel, B., and Bartel, D. R (2002). Prediction of plant microRNA targets. Cell 770, 513-520. Riechmann, J. L., Krizek, B. A., and Meyerowitz, E. M. (1996a). Dimerization specificity oi Arabidopsis MADS domain homeotic proteins APETALAl, APETALA3, PISTILLATA, and AGAMOUS. Proc Natl Acad Sci USA 93,4793-4798. Riechmann, J. L., and Meyerowitz, E. M. (1997a). Determination of floral organ identity by Arabidopsis MADS domain homeotic proteins API, AP3, PI, and AG is independent of their DNA-binding specificity. Mol Biol Cell 8, 1243-1259. Riechmann, J. L., and Meyerowitz, E. M. (1997b). MADS domain proteins in plant development. Biol Chem 378, 1079-1101. Riechmann, J. L., and Meyerowitz, E. M. (1998). The AP2/EREBP family of plant transcription factors. Biol Chem 379, 633-646. Riechmann, J. L., Wang, M., and Meyerowitz, E. M. (1996b). DNA-binding properties of Arabidopsis MADS domain homeotic proteins APETALAl, APETALA3, PISTILLATA and AGAMOUS. Nucleic Acids Res 24, 3134-3141. Samach, A., Klenz, J. E., Kohalmi, S. E., Risseeuw, E., Haughn, G. W., and Crosby, W. L. (1999). The UNUSUAL FLORAL ORGANS gene of Arabidopsis thaliana is an F-box protein required for normal patterning and growth in the floral meristem. Plant J 20, 433-445. Sawa, S., Watanabe, K., Goto, K., Liu, Y G., Shibata, D., Kanaya, E., Morita, E. H., and Okada, K. (1999). FILAMENTOUS FLOWER, a meristem and organ identity gene of Arabidopsis, encodes a protein with a zinc finger and HMG-related domains. Genes Dev 73, 1079-1088. Schwarz-Sommer, Z., Hue, I., Huijser, P., Flor, P. J., Hansen, R., Tetens, R, Lonnig, W. E., Saedler, H., and Sommer, H. (1992). Characterization of the Antirrhinum floral homeotic MADS -box gene deficiens: evidence for DNA binding and autoregulation of its persistent expression throughout flower development. Embo J 77,251-263. Sessions, A., Burke, E., Presting, G., Aux, G., McElver, J., Patton, D., Dietrich, B., Ho, R, Bacwaden, J., Ko, C, et al. (2002). A high-throughput Arabidopsis reverse genetics system. Plant Cell 14, 2985-2994. Sharma, V. *:., and Fletcher, J. C. (2002). Maintenance of shoot and floral meristem cell proliferation and fate. Plant Physiol 72P, 31-39. Shiraishi, H., Okada, K., and Shimura, Y. (1993). Nucleotide sequences recognized by the AGAMOUS MADS domain of Arabidopsis thaliana in vitro. Plant J ^, 385-398. Sieburth, L. E., and Meyerowitz, E. M. (1997). Molecular

Chapter 33

Transcriptional Regulation of Floral Homeotic Genes

dissection of the AGAMOUS control region shows that cis elements for spatial regulation are located intragenically. Plant Cell P, 355-365. Simpson, G. G., and Dean, C. (2002). Arabidopsis, the Rosetta stone of flowering time? Science 296, 285-289. Smyth, D. R., Bowman, J. L., and Meyerowitz, E. M. (1990). Early flower development in Arabidopsis. Plant Cell 2, 755-767. Sridhar, V. V., Surendrarao, A., Gonzalez, D., Conlan, R. S., and Liu, Z. (2004). Transcriptional repression of target genes by LEUNIG and SEUSS, two interacting regulatory proteins for Arabidopsis flower development. Proc Natl Acad Sci USA 101, 11494-11499. Sundaresan, V., Springer, P., Volpe, T., Haward, S., Jones, J. D., Dean, C , Ma, H., and Martienssen, R. (1995). Patterns of gene action in plant development revealed by enhancer trap and gene trap transposable elements. Genes Dev 9, 1797-1810. Theissen, G. (2001). Development of floral organ identity: stories from the MADS house. Curr Opin Plant Biol 4, 75-85. Theissen, G., and Saedler, H. (2001). Plant biology. Floral quartets. Nature 409, 469-471. Tilly, J. J., Allen, D. W., and Jack, T. (1998). The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects. Development 125, 1647-1657. van Meyel, D. J., Thomas, J. B., and Agulnick, A. D. (2003). Ssdp proteins bind to LIM-interacting co-factors and regulate the activity of LIM-homeodomain protein complexes in vivo. Development 130, 1915-1925. Wagner, D., Sablowski, R. W., and Meyerowitz, E. M. (1999). Transcriptional activation of APETALAl by LEAFY. Science 285, 582-584.

547'

Wang, X., Feng, S., Nakayama, N., Crosby, W L., Irish, V., Deng, X. W., and Wei, N. (2003). The C0P9 signalosome interacts with SCF UFO and participates in Arabidopsis flower development. Plant Cell 75, 1071-1082. Weigel, D., Alvarez, J., Smyth, D. R., Yanofsky, M. F., and Meyerowitz, E. M. (1992). LEAFY controls floral meristem identity in Arabidopsis. Cell 69, 843-859. Weigel, D., and Meyerowitz, E. M. (1993). Activation of floral homeotic genes in Arabidopsis. Science (Washington D C) 261, 1723-1726. Weigel, D., and Meyerowitz, E. M. (1994). The ABCs of floral homeotic genes. Cell 78, 203-209. Weigel, D., and Nilsson, O. (1995). A developmental switch sufficient for flower initiation in diverse plants. Nature 377, 495-500. Wilkinson, M. D., and Haughn, G. W. (1995). UNUSUAL FLORAL ORGANS Controls Meristem Identity and Organ Primordia Fate in Arabidopsis. Plant Cell 7, 1485-1499. Wilhams, F. E., and Trumbly, R. J. (1990). Characterization of TUPl, a mediator of glucose repression in Saccharomyces cerevisiae. Mol Cell Biol 10, 6500-6511. Wynne, J., and Treisman, R. (1992). SRF and MCMl have related but distinct DNA binding specificities. Nucleic Acids Res 20, 3297-3303. Yanofsky, M. F., Ma, H., Bowman, J. L., Drews, G. N., Feldmann, K. A., and Meyerowitz, E. M. (1990). The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors. Nature 346, 35-39. Young, J. C , Krysan, R J., and Sussman, M. R. (2001). Efficient screening of Arabidopsis T-DNA insertion lines using degenerate primers. Plant Physiol 125, 513-518.

Chapter 34 Transcription Control in Bacteria Ding Jun Jin^ and Yan Ning Zhou^ Transcription Control Section, Gene Regulation and Chromosome Biology Laboratory, National Cancer Institute-Frederick, National Institutes ofHealth, Frederick, MD 21702, USA ^Laboratory of Molecular Biology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA

Key Words: transcription, RNA polymerase, transcription factories, global gene regulation, nucleoid, nutrient starvation response, prokaryotes, bacteria, E. coli

Summary Regulation of transcription is a key step in controlling gene expression in all cells. Many diseases and cancers result from alterations of gene expression caused by defects in transcription machinery. The basic structure and function of RNA polymerase (RNAP) and RNAPassociated proteins are conserved throughout evolution. Sophisticated genetics and advanced biochemistry make single-cell organisms, such as E. coli, an ideal model system to study the role of RNAP and transcription factors in gene expression and regulation. Studies of the simple model system have contributed greatly to our knowledge of transcription in principle, which underpin our understanding of gene regulation in much more complex eukaryotic organisms. In addition, studies ofE. coli and other microorganisms have laid the foundation for the biotechnology industry. This chapter describes transcription machinery including RNAP and RNAPassociated proteins and regulation of transcription cycle in E, coli, with a focus on the unique feature of global regulation by RNAP (re)distribution in response to environment cues. Transcription Machinery A: RNAP Escherichia coli RNA polymerase (RNAP) is a

multisubunit enzyme (Table 34.1). Unlike in eukaryotes, in which three different RNAPs (Pol I, II, and III) synthesize three different RNA species (rRNA, mRNA, and tRNA/5S rRNA respectively), a single RNAP synthesizes all RNA species in E. coli (Burgess et al, 1987). In E. coli, RNAP exists in two forms, core RNAP (E) and holoenzyme (EG), as shown in Fig. 34.1. The core RNAP consists of two a subunits, and one subunit each of p, p' and co; and upon binding to a a factor, it converts to a holoenzyme. The core RNAP is capable of transcription elongation and termination at intrinsic transcription terminators. However, only the holoenzyme can recognize a promoter and engage in transcription initiation (Burgess et ah, 1969). Recently, the high-resolution structures of bacterial RNAP have been determined (Murakami et al, 2002; Vassylyev et a/., 2002; Zhang et al, 1999). Strikingly, the basic architectures of bacterial RNAP and yeast Pol II are conserved (Ebright, 2000; Fu et al, 1999), which is consistent with the notion that bacterial RNAP shares considerable sequence homology with its eukaryotic counterpart (AlHson et al., 1985; Sweetser et ah, 1987). These structural studies not only have validated many mutational analyses of RNAP (Jin and Zhou, 1996), but also provided structural basis for the function of RNAP (Borukhov and Nudler, 2003) and the actions of various antibiotics. As an essential enzyme in the cell, bacterial RNAP has been a target for multiple antibiotics, including rifampicin, streptolydigin, sorangicin A, and Microcin J25 (Adelman et al, 2004; Heisler et al, 1993; Severinov et al, 1995; Yang and Price, 1995). Among

Corresponding Author: Ding Jun Jin, Tel: (301) 846-7684, Fax: (301) 846-1456, E-mail: [email protected]

Section V

•550Table 34.1

Special Topics

RNAP Subunits and Associated Proteins.

A. J ^ A P Core Subunits Gene Name

Subunit

M.W. (kDal)

Map Position

Function

rpoA rpoB

a

37

74 min.

assembly, contact with DNA and transcriptional activators

P P' a

151

90 min.

active site, rifampicin binding

155

90 min.

active site, DNA binding

10

82 min.

unknown

rpoC rpoZ

B. RNA? Sigma Factors Gene Name

Subunit

M.W. (kPal)

Map Position

Function

rpoD

70

69 min.

housekeeping genes

rpoE

22

58 min.

genes for periplasmic and envelope proteins

rpoF

28

43 min.

genes for flagella and chemotaxis

rpoH

32

78 min.

heat shock stress response genes

rpoN

54

72 min.

nitrogen limitation genes

38

62 min.

stationary phase genes

19

97 min.

ferric citrate transport genes

rpoS feci

a _FecI

C. RNAP Associated Proteins Gene Name

M.W. (kPal)

Map Position

Function

dksA

18

3 min.

regulation of rRNA promoters during the stringent response

greA

18

72 min.

cleaves RNA in arrested elongation complexes

greB

19

76 min.

cleaves RNA in arrested elongation complexes

nusA

55

71 min.

termination/antitermination

nusE

12

74 min.

termination/antitermination

nusG

20

90 min.

termination/antitermination

rapA

101

1 min.

RNAP recycling

sspA

24

73 min.

transcription activator; acid tolerance in stationary phase

topA

97

29 min.

introduces (+) supercoils

a2pP'a) + a core (E)

:i=

=^

a2pp'a)a Holoenzyme (Ea)

Fig.34.1 The E, coli RNAP is a multisubunit enzyme. The association of o with the core in the holoenzyme differentiates between the two different forms ofE. coli RNAP.

them, rifampicin and its derivatives have been the most important in clinical use for the treatments of tuberculosis, meningitis and staphylococcal infections (Fisher, 1971; Kapusnik et al, 1984; Leung et al, 1998; Lounis and Roscigno, 2004). Mutations in E. coli RNAP conferring rifampicin-resistance (Rif) were reported shortly after the antibiotic was discovered (Ezekiel and Hutchins, 1968; Rabussay and Zillig, 1969). Rif mutations have been located exclusively on the second largest subunit of RNAP, the p subunit encoded by the rpoB gene. Most of the Rif mutations are clustered in the middle of the gene defined as the rif region (Jin and Gross, 1988;

Severinov et ai, 1993). The rif region is well conserved in different bacteria including many pathogens (AubryDamon et al., 1998; Ramaswamy and Musser, 1998). Rifampicin inhibits RNAP's function by blocking the transition fi-om transcription initiation to transcription elongation (McClure and Cech, 1978). Cross-linking experiments have indicated that the rifampicin blocks a channel leading a nascent RNA out of the catalytic center of RNAP (Mustaev et al, 1994). The crystal structure of the T. aquaticus core RNAP complexed with rifampicin indicates several conserved amino acid residues in the rif region that interact with the antibiotic (Campbell et al, 2001), which adequately account for all known Rif mutants. Rifampicin binds to the rif region of the P subunit, which lies deep within the DNA/RNA channel. Clearly, the critical location of the rif region in RNAP is responsible for the multiple effects of Rif mutations on different aspects of transcription (Jin et ai, 1988; Jin and Gross, 1989;

Chapter 34 Transcription Control in Bacteria

Zhou and Jin, 1998). Interestingly, the antibiotic sorangicin A, which has a different structure than rifampicin, also binds RNAP in the same P subunit pocket, as seen from the structure of the T. aquaticus RNAP- sorangicin A complex (Campbell et al, 2005). This overlap in binding sites for different antibiotics in RNAP not only explains the reason why Rif mutants are cross-resistance to multiple drugs (Xu et al, 2005), but also poses a challenge for the development of new generation and antibiotics. Because Rif mutations are highly conserved in eubacteria, the well studied set ofE. coli Rif mutant RNAPs could be used to screen for new antibiotics that will inhibit the growth of Rif pathogenic bacteria which have emerged as an important clinical issue worldwide. The size of an E. coli cell is about 2-4 |im long and less than 1 jim in width. The E. coli genome is close to five million base pairs encoding over 4,000 genes (Blattner et al, 1997) and forms loose structures called nucleoids (Drlica, 1987; Hobot et al, 1985; Pettijohn, 1996; Robinow and Kellenberger, 1994) without the presence of a membrane separating the genome from the cytoplasm. It is estimated that there are about 2,000 core RNAP molecules in the cell (Ishihama, 2000; Ishihama, 1981). The actual number of genes per cell substantially exceeds that number because a rapidly growing E. coli cell contains more than one chromosome (Bremer and Dennis, 1996). Apparently, the number of RNAP is less than the total number of genes in the genome, which suggests that core RNAP is limiting. Thus, control of RNAP distribution in the genome could be critical for global gene regulation in the cell (see below). There are seven a factors in E. coli (Table 34.1). Among them, a encoded by rpoD is the major a factor (Burton et al, 1983) and the holoenzyme Ea''^ is responsible for the housekeeping functions in the cell. Each of the minor a factors is required for the expression of a specific set of genes called regulons under different physiological conditions involving various stress responses (Gross et al, 1998). For example, the holoenzyme Ea is required for the expression of stationary-phase specific genes (Loewen and HenggeAronis, 1994). While Ea^^ is responsible for the expression of heat shock genes during the cytoplasmic stress response (Grossman et al, 1984), Eo^ is responsible for the expression of genes encoding periplasmic proteins and envelope components during the extracytoplasmic or envelope stress response (Erickson and Gross, 1989). Eo^ is important for the expression of genes which are activated during nitrogen limitation (Kustu et aL, 1989). Ea^ controls the

551

expression of flagellar and chemotaxis genes (Helmann, 1991), and Eo^^^Ms involved in transcription initiation of the fee operon (Pressler et al, 1988). The expression or the activity of different o factors is sensitive to the signals induced by different stresses. For example, while unfolding or misfolding of cytoplasmic proteins induced by heat shock stimulates the expression of a , heat shock induced unfolding or misfolding of extracytoplasmic or periplasmic proteins activates c^ (Alba and Gross, 2004; Straus et al, 1990). In addition, the cellular levels of some a factors, such as a^^, a^ and a^ are known to be subject to regulated proteolysis (Ades et al, 1999; Straus et al, 1990; Zhou et al, 2001). B: RNAP-Associated Proteins and Transcription Factors Many RNAP-associated proteins have been identified in E. coli, most of those have regulatory fimction in transcription (Table 34.1). For example, transcription regulator DksA mediates the transcription of ribosomal operons and the stringent response (Paul et al., 2004a). SspA, the stringent starvation protein, is a transcriptional co-activator for the phage PI late promoters important for the phage development (Hansen et al., 2003). In addition, SspA plays a pivotal role in acid tolerance of E. coli during stationary phase growth (Hansen et al., 2005). Nus factors (NusA, NusB, NusE, and NusG) are involved in transcription elongation and termination/ antitermination (Condon et al, 1995; Friedman and Court, 1995; Nudler and Gottesman, 2002). Top A is important in modulating DNA topology (Tse-Dinh et al, 1997), as an elongating RNAP generates positive supercoils ahead and leaves a negative supercoils behind (Wu et al, 1988). While some of these transcription regulators, such as NusA and RapA, bind to RNAP with high affinity, others bind only loosely and their interaction with RNAP cannot be detected during conventional purification of the enzyme (Zhi et al, 2003b). Among the RNAP-associated proteins, GreA and GreB are the functional homologs of eukaryotic transcript cleavage factor TFIIS, and are involved in the RNA cleavage reaction of arrested elongation complexes (Borukhov et al, 2001). Also, RapA, an ATPase, which is stimulated by the interaction with RNAP, is a bacterial homolog of the SWI/SNF proteins (Sukhodolets and Jin, 1998). Eukaryotic SWI/SNF proteins are important in chromatin/ nucleosome remodeling, gene expression and DNA repair (Citterio et al, 2000; Muchardt and Yaniv, 1999; Pazin and Kadonaga, 1997; Peterson, 1996), indicating that ATP-mediated chromatin remodeling by the SWI/ SNF proteins is important for the regulation of cell growth. RapA plays an important role in stimulating

552

Section V

RNAP recycling in transcription (Sukhodolets et ah, 2001), and provides an opportunity to study the detailed mechanism of this homolog of SWI2/SNF2 in transcription and gene regulation. In addition, there are many transcription factors which modulate transcription at different stages of the transcription cycle (Ishihama, 2000). Numerous repressors and activators control transcription initiation by binding to regulatory regions in or near promoters. A classical example is the Lac repressor and CRP activator, which represses and activates the lac operon respectively, depending on the growth condition (Savery et ah, 1996; Shuman and Silhavy, 2003). Several elongation factors regulate rate of elongation and/or determine an outcome of termination or antitermination by modulating elongation complexes at regulatory sites in nascent RNA (Friedman and Court, 1995; Weisberg and Gottesman, 1999). One of the major transcriptional termination mechanisms requires the Rho protein which is a RNA-dependent ATPase and DNA:RNA helicase (Piatt, 1994). Another class of proteins, collectively called nucleoid proteins including Fis, Hu, HN-S, and IHF (Azam and Ishihama, 1999; Dorman and Deighan, 2003), is also important for transcription. These small proteins bind to DNA with specific sequences and /or at the bend of DNA. Thus, they exert their role in regulation of transcription either directly by binding to some promoter regions, as a repressor or activator, or indirectly by changing the topology of DNA (Travers et al, 2001).

Special Topics

regions has a consensus length of 17 bp (Ayers et al, 1989; Stefano and Gralla, 1982). At some promoters, there are other regulatory sites either within or near the promoter region where transcription factors, such as repressors or activators, can bind and control transcription initiation. In addition, an A/T rich sequence upstream of the -35 region called the UP element enhances promoter activity by providing additional interaction with RNAP and other transcription factors at some promoters (Blatter et al, 1994; Davis et aL, 2005; Ross et al., 1993). In another subset of promoters, there is only the typical -10 region, but lacks the -35 region. At these promoters, an additional activator is required in order for RNAP to initiate transcription. This requirement is overcome at yet another subset of promoters, where there is an extended -10 region (TON) (Keilty and Rosenberg, 1987; Mitchell et al, 2003), which enables RNAP to recognize these promoters in the absence of the -35 region. Promoter recognition is mainly determined by the a factor, whose distinct domains bind to and/or act at different elements of promoter (Gross et ai, 1998; Young et aL, 2002).

EG

DNA

Termination

Initiation

Transcription Cycle Elongation

Transcription is divided into the following stages: initiation, elongation, termination, and RNAP recycling (Fig.34.2). In each stage, however, there are multiple steps involved and each step potentially could be a regulatory step in transcription (von Hippel et al, 1996).

Fig.34.2 The cranscription cycle. Transcription is a cyclical process. Upon the formation of Eo and the promoter binding, RNAP undergoes the process of initiation, elongation, and termination. The cycle is completed with the help of RapA, which promotes RNAP recycling, and RNAP is ready to start the cycle again.

A: Initiation Initiation of transcription occurs at sites in the DNA called promoters (Fig.34.3). Initiation of transcription is a complex process consisting of several steps: initial binding of RNAP holoenzyme to a promoter, formation of a competent initiation complex, synthesis of the initial phosphodiester bonds, and clearance of RNAP from the promoter (deHaseth et al, 1998), as shown in Fig. 34.4. The basic elements of a promoter recognized by E. coli Eo 70 are the -35 (TTGACA) and -10 (TATAAT) regions relative to the starting site which is defined as +1 (Harley and Reynolds, 1987; Hawley and McClure, 1983). The spacer between the -35 and -10

The first complex to form upon initial binding of RNAP (R) to promoter (P) is a closed complex (RPc), which transforms into an open complex (RPQ) through several isomerization steps. During this transformation, ~ 10-12 bp segment of the double strand of DNA near the -10 region is melted, and the template DNA strand is positioned into the active center of RNAP making RPQ competent for initiation. There are large scale conformational changes of RNAP in forming these kinetically significant intermediates (Saecker et aL, 2002). With the addition of NTPs, RNAP forms initiation complex (RPinit). However, before RPinit escapes the promoter to become an elongation complex

Chapter 34 Transcription Control in Bacteria

553 +1

A

A/T-rich

TTGACA

R

TGNTATAAT

r^

extended transcription -10 region start site -35 region UP element -10 region Fig.34.3 Elements in the promoter region. The basic structure of the promoter region includes a -35 region and a -10 region (indicated by the blue boxes) for recognition by RNAR An A/T-rich UP element upstream (in purple) of the consensus sequence helps enhance transcription. In some cases, the promoter lacks the -35 region, but contains an extended -10 region (highlighted by the green color) or an additional activator region to facilitate the a recognition. Sites for activator binding (denoted by the red 'A') can enhance transcription initiation. Repressor sites (denoted by the red 'R') found in and/or near the promoter region block transcription through repressor binding. NTP, . RP,2 Z=^ RPol ^ ^ RPo2 ^

binding

1

isomenzation

NTP, RPinit - ^

EC

AP

promoter clearance

Fig.34.4 Intermediates in the process of transcription initiation. The initiation of transcription is a multi-step process that starts with the RNAP holoenzyme (R) recognition and binding to the promoter (P), resulting in a closed complex (RPc). The closed complex then undergoes several isomerization steps leading to the formation of an open complex (RPQ). Although the open complex of most promoters is stable (irreversible), the formation of the open complex may be reversible in some cases as indicated by the green arrows. Addition of NTPs leads to the formation of the initial phosphodiester bonds in the nascent RNA resulting in the initiation complex (RPinit). The initiation complex makes short non-productive initiation or abortive products (AP) at most promoters. The fmal step of the process involves promoter clearance leading to the transcription elongation complex (EC).

(EC), RNAP generally synthesizes short non-productive RNAs (abortive products), which dissociate from RNAR There are two kinds of non-productive initiation: abortive and slippage (Hsu et ah, 2003; Jin, 1994; Jin and Tumbough, 1994; Liu et al, 1994; McDowell et al, 1994). While abortive initiation is generally found at most promoters, slippage initiation or reiterative RNA synthesis is limited to promoters which have a run of three or more A, T or C sequences at the beginning of the transcript. Multiple mechanisms are involved in the control of transcription initiation. As mentioned earlier, initiation is carried out by RNAP holoenzyme containing sigma factors. Different holoenzymes containing different a factors recognize different sets of promoters in the genome. Therefore, operationally, interaction between o factors and core RNAP is the first step in initiation. Genetically, it has been shown that different a factors compete for binding to core RNAP (Zhou et ai, 1992),

indicating that core RNAP is limiting in the cell. Thus, the amount and/or the affinity of a particular a factor for core RNAP determines the level of a particular holoenzyme (Maeda et ai, 2000), which in turn modulates the transcription profiles in the cell. On the other hand, there are different anti-a factors (Hughes and Mathee, 1998) in the cell which antagonize either the interaction between a factors and core RNAP or the activity of holoenzymes containing a factors. The issue of when a factor releases from RNAP is not resolved yet (Bar-Nahum and Nudler, 2001; Gill et al, 1991; Greenblatt and Li, 1981; Mukhopadhyay et al., 2001; Shimamoto et al, 1986). However, it is likely that a factor releases shortly after RNAP enters elongation phase. Various transcription factors act on promoters with different mechanisms (Ishihama, 2000). For example, while some repressors bind at promoters to prevent the binding of RNAP to the promoters due to steric hindrance, others bind to inhibit the isomerization step(s). In addition, some repressors bind at multiple sites in the promoter regions to form a DNA loop via protein-protein interactions, usually in a concerted action with nucleoid-binding proteins (Adhya et aL, 1998). Antibiotics rifampicin and sorangicin A, as well as the nucleoid-binding protein H-NS, prevent RNAP from promoter clearance (Campbell et ah, 2005; McClure and Cech, 1978; Xu et al, 2005; Schroder and Wagner, 2000). Activators are able to stimulate transcription at different steps in initiation (Browning and Busby, 2004; Lawson et al, 2004). In general, however, the role of activators is to recruit RNAP to the promoters which usually have weak or no binding to RNAP alone. The two a subunits of RNAP participate in the interaction with various transcriptional activators (Ebright, 1993; McLeod et a/., 2002; Ross et al., 1993). The GreA and GreB proteins stimulate promoter escape or promoter clearance (Hsu et al., 1995). In addition.

554'

Section V

NTP concentration controls promoter clearance at some promoters (Jin, 1994; Qi and Tumbough, 1995). For example, the non-productive slippage initiation is favored at the ;?yr^/promoter of pyrimidine biosynthetic operons when the concentration of UTP is high, whereas the slippage is minimal when UTP is low (Liu et ah, 1994). Thus, the productive initiation oi pyrBI responds to the concentration of UTP, which is biologically relevant because the end products of the pyrimidine biosynthetic operons are UTP and CTP. Initiation at the promoters from the ribosomal operons {rm) is an example of multiple controls including several transcription factors and small molecules (Gralla, 2005; Paul et al, 2004b). Regulation of transcription of rrn is critical for cell growth and global genome-wide regulation because synthesis of rRNA is the single most important factor that influences the distribution of RNAP inside the cell under different physiological conditions (see next section below). The rm promoters are the most active promoters in the cell grown in rich media, but they have only minimal activity in the cell starved for nutrients. Hence, they are called stringent promoters. The key feature of the rm promoters is that the interaction between wild type RNAP and stringent promoters is intrinsically unstable, presumably because the steps prior to the first phosphodiester bond formation are reversible and the intermediate closed and open complexes are in rapid equilibrium with each other. In contrast, open complexes at non-stringent promoters are generally very stable and the reactions back to closed complexes are negligible (McClure, 1980). Many factors act on this regulatory step. While the DksA protein along with the small molecule ppGpp (the level of ppGpp is minimal in fast growing cells and maximum in nutrient starvation cells) act synergistically to destabilize the open complex (Paul et ah, 2004a), the Fis protein stabilizes the complex (Zhi et ah, 2003a). In addition, the concentration of the initial NTP to be incorporated into rRNA affects the stability of the open complex (Gaal et al, 1997). The study of the "stringent" mutant RNAPs (Zhou and Jin, 1998), which destabilize the open complex of stringent promoters in vitro and reduce the synthesis of rRNA even when cell are grown in rich media, further support the notion that the regulation of the rm operons and the control of the stringent response during nutrient starvation is mainly aimed at the stability of the open complex of the rm promoters (see next section below). B: Elongation Escapefi*omthe promoter converts RNAP into an elongation complex (Korzheva et al, 2000) where 8-9

Special Topics

nucleotides at the 3' end of the nascent RNA form a hybrid with the template DNA and the 3' end of the RNA in the hybrid is located at the active center of the enzyme (Fig. 34.5). The rate of elongation is not constant because RNAP pauses at some sites called pausing sites (Kingston and Chamberlin, 1981; Landick et al, 1987). Although the formation of an RNA hairpin in the nascent transcript coincides with pausing (Landick et al, 1996), the nature of the pausing at many other sites is not well understood (Artsimovitch and Landick, 2000; Levin and Chamberlin, 1987). However, because pausing in general is sensitive to concentration of NTPs, and some mutant RNAPs with modified elongation rates (pausings) have altered Km for NTPs (Jin and Gross, 1991), there is a kinetic element associated with the pausing: the Km of RNAP for the nucleotide to be incorporated at the pausing site is increased. Transcription factors and/or antitermination factors, such as NusA and N, modulate the rate of elongation by either enhancing pausing or suppressing pausing (Greenblatt et ai, 1981; Gusarov and Nudler, 2001; Kingston and Chamberlin, 1981; Rees et al., 1996). Sometimes the elongation complex becomes arrested at intrinsic arrest sites in DNA in vitro and in vivo (Komissarova and Kashlev, 1997a; Toulme et al, 2000). Arrest also occurs when RNAP encounters physical obstacles in template such as "roadblock" or chemical lesions in DNA. These arrested complexes cannot be rescued by increasing concentration of NTPs. Detailed biochemical analysis revealed that the arrest is caused by RNAP backtracking along DNA, associated with reverse threading of the RNA through the enzyme (Fig. 34.5). The 3' end of the transcript is extruded fi-om the enzyme during the backtracking, causing its disengagement from the active center of RNAP. Transcription factors GreA/GreB reactivate the arrested complex by stimulating an endonucleolytic cleavage of the nascent RNA at the backtracked position of the active center in the enzyme (Komissarova and Kashlev, 1997b), thus generating a new 3' RNA end at the upstream location of RNAP. This function is conserved: eukaryotic transcript cleavage factor TFIIS reactivates the backtracked complexes by the same mechanism and promotes Pol II transcription through the nucleosomes (Kireeva et aL, 2005). In addition, transcription repair coupling factor Mfd (Selby and Sancar, 1993) rescues the arrested complexes by promoting forward translocation (thus reverse backtracking) of RNAP so that the active center of RNAP re-engage the RNA 3' end (Park et aL, 2002; Roberts and Park, 2004).

Chapter 34

Transcription Control in Bacteria

Normal Elongation Complex

555

DH

Arrested Elongation Complex

1^

Rescue of Arrested Elongation Complex

+ Mfd

Ilim_

MMIfTTP

: ^

I

I IF

Fig.34.5 Backtracking of eiuii^itiiuii cumpieA auu icscuiug ailesicu cuiiipicA uy vjic laciuis aiiu iYiid. In the elongation complex, 8-9 nucleotides at the 3' end of the nascent RNA form a hybrid with the template DNA and the 3' end of the RNA (denoted by a black circle) in the hybrid is located at the active center (denoted by the star) of the enzyme. The arrested RNAP complex backtracks along the DNA, simultaneously causing portion of the 3' end of the nascent RNA to extrude out of the active center (indicated by purple color). The arrested complex can be rescued either by Gre factors (GreA/GreB) which cleave the extruded portion of the RNA at the catalytic center, or by Mfd which promotes forward translocation (or reverse backtracking) of the enzyme.

C: Termination and Antitermination Termination of transcription occurs when elongating RNAP reaches a terminator (Henkin, 2000; Nudler and Gottesman, 2002; von Hippel, 1998). There are two kinds of terminators in E. coli. One type is called intrinsic or simple terminator and causes dissociation of elongation complex in the absence of trans-acting protein factors (Brendel et al, 1986; d'Aubenton Carafa et ai, 1990). The other type is called a Rho-dependent terminator because termination at those sites requires the transcription factor Rho (Richardson, 2002). However, the kinetic element is important for all termination systems: mutant RNAPs with altered rates of elongation, hence pausing, also have altered properties during termination at both simple and Rho-dependent terminators (Jin et al, 1992; McDowell e/a/., 1994). The intrinsic or simple terminators in DNA have two common features: a GC-rich palindromic element, immediately followed by a stretch of T sequence. In

RNA, this sequence forms a stable termination hairpin structure followed by 7-9 unpaired U residues (Fig. 34.6). Pausing at the terminators induces the formation of the termination hairpin, which coupled with the intrinsic instability of dA-U pairs (Gusarov and Nudler, 1999; Komissarova et al., 2002; Martin and Tinoco, 1980), facilitates the release of RNA. Thus, formation of the termination hairpin immediately before the stretch of T sequence at the terminators is critical for termination, a step various anti-termination mechanisms act upon (see below). At Rho-dependent terminators, RNAP does not stop without the assistance of the Rho protein (Piatt, 1994; Richardson, 2002). Although there is no common feature for this type of terminator, RNAP generally pauses at the terminator in the absence of Rho. Rho then binds to the upstream part of nascent RNA to be terminated and translocates along the RNA using its ATPase activity (Richardson, 2003). Upon reaching elongation complex, Rho displaces the nascent RNA

Section V

556"

Special Topics

from the hybrid with DNA in the active center using its DNA.RNA heUcase activity powered by ATP hydrolysis (Brennan et al, 1987; Walstrom et a/., 1997). NusG stimulates Rho-dependent termination, probably by forming a Rho-NusG-RNAP complex (Bums et ai, 1999) since NusG interacts with both RNAP and Rho (Nehrke and Piatt, 1994).

O UUUUUUUUU-3' TTTTTTTTT 5' DNA Fig.34.6 The intrinsic or simple transcription terminator. In DNA, there are two components for the intrinsic terminator: a GC-rich palindromic element (indicated by green and purple arrows), immediately followed by a stretch of T sequence. In the RNA to be terminated, this sequence forms a stable termination hairpin structure (shown by the green and purple pairing) followed by 7-9 unpaired U residues.

Elongating RNAP can be modified by transcription or antitermination factors suppressing termination at intrinsic and Rho-dependent terminators in a process called antitermination. The best studied antitermination systems are from X phage (Friedman and Court, 1995; Gottesman and Weisberg, 2004; Weisberg and Gottesman, 1999). In XN antitermination, the phage N protein binds to a stem-loop structure in RNA called BoxB and modifies elongation complex making it resistant to termination. Although N alone is able to cause antitermination at short distance from BoxB (Gusarov and Nudler, 2001; Rees et al, 1996), formation of a

progressive antitermination complex requires binding of general elongation factors NusA, NusE, NusB, and NusG (DeVito and Das, 1994). Mechanisms of how N cause antitermination and the role of Nus factors in N action are not well understood. N may physically interfere with formation of termination hairpins, stabilize the interaction of RNAP with the RNA-DNA hybrid, or block the access of Rho to the RNA-DNA hybrid. In addition, N may reduce the dwell time for the formation of the termination-competent conformation of RNAP at terminators by suppressing pausing of RNAP at the termination sites. Similarly, phage Q protein sippresses termination by directly interfering with hairpin formation, although cellular factors are not required in >-Q antitermination (Roberts et al, 1998). Cellular antitermination is important for the transcription of ribosomal RNA {rrn) operons (Squires et ai, 1993). Like X,N antitermination system, this system has BoxB and other cis elements; however, factors involved in the rrn operons antitermination are less well defined, but they include NusA, NusB, NusE, NusG, and ribosomal protein S4 (Squires et al., 2003). In some bacterial systems, control of transcription is mediated by alternating termination and antitermination in responding to environmental signals (Henkin and Yanofsky, 2002; Yanofsky, 2000). In these systems, the nascent RNA is able to form two alternating pairings: one pairing results in termination as an intrinsic terminator and the other pairing results in antitermination as it prevents the formation of the termination hairpin (Fig.34.7). Many effectors modulate the alternating pairings in different ways. For example, in trp attenuation, the position of a ribosome translating the leader peptide is critical for the regulation (Zurawski et al., 1978). When tryptophan is limiting in the cell, an

o

Effector RNA

DNA

UUUUUUUUU-3' TTTTTTTTT - 5'

5'-

-3'

3'-

-5' DNA

Termination Antitermination Fig.34.7 Alternating termination and antitermination with different RNA pairings. The nascent RNA sequence is able to form alternative pairings as indicated by regions 1 to 4. One pairing involves the formation of a termination hairpin, represented by the pairing of regions 3 and 4 in green and purple leading to termination. An alternative pairing of regions 2 and 3 (blue and green) forms the alternate hairpin structure, preventing the formation of the termination hairpin, thus favoring antitermination. Many effectors influence the alternating pairings in different ways to control gene expression.

Chapter 34 Transcription Control in Bacteria

uncharged tRNA^"^ binds to the ribosome causing the ribosome to stall at the Trp codons in the leader peptide in such a way that the formation of the antitermination pairing is favored. Conversely, when tryptophan is available, charged tRNA^'P will not stall the ribosome at the leader peptide so that a termination pairing is favored. In other bacterial systems, various effectors, including different tRNAs and some small molecules, are able to modulate the alternating pairings in the absence of translation (Epshtein et al, 2003; Grundy and Henkin, 2003). D: RNAP Recycling After the end of one round of transcription, RNAP needs to release from DNA and/or RNA in order for reuse. However, the ability of RNAP to recycle after one round of transcription is limited at least in vitro. RapA activates transcription by stimulating RNAP recycling (Sukhodolets et al, 2001), suggesting that RNAP recycling is potentially a regulatory step in transcription. Probably, RNAP becomes trapped or immobilized in a post transcription or post-termination complex after one round of transcription. As RapA is an ATPase and a member of the SWI/SNF superfamily of helicase-like proteins, it is then able to remodel these complexes so that RNAP is released or becomes mobile for recycling. Also, a 70 enhances dissociation of RNAP after termination in vitro (Amdt and Chamberlin, 1988); however, the mechanism by which o 70 promotes RNAP recycling is unknown. Global Genome-wide Regulation There are many levels of gene regulation. One is involved in specific operons. The classical example is the lac operon, which is specifically induced by the substrate of the operon (Jacob and Monod, 1961). Virtually all carbohydrate catabolic genes or operons can be regulated by substrate-specific induction (Bruckner and Titgemeyer, 2002). Another level of regulation is involved in a limited set of operons which share some common features. One example is carbon catabolite repression that inhibits expression of various alternative carbon utilization pathways when glucose, which is readily usable by the cell, is present (Saier, 1998). When carbon catabolite repression is relaxed, CRP, a global transcription activator for most of carbon catabolic pathways, is activated (Crasnier, 1996). Another example is the expression of different regulons by holoenzymes containing different o factors as described above. There is a genome-wide global regulation via

557'

RNAP distribution in response to nutrient cues, which affects the overall transcription program in the cell. Under optimal growth conditions such as when the cell is grown in nutrient-rich media, the vast majority of RNAP molecules synthesize rRNA and tRNA (termed stable RNAs) (Bremer and Dermis, 1996). The stable RNAs are encoded by the genes that represent less than 1% of the genome. Thus, the remaining few RNAP molecules not synthesizing stable RNAs are responsible for transcribing the other 99% of genes in the genome. Under suboptimal conditions, such as when cells are growing slowly in nutrient-poor media, few RNAP molecules synthesize stable RNAs. When cells are shifted from nutrient-rich to starvation conditions, such as amino acid starvation, leading to what is termed the stringent response (Cashel et al, 1996), the cellular transcription machinery is dramatically reprogrammed in such a way that the expression of stable RNAs is totally inhibited while that of other genes or operons, such as amino acid biosynthetic operons, is activated. Similarly, global transcriptional programs reveal a carbon source foraging strategy: as the available carbon substrate becomes poorer, cells systematically increase the number of genes expressed and reduce the expression of stable RNAs (Liu et al, 2005). Until very recently, little has been known about the location and distribution of the RNAP molecule in E. coli under different physiological conditions. A functional rpoC-gfp gene fusion (the (3' subunit of RNAP is fused to the green fluorescent protein (GFP) from marine jellyfish) on the E, coli chromosome has been constructed to visualize RNAP in the cell by fluorescence microscopy under different growth conditions (Cabrera and Jin, 2003). The results have demonstrated that the distribution ofE. coli RNAP is dynamic and sensitive to physiological changes. Several conclusions have been derived from the cell biology study of RNAP. First, RNAP is located exclusively either within and/or surrounding the nucleoid and there is no RNAPGFP signal in cytoplasmic space. Second, growth conditions, nutrient deprivation, and transcription activity affect the distribution of RNAP. In fast-growing cells cultured in rich medium, RNAP distribution is heterogeneous, being concentrated in areas of the nucleoid (Fig.34.8). These areas are named transcription foci because they disappear in the presence of antibiotic rifampicin, which inhibits transcription. The transcription foci are likely RNAP molecules actively engaged in stable-RNA synthesis, because in slow-growing cells cultured in nutrient-poor media, the distribution of RNAP is relatively homogeneous and transcription foci are not evident (Fig. 34.8). Also, while the transcription

Section V Special Topics

558 Medium

RNAP-GFP

Cell and Nucleoid

Rich

-f A ?%-;

Poor

rig.34.8 RNA polymerase distribution in cells grown in different media. Images of the rpoC-gfp cells grown in rich LB and in poor glucose-minimal media are indicated. The larger cell grown in LB has two nucleoids and the smaller cell grown in glucose-minimal medium has one nucleoid. The arrows indicate the transcription foci of the RNAP-GFP in the cell grown in rich medium. RNAP

Inhibition of transcription Nutrient deprivation,or stringent response Low stable-RNA synthesis

tRNA2 RNAP dispersed Weak interaction between DNA loops Nucleoid decondensed DNA loops/Nucleoid Interactions between DNA loops are dynamic & affected by stable-RNA synthesis

High growth rates High stable-RNA synthesis

Transcription factories or foci

11

Appearance of transcription factories or foci Strong interaction between DNA loops Nucleoid condensed Fig.34.9

Model of stable-RNA synthesis, transcription factories/foci, and chromosome condensation. The E. coli chromosome is

represented as blue lines folded in loops, the ori (origin) of replication as a black square, the seven rRNA operons as large red circles with letters, and the two representative tRNA operons as small red circles. The RNAP molecules are represented as small green circles. For simplicity, only two putative transcription factories/foci, which make the nucleoid more compact by pulling different stable RNA operons into proximity, are indicated here (bottom part of the diagram, large green circles labeled 1 and 2). (Adapted from Cabrera and Jin, 2003). See text for details. foci disappear rapidly in wild-type cells during amino acid starvation, they remain present in an isogenic relA mutant strain in which stable RNAs are still actively synthesized (Metzger et ai, 1989). Moreover, the distribution of a "stringent" RNAP, in which stable-RNA synthesis is impaired even in rich media (Zhou and Jin,

1998) resemble that of wild-type RNAP during the stringent response. Thus, the transcription foci are proposed to be transcription "factories" synthesizing stable RNAs, which form structures analogous to the eukaryotic nucleolus (Cook, 1999). Finally, the synthesis of stable RNAs has been suggested to be a driving force

Chapter 34

Transcription Control in Bacteria

in the condensation of the E. coli chromosome. The nucleoids become decondensed in wild-type cells when stable-RNA synthesis is preferentially inhibited during the stringent response, whereas they remain condensed in the relA mutant cells where stable-RNA synthesis is maintained during amino acid starvation. Moreover, the nucleoids are decondensed in the "stringent" RNAP mutant defective in stable-RNA synthesis even when grown in nutrient-rich media. A working model is postulated to link the synthesis of stable RNAs, RNAP distribution, and chromosome condensation in bacteria (Fig. 34.9). In summary, systemic studies combining genetics, biochemistry and cell biology approaches not only reveal a link between global gene regulation, such as the stringent (nutrient deprivation) response, and RNAP's (re)distribution in the cell, but also reveal an important role played by RNAP actively engaged in the synthesis of stable RNAs (in particular rRNA), in forming transcription factories or foci and in bringing about chromosome condensation. Acknowledgment We thank many colleagues for their contributions in the research. We are grateful for the comments from Mikhail Kashlev, Monica Hui and Julio Cabrera, and for the preparations of figures and table by Monica Hui and Julio Cabrera. This research was supported [in part] by the Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research.

References Adelman, K., Yuzenkova, J., La Porta, A., Zenkin, N., Lee, J., Lis, J. T., Borukhov, S., Wang, M. D., and Severinov, K. (2004). Molecular mechanism of transcription inhibition by peptide antibiotic Microcin J25. Mol Cell 14, 753-762. Ades, S. E., Connolly, L. E., Alba, B. M., and Gross, C. A. (1999). The Escherichia coli sigma(E)-dependent extracytoplasmic stress response is controlled by the regulated proteolysis of an anti-sigma factor. Genes Dev 13, 2449-2461. Adhya, S., Geanacopoulos, M., Lewis, D. E., Roy, S., and Aki, T. (1998). Transcription regulation by repressosome and by RNA polymerase contact. Cold Spring Harb Symp Quant Biol 63, 1-9. Alba, B. M., and Gross, C. A. (2004). Regulation of the Escherichia coli sigma-dependent envelope stress response. Mol Microbiol 52, 613-619. AlUson, L. A., Moyle, M., Shales, M., and Ingles, C. J. (1985). Extensive homology among the largest subunits of eukaryotic and prokaryotic RNA polymerases. Cell 42, 599-610.

559

Amdt, K. M., and Chamberlin, M. J. (1988). Transcription termination in Escherichia coli. Measurement of the rate of enzyme release from Rho-independent terminators. J Mol Biol 2(^2,271-285. Artsimovitch, L, and Landick, R. (2000). Pausing by bacterial RNA polymerase is mediated by mechanistically distinct classes of signals. Proc Natl Acad Sci USA 97, 7090-7095. Aubry-Damon, H., Soussy, C. J., and Courvalin, P. (1998). Characterization of mutations in the rpoB gene that confer rifampin resistance in Staphylococcus aureus. Antimicrob Agents Chemother 42, 2590-2594. Ayers, D. G., Auble, D. T., and deHaseth, R L. (1989). Promoter recognition by Escherichia coli RNA polymerase. Role of the spacer DNA in functional complex formation. J Mol Biol 207, 749-756. Azam, T. A., and Ishihama, A. (1999). Twelve species of the nucleoid-associated protein from Escherichia coli. Sequence recognition specificity and DNA binding affinity. J Biol Chem 27^,33105-33113. Bar-Nahum, G., and Nudler, E. (2001). Isolation and characterization of sigma(70)-retaining transcription elongation complexes from Escherichia coli. Cell 106, 443-451. Blatter, E. E., Ross, W., Tang, H., Course, R. L., and Ebright, R. H. (1994). Domain organization of RNA polymerase alpha subunit: C-terminal 85 amino acids constitute a domain capable of dimerization and DNA binding. Cell 78, 889-896. Blattner, F. R., Plunkett, G., 3rd, Bloch, C. A., Pema, N. T, Burland, v., Riley, M., CoUado-Vides, J., Glasner, J. D., Rode, C. K., Mayhew, G. R, et al (1997). The complete genome sequence of Escherichia coHK-n. Science277, 1453-1474. Borukhov, S., Laptenko, O., and Lee, J. (2001). Escherichia coli transcript cleavage factors GreA and GreB: fimctions and mechanisms of action. Methods Enzymol 342, 64-76. Borukhov, S., and Nudler, E. (2003). RNA polymerase holoenzyme: structure, function and biological implications. Curr Opin Microbiol 6, 93-100. Bremer, H., and Dennis, P. (1996). Modulation of Chemical Composition and Other Parameters of the Cell by Growth Rate. In Escherichia coli and Salmonella Typhimurium, F. Neidhardt, ed. (Washington, D.C., American Society for Microbiology), pp. 1553. Brendel, V., Hamm, G. H., and Trifonov, E. N. (1986). Terminators of transcription with RNA polymerase from Escherichia coli: what they look like and how to find them. J Biomol Struct Dyn 3, 705-723. Brennan, C. A., Dombroski, A. J., and Piatt, T. (1987). Transcription termination factor rho is an RNA-DNA helicase. Cell 48, 945-952. Browning, D. R, and Busby, S. J. (2004). The regulation of bacterial transcription initiation. Nat Rev Microbiol 2, 57-65. Bruckner, R., and Titgemeyer, F. (2002). Carbon catabolite repression in bacteria: choice of the carbon source and

560

Section V

autoregulatory limitation of sugar utilization. FEMS Microbiol Lett 2(?P, 141-148. Burgess, R. R., Erickson, B., Gentry, D., Gribskov, M., Hager, D., Lesley, S., Strickland, M., and Thompson, N. (1987). Bacterial RNA polymerase subunits and genes. In RNA polymerase and the regulation of transcription, W. S. ReznikofF, ed. (New York, NY, Elsevier Science Publishing), pp. 3-15. Burgess, R. R., Travers, A. A., Dunn, J. J., and Bautz, E. K. (1969). Factor stimulating transcription by RNA polymerase. Nature 227, 43-46. Bums, C. M., Nowatzke, W. L., and Richardson, J. R (1999). Activation of Rho-dependent transcription termination by NusG. Dependence on terminator location and acceleration of RNA release. J Biol Chem 274, 5245-5251. Burton, Z. F., Gross, C. A., Watanabe, K. K., and Burgess, R. R. (1983). The operon that encodes the sigma subunit of RNA polymerase also encodes ribosomal protein S21 and DNA primase in E. coli K12. Cell 52, 335-349. Cabrera, J. E., and Jin, D. J. (2003). The distribution of RNA polymerase in Escherichia coli is dynamic and sensitive to environmental cues. Mol Microbiol 50, 1493-1505. Campbell, E. A., Korzheva, N., Mustaev, A., Murakami, K., Nair, S., Goldfarb, A., and Darst, S. A. (2001). Structural mechanism for rifampicin inhibition of bacterial ma polymerase. Cell 104, 901-912. Campbell, E. A., Pavlova, O., Zenkin, N., Leon, F., Irschik, H., Jansen, R., Severinov, K., and Darst, S. A. (2005). Structural, functional, and genetic analysis of sorangicin inhibition of bacterial RNA polymerase. EMBO J 2^674-682. Cashel, M., Gentry, D. R., Hemandez, V. J., and Vinella, D. (1996). The stringent response. In Escherichia coli and Salmonella typhimurium, F. C. Neidhardt, ed. (Washington, D.C., A.S.M. Press), pp. 1458-1496. Citterio, E., Van Den Boom, V., Schnitzler, G., Kanaar, R., Bonte, E., Kingston, R. E., Hoeijmakers, J. H., and Vermeulen, W. (2000). ATP-dependent chromatin remodeling by the Cockayne syndrome B DNA repair-transcription-coupling factor. Mol Cell Biol 20, 7643-7653. Condon, C , Squires, C , and Squires, C. L. (1995). Control of rRNA transcription in Escherichia coli. Microbiol Rev 59, 623-645. Cook, P. R. (1999). The organization of replication and transcription. Science 2^^, 1790-1795. Crasnier, M. (1996). Cyclic AMP and catabolite repression. Res Microbiol 147, ^19A%1. d'Aubenton Carafa, Y, Brody, E., and Thermes, C. (1990). Prediction of rho-independent Escherichia coli transcription terminators. A statistical analysis of their RNA stem-loop structures. J Mol Biol 216, 835-858. Davis, C. A., Capp, M. W., Record, M. T., Jr., and Saecker, R. M. (2005). The effects of upstream DNA on open complex formation by Escherichia coli RNA polymerase. Proc Natl Acad Sci USA

Special Topics 102,285-290. deHaseth, R L., Zupancic, M. L., and Record, M. T., Jr. (1998). RNA polymerase-promoter interactions: the comings and goings of RNA polymerase. J Bacteriol ISO, 3019-3025. DeVito, J., and Das, A. (1994). Control of transcription processivity in phage lambda: Nus factors strengthen the termination-resistant state of RNA polymerase induced by N antiterminator. Proc Natl Acad Sci USA 91, 8660-8664. Dorman, C. J., and Deighan, P. (2003). Regulation of gene expression by histone-like proteins in bacteria. Curr Opin Genet Dev 75, 179-184. Drlica, K. (1987). The nucleoid. In Escherichia coli and Sahnonella typhimurium, F. Neidhardt, ed. (Washington, D.C., American Society for Microbiology), pp. 91 -103. Ebright, R. H. (1993). Transcription activation at Class I CAP-dependent promoters. Mol Microbiol 8,191-%^!. Ebright, R. H. (2000). RNA polymerase: structural similarities between bacterial RNA polymerase and eukaryotic RNA polymerase 11. J Mol Biol i04, 687-698. Epshtein, V., Mironov, A. S., and Nudler, E. (2003). The riboswitch-mediated control of sulfur metabolism in bacteria. Proc Nad Acad Sci USA 100, 5052-5056. Erickson, J. W, and Gross, C. A. (1989). Identification of the sigma E subunit of Escherichia coli RNA polymerase: a second alternate sigma factor involved in high-temperature gene expression. Genes Dev 5, 1462-1471. Ezekiel, D. H., and Hutchins, J. E. (1968). Mutations affecting RNA polymerase associated with rifampicin resistance in Escherichia coli. Nature 220, 216-211. Fisher, L. (1971). Rifampin-new and potent drug for TB treatment. Bull Natl Tuberc Respir Dis Assoc 57, 11-12. Friedman, D. I., and Court, D. L. (1995). Transcription antitermination: the lambda paradigm updated. Mol Microbiol 18, 191-200. Fu, J., Gnatt, A. L., Bushnell, D. A., Jensen, G. J., Thompson, N. E., Burgess, R. R., David, R R., and Romberg, R. D. (1999). Yeast RNA polymerase II at 5 A resolution. Cell 98, 799-810. Gaal, T., Bartlett, M. S., Ross, W, Tumbough, C. L., Jr., and Course, R. L. (1997). Transcription regulation by initiating NTP concentration: rRNA synthesis in bacteria. Science 278, 2092-2097. Gill, S. C, Weitzel, S. E., and von Hippel, P H. (1991). Escherichia coli sigma 70 and NusA proteins. I. Binding interactions with core RNA polymerase in solution and within the transcription complex. J Mol Biol 220, 307-324. Gottesman, M. E., and Weisbeig, R. A. (2004). Little lambda, who made thee? Microbiol Mol Biol Rev 68, 796-813. Gralla, J. D. (2005). Escherichia co//ribosomal RNA transcription: regulatory roles for ppGpp, NTPs, architectural proteins and a polymerase-binding protein. Mol Microbiol 55, 973-977. Greenblatt, J., and Li, J. (1981). Interaction of the sigma factor and the nusA gene protein oiE. coli with RNA polymerase in the

Chapter 34 Transcription Control in Bacteria initiation-termination cycle of transcription. Cell 24,421-428. Greenblatt, J., McLimont, M., and Hanly, S. (1981). Termination of transcription by nusA gene protein of Escherichia coli. Nature 292,215-220. Gross, C. A., Chan, C, Dombroski, A., Gruber, T,, Sharp, M., Tupy, J., and Young, B. (1998). The functional and regulatory roles of sigma factors in transcription. Cold Spring Harb Symp Quant BioUJ, 141-155. Grossman, A. D., Erickson, J. W., and Gross, C. A. (1984). The htpR gene product of E. coli is a sigma factor for heat-shock promoters. Cell 38, 383-390. Grundy, F. J., and Henkin, T. M. (2003). The T box and S box transcription termination control systems. Front Biosci 8, d20-31. Gusarov, I., and Nudler, E. (1999). The mechanism of intrinsic transcription termination. Mol Cell 3,495-504. Gusarov, I., and Nudler, E. (2001). Control of intrinsic transcription termination by N and NusA: the basic mechanisms. Cell 107, 437-449. Hansen, A. M., Lehnherr, H., Wang, X., Mobley, V., and Jin, D. J. (2003). Escherichia coli SspA is a transcription activator for bacteriophage PI late genes. Mol Microbiol ^5, 1621-1631. Hansen, A. M., Qiu, Y., Yeh, N., Blattner, F. R., Durfee, T., and Jin, D. J. (2005). SspA is required for acid resistance in stationary phase by downregulation of H-NS in Escherichia coli. Mol Microbiol 5(5, 719-734. Harley, C. B., and Reynolds, R. R (1987). Analysis of £". coli promoter sequences. Nucleic Acids Res 75, 2343-2361. Hawley, D. K., and McClure, W. R. (1983). Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res 77, 2237-2255. Heisler, L. M., Suzuki, H., Landick, R., and Gross, C. A. (1993). Four contiguous amino acids define the target for streptolydigin resistance in the beta subunit of Escherichia coli RNA polymerase. J Biol Chem 268, 25369-25375. Helmann, J. D. (1991). Alternative sigma factors and the regulation of flagellar gene expression. Mol Microbiol 5, 2875-2882. Henkin, T. M. (2000). Transcription termination control in bacteria. Curr Opin Microbiol 3, 149-153. Henkin, T. M., and Yanofsky, C. (2002). Regulation by transcription attenuation in bacteria: how RNA provides instructions for transcription termination/antitermination decisions. Bioessays 24, im-l()l. Hobot, J. A., VilHger, W., Escaig, J., Maeder, M., Ryter, A., and Kellenberger, E. (1985). Shape and fine structure of nucleoids observed on sections of ultrarapidly frozen and cryosubstituted bacteria. J Bacteriol 162, 960-971. Hsu, L. M., Vo, N. v., and Chamberlin, M. J. (1995). Escherichia coli transcript cleavage factors GreA and GreB stimulate promoter escape and gene expression in vivo and in vitro. Proc Natl Acad Sci USA 92, 11588-11592. Hsu, L. M., Vo, N. v., Kane, C. M., and Chamberlin, M. J. (2003).

561

In vitro studies of transcript initiation by Escherichia coli RNA polymerase. 1. RNA chain initiation, abortive initiation, and promoter escape at three bacteriophage promoters. Biochemistry 42, 3777-3786. Hughes, K. T., and Mathee, K. (1998). The anti-sigma factors. Annu Rev Microbiol 52, 231 -286. Ishihama, A. (1981). Subunit of assembly of Escherichia coli RNA polymerase. Adv Biophys 74, 1-35. Ishihama, A. (2000). Functional modulation of Escherichia coli RNA polymerase. Annu Rev Microbiol 54, 499-518. Jacob, F., and Monod, J. (1961). Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol 3, 318-356. Jin, D. J. (1994). Slippage synthesis at the galP2 promoter of Escherichia coli and its regulation by UTP concentration and cAMPcAMP receptor protein. J Biol Chem 269, 17221-17227. Jin, D. J., Burgess, R. R., Richardson, J. P., and Gross, C. A. (1992). Termination efficiency at rho-dependent terminators depends on kinetic coupling between RNA polymerase and rho. Proc Natl Acad Sci USA (^P, 1453-1457. Jin, D. J., Cashel, M., Friedman, D. I., Nakamura, Y, Walter, W. A., and Gross, C. A. (1988). Effects of rifampicin resistant rpoB mutations on antitermination and interaction with nusA in Escherichia coli. J Mol Biol 204, 247-261. Jin, D. J., and Gross, C. A. (1988). Mapping and sequencing of mutations in the Escherichia coli rpoB gene that lead to rifampicin resistance. J Mol Biol 202, 45-58. Jin, D. J., and Gross, C. A. (1989). Characterization of the pleiotropic phenotypes of rifampin-resistant rpoB mutants of Escherichia coli. J Bacteriol 777, 5229-5231. Jin, D. J., and Gross, C. A. (1991). RpoB8, a rifampicin-resistant termination-proficient RNA polymerase, has an increased Km for purine nucleotides during transcription elongation. J Biol Chem 266, 14478-14485. Jin, D. J., and Tumbough, C. L., Jr. (1994). An Escherichia coli RNA polymerase defective in transcription due to its overproduction of abortive initiation products. J Mol Biol 236, 72-80. Jin, D. J., and Zhou, Y N. (1996). Mutational analysis of structure-function relationship of RNA polymerase in Escherichia coli. Methods Enzymol 273,300-319. Kapusnik, J. E., Parenti, F., and Sande, M. A. (1984). The use of rifampicin in staphylococcal infections—a review. J Antimicrob Chemother 13 Suppl C, 61-66. Keilty, S., and Rosenberg, M. (1987). Constitutive function of a positively regulated promoter reveals new sequences essential for activity. J Biol Chem 262, 6389-6395. Kingston, R. E., and Chamberlin, M. J. (1981). Pausing and attenuation of in vitro transcription in the rmB operon of E. coli. Cell 27, 523-531. Kireeva, M. L., Hancock, B., Cremona, G. H., Walter, W., Studitsky, V. M., and Kashlev, M. (2005). Nature of the Nucleosomal Barrier to RNA Polymerase II. Mol Cell 18, 97-108.

562

Section V

Komissarova, N., Becker, J., Solter, S., Kireeva, M., and Kashlev, M. (2002). Shortening of RNA:DNA hybrid in the elongation complex of RNA polymerase is a prerequisite for transcription termination. Mol Cell 10, 1151-1162. Komissarova, N., and Kashlev, M. (1997a). RNA polymerase switches between inactivated and activated states By translocating back and forth along the DNA and the RNA. J Biol Chem 272, 15329-15338. Komissarova, N., and Kashlev, M. (1997b). Transcriptional arrest: Escherichia coli RNA polymerase translocates backward, leaving the 3' end of the RNA intact and extruded. Proc Natl Acad Sci USA P^, 1755-1760. Korzheva, N., Mustaev, A., Kozlov, M., Malhotra, A., Nikiforov, v., Goldfarb, A., and Darst, S. A. (2000). A structural model of transcription elongation. Science 289, 619-625. Kustu, S., Santero, E., Keener, J., Popham, D., and Weiss, D. (1989). Expression of sigma 54 (ntrA)-dependent genes is probably united by a common mechanism. Microbiol Rev 53, 367-376. Landick, R., Carey, J., and Yanofsky, C. (1987). Detection of transcription-pausing in vivo in the trp operon leader region. Proc Natl Acad Sci USA 5^, 1507-1511. Landick, R., Wang, D., and Chan, C. L. (1996). Quantitative analysis of transcriptional pausing by Escherichia coli RNA polymerase: his leader pause site as paradigm. Methods Enzymol 274, 334-353. Lawson, C. L., Swigon, D., Murakami, K. S., Darst, S. A., Berman, H. M., and Ebright, R. H. (2004). Catabolite activator protein: DNA binding and transcription activation. Curr Opin Struct Biol 14, 10-20. Leung, M. J., Kell, A. D., and Collignon, R (1998). Antibiotic guidelines for meningococcal prophylaxis. Med J Aust 169, 396. Levin, J. R., and Chamberlin, M. J. (1987). Mapping and characterization of transcriptional pause sites in the early genetic region of bacteriophage T7. J Mol Biol 196, 61-84. Liu, C, Heath, L. S., and Tumbough, C. L., Jr. (1994). Regulation of pyrBI operon expression in Escherichia coli by UTP-sensitive reiterative RNA synthesis during transcriptional initiation. Genes Dev (5, 2904-2912. Liu, M., Durfee, T., Cabrera, J. E., Zhao, K., Jin, D. J., and Blattner, F. R. (2005). Global transcriptional programs reveal a carbon source foraging strategy by Escherichia coli. J Biol Chem. 2(^(^:15921-15927. Loewen, P. C , and Hengge-Aronis, R. (1994). The role of the sigma factor sigma S (KatF) in bacterial global regulation. Annu Rev Microbiol 48, 53-80. Lounis, N., and Roscigno, G. (2004). In vitro and in vivo activities of new rifamycin derivatives against mycobacterial infections. Curr Pharm Des 10, 3229-3238. Maeda, H., Fujita, N., and Ishihama, A. (2000). Competition among seven Escherichia coli sigma subunits: relative binding affinities to the core RNA polymerase. Nucleic Acids Res 28, 3497-3503.

Special Topics Martin, F. H., and Tinoco, L, Jr. (1980). DNA-RNA hybrid duplexes containing oligo(dA:rU) sequences are exceptionally unstable and may facilitate termination of transcription. Nucleic Acids Res 8, 2295-2299. McClure, W. R. (1980). Rate-limiting steps in RNA chain initiation. Proc Natl Acad Sci USA 77, 5634-5638. McClure, W R., and Cech, C. L. (1978). On the mechanism of rifampicin inhibition of RNA synthesis. J Biol Chem 253, 8949-8956. McDowell, J. C , Roberts, J. W, Jin, D. J., and Gross, C. (1994). Determination of intrinsic transcription termination efficiency by RNA polymerase elongation rate. Science 266, 822-825. McLeod, S. M., Aiyar, S. E., Course, R. L., and Johnson, R. C. (2002). The C-terminal domains of the RNA polymerase alpha subunits: contact site with Fis and localization during co-activation with CRP at the Escherichia coli pro? P2 promoter. J Mol BioUid, 517-529. Metzger, S., Schreiber, G., Aizenman, E., Cashel, M., and Glaser, G. (1989). Characterization of the relAl mutation and a comparison of relAl with new relA null alleles in Escherichia coli. J Biol Chem 264, 21146-21152. Mitchell, J. E., Zheng, D., Busby, S. J., and Minchin, S. D. (2003). Identification and analysis of 'extended -10' promoters in Escherichia coli. Nucleic Acids Res 31,4689-4695. Muchardt, C , and Yaniv, M. (1999). The mammalian SWI/SNF complex and the control of cell grov^h. Semin Cell Dev Biol 10, 189-195. Mukhopadhyay, J., Kapanidis, A. N., Mekler, V., Kortkhonjia, E., Ebright, Y. W, and Ebright, R. H. (2001). Translocation of sigma(70) with RNA polymerase during transcription: fluorescence resonance energy transfer assay for movement relative to DNA. Cell 106,453-463. Murakami, K. S., Masuda, S., Campbell, E. A., Muzzin, O., and Darst, S. A. (2002). Structural basis of transcription initiation: an RNA polymerase holoenzyme-DNA complex. Science 296, 1285-1290. Mustaev, A., Zaychikov, E., Severinov, K., Kashlev, M., Polyakov, A., Nikiforov, V., and Goldfarb, A. (1994). Topology of the RNA polymerase active center probed by chimeric rifampicin-nucleotide compounds. Proc Natl Acad Sci USA 91, 12036-12040. Nehrke, K. W., and Piatt, T. (1994). A quaternary transcription termination complex. Reciprocal stabilization by Rho factor and NusG protein. J Mol Biol 243, 830-839. Nudler, E., and Gottesman, M. E. (2002). Transcription termination and anti-termination in E. coli. Genes Cells 7, 755-768. Park, J. S., Marr, M. T., and Roberts, J. W. (2002). E. coli Transcription repair coupling factor (Mfd protein) rescues arrested complexes by promoting forward translocation. Cell 109, 757-767. Paul, B. J., Barker, M. M., Ross, W, Schneider, D. A., Webb, C , Foster, J. W, and Course, R. L. (2004a). DksA: a critical

Chapter 34 Transcription Control in Bacteria component of the transcription initiation machinery that potentiates the regulation of rRNA promoters by ppGpp and the initiating NTR Cell 118, 311-322. Paul, B. J., Ross, W., Gaal, T., and Course, R. L. (2004b). rRNA transcription in Escherichia colt Annu Rev Genet 38, 749-770. Pazin, M. J., and Kadonaga, J. T. (1997). SWI2/SNF2 and related proteins: ATP-driven motors that disrupt protein-DNA interactions? Cell 88, 737-740. Peterson, C. L. (1996). Multiple Switches to turn on chromatin? Curr Opin Genet Dev 5, 171 -175. Pettijohn, D. E. (1996). The nucleoid. In Escherichia coli and Salmonella Typhimurium, F. Neidhardt, ed. (Washington, D. C , American Society for Microbiology), pp. 158. Piatt, T. (1994). Rho and RNA: models for recognition and response. Mol Microbiol 77, 983-990. Pressler, U., Staudenmaier, H., Zimmermann, L., and Braun, V. (1988). Genetics of the iron dicitrate transport system of Escherichia coli J Bacteriol 770, 2716-2724. Qi, R, and Tumbough, C. L., Jr. (1995). Regulation of codBA operon expression in Escherichia coli by UTP-dependent reiterative transcription and UTP-sensitive transcriptional start site switching. J Mol Biol 254, 552-565. Rabussay, D., and ZilHg, W. (1969). A rifampicin resistent ma-polymerase from E. coli altered in the beta-subunit. FEBS Lett 5, 104-106. Ramaswamy, S., and Musser, J. M. (1998). Molecular genetic basis of antimicrobial agent resistance in Mycobacterium tuberculosis: 1998 update. Tuber Lung Dis 79, 3-29. Rees, W A., Weitzel, S. E., Yager, T. D., Das, A., and von Hippel, P. H. (1996). Bacteriophage lambda N protein alone can induce transcription antitermination in vitro. Proc Natl Acad Sci USA 93, 342-346. Richardson, J. P. (2002). Rho-dependent termination and ATPases in transcript termination. Biochim Biophys Acta 1577, 251-260. Richardson, J. P. (2003). Loading Rho to terminate transcription. Cell 77^157-159. Roberts, J., and Park, J. S. (2004). Mfd, the bacterial transcription repair coupling factor: translocation, repair and termination. Curr Opin Microbiol 7, 120-125. Roberts, J. W, Yamell, W, Bartlett, E., Guo, J., Marr, M., Ko, D. C , Sun, H., and Roberts, C. W (1998). Antitermination by bacteriophage lambda Q protein. Cold Spring Harb Symp Quant BioUi, 319-325. Robinow, C , and Kellenberger, E. (1994). The bacterial nucleoid revisited. Microbiol Rev 58, 211-232. Ross, W, Gosink, K. K., Salomon, J., Igarashi, K., Zou, C , Ishihama, A., Severinov, K., and Course, R. L. (1993). A third recognition element in bacterial promoters: DNA binding by the alpha subunit of RNA polymerase. Science 262, 1407-1413. Saecker, R. M., Tsodikov, O. V., McQuade, K. L., Schlax, R E., Jr., Capp, M. W., and Record, M. T., Jr. (2002). Kinetic studies and structural models of the association of E. coli sigma(70)

563

RNA polymerase with the lambdaP(R) promoter: large scale conformational changes in forming the kinetically significant intermediates. J Mol Biol 319, 649-671. Saier, M. H., Jr. (1998). Multiple mechanisms controlling carbon metaboHsm in bacteria. Biotechnol Bioeng 58, 170-174. Savery, N., Rhodius, V., and Busby, S. (1996). Protein-protein interactions during transcription activation: the case of the Escherichia coli cyclic AMP receptor protein. Philos Trans R Soc Lond B Biol Sci 351, 543-550. Schroder, O., and Wagner, R. (2000). The bacterial DNA-binding protein H-NS represses ribosomal RNA transcription by trapping RNA polymerase in the initiation complex. J Mol Biol 298, 11>1-1A%.

Selby, C. P., and Sancar, A. (1993). Molecular mechanism of transcription-repair coupling. Science 260, 53-58. Severinov, K., Markov, D., Severinova, E., Nikiforov, V., Landick, R., Darst, S. A., and Goldfarb, A. (1995). Streptolydigin-resistant mutants in an evolutionarily conserved region of the beta' subunit of Escherichia coli RNA polymerase. J Biol Chem 270, Severinov, K., Soushko, M., Goldfarb, A., and Nikiforov, V. (1993). Rifampicin region revisited. New rifampicin-resistant and streptolydigin-resistant mutants in the beta subunit oiEscherichia coli RNA polymerase. J Biol Chem 268, 14820-14825. Shimamoto, N., Kamigochi, T., and Utiyama, H. (1986). Release of the sigma subunit of Escherichia coli DNA-dependent RNA polymerase depends mainly on time elapsed after the start of initiation, not on length of product RNA. J Biol Chem 261, 11859-11865. Shuman, H. A., and Silhavy, T. J. (2003). The art and design of genetic screens: Escherichia coll Nat Rev Genet 4, 419-431. Squires, C. L., Condon, C , and Seoh, H. K. (2003). Assay of antitermination of ribosomal RNA transcription. Methods EnzymoU77, 472-487. Squires, C. L., Greenblatt, J., Li, J., and Condon, C. (1993). Ribosomal RNA antitermination in vitro: requirement for Nus factors and one or more unidentified cellular components. Proc Natl Acad Sci USA 90, 91^-91 \. Stefano, J. E., and Gralla, J. D. (1982). Spacer mutations in the lac ps promoter. Proc Natl Acad Sci USA 79, 1069-1072. Straus, D., Walter, W., and Gross, C. A. (1990). DnaK, DnaJ, and GrpE heat shock proteins negatively regulate heat shock gene expression by controlling the synthesis and stability of sigma 32. Genes Dev 4, rmi-lim. Sukhodolets, M. V., Cabrera, J. E., Zhi, H., and Jin, D. J. (2001). RapA, a bacterial homolog of SWI2/SNF2, stimulates RNA polymerase recycling in transcription. Genes Dev 15, 3330-3341. Sukhodolets, M. V., and Jin, D. J. (1998). RapA, a novel RNA polymerase-associated protein, is a bacterial homolog of SWI2/SNF2. J Biol Chem 273, 7018-7023. Sweetser, D., Nonet, M., and Young, R. A. (1987). Prokaryotic and eukaryotic RNA polymerases have homologous core subunits.

564'

Section V

Proc Natl Acad Sci USA 84, 1192-1196. Toulme, R, Mosrin-Huaman, C , Sparkowski, J., Das, A., Leng, M., and Rahmouni, A. R. (2000). GreA and GreB proteins revive backtracked RNA polymerase in vivo by promoting transcript trimming. EMBO J 19, 6853-6859. Travers, A., Schneider, R., and Muskhelishvili, G. (2001). DNA supercoiling and transcription in Escherichia colv. The FIS connection. Biochimie 53, 213-217. Tse-Dinh, Y. C, Qi, H., and Menzel, R. (1997). DNA supercoiling and bacterial adaptation: thermotolerance and thermoresistance. Trends Microbiol 5, 323-326. Vassylyev, D. G., Sekine, S., Laptenko, O., Lee, J., Vassylyeva, M. N., Borukhov, S., and Yokoyama, S. (2002). Crystal structure of a bacterial RNA polymerase holoenzyme at 2.6 A resolution. Nature ^77, 712-719. von Hippel, R H. (1998). An integrated model of the transcription complex in elongation, termination, and editing. Science 281, 660-665. von Hippel, R H., Rees, W. A., Rippe, K., and Wilson, K. S. (1996). Specificity mechanisms in the control of transcription. Biophys ChemJP, 231-246. Walstrom, K. M., Dozono, J. M., and von Hippel, R H. (1997). Kinetics of the RNA-DNA helicase activity of Escherichia coli transcription termination factor rho. 2. Processivity, ATP consumption, and RNA binding. Biochemistry 36, 7993-8004. Weisberg, R. A., and Gottesman, M. E. (1999). Processive antitermination. J Bacteriol 181, 359-367. Wu, H. Y, Shyy, S. H., Wang, J. C , and Liu, L. R (1988). Transcription generates positively and negatively supercoiled domains in the template. Cell 53, 433-440. Xu, M., Zhou, Y N., Goldstein, B. R, and Jin, D. J. (2005). Cross-resistance of Escherichia coli RNA polymerases conferring rifampin resistance to different antibiotics. J Bacteriol 187, 2783-2792. Yang, X., and Price, C. W. (1995). Streptolydigin resistance can

Special Topics be conferred by alterations to either the beta or beta' subunits of Bacillus subtilis RNA polymerase. J Biol Chem 270, 23930-23933. Yanofsky, C. (2000). Transcription attenuation: once viewed as a novel regulatory strategy. J Bacteriol 182, 1-8. Young, B. A., Gruber, T. M., and Gross, C. A. (2002). Views of transcription initiation. Cell 109, 417-420. Zhang, G., Campbell, E. A., Minakhin, L., Richter, C , Severinov, K., and Darst, S. A. (1999). Crystal structure of Thermus aquaticus core RNA polymerase at 3.3 A resolution. Cell 98, 811-824. Zhi, H., Wang, X., Cabrera, J. E., Johnson, R. C , and Jin, D. J. (2003a). Fis stabilizes the interaction between RNA polymerase and the ribosomal promoter rmB PI, leading to transcriptional activation. J Biol Chem 278, 47340-47349. Zhi, H., Yang, W, and Jin, D. J. (2003b). Escherichia coli proteins eluted from mono Q chromatography, a final step during RNA polymerase purification procedure. Methods Enzymol 370, 291-300. Zhou, Y, Gottesman, S., Hoskins, J. R., Maurizi, M. R., and Wickner, S. (2001). The RssB response regulator directly targets sigma(S) for degradation by ClpXP. Genes Dev 15, 627-637. Zhou, Y N., and Jin, D. J. (1998). The rpoB mutants destabilizing initiation complexes at stringently controlled promoters behave like "stringent" RNA polymerases in Escherichia coli. Proc Natl Acad Sci USA 95,2908-2913. Zhou, Y N., Walter, W A., and Gross, C. A. (1992). A mutant sigma 32 with a small deletion in conserved region 3 of sigma has reduced affinity for core RNA polymerase. J Bacteriol 174, 5005-5012. Zurawski, G., Elseviers, D., StauflFer, G. V, and Yanofsky, C. (1978). Translational control of transcription termination at the attenuator of the Escherichia coli tryptophan operon. Proc Natl Acad Sci USA 75, 5988-5992.

Chapter 35 Gene Therapy: Back to the Basics JimHu Programme in Lung Biology Research, Hospital for Sick Children, Departments of Laboratory Medicine and Pathobiology, and Paediatrics, University of Toronto, Toronto, Ontario, Canada

Key Words: gene delivery, transgene expression, airway disease, viral vector, host immune responses, gene therapy, adenoviruses, helper-dependent adenoviral vector, adeno-associated virus, cystic fibrosis, retroviruses, X-linked severe combined immunodeficiency disease, adenosine deaminase-deficient severe combined immunodeficiency, innate (page 559), adaptive, inflammation, macrophages, proinflammatory cytokines, NF-kappaB signaling pathway, DNA regulatory elements

Summary The concept of gene therapy evolved from the knowledge gained in modem molecular genetics. Following the establishment of the "central dogma" of gene expression—that DNA begets RNA begets protein, it was natural to imagine that a human genetic defect could be cured by delivering the correct gene to the affected cells. Therefore, it is fair to state that modem molecular genetics is the foremnner to gene therapy. Over the past few decades biologists have shown that phenotypical changes resulted from mutations in a prokaryotic (e.g., E. coli) or eukaryotic (e.g., yeast) gene can be corrected by delivering a copy of the correct gene to the mutant cells. Hence, gene therapy is indeed conceptually sound. The technical difficulty for gene therapy in humans, however, was initially underestimated and successful examples of clinical trials are still rare. As a result, the initial hype of gene therapy led to the great disappointment for the public. This also led to some scientists and joumal editors to look for major breakthroughs and ignore the incremental progress in the field. In this chapter, I shall review the major advancements over the past two decades and.

using lung gene therapy as an example, discuss the current obstacles and possible solutions to provide a roadmap for future research on gene therapy. Introduction The potential of gene therapy in medical applications was recognized soon after the discovery of DNA as genetic material and of genetic information flow (fi-om DNA to RNA to protein). The early history of gene therapy was extensively reviewed by Wolff and Lederberg (1994) and I shall only highlight a few points here prior to the discussion of vectors and approaches used in gene therapy. Actually, attempts at human gene therapy were initiated in the late 1960s and early 1970s when S. Rogers injected the Shope papilloma vims into patients with arginase deficiency, based on his initial observation that the vims induced high levels of arginase activity in rabbit skin tumors and might contain an arginase gene (Rogers and Moore, 1963). Although the attempt eventually tumed out to be unsuccessful (Terheggen et al, 1975), it demonstrated the early enthusiasm in gene therapy. Due to the lack of basic understanding of gene expression and effective methods for gene delivery, the early attempts at gene therapy were doomed to fail. Gene therapy research intensified during the last 15 years following development of various gene delivery methods. Over this period, discoveries were made in recognizing problems associated with in vivo gene delivery, including physical barriers and host immune reactions and a lack of sustained expression of transgenes (George, 2003; Koehler et al, 2001). In addition, there were quite a number of successfiil gene transfer examples performed in animals (Barquinero et al, 2004; Ferrari et ah, 2004; George, 2003; Kaplan et

Corresponding Author: Tel: (416) 813-6412, Fax: (416) 813-5771, E-mail: [email protected]

566

Section V

al, 1998; Kim et aL, 2001; Koehler et al., 2003; Toietta et ai, 2003; Wang et aL, 2000; Wang et al, 2005) although successfiil human studies remain scarce (Aiuti et aL, 2002; Cavazzana-Calvo et al, 2000; Caspar et al., 2004). The slow progress in clinical applications brought much disappointment to the public, and a single case of gene therapy-related death in 1999 (NIH Report, 2003, Hum. Gene Then 13:3-9) (Raper et ai, 2003; Raper et al., 2002) further dampened the enthusiasm in the field and raised concerns of safety of gene therapy. Over the past few years, major efforts in gene therapy were directed toward understanding the problems associated with gene delivery, such as acute toxicity associated with adenoviral vectors (Morral et al, 2002), further improving gene therapy vectors (Barquinero et al, 2004; Koehler et ai, 2001; Parks, 2000) and exploring experimental conditions for enhancing the efficiency of gene delivery (Glimm and Eaves, 1999; Hennemann et al, 1999; Limberis et al, 2002). In the next part of this chapter, I shall briefly describe vectors commonly used for gene delivery to animal models and to humans, followed by discussing the current problems associated with gene therapy. Vectors for Gene Therapy There are two general approaches being employed in gene therapy based on vectors used for gene delivery. One approach employs recombinant viruses to deliver genes and the other uses non-viral vectors. In general, viral vector-mediated gene transfer is more efficient than the non-viral approach, but some vectors elicit stronger immune responses. Among the viral vectors developed for in vivo gene delivery, I shall briefly describe the vectors derived from adenovirus (Ad), adeno-associated virus (AAV), and retrovirus since these vectors have been used in clinical trials. Progress has also been made in vectors derived from other viruses, such as herpes simplex virus (Glorioso et al, 1994) and Sendai virus (the murine parainfluenza virus type 1) (Ferrari et al, 2004). Due to the space limitation, however, these vectors will not be covered in this chapter. Among the non-viral vectors, only cationic liposomes were extensively explored and these will be discussed. A: Viral Vectors Al: Adenoviral Vectors Adenoviruses contain a linear double-stranded DNA packaged in an icosahedral, non-enveloped capsid with fiber-like projections from each of the 12 vertices (Kojaoghlanian et al, 2003). In addition to the fiber, the

Special Topics

other two major types of capsid proteins are the hexon that forms each geometric face of the capsid and the penton base that anchors the fiber. There are at least 51 human Ad serotypes that are classified into six subgroups (A-F) according to various properties (Kojaoghlanian et al, 2003). Members in subgroup C, such as Ad2 and Ad5, are non-oncogenic and predominantly used as vectors for gene delivery (Cao et al, 2004). The viral genome, which is about 36 kb, is experimentally divided into early and late regions based on whether genes in a region are expressed before or after DNA replication. Early regions, Ela and Elb, contain genes encoding proteins for trans-activating other viral genes or regulating the host's cell cycle, and E2 harbors genes for viral DNA replication, while E3 and E4 genes play roles in modulating host immune responses (Kojaoghlanian et al, 2003) or inhibiting host cell apoptosis (Jomot^^ al, 2001). The late genes encode proteins for either the viral capsid or gene regulation (Cao et al, 2004). Cellular receptors are required for efficient transduction by Ad. The coxsackie-adenovirus receptor (CAR) is the primary receptor, and the avPs and avps integrins are the secondary receptors for Ad to gain entry into a host cell (Parks, 2000). Infection initiates via attachment of the fiber knob to the CAR and subsequent binding of the penton base proteins to the integrin receptors, which allows a virus to enter the cell via receptor-mediated endocytosis. Ads can also enter cells through CAR-independent transduction, via heparin sulfate glycosoaminoglycans (Smith et al, 2002). Following endocytosis, the virus escapes from the endosome through the lysis of the endosomal membrane and enters the nuclear pore complex via microtubule-mediated translocation. For a wild type Ad, transcription and replication begin upon entering the nucleus. During a lytic life cycle, viral DNA is packaged into virions by self-assembly of the capsid proteins and the viruses are then released following the death of the host cell (Cao et al, 2004). For gene replacement therapy, however, replication-defective Ads are used and these viruses do not go through the lytic life cycle or cause the death of host cells. Ad DNA does not integrate into the genome of the host cell and therefore, poses virtually no risk of insertional mutagenesis to the host cell. Unlike plasmids, the Ad genome is highly stable in transduced cells, making it attractive to be used for gene delivery (Benihoud et al, 1999; Ehrhardt etal, 2003; Hillgenberg et al, 2001). Adenoviruses have been widely used as tools for gene delivery also because of their ability to infect both dividing and non-dividing cells with high efficiency and to produce high-titre of viral particles in cultured cells

Chapter 35

Gene Therapy: Back to the Basics

(Cao et al, 2004; Parks, 2000). The early Ad vectors were developed by deleting the El region that is required for viral DNA replication, and the El function was provided in trans by cells used for viral propagation. Ad vectors with El deleted can carry only 4 kb foreign DNA. To increase the cloning capacity, other Ad vectors were developed by deleting more than one early region (Parks, 2000). These Ad vectors have been used in a variety of experiments on gene transfer in vitro and in vzvo. Phase I gene therapy trials with the first generation of Ad vectors in patients with cystic fibrosis (CF) concluded that the level of gene transfer and expression is too low to achieve clinical benefits. CF is the most common monogenic fatal disorder in the Caucasian population and it is caused by recessive mutations in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR) (Rommens et al, 1989). CFTR is a cAMP-regulated chloride channel, and defective or absent CFTR in epithehal cells of many internal organs of CF patients, including the lung, pancreas, intestine, gall bladder, and reproductive organs, results in salt and water imbalance across the epithelium (Boucher, 1994; Tsui, 1995; Welsh et al, 1995). Although the disease affects multiple organs, lung failure due to chronic infection and inflammation is currently responsible for most morbidity and mortality (Koehler et al, 2001). Therefore, CF gene therapy studies to date have been aimed at treating the pulmonary manifestations. An early trial (Zabner et ah, 1993) showed adenoviral transfer of CFTR to human nasal epithelium, with correction of nasal transmembrane potential differences (PD). But this gene transfer was correlated with injury caused by the application device, similar results were reported later by Grubb et al (Grubb et al, 1994). It was confirmed (Knowles et al, 1995) that there is no functional correction of nasal PD in patients resulting from adenoviral CFTR transfer in the absence of injury of the epithelium. Several other studies with Ad vectors showed CFTR gene transfer, but none demonstrated sustained CFTR expression (Bellon et al, 1997; Crystal et al, 1994; Harvey et al, 1999; Joseph et al, 2001; McElvaney and Crystal, 1995; Perriconee^a/., 2001). The human studies mentioned above as well as experiments with animals (Dai et al, 1995; Wilson et al, 1998; Yang et al, 1996; Yang et al, 1995) showed that recombinant Ad vectors delivered to the airways or to the circulation system intravenously induce potent host immune responses that limits both stable transgene expression and the possibility for vector readministration (Wivel et al, 1999). These strong

567

anti-vector responses are largely attributed to viral particles in the inoculum (Kafri et al, 1998; McCoy et al, 1995) and the expression of viral proteins in transduced cells (Wivel et al, 1999). The transgene product itself, particularly when derived fi*om a species different from the host, can also contribute to host immune responses if it is foreign to the host (Michou et al, 1997; O'Neal et al, 2000; Tripathy et al, 1996). This subject will be discussed further. To improve Ad vectors, the helper-dependent (or gutted) adenoviral (HD-Ad) vector was developed by deleting all the viral coding sequences, leaving only the viral inverted terminal repeats (ITRs) and packaging signal. The deletion of viral coding sequences indeed reduces host adaptive immune responses (Parks, 2000) and prolongs transgene expression (Kim et al, 2001; Morsy et al, 1998; Toietta et al, 2003) in addition to the expansion of the cloning capacity to -36 kb. Because HD-Ad vectors have the same capsid proteins, host immune responses to the vectors are still present (Brunetti-Pierri et al, 2004; Morral et al, 2002). However, since non-capsid proteins encoded by Ad (Schaack et al, 2004) can cause inflammation, the innate immune response to HD-Ad vectors is attenuated as demonstrated in gene transfer studies in mice (Kim et al, 2001; Morsy et al, 1998; Toietta et al, 2003). For HD-Ad vector propagation, a helper-virus is required to provide functions for DNA replication and assembly of the virions (Parks, 2000). One past problem in using the HD-Ad vector in clinical studies was the difficulty in large-scale production (Cao et al, 2004). This problem has recently been solved by Ng's group by using a new helper virus and 293 cells capable of growing in liquid suspension (Palmer and Ng, 2003). Although HD-Ad vectors have been shown to be superior to the early generation of Ad vectors, they have not been tested clinically due to the safety concern raised with the conventional Ad vectors (Raper et al, 2003). Since no viral gene expression from the HD-Ad vector, however, transient pharmacological immune modulation and antiinflammation intervention may be used to control the acute toxicity caused by the capsid proteins. A2: Adeno-associated Viral Vectors Recombinant adeno-associated virus (rAAV) vectors are another major type of viral vectors currently used in gene therapy studies (Tal, 2000). AAV is a replication-defective parvovirus that depends on a helper virus, either adenovirus or herpes virus, for its propagation during lytic infection (Bems and Giraud, 1996). AAV has a very small (about 4.7 kb) singlestranded DNA genome (Carter, 2004), including 145 bp

568

Section V

ITRs that are the only sequences required for vector construction. The AAV genome encodes three viral capsid proteins (VPl, VP2, and VP3), Rep68/78 proteins that bind to the ITRs and mediate its integration into the host chromosome (Carter, 2004), and Rep52/40 proteins whose functions are not clear (Tal, 2000). Therefore, rAAV vectors are essentially helper-dependent viral vectors retaining only the ITRs. All the capsid and Rep proteins are provided in trans by either a helper virus or sequences integrated into the host genome during vector propagation. The small cloning capacity (4.5 kb) is a disadvantage of AAV vectors because it limits their utilization for therapeutic genes with coding sequences longer than 4.5 kb and with little room for inclusion of DNA regulatory elements even for smaller genes. AAV uses heparan sulfate proteoglycan as receptor to gain entry into host cells via endocytosis (Summerford and Samulski, 1998) and it can transduce both dividing and non-dividing cells. The viral genome can integrate into a host chromosome or stay episomally in the cell, however the frequency of integration is very low (Hargrove et al, 1997). In nondividing cells, AAV vectors stay episomally as head to tail concatemers (Schnepp et a/., 2003). While the wild type AAV integrates specifically at the AAVSl site on human chromosome 19 (Kotin et al, 1990), rAAV vectors integrate randomly (Keams et al, 1996) at a much lower frequency than previously believed (Carter, 2004). Although AAV can transduce a broad spectrum of cell types, a very high ratio of viral particles is required to transduce target cells. This may be partially due to the low levels of receptor present on the cell surface, for AAV integration or gene expression, the single- stranded DNA genome has to be converted into double-stranded and this could also be a rate-limiting step especially in nondividing cells or primary cultured cells (Tal, 2000). There are 8 serotypes of AAV identified (AAVl to AAV8) and some of them show difference in tissue-tropism (Gao et aL, 2002). For example, AAV6 (Blankinship et aL, 2004) and AAV8 (Gao et aL, 2002; Wang et aL, 2005) transduce muscle cells very efficiently. In addition, levels of neutralizing antibodies against them are different; Sera from humans show little neutralizing activity to AAV7 and AAV8. Since the viral capsid proteins can be exchanged, a desired serotype can be selected during vector production to maximize the efficiency of gene delivery to a particular tissue. Serotype-switching can also be used to minimize neutralizing antibodies during vector readministration. Since the cloning capacity of rAAV is limited, inclusion of extra promoter/enhancer elements for better transgene expression would further reduce the capacity.

Special Topics

This problem can be minimized by reducing the size of a therapeutic gene. One example was the construction of an AAV vector for expression of a minedystrophin gene for gene therapy against Duchenne muscular dystrophy (DMD) (Wang et aL, 2000). DMD is an X-linked, fatal genetic muscle disease affecting 1 of every 3,500 males bom and the progressive muscle degeneration leads to death of patients by their early twenties. The dystrophin gene spans nearly 3 million bp on the X-chromosome (Koenig et aL, 1987) and it produces a mRNA of 14 kb. Wang et aL created a 4.2 kb minidystrophin gene and cloned it into an AAV vector containing a muscle-specific creatine kinase (MCK) promoter. They showed that this vector effectively ameliorates muscular dystrophy in the mdx mouse model (Wang et aL, 2000). The other example was the development of an AAV vector expressing a mini version of the CFTR gene (Siminger et aL, 2004). Since viral promoters are often attenuated or silenced (this subject will be addressed later in this chapter), authors used the beta-actin promoter plus an enhancer from the cytomegalovirus (CMV) to drive a CFTR minigene. In addition to the utilization of minigenes, trans-splicing has been explored to expand the cloning capacity of AAV vectors. The process of trans-splicing was initially discovered in Trypanosoma brucei 23 years ago when different surface glycoprotein mRNAs was found to carry a common 39-nucleotide sequence, namely, the spliced leader sequence (Boothroyd and Cross, 1982). In trans-splicing, two primary RNA transcripts are used to produce a mRNA by the RNA splicing machinery and this subject was recently reviewed (Liang et aL, 2003). Two AAV vectors can be used to produce two half transcripts for a therapeutic gene and the transcripts can be trans-spliced in cells to produce a functional mRNA (Duan et aL, 2001; Pergolizzi and Crystal, 2004; Reich ^^ a/., 2003; Yan^/a/., 2000). Clinical studies with rAAV vectors for CF gene therapy have yielded mixed results. The major advantage of these vectors is that they are less immunogenic than Ad vectors (Wagner et aL, 1999a), but since the AAV vector used in this study contains only the promoter in the ITR sequence to drive CFTR expression, limited gene expression was detected when the maxillary sinus of CF patients was used as a delivery test site (Wagner et aL, 1999b). The first multi-dose inhalation trial in CF patients demonstrated safety and a transient improvement of lung function (Moss et aL, 2004). Clinical studies in other organ systems also showed gene transfer and expression (Tal, 2000); major breakthroughs using A W vectors in clinical studies remain to be achieved. The recent discovery of AAV8 being able to cross blood

Chapter 35

Gene Therapy: Back to the Basics

vessel barriers efficiently transducing skeletal and heart muscles (Wang et al, 2005) will facilitate the utilization of AAV vectors in clinical applications. A3: Retroviral Vectors Retroviral vectors are based on retroviruses that comprise a large class of enveloped viruses that contain two identical single-stranded RNAs (7-11 kb) as the viral genome. The retroviridae family consists of seven genera: alpharetrovirus, betaretrovirus, gammaretrovirus deltar etrovirus, epsilonretrovirus, lentivirus, and spumavims (Pringle, 1999). The first five genera were also known as oncoretrovimses, and the first retroviral vector was developed based on a gammaretrovirus, Moloney murine leukemia virus (MoMLV). Retroviral vectors were also developed based on lentivirus (Copreni et al, 2004) although traditionally only vectors based on oncoretrovimses were referred as retroviral vectors. The retroviral genome contains three genes (gag coding for the group specific antigens or core protein, pol for reverse transcriptase and env for viral envelope protein), two long terminal repeats (LTRs) and a sequence required for packaging viral RNA during viral propagation. During the infection, the retroviral envelope protein interacts with a cell surface receptor to gain entry into the host cell. Different viruses use different receptors. For example, MoMLV uses a sodium-dependent phosphate transporter as its receptor while lentivirus uses CD4 as its primary receptor (Overbaugh et ah, 2001). Upon entering a host cell, the RNA genome is reversetranscribed into double- stranded DNA that binds to cellular proteins to form a nucleoprotein preintegration complex (PIC) that migrates to the nucleus and integrates into the host genome. The nuclear membrane, however, can be a barrier for some retroviruses. For instance, the PICs of MoMLV cannot cross the membrane and require a mitotic cycle to disrupt the nuclear membrane for the viral genome to reach the nucleus (Barquinero et ah, 2004). Therefore MoMLV cannot transduce non- dividing cells. On the other hand, lentiviral vectors based on human immunodeficiency virus-1 (HIV-1) do not have this limitation and thus can transduce nondividing cells (Barquinero et ai, 2004). For development of retroviral vectors, only the 5' and 3' LTRs as well as the packaging signal sequence are required for the vector DNA, while the functions of gag, pol and env are provided by host cells used for viral propagation. Over the years, there were several types of improvements made for the retroviral vectors. The first type was the improvement in transgene expression. This was done by using LTR variants for transgene expression in certain cell types (Smith, 1995)

569'

and engineering regulatory regions to enhance transgene expression or reduce transcriptional silencing in specific target cells (Barquinero et ah, 2004). Hybrid retroviral vectors with improved expression in hematopoietic cells were developed using sequences from the murine embryonic stem cell virus and the Friend mink cell focus-forming virus or the myeloproliferative sarcoma virus (Baum et al, 1995). Challita et al (1995) increased transgene expression and decreased DNA methylation of retroviral vectors by introducing multiple changes in the LTRs. General principles regarding mechanisms of transcriptional regulation and DNA methylation are extensively reviewed elsewhere in this book and readers are encouraged to visit other chapters. The second type of improvements was the utilization of alternative envelope proteins, a technique called pseudotyping. For example, many hematopoietic cells express higher levels of Glvrl, the receptor for the gibbon ape leukemia virus (GALV), than that of Ram 1 the receptor for amphotropic vectors (Bauer et al, 1995), and GALV-pseudotyped vector particles are more efficient at transducing primate repopulating hematopoietic stem cells than conventional amphotropic vector particles. Another example is the feline endogenous retrovirus (RD114)-pseudotyped vector particles that were shown to be more efficient in transduction of cord blood cells than amphotropic vector particles (van der Loo et al, 2002). In addition, although the vesicular stomatitis virus-G (VSV-G)-pseudotyped oncoretroviral vector particles did not show enhancement in transducing primitive primate hematopoietic cells, (Evans et al, 1999), VSV-G- pseudotyped lentiviral vectors could be useful for gene delivery to other cell types such as airway epithelial cells (Copreni et al, 2004; Sinn et al, 2003). VSV-G is a fusogenic protein that interacts with membrane phospholipids to facilitate transduction, and VSV-G- pseudotyped vector particles are more stable (Yam e^ a/., 1998). The third type of improvement in retroviral design was the development of self-inactivating (SIN) vectors. A deletion of 229 bp in the 3' LTR eliminated the enhancer and promoter present in the LTR (Yu et al, 1986). During the reverse transcription, the deletion was transferred to the 5' LTR, resulting in a vector without viral promoters or enhancers. The absence of the viral promoter and enhancer minimizes the risk of activation of oncogenes as a result of integration and allows transgene expression under the control of desired promoter/enhancer sequences. The most important improvement needed right now is to design a vector that can be safely and specifically integrated at a chromosomal site that allows efficient therapeutic gene expression.

570'

Section V

Special Topics

In addition to the improvements made in retroviral vector development, other strategies have also been used to enhance the retroviral gene delivery. Since retroviral vectors have been heavily used for ex vivo gene therapy to target hematopoietic stem cells, several techniques were developed to enhance their transduction efficiency. The first strategy was to use cytokines to mobilize the primitive stem cells to peripheral blood and to improve the susceptibility of the cells to retroviral transduction. It was shown that in mice and monkeys, treatment of donor animals with granulocyte colony-stimulating factor (G-CSF) and stem cell factor (SCF) increased the number of CD34^ cells targeted for gene transfer in both peripheral blood and bone marrow, and these cells could be more efficiently transduced (Bodine et al., 1996; Dunbar et al, 1996). The second strategy was to use cytokines to induce the primitive human hematopoietic cells to divide, therefore enhancing the retroviral transduction efficiency while maintaining the hematopoietic potential. Primitive human hematopoietic cells could be stimulated to undergo self- renewal while retaining repopulating potential when SCF and Flt-3 ligand were used in combination with IL-3, IL-6, and G-CSF (Glimm and Eaves, 1999). These stimulated cells could be transduced more efficiently (Veena et al, 1998). The third strategy was to use fibronectin fi*agments to enhance retroviral transduction efficiency (Hanenberg et aL, 1996; Moritz et al., 1994). Fibronectin fragments bind both vector particles and target cells and therefore may facilitate the uptake of vector particles by the cells (Moritz et al., 1996). Until now, three human gene therapy studies successfully brought clinical benefits to patients and all these trials were conducted by using retroviral vectors. The first trial was reported (Cavazzana-Calvo et al, 2000) in the treatment of children with X-linked severe combined immunodeficiency disease (SCID-Xl). The patients have a defective gene encoding the common gamma chain (yc) of receptors for IL-2, -4, -7, -9, -15 and -21, which leads to the absence of functional B, T and NK cells, and they die at very early age. Ten patients were treated by reinfusion of their own CD34+ bone marrow cells transduced with a retroviral vector expressing the wild-type yc gene in the absence of any myelosuppression. Myelosuppression means a decrease in number of blood cells produced fi-om the bone marrow following a pharmacological intervention or under a diseased situation. Nine of ten patients showed almost normal levels of T-cell counts and significantly improved immune function. Despite the insertional mutagenesis resulting in activation of the T-cell protooncogene LMO-2 in two patients (Hacein-Bey-Abina et

al, 2003), this clinical trial was the first milestone to mark the feasibility of using gene therapy to cure a human disease. The second successful clinical trial was conducted in two children with adenosine deaminasedeficient severe combined immunodeficiency (ADASCID) (Aiuti et al, 2002). In ADA-SCID patients, the accumulation of purine metabolites toxic primarily to T cells leads to the immunodeficiency. Autologous CD34+ cells fi*om patients were transduced with a retroviral vector (GIADAl), and four days later, reinfused into the patients who received two doses of busulfan (2 mg/kg/ per day) for transient myelosuppression prior to the reinfusion. During the follow-up for more than one year, two patients were in good clinical conditions and did not experience any severe infectious episodes. The third case was reported in UK (Caspar et al, 2004) on four SCID-Xl patients who received treatment similar to that reported in the first case (Cavazzana-Calvo et al, 2000). B: Nonviral Vectors Nonviral methods for gene delivery have also been extensively explored over the past two decades in searching for altematives safer than viral gene delivery. Liposomes are the most studied types pf nonviral vectors. Based on their charge, liposomes can be classified into two classes, positively charged or cationic liposomes and negatively charged or pH-sensitive liposomes (Singhal and Huang, 1994). Cationic liposomes are commonly used for gene delivery and many types of formulations are available. They are made up of a cationic lipid and a neutral lipid, often dioleoylphosphatidylethanolamine (DOPE) or cholestrol. There are many types of cationic lipids that have been tested in gene delivery studies, such as 3P(N(N', N'-dimethylaminoethane) carbamoyl)-cholesterol (DCchol), 1,2-dioleoyloxy-3-(trimethylammonio) propane (DOTAP), and N-(2,3-(dioleoyloxy)propyl)-N,N,Ntrimethyl ammonium chloride (DOTMA). Detailed information regarding various cationic liposomes was covered by Gao and Huang (1995). Negatively charged or pH-sensitive liposomes contain DOPE and another lipid, such as palmitoylhomocysteine or free fatty acids. They fuse with other lipid bilayers at low pH and can be used to deliver molecules to cytoplasm. This type of liposomes was less frequently used for gene delivery (Singhal and Huang, 1994). Although liposomes have been commonly used for delivery of DNA to cultured cells, their potential for in vivo gene delivery remains to be shown. Other types of non-viral formulations, such as those using polyethyleneimine (PEI) or polylysine, were also studied for their gene transfer ability (Bragonzi et al, 2000; Kollen et al, 1999). They share

Chapter 35

Gene Therapy: Back to the Basics

with liposomes the same problem of inefficient gene transfer in vivo. Many clinical trials have been conducted with cationic liposomes mostly to assess the potential for treating patients with cystic fibrosis (CF). The first liposome CF trial was carried out in the noses of CF patients (DF508 mutation) using DC-Chol:DOPE complexed to CFTR cDNA (Caplen et ai, 1995). Later, several nasal trials with various formulations of liposomes were performed (Gill et ai, 1991 \ Porteous et al, 1997; Zabner et al, 1997). Although safe gene transfer and/or a statistically significant partial correction of nasal electrophysiology was reported in these trials, further improvement is needed to achieve the level of efficacy needed for CF gene therapy. A double-blind placebocontrolled nasal trial with p-ethyl- dimyristoylphosphad ityl choline (EDMPC) complexed with human CFTR cDNA concluded that this lipid-DNA complex was also relatively safe but did not produce evidence of gene transfer to the nasal epithelium by physiological or molecular measures (Noone et ai, 2000). The first clinical trial in lung was carried out with CFTR cDNA complexed with GL67 liposomes (Alton et ai, 1999). One week after nebulizing the DNA/liposome complexes into the lungs of eight subjects, seven of the eight developed mild flu-like symptoms that disappeared within 36 hours. It was found later that DNA produced in bacteria contributes to the inflammatory process. Six of eight patients showed a small change in chloride conductance towards normal values. A trial later demonstrated that even eukaryotic DNA in combination with GL67 elicits immunogenic responses in patients (Ruiz et ai, 2001). For liposomes to be used in future gene therapy, it is essential to demonstrate their ability to achieve efficient gene delivery and sustained transgene expression in animal models, that remain to be shown. Obstacles and Solutions Despite all the advancements in the development of vectors for gene delivery and a few successful gene therapy trials, fundamental problems in gene delivery and transgene expression remain to be solved before gene therapy can be used as a common practice in hospitals. Over the years, many of these problems have been identified. In the following, I shall use gene delivery to the lung airway as an example to point out the obstacles, including physical barriers to gene delivery, host immune responses and maintaining transgene expression, and to propose solutions to overcome these obstacles.

571

A: Physical Barriers to Gene Delivery The difficulty in gene delivery was initially underestimated. In fact, the term "gene medicine" may be a little misleading, because most conventional drugs can be delivered orally and/or intravenously or subcutaneously. However, genes delivered in viral vectors or complexed with liposomes have difficulty to reach target cells because of the following reasons. First, viral vectors or DNA/liposome complexes are much larger in size than conventional drugs and therefore they cannot move freely inside a body. For example, most viral vectors once entering a cell cannot get out of the cell. The wild type viruses can spread easily inside a body because they can propagate in an infected cell and cause the cell to burst which allows the progeny to infect other cells and travel to other organs if they can enter the blood circulation. However, for safety reasons, most viral vectors are replication-incompetent. Regarding in vivo migration, rAAV is the only known type that can cross the blood vessel barrier because of the relatively small size (Wang et aL, 2005). Second, "gene medicine" is biologically labile and vulnerable to host defense system. Viral vectors can be inactivated by the innate immune response or preexisting antibodies, and DNA plasmids are quickly degraded inside and outside cells if they are separated from liposomes. These issues will be discussed below in the context of airway gene delivery. The lung airway represents an attractive target for gene transfer because vectors can be delivered efficiently to the airway surface. The lung epithelium is a continuous layer of cells lining all the airways and air spaces from the trachea to alveoli, and it is composed of at least eight different cell types that have a range of functions (Spina, 1998). Lung airways provide important defense capabilities to keep infectious or harmful particles from entering the body through the respiratory system (Koehler et aL, 2001), in addition to providing a passage for air to go in and out. The surface layer of mucous-containing liquid produced fi'om epithelial goblet cells and submucosal glands can bind foreign particles that are then cleared from airways by the sweeping action of ciliated epitheUal cells (Boucher, 1999). The intercellular space of the airway epithelial cells is linked by tight junctions so that the entire epithelium forms a physical barrier keeping infectious particles from penetrating the surface layer of the airway (Boucher, 1999; Koehler et al., 2001). The airway epithelium has also been suggested to play an important role in mucosal immunoglobulin A production, through supplying cytokines responsible for B-cell isotype switch, growth and differentiation into IgA-

572

Section V

secreting plasma cells (Salvi and Holgate, 1999). Additionally, lung epithelial cells are important in maintaining ion and water homeostasis (Boucher, 1994; Boucher et al, 1986), as evident from diseases such as cystic fibrosis (Rommens et al, 1989; Tsui, 1995). The alveolar epithelial cells are mainly responsible for air exchange or producing surfactants to keep the airspace open. Macrophages are the major type of non-epithelial cells in the airway and they comprise of more than 90% of the cells present in bronchoalveolar lavage (BAL) fluids (washout fluids from airways and alveoli) (Zsengellere^a/., 2000). When genes in viral or nonviral vectors are delivered to the lung airway, they can be trapped by the layer of mucous and swept out by the mucociliary action. The transmembrane mucin MUCl as well as other sialoglycoconjugates was reported to inhibit Ad-mediated gene transfer to epithelial cells (Arcasoy et al., 1997). Consistent with these results, glycocalyx on the apical surface of polarized epithelial cells was found to act as a barrier to Ad-mediated gene transfer (Pickles et aL, 2000). The mucous layer on the surface of cultured epithelial cells was also found as a barrier to AAVmediated gene transfer (Bals et al, 1999). One strategy to overcome the problem of mucous layer barrier, as suggested by Koehler et al (Koehler et al, 2001) is to use mucolytic reagents prior to vector delivery. The second strategy is to neutralize the vector trapping sites on presumably negatively charged mucins, or glycosami noglycans. Interestingly, Kaplan et al. showed that various polycations, such as DEAE-dextran, polylysines, polybrene, protamine, and branched polyethylenimine, could enhance Ad transduction in mouse airways (Kaplan et al, 1998). These polycations are likely able to neutralize the viral vector trapping sites in the airway. The polycations with no side effects in human, such as DEAE-dextran (Pupita and Barone, 1983), may be used to reduce the viral vector particles used in gene transfer, thus decreasing host immune responses in lung gene therapy. The second physical barrier is the loss of gene therapy vectors (viral or nonviral) to lung macrophages. For example, it was demonstrated that 70% of adenoviral vectors were lost in the mouse airway within 24 h and that depletion of macrophages with liposome/ dichloromethylene-biphosphonate (CI2MDP or clodro nate) complexes resulted in a 100% increase in vector DNA recovered from the lung (Worgall et al, 1997). The mechanism of vector uptaking by macrophages is likely different from that involved in cell transduction because macrophages are hardly transduced despite they uptake Ad vectors very efficiently (Zsengeller et al.

Special Topics

2000). Since lung macrophages not only destroy gene therapy vectors, but also play a major role in the innate immune response (this will be addressed later), it is important to consider them as a problem in lung gene therapy. One strategy to minimize the problem is to transiently deplete lung macrophages. Gadolinium chloride (Singh and de la Concha-Bermejillo, 1998) or liposome-encapsulated CI2MDP (Thepen et al, 1991; Worgall et al, 1997) were used to deplete lung macrophages in animals. But, there is no such a drug identified yet for the depletion of human airway macrophages. The second strategy is to avoid macrophages. For example, when vectors delivered by aerosol, large size aerosol droplets or particles will preferentially deposit in the airway instead of alveoli where macrophages are abundant. Finally, pharmacological intervention may be used to block the macrophage fimction. It was recently reported that lung macrophages of knockout mice lacking GM-CSF expression or transcription factor PU.l activity are incapable of uptaking Ad vectors (Berclaz et al, 2002). Therefore, reagents may be developed to block the GM-CSF or PU.l prior to gene delivery. The third physical barrier is the lack of viral receptors present on the apical surface of airway epithelial cells for efficient transduction. For example, the major receptor for Ad, CAR, is expressed on the basal lateral side where the virus can not reach unless the tight junction is loosened. One strategy is to modify viral vectors so that they can recognize receptors expressed on the apical surface. This can be done by "pseudotyping" the vectors using different capsid proteins (Ad or AAV) or envelope proteins (Retrovirus) or artificially modifying these proteins so that they can recognize the receptors on the apical side (Bamette^a/., 2002). The other strategy is to use reagents to transiently break the tight junctions. For example, application of the Ca^^ chelator, EGTA to airways prior to vector delivery can enhance Ad-mediated gene transfer significantly (Chu et al, 2001). In addition, L-a-lysophosphatidylcholine (LPC) can also achieve the same effect in mice (Limberis et al, 2002), and as shown by my group, LPC can be mixed with Ad vectors for aerosol delivery to rabbit airways (Koehler et al, 2005). Finally gene therapy vectors can be lost in other ways such as degradation or inactivation by enzymes secreted to the airway surface fluid. Even delivered inside a cell, plasmid DNA can be quickly degraded by intracellular nucleases. These problems were extensively reviewed by Koehler et al in 2001 (Koehler et al, 2001).

Chapter 35

Gene Therapy: Back to the Basics

B: Immunological Barriers The immunological barriers to gene delivery can be divided into two categories, innate and adaptive immune responses. Although the adaptive immune response to viral vectors was recognized early on and investigated extensively (Dai et al, 1995; Kay et al., 1995; Yang et al, 1995), the innate immune response was greatly underestimated. This was evident from the first incidence of gene therapy related death. In September 1999, a patient who received a high dose of an Ad vector via the hepatic artery succumbed to the acute toxicity cause by the vector and the news shocked the scientific community. Post-mortem analysis confirmed that the patient suffered from systemic inflammation, biochemically detectable disseminated intravascular coagulation, and multiple organ failure within 98 hours (Raper et al,, 2003). Clearly this was the result of patient's innate immune system reacting to the high dose of the Ad vector. Bl: Innate Immune Response The innate immunity is a fast, receptor-mediated, host defense mechanism. The receptors recognize highly conserved structures, called pathogen-associated molecular patterns (PAMPs), present in microorganisms (Medzhitov and Janeway, 2000). These receptors are inherited, therefore limited in numbers, and expressed on many cell types involved in the innate immune system, especially on macrophages, dendritic cells, and B-cells. They can be ftmctionally classified into three categories: secreted, endocytic, and signaling. The secreted receptors, such as the mannan-binding lectin, fimction as opsonins by interacting with their ligands flagging the microorganisms for recognition by the complement system and phagocytes. The endocytic receptors expressed on the surface of phagocytes, such as the macrophage scavenger receptor, mediate the uptake and delivery of pathogens into lysosomes where they are destroyed (Suzuki et aL, 1997). The pathogenderived peptides are then presented by majorhistocompatibility-complex (MHC) molecules on the surface of macrophages. The signaling receptors, such as Toll-like receptors, interact with their ligands and activate signal-transduction pathways for expression of a variety of cytokines. For airway gene delivery, lung macrophages are the major cell type involved in the initial innate immune response. Macrophages not only uptake gene therapy vectors and destroy them, but also initiate the production of proinflammatory cytokines. For example, TNF-a, IL-6, MIP-2, and MlP-la were dramatically induced in macrophages, not in other cell types, upon Ad vector

573

delivery to mouse airways within 6 hours (Zsengeller et al., 2000). The proinflammatory cytokines released from macrophages can affect other cells in the lung as well as macrophages themselves leading to a cytokine cascade, which could lead to airway damage, if the host can not shut down the cascade. One of the important pathways involved in the induction of inflammatory cytokines is the NF-KB signaling pathway (Baldwin, 1996). Details of the NF-KB signaling pathway have been described elsewhere in this book. A variety of inflammatory cytokines, such as IL-6 and IL-8, can be induced by the activation of NF-KB, which is inactive when it is associated with its inhibitor IKB in cytoplasm. When cells are induced with microbial products, such as lipopolysaccharide (LPS) or certain cytokines, such as TNF-a and IL-IB, the signals are channeled inside the cell through a pathway and cause the activation of the IKB kinase (IKK) through phosphorylation. The activated IKK, in turn, phosphoylates IKB leading to its ubiquitination and degradation (Baldwin, 1996), therefore NF-KB is released from inhibition and translocated into nucleus resulting in up-regulation of its target genes. Even non-viral vectors, bacterial DNA can be recognized by Toll-like receptor 9 which activates the NF-KB pathway (Koehler et al., 2004). In humans, a high level of IL-8, a potent neutrophil chemoattractant, can cause neutrophil infiltration that leads to tissue damage (Cao et ai, 2005; Matsushima et aL, 1988). Roles of other cell types in the initial innate immune response to gene therapy vectors are not clear. Lung epithelial cells may produce IP-10 (Borgland et al, 2000), but very little other cytokines, in response to Ad vectors. The innate immune response not only leads to acute toxicity, but also controls the adaptive immune response (this subject will be discussed below). Patients receiving Ad vectors often show an acute inflammatory response. This response is characterized by the infiltration of inflammatory cells in tissues of organs targeted in gene therapy, such as liver and lung and the local release of pro-inflammatory cytokines, including TNF-a, IL-lb, IL-6, and IL8 (Cao et ah, 2004; George, 2003). Even for nonviral vector-mediated gene transfer, patients show inflammatory response (Ruiz et al, 2001). Therefore, it is very important to reduce the host innate immune response during gene therapy treatment. One of the strategies is to eliminate or inactivate lung macrophages as described earlier. Secondly, antiinflammatory drugs, such as corticosteroids or Ibuprofen, can be used to reduce inflammation (Koehler et al, 2004). If possible, vectors that do not cause strong host innate immune responses should be used. For example, AAV instead of Ad vectors should be used if they show

574'

Section V

the same efficiency in a particular gene delivery task. B2: Adaptive Immune Response The adaptive immunity relies on T- and Blymphocytes to produce cellular and humoral responses to infectious agents. During postnatal development, an extremely diverse repertoire of receptors is generated randomly and each type of receptors, that recognizes a unique antigen, is expressed on the surface of one lymphocyte only. The cells bearing useful receptors are subsequently selected from billions of lymphocytes for clonal expansion by interacting with antigens. Antigens are bound to the MHC II molecules on the surface of professional-antigen-presenting cells, normally macrophages or dendritic cells and presented to helper T cells. Activation of helper T cells by antigen presenting cells also requires a co-stimulatory signal, e.g., CD80 or CD86, on the surface of the antigen-presenting cell to bind to CD28 on the surface of the T cell. The expression of co-stimulatory molecules is regulated by innate immunity (Fearon and Locksley, 1996), and therefore, the adaptive immunity is controlled by the innate immunity. After activation, helper T cells control other cells in the adaptive immune system, such as activation of cytotoxic T cells to destroy infected cells and B cells to produce antibodies. Following elimination of an infection, some antigen-specific clones of T and B cells remain as "memory" lymphocytes so that the adaptive immune system remembers the antigens and destroy them quickly when encountered a second time. Compared to the innate immune response, the adaptive immune response is a slow process and it takes three to five days to mobilize enough lymphocytes to take action. Previous work in several groups (Dai et al, 1995; Kay et a/., 1995; Yang et a/., 1995) showed clearly that both cellular and humoral responses are involved in Ad vector-mediated gene transfer in mice. Repeated delivery of viral vectors, or primary delivery to individuals with pre-existing immunity, is problematic because of antibodies against the capsid proteins. Various strategies can be used to overcome the problem. First of all, blocking the innate immune response may be used to reduce the adaptive immune response. Reducing the uptake of vectors by macrophages should inhibit antigen presentation. Therefore, all the strategies used to reduce the innate immune response mentioned above can be used to reduce the adaptive immune response. Another strategy for effective repeated delivery of recombinant viruses is "serotype switching" (Mastrangeli et al., 1996). Gene therapy is initiated with one virus serotype, then switched to a second serotype for a subsequent

Special Topics

administration, thereby avoiding neutralizing antibodies induced by the first serotype (Mack et al, 1997). However, the level and duration of transgene expression following serotype switching may be limited by cross-reactive cytotoxic T lymphocytes that can also target cells infected by the second serotype virus (Mack et al., 1997; Smith et al., 1998). Furthermore since all the viral gene therapy vectors used in the fiiture will not express any viral coding proteins, transient immune modulation may be used to block the adaptive immune response. Drugs normally used for immunosuppression, such as cyclosporine and cyclophosphamide, may be used to transiently modulate host adaptive immune responses. For example, it was shown that cyclophosphamide alone or in combination with cyclosporine A extended transgene expression mediated by the first generation adenoviral vector (Dai et al., 1995). Finally, blocking co-stimulatory pathways can be used to modulate the host adaptive immune response. Several groups showed that an antibody against CD40 ligand (Scaria et al., 1997; Wilson et al., 1998) or expressing CTLA4Ig, a fiision protein of cytotoxic T lymphocyteassociated protein 4 (CTLA4) and the Fc portion of immunoglobulin G (IgG), by the HD-Ad vector, improved transgene expression in rodents (Jiang et al., 2002; Yamashita et al., 2003), C: Transgene Expression Barriers How to control therapeutic gene expression was ignored initially by the gene therapy community since some viral promoter showed high activity in cultured cells. In addition, the initial goal in gene therapy research was to demonstrate gene transfer and gene expression. It was later discovered that viral promoters can be attenuated by host cytokines (Qin et al., 1997; Sung et al., 2001) and some retroviral promoters can be silenced following vector integration (Barquinero et al., 2000; Fearon and Locksley, 1996; Kalberer et al., 2000). As described in the first Chapter by Goodrich and Tjian, we now know that the processes of gene transcription, RNA processing and mRNA transport are coupled. It is important to take into consideration all the DNA elements required for gene expression in the design of a gene expression cassette, such as enhancers for transcription, introns and polyA signals for RNA processing and transport as well as sequences for efficient translation and RNA stability. Some gene introns contain DNA control elements that are required to achieve cell-specific expression (Aronow et al., 1992; Oshima et al., 1990). In addition, for integration vectors, insulators or locus control regions are required to prevent transgene silencing due to the integration. All these regulatory

Chapter 35

Gene Therapy: Back to the Basics

elements are described elsewhere in the book; I shall only discuss their utility here. CI: Cell-specific Expression The temporal and spatial expression of genes is determined by the DNA regulatory elements and gene positions on chromosomes. Ideally, for expression of a therapeutic gene, its own DNA regulatory elements should be used to drive the expression, since nonspecific expression of a gene could result in adverse effects. Unfortunately, for many genes, their regulatory elements are not characterized. Initially, most gene therapy studies were done with promoters from viruses, such as Simian virus 40 (SV40), CMV and respiratory syncytial virus (RSV). As mentioned above, the viral promoters can be shut down in mammals by host cytokines although these promoters are quite active in cultured cells. Another problem associated with the viral promoters is that they are not cell or tissue- specific. One strategy to solve this problem is to use DNA regulatory elements from a gene that shows similar cell-specificity to that of a therapeutic gene. My group applied this strategy to our gene therapy research at the very beginning. For CF gene transfer, we developed a gene expression cassette using DNA control elements from the human cytokeratin 18 gene which displays a very similar expression pattern as the CFTR gene (Chow et al., 1991 \ Chow et ai, 2000). We showed that this gene expression cassette can be used to efficiently express transgenes in HD-Ad vectors in mice (Toietta et al., 2003). We further demonstrated that CF knockout mice treated with a HD-Ad vector expressing the CFTR gene from our K18 expression cassette became resistant, like the wild-type mice, to acute lung infection by a clinically relevant Burkholdera cepacia strain (Koehler et al, 2003). Recently, we showed that our vectors efficiently transduced airway epithelia of rabbits (Koehler et aL, 2005). The other strategy is to use hybrid promoters with regulatory elements from different promoters. As mentioned early, an AAV vector using the beta-actin promoter plus an enhancer from the CMV promoter exhibited stronger expression of a CFTR minigene gene than that from vectors using viral promoters (Siminger et al, 2004). C2: Sustained and Regulated Expression Sustained therapeutic gene expression is critical for gene therapy. One major problem in CF lung gene therapy trials is the lack of sustained transgene expression. For liposome-mediated gene transfer, this can be attributed, at least partially, to the instability of the plasmid DNA

575

in the transfected cells. For Ad vectors, host immune responses are the major problem. For AAV vectors, the small capacity for carrying DNA does not allow it to include enough DNA regulatory sequences. Since all the lung gene therapy trials conducted so far have not demonstrated efficient gene transfer, the lack of sustained transgene expression would further diminish any hope for showing clinical benefits. Lentiviral vectors have not been used for lung gene therapy trials, it is not clear whether silencing of transgene expression will be a problem. Therefore, solutions to the lack of sustained transgene expression may be different for different vectors. For Ad vectors, simply switching to HD-Ad vectors can greatly improve the length of transgene expression in the lung (Toietta et al., 2003) and in other organs as well (Kim et al., 2001; Maione et al, 2001; Morsy et al, 1998). In addition, reducing the innate and adaptive immune responses will also enhance the sustained transgene expression if the therapeutic gene product were not previously present in patients. However, even for HD-Ad vectors to be used in lung gene therapy, there is an additional obstacle, epithelial cell turnover. This is also problematic for rAAV vectors because their frequency of integration is very low (Schnepp et al, 2003). This requires readministration of vectors, which may not be as difficult as many think since the mucosal antibody response is short-lived (Ahmed and Gray, 1996). For lentiviral vectors, unless the integration at a specific, benign chromosomal site can be established, they are too risky to be used for lung gene therapy, because of so many cells that need to be targeted. If integration vectors are used in gene therapy, all silencing elements should be removed and insulators or locus control regions may be added to prevent silencing caused by integration. I do not think that the current nonviral vectors can be used for efficient gene delivery to the lung and it is no use at this point to propose strategies to enhance sustained transgene expression for them. Regulated transgene expression is a subject that did not attract much attention of the gene therapy community. As described in other chapters of this book, the level as well as the temporal and spatial expression of each gene in eukaryotic organisms is carefully regulated. For current gene therapy studies, most therapeutic genes are expressed from heterologous promoters. Modification of these promoters may be needed to make the therapeutic gene expression match the normal expression pattern and/or level. This type of fine-tuning of design will require comprehensive knowledge of gene regulation. This will still be a daunting task for years to come. It is no exaggeration to

576'

Section V

say that improvement of human gene therapy is still dependent on the advancement of our knowledge of gene regulation. Concluding Remarks Gene therapy evolved largely from modem molecular genetics in anticipation of inventing novel treatments for human diseases. Our knowledge of gene expression and regulation plays a critical role in the design of gene therapy studies. Despite the initial underestimation of the difficulty in safety and efficiency of gene delivery, a few successftil clinical studies have shown the feasibility of using gene therapy to cure fatal human diseases. Previous work in the field not only enhanced our understanding of the problems involved in gene therapy, but also will allow us to continue improving our methodology. Although the obstacles discussed here still impede our current progress in bringing clinical benefits of gene therapy to patients, all these problems can be solved theoretically. The complexity of human biology is expected to dictate different approaches to be used for different diseases, such as an ex vivo approach for blood diseases and a direct gene transfer method for airway diseases. Because of the differences in organ anatomy and in drug tolerance between rodents and humans, more large animal studies will be needed to check the safety and efficiency of gene therapy vectors before being clinical tested. As we know more about genes involved in diseases, more therapeutic "drugs" will be available. One can predict that more clinical benefits of gene therapy will be brought to society by a combined effort of the persistent basic and clinical researchers in the field. Acknowledgment I thank Drs. Carl A. Price and Jun Ma, and Mr. Quinn Hu for reviewing the manuscript. Research in my laboratory was supported by Operating Grants from the Canadian Institutes of Health Research, the Canadian Cystic Fibrosis Foundation, the Foundation Fighting Blindness-Canada and NIH, USA. J.H. is a CCFF Scholar, a recipient of the CCFF Zellers Senior Scientist Award, and holds a Premier's Research Excellence Award of Ontario, Canada.

References Ahmed, R., and Gray, D. (1996). Immunological memory and protective immunity: understanding their relation. Science 272,

Special Topics 54-60. Aiuti, A., Slavin, S., Aker, M., Ficara, F., Deola, S., Mortellaro, A., Morecki, S., Andolfi, G., Tabucchi, A., Carlucci, F., et al (2002). Correction of ADA-SCID by stem cell gene therapy combined with nonmyeloablative conditioning, Science 296, 2410-3. Alton, E. W., Stem, M., Farley, R., Jaffe, A., Chadwick, S. L., Phillips, J., Davies, J., Smith, S. N., Browning, J., Davies, M. G., et al. (1999). Cationic lipid-mediated CFTR gene transfer to the lungs and nose of patients with cystic fibrosis: a double-blind placebo-controlled trial, Lancet 353, 947-54. Arcasoy, S. M., Latoche, J., Gondor, M., Watkins, S. C , Henderson, R. A., Hughey, R., Finn, O. J., and Pilewski, J. M. (1997). MUCl and other sialoglycoconjugates inhibit adenovirus-mediated gene transfer to epithelial cells, Am J Respir Cell Mol Biol 17,422-35. Aronow, B. J., Silbiger, R. N., Dusing, M. R., Stock, J. L., Yager, K. L., Potter, S. S., Hutton, J. J., and Wiginton, D. A. (1992). Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression, Mol Cell Biol 12, 4170-85. Baldwin, A. S., Jr. (1996). The NF-kappa B and I kappa B proteins: new discoveries and insights, Annu Rev Immunol 14, 649-83. Bals, R., Xiao, W., Sang, N., Weiner, D. J., Meegalla, R. L., and Wilson, J. M. (1999). Transduction of well-differentiated airway epithelium by recombinant adeno-associated virus is limited by vector entry, J Virol 73, 6085-8. Bamett, B. G., Crews, C. J., and Douglas, J. T. (2002). Targeted adenoviral vectors, Biochim Biophys Acta 1575, 1-14. Barquinero, J., Eixarch, H., and Perez-Melgosa, M. (2004). Retroviral vectors: new applications for an old tool. Gene Ther 11 Suppl 1, S3-9. Barquinero, J., Segovia, J. C, Ramirez, M., Limon, A., Guenechea, G., Puig, T., Briones, J., Garcia, J., and Bueren, J. A. (2000). Efficient transduction of human hematopoietic repopulating cells generating stable engraftment of transgene-expressing cells in NOD/SCID mice, Blood 95, 3085-93. Bauer, T. R., Jr., Miller, A. D., and Hickstein, D. D. (1995). Improved transfer of the leukocyte integrin CD 18 subunit into hematopoietic cell lines by using retroviral vectors having a gibbon ape leukemia virus envelope, Blood 86, 2379-87. Baum, C , Hegewisch-Becker, S., Eckert, H. G., Stocking, C , and Ostertag, W. (1995). Novel retroviral vectors for efficient expression of the multidrug resistance (mdr-1) gene in early hematopoietic cells, J Virol 69, 7541-7. Bellon, G., Michel-Calemard, L., Thouvenot, D., Jagneaux, V., Poitevin, F , Malcus, C , Accart, N., Layani, M. P., Aymard, M., Bemon, H., et al (1997). Aerosol administration of a recombinant adenovirus expressing CFTR to cystic fibrosis patients: a phase I clinical trial. Hum Gene Ther 8, 15-25. Benihoud, K., Yeh, P., and Perricaudet, M. (1999), Adenovirus

Chapter 35

Gene Therapy: Back to the Basics

vectors for gene delivery, Curr Opin Biotechnol 10, 440-7. Berclaz, P. Y., Zsengeller, Z., Shibata, Y., Otake, K., Strasbaugh, S., Whitsett, J. A., and Trapnell, B. C. (2002). Endocytic intemaHzation of adenovirus, nonspecific phagocytosis, and cytoskeletal organization are coordinately regulated in alveolar macrophages by GM-CSF and PU.l, J Immunol 169, 6332-42. Bems, K. I., and Giraud, C. (1996). Biology of adeno-associated virus, Curr Top Micriobiol Immunol 218, 1-23. Blankinship, M. J., Gregorevic, P., Allen, J. M., Harper, S. Q., Harper, H., Halbert, C. L., Miller, D. A., and Chamberlain, J. S. (2004). Efficient transduction of skeletal muscle using vectors based on adeno-associated virus serotype 6, Mol Ther 70, 671-8. Bodine, D. M., Seidel, N. E., and OrHc, D. (1996). Bone marrow collected 14 days after in vivo administration of granulocyte colony-stimulating factor and stem cell factor to mice has 10-fold more repopulating ability than untreated bone marrow. Blood 88, 89-97. Boothroyd, J. C , and Cross, G. A. (1982). Transcripts coding for variant surface glycoproteins of Trypanosoma brucei have a short, identical exon at their 5' end. Gene 20, 281-289. Borgland, S. L., Bowen, G. P., Wong, N. C, Libermann, T. A., and Muruve, D. A. (2000). Adenovirus vector-induced expression of the C-X-C chemokine IP-10 is mediated through capsiddependent activation of NF-kappaB, J Virol 74, 3941-7. Boucher, R. C. (1994). Human airway ion transport. Part 1., Am J Respir Crit Care Med 150, 271-281. Boucher, R. C. (1999). Status of gene therapy for cystic fibrosis lung disease. (Letter; Comment). (Review) (22 refs), J Clin Invest 76/5,441-5. Boucher, R. C , Stutts, M. J., Knowles, M. R., Cantley, L., and Gatzy, J. T. (1986). Na+ transport in cystic fibrosis respiratory epithelia. Abnormal basal rate and response to adenylate cyclase activation, J Clin Invest 78, 1245-52. Bragonzi, A., Dina, G., Villa, A., Calori, G., Biffi, A., Bordignon, C , Assael, B. M., and Conese, M. (2000). Biodistribution and transgene expression with nonviral cationic vector/DNA complexes in the lungs, Gene Ther 7, 1753-1760. Brunetti-Pierri, N., Palmer, D. J., Beaudet, A. L., Carey, K. D., Finegold, M., and Ng, P. (2004). Acute toxicity after high-dose systemic injection of helper-dependent adenoviral vectors into nonhuman primates, Hum Gene Ther 75, 35-46. Cao, H., Koehler, D. R., and Hu, J. (2004). Adenoviral vectors for gene replacement therapy. Viral Immunol 17, 327-33. Cao, H. B., Wang, A., Martin, B., Koehler, D. R., Zeitlin, R L., Tanawell, A. K., and Hu, J. (2005). Down-regulation of IL-8 expression in human airway epithelial cells through helperdependent adenoviral-mediated RNA interference. Cell Res 15, 111-119. Caplen, N. J., Alton, E. W, Middleton, P G., Dorin, J. R., Stevenson, B. J., Gao, X., Durham, S. R., Jeffery, P K., Hodson, M. E., Coutelle, C , et al (1995). Liposome-mediated CFTR gene transfer to the nasal epithelium of patients with cystic fibrosis [see comments].

577

Nat Med 7, 39-46. Carter, B. J. (2004). Adeno-associated vims and the development of adeno-associated virus vectors: A historical perspective, Mol Ther 70, 981-989. Cavazzana-Calvo, M., Hacein-Bey, S., de Saint Basile, G., Gross, F., Yvon, E., Nusbaum, P., Selz, F., Hue, C, Certain, S., Casanova, J. L., et al (2000). Gene therapy of human severe combined immunodeficiency (SCID)-Xl disease. Science 255, 669-72. Challita, P M., Skelton, D., el-Khoueiry, A., Yu, X. J., Weinberg, K., and Kohn, D. B. (1995). Multiple modifications in cis elements of the long terminal repeat of retroviral vectors lead to increased expression and decreased DNA methylation in embryonic carcinoma cells, J Virol 69, 748-55. Chow, Y H., O'Brodovich, H., Plumb, J., Wen, Y, Sohn, K. J., Lu, Z., Zhang, F., Lukacs, G. L., Tanswell, A. K., Hui, C. C, et al (1997). Development of an epithelium-specific expression cassette with human DNA regulatory elements for transgene expression in lung airways, Proc Natl Acad Sci USA 94, 14695-14700. Chow, Y H., Plumb, J., Wen, Y, Steer, B. M., Lu, Z., Buchwald, M., and Hu, J. (2000). Targeting Transgene Expression to Airway Epithelia and Submucosal Glands, Prominent Sites of Human CFTR Expression., Mol Ther 2, 359-367. Chu, Q., St George, J. A., Lukason, M., Cheng, S. H., Scheule, R. K., and Eastman, S. J. (2001). EGTA enhancement of adenovirusmediated gene transfer to mouse tracheal epithelium in vivo. Hum Gene Ther 12, 455-67. Copreni, E., Penzo, M., Carrabino, S., and Conese, M. (2004). Lentivims-mediated gene transfer to the respiratory epithelium: a promising approach to gene therapy of cystic fibrosis. Gene Ther 11 Suppll,S61-15. Crystal, R. G., McElvaney, N. G., Rosenfeld, M. A., Chu, C. S., Mastrangeli, A., Hay, J. G., Brody, S. L., Jaffe, H. A., Eissa, N. T., and Danel, C. (1994). Administration of an adenovirus containing the human CFTR cDNA to the respiratory tract of individuals with cystic fibrosis, Nat Genet 8, 42-51. Dai, Y, Schwarz, E. M., Gu, D., Zhang, W. W, Sarvetnick, N., and Verma, I. M. (1995). Cellular and humoral immune responses to adenoviral vectors containing factor IX gene: tolerization of factor IX and vector antigens allows for long-term expression, Proc Natl Acad Sci USA 92, 1401-5. Duan, D., Yue, Y, Engelhardt, J. F., and Evans, D. (2001). Expanding AAV packaging capacity with trans-splicing or overlapping vectors: a quantitative comparison A complex containing CstF-64 and the SL2 snRNP connects mRNA 3' end formation and trans-splicing in C elegans operons, Mol Ther ^,383-91. Dunbar, C. E., Seidel, N. E., Doren, S., Sellers, S., Cline, A. P, Metzger, M. E., Agricola, B. A., Donahue, R. E., and Bodine, D. M. (1996). Improved retroviral gene transfer into murine and Rhesus peripheral blood or bone marrow repopulating cells primed in vivo with stem cell factor and granuloc3rte

578

Section V

colony-stimulating factor, Proc Natl Acad Sci USA 93, 11871-6. Ehrhardt, A., Xu, H., and Kay, M. A. (2003). Episomal persistence of recombinant adenoviral vector genomes during the cell cycle /«v/vo, J Virol 77, 7689-95. Evans, J. T., Kelly, P. E, O'Neill, E., and Garcia, J. V. (1999). Human cord blood CD34-I-CD38- cell transduction via lentivirus-based gene transfer vectors. Hum Gene Ther 10, 1479-89. Fearon, D. T., and Locksley, R. M. (1996). The instructive role of innate immunity in the acquired immune response. Science 272, 50-3. Ferrari, S., Griesenbach, U., Shiraki-Iida, T., Shu, T., Hironaka, T., Hou, X., Williams, J., Zhu, J., Jeffery, P. K., Geddes, D. M., et al (2004). A defective nontransmissible recombinant Sendai virus mediates efficient gene transfer to airway epithelium in vivo. Gene Ther 77, 1659-64. Gao, G. P., Alvira, M. R., Wang, L., Calcedo, R., Johnston, J., and Wilson, J. M. (2002). Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy, Proc Natl Acad Sci USA PP, 11854-9. Gao, X., and Huang, L. (1995). Cationic liposome-mediated gene transfer. Gene Ther 2, 710-22. Gaspar, H. B., Parsley, K. L., Howe, S., King, D., Gilmour, K. C , Sinclair, J., Brouns, G., Schmidt, M., Von Kalle, C , Barington, T., et al (2004). Gene therapy of X-linked severe combined immunodeficiency by use of a pseudotyped gammaretroviral vector. Lancet 364, 2181-2187. George, J. S. (2003). Gene Therapy Progress and Prospects: Adenoviral Vector, Gene Ther 10, 1135-1141. Gill, D. R., Southern, K. W, Mofiford, K. A., Seddon, T., Huang, L., Sorgi, F., Thomson, A., MacVinish, L. J., Ratcliff, R., Bilton, D., et al (1997). A placebo-controlled study of liposomemediated gene transfer to the nasal epithelium of patients with cystic fibrosis. Gene Ther 4, 199-209. Glimm, H., and Eaves, C. J. (1999). Direct evidence for multiple self-renewal divisions of human in vivo repopulating hematopoietic cells in short-term culture, P^, 2161-2168. Glorioso, J. C , DeLuca, N. A., Goins, W. F., and Fink, D. J. (1994). Development of herpers simplex virus vectors for gene transfer to central nervous system. In Gene Therapeutics, J. A. Wolff, ed. (Boston, Birkhauser), pp. 281-302. Grubb, B. R., Pickles, R. J., Ye, H., Yankaskas, J. R., Vick, R. N., Engelhardt, J. F., Wilson, J. M., Johnson, L. G., and Boucher, R. C. (1994). Inefficient gene transfer by adenovirus vector to cystic fibrosis airway epithelia of mice and humans, Nature 371, 802-6. Hacein-Bey-Abina, S., Von Kalle, C , Schmidt, M., McCormack, M. R, Wulffraat, N., Leboulch, R, Lim, A., Osborne, C. S., Pawliuk, R., Morillon, E., et al (2003). LM02-associated clonal T cell proliferation in two patients after gene therapy for SCID-Xl., Science 302, 415-419. Hanenberg, H., Xiao, X. L., Dilloo, D., Hashino, K., Kato, I., and Williams, D. A. (1996). Colocalization of retrovirus and target cells on specific fibronectin fragments increases genetic

Special Topics transduction of mammalian cells, Nat Med 2, 876-82. Hargrove, P. W., Vanin, E. F., Kurtzman, G. J., and Nienhuis, A. W. (1997). High-level globin gene expression mediated by a recombinant adeno-associated virus genome that contains the 3' gamma globin gene regulatory element and integrates as tandem copies in erythroid cells. Blood 89, 2167-75. Harvey, B. G., Hackett, N. R., El-Sawy, T., Rosengart, T. K., Hirschowitz, E. A., Lieberman, M. D., Lesser, M. L., and Crystal, R. G. (1999). Variability of human systemic humoral immune responses to adenovirus gene transfer vectors administered to different organs, J Virol 73, 6729-42. Hennemann, B., Conneally, E., Pawliuk, R., Leboulch, P., RoseJohn, S., Reid, D., Chuo, J. Y, Humphries, R. K., and Eaves, C. J. (1999). Optimization of retroviral-mediated gene transfer to human NOD/SCID mouse repopulating cord blood cells through a systematic analysis of protocol variables, Exp Hematol 27, 817-25. Hillgenberg, M., Tonnies, H., and Strauss, M. (2001). Chromosomal integration pattern of a helper-dependent minimal adenovirus vector with a selectable marker inserted into a 27.4-kilobase genomic stufifer, J Virol 75, 9896-908. Jiang, Z., Feingold, E., Kochanek, S., and Clemens, R R. (2002). Systemic delivery of a high-capacity adenoviral vector expressing mouse CTLA4Ig improves skeletal muscle gene therapy, Mol Ther 6, 369-76. Jomot, L., Petersen, H., Lusky, M., Pavirani, A., Moix, I., Morris, and Rochat, T. (2001). Effects of first generation E1E3-deleted and second generation E1E3E4-deleted/modified adenovirus vectors on human endothelial cell death, Endothelium 8, 167-79. Joseph, P. M., O'Sullivan, B. P., Lapey, A., Dorkin, H., Oren, J., Balfour, R., Perricone, M. A., Rosenberg, M., Wadsworth, S. C , Smith, A. E., et al (2001). Aerosol and lobar administration of a recombinant adenovirus to individuals with cystic fibrosis. I. Methods, safety, and clinical implications, Hum Gene Ther 12, 1369-1382. KafH, T., Morgan, D., Krahl, T., Sarvetnick, N., Sherman, L., and Verma, I. (1998). Cellular immune response to adenoviral vector infected cells does not require de novo viral gene expression: implications for gene therapy, Proc Natl Acad Sci USA 95, 11377-82. Kalberer, A., Zimmerman-Phillips, S., Barker, M. J., Geier, L., and Kalberer, C. P. (2000). Preselection of retrovirally transduced bone marrow avoids subsequent stem cell gene silencing and age-dependent extinction of expression of human beta-globin in engrafted mice.(comment), Annals of Otol Rhinol Laryngol Supplement 185, 75-7. Kaplan, J. M., Pennington, S. E., St., George, J. A., Woodworth, L. A., Fasbender, A., Marshall, J., Cheng, S. H., Wadsworth, S. C , Gregory, R. J., and Smith, A. E. (1998). Potentiation of gene transfer to the mouse lung by complexes of adenovirus vector and polycations improves therapeutic potential, Hum Gene Ther P, 1469-79.

Chapter 35

Gene Therapy: Back to the Basics

Kay, M. A., Holterman, A. X., Meuse, L., Gown, A., Ochs, H. D., Linsley, P. S., and Wilson, C. B. (1995). Long-term hepatic adenovirus-mediated gene expression in mice following CTLA4Ig administration, Nat Genet 11, 191-7. ^ Keams, W. G., Afione, S. A., Fulmer, S. B., Pang, M. C , Erikson, D., Egan, M., Landrum, M. J., Flotte, T. R., and Cutting, G. R. (1996). Recombinant adeno-associated virus (AAV-CFTR) vectors do not integrate in a site-specific fashion in an immortalized epithelial cell line. Gene Ther 3, 748-55. Kim, I. H., Jozkowicz, A., Piedra, P. A., Oka, K., and Chan, L. (2001). Lifetime correction of genetic deficiency in mice with a single injection of helper-dependent adenoviral vector, Proc Natl Acad Sci USA P5, 13282-7. Knowles, M. R., Hohneker, K. W., Zhou, Z., Olsen, J. C, Noah, T. L., Hu, R C, Leigh, M. W., Engelhardt, J. R, Edwards, L. J., Jones, K. R., et al (1995). A controlled study of adeno viral-vector-mediated gene transfer in the nasal epithelium of patients with cystic fibrosis (see comments), Nat Genet 333, 823-31. Koehler, D. R., Downey, G. R, Sweezey, N. B., Tanswell, A. K., and Hu, J. (2004). Lung inflammation as a therapeutic target in cystic fibrosis. Am J Respir Cell Mol Biol 31, 377-81. Koehler, D. R., Fmdova, H., Leung, K., Louca, E., Palmer, D., Ng, R, McKerlie, C , Cox, R, Coates, A. L., and Hu, J. (2005). Aerosol delivery of an enhanced helper-dependent adenovirus formulation to rabbit lung using an intratracheal catheter, J Gene Med, In press. Koehler, D. R., Hitt, M. M., and Hu, J. (2001). Challenges and strategies for cystic fibrosis lung gene therapy., Mol Ther 4, 84-91. Koehler, D. R., Sajjan, U., Chow, Y.-H., Martin, B., Kent, G., Tanswell, A. K., McKerlie, C , Forstner, J. R, and Hu, J. (2003). Protection of Cftr knockout mice from acute lung infection by a helper-dependent adenoviral vector expressing Cftr in airway epithelia, Proc Natl Acad Sci USA 100, 15364-15369. Koenig, M., Hoffman, E. P., Bertelson, C. J., Monaco, A. P., Feener, C , and Kunkel, L. M. (1987). Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals, Cell 50, 509-17. Kojaoghlanian, T., Flomenberg, R, and Horwitz, M. S. (2003). The Impact of Adenovirus Infection on the Immunocompromised Host, Rev Med Virol 13, 155-171. Kollen, W. J., Mulberg, A. E., Wei, X., Sugita, M., Raghuram, V., Wang, J., Foskett, J. K., Click, M. C , and Scanlin, T R (1999). High-efficiency transfer of cystic fibrosis transmembrane conductance regulator cDNA into cystic fibrosis airway cells in culture using lactosylated polylysine as a vector. Hum Gene Ther 10,615-22. Kotin, R. M., Siniscalco, M., Samulski, R. J., Zhu, X. D., Hunter, L., Laughlin, C. A., McLaughlin, S., Muzyczka, N., Rocchi, M., and Bems, K. I. (1990). Site-specific integration by adenoassociated virus, Proc Natl Acad Sci USA 57, 2211-5.

579

Liang, X. H., Haritan, A., Uliel, S., and Michaeli, S. (2003). trans and cis splicing in trypanosomatids: mechanism, factors, and regulation, Eukaryotic Cell 2, 830-40. Limberis, M., Anson, D. S., Fuller, M., and Parsons, D. W. (2002). Recovery of airway cystic fibrosis transmembrane conductance regulator function in mice with cystic fibrosis after single-dose lentivirus-mediated gene transfer, [erratum appears in Hum Gene Ther. 2002 Nov 20;13(17)2112, Hum Gene Ther 13, 1961-70. Mack, C. A., Song, W. R., Carpenter, H., Wickham, T. J., Kovesdi, I., Harvey, B. G., Magovem, C. J., Isom, O. W, Rosengart, T., Falck-Pedersen, E., et al (1997). Circumvention of anti-adenovirus neutralizing immunity by administration of an adenoviral vector of an alternate serotype. Hum Gene Ther 8, 99-109. Maione, D., Delia Rocca, C, Giannetti, P., D'Arrigo, R., Liberatoscioli, L., Franlin, L. L., Sandig, V., Ciliberto, G., La Monica, N., and Savino, R. (2001). An improved helper-dependent adenoviral vector allows persistent gene expression after intramuscular delivery and overcomes preexisting immunity to adenovirus, Proc Natl Acad Sci USA 95,5986-91. Mastrangeli, A., Harvey, B. G., Yao, J., Wolff, G., Kovesdi, I., Crystal, R. G., and Falck-Pedersen, E. (1996). "Sero-switch" adenovirus-mediated in vivo gene transfer: circumvention of anti-adenovirus humoral immune defenses against repeat adenovirus vector administration by changing the adenovirus serotype. Hum Gene Ther 7, 79-87. Matsushima, K., Morishita, K., Yoshimura, T, Lavu, S., Kobayashi, Y, Lew, W, Appella, E., Kung, H. R, Leonard, E. J., and Oppenheim, J. J. (1988). Molecular cloning of a human monocyte-derived neutrophil chemotactic factor (MDNCF) and the induction of MDNCF mRNA by interleukin 1 and tumor necrosis factor, J Exp Med 167, 1883-93. McCoy, R. D., Davidson, B. L., Roessler, B. J., Huffnagle, G. B., Janich, S. L., Laing, T. J., and Simon, R. H. (1995). Pulmonary inflammation induced by incomplete or inactivated adenoviral particles. Hum Gene Ther 6, 1553-60. McElvaney, N. G., and Crystal, R. G. (1995). IL-6 release and airway administration of human CFR cDNA adenovirus vector, Nat Med y, 182-4. Medzhitov, R., and Janeway, C , Jr. (2000). Innate immunity, N Engl J Med 5^5, 338-44. Michou, A. L, Santoro, L., Christ, M., Julliard, V., Pavirani, A., and Mehtah, M. (1997). Adenovirus-mediated gene transfer: influence of transgene, mouse strain and type of immune response on persistence of transgene expression. Gene Ther 4, 473-82. Moritz, T, Dutt, P., Xiao, X., Carstanjen, D., Vik, T, Hanenberg, H., and Williams, D. A. (1996). Fibronectin improves transduction of reconstituting hematopoietic stem cells by retroviral vectors: evidence of direct viral binding to chymotryptic carboxy-terminal fragments. Blood 88, 855-62. Moritz, T, Patel, V. P., and Williams, D. A. (1994). Bone marrow

580'

Section V

extracellular matrix molecules improve gene transfer into human hematopoietic cells via retroviral vectors, J Clin Invest 93, 1451-7. Morral, N., O'Neal, W. K., Rice, K., Leland, M. M., Piedra, P. A., Aguilar-Cordova, E., Carey, K. D., Beaudet, A. L., and Langston, C. (2002). Lethal toxicity, severe endothelial injury, and a threshold effect with high doses of an adenoviral vector in baboons, Hum Gene Ther 13, 143-54. Morsy, M. A., Gu, M., Motzel, S., Zhao, J., Lin, J., Su, Q., Allen, H., Franlin, L., Parks, R. J., Graham, F. L., et al (1998). An adenoviral vector deleted for all viral coding sequences results in enhanced safety and extended expression of a leptin transgene, Proc Natl Acad Sci USA 95, 7866-71. Moss, R. B., Rodman, D., Spencer, L. T., Aitken, M. L., Zeitlin, P. L., Waltz, D., Milla, C , Brody, A. S., Clancy, J. R, Ramsey, B., et al (2004). Repeated adeno-associated virus serotype 2 aerosol-mediated cystic fibrosis transmembrane regulator gene transfer to the lungs of patients with cystic fibrosis: a multicenter, double-blind, placebo-controlled trial. Chest 125, 509-21. Noone, R G., Hohneker, K. W., Zhou, Z., Johnson, L. G., Foy, C , Gipson, C , Jones, K., Noah, T. L., Leigh, M. W., Schwartzbach, C, et al (2000). Safety and biological efficacy of a lipid-CFTR complex for gene transfer in the nasal epithelium of adult patients with cystic fibrosis, Mol Ther 1, 105-14. O'Neal, W. K., Rose, E., Zhou, H., Langston, C , Rice, K., Carey, D., and Beaudet, A. L. (2000). Multiple advantages of alpha-fetoprotein as a marker for in vivo gene transfer, Mol Ther 2, 640-8. Oshima, R. G., Abrams, L., and Kulesh, D. (1990). Activation of an intron enhancer within the keratin 18 gene by expression of c-fos and c-jun in undifferentiated F9 embryonal carcinoma cells, Genes Dev 4, 835-848. Overbaugh, J., Miller, A. D., and Eiden, M. V. (2001). Receptors and entry cofactors for retroviruses include single and multiple transmembrane-spanning proteins as well as newly described glycophosphatidylinositol-anchored and secreted proteins, Microbiol Mol Biol Rev 65, 371-89. Palmer, D., and Ng, P. (2003). Improved system for helperdependent adenoviral vector production, Mol Ther 8, 846-52. Parks, R. J. (2000). Improvements in adenoviral vector technology: overcoming barriers for gene therapy, Clin Genet 55, 1-11. Pergolizzi, R. G., and Crystal, R. G. (2004). Genetic medicine at the RNA level: modifications of the genetic repertoire for therapeutic purposes by pre-mRNA trans-splicing, Comptes Rendus Biologies 327, 695-709. Perricone, M. A., Morris, J. E., Pavelka, K., Plog, M. S., O'Sullivan, B. R, Joseph, P M., Dorkin, H., Lapey, A., Balfour, R., Meeker, D. P, et al (2001). Aerosol and lobar administration of a recombinant adenovirus to individuals with cystic fibrosis, ii. transfection efficiency in airway epithelium. Hum Gene Ther 12, 1383-94. Pickles, R. J., Fahmer, J. A., Petrella, J. M., Boucher, R. C , and Bergelson, J. M. (2000). Retargeting the coxsackievirus and

Special Topics adenovirus receptor to the apical surface of polarized epithelial cells reveals the glycocalyx as a barrier to adenovirus-mediated gene transfer, J Virol 74, 6050-7. Porteous, D. J., Dorin, J. R., McLachlan, G., Davidson-Smith, H., Davidson, H., Stevenson, B. J., Carothers, A. D., Wallace, W. A., Moralee, S., Hoenes, C, et al (1997). Evidence for safety and efficacy of DOTAP cationic liposome mediated CFTR gene transfer to the nasal epithelium of patients with cystic fibrosis, Gene Ther ^,210-8. Pringle, C. R. (1999). Virus taxonomy-1999. The universal system of virus taxonomy, updated to include the new proposals ratified by the International Committee on Taxonomy of Viruses during 1998, Arch Virol 144, 421 -9. Pupita, F., and Barone, A. (1983). Clinical pharmacology of DEAE-dextran for long-term administration (one year), Int J Clin Pharmacol Res 3, 287-93. Qin, L., Ding, Y., Pahud, D. R., Chang, E., Imperiale, M. J., and Bromberg, J. S. (1997). Promoter attenuation in gene therapy: Interferon-gamma and tumor necrosis factor-alpha inhibit transgene expression. Hum Gene Ther 8,2019-2029. Raper, S. E., Chirmule, N., Lee, F. S., Wivel, N. A., Bagg, A., Gao, G. P, Wilson, J. M., and Batshaw, M. L. (2003). Fatal systemic inflammatory response syndrome in a ornithine transcarbamylase deficient patient following adenoviral gene transfer, Mol Genet Metab 80, 148-58. Raper, S. E., YudkoflF, M., Chirmule, N., Gao, G. P, Nunes, R, Haskal, Z. J., Furth, E. E., Propert, K. J., Robinson, M. B., Magosin, S., et al (2002). A pilot study of in vivo liver-directed gene transfer with an adenoviral vector in partial ornithine transcarbamylase deficiency. Hum Gene Ther 13, 163-75. Reich, S. J., Auricchio, A., Hildinger, M., Glover, E., Maguire, A. M., Wilson, J. M., and Bennett, J. (2003). Efficient trans-splicing in the retina expands the utility of adeno-associated virus as a vector for gene therapy, Hum Gene Ther 14, 37-44. Rogers, S., and Moore, M. (1963). Studies of the mechanism of action of the shope rabbit papilloma virus. I. Concerning the nature of the induction of arginase in the infected cells, J Exp Med 777, 521-542. Rommens, J. M., lannuzzi, M. C , Kerem, B., Drumm, M. L., Melmer, G., Dean, M., Rozmahel, R., Cole, J. L., Kennedy, D., Hidaka, N., et al (1989). Identification of the cystic fibrosis gene: chromosome walking and jumping. Science 245, 1059-65. Ruiz, F. E., Clancy, J. P., Perricone, M. A., Bebok, Z., Hong, J. S., Cheng, S. H., Meeker, D. P., Young, K. R., Schoumacher, R. A., Weatherly, M. R., et al (2001). A clinical inflammatory syndrome attributable to aerosolized lipid-DNA administration in cystic fibrosis. Hum Gene Ther 12, 751-61. Salvi, S., and Holgate, S. T. (1999). Could the airway epithelium play an important role in mucosal immunoglobulin A production?, Clin Exp Allergy 29, 1597-605. Scaria, A., St George, J. A., Gregory, R. J., Noelle, R. J., Wadsworth, S. C, Smith, A. E., and Kaplan, J. M. (1997). Antibody to CD40

Chapter 35 Gene Therapy: Back to the Basics ligand inhibits both humoral and cellular immune responses to adenoviral vectors and facilitates repeated administration to mouse airway, Gene Ther 4, 611-7. Schaack, J., Bennett, M. L., Colbert, J. D., Torres, A. V., Clayton, G. H., Omelles, D., and Moorhead, J. (2004). ElA and ElB proteins inhibit inflammation induced by adenovirus, Proc Natl Acad Sci USA 7(?7, 3124-9. Schnepp, B. C , Clark, K. R., Klemanski, D. L., Pacak, C. A., and Johnson, P. R. (2003). Genetic fate of recombinant adenoassociated virus vector genomes in muscle, J Virol 77, 3495-504. Singh, B., and de la Concha-Bermejillo, A. (1998). Gadolinium chloride removes pulmonary intravascular macrophages and curtails the degree of ovine lentivirus-induced lymphoid interstitial pneumonia, Int J Exp Pathol 79, 151-62. Singhal, A., and Huang, L. (1994). Gene transfer in mammalian cells uisng liposomes as carriers. In Gene Therapeutics, J. A. Wolff, ed. (Boston, Birkhauser), pp. 118-142. Sinn, P L., Hickey, M. A., Staber, R D., Dylla, D. E., Jeffers, S. A., Davidson, B. L., Sanders, D. A., and McCray, P B., Jr. (2003). Lentivirus vectors pseudotyped with filoviral envelope glycoproteins transduce airway epithelia from the apical surface independently of folate receptor alpha, J Virol 77, 5902-10. Siminger, J., Muller, C , Braag, S., Tang, Q., Yue, H., Detrisac, C , Ferkol, T., Guggino, W. B., and Flotte, T. R. (2004). Functional characterization of a recombinant adeno-associated virus 5-pseudotyped cystic fibrosis transmembrane conductance regulator vector. Hum Gene Ther 75, 832-41. Smith, A. E. (1995). Viral vectors in gene therapy, Annu Rev Microbiol 49, 807-38. Smith, C. A., Woodruff, L. S., Rooney, C , and Kitchingman, G. R. (1998). Extensive cross-reactivity of adenovirus-specific cytotoxic T cells. Hum Gene Ther 9, \M^-11. Smith, T, Idamakanti, N., KyleQord, H., Rollence, M., King, L., Kaloss, M., Kaleko, M., and Stevenson, S. C. (2002). In vivo hepatic adenoviral gene delivery occurs independently of the coxsackievirus-adenovirus receptor, Mol Ther 5, 770-9. Spina, D. (1998). Epithelium smooth muscle regulation and interactions, Am J Respir Crit Care Med 755, S141-5. Summerford, C , and Samulski, R. J. (1998). Membraneassociated heparan sulfate proteoglycan is a receptor for adenoassociated virus type 2 virions, J Virol 72, 1438-45. Sung, R. S., Qin, L., and Bromberg, J. S. (2001). TNF-alpha and IFN-gamma induced by innate anti-adenoviral immune responses inhibit adenovirus-mediated transgene expression, Mol Ther S, 151-61. Suzuki, H., Kurihara, Y., Takeya, M., Kamada, N., Kataoka, M., Jishage, K., Ueda, O., Sakaguchi, H., Higashi, T., Suzuki, T, et al (1997). A role for macrophage scavenger receptors in atherosclerosis and susceptibility to infection. Nature 386, 292-6. Tal, J. (2000). Adeno-associated virus-based vectors in gene therapy, J Biomed Sci 7,279-91. Terheggen, H. G., Lowenthal, A., Lavinha, F., Colombo, J. P.,

581

and Rogers, S. (1975). Unsuccessful trial of gene replacement in arginase deficiency, J Exp Med 119, 1-3. Thepen, T., McMenamin, C , Oliver, J., Kraal, G., and Holt, P G. (1991). Alveolar macrophage elimination in vivo is associated with an increase in pulmonary immune response in mice, Eur J Immunol 21, 2845-50. Toietta, G., Koehler, D. R., Finegold, M., Lee, B., Hu, J., and Beaudet, A. L. (2003). Reduced inflammation and improved airway expression using helper-dependent adenoviral vectors with a K18 promoter, Mol Ther 7, 649-658. Tripathy, S. K., Black, H. B., Goldwasser, E., and Leiden, J. M. (1996). Immune responses to transgene-encoded proteins limit the stability of gene expression after injection of replicationdefective adenovirus vectors, Nat Med 2, 545-50. Tsui, L. C. (1995). The Cystic Fibrosis Transmembrane conductance Regulator gene. Am J Respir Crit Care Med 757, S47-S53. van der Loo, J. C , Liu, B. L., Goldman, A. I., Buckley, S. M., and Chrudimsky, K. S. (2002). Optimization of gene transfer into primitive human hematopoietic cells of granulocyte-colony stimulating factor-mobilized peripheral blood using low-dose cytokines and comparison of a gibbon ape leukemia virus versus an RD114-pseudotyped retroviral vector. Hum Gene Ther 13, 1317-30. Veena, R, Traycoff, C. M., Williams, D. A., McMahel, J., Rice, S., Cometta, K., and Srour, E. F. (1998). Delayed targeting of cytokine-nonresponsive human bone marrow CD34(+) cells with retrovirus-mediated gene transfer enhances transduction efficiency and long-term expression of transduced genes. Blood 97,3693-701. Wagner, J. A., Messner, A. H., Moran, M. L., Daifuku, R., Kouyama, K., Desch, J. K., Manley, S., Norbash, A. M., Conrad, C. K., Friborg, S., et al (1999a). Safety and biological efficacy of an adeno-associated virus vector- cystic fibrosis transmembrane regulator (AAV-CFTR) in the cystic fibrosis maxillary sinus. Laryngoscope 109, 266-1 A, Wagner, J. A., Nepomuceno, I. B., Shah, N., Messner, A. H., Moran, M. L., Norbash, A. M., Moss, R. B., Wine, J. J., and Gardner, P. (1999b). Maxillary sinusitis as a surrogate model for CF gene therapy clinical trials in patients with antrostomies, J Gene Med 7, 13-21. Wang, B., Li, J., and Xiao, X. (2000). Adeno-associated virus vector carrying human minidystrophin genes effectively ameliorates muscular dystrophy in mdx mouse model, [see comment], Proc Natl Acad Sci USA 97, 13714-9. Wang, Z., Zhu, T., Qiao, C , Zhou, L., Wang, B., Zhang, J., Chen, C , Li, J., and Xiao, X. (2005). Adeno-associated virus serotype 8 efficiently delivers genes to muscle and heart, Nat Biotechnol 23, 321-8. Welsh, M. J., Tsui, L. C , Boat, T. F., and Beaudet, A. L. (1995). Cystic Fibrosis. In The Metabolic and Molecular Basis of Inherited Disease, C. R. Scriver, A. L. Beaudet, W S. Sly, and D.

582

Section V

Valle, eds. (New York, McGraw-Hill), pp. 3799-3876. Wilson, C. B., Embree, L. J., Schowalter, D., Albert, R., Aruffo, A., Hollenbaugh, D., Linsley, P., and Kay, M. A. (1998). Transient inhibition of CD28 and CD40 ligand interactions prolongs adenovirus-mediated transgene expression in the lung and facilitates expression after secondary vector administration, J Virol 72, 7542-50. Wivel, N. A., Gao, G. P., and Wilson, J. M. (1999). Adenovirus vectors. In The Development of Human Gene Therapy, T. Friedmann, ed. (San Diego, CA, Cold Spring Harbor Laboratory Press), pp. 87-110. Wolff, J. A., and Lederberg, J. (1994). A history of gene transfer and therapy. In Gene Therapeutics, J. A. Wolff, ed. (Boston, Birkhauser), pp. 3-25. Worgall, S., Leopold, P. L., Wolff, G., Ferris, B., Van Roijen, N., and Crystal, R. G. (1997). Role of alveolar macrophages in rapid elimination of adenovirus vectors administered to the epithelial surface of the respiratory tract. Hum Gene Ther 5, 1675-84. Yam, R Y, Yee, J. K., Ito, J. I., Sniecinski, I., Doroshow, J. H., Forman, S. J., and Zaia, J. A. (1998). Comparison of amphotropic and pseudotyped VSV-G retroviral transduction in human CD34+ peripheral blood progenitor cells from adult donors with HIV-1 infection or cancer, Exp Hematol 26, 962-8. Yamashita, K., Masunaga, T., Yanagida, N., Takehara, M., Hashimoto, T., Kobayashi, T., Echizenya, H., Hua, N., Fujita, M., Murakami, M., et al (2003). Long-term acceptance of rat cardiac allografts on the basis of adenovirus mediated CD40Ig plus CTLA4Ig gene therapies. Transplantation 76, 1089-96. Yan, Z., Zhang, Y , Duan, D., and Engelhardt, J. F. (2000).

Special Topics Trans-splicing vectors expand the utility of adeno-associated virus for gene therapy.(see comment), Proc Natl Acad Sci USA P7, 6716-21. Yang, Y, Jooss, K. U., Su, Q., Ertl, H. C , and Wilson, J. M. (1996). Immune responses to viral antigens versus transgene product in the elimination of recombinant adenovirus-infected hepatocytes in vivo. Gene Ther 5, 137-144. Yang, Y, Li, Q., Ertl, H. C , and Wilson, J. M. (1995). Cellular and humoral immune responses to viral antigens create barriers to lung-directed gene therapy with recombinant adenoviruses, J Virol 69, 2004-15. Yu, S. F., von Ruden, T., Kantoff, R W., Garber, C , Seiberg, M., Ruther, U., Anderson, W F., Wagner, E. F., and Gilboa, E. (1986). Self-inactivating retroviral vectors designed for transfer of whole genes into mammalian cells, Proc Natl Acad Sci USA 53, 3194-8. Zabner, J., Cheng, S. H., Meeker, D., Launspach, J., Balfour, R., Perricone, M. A., Morris, J. E., Marshall, J., Fasbender, A., Smith, A. E., and Welsh, M. J. (1997). Comparison of DNA-lipid complexes and DNA alone for gene transfer to cystic fibrosis airway epithelia in vivo, J Clin Invest 100, 1529-37. Zabner, J., Couture, L. A., Gregory, R. J., Graham, S. M., Smith, A. E., and Welsh, M. J. (1993). Adenovirus-mediated gene transfer transiently corrects the chloride transport defect in nasal epithelia of patients with cystic fibrosis, Cell 75, 207-16. Zsengeller, Z., Otake, K., Hossain, S. A., Berclaz, P. Y, and Trapnell, B. C. (2000). Internalization of adenovirus by alveolar macrophages initiates early proinflammatory signaling during acute respiratory tract infection, J Virol 74, 9655-67.