alberts
bray
hopkin
johnson
lewis
raff
2n Έκδοσn
ιατρικές εκδόσεις
n.x.
πασχαλίδης
roberts
walter
Τα αμινοξ...
1401 downloads
5096 Views
123MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
alberts
bray
hopkin
johnson
lewis
raff
2n Έκδοσn
ιατρικές εκδόσεις
n.x.
πασχαλίδης
roberts
walter
Τα αμινοξέα και Ία σύμβολά Ίους
Κωδlκόνια
ασπαρτικό οξύ
GAC GM AGA
D
ισολευκίνη
Asp Glu Arg Lys His Asn Gln Ser Thr Tyr Ala Gly Val Leu Ile
πρoiΊίνη
Ρω
Ρ
φαινυλαλανίνη
Phe Met Trp Cys
F
Υλουταμικό οξύ αΡΥινίνη λυσίνη ιmιδίνη ασπαραΥίνη
Υλουταμίνη σερίνη
θρεονίνη τυροσίνη
αλανίνη
Υλυκίνη βαλίνη
λευκίνη
μεθειονίνη τρυmοφάνη
κυmεινη
Ε
R Κ
ΑΜ
Η
CAC MC CM AGC ACA UAC GCA GGA GUA
Ν
Q S Τ Υ
Α
G V L
υυΑ
Ι
AUA CCA UUC AUG UGG UGC
Μ
W C
Κωδικόνια ΤΕΡΜΑΤΙΣΜΟΥ
υΜ
GAU GAG AGG MG CAU
CGA
CGC
CGG
CGU
UCA ACG
UCC ACU
UCG
UCU
GCG GGG GUG CUA
GCU GGU GUU CUC
CUG
CUU
Μυ
CAG AGU ACC UAU GCC GGC GUC UUG AUC CCC
Αυυ
CCG
CCU
υυυ
UGU UAG
UGA
Ηλεκτραρνητικά πολικά αμινοξέα: πράσινο, ηλεκφοθετικά πολικά αμινοξέα: μαύρο, μη φορτισμένα πολικά αμινοξέα: κόκκινο, πολικά αμινοξέα: μπλε
Μήκος
Όγκος
1 km (χιλιόμετρο) 1 m (μέτρο) 1 cm (εκαωmόμετρο) 1 mm (χιλιοmόμετρο) 1 μm (μικρόμετρο) 1 nm (νανόμετρο) 1 Α (Angstr6m) ΜάΖα
10-2 m 10-3 m 10-6 m 10-9 m 10-10 m
10-31 10-61 10-91
Συγκένφωση
103 g
1 Μ (molar) 1 mM (millimolar) 1 μΜ (micromolar) 1 ηΜ (nanomolar)
10-3 g 10-6 g 10-9 g
1 mole 1 c (θερμίδα)
(
1 kg (χιλιόΥραμμο) 1 g (Υραμμάριο) 1 mg (xιiΊιoσι:oyραμμάριo) = 1 μg (μιιφΟΥραμμάριο) 1 ng (νανΟΥραμμάριο) =
11 (λίτρο) 1 ml (χιλιοmόλιτρο) 1 μΙ (μικρόλιτρο) 1 ηl (νανόλιτρο)
1 mole/l 10-3 Μ 10-6 Μ 10-9 Μ
=
6.02 χ 1023 μόρια/Ι
Χρήσιμες ΟΊαθερές, ΜεΊαΊροπές και Ορισμοί
6.02 χ 1023 μόρια ποσό θερμότητας που απαιτείται Υια ν' αυξηθεί η θερμοκρασία 1 g νερού
κατά
1 kcal (xιiΊιoθερμίδα) 11 νερό 1 d (dalton)
=
1°C 103 c = 4.18 kJ (xιiΊιoθερμίδες) 1 kg (mους 4°C)
κατά προσέν/ιση, η μάΖα ενός ατόμου
ΜάΖα της Γης
υδΡΟΥόνου (1.7 χ 10-24 g) 103 d 1024 kg
Γονιδίωμα βακτηρίων
0.5-5 χ 106 ΖεύΥη νουκλεοτιδίων
1 kd (kilodalton)
(ανάλΟΥα με 10 βακτήριο)
Γονιδίωμα ανθρώπου
3 χ 109 ΖεύΥη νουκλεοτιδίων (απλοειδές)
Βαοιι"
ΟΗ
"'C 11
Ο
5
H-C-OH
1
4 ΟΗ
ΗΟ
3
12 13
_ _ HO-C-H
_
Η
2
1CH 20H ισομεράση της φωσφορικής γλυκόζης
H-C-OH
14 15
H-C-OH
ΟΗ
β CΗ20 Θ
(μορφή δακτυλίου)
Ι
C=O
21 31 H-C-OH 41 H-C-OH 51
HO-C-H
(μορφή ανοικτής αλυσίδας)
β-φωσφορική γλυκόζη
Η νέα υδροξυλομάδα Θ
στο C-1φωσφορυλιώνεται από το
ΑΤΡ κατά"'!1ν~ρoετ~ιμασίαγια το
Ο)(11ματισμο δυο μοριων φωσφορι-
κών σακχάρων με τρία άτομα άνθρακα το καθένα. Η είσοδος των
σακχάρων στη γλυκόλυση ελέγχεται σε αυτό το βήμα μέσω του ενζύμου
κινάση της φωσφορικής φρουκτόζης (φωσφοφρουκτοκινάση)
Ι Βήμα 4
Ρ OH2C
Ο
CH20H
~O
(μορφή δακτυλίου)
βCΗΡΘ
(μορφή ανοικτής αλυσίδας)
Ι Βήμα 3
+
O~ /Η
μετακινειται απο το
αλδόζη μετατρέπεται σε μια κετόζη
+
Η
β-φωσφορικήγλυκόζη
Θ
δομής (ισομερίωση), το άτομο του οξυγόνου
1 (C-1) στο άτομο 2 (C-2). Έτσι μια
~:PΘ>
ΗΟ
ΟΗ
αναδιάταξη της χημικής ~β CΗΡ Ρ
άτομο άνθρακα
--
+ rm:ι
γλυκόζη
Με μια
εύκολα αντιστρεπτή
του Kαρ~oνυλίo.υ
εξοκινάση
β-φωσφορική φρουκτόζη
κινάση της φωσφορικής φρουκτόζης
+
ΟΗ
ΟΗ β-φωσφορική φρουκτόζη
1,β-διφωσφορική
Το άλλο προ'ίόν του
CΗΡΘ
CΗΡΘ
C=O
C=O
ι'
ι
προηγούμενου βήματος, η
φωσφορική διϋδροξυακετόνη υφίσταται ισομερίωση και μετατρέπεται σε 3-φωσφορική γλυκεριναλδεΟδη
φρουκτόζη
Ι
HO-C-H
Ι
αλδολάση
HO-C-H
Ι
Ι
Η
H-C-OH
Ι
+
H-C-OH
Ι
CΗΡΘ
(μορφή δακτυλίου)
(μορφή ανοικτής αλυσίδας)
1,β-διφωσφορική
Ι Βήμα 5
Το άλλο προϊόν του
προηγούμενου βήματος, η φωσφορική διϋδροξυακετόνη υφίσταται ισομερίωση και μετατρέπεται σε 3-φωσφορική γλυκεριναλδεΟδη
534
Κεφάλαιο
CΗΡΗ
Ι
φωσφορική διϋδροξυακετόνη
φρουκτόζη
ισομεράση των φωσφορικών τριαζών
C=O
ι
CΗΡΘ
Η" ,-90 ιY
C Ι
H-C-OH
Ι
CΗΡΘ
φωσφορική
3-φωσφορική
διϋδροξυακετόνη
γλυκεριναλδεΟδη
13: Τα Κύτταρα Αποκτούν Ενέργεια από τις Τροφές
3-φωσφορική γλυκεριναλδεΟδη
Ι Βήμα 6
Τα δύο μόρια 3-φωσφο-
αφυδρογονάαη της 3-φωσφορικής γλυκεριναλδεΟδης
O~ /Η ""'C
ρικής γλυκεριναλδεΟδης οξειδώνο νται. Στο βήμα αυτό αρχίζει η φάαη
Ι
παραγωγής ενέργειας, καθώς σχηματίζονται ΝΑDΗ και ένας ανυδριτικός δεσμός με το φωσφορικό, ο οποίος είναι δεσμός υψηλής ενέργειας (βλ. Εικόνα 13-5)
+
NAD+
""'cΙ
+®
H-C-OH
Ι
CΗΡ0
CΗΡ0 1,3-διφωσφογλυκερινικό
00
Ο
Η μεταφορά της
~
/ C Ι H-C-OH
φωσφορικής ομάδας υψηλής ενέργειας που σχηματίστηκε στο βήμα 6 σ' ένα μόριο ΑDΡ οδηγεί στην παραγωγή ΑΤΡ
Ι
CH 20
Ο
κινάαη του φωσφογλυκερινικού
0~
""'cΙ
+
CΗΡ0 3-φωσφογλυκερινικό
Ο φωσφοεστερικός
O~C/Oμουτάαη του φωσφογλυκερινικού
3-φωσφογλυκερινικό, όταν
ι H-c- 0
υδρολύεται αποδίδει σχετικά λιγότερη ποσότητα ελεύθερης ενέργειας. Ο δεσμός αυτός
Ι
0
CΗΡΗ
μετακινείται 'οπό το C-3 στο C-2, οπότε σχηματίζεται
2-φωσφογλυκερινικό
2-φωσφογλυκερινικό
Με αφαίρεαη νερού
από το 2-φωσφογλυκερινικό
ενολάαη
δημιουργείται ένας φωσφοενολικός δεσμός υψηλής ενέργειας
2-φωσφογλυκερινικό
Ι Βήμα 1Ο
+
Ι
0
δεσμός που απομένει στο
Ι Βήμα 9
/
H-C-OH
1,3-διφωσφογλυκερινικό
Βήμα 8
/00
H-C-OH
Ι
3-φωσφορική γλυκεριναλδεΟδη
Βήμα 7
O~
Η μεταφορά της
φωσφοενολοπυροσταφυλικό
0~C/
Ο
φωσφορικής ομάδας υψηλής ενέργειας που σχηματίστηκε στο βήμα 9 σ' ένα μόρια ΑDΡ οδηγεί στην παραγωγή ΑΤΡ. Έτσι ολοκληρώνεται η γλυκόλυαη
Ι C- 0
κινάαη του πυρασταφυλικού
O~C/O Ι
0
+
C=O
Ι
11
CH 2
CH 3
φωσφοενολοπυροσταφυλικό
πυροσταφυλικό
ΙΣΥΝΟΛΙΚΟ ΑΠΟΤΕΛΕΣΜΑ ΤΗΣ ΓΛΥΚΟΛΥΣΗΣ
CΗΡΗο
~
ΗΟ
ΟΗ
ΟΗ
ΟΗ
( (
••
{+ ιmτmι
~ ~ •
•
:
0-
O~C/ Ι
C=O
Ι
CH 3 γλυκόζη
Εκτός από το πυροσταφυλικό, όταν ολοκληρώνεται η γλυκόλυαη έχουν παραχθεί δύο μόρια ΑΤΡ και δύο μόρια ΝΑDΗ
δύο μόρια πυροσταφυλικού
Η Αποδόμηση των Σακχάρων και των Λιπιδίων
535
Εικόνα
13-4.
Η αποδόμηση του πυροσταφυ
(Α)
λlκού υπό αναερόβιες συνθήκες. (Α) Σε συν
ΖΥΜΩΣΗ ΠΟΥ ΟΔΗΓΕΙ ΣΤΟ ΣΧΗΜΑΤΙΣΜΟ ΓΑΜΚΤΙΚΟΥ
θήκες έλλειψης οξυγόνου, για παράδειγμα σ' ένα μυΙκό κύπαρο που συστέλλεται έντονα, το πυροσταφυλικό που παράγεται από τη γλυκό
λυση μετατρέπεται σε γαλακτικό με το μηχανι σμό που αποδίδεται στη διπλανή εικόνα. Η α ντίδραση αυτή οδηγεί σε αναγέννηση του NAD+ το οποίο είχε καταναλωθεί στο βήμα 6 της γλυκόλυσης. Ωστόσο, η όλη οδός συνολι
Ο
κά αποδίδει πολύ λιγότερη ενέργεια από την πλήρη οξείδωση.
(8)
~ /
0-
Ο
σμούς, όπως οι ζυμομύκητες που αναmύσσο
Ι
νται υπό αναερόβιες συνθήκες, το πυροστα
CH 3
φυλικό μετατρέπεται μέσω της ακεταλδεΟδης σε διοξείδιο του άνθρακα και αιθανόλη, ενώ παράλληλα το NAD+ αναγεννάται από το
2χ
ΝΑΟΗ, όπως απαιτείται για να συνεχιστεί η γλυκόλυση. Τόσο το (Α) όσο και το
(8)
(Β)
γαλακτικό
ΖΥΜΩΣΗ ΠΟΥ ΟΔΗΓΕΙ ΣΤΟ ΣΧΗΜΑΤΙΣΜΟ ΑΙΘΑΝΟΛΗΣ ΚΑΙ
αποτε
0-
C Ι H-C-OH Ι CH 3
C Ι C=O
Σε ορισμένους οργανι
~ /
CO 2
~λUKόζι}>
λούν παραδείγματα ζυμώσεων.
" . . . - - - - - - 2 NAD+ - . - - - - -_____
'-------. 2ΙΙΙΙ + 2Η+ Ο
~ /
2 NAD+
=-:-
000-
Step 8
,-Ι
000tH ισοκιτρικό (6C)
9 Η2
'Τ 2
HC-COO
COOOξaλOξΙKό (4C)
H-~-OH 9Η2
100-
qJ=O
μηλικό
ι
HO-CH
(4C)
COO-
COO-
ΚΥΚΛΟΣ κιτρικογ ΟΞΕΟΣ
~
'--"
ρ
Βήμα
φουμαρικό (4C)
Βήμα
7
α-κετογλουταρικό(5C)
000-
ηλεκτρυλο-CοΑ (4C)
ηλεκτρικό (4C)
CH
COOtH
'1
Ι
9Η Βήμα
COO-
6
Ι
ιoo~
C=O
aD+H+
CO 2
_
COO
9 Η2
~) lIiIίMIiJ
2
9 Η2 Ι
~H2
ΊE
NAD+
3
C=O Ι S-CoA
FAD
HS-CoA
Τα οκτώ βήματα παρουσιάζονταιλεmομερώς στη συνέχεια. Για κάθε βήμα, το τμήμα του μορίου που μεταβάλλεταισκιάζεται με μπλε χρώμα, ενώ το όνομα του ενζύμου που καταλύει την αντίδραση γράφεται σ' ένα κίτρινο ορθογώνιο
Ι
Βήμα 1
ι..
Αρχικά, με τη
δράση ενός ενζύμου,
COO-
ένα πρωτόνιο αφαίρειται από την ομάδα CH 3 του ακετυλο-CοΑ. O=C-S-CoA Το φορτισμένο αρνητικά CH 2που σχηματίζεται, συνδέεται Ι με το άτομο άνθρακα ενός CH 3 καρβονυλίου του OξaλOξΙKOύ.
Ι
C=
Ι
+
CH 2
Ι
COO-
Κατόπιν ελευθερώνεται το συνένζυμο Α (CoA). Από την υδρόλυση αυτή απελευθερώνεται σημαντική
ποσότητα ελεύθερης ενέργειας
που προωθεί ισχυρά την
Ο
.
O=C-S-CoA
-
CH 2 Ι HO-C-COO-
συνθαση ;ου κιτρικου
Σε μια αντίδραση
ισομερίωσης, στην οποία αρχικά αφαιρείται και κατόπιν επανα προστίθεται νερό, η υδροξυλο μάδα μετακινείται από ένα άτομο άνθρακα στο γειτονικό άτομο
HS-CoA + Η+
Ι
Ι
COOλ
C
ακετυ 0- ο
Α
OξaλOξΙKό
S-κιτρυλο-CοΑ ενδιάμεσο προ'ίόν
COO-
Ι
H-C-H Ι HO-C-COOΙ H-C-H Ι COO-
ΗΡ
ακοτινάση
J•
κιτρικό
546
+
CH 2
αντίδραση προς τα δεξιά
Ι Βήμα 2
Ι
Κεφάλαιο 13: Τα Κύτταρα Αποκτούν Ενέργεια από τις Τροφές
COO
Ι
H-C-H Ι C-COO11
C-H
Ι
COOc;s-οκονιτικό ενδιάμεσο προ'ίόν
κιτρικό
COO
Ι
H-C-H
Ι
H-C-COOΙ HO-C-H Ι COOισοκιτρικό
Ι Βήμα 3
Στο πρώτο από τα
τέσσερα βήματα οξείδωσης του κύκλου, το άτομο άνθρακα που έχει την υδροξυλομάδα μετατρέπεται σε μια ομάδα καρβονυλίου. Το προϊόν είναι ασταθές και χάνει CO 2 ενώ είναι ακόμα συνδεδεμένο με το ένζυμο
COOΙ H-C-H
COOΙ H-C-H
αφυδρογονάση του ισοκιτρικού
Ι
Ι
H-C-COOΙ C=O
H-C-COOΙ HO-C-H
Ι
Ι
COOΙ H-C-H Ι H-C-H
(\
Ι
C=O Ι COO-
COO-
COOισοκιτρικό
α-κετογλουταρικό
οξαλοηλεκτρικό
ενδιάμεσο
Ι Βήμα 4
Το ενζυμικό σύμπλΟΚΟ της
αφυδρογονάσης του α-κετογλουτα ρικού μοιάζει πολύ με το μεγάλο ενζυμικό σύμπλοκο που μετατρέπει το πυροσταφυλικό σε ακετυλο-CοΑ (αφυδρογονάση του πυροσταφυλικού). Κατ' αναλογία επίσης καταλύει μια οξείδωση που παράγει ΝΑΟΗ, CO2 , και
ένα θειολεστερικό δεσμό υψηλής ενέργειας με το συνένζυμο Α (CoA).
Ι Βήμα 5
'Ενα μόριο φωσφορικού
από το διάλυμα εκτοπίζει το CoA, σχηματίζοντας έναν φωσφορικό δεσμό υψηλής ενέργειας με το ηλεκτρικό (σουκκινικό). Κατόπιν το φωσφορικό αυτό μεταφέρεται από το ηλεκτρικό στο GDP, οπότε σχηματίζεται GTP. (Στα βακτήρια και τα φυτά, αντί για GTP σχηματίζεται ΑΤΡ)
Ι Βήμα 6
Στο τρίτο βήμα
οξείδωσης του κύκλου, το FAD αφαιρεί δύο άτομα υδρογόνου από το ηλεκτρικό
COOΙ H-C-H Ι H-C-H
COO-
Ι
Ι
C=O Ι S-CoA CO 2
α-κετογλουταρικό
ηλεκτρυλο-CοΑ
COO-
COO
Ι
H-C-H
συνθετάση του ηλεκτρυλο-CοΑ
Ι
Ι
H-C-H Ι COO-
ηλεκτρυλο-CοΑ
ηλεκτρικό
Ι
Ι
αφυδρογονάση του ηλεκτρικού
C-H
H-C-H
Ι
COOΙ C-H 1I
H-C Ι COO-
("\
11
H-C Ι COO-
ιzm:ι
FAD
φουμαρικό
COOΙ HO-C-H
φουμαράση
(
Ι
H-C-H Ι COO-
ΗΡ
μηλικό
φουμαρικό
COO-
Ι
HO-C-H
Ι
H-C-H
Ι
COOμηλικό
+ HS-CoA
COO-
COO-
ηλεκτρικό
Βήμα 8 Στο τελευταίο από τα τέσσερα βήματα οξείδωσης του κύκλου, το άτομο του άνθρακα που έχει την υδροξυλομάδα μετατρέπεται σε μια ομάδα καρβονυλίου. Με τον τρόπο αυτό αναγεwάται το οξαλοξικό που χρειάζεται για το βήμα 1
Ι
H-C-H
H-C-H Ι C=O Ι S-CoA
Ι
Ι
Ι
H-C-H
C=O Ι COO-
COO-
Βήμα 7 Η προσθήκη νερού στο φουμαρικό τοποθετεί μια υδροξυλομάδα δίπλα στο άτομο του άνθρακα ενός καρβονυλίου
H-C-H
+ HS-CoA
H-C-H
Ι
Ι
σύμπλοκο της αφυδρογονάσης του α-κετογλουταρικού
αφυδρογονάση του μηλικού
( NAD+
"\ 1!'!mJ+
COO
Ι
C=O
ι
CH 2
Η+
Ι
COOοξαλοξικό
Η Αποδόμηση των Σακχάρων και των Λιπιδίων
547
νται από το μοριακό οξυγόνο αλλά από το νερό. Όπως φαίνεται τημα
13-2,
mo Παράρ
σε κάθε κύκλο διασπώνται τρία μόρια νερού. Τα άτομα του οξυ
γόνου ορισμένων μορίων νερού τελικά χρησιμοποιούνται για την παραγωγή
CO2. Εδώ ας ξεκαθαρίσουμε μια κοινή παρανόηση σχετικά με την κυπαρική αναπνοή: παρότι απαιτεί παροχή 02 και παράγει CO 2, τα μόρια του οξυγόνου ανάγονται σε νερό και δεν ενσωματώνονται άμεσα σε CO 2. Εκτός από το πυροmαφυλικό και τα λιπαρά οξέα, ορισμένα αμινοξέα επί σης περνούν από το κυπαροδιάλυμα
ma μιτοχόνδρια, όπου επίσης μετατρέ
πονται σε ακετύλο-CοΑ ή σε κάποιο άλλο ενδιάμεσο του κύκλου του κιτρι κού οξέος (βλ. Εικόνα
13-2).
Επομένως,
ma
ευκαρυωτικά κύπαρα το μιτο
Χόνδριο είναι το κεντρικό σημείο mo οποίο οδηγούν όλες οι διεργασίες που αποδίδουν ενέργεια, ανεξάρτητα από το αν ξεκινούν από σάκχαρα, λίπη ή πρωτεΊνες.
Ο κύκλος του κιτρικού οξέος λειτουργεί επίσης ως αφετηρία για βιοσυν
θετικές αντιδράσεις επειδή παράγει σημαντικά ενδιάμεσα, όπως το οξαΛοξι κό και το α-κεroγΛουraρικό. Οι ενώσεις αυτές που παράγονται από τον κατα βολισμό μεταφέρονται από τα μιτοχόνδρια
mo
κυπαροδιάλυμα, όπου συμ
μετέχουν σε αναβολικές αντιδράσεις ως πρόδρομες ενώσεις για τη σύνθεση πολλών απαραίτητων μορίων, όπως τ' αμινοξέα.
Epώmσn
•
Σιο περισσότερα κύπαρα, η μειοφορά ηλεκτρονίων προωθεί
13-4
Παρωηρείmε τις αντιδρά σεις που παρουσιάΖΟνται λε πτομερώς
13-2.
mo
Παράρτημα
Κατά τη γνώμη σας,
για ποιο λόγο είναι σκόπιμο να συνδέεται η ακετυλομά
τη σύνθεση !ου μεγαλύτερου μέρους του ΑΤΡ Το κύριο μέρος της χημικής ενέργειας ενός μορίου των τροφών εκλύεται
κατά το τελευταίο βήμα της αποδόμησής του. Σε αυτή την τελική διεργασία,
οι φορείς ηλεκτρονίων
FADH2 μεταφέρουν τα ηλεκτρόνια που κέρδισαν από την οξείδωση άλλων μορίων mnv αλυσιοα μεταφοράς ηλε κτρονίων (electron-transport chain), η οποία είναι ενσωματωμένη mnv εσω NADH
και
δα μ' έναν άλλο ανθρακικό σκελετό (το
τερική μεμβράνη του μιτοχονδρίου. Καθώς προχωρούν κατά μήκος αυτής
οξαλοξικό) προτού τα δύο άτομα άνθρα
της μακριάς αλυσίδας εξειδικευμένων μορίων που λειτουργούν ως δέκτες
κα οξειδωθούν πλήρως σε
και δότες ηλεκτρονίων, τα ηλεκτρόνια πέφτουν προοδευτικά σε χαμηλότερες
CO2;
καταmάσεις ενέργειας. Η ενέργεια που εκλύεται κατά την όλη διεργασία
χρησιμεύει για τη μετακίνηση πρωτονίων (ιόντων Η+) διαμέσου της εσωτερι κής μιτοχονδριακής μεμβράνης, από το εσωτερικό του μιτοχονδρίου προς τα
έξω. Με τον τρόπο αυτό δημιουργείται μια βαθμίδωση ιόντων Η+ η οποία λειτουργεί ως πηγή ενέργειας (σαν μπαταρία) και προωθεί ποικίλες αντιδρά
σεις που απαιτούν ενέργεια. Η σημαντικότερη από αυτές τις αντιδράσεις εί ναι ο σχηματισμός ΑΤΡ με τη φωσφορυλίωση του
ADP.
Στο τέλος της αλυσίδας μεταφοράς ηλεκτρονίων, τα ηλεκτρόνια περνούν
σε μόρια αερίου
μόρια του
02 τα οποία έχουν εισέλθει με διάχυση ma μιτοΧόνδρια. Τα 02 ταυτόχρονα αντιδρούν με πρωτόνια (Η+) από το περιβάλλον
διάλυμα και παράγουν μόρια νερού. Τα ηλεκτρόνια βρίσκονται τώρα
mn χα
μηλότερη ενεργειακή mάθμη: επομένως όλη η διαθέσιμη ενέργεια έχει α
ποσπαmεί από τα μόρια της τροφής που οξειδώθηκαν. Οξειοωrικn φωσφο ΡvΜωσn (Εικόνα
13-17)
πραγματοποιείται επίσης και
mnv κυπαρική
μεμ
βράνη των βακτηρίων. Το φαινόμενο αυτό είναι ένα από τα πιο αξιοσημείω-
548
Κεφάλαιο 13: Τα Κύτταρα Αποκτούν Ενέργεια από τις Τροφές
πυpoσrαφυλΙKό
ΝΑΟΗ από τη
από τη γλυκόλυση
γλυκόλυση
Εικόνα 13-17. Τα τελικά στάδια κατά την οξεί 02
. ~ ---------
πυpoσrαφυλΙKό
δωση των μορίων των τροφών. Μόρια ΝΑDΗ και FADH 2 (δεν εικονίζεται) που παράγονται α πό τον κύκλο του κιτρικού οξέος προσφέρουν τα ηλεκτρόνιά τους, τα οποία τελικά χρησιμο
IADPI+ Ρ;
ι
ΑΚΕΤΥΛΟCοΑ
NAD+
CoA
-
2e
ποιούνται για την αναγωγή του αέριου οξυγό νου σε νερό. Μεγάλο μέρος της ενέργειας που
ΟΞΕIΔΩΤιΚΗ
ΦΩΣφοργΛΙΩΣΗ
εκλύεται κατά τη διάρκεια της πολύπλοκης διεργασίας μεταφοράς ηλεκτρονίων η οποία ε Η2Ο
..J.
βράνη (ή στην κυπαρική μεμβράνη των βακτη ρίων) αξιοποιείται για τη σύνθεση ΑΤΡ.
11
ΜΙΤΟΧΟΝΔΡΙΟ
ξελίσσεται στην εσωτερική μιτοχονδριακή μεμ
ΤΟ επιτεύγματο της κυπαρικής εξέλιξης και θα μας απασχολήσει ιδιαίτερα
Ερώmσn
στο Κεφάλαιο
Αποφασίστε αν είναι σωστή
14.
Συνολικά, η πλήρης οξείδωση ενός μορίου γλυκόΖης σε Η 2 Ο και
CO 2
ή λάθος η παρακάτω φρά
30 μορίων ΑΤΡ.
ση: «Το οξυγόνο που κατο
2 μόρια ΑΤΡ ανά μόριο γλυκόΖης παράγονται κατά τη γλυκό
ναλώνετοι κατά την οξείδω
χρησιμοποιείτοι από το κ\)παρο γω την παραγωγή περίπου Αντίθετο, μόνο
13-5
λυση.
ση της γλυκόΖης στα Ζωικά
•,
κύπαρα επιστρέφει στην α
τμόσφαιρα ως μέρος του
Αποθήκευση και χρησιμοποίηση ιων
CO 2 )}.
Πώς θα
μπορούσατε να στηρίξετε πειραματικά
ιροφών
την απάντησή σας;
Για να διατηρείτοι βιολογική τάξη στα κύπαρα, όλοι οι οργανισμοί πρέπει να KGi\ύmouv συνεΧώς τις ανάγκες τους σε ΑΤΡ. Ωστόσο, ΤΟ μεν Ζώα δεν έ χουν πάντα πρόσβαση σε τροφή ΤΟ δε φυτά είναι υποχρεωμένα να επιβιώ
νουν τη νύΧτο χωρίς ηλωκό φως και, επομένως, χωρίς τη δυνατότητο να πα ράγουν σάκχαρα με τη φωτοσύνθεση. Συνεπώς, ΤΟ Ζώα και ΤΟ φυτά ανέπτυ ξαν ΤΟ μέσα για την αποθήκευση μορίων της δίαιτος που μπορεί να κατονα λωθούν αργότερα, ότον σπανίΖουν οι πηγές ενέργειας.
ΟΙ οργανιομοί αποθηκεύουν μόρια των τροφών σε ειδικές «αποθήκες» Τα Ζώα αντέχουν σε μακρές περιόδους νηστείας αποθηκεύοντας τροφή
στα κύπαρά τους. Τα λιπαρά οξέα αποθηκεύονται κυρίως στα εξειδικευμένα λιποκύπαρα υπό μορφή λιποσταγονιδίων, που αποτελούνται από τρωκυλο γλυκερόλες οι οποίες δεν είναι δωλυτές στο νερό (Εικόνα 13-9Α). Τα σάκ
χαρα αποθηκεύονται υπό μορφή υπομονάδων γλυκόΖης στο γλυκογόνο
(glycogen)
(Εικόνα
13-18),
έναν μεγάλο διακλαδΙΖόμενο πολυσακχαρίτη, ο
οποίος βρίσκετοι σε μικρά κοκκία στο κυπαρόπλασμα πολλών κυπάρων, συμπεριλαμβανομένων των ηπατικών και των μυϊκών κυπάρων. Η σύνθεση και η αποδόμηση του γλυκογόνου ρυθμίΖονται γρήγορα σύμφωνα με τις α
νάγκες. Ότον οι ανάγκες σε ΑΤΡ υπερβαίνουν τις δυνατότητες παραγωγής ΑΤΡ από ΤΟ μόρια των τροφών που παραλαμβάνονται από την κυκλοφορία
του αίματος, τότε ΤΟ κύπαρα αποδομούν γλυκογόνο με μια αντίδραση που
Αποθήκευση και Χρησιμοποίηση των Τροφών
549
Εικόνα
13-18. Τα ζωικά
κύπαρα χρησιμοποι
ούν το γλυκογόνο ως απόθεμα ενέργειας για περιόδους νηστείας. (Α) Η δομή του γλυκογό νου και του αμύλου. Και τα δύο είναι αποθέμα
κοκκία γλυκογόνου
τα πολυμερών της γλυκόζης τα οποία διαφέ ρουν μεταξύ τους μόνο ως προς τη συχνότητα
των διακλαδώσεών τους (η περιοχή που περι κλείεται στον κίτρινο κύκλο αποδίδεται σε με γέθυνση στο κάτω μέρος της εικόνας). Οι δια
κλαδώσεις είναι πολύ περισσότερες στο γλυ κογόνο. (8) Ηλεκτρονιομικρογραφία: κοκκία γλυκογόνου στο κυπαρόπλασμα ενός ηπατο κυπάρου. (Με την άδεια των και
Daniel S. Friend).
Robert Fletterick
στο Kuπαρόπλασμα
ενός ηπατοκυπάρου
(Α)
;' /
Ι Ι Ι
, ι
\;Ζ \
\
'\. "...
--
σημείο διακλάδωσης
κατάλοιπαγλυκόζης
"'o~o '"
',μm' Oι----. ασπαρτικό, άλλα αμινοξέα, πουρίνες,
/
./
,t
./
λιπαρά οξέα
\
ΚΥΚΛΟΣ
)
ΚΙΤΡΙΚΟΥ ΟΞΕΟΣ
α-KετOγλOUΤαΡΙKό
\
r'
χοληστερόλη,
κιτρικο
οξαλοξικό
_
πυριμιδίνες
αίμη,
.~
ηλεκτρυλ~-CΟΑ
χλωροφύλλη
"-
γλOUΤαμΙKό, άλλα αμινοξέα, ποuρίνες
πό τους οποίους σχηματίΖονωιπολ/ά άλ/α μόρια του κυπάρου (Βλ. Εικόνα
3-3).
Μέχρι τώρα, δώσαμε μεγαλύτερη έμφαση στο θέμα της παραγωγής ε
νέργεΙQς κω παραΒλέψαμε την παραγωγή των πρώτων υλών γlQ Βιοσυνθέ
σεις. Ωστόσο, πολ/ά από τα ενδιάμεσα που ΣXηματίZOVΤω κατά τη γλυκόλυ ση κω τον κύκλο του κιτρικού οξέος δΙOXετεύOVΤω σε άλλα ένζυμα τα οποία τα χρησιμοποιούν για τη σύνθεση των αμινοξέων, των νουκλεοτιδίων, των λι
πιδίων και των άλλων μικρών μορίων που χρειάΖεται το κύπαρο. Μια ιδέα για την πολυπλοκότητα αυτής της διεργασίας δίνεται στην Εικόνα
13-23,
ό
που παρoυσιάZOVΤω ορισμένοι από τους κλάδους των KεVΤΡΙKών καταΒολι
κών οδών, οι οποίοι οδηγούν σε Βιοσυνθέσεις. Όπως θα δούμε αμέσως μετά, η ύπαρξη τόσο πολ/ών παράπλευρων ο δών στο κύπαρο απαιτεί προσεκτική επιλογή κω ρύθμιση σε κάθε σημείο δΙQκλάδωσης.
Ο μεταβολισμός οργανώνεται και ρυθμίΖεται Μπορεί κανείς ν' αποκτήσει μια αίσθηση της χημικής πολυπλοκότητας ε
νός κυπάρου από την Εικόνα
13-24.
Στην εικόνα αυτή παρουσιάΖετω ένα
διάγραμμα που αvτιπρoσωπεύει ορισμένες μόνο από τις ενΖυμικές οδούς του κυπάρου. Στο διάγραμμα με κόκκινο χρώμα επισημαίνOVΤω η γλυκόλυ ση κω ο κύκλος του κιτρικού οξέος. Είναι προφανές ότι μέχρι στιγμής ασχο ληθήκαμε μόνο μ' ένα πολύ μικρό μέρος της χημείας του κυπάρου.
Αποθήκευση και Χρησιμοποίηση των Τροφών
553
Εικόνα 13-24. Η γλυκόλυση και ο κύκλος του κιτρικού οξέος βρίσκονται στο κέντρο του μεταβολισμού. Στο διπλανό σχεδιάγραμμα εμφανίζονται περίπου
500
μεταβολικές αντι
δράσεις, ενός συνηθισμένου κυπάρου. Οι α
ντιδράσεις της γλυκόλυσης και του κύκλου του κιτρικού οξέος επισημαίνονται με κόκκινο χρώμα. Άλλες αντιδράσεις είτε κατευθύνονται
προς αυτές τις δύο κεντρικές οδούς και αποδί δουν μικρά μόρια προκειμένου να καταβολι στούν για παραγωγή ενέργειας, είτε οδηγού νται έξω από αυτές και παρέχουν ενώσεις του άνθρακα για βιοσυνθέσεις.
•,
Ερώmσn
ΌΛες αυτές οι αvτlδράσεlς πραγματοποιούνται σ' ένα κύπαρο με διάμε
13-7
Προϋπόθεση
για τη Λει
τρο μικρότερη από
0.1 mm. ΕπιπΛέον, η καθεμία απαιτεί ένα διαφορετικό έν Όπως φαίνεται στην Εικόνα 13-24, το ίδιο μόριο συχνά μπορεί να συμ
τουργία μιας κυκλικής οδού
Ζυμο.
αντιδράσεων είναι η ανα
μετέχει σε πολ/ές διαφορετικές οδούς. Για παράδειγμα, το πυροσταφυΛικό α
γέννηση της αρχικής ένω
ποτεΛεί υπόστρωμα για περισσότερα από έξι διαφορετικά ένΖυμα, καθένα α
σης στο τέΛος κάθε κύκλου.
πό τα οποία το τροποποιεί χημικά με διαφορετικό τρόπο. Έτσι, ένα ένΖυμο το
Διάφορες ενώσεις, ενδιά
μετατρέπει σε ακετυΛο-CοΑ, ένα άλ/ο σε οξαΛοξlκό, ένα τρίτο στο αμινοξύ α
μεσα του κύκλου του κιτρικού οξέος, διο
Λανίνη, ένα τέταρτο σε γαΛακτικό κ'0.κ' ΌΛες αυτές οι διαφορετικές οδοί συ
χετεύονται ως δομικοί Λίθοι σε ποικίλες
ναγωνίΖΟνται για το ίδιο μόριο πυροσταφυΛικού. ΑνάΛογος συναγωνισμός ε
άΜες μεταΒοΛικές αντιδράσεις. Τότε,
ξεΛίσσεται ταυτόχρονα για χιΛιάδες άλ/α μικρά μόρια. Έτσι, θα μπορούσε κα
γιατί δεν σταματά να Λειτουργεί ο κύκλος
νείς να συμπεράνει ότι το όΛο σύστημα θα ήταν εξαιρετικά ευμετάΒΛητο και
του κιτρικού οξέος;
ευάΛωτο, με συνέπεια η παραμικρή διαταραχή, όπως μια παροδική μεταΒολή στην πρόσΛηψη τροφής, να είναι δυνητικά καταστροφική. Στην πραγματικότητα, η μεταΒοΛική ισορροπία ενός κυπάρου είναι εvτυ-
554
Κεφάλαιο 13: Τα Κύτταρα Αποκτούν Ενέργεια από τις Τροφές
πωσιακά σrαθερή. Όταν διαταράσσεται η ισορροπία, 10 κύπαρο ανπδρά για ν' αΠOKατασrήσειτην αρχική KαTάσrαση. Το κύπαρο είναι ικανό να προσαρ
μόΖεται και να συνεΧίσει να λειτουργείσε περιόδους νησrείας ή ασθένειας. Διάφορες μεταλλάξειςμπορεί να βλάψουν ή ακόμα και να καταργήσουνει
δικές μεταβολικές οδούς. Μολαταύτα 10 κύπαρο επιβιώνει, αρκεί να πλη ρούνται ορισμένες ελάxισrες προϋποθέσεις.Αυτό επιτυγΧάνεταιχάρη σrη λεΙ1Ουργία ενός σύνθε1Ου δικτύου μηχανισμών ελέγχου που ρυθμίΖουν και
συντονίΖουντη λειτουργίατων ενΖύμων, διαμορφώνονταςέτοι την ταΧύτητα όλων των αντιδράσεων1Ου κυπάρου.
Βαοικέs έVVΟΙΕS •
Η γλυκόΖη και άλ/α μόρια των τροφών αποδομούνται με ελεγΧόμενη σrα διακή οξείδωση και παρέχουν χημική ενέργεια σrη μορφή των ενεργο ποιημένων φορέων ΑΤΡ και ΝΑΟΗ.
•
Η αποδόμηση των μορίων των τροφών περιλαμβάνει τρία διακριτά σrά δια: τη γλυκόλυση (η οποία πραγμα1Οποιείται σro κυπαροδιάλυμα), 1Ον κύκλο 1Ου κιτρικού οξέος (σro μΙ1Οχονδριακό σrρώμα) και την οξειδωπκή φωσφορυλίωση (σrην εσωτερική μιτοχονδριακή μεμβράνη).
•
Οι αντιδράσεις της γλυκόλυσης διασπούν 10 μόριοτης γλυκόΖης, ένα σάκ χαρο με έξι ά1Ομα άνθρακα, σε δύο μόρια πυρoσrαφυλΙKOύ,ένα σάκχαρο με τρία ά1Ομα άνθρακα. Από την όλη διεργασία παράγεταιμικρός αριθμός μορίων ΑΤΡ και ΝΑΟΗ.
•
Υπό αερόβιες συνθήκες, 10 πυρoσrαφυλΙKόμετατρέπεταισε ακετύλο-CοΑ και COz. Κατόπιν, ο κύκλος 1Ου κιτρικού οξέος μετατρέπει την ακετυλομά δα 1Ου ακετύλο-CοΑ σε
CO2 και Η 2 ο.
Στα ευκαρυωπκά κύπαρα, οι αντι
δράσεις αυτές πραγμα1Οποιούνται σrα μΙ1ΟΧόνδρια. Μεγάλο μέρος από την ενέργεια που εκλύεται σrις οξειδωπκές αντιδράσεις αποθηκεύεται με τη μορφή ηλεκτρονίων υψηλής ενέργειας σroυς φορείς ΝΑΟΗ και
FADH2· •
Η άλ/η κύρια πηγή ενέργειας σrις τροφές είναι 10 λίπος. Τα λιπαρά οξέα που παράγονταιαπό τα λίπη εισάγονται σrα μΙ1ΟΧόνδριακαι οξειδώνονται σε μόρια ακετύλο-CοΑ. Στη συνέχεια, τα μόρια 1Ου ακετύλο-CοΑοξειδώ νονται περαιτέρω μέσω 1Ου κύκλου 1Ου κιτρικού οξέος. Το ίδιο γίνεται και με τα μόρια 1Ου ακετύλο-CοΑπου προέρχονταιαπό 10 πυρoσrαφυλΙKό.
•
Τα ΝΑΟΗ και
FADH2 διοχετεύουν τα ηλεκτρόνια που περιέχουν σε μια α
λυσίδα μεταφοράς ηλεκτρονίων που εντοπίζεται σrην εσωτερική μΙ1Οχον δριακή μεμβράνη, όπου μια σειρά αντιδράσεων μεταφοράς ηλεκτρονίων χρησιμοποιείται για να προάγει 10 σχημαπσμό ΑΤΡ. Το μεγαλύτερο μέ ρος της ενέργειας που εκλύεται κατά την αποδόμησητων μορίων των τρο
φών αξιοποιείται κατά τη διάρκεια αυτής της διεργασίας που αποκαλείται οξειδωπκή φωσφορυλίωση(περιγράφεταισro Κεφάλαιο 14).
•
Τα κύπαρα αποθηκεύουν τροφές για εφεδρεία. Υπομονάδες γλυκόΖης α ποθηκεύονται σrαμεν Ζώα με τη μορφή 1Ου γλυκογόνου σrα δε φυτά με τη μορφή 1Ου αμύλου. Τόσο τα Ζώα όσο και τα φυτά αποθηκεύουν ενέργεια
Βασικές Έννοιες
555
με τη μορφή λιπών. Τα αποθέματα Τροφών των φυτών είναι βασική πηγή Τροφής για τα Ζώα και για τον άνθρωπο .
•
Τα μόρια που προσλαμβάνονται με τις τροφές χρησιμοποιούνται τόσο ως πηγή μεταβολικής ενέργειας όσο και ως πρώτες ύλες για βιοσυνθέσεις.
Έτσι, πολλά ενδιάμεσα της γλυκόΖης και του κύκλου του κιτρικού οξέος είναι η αφετηρία οδών που οδηγούν στη σύνθεση πρωτεϊνών, νουκλεϊνι κών οξέων και άλλων εξειδικευμένων μορίων του κυπάρου .
•
Οι πολλές χιλιάδες διαφορετικές αντιδράσεις που διεξάγονται ταυτόΧρο
να από ένα κύπαρο συντονίΖΟνται προσεκτικά. Έτσι, το κύπαρο μπορεί
να προσαρμόΖεται και να εξακολουθεί να λειτουργεί σ' ένα ευρύ φάσμα ε ξωτερικών συνθηκών.
Βασικοί Όροι ΑDΡ,ΑΤΡ ακετύλο-CοΑ
κύκλος κιτρικού οξέος
αλυσίδα μεταφοράς ηλεκτρονίων
λίπος
άμυλο
NAD+,NADH
γλυκογόνο
οξειδωτική φωσφορυλίωση
γλυκόΖη
πυροσταφυλικό
γλυκόλυση
FAD, FADHz
Ζύμωση
556
GDP, GTP
Κεφάλαιο 13: Τα Κύτταρα Αποκτούν Ενέργεια από τις Τροφές
Ερωιήσειs
σιάΖεται στην Εικόνα
Ερώmση
στε την απάντησή σας με βάση τις πληροφορίες που δίνο
13-7).
Για ποιο λόγο η ένωση αυτή
χρησιμεύει για την αποθήκευση ενέργειας; Δικαιολογεί
13-8
Η οξείδωση των μορίων των σακχάρων από το κύπαρο γί
νεται σύμφωνα με τη γενική αντίδραση
C6H12 0 6 (γλυκόΖη)
+ 602 ~ 6C02 + 6Η 2 Ο + ενέργεια.
Ποιες από τις ακό
νται στην Εικόνα Ερώτηση
13-7.
13-12
λουθες φράσεις είναι σωστές; Δικαιολογείστε τις απαντή
Οδοί αντιδράσεων παρόμοιες με αυτές που αποτελούν τη
σεις σας.
σύνθετη ακολουθία των αντιδράσεων της γλυκόλυσης
Α. Όλη η ενέργεια που παράγεται είναι θερμική ενέργεια.
(Παράρτημα
Β. Κατά την αντίδραση αυτή δεν παράγεται καθόλου θερ
κύπαρα, από τα βακτήρια έως τον άνθρωπο. Ωστόσο, θα
μότητα.
μπορούσε να σκεφτεί κανείς αμέτρητους εναλλακτικούς
Γ. Η ενέργεια παράγεται από την οξείδωση ατόμων άν
μηχανισμούς χημικών αντιδράσεων οι οποίοι θα διεκπε
13-1)
διεξάγονται στα περισσότερα Ζωντανά
θρακα.
ραίωναν την οξείδωση των μορίων των σακχάρων και θε
Δ. Η αντίδραση αυτή εφοδιάΖει το κύπαρο με το απαραίτη
ωρητικά θα ήταν δυνατό να είχαν εξελιΧθεί σε αντικατά
το νερό.
σταση της γλυκόλυσης. Σχολιάστε το όλο θέμα στο πλαί
Ε. Στα κύπαρα, η αντίδρ~ση πραγματοποιείται σε περισ
σιο της εξέλιξης.
σότερα από ένα βήματα. Ζ. Πολλά βήματα στην οξείδωση των μορίων των σακχά-
Ερώτηση
13-13
Υποθέστε ότι ένα Ζωικό κύπαρο είναι ένας κύβος με μή
ρων περιλαμβάνουν αντίδραση με το οξυγόνο.
Η. Ορισμένοι οργανισμοί πραγματοποιούν την αντίστρο
κος πλευράς 10 μm. Το κύπαρο περιέχει 109 μόρια ΑΤΡ
φη αντίδραση.
τα οποία χρησιμοποιεί κάθε λεπτό. Το ΑΤΡ που κατανα
Θ. Υπάρχουν κύπαρα ικανά ν' αυξάνουν υπό αναερόβιες συνθήκες και χωρίς να παράγουν
λώνεται αναπληρώνεται με οξείδωση μορίων γλυκόΖης. Μετά από πόσο χρόνο το κύπαρο θα έχει καταναλώσει μια
CO 2.
ποσότητα αερίου οξυγόνου ίση με τον όγκο του; (Ένα
Ερώmση
γραμμομόριο περιέχει 6 χ 1023 μόρια. Ένα μόριο ενός αε
13-9
Υποθέστε ότι ένα εξαιρετικά ευαίσθητο μηχάνημα (θα πρέ
ρίου έχει όγκο
22.4 λίτρων).
πει να περιμένουμε ν' ανακαλυφθεί ένα τέτοιο μηχάνημα) απέδειξε ότι ένα από τα άτομα του άνθρακα του
CO 2 της
Ερώmση
13-14
τελευταίας εKπvoής του Κάρολου Δαρβίνου βρέθηκε στην
Στις συνθήκες που επικρατούν στο κύπαρο, η ελεύθερη ε
κυκλοφορία του αίματός σας, όπου αποτελεί μέρος ενός
νέργεια των πρώτων αντιδράσεων της γλυκόλυση ς (Πα
μορίου αιμοσφαιρίνης. Πώς θα μπορούσε το άτομο αυτό
ράρτημα
τα μόρια στα οποία μπορεί να είχε ενσωματωθεί κατά τη
13-1) είναι: βήμα 1 ΔG βήμα 2 ΔG
διαδρομή του.
βήμα
3
ΔG
βήμα
4
ΔG
να φτάσει από τον Δαρβίνο σε σας; Γράψτε ορισμένα από
Ερώτηση
13-10
= -8.0 kcaVmole -0.6 kcaVmole = -5.3 kcal/mole = -0.3 kca1/mole
=
Είναι ενεργειακά ευνοϊκές οι παραπάνω αvτιδράσεις;
Οι Ζυμομύκητες αυξάνουν τόσο υπό αερόβιες όσο και υπό
Χρησιμοποιώντας τις τιμές αυτές, σχεδιάστε σε κλίμακα έ
αναερόβιες συνθήκες. Κάτω από ποιες συνθήκες αναμέ
να ενεργειακό διάγραμμα (Α) για τη συνολική αντίδραση
νετε ότι τα κύπαρα θ' αναπτύσσονταν καλύτερα και γιατί;
και (Β) για την οδό που αποτελείται από τις τέσσερις αντι δράσεις ξεχωριστά.
Ερώmση
13-11 13-15
Κατά τη διάρκεια των κινήσεων, τα μυϊκά κύπαρα απαι
Ερώmση
τούν μεγάλες ποσότητες ΑΤΡ για να καλύψουν ενεργεια
Η χημεία των περισσότερων μεταβολικών αντιδράσεων
κά τον μηχανισμό της συστολής. Τα κύπαρα αυτά περιέ
διαλευκάνθηκε με τη σύνθεση μεταβολιτών που περιείχαν
χουν μεγάλες ποσότητες φωσφορικής κρεατίνης (παρου-
ισότοπα ατόμων διαφορετικών από αυτά που υπάρχουν
Ερωτήσεις
557
αη φύση. Τα προϊόντα των αντιδράσεων που χρησιμοποι
ρικό εκχύλισμα ικανό να διενεργεί οξειδωηκή φωσφο
ούν μετοβολίτες σημασμένους με ισότοπα μπορεί ν' ανα
ρυλίωση. Ποια από ης παραγόμενες ενώσεις θα περιέ-
λυθούν ώαε να καθΟΡΙσΙούν επακριβώς ίΟ άτομα των
χει το μεγαIlυτερο μερος του
προϊόντων που προέρχονται από συγκεκριμένα άτομα των
λ'
,
l4C
;
Β. Υποθέαε όη σιο ίδιο κυπαρικό εκχύλισμα προαίθεται
ξ
λ
ξ
,
'
'δ ιενεργο 14C
αντιδρώντων. Οι μέθοδοι ανίχνευσης αξιοποιούν το γεγο
ο αιιο ικο που περιεχει ρα
νός όη τα διάφορα ισότοπα έχουν διαφορεηκή μάΖα και
'δ α του. ομα
μπορεί να διακριθούν με τη βοήθεια βιοφυσικών μεθόδων
πό έναν ακριβώς γύρο του κύκλου; (Βλ. Παράρτημα
όπως η φασματομετρία μαΖών. Επιπλέον, ορισμένα ισότο
13-2).
'
αην κετονικη
Π' ' , c ' αου θ α β ρισκοτοντο ατομο του 1 4 μετο
πα είναι ραδιενεργά και, επομένως, μπορεί ν' ανιχνευ
θούν εύκολα με μετρητές
Geiger ή έκθεση σ' ένα φωτο
Ερώτηση
13-16
γραφικό φιλμ.
Σε κύπαρα που αυξάνουν τόσο υπό αερόβιες όσο και υπό
Α. Υποθέαε όη το πυροααφυλικό που περιέχει ραδιενερ
αναερόβιες συνθήκες, η παρουσία μοριακού οξυγόνου α
γό
558
14C
αην καρβοξυλομάδαπροαίθετοι σε ένα κυπα-
Κεφάλαιο 13 : Τα Κύτταρα Αποκτούν Ενέργεια από τις Τροφές
νααέλ/ει τη Ζύμωση. Γιο ποιο λόγο συμβαίνει αυτό;
Παραγωγή Εvέργειαs σια Μιιοχόνδρια και OIOUS Χλωροπλάσιεs
Η θεμελιώδης ανάγκη για αποτελεσμαηκή παραγωγή ενέργειας είχε ση μανΤικές συνέπειες για ων εξέλιξη ως Ζωής οιη Γη. Η δομή, η λεπουργία και
η εξέλιξη των κυπάρων κΟ! των οργανισμών σε μεγάλο βαθμό εξαρτώνΤΟ! α πό ης ενεργειακές ανάγκες ωυς. Η επιβίωση ΚΟ! η ανάπωξη των πρώιμων (αρΧέγονων) κυπάρων πιθανόν βασίοιηκε οιην αποδόμηση με αναερόβια Ζύμωση οργανικών μορίων που είχαν απομείνει από προγενέοιερες γεωχη
μικές διεργασίες. ΟΙ ανΤιδράσεις ως Ζύμωσης συμβαίνουν οιο κυπαρόπλα σμα των σημερινών κυπάρων. ΟΙ ανΤιδράσεις αυτές χρησιμοποιούν την ε νέργεια που προέρχεΙΟ! από 10 πλούσια σ' ενέργεια μόρια ως τροφής για να σχημοιίσουνΑΤΡ, 10 ενεργειακόχημικό νόμισμα Των κυπάρων.
Ωοιόσο, σε πολύ πρώιμα οιάδια ως ιοιορίας της Ζωής αναπτύΧθηκεμια πολύ πιο αποτελεσμαηκήμέθοδος για την παραγωγή ενέργειας και ω σύν θεση ωυ ΑΤΡ. Η διεργασία αυτή βασίΖεΙΟ! οιη με1Οφορά ηλεκτρονίωνμέσα οιις μεμβράνες.Δισεκαωμμύριαχρόνια μετά, έχει τόσο μεγάλη σημασία για ω Ζωή πάνω οιη γη, ώοιε αφιερώνουμεολόκληρο 10 κεφάλΟ!ο αυτό οιην
παρουσίασήως. Όπως θα δούμε, 10 κύπαρα χρησιμοποιούν10 συγκεκρι μένο μηχανισμό για ν' αποκτήσουν ενέργεια από πολ/ές ΚΟ! διαφορεηκές πηγές: έιοι, για παράδειγμα, ο μηχανισμός αυτός έχει καίρια σημασία οιη με1Οτροπήως φωτεινής ενέργειας σε ενέργεια χημικών δεσμών με ω φωω σύνθεση, όπως επίσης και οιην αερόβια αναπνοή που μας επιτρέπεινα χρη
σιμοποιούμε10 οξυγόνο για να παράγουμεμεγάλες ποσόωτες ΑΤΡ από 10 μόρια ως τροφής. Ο μηχανισμόςπου θα περιγράψουμεπρωωαναπτύΧθηκε
σε βακωριακά κύπαρα περίπου πριν από 3.5 δισεκαωμμύρια χρόνια. Οι α πόγονοι αυτών των κυπάρων γέμισαν Την ατμόσφαιρα με αέριο οξυγόνο
(02) ΚΟ! aπoίKIσαν κάθε γωνιά ΚΟ! χαράδρα ως ξηράς ΚΟ! ως θάλασσας με μια τεράοιια ποικιλία ΖωνΤανών μορφών. Η προέλευσή μας ΚΟ! οι σχέσεις μας με τ' άλ/α έμβια όνΤα είναι ερωτή
μα1Ο που έχουν απασχολήσει ων άνθρωπο από πολύ παλιά. Η ιοιορία ως Ζωής, όπως διαμορφώθηκε από μια μακριά σειρά εpΕUνηηKών προσπαθει
ών, είνΟ! μια από ης πιο ΖωνΤανές και ενΤυπωσιακές αφηγήσεις. Ωοιόσο, δεν
Τα κύπαρα αποκτούν το μεγαλύτερο μέρος της ενέργειάς τους μ' έναν μηχανισμό που βασίζεται στις μεμβράνες Τα μιτοχόνδρια και η οξειδωτική φωσφορυλίωση Ένα μιτοχόνδριο περιέχει μια εξωτερική μεμβράνη, μια εσωτερική μεμβράνη και δύο εσωτερικά διαμερίσματα Ηλεκτρόνια υψηλής ενέργειας παράγονται από τον κύκλο του κιτρικού οξέος Μια χημειωσμωτική διεργασία μετατρέπει την οξειδωτική ενέργεια σε ΑΤΡ Τα ηλεκτρόνια μεταφέρονται κατά μήκος μιας αλυσίδας πρωτεϊνών της εσωτερικής μιτοχονδριακής μεμβράνης Η μεταφορά ηλεκτρονίων δημιουργεί μια βαθμίδωση πρωτονίων διαμέσου της μεμβράνης Η βαθμίδωση των πρωτονίων προωθεί τη σύνθεση τουΑΤΡ
Η συζευγμένη μεταφορά διαμέσου της εσωτερικής μιτοχονδριακής μεμβράνης προωθείται από την ηλεκτροχημική βαθμίδωση των πρωτονίων Οι βαθμιδώσεις των πρωτονίων παράγουν το μεγαλύτερο μέρος του ΑΤΡ ενός κυπάρου Η ταχεία μετατροπή του ΑΟΡ σε ΑΤΡ στα μιτοχόνδρια διατηρεί τον ενδοκυπάριο λόγο ΑΤΡ:ΑΟΡ σε υψηλά επίπεδα Αλυσίδες μεταφοράς ηλεκτρονίων και άντληση πρωτονίων Τα πρωτόνια μετακινούνται εύκολα από τη μεταφορά των ηλεκτρονίων Το οξειδο-αναγωγικό δυναμικό είναι ένα μέτρο της συγγένειας για τα ηλεκτρόνια Η μεταφορά των ηλεκτρονίων απελευθερώνει μεγάλες ποσότητες ενέργειας Ιόντα μετάλλων που προσδένονται ισχυρά σε πρωτεΙΎες σχηματίζουν ευέλικτους φορείς ηλεκτρονίων Η οξειδάση του κυτοχρώματος καταλύει την αναγωγή του οξυγόνου Ο μηχανισμός άντλησης των Η+ σύντομα θ' αποκαλυφθεί σε ατομικό επίπεδο Η αναπνοή είναι εντυπωσιακά αποτελεσματική Χλωροπλάστες και φωτοσύνθεση Οι χλωροπλάστες μοιάζουν με τα μιτοχόνδρια, διαθέτουν όμως ένα επιπλέον διαμέρισμα Οι χλωροπλάστες αιχμαλωτίζουν ενέργεια από το ηλιακό φως και τη χρησιμοποιούν για τη δέσμευση του άνθρακα Τα διεγερμένα μόρια της χλωροφύλλης διοχετεύουν ενέργεια σ' ένα κέντρο αντίδρασης Η φωτεινή ενέργεια προωθεί τη σύνθεση των ΑΤΡ και ΝΑΟΡΗ Η δέσμευση του άνθρακα καταλύεται από την καρβοξυλάση της διφωσφορικής ριβουλόζης Στους χλωροπλάστες από τη δέσμευση του άνθρακα παράγεται σουκρόζη και άμυλο Η προέλευση των χλωροπλαστών και των μιτοχονδρίων Η οξειδωτική φωσφορυλίωση προσέφερε ένα εξελικτικό πλεονέκτημα στα αρχέγονα βακτήρια Τα φωτοσυνθετικά βακτήρια είχαν ακόμα λιγότερες απαιτήσεις από το περιβάλλον τους Ο τρόπος ζωής του Methanococcus υποδηλώνει ότι η χημειωσμωτική σύζευξη είναι αρχέγονη διεργασία
559
έχουμε ακόμα συνθέσει την πΛήρη εικόνα. Χρόνο με το χρόνο, οι νέες ανα καλύψεις της κυτταρικής βιολογίας επιτρέπουν να προσθέτουμε οιη διήγησή μας περισσότερες λεπτομέρειες με μια διαδικασία μοριακής ανίχνευσης,
που αποκτά όλο και μεγαλύτερη δύναμη. Αποφασιοιική σημασία για την εξέλιξη της Ζωής είχε η εξασφάλιση ά
φθονης πηγής ενέργειας για ΤΟ κύτταρα. Σης παραγράφους που ακολου θούν, θ' ασχοληθούμε με τον αξιοσημείωτο αυτό μηχανισμό που επέτρεψε να συμβούν όλα αυτά.
Τα κύπαρα αποκτούν το μεγαλύτερο μέρος της ενέργειάς τους μ' έναν μηχανισμό που βασίΖεται στις μεμβράνες Το κύριο ενεργειακό χημικό νόμισμα των κυττάρων είναι το ΑΤΡ (βλ. Εικόνα
3-32).
Στο ευκαρυωηκά κύτταρα, μικρές ποσότητες ΑΤΡ παράγο
ντοι κατά τη διάρκεια της γλυκόλυσης στο κυτταροδιάλυμα (Κεφάλαιο
13). Ωστόσο, το μεγαλύτερο μέρος του ΑΤΡ παράγετοι στα μποχόνδρια (όπως επίσης και στους Χλωροπλάστες των κυττάρων των φυτών και των αλγών) με διεργασίες που βασίΖοντοι στις μεμβράνες. Παρόμοιες διεργα σίες συμβαίνουν επίσης και οιην κυτταρική μεμβράνη πολ/ών βακτηρίων. Ο βασικός μηχανισμός που χρησιμοποιείτοι για την παραγωγή όλου αυ τού του ΑΤΡ εμφανίστηκε πολύ πρώιμα κοτά την ιοιορία της Ζωής και ήτον τόσο επιτυχής, ώστε ΤΟ κύρια χαρακτηριοιικά του διατηρήθηκαν οιο μα
κρύ εξελΙΚΤικό τοξίδι από τους πρώιμους προκαρυώτες έως ΤΟ σημερινά κύτταρα. Η όλη διεργασία αποτελείτοι από δύο αλ/ηί\ένδετο στάδια, ΤΟ ο ποία διεκπεραιώνοντοι και ΤΟ δύο από πρωτεϊνικά σύμπλοκα ενσωματω μένα σε μια μεμβράνη.
Στάδιο
1.
Τα ηλεκτρόνια (το οποία Πe9έρχονται από την οξείδωση των
μορίων της τροφής ή από άλ/ες πηγές, όπως θα δούμε αργότερα) μετοφέ ρονται κατά μήκος μιας σειράς φορέων ηλεκτρονίων
(electron carriers), που είναι Υνωοιή ως αΛυσίδα μετοφοράς n?Jεκτροvίωv (electron-transport chain),
η οποία είναι ενσωμοτωμένη οιη μεμβράνη. Η μετοφορά αυτή απελευθερώ
νει ενέργεια που χρησιμοποιείται για την άντληση πρωτονίων (Η+, ΤΟ οποία
προέρχονται από το νερό που υπάρχει άφθονο σέ όλα ΤΟ κύτταρα) διαμέσου της μεμβράνης. Έτσι, δημιουργείτοι μια ηλεκτροχημική βαθμίδωση πρωτο
νίων (Εικόνα 14-1Α). Όπως αναφέραμε οιο Κεφάλαιο
12, μια βαθμίδωση
ιόντων διαμέσου μιας μεμβράνης είναι μια μορφή αποθηκευμένης ενέργει ας. Η ενέργεια αυτή μπορεί ν' αξιοποιηθεί για την εκτέλεση χρήσιμου έργου ότον ΤΟ ιόντα μετοκινηθούν αντίθετα διαμέσου της μεμβράνης, προς τη φορά της ηλεκτροχημικής βαθμίδωσής τους.
Στάδιο 2. Τα ιόντα των Η+ ρέουν παλίνδρομα, ακολουθώντας την ηλε κτροχημική βαθμίδωσή τους, διαμέσου ενός πρωτεϊνικού συμπί\όκου, Υνω οιού ως συvθάσn του Α ΤΡ (ΑΤΡ
σύνθεση του ΑΤΡ από
synthase).
Η συνθάση του ΑΤΡ κατολύει τη
ADP και ανόργανο φωσφορικό (Ρί), μια αντίδραση
που απαπεί ενέργεια. Το οικουμενικό αυτό ένΖυμο χρησιμεύει σαν ένας υ δροτροχός που επιτρέπει οιη βαθμίδωση Των πρωτονίων να προωθήσει την παραγωγή του ΑΤΡ (Εικόνα 14-1Β).
560
Κεφάλαιο 14: Παραγωγή Ενέργειας στα Μιτοχόνδρια και στους Χλωροπλάστες
Στη δεκαετία του
1960,
όταν προτάθηκε η διaσύνδεση της μεταφοράς
Ερώτηση
144
των ηλεκτρονίων και της άντλησης των πρωτονίων με τη σύνθεση του ΑΤΡ, η
Η δινιτροφαινόλη
όλη διεργασία ονομάστηκε χημειωσμωτική υπόθεση
dinitrophenol)
(chemiosmotic hypoth-
(DNP,
είναι ένα μι
επειδή οι αντιδράσεις που συνθέτουν ΑΤΡ (στις οποίες σχηματίΖΟνται
κρό μόριο που καθιστά τις
χημικοί δεσμοί) συνδέονται με τις διεργασίες της μεμβρανικής μεταφοράς
μεμβράνες διaπερατές στα
(ωσμωτικές διεργασίες). Το όλο φαινόμενο αναφέρεται πλέον ως xnμειω
πρωτόνιa. Τη δεκαετία του
esis),
σμωτική σύΖευξη
1940, μικρές
(chemiosmotic coupling).
•
ποσότητες αυ
Η χημειωσμωτική σύΖευξη πρώτα εξελίΧθηκε στα βακτήρια. Επομέ
τής της πολύ τοξικής ένωσης χορηγήθη
νως, δεν πρέπει να μας ξενίΖει το γεγονός ότι τα αερόβια ευκαρυωτικά
καν σε ασθενείς με σκοπό την απώλειa
κύτταρα υιοθέτησαν ακέραιους τους χημειωσμωτικούς μηχανισμούς των
σωματικού βάρους. Η ΟΝΡ υπήρξε απο
βακτηρίων, πρώτα «καταβροΧθίΖοντας» αερόβιa βαKτήριa γιa το σχηματι
τελεσματική, προκαλώντας ελάττωση των
σμό των μιτοχονδρίων και κάπως αργότερα, Ο! άλγες και τα φυτά, «κατα
αποθεμάτων του λίπους. Με ποιο μηχα
βροχθίΖοντας» κυανοβακτήρια για το σχηματισμό των Χλωροπλαστών
νισμό πιστεύετε ότι συνέβη αυτό; Ωστό
(Κεφάλαιο
σο, το φάρμακο είχε διάφορες παρενέρ
1).
Στο κεφάλαιο αυτό θα εξετάσουμε το θέμα της παραγωγής ενέργειας τό
γειες. Έτσι, κατά τη διάpKειa της θερα
σο στα μιτoxόνδριa όσο ~αι στους xiΊωρoπiΊάστες, δίνοντας έμφαση στις κοι
πείας οι ασθενείς εμφάνΙΖαν αυξημένη
νές αρχές με τις οποίες δημιουργούνται και χρησιμοποιούνται Ο! βαθμιδώ
θερμοκρασία
σεις των πρωτονίων στα συγκεκριμένα οργανίδια και στα βακτήρια. Στην αρ
Ερμηνεύστε αυτά τα συμπτώματα.
και έντονη
εφίδρωση.
χή θα περιγράψουμε τη δομή και τη λειτουργία των μιτοχονδρίων και θα εκ
θέσουμε λεπτομερώς τα γεγονότα που συμβαίνουν στη μιτoxoνδριaKή μεμ βράνη έτσι ώστε να δημιουργηθεί η βαθμίδωση των πρωτονίων και να παρα χθεί ΑΤΡ. Στη συνέχεια, θ' ασχοληθούμε με τη φωτοσύνθεση, όπως εξελίσ
σεται στους xiΊωρoπiΊάστες των φυτικών κυττάρων. Τέλος, θ' ανιχνεύσουμε τις αναπτυξιακές οδούς που δημιούργησαν αυτούς τους μηχανισμούς παρα γωγής ενέργειας. Από την εξέταση του τρόπου Ζωής ποικίλων μονοκύτταρων οργανισμών
-
από τους οποίους, ορισμένΟ! ίσως μοιάΖουν με τους αρχέγο
νους προγόνους μας
-
μπορούμε να κατανοήσουμε το ρόλο που έπαιξε η
χημειωσμωτική σύΖευξη στην άνοδο των περίπλοκων ευκαρυωτών και στην ανάπτυξη όλων των μορφών Ζωής στη Γη.
Εικόνα
14-1. Αξιοποίηση
της ενέργειας για
τη ζωή. (Α) Οι αναγκαίες προϋποθέσεις για τη χημειώσμωση είναι μια μεμβράνη, στην οποία ενσωματώνεται μια πρωτεϊνική αντλία, μια συνθάση του ΑΤΡ και πηγές ηλεκτρονίων υψη λής ενέργειας (e-) και πρωτονίων (Η+). Η α ντλία αξιοποιεί την ενέργεια από τη μεταφορά
των ηλεκτρονίων (στην Εικόνα αυτή δεν δίνο νται λεπτομέρειες) για ν' αντλήσει πρωτόνια που προέρχονται από το νερό, δημιουργώντας
\
ηλεκτρόνιο χαμηλής Ο ενέργειας ο ο
έτσι μια βαθμίδωση πρωτονίων διαμέσου της
μεμβράνης.
(8) Η βαθμίδωση αυτή λειτουργεί
ως απόθεμα ενέργειας που μπορεί να χρησι
ο
μεύσει για την πραγματοποίηση ποικίλων αντι δράσεων που απαιτούν ενέργεια στα μιτοχόν ΠΑΔΙΟ
1:
Η ΜΕΤΑΦΟΡΑ ΤΩΝ ΗΛΕΚΤΡΟΝΙΩΝ
ΠΡΟΩΘΕΙ ΜΙΑ ΑΝΤΛΙΑ ΠΟΥ ΑΝΤΛΕΙ ΠΡΩΤΟΝΙΑ ΔΙΑΜΕΣΟΥ ΤΗΣ ΜΕΜΒΡΑΝΗΣ
(Α)
ΠΑΔΙΟ 2: Η ΒΑΘΜΙΔΩΣΗ ΤΩΝ ΠΡΩΤΟΝΙΩΝ ΑΞΙΟΠΟΙΕΙΤΑΙ ΑΠΟ ΤΗ ΣΥΝΘΑΣΗ ΤΟΥ ΑΤΡ ΓΙΑ ΤΟ ΣΧΗΜΑΤΙΣΜΟ ΑΤΡ (Β)
δρια, στους χλωροπλάστες και στα βακτήρια,
μεταξύ των οποίων και η σύνθεση του ΑΤΡ από τη συνθάση. Το κόκκινο βέλος δείχνει την κα τεύθυνση της μετακίνησης των πρωτονίων σε κάθε στάδιο.
Κεφάλαιο 14: Παραγωγή Ενέργειας στα Μιτοχόνδρια και στους Χλωροπλάστες
561
Τα μn:οΧόνδρια και η οξειδωτική φωσφορυλίωση Τα μποχ6νδριο βρίσκονται σε όλα σχεδόν τα ευκαρυωτικά κύπαρα
(ma
φυτά,
ma Ζώα και mους περισσότερουςευκαρυωτικούςμικροοργανισμούς). Είναι τα οργανίδια ma οποία συντίθεται το μεγαλύτερο μέρος του ΑΤΡ ενός κυπάρου. Χωρίς αυτά, οι σύγχρονοι ευκαρυώτες θα εξαρτώνταν από τησχε τικά αναποτελεσματική διεργασία της γλυκόλυσης (Κεφάλαιο 13) για την πα
ραγωγή όλου του ΑΤΡ που θα χρειάΖονταν. Υπό αυτές τις συνθήκες, η ανά
πτυξη και επιβίωση πολύπλοκων, πολυκύπαρων οργανισμών θα ήταν μάλ λον απίθανη. Όταν η γλυκόΖη μετατρέπεται σε πυροmαφυλlκό με τη γλυκό λυση, απελευθερώνεται λιγότερο από το
10% της
συνολικής ελεύθερης ε
νέργειας που δυνητικά θα μπορούσε ν' αποδώσει η γλυκόΖη. Στα μιτοΧόν
δρια, ο μεταβολισμός των σακχάρων ολοκληρώνεται και η ενέργεια που α πελευθερώνεται αξιοποιείται τόσο αποτελεσματικά ώmε ανά μόριο γλυκόΖης
που οξειδώνεται παράγονται περίπου
30 μόρια ΑΤΡ.
Αντίθετα, κατά τη γλυ
κόλυση, ανά μόριο γλυκόΖης παράγονται μόνο δύο μόρια ΑΤΡ. Οι διαταραχές της μιτοχονδριακής λειτουργίας μπορεί να έχουν δυσμε
νείς επιmώσεις για τον οργανισμό. Χαρακτηριmlκό παράδειγμα είναι το νό
σημα που αποκαλείται μυοκίΊονικΩ επιl1nψfa κω νόσος κόκκινων μυϊκών Ι νών
(myoclonic epilepsy and ragged red fiber disease, MERRF). Η νόσος MERRF προκαλείται από μετάλλαξη ενός από τα γονίδια του μιτοχονδριακού μεταφορικού RNA (tRNA). ΧαρακτηρίΖεται από μειωμένη σύνθεση πρω τεϊνών που απαιτούνται για τη μεταφορά ηλεκτρονίων και την παραγωγή ΑΤΡ. Έτσι, οι ασθενείς με αυτή τη διαταραχή-εκδηλώνουν μυϊκή αδυναμία ή
καρδιακά προβλήματα (λόγω βλαβών
(λόγω βλαβών
mo μυοκάρδιο) και επιληψία ή άνοια ma νευρικά κύπαρα). Τα μυϊκά και τα νευρικά κύπαρα είναι
οι κύριοι mόΧΟI των μιτοχονδριακώνβλαβών επειδή η λειτουργία τους προ ϋποθέτειιδιαίτεραυψηλή κατανάλωση ΑΤΡ. Οι ίδιες μεταβολικές αντιδράσεις συμβαίνουν επίσης και
ma αερόβια βα
κτήρια, τα οποία δεν διαθέτουν μιτοχόνδρια. Στην περίπτωση αυτή, οι χημεl
ωσμωτικές διεργασίες επιτελούνται mnv κυπαρική μεμβράνη. Ωmόσο, αντί θετα από ένα βακτηριακό κύπαρο, το οποίο έχει επίσης να εκτελέσει πολ/ές άλλες λειτουργίες, το μιτοΧόνδριο έχει αποκτήσει εξαιρετική εξειδίκευση για την παραγωγή ενέργειας.
Ένα μιτοΧόνδριο περιέχει μια εξωτερική μεμβράνη, μια εσωτερική μεμβράνη και δύο εσωτερικά διαμερίσματα Σε γενικές γραμμές, τα μιτοΧόνδρια μοιάΖουν με τα βακτήρια ως προς το μέγεθος και το σχήμα τους, μολονότι τα χαρακτηριmlκά αυτά μπορεί να ποι
κίλουν ανάλογα με το είδος του κυπάρου. Τα μιτοΧόνδρια περιέχουν τα δι κά τους ιδιαίτερα μόρια ΟΝΑ και
RNA και ένα πλήρες
σύmημα μεταγραφής
και μετάφρασης, που περιλαμβάνει και ριβοσωμάτια. Έτσι, έχουν τη δυνα τότητα να συνθέτουν ορισμένες από τις πρωτεΙνες τους. Η κινηματογράφη
ση με αργό ρυθμό Ζωντανών κυπάρων αποκάλυψε ότι τα μιτοχόνδρια είναι
562
Κεφάλαιο 14: Παραγωγή Ενέργειας στα Μιτοχόνδρια και στους Χλωροπλάστες
~
ιδιαίτερα ευκίνητα οργανίδια, τα οποία συνεΧώς αλ/άΖουν σχήμα και θέση.
Σε ορισμένα κύπαρα αφθονούν ιδιαίτερα (π.Χ. κάθε ηπατοκύπαρο περιέχει
1000-2000 μιτοΧόνδρια),
οπότε μπορεί να σχηματίσουν μακριές, κινητές α
λυσίδες μαΖί με τους μικροσωληνίσκους του κυπαροσκελετού (βλ. Κεφά λαιο
17).
Σε άλλα κύπαρα, παραμένουν καθηλωμένα σε μια περιοχή του
κυπάρου έτσι ώστε να διοχετεύουν άμεσα το ΑΤΡ σε μια περιοχή που απαι τεί ιδιαίτερα αυξημένη κατανάλωση ΑΤΡ. Για παράδειγμα, σ' ένα μυοκαρ διακό κύπαρο, τα μιτοΧόνδρια εντοπίΖΟνται κοντά στη συσταλτική συσκευή, ενώ σ' ένα σπερμαΤΟΖωάριο τυλίγονται σφιχτά γύρω από το κινητό μαστίγιο (Εικόνα
14-2).
Ο αριθμός των μιτοχονδρίων σε κύπαρα διαφορετικού εί
δους ποικίλλει εντυπωσιακά και μπορεί ν' αλλάξει ανάλογα με τις ενεργεια κές ανάγκες του κυπάρου. Για παράδειγμα, στα σκελετικά μυϊκά κύπαρα ο
αριθμός των μιτοχονδρίων μπορεί ν' αυξηθεί κατά
5-1 Ο φορές λόγω της αύ
ξησης και διαίρεσης των μιτοχονδρίων που συμβαίνει αν ο μυς διεγερθεί ε παναληπτικά σε συστολή. Κάθε μιτοΧόνδριο περιβάλλεται από δύο πολύ εξειδικευμένες μεμβρά νες, η μια γύρω από την άλλη, οι οποίες παίΖουν σημαντικό ρόλο στις λει τουργίες του. Η εξωτερική και η εσωτερική μεμβράνη δημιουργούν δύο μι
τοχονδριακά διαμερίσματα: έναν μεγάλο εσωτερικό Χώρο γνωστό ως στρώ
μα
(matrix) και έναν πολύ στενότερο, τον δ1Ομεμ8ρaνικό χώρο (intermembrane space) (Εικόνα 14-3). Η βιοχημική σύσταση καθεμιάς από τις δύο
μεμβράνες και των Χώρων που περικλείονται από αυτές μπορεί να καθορι στεί με ήπια επεξεργασία ενός δείγματος καθαρών μιτοχονδρίων και κλα σμάτωση των επιμέρους συστατικών με την τεχνική της διαφορικής φυγοκέ ντρησης (βλ. Παράρτημα
4-3). Κάθε κλάσμα
περιέχει μια μοναδική συλ/ογή
πρωτεϊνών.
Η εξωτερικι1 μεμ8ράvn
(outer membrane) περιέχει
πολ/ά μόρια πορίνης,
μιας μεταφορικής πρωτεΊνης η οποία, όπως είδαμε στο Κεφάλαιο
11,
σχη
ματίΖει ευρείς υδρόφιλους διαύλους διαμέσου της διπλοστιβάδας των λιπι
δίων. Έτσι, λειτουργεί σαν ένας ηθμός, διαπερατός από όλα τα μόρια με μο ριακό βάρος έως
5000 daltons, συμπεριλαμβανομένων
και των μικρών πρω
τεϊνών. Αυτό καθιστά το διαμεμβρανικό Χώρο χημικώς ισοδύναμο με το κυτ ταροδιάλυμα, σχετικά με τα μικρά μόρια που περιέχει. Αντίθετα, η εσωτερικι1 μεμ8ράvn
(inner membrane), όπως και άλλες μεμβράνες του κυπάρου,
είναι
αδιαπέραστη από τα ιόντα και τα περισσότερα μικρά μόρια σε όλη την έκτα-
Εικόνα
14·2.
Η τοποθέτηση των μιτοχον
δρίων σε θέσεις μεγάλης κατανάλωσης ΑΤΡ. (Α) Σ' ένα μυοκαρδιακό κύπαρο, τα μιτοχόν δρια βρίσκονται κοντά στη συσταλτική συ σκευή έτσι ώστε η υδρόλυση του ΑΤΡ να πα
ρέχει την απαιτούμενη ενέργεια για τη συστο λή. (Β) Σ' ένα σπερματοζωάριο, τα μιτοχόνδρια βρίσκονται στην ουρά, γύρω από τον πυρήνα (Α)
ΜΥΟΚΑΡΔΙΑΚΟ ΚΥΠΑΡΟ
(Β)
ΟΥΡΑ ΣΠΕΡΜΑΤΟΖΩΑΡΙΟΥ
του κινητού μαστιγίου, που χρειάζεται ΑΤΡ για την κίνησή του.
Τα Μιτοχόνδρια και η Οξειδωτική Φωσφορυλίωση
563
σή της εκτός από τις θέσεις όπου υπάρχουν κατάλ/ηλοι δίαυλοι, που σχημα τίΖΟνται από τις μεταφορικές πρωτεΤνες της μεμβράνης. Επομένως, το μιτο χονδριακό στρώμα περιέχει μόνο τα μόρια που μπορεί να διαπεράσουν την
εσωτερική μεμβράνη. Με άλ/α λόγια, το περιεΧόμενό του είναι πολύ εξειδι κευμένο.
στρώμα
διαμεμβρανικός χώρος εσωτερική μεμβράνη
εξωτερική μεμβράνη
~
100 nm
Στρώμα. Αυτός ο μεγάλος εσωτερικός χώρος περιέχει ένα πολύ πυκνό μείγμα εκατοντάδων ενζύμων, στα οποία περιλαμβάνονται τα ένζυμα που απαιτούνται για την οξείδωση του πυροσταφυλικού και των λιπαρών οξέων καθώς και τα ένζυμα του κύκλου του κιτρικού οξέος. Το στρώμα περιέχει επίσης αρκετά αντίγραφα του μιτοχονδριακού γονιδιώματος, ειδικά μιτοχονδριακά ριβοσωμάτια, μόρια tRNA και ποικίλα ένζυμα απαραίτητα για την έκφραση των μιτοχονδριακών γονιδίων. Εσωτερική μεμβράνη. Η εσωτερική μεμβράνη (με κόκκινο χρώμα) είναι διπλωμένη σε πολυάριθμες ακρολοφίες, οι οποίες αυξάνουν σημαντικά τη συνολική επιφάνειά της. Περιέχει πρωτείνες που εκτελούν τρεις διαφορετικές λειτουργίες: (1) τις πρωτεί\ιες που διεκπεραιώνουν τις οξειδωτικές αντιδράσεις της αλυσίδας μεταφοράς των ηλεκτρονίων, (2) τη συνθάση του ΑΤΡ που παράγει ΑΤΡ στο στρώμα, (3) μεταφορικές πρωτείνες που επιτρέπουν τη δίοδο μεταβολιτών προς και από το στρώμα. Διαμέσου αυτής της μεμβράνης αναmύσσεται μια βαθμίδωση Η + που προωθεί τη συνθάση του ΑΤΡ. Για το λόγο αυτό, η εσωτερική μεμβράνη πρέπει να είναι αδιαπέραστη από τα ιόντα και τα περισσότερα φορτισμένα μόρια. Εξωτερική μεμβράνη. Η εξωτερική μεμβράνη είναι διαπερατή απ' όλα τα μόρια με μοριακό βάρος μικρότερο από 5000 daltons επειδή περιέχει μια μεγάλη πρωτείνη που σχηματίζει διαύλους (γνωστή ως πορίνη). Στις πρωτείνες αυτής της μεμβράνης περιλαμβάνονται ένζυμα που εμπλέκονται στη σύνθεση των λιπιδίων και άλλα ένζυμα που μετατρέπουν τα λιπίδια σε παράγωγα τα οποία στη συνέχεια μεταβολίζονται στο στρώμα. Διαμεμβρανικός χώρος. Ο χώρος αυτός (με άσπρο χρώμα) περιέχει αρκετά ένζυμα τα οποία χρησιμοποιούν το ΑΤΡ που εξέρχεται από το στρώμα για να φωσφορυλιώσουν άλλα νουκλεοτίδια
Εικόνα
14·3.
Η γενική οργάνωση ενός μιτοχονδρίου. Η καθεμία από τις τέσσερις περιοχές ενός μιτοχονδρίου περιέχει ένα μοναδικό σύ
νολο πρωτε'ίνών οι οποίες επιτρέπουν στο αvτίστoιxo διαμέρισμα να διεκπεραιώνει τις χαρακτηριστικές λειτουργίες του. Στα μιτοχόνδρια των ηπατικών κυπάρων, έχει υπολογιστεί ότι το
σωτερική μεμβράνη, το
564
67% του συνόλου των μιτοχονδριακών πρωτε'ίνών βρίσKOVΤαι στο στρώμα, το 21% στην 6% στην εξωτερική μεμβράνη και το 6% στον διαμεμβρανικό χώρο. (Με την άδεια του Daniel S. Friend).
Κεφάλαιο 14: Παραγωγή Ενέργειας στα Μιτοχόνδρια και στους Χλωροπλάστες
ε
Η εσωτερική μιτοχονδριακή μεμβράνη είναι ο τόπος όπου επιτελείται η
Ερώτηση
14-2
μεταφορά των ηλεκτρονίων και η άντληση των πρωτονίων και περιέχει τη
Όπως φαίνεται σε ηλεκτρο
συνθάση του ΑΤΡ. Οι περισσότερες πρωτεΤνες που είναι ενσωματωμένες σ'
νιοφωτογραφίες,
αυτήν αποτελούν συστατικά των αλυσίδων μεταφοράς ηλεκτρονίων οι οποίες
Χόνδρια των κυττάρων του
είναι απαραίτητες για την οξειδωτική φωσφορυλίωση. Η εσωτερική μιτοχον
μυοκαρδίου διαθέτουν πο
δριακή μεμβράνη έχει χαρακτηριστική σύσταση σε λιπίδια και επίσης περιέχει
λύ περισσότερες ακρολο
ποικίλες μεταφορικές πρωτεl\ιες που επιτρέπουν την είσοδο στο στρώμα επι
φίες από τα μιτοχόνδρια των
λεγμένων μικρών μορίων, όπως το πυροσταφυλικό και τα λιπαρά οξέα. Η εσωτερική μεμβράνη συνήθως είναι πολύ πτυχωμένη. ΣχηματίΖει μια
σειρά πτυΧών, που αναφέρονται ως ακρολοφίες
(cristae),
τα μιτο
•,
δερματικών κυττάρων. Ερμηνεύστε αυτή την παρατήρηση.
οι οποίες προβάλ
λουν στο μιτοχονδριακό στρώμα και αυξάνουν πολύ την επιφάνεια της μεμ βράνης (Εικόνα
14-3). Με τον τρόπο
αυτό εξασφαλίζεται μια μεγάλη επιφά
νεια στην οποία μπορεί να συμβεί η σύνθεση του ΑΤΡ. Για παράδειγμα, σ' έ να ηπατοκύτταρο, το άθροισμα της επιφάνειας της εσωτερικής μεμβράνης ό λων των μιτοχονδρίων είναι ίσο περίπου με το ένα τρίτο της επιφάνειας του συνόλου των μεμβρανών .του κυττάρου. Επίσης, ο αριθμός των ακρολοφιών
είναι τριπλάσιος στα μιτοΧόνδριο ενός μυοκαρδιακού κυττάρου σε σύγκριση προς ένα ηπατοκύτταρο, μάλ/ον εξαιτίας των μεγαλύτερων αναγκών σε ΑΤΡ.
Ηλεκτρόνια υψηλής ενέργειας παράγOVΤαI από τον κύκλο
του κιτρικού οξέος Ο μεταβολισμός των μορίων των τροφών ολοκληρώνεται στα μιτοΧόν δρια. Τα μιτοΧόνδρια έχουν τη δυνατότητα να χρησιμοποιούν ως καύσιμα
τόσο το πυροσταφυλικό οξύ όσο και τα λιπαρά οξέα. Το πυροσταφυλικό οξύ προέρχεται από τη γλυκόΖη και άλλα σάκχαρα, ενώ τα λιπαρά οξέα από τα λί πη. Και τα δύο είδη καυσίμων μεταφέρονται διαμέσου της εσωτερικής μιτο χονδριακής μεμβράνης και κατόπιν μετατρέπονται στο καίριο μεταβολικό εν διάμεσο, το aκεrvί\ο-CοΑ, με τη δράση ενΖύμων που εντοπίΖονται στο μιτο
χονδριακό στρώμα (βλ. Εικόνα
13-10).
Στη συνέχεια, οι ακετυλομάδες του
ακετυλο-CοΑ οξειδώνονται στο στρώμα μέσω του κύκλου του κιτρικού οξέ
ος. Ο κύκλος παράγει
CO z, το
οποίο αποβάλλεται από το κύτταρο, και ηλε
κτρόνια υψηλής ενέργειας που μεταφέρονται από τα ενεργοποιημένα μόρια
φορείς ΝΑΟΗ και
FADH z (Εικόνα 14-4).
Στη συνέχεια, τα ηλεκτρόνια αυτά
μεταφέρονται στην εσωτερική μιτοχονδριακή μεμβράνη, όπου εισέρχονται
στην αλυσίδα μεταφοράς ηλεκτρονίων. Η απώλεια των ηλεκτρονίων από τα
ΝΑΟΗ και
FADHz οδηγεί σε αναγέwηση των NAD+ και FAD, που είναι α
παραίτητα για να συνεχιστεί ο οξειδωτικός μεταβολισμός. Από το σημείο αυ τό, αρχίΖει η μεταφορά των ηλεκτρονίων κατά μήκος της αλυσίδας. Η πλήρης
ακολουθία των αντιδράσεων αποδίδεται συνοπτικά στην Εικόνα
14-5.
Μια χημειωσμωIlκή διεργασία μετατρέπει την οξειδωIlκή
ενέργειο σε ΑΤΡ Παρότι ο κύκλος του κιτρικού οξέος θεωρείται μέρος του αερόβιου μετα βολισμού, εντούτοις δεν χρησιμοποιεί μοριακό οξυγόνο. Άμεση κατανάλω-
Τα Μιτοχόνδρια και η Οξειδωτική Φωσφορυλίωση
565
ασταθέςισομερές
ΑΝΑΔΙΑΤΑΞΗ ΔΕΣΜΩΝ
ΠΡΟΣΦΟΡΑ ΗΛΕΚΤΡΟΝΙΩΝ
Τ
ιόν υδριδίου
Η:
Η λ. +
Εικόνα
14-4.
2
e- _
δύοηλεκτρόνιαπροςτην αλυσίδα
μεταφοράς ηλεκτρονίων της μεμβράνης
Πώς προσφέρει ηλεκτρόνια το αυτό, τα ηλεκτρόνια
NADH. Στο σχεδιάγραμμα
υψηλής ενέργειας αποδίδονται ως δύο κόκκι νες κηλίδες πάνω σ' ένα κίτρινο άτομο υδρογό
ση οξυγόνου συμβαίνει μόνο σης τελικές καταβολικές ανηδράσεις που δια
= ένα άτομο υδρο
δραματίΖΟνται στην εσωτερική μιτοχονδριακή μεμβράνη. Σχεδόν όλη η ε
γόνου και ένα επιπλέον ηλεκτρόνιο) αφαιρείται
νέργεια που προέρχεται από την καύση των υδατανθράκων, των λιπών και
νου. Ένα ιόν υδριδίου (Η-
από το ΝΑDΗ και μετατρέπεται σ' ένα πρωτό νιο και δύο ηλεκτρόνια υψηλής ενέργειας: Η
άλλων μορίων των τροφών σε πρωιμότερα στάδια της οξείδωσης πρώτα α
μόνο ο
ποθηκεύεται στα ενεργοποιημένα μόρια φορείς τα οποία παράγονται κατά τη
δακτύλιος που μεταφέρει τα ηλεκτρόνια συν
γλυκόλυση και τον κύκλο του κιτρικού οξέος, δηλαδή το ΝΑΩΗ και το
~ Η+
+ 2e-. Στην εικόνα παρουσιάζεται
δεδεμένα μ' έναν δεσμό υψηλής ενέργειας (για την πλήρη δομή του ΝΑDΗ και το σχηματισμό
FADH2 . Αυτά τα μόρια-φορείς δωρίΖουν ηλεκτρόνια υψηλής ενέργειας στην
του από το
αλυσίδα μεταφοράς ηλεκτρονίων της μιτοχονδριακής μεμβράνης και με τον
NAD+
παρατηρείστε τη δομή του
συγγενικού μορίου ΝΑDΡΗ στην Εικόνα
3-35).
Ηλεκτρόνια μεταφέρονται επίσης με ανάλογο τρόπο από το
FADH 2 ,
η δομή του οποίου πα
ρουσιάζεται στην Εικόνα
13-128.
τρόπο αυτό οξειδώνονται σε NAD+ και FAD. Τα ηλεκτρόνια μεταφέρονται γρήγορα κατά μήκος της αλυσίδας προς το μοριακό οξυγόνο
(02) για το ΣΧη
μαησμό νερού (Η 2 Ο).
εξωτερική μιτοχονδριακή μεμβράνη
εσωτερική μιτοχονδριακή μεμβράνη
Εικόνα
14-5. Συνοπτική
απόδοση των μετα
βολικών διεργασιών που παράγουν ενέργεια
α -R_--tt-=Ε=ΞΩ. α
στα μιτοχόνδρια. Το πυροσταφυλικό και τα λι παρά οξέα εισέρχονται στο μιτοχόνδριο (κάτω μέρος της εικόνας), μετατρέπονται σε ακετυ
---H---H-IADPI + Ρ;
λο-CοΑ και στη συνέχεια μεταβολίζονται από τον κύκλο του κιτρικού οξέος, στον οποίο το
NAD+ ανάγεται σε FADH 2 , η αναγωγή
ΝΑDΗ (και το
FAD+
ΕΞΩ
σε
αυτή δεν παρουσιάζεται
στην εικόνα). Κατά τη διεξαγωγή της οξειδωτι ακετυλο-CοΑ
κής φωσφορυλίωσης, ηλεκτρόνια υψηλής ε νέργειας από το ΝΑDΗ (και το
FADH 2)
μετακι
νούνται κατά μήκος της αλυσίδας μεταφοράς
/
"
πυροσταφυλικό
λιπαρά οξέα
πυροσταφυλικό
λιπαρά οξέα
των ηλεκτρονίων στην εσωτερική μεμβράνη και
φτάνουν στο οξυγόνο (02)' Αυτό το σύστημα μεταφοράς ηλεκτρονίων δημιουργεί μια βαθμί δωση πρωτονίων διαμέσου της εσωτερικής μι
τοχονδριακής μεμβράνης, η οποία προωθεί τη σύνθεση του ΑΤΡ από τη συνθάση του ΑΤΡ.
566
!
Ι
ΜΟΡΙΑ ΤΗΣ ΤΡΟΦΗΣ ΑΠΟ ΤΟ ΚΥΠΑΡΟΔΙΜΥΜΑ
Κεφάλαιο 14: Παραγωγή Ενέργειας στα Μιτοχόνδρια και στους Χλωροπλάστες
Εικόνα
βαθμίδωση Η+
2e~' Ι
aED
μόρια λιπών και
υδατανθράκων
14-6. Άντληση πρωτονίων στα μιτο
χόνδρια. Στην εικόνα αυτή παρουσιάζεται μόνο το πρώτο στάδιο της χημειωσμωτικής σύζευ
ξης. Τα εισερχόμενα φαίνονται ανοιχτά κίτρινα,
........
ενώ τα παραγόμενα μπλε. Η ροή των ηλεκτρο
αντλία
νίων υποδηλώνεται από τα κόκκινα βέλη.
Η+
2e-tΙ
κύκλος _του κιτρικού ~
οξέος
~
προ'ίόντα
Η ενέργεια που απείΊευθερώνεται κατά τη διέίΊευση των ηίΊεκτρονίων κα τά μήκος της αίΊυσίδας μεταφοράς των ηλεκτρονίων χρησιμοποιείται για την άντίΊηση πρωτονίων (Εικόνα
14-6). Με τη σειρά της,
η βαθμίδωση των πρω
τονίων προωθεί τη σύνθεση του ΑΤΡ, οίΊοκληρώνοντας έτσι τον χημειωσμω
τικό μηχανισμό. Η όίΊη διεργασία συνίααται σε κατανάίΊωση
02 και
σε πα
ράίΊίΊηίΊη σύνθεση ΑΤΡ, με την προσθήκη μιας φωσφορικής ομάδας αο
ADP. Για το ίΊόγο αυτό αποκαίΊείται phosphorylation) (Εικόνα 14-7).
οξειδωτικΠ φωσφορυλίωση
(oxidative
Ο βασικός χημειωσμωτικός μηχανισμός χρησιμοποιείται για την παρα
~
γωγή ΑΤΡ από τους περισσότερους Ζωντανούς οργανισμούς. Η πηγή των η
ίΊεκτρονίων που προωθούν την άντίΊηση των πρωτονίων ποικίίΊίΊει πολύ. Ό πως αναφέραμε, αην αερόβια αναπνοή που παράγει ΑΤΡ αα μιτοΧόνδρια και
m'
ΟΞΕIΔΩΤιΚΗ
αερόβια βακτήρια, τα ηίΊεκτρόνια τείΊικά προέρχονται από την οξείδω
Ι
14-7).
Στη
χημειωσμωτική σύνδεση κατά τη φωτοσύνθεση, τα απαραίτητα ηίΊεκτρόνια προέρχονται από την επίδραση του φωτός αην πράσινη χρωαική, τη χίΊω ροφύλ/η. ΤέίΊος, πολ/ά βακτήρια χρησιμοποιούν ως πηγή των ηίΊεκτρονίων
υψηίΊής ενέργειας που χρειάΖονται για τη σύνθεση του ΑΤΡ διάφορες ανόρ γανες ουσίες, όπως το υδρογόνο, τον σίδηρο και το θείο.
ΦΩΣΦΟΡΥΛΙΩΣΗ ~
/
ση της γίΊυκόΖης ή των ίΊιπαρών οξέων και το οξυγόνο δρα ως τείΊικός δέκτης
των ηίΊεκτρονίων, παράγοντας νερό ως άχρηαο προϊόν (Εικόνα
)
διεργασίες μετατροπής ενέργειας στη μεμβράνη
'"'"'"
11Ι
IADPI+p; Εικόνα
14-7.
Η κυριότερη μετατροπή ενέρ
γειας καταλύεται από το μιτοχόνδριο. Στην ο ξειδωτική φωσφορυλίωση, η ενέργεια που α
πελευθερώνεται από την οξείδωση του ΝΑΟΗ σε
NAD+ τιθασεύεται,
μέσω διεργασιών μετα
τροπής της ενέργειας που πραγματοποιού
Στη συνέχεια θα παρουσιάσουμε σε γενικές γραμμές τις αντιδράσεις που
καθιαούν εφικτή την οξειδωτική φωσφορυίΊίωση.
νται στη μεμβράνη (μεταφορά ηλεκτρονίων, ά
ντληση πρωτονίων και ροή των πρωτονίων δια μέσου της συνθάσης του ΑΤΡ) και καλύmει ε νεργειακά τη φωσφορυλίωση του ΑΟΡ για το
Τα ηλεκτρόνια μειοφέΡΟνΙαι κατά μήκος μιας αλυσίδας
σχηματισμό ΑΤΡ. Τα ηλεκτρόνια υψηλής ενέρ γειας που χάθηκαν από το ΝΑΟΗ μετακινού
πρωτεϊνών της εσωτερικής μιιοχονδριακής μεμβράνης
νται κατά μήκος μιας αλυσίδας μεταφοράς η
Η αλυοιΟΟ μεrαφoράςnλεκτρovίων
(electron transport chain), Υνωαή ε πίσης και ως αναπνευσrl~ή αilvσfδα (respiratory chain), η οποία διεκπεραιώ νει την οξειδωτική φωσφορυίΊίωση, βρίσκεται αην εσωτερική μιτοχονδρια κή μεμβράνη σε πολ/ά αντίγραφα. Περιέχει πάνω από
οποίες περίπου
15 εμπίΊέκονται
40 πρωτε'ϊνες,
από τις
άμεσα αη μεταφορά των ηίΊεκτρονίων. Οι
λεκτρονίων της μεμβράνης και τελικά αντι δρούν με το μοριακό οξυγόνο και Η+ για το
σχηματισμό νερού. Η συνολική εξίσωση γι' αυ τή τη διεργασία μεταφοράς ηλεκτρονίων είναι:
ΝΑΟΗ
+ %02 + Η+ -7 NAD+ + Η 2 Ο, όταν δύο
ηλεκτρόνια περνούν από το ΝΑΟΗ στο οξυγό νο (βλ. Εικόνα
14-6).
Τα Μιτοχόνδρια και η Οξειδωτική Φωσφορυλίωση
567
Ισιορική Αναδρομή: Πώs η χημειωσμωnκή σύΖευξη προωθεί ιη σύνθεση ιου ΑΤΡ Το
ο
1861
Louis Pasteur ανακάλυψε
Αξιοποίηση της ισχύος
ότι τα κύπαρα της ζύμης
Το
αυξάνουν και διαιρούνται πιο έντονα υπό αερόβιες συνθήκες. Έ τσι, για πρώτη φορά αποδείχθηκε ότι ο αερόβιος μεταβολισμός
1961, ο Peter Mitchell διατύπωσε
για πρώτη φορά την άποψη
ότι το «ενδιάμεσο υψηλής ενέργειας» που αναζητούσαν οι συνά
είναι πιο αποτελεσματικός από τον αναερόβιο. Οι παρατηρήσεις
δελφοί του ήταν η ηλεκτροχημική βαθμίδωση πρωτονίων την ο
του
σωστές: σήμερα γνωρίζουμε ότι η οξειδωτική
ποία παρήγαγε το σύστημα μεταφοράς των ηλεκτρονίων. Σύμφω
φωσφορυλίωση παράγει ΑΤΡ πολύ πιο αποτελεσματικά από τη
να με το μοντέλο του, που ονομάστηκε χημειωσμωτική υπόθεση, η
Pasteur ήταν
γλυκόλυση. Τα συστήματα μεταφοράς ηλεκτρονίων παράγουν
ενέργεια μιας βαθμίδωσης Η+ που σχηματίζονται κατά τη δίοδο
περίπου
των ηλεκτρονίων μέσω της μεταφορικής αλυσίδας αξιοποιείται για
30 μόρια ΑΤΡ για κάθε
μόριο γλυκόζης που οξειδώνεται,
ενώ μόνο η γλυκόλυση αποδίδει μόλις δύο μόρια ΑΤΡ. Χρειάστη
να προωθήσει τη σύνθεση του ΑΤΡ.
κε να περάσουν άλλα εκατό χρόνια για να καθοριστεί ότι η παρα
Αρκετές διαφορετικές ενδείξεις στηρίζουν τη χημειωσμωτική
γωγή ενέργειας με τόση αποτελεσματικότητα οφείλεται στη διερ
σύζευξη. Πρώτον, τα μιτοχόνδρια πράγματι αναmύσσουν μια βαθ
γασία της χημειωσμωτικής σύζευξης, δηλαδή στην αξιοποίηση
μίδωση πρωτονίων διαμέσου της εσωτερικής μεμβράνης τους. Τι
της άντλησης των πρωτονίων για την προώθηση της σύνθεσης
εξυπηρετεί αυτή η βαθμίδωση; Αν η ηλεκτροχημική βαθμίδωση Η+ (γνωστή επίσης και ως πρωτονιοκινητική δύναμη) ήταν απαραίτη
του ΑΤΡ.
τη για τη σύνθεση του ΑΤΡ, όπως προτείνει η χημειωσμωτική υπό Υποθετικά ενδιάμεσα Τη δεκαετία του
θεση, τότε η απαλοιφή της (ή, εναλλακτικά, η καταστροφή της ί
1950 πολλοί ερευνητές
πίστευαν ότι η οξειδωτι
διας της μεμβράνης) θα οδηγούσε σε αναστολή της παραγωγής ε
κή φωσφορυλίωση που συμβαίνει στα μιτοχόνδρια παράγει ΑΤΡ
νέργειας. Αυτό όντως συμβαίνει. Η αποδιοργάνωση της εσωτερι
περίπου όπως και η γλυκόλυση. Κατά τη γλυκόλυση, ΑΤΡ παράγε
κής μιτοχονδριακής μεμβράνης διακόmει τη σύνθεση του ΑΤΡ. Το
ται με άμεση φωσφορυλίωση ενός μορίου ΑDΡ από ένα ενδιάμεσο υψηλής ενέργειας. Τέτοια φωσφορυλίωση συμβαίνει στα βήματα 7
πρωτονίων με χημικούς παράγοντες «αποσύζευξης», όπως η
ίδιο αποτέλεσμα έχει και ο εκμηδενισμός της βαθμίδωσης των
2,4-
1Ο της γλυκόλυσης: εκεί, οι φωσφορικές ομάδες υψηλής ενέρ γειας του 1,3-διφωσφογλυκερινικού και του φωσφοενολοπυρο
τερική μιτοχονδριακή μεμβράνη, όπου δρουν ως φορείς Η+, εξα
σταφυλικού μεταφέρονται στο ΑDΡ οπότε σχηματίζεται ΑΤΡ (βλ.
σφαλίζοντας μια οδό για τη ροή των Η+ που παρακάμmει τη συν
Παράρτημα
θάση του ΑΤΡ (Εικόνα
και
13-1). Την εποχή
δινιτροφαινόλη. Αυτοί οι παράγοντες ενσωματώνονται στην εσω
εκείνη ήταν διαδεδομένη η υπόθεση
14-8).
Με αυτό τον τρόπο προκαλούν απο
ότι, κατ' αντίστοιχο τρόπο, η αλυσίδα μεταφοράς των ηλεκτρονίων
σύζευξη της μεταφοράς των ηλεκτρονίων από τη σύνθεση του
στα μιτοχόνδρια θα παρήγαγε κάποιο ενδιάμεσο υψηλής ενέργει
ΑΤΡ. Εξαιτίας αυτής της παράκαμψης, η πρωτονιοκινητική δύναμη
ας, το οποίο στη συνέχεια θα προσέφερε τη φωσφορική ομάδα
εκμηδενίζεται και σταματά η σύνθεση του ΑΤΡ.
του άμεσα στο
ADP. Αυτό το μοντέλο
πυροδότησε την άκαρπη και
Στη φύση, ανάλογη αποσύζευξη συμβαίνει σε μερικά εξειδικευ
μάταια, μακροχρόνια αναζήτηση του μυστηριώδους ενδιαμέσου.
μένα λιποκύπαρα. Στα λεγόμενα καστανά λιποκύπαρα, το μεγα
Διάφοροι ερευνητές κατά καιρούς ισχυρίστηκαν ότι είχαν ανακα
λύτερο μέρος της ενέργειας από την οξείδωση αντί να μετατραπεί
λύψει το αγνοούμενο ενδιάμεσο, αλλά, όπως αποδείχθηκε, οι σχε
σε ΑΤΡ χάνεται υπό 'μορφή θερμότητας. Η εσωτερική μεμβράνη
τικές ενώσεις είτε δεν σχετίζονταν με τη μεταφορά των ηλεκτρο
των μεγάλων μιτοχονδρίων αυτών των κυπάρων περιέχει μια ειδι
νίων είτε ήταν «αποκυήματα φαντασίας υψηλής ενέργειας», όπως
κή μεταφορική πρωτεΊνη που επιτρέπει στα πρωτόνια να μετακι
εύστοχα το έθεσε ένας ερευνητής σε μια ανασκόπηση για την ι στορία της βιοενεργειακής επιστήμης.
νούνται στη φορά της ηλεκτροχημικής βαθμίδωσής τους, παρακά μmοντας τη συνθάση του ΑΤΡ. Έτσι, τα κύπαρα οξειδώνουν γρή-
εξωτερική μιτοχοvδριακή μεμβράνη
εσωτερική μιτοχοvδριακή μεμβράνη
ο
--L
προσθήκη παράγοντα αποσύζευξης
IADp!+ Pj Εικόνα
14-8, Οι παράγοντες
αποσύζευξης είναι φορείς Η+ ικανοί να ενσωματώνονται στην εσωτερική μιτοχονδριακή μεμβράνη, Κα
θιστούντη μεμβράνη διαπερατή από τα πρωτόνια: έτσι, τα Η+ εισρέουν στο μιτοχόνδριο παρακάμmοντας τη συνθάση του ΑΤΡ. Κατ' αυ τόν τον τρόπο προκαλείται αποσύζευξη της μεταφοράς των ηλεκτρονίων από τη σύνθεση του ΑΤΡ.
'"
.,~
~ ..
/lc,
~
~
-,"
/~ς και στα Ζωικά κύπαρα, 10 μεγai\ύτερο μέρος του
ΑΤΡ που υπάρχει στο κυπαροδιάλυματων φυηκών κυπάρων παράγεται από την οξείδωσητων σακχάρωνκαι των λιπών στα μιτοχόνδρια.
Οι χλωροπλάστεςμοιάΖουv με IQ μnοχόvδρια,
διαθέτουv όμως έvα επιπλέοv διαμέΡΙσμα Οι χλωροπλάστεςδιεκπεραιώνουνης αλ/ηλομετατροπέςενέργειας μέ σω βαθμιδώσεωνπρωτονίων, περίπου όπως και τα μιτοχόνδρια. Μολονόη
μεγαλύτεροιαπό τα μιτοχόνδρια (Εικόνα 14-29Α), εν τούτοις οργανώνονται με ης ίδιες βασικές αρχές. Διαθέτουν μια πολύ διαπερατή εξωτερική μεμ-
Εικόνα
14-28.
Μικροοργανισμοί που εκτε
λούν φωτοσύνθεση παράγοντας οξυγόνο άλλαξαν την ατμόσφαιρα της γης. (Α) Ζωντα νοί στρωματόλιθοι από μια λιμνοθάλασσα στη
Δυτική Αυστραλία. Οι στρωματόλιθοι δημιουρ γούνται από μεγάλες αποικίες φωτοσυνθετι κών κυανοβακτηρίων που παράγουν οξυγόνο και εναποθέτουν διαδοχικές στιβάδες υλικού.
Στρωματόλιθοι σχηματίζονται υπό ειδικές συν θήκες. (Β) Εγκάρσια διατομή ενός σύγχρονου
στρωματόλιθου, όπου φαίνεται η πολύστιβη δομή του. (η Εγκάρσια διατομή ενός απολι θωμένου στρωματόλιθου σ' ένα πέτρωμα ηλι
κίας
3.5
δισεκατομμυρίων ετών. Προσέξτε ότι
η δομή του μοιάζει με τη δομή του (Β). Οι απο
λιθωμένοι στρωματόλιθοι θεωρείται ότι σχη ματίστηκαν από φωτοσυνθετικά βακτήρια που έμοιαζαν πολύ με τα σύγχρονα κυανοβακτή
ρια. Η δραστηριότητα τέτοιων βακτηρίων που απελευθερώνουν αέριο 02 ως απόβλητο προ"ί όν της φωτοσύνθεσης, σιγά-σιγά άλλαξε την ατμόσφαιρα της γης. (Α. με την άδεια της
SalBirch, Oxford Scientific Films. Β και Γ. με την άδεια του S.M. Awramik, University of CaliforniaJBiological Photo Service). ΙΥ
Χλωροπλάστες και Φωτοσύνθεση
591
KUΠαΡΙKό τοίχωμα ~ κενοτόπιο
περίβλημα του χλωρο
πλάστη
(Α)
ι
5
0.5
μm
μm
κενοτόπιο
θυλακοειδές
/
~_..,.~~~;;; ~λrnα, \
KUΠαΡΙKό τοίχωμα (Β)
1 μm
Εικόνα 14-29. Ηλεκτρονιογραφίες χλωροπλαστών. (Α) Ένα κύπαρο από ένα φύλλο σιταριού στο οποίο ένας λεmός δακτύλιος κυπαρο πλάσματος, που περιέχει τον πυρήνα, τους χλωροπλάστες και τα μιτοχόνδρια, περιβάλλει ένα μεγάλο κενοτόπιο. (Β) Μια λεmή τομή ενός μεμονωμένου χλωροπλάστη. Φαίνονται το περίβλημα του χλωροπλάστη, κοκκία αμύλου και σταγονίδια λιπιδίων (λιποσταγονίδια) τα οποία
έχουν συσσωρευθεί στο στρώμα ως αποτέλεσμα των βιοσυνθέσεων που συντελούνται εκεί. (η Σε μεγάλη μεγέθυνση, δύο στοίβες θυλακο ειδών που αναφέρονται ως κοκκία
(grana). (Με την άδεια του Κ. Plaskitt).
βράνη και μια πολύ λιγότερο διαπερατή εσωτερική μεμβράνη, στην οποία εί
ναι ενσωματωμένες οι μεμβρανlκές πρωτεΊνες μεταφοράς. Ανάμεσα στις δύο μεμβράνες παρεμβάλλεται ο στενός διαμεμβρανlκός χώρος. ΜαΖί οι δύο μεμβράνες σχηματίΖουν το περίβλημα του χλωροπλάστη (Εικόνα
298).
14-
Η εσωτερική μεμβράνη περιβάλ/εl ένα μεγάλο χώρο, γνωστό ως
σφώμα
(stroma), ο οποίος
είναι ανάλογος με το μιτοχονδριακό στρώμα και
περιέχει πολ/ά μεταβολικά ένΖυμα. Όπως συνέβη και με τα μιτοΧόνδρια, οι
χλωροπλάστες εξελίΧθηκαν από ένα βακτήριο που εγκολεάσθηκε σ' ένα αρ Χέγονο κύπαρο και εξακολουθούν ακόμα να περιέχουν το δικό τους, ιδιαίτε ρο, γονιδίωμα και γενετικό σύστημα. Επομένως, το στρώμα, κατ' αναλογία
με το μιτοχονδριακό στρώμα, επίσης περιέχει μια ειδική ομάδα από ριβοσω μάτια και μόρια
592
RNA και
ΟΝΑ.
Κεφάλαιο 14: Παραγωγή Ενέργειας στα Μιτοχόνδρια και στους Χλωροπλάστες
Ωσrόσo, υπάρχει μια σημαντική διαφορά ανάμεσα σrην οργάνωση των
Ερώτηση 14-8
Οι XΛωρoπλάσrες
νη των XΛωρoπλασrών δεν περιέχει αλυσίδες μεταφοράς των ηλεκτρονίων.
τουν ένα τρίτο εσωτερικό
Αντίθετα, τα συσrήματα για τη δέσμευση του φωτός, οι αλυσίδες μεταφοράς
διαμέρισμα: πρόκειτοι για
των ηλεκτρονίων και η συνθάση του ΑΤΡ περιέχονται σrη θυΛακοειδή μεμ
τον θυλακοειδή χώρο ο ο
8ράνn
μια τρίτη μεμβράνη, η οποία σχηματίΖει ένα
ποίος περιβάλλεται από τη
σύνολο επιπεδωμένων, δισκοειδών ασκών που αναφέρονται ως θυΛακοει
θυλακοειδή μεμβράνη. Η
δή
βλ. Εικόνα 14-29Γ). Τα θυλακοειδή διατάσσονται κατά σroί
μεμβράνη αυτή περιέχει τα φωτoσυσrή
βες, ο δε χώρος που βρίσκεται σro εσωτερικό κάθε θυλακοειδούς θεωρείται
ματα, τα κέντρα αντίδρασης, την αλυσίδα
ότι επικοινωνεί με τον αντίσroιxo χώρο άλ/ων θυλακοειδών. Έτσι, σχηματί
μεταφοράς των ηλεκτρονίων και τη συν
Ζουν ένα συνεΧές τρίτο διαμέρισμα, το οποίο διαχωρίΖεται από το σrρώμα με
θάση του ΑΤΡ. Αντίθετα, σrα μιτοΧόν
τη θυλακοειδή μεμβράνη (Εικόνα
ομοιότητες και διαφο
δρια, για τη μεταφορά των ηλεκτρονίων
ρές ανάμεσα σrα μιτοΧόνδρια και τους XΛωρoπλάσrες παρουσιάΖΟνται σrην
και τη σύνθεση του ΑΤΡ χρησιμοποιείται
Εικόνα
η εσωτερική μεμβράνη. Και σrα δύο ορ
(thylakoid membrane),
(thylakoids,
14-30). Οι δομικές
14-31.
διαθέ
•,
μιτοχονδρίων και την οργάνωση των XΛωρoπλασrών. Η εσωτερική μεμβρά
γανίδια, τα πρωτόνια αντλούνται από το
Οι χλωροπλάmες αl~μαλωτίzoυν ενέργεια από το ηλιακό
μεγαλύτερο εσωτερικό διαμέρισμα [δη
φως και τη χρησιμοποιούν για τη δέσμευση του άνθρακα
λαδή το σrρώμα
ΟΙ πολ/ές αντιδράσεις που συμβαίνουν κατά τη διάρκεια της φωτοσύν
θεσης σrα φυτά μπορεί να καταταγούν σε δύο μεγάλες κατηγορίες (Εικόνα
14-32): 1. Στις φωroσυνθετικές αντιδράσεις μεταφοράς nΛεκrρον[ων (photosynthetic electron-transfer reactions), yνωσrές επίσης και ως «φωτεινές αντιδρά σεις» ( υψηλής ενέργειας, το οποίο μεταφέρετaι μέσω μιας α λυσίδας μεταφοράς ηλεκτρονίων προς το δεύτερο φωτοσύστημα. Ενώ μετα Kινείτaι κατά μήκος της αλυσίδας μεταφοράς ηλεκτρονίων, το ηλεκτρόνιο
ένα κέντρο αντίδρασης προκαλούν έναν δια χωρισμό φορτίων. Ένα από τα μόρια της χλω
ροφύλλης του ειδικού ζεύγους (με πράσινο χρώμα) συγκρατείται σφιχrά σ' ένα σύμπλοκο χρωστικής-πρωτεΊνης, το οποίο είναι έτσι το
ποθετημένο, ώστε κοντά να υπάρχουν τόσο έ νας δυνητικός δότης ηλεκτρονίων χαμηλής ε νέργειας (με γκρι χρώμα) όσο και ένας δυνητι
κός δέκτης ηλεκτρονίων υψηλής ενέργειας (με μπλε χρώμα). Μόλις το κόκκινο ηλεκτρόνιο της χλωροφύλλης διεγερθεί από φωτεινή ενέρ γεια, μεταβιβάζεται στον δέκτη των ηλεκτρο νίων και σταθεροποιείται ως ηλεκτρόνιο υψη λής ενέργειας. Το θετικά φορτισμένο μόριο της χλωροφύλλης προσελκύει γρήγορα ένα η λεκτρόνιο χαμηλής ενέργειας (με πορτοκαλί
χρώμα) και επανέρχεται σε κατάσταση ηρε μίας. Οι αντιδράσεις αυτές ολοκληρώνονται μέσα σε λιγότερο από 10-6 δευτερόλεmα. (8) Η τελική παραγωγή ενός ηλεκτρονίου υψηλής ενέργειας από ένα ηλεκτρόνιο χαμηλής ενέρ γειας. Κατά τη διεργασία αυτή, η οποία ακο λουθείτην οδό που παρουσιάζεται στο (Α), ο λόκληρο το κέντρο αντίδρασης αποκαθίστα ται σε κατάσταση ηρεμίας. Συγκεκριμένα, στη
θυλακοειδή μεμβράνη σχηματίστηκε ένα ηλε κτρόνιο υψηλής ενέργειας από ένα άλλο, χα μηλής ενέργειας, που παραλήφθηκε από το νερό.
προωθεί μια αVΤλία Η+ της θυλακοειδούς μεμβράνης Kaι δημιουργεί μια βαθμίδωση πρωτονίων κατά τον τρόπο που περιγράψαμε προηγουμένως για
την οξειδωτική φωσφορυλίωση (Εικόνα
14-36). Στη
συνέχεια, μια συνθάση
του ΑΤΡ που εvτoπίzετaι στη θυλακοειδή μεμβράνη χρησιμοποιεί αυτή τη βαθμίδωση για να προωθήσει τη σύνθεση του ΑΤΡ στην πλευρά της μεμβρά νης προς το στρώμα.
Μόλις το ηλεκτρόνιο φτάσει στο δεύτερο φωτοσύστημα της οδού (φωro σύστnμα ι), το ηλεκτρόνιο «γεμίΖει» ένα ηλεκτροθετικό «κενό» που δημιουρ γήθηκε στο KέVΤΡO αντίδρασης από την απομάκρυνση ενός άλ/ου ηλεκτρονί
ου λόγω της απορρόφησης ενός δεύτερου φωτονίου. Εφόσον το φωτοσύστη-
Χλωροπλάστες και Φωτοσύνθεση
597
ένζυμο που διασπά το νερό
ΦΩΣ
ΦΩΣ
Θγλ/ΚΟΕΙΔΗΣ ΧΩΡΟΣ
02 πλαστοκυανίνη
4Η+
Θγλ/ΚΟΕΙΔΗΣ
ι
ΜΕΜΒΡΑΝΗ
η μετακίνηση των πρωτονίων στη φορά της ηλεκτροχημικής βαθμίδωσής τους παράγει ΑΤΡ
ΣΤΡΩΜΑ
NADP+ φωτοσύστημα
I1
Εικόνα
14·36.
φωτοσύστημα Ι
σύμπλοκο
KUΤOxpωμάτων
αναγωγάση φερρεδοξίνης-ΝΑΟΡ
b6-f
Κατά τη διάρκεια της φωτοσύνθεσης τα ηλεκτρόνια ρέουν κατά μήκος μιας αλυσίδας μεταφοράς ηλεκτρονίων στη θυ
λακοειδή μεμβράνη. Το φως συλλέγεται από τα σύμπλοκα των κεραιών στα δύο μεμβρανικά φωτοσυστήματα και διοχετεύεται προς τα μό ρια χλωροφύλλης στο κέντρο αντίδρασης κάθε φωτοσυστήματος (βλ. Εικόνα
14-34). Από
εκεί, τα ηλεκτρόνια μεταφέρονται στην αλυσίδα
μεταφοράς των ηλεκτρονίων μέσω κινητών φορέων. Αυτοί οι φορείς είναι η πλαστοκυανίνη (μια μικρή πρωτεΙνη που περιέχει χαλκό) και η
φερρεδοξίνη (μια μικρή πρωτεΙνη που περιέχει ένα κέντρο σιδήρου-θείου). Το σύμπλοκο των κυΤΟχΡωμάτων των κυΤΟχΡωμάτων
b-c 1 των μιτοχονδρίων και είναι η
b6-f μοιάζει
με το σύμπλοκο
μοναδική θέση στην αλυσίδα μεταφοράς ηλεκτρονίων όπου διενεργείται ενεργός ά
ντληση Η+. Τα Η+ που απελευθερώνονται από την οξείδωση του νερού και τα Η+ που παραλαμβάνονται κατά το σχηματισμό του ΝΑDΡΗ ε πίσης συνεισφέρουν στη δημιουργία της ηλεκτροχημικής βαθμίδωσης των πρωτονίων. Η βαθμίδωση αυτή (μπλε βέλος) προωθεί μια συν θάση του ΑΤΡ που είναι τοποθετημένη στην ίδια μεμβράνη (δεν εικονίζεται εδώ).
μα Ι είναι σχεδιασμένο να ξεκινά από υψηί\ότερη ενεργειακή στάθμη από το φωτοσύστημα
11, καταλήγει
σε υψηλότερη στάθμη και, έτσι, έχει τη δυνατότη
τα να εκτινάξει τα ηλεκτρόνια στην πολύ υψηλή ενεργειακή στάθμη η οποία α
παιτείται για το σχηματισμό του ΝΑΟΡΗ από το NADP+ (Εικόνα
14-36). Τα 0-
ξειδο-αναγωγικάδυναμικάτων συστατικώνπου βρίσκονταικατά μήκος αυτής της αλυσίδας μεταφοράς ηλεκτρονίωνπαρουσιάΖΟνταιστην Εικόνα 14-37. Κατά τη συνολική διεργασία που περιγράφηκε έως τώρα, ένα ηλεκτρόνιο το οποίο αποσπάστηκε από ένα μόριο xiΊωρoφύλ/ης του κέντρου αντίδρα σης του φωτοσυστήματος
11 μετακινείται
κατά μήκος όλης της αλυσίδας μετα
φοράς ηλεκτρονίων στη θυλακοειδή μεμβράνη και τελικά προσφέρεται στο ΝΑΟΡΗ. Για να επιστρέψει το σύστημα σε κατασταση ηρεμίας, το αρχικό αυ τό ηλεκτρόνιο πρέπει ν' αVΤΙKατασταθεί από κάποιο άλ/ο. Τ ο ηλεκτρόνιο προέρχεται από έναν δότη ηλεκτρονίων χαμηλής ενέργειας. Στα φυτά και σε
πολ/ά φωτοσυνθετικά βακτήρια, ο δότης αυτός είναι το νερό (βλ. Εικόνα 35Β). Το κέντρο αντίδρασης του φωτοσυστήματος
11 περιλαμβάνει
14-
ένα ένΖυ
μο που διασπά το νερό, το οποίο συγκρατεί τα άτομα του οξυγόνου των δύο μορίων του νερού συνδεμένα σ' ένα σύμπλοκο ατόμων μαΥΥανίου της πρω τεΊνης (Εικόνες
14-36 και 14-37). Το
ένΖυμο αυτό αποσπά ηλεκτρόνια από
το νερό, με ρυθμό ένα τη φορά, για να KαiΊύψει τα κενά που δημιουργήθη καν από το φως στα μόρια της xiΊωρoφύλ/ης του κέντρου αντίδρασης. Μόλις
αποσπαστούν τέσσερα ηλεκτρόνια από τα δύο μόρια του νερού (κάτι που
προϋποθέτει απορρόφηση τεσσάρων φωτονίων), απελευθερώνεται το
02' Η
διεργασία αυτή, η οποία πραγματοποιείται επί δισεκατομμύρια χρόνια, είναι υπεύθυνη για την παραγωγή όλου του
598
Κεφάλαιο 14: Παραγωγή Ενέργειας στα Μιτοχόνδρια και στους Χλωροπλάστες
02 στην ατμόσφαιρα
της γης.
Εικόνα
φωτοσύστημα Ι
δο-αναγωγικό δυναμικό κάθε μορίου υποδη
_καιΒ:!
-1000
φερρεδοξίνη αναγωγάση ΝΑΟΡ
-800
Θ
:;-
..s. -400 "§- -200
δημιουργία ηλεκτρο χημικής βαθμίδωση ς
l'iiiI
i\
>
::>
Κ)
[
Ο
Ο 15
200
Ι
400
το φως
ο
Ι
Ht+
το φως
προκαλεί
διαχωρισμό
σύμπλοκ::::
ο
+
Η+
KUΤOχpωματων
λώνεται από την τοποθέτησή του κατά μήκος του κάθετου άξονα. Το φωτοσύστημα 11 μετα βιβάζει ηλεκτρόνια από τη διεγερμένη χλω ροφύλλη του σε μια αλυσίδα μεταφοράς ηλε κτρονίων της θυλακοειδούς μεμβράνης η ο ποία οδηγεί στο φωτοσύστημα Ι. Η καθαρή ροή των ηλεκτρονίων διαμέσου των δύο φω
τοσυστημάτων που συνδέονται εν σειρά αρ χίζει από το νερό και κατευθύνεται προς το NADP+, παράγοντας ΝΑDΡΗ και ΑΤΡ. Το ΑΤΡ συντίθεται από μια συνθάση του ΑΤΡ, η οποία
6 -t
_ _ .,
πλαστοκυανίνη
600
NADP+
ίων
[jb πλαστοκινόνη~ ~-
προκαλεί διαχωρισμό φορτίων
~
που παράγει
'0
~
c3:o~
φωτοσύστημα 11
-800
συστατικά της αλυσίδας
ρετικό οξειδο-αναγωγlκό δυναμικό. Το οξει
φωτός για παραγωγή
-1200
14-37. Τα
μεταφοράς των ηλεκτρονίων έχουν διαφο
συλλογή της ενέργειας του
αξιοποιεί την ηλεκτροχημική βαθμίδωση των
Θ
πρωτονίων που προέκυψε από τη μεταφορά των ηλεκτρονίων.
800 1000 1200
02
Ερώτηση
κατεύθυνση της ροής των ηλεκτρονίων
14-9
Ποιες από ης ακόλουθες
διαπιστώσεις είναι σωστές;
Η δέσμευση Ίου άνθρακα καΊαλύεωι από Ίην καρβοξυλάση Ίης διφωσφορικής ριβουλόΖης
NADPH από ης φωτεινές
σεις σας.
Α. Μετά την αφαίρεση ενός
Σης παραγράφους που προηγήθηκαν είδαμε πώς παράγεται το ΑΤΡ και
το
Δικαιολογείστε ης απαντή
ηλεκτρονίου από το φως,
•,
ανηδράσεις της φωτοσύνθεσης. Στη συνέχεια,
η συγγένεια της θεηκά φορησμένης
θα εξετάσουμε πώς χρησιμοποιούνται αυτές οι ενώσεις σης αντιδράσεις δέ
χλωροφύλλης για ΤΟ ηλεκτρόνια στο
σμευσης του άνθρακα
'Orαν οι υδατάνθρακες οξειδώνο
κέντρο αντίδρασης του πρώτου φωτο
CO2 και Η 2 Ο απελευθερώνεται μεγάλη ποσότητο ελεύθερης ενέργει ας. Προφανώς, η αντίστροφη αντίδραση, στην οποία το CO 2 και το Η 2 Ο συν
συστήματος (φωτοσύστημα 11) είναι α
(carbon fixation).
νται σε
δέονται για το σχημαησμό υδατονθράκων, πρέπει να είναι μη ευνοϊκή από ε
νεργειακή άποψη. Για να συμβεί, είναι αναγκαίο να συΖευχθεί με μια ενερ γειακά ευνοϊκή αντίδραση που θα την προωθήσει
κόμα μεγαλύτερη από Τη συγγένεια
του
02 για ΤΟ ηλεκτρόνια.
Β. Φωτοσύνθεση είναι η προωθούμενη από το φως μετοφορά ενός ηλεκτρο
Η κεντρική αντίδραση της δέσμευσης του άνθρακα κοτά τη φωτοσύνθε ση, στην οποία ένα άτομο ανόργανου άνθρακα (στη μορφή του
νίου από τη χλωροφύλ/η σ' ένα δεύ
CO2) μετο τρέπετοι σε οργανικό άνθρακα, αποδίδεται στην Εικόνα 14-38. Το CO 2 που
τερο μόριο με πολύ μικρότερη συΥΥέ
προέρχετοι από την ατμόσφαιρα αντιδρά με μια πεντόΖη, την 1,5-διφωσφο
Γ. Επειδή για Την απελευθέρωση ενός
νεια για ΤΟ ηλεκτρόνια.
ρική ρι60υiΊόΖn, και με το νερό για το σχημαησμό δύο μορίων 3-φωσφογλυ
μορίου
κερινικού, μιας ένωσης με τρία άτομα άνθρακα. Η αντίδραση αυτή, η οποία
τείται η απορρόφηση τεσσάρων φωτο
ανακαλύφθηκε το
1948, πραγματοποιείται στο στρώμα των χλωροπλαστών
νίων, το ένΖυμο που διασπά το νερό ε
και κατολύεται από ένα μεγάλο ένΖυμο γνωστό ως κaρ60ξυί'Jάσn rnς διφω
πιβάλ/ετοι να συγκροτεί ισχυρά συν
σφορικής ρι60υiΊόΖnς (ribulose
Σε σύ
δεμένα ΤΟ ενδιάμεσα της αντίδρασης,
γκριση με ΤΟ περισσότερα άλ/α ένΖυμα, το συγκεκριμένο ένΖυμο λειτουργεί
έτσι ώστε ν' αποτραπεί η διαφυγή με
εξαιρεηκά αργά (επεξεργάΖετοι περίπου
ρικώς ανηγμένων, και επομένως επι
biphosphate carboxylase, rubisco).
3 μόρια υποστρώματος ανά δευτε
ρόλεπτο, ότον, στον ίδιο χρόνο, ένα συνηθισμένο ένΖυμο επεξεργάΖετοι
02 από δύο μόρια νερού
απαι
κίνδυνων, ΡΙΖών του υπεροξειδίου.
Χλωροπλάστεςκαι Φωτοσύνθεση
599
Εικόνα
14-38.
Η αρχική αντίδραση στη δέ
CΗ 2 0Θ
σμευση του άνθρακα. Η αντίδραση αυτή, στην οποία το διοξείδιο του άνθρακα μετατρέ πεται σε οργανικό άνθρακα, καταλύεται στο στρώμα των χλωροπλαστών από το άφθονο
ένζυμο καρβοξυλάση της διφωσφορικής ρι
O=c-O
+
βουλόζης. Το προϊόν είναι το 3-φωσφογλυκε
~HΡΘ c=o Ι
-ο
H-C-OH Ι H-C-OH Ι
ρινικό.
CΗ 2 0Θ
διοξείδιο του άνθρακα
1000 μόρια
Ο
1,5-διφωσφορική ριβουλόζη
CΗρΘ
~
/
Ι H-C-OH Ι
coo-
ι
+
I.Q-C'--OH Ι
COOΙ H-C-OH Ι
C=O Ι H-C-OH Ι
CΗρΘ
CΗ 2 0Θ
δύο μόρια 3-φωσφογλυκερινικού
ενδιάμεσο
υπoσrρώμαως). Για 10 λόγο αυτό, απαιωύνΤαι πολ/ά μόρια ωυ
ενΖύμου. Η καρβοξυλάσητης διφωσφορικήςριβουλόΖης ανΤιπροσωπεύει
περισσότερο από 10 50% ωυ συνόλου Των πρωτεϊνών των XΛωρoπλασrών και υπoσrηρίZε1OΙ ότι είναι η πιο άφθονη πρωπ'ϊνη σrη γη.
Η ανΤίδραση σrην οποία αρχικά δεσμεύε1ΟΙ 10
CO2 είναι ενεργειακά
ευ
νοϊκή, μόνο όμως επειδή εφοδιάΖε1ΟΙ συνεΧώς με 1,5-διφωσφορική ριβου
λόΖη, μια ένωση πλούσια σε ενέργεια, σrην οποία ΠΡOσrίθε1OΙ 10 κάθε μόριο 1Ου
CO2 (Εικόνα 14-38).
Η περίτεχνη με1Οβολική οδός μέσω της οποίας α
ναγεwά1ΟΙ η ένωση αυτή απαιτεί ΑΤΡ και ΝΑDΡΗ και διαλευκάνθηκε με τη χρησιμοποίηση ραδιοσημασμένων δεικτών. Ο κύκλος τnς δέσμευσnς του άvθρακα
(carbon fίxation cycle) ή κύκλος ωυ Calvin αποδίδεται συνοπτικά 14-39. Είναι μια κυκλική διεργασία, που αρχίΖει και τελειώνει 1,5-διφωσφορική ριβουλόΖη. Για κάθε φία μόρια CO 2 που εισέρχο
σrην Εικόνα με την
νται στον κύκλο, παράγεται ένα νέο μόριο 3-φωσφορικΩς γiΊυκεριvαiΊ δεiJδnς. Η ένωση αυτή, ένα σάκχαρο με φία άωμα άνθρακα, αποτελεί 10 καθαρό προϊόνωυ κύκλου και στη συνέχειαχρησιμοποιείταιγια τη σύνθεση
•,
πολ/ών άλλων σακχάρων και οργανικώνμορίων. Ερώτηση
14-10
Α. Πώς επιβιώνουν τα κύτ
Σων κύκλο δέσμευσηςωυ άνθρακα, για κάθε μόριο CO 2 που με1Οφέ
πεται σε υδατάνθρακες, καταναλώνονΤαι φία μόρια ΑΤΡ και δύο μόρια
ταρα στις ρίΖες των φυ
NADPH.
τών, ενώ δεν περιέχουν
παιτεί1ΟΙ ενέργεια φωσφορικώνδεσμών (υπό μορφή ΑΤΡ) όπως επίσης και
XΛωρoπλάσrες και δεν εί
αναγωγική δύναμη (υπό μορφή ΝΑDΡΗ).
Συνεπώς, για 10 σχηματισμό σακΧάρων από 10
CO2 και 10 Η 2 Ο α
ναι εκτεθειμένα σro φως; Β. ΑνΤίθετα από τα μιωΧόν
δρια, οι XΛωρoπΓιάσrες δεν διαθέωυν έ να με1Οφορέα για την εξαγωγή ωυ ΑΤΡ
σω κυπαροδιάλυμα. Με ποιο φόπο α ποκτούν 10 φυτικά κύπαρα 10 ΑΤΡ 10 ο ποίο χρειάΖονται για την εκτέλεση διά
φορων μεταβολικών αντιδράσεωνπου απαιωύν ενέργεια σro κυπαροδιάλυμα;
Στους χλωροπλάσΙες,από Ίη δέσμευσητου άνθρακα παράγnαl σουκρόΖη και άμυλο Μεγάλο μέρος της 3-φωσφορικήςγλυκεριναλδευδηςπου παράγεται
στους χλωροπΓιάστεςμε1Οφέρεται από εκεί στο κυπαροδιάλυμα.Μια ποσό τητά της εισέρχεται σrη γλυκολυτική οδό και με1Οφέπεται σε πυρoσrαφυλι κό, 10 οποίο κατόπιν χρησιμοποιεί1ΟΙγια την παραγωγή ΑΤΡ με οξειδωτική φωσφορυλίωσηστα μιωΧόνδριατων φυτικών κυπάρων. Η 3-φωσφορική
γλυκεριναλδευδημε1Οφέπεται επίσης σε πολ/ούς άλ/ους με1Οβολίτες, με 1Οξύ των οποίων και σroν δισακχαρίτη σουκρόΖη (καλαμοσάκχαρο).Η σου ΚΡάΖn είναι η κύρια μορφή σακΧάρου που με1Οφέρε1ΟΙ σrα φυτικά κύπαρα.
600
Κεφάλαιο 14: Παραγωγή Ενέργειας στα Μιτοχόνδρια και στους Χλωροπλάστες
r
Εικόνα
τρία μόρια
j4·39.
Ο κύκλος δέσμευσης του άν·
θρακα ο οποίος σχηματίζει οργανικά μόρια
από το
CO 2 και το Η 2 Ο. Ο αριθμός των ατό
μων του άνθρακα κάθε μορίου αναγράφεται σε λευκά κουτάκια. Ανάμεσα στην 3-φωσφορι κή γλυκεριναλδεΟδη και την 5-φωσφορική ρι βουλόζη υπάρχουν πολλά ενδιάμεσα, τα οποία έχουν παραλειφθεί για μεγαλύτερη σαφήνεια. Επίσης, δεν εικονίζεται η είσοδος του νερού
έξι μόρια
~--61S11
στον κύκλο.
~---6IADPI
11.....- - _ 6 NADP+
----6@
r-----.:...--.---.
από τη δέσμευση τριών μορίων CO2 αποδίδεται συνολικά ένα μόριο 3-φωσφορικής γλυκεριναλδευδης με συνολική δαπάνη εwέα μορίων ΑΤΡ και έξι μορίων ΝΑDΡΗ
H-C=O Ι
Η-γ-ΟΗ
CH
Ο 11
-ο-ρ-ο-
2
Ι
0ΣΑΚΧΑΡΑ, ΛΙΠΑΡΑ ΟΞΕΑ, ΑΜΙΝΟΞΕΑ
Όπως η γλυκόΖη μεταφέρεται σιην κυκλοφορία του αίματος των Ζώων, έτσι και η σουκρόΖη εξάγεται από τα φύλλα μέσω του αν/ειακού δεματίου και με ταφέρεται σια υπόλοιπα μέρη του φυτού. Η 3-φωσφορική γλυκεριναλδευδη που παραμένει σιους χλωροπλάσιες κυρίως μετατρέπεται σε άμυΙΊο σιο σιρώμα. Το άμυλο, όπως και το γλυκογό νο σια Ζώα, είναι ένα μεγάλο πολυμερές της γλυκόΖης που λειτουργεί ως α πόθεμα υδατανθράκων (βλ. Εικόνα
13-18).
Η παραγωγή του αμύλου υπό
κειται σε ρύθμιση: συγκεκριμένα, άμυλο παράγεται και αποθηκεύεται σιο σιρώμα των χλωροπλασιών υπό μορφή μεγάλων κοκκίων κατά τη διάρκεια περιόδων έντονης φωτοσυνθετικής δρασιηριότητας (βλ. Εικόνα 13-29Β). Τη νύχτα, το άμυλο αποδομείται σε σάκχαρα (γλυκόΖη), συμβάλ/οντας σιην κά λυψη των μεταβολικών αναγκών του φυτού. Το άμυλο είναι σημαντικό συ
σιατικό της δίαιτας όλων των φυτοφάγων Ζώων.
Η προέλευση των χλωροπλαστών και των μnοχονδρίων Σήμερα είναι γενικά αποδεκτό ότι οι χλωροπλάσιες και τα μιτοχόνδρια προήλθαν από βακτήρια τα οποία καταβροΧθίσιηκαν από αρχέγονα ευκα ρυωτικά κύπαρα πριν από ένα και πλέον δισεκατομμύρια χρόνια (βλ. Εικόνες
Η Προέλευση των Χλωροπλαστών και των Μιτοχονδρίων
601
ΣΧΑΣΗ
..
(Α)
ΣΥΝΤΗΞΗ
1 mm
Εικόνα 14·40. Το μιτοχόνδριο διαιρείται ό· πως ένα βακτήριο. (Α) Γνωρίζουμε ότι συμ βαίνει σχάση και σύντηξη μιτοχονδρίων. Η σχάση μοιάζει με τη διεργασία της διαίρεσης των βακτηρίων.
(8)
Ηλεκτρονιογραφία ενός δι
1-19 και 1-21). Ενδείξεις
γι' αυτήν την εξελικτική προέλευση προέρχονται α
αιρούμενου μιτοχονδρίου. (Με την άδεια του
πό το γεγονός ότι τόσο τα μιτοΧόνδρια όσο και οι xiΊωρoπiΊάστες περιέχουν το
Daniel S. Friend).
δικό τους γονιδίωμα, όπως επίσης και ένα πλήρες σύστημα μεταγραφής και μετάφρασης, το οποίο είναι απαραίτητο για την παραγωγή πρωτεϊνών από τα
γονίδια αυτά. Επιπρόσθετη ένδειξη για τη βακτηριακή προέλευση των μιτο
χονδρίων και των xiΊωρoπλαστών είναι ο τρόπος αναπαραγωγής τους αύξησης και διαίρεσης προϋπαρΧόντων οργανιδίων (Εικόνα
-
μέσω
14-40).
Η αύξηση και ο πολ/απλασιασμός των μιτοχονδρίων περιπλέκονται από
το γεγονός ότι οι πρωτε'ί'νες τους κωδικοποιούνται από δύο ανεξάρτητα γενε τικά συστήματα, ένα στο οργανίδιο και ένα στον πυρήνα του κυττάρου. Στην περίπτωση του μιτοχονδρίου, τα περισσότερα από τ' αυθεντικά βαKτnριαKά γονίδια μετατοπίστηκαν στον πυρήνα του κυττάρου, ενώ στο μιτοχόνδριο πα ρέμειναν σχετικά λίγα γονίδια. Πράγματι, τα μιτοΧόνδρια των Ζώων περιέ χουν ένα εξαιρετικά απλό γενετικό σύστημα: για παράδειγμα το μιτοχονδρια
κό γονιδίωμα του ανθρώπου αποτελείται μόνο από 16,569 Ζεύγη νουκλεοτι δίων και περιέχει
37 γονίδια.
Οι περισσότερες μιτοχονδριακές πρωτεlνες, συ
μπεριλαμβανόμενων και εκείνων που απαιτούνται για τη σύνθεση της μιτο
χονδριακής ΗΝΑ πολυμεράσης, των πρωτεϊνών των μιτοχονδριακών ριβοσω ματίων και όλων των ενΖύμων του κύκλου του κιτρικού οξέος, παράγονται α πό πυρηνικά γονίδια. Επομένως, οι πρωτεlνες αυτές πρέπει να εισαΧθούν στα μιτοΧόνδρια από το KυτταρoδιάiΊυμα, όπου και συντίθενται (Κεφάλαιο
15).
Ο xiΊωρoπiΊάστης επίσης περιέχει πολ/ά από τα γονίδια που χρειάΖεται για να λειτουργήσει όπως επίσης και ένα πλήρες σύστημα μεταγραφής και μετά
φρασης για την παραγωγή πρωτεϊνών από αυτά τα γονίδια. Το γονιδίωμα των xiΊωρoπλαστών είναι πολύ μεγαλύτερο από το αντίστοιχο των μιτοχονδρίων. Για παράδειγμα, στα ανώτερα φυτά αποτελείται από
τιδίων και περιέχει περίπου
120 γονίδια.
120,000 Ζεύγη νουκλεο
Αυτά τα γονίδια μοιάΖουν εντυπω
σιακά με τα γονίδια των κυανοβακτηρίων από τα οποία πιστεύεται ότι προήλ-
602
Κεφάλαιο 14: Παραγωγή Ενέργειας στα Μιτοχόνδρια και στους Χλωροπλάστες
θαν οι χλωροπλάοτες. Μολα1Ού1Ο, όπως σuμβαίνει και με τις πρωτε'ί'νες των
μιτοχονδρίων, πολ/ές πρωτε'ί\/ες των χλωροπλαοτών κωδικοποιούνται από
γονίδια τou πuρήνα και πρέπει να εισαΧθούν από το κuπαροδιάλuμα. Οι ίδιες τεχνικές ποu επέτρεψαν ν' αναiΊύσοuμε το γονιδίωμα των μιτο χονδρίων και των χλωροπλαοτών προσέφεραν επίσης τη δuνατότη1Ο ν' ανα
yvωρίσοuμε και να μελετήσοuμε τη μοριακή βιολογία πολ/ών μικροοργανι σμών οτη Γη. Μερικοί από τοuς οργανισμούς αuτούς εuημερούν σε εντελώς
αφιλόξενο περιβάλ/ον, όπως οι uδροθερμικές φλέβες οτον ωκεάνειο πuθ μένα και οι θειούχες θερμές πηγές. Σε αuτά 10 φαινομενικάπαράδοξα, σύγ χρονα βακτήρια μπορούμε να βρούμε εύκολα ενδείξεις για την ιοτορία της Ζωής, κuρίως οτη μορφή των πολ/ών μορίων από 10 οποία αποτελούνταιΌ
πως 10 δαKΤUλΙKά αΠOΤUπώμα1Oοτον τόπο τou εγκλήματος, αuτά τα μόρια προσφέροuνισχuρές ενδείξεις ποu μας επιτρέποuν να διαλεuκάνοuμεπα
λαιά γεγονότα και να διατuπώσοuμεuποθέσεις για την προέλεuση των
ou-
οτημάτων παραγωγής ΑΤΡ ποu uπάρχοuν οτα σύγχρονα μιτοΧόνδρια και
οτοuς σύγχρονοuς χλωροπλάοτες. Για το λόγο αuτό, θα κλείσοuμε το κεφά λαιο με μια αναφορά οτην εξέλιξη των σuοτημάτων σuλ/ογής ενέργειας τα οποία παροuσιάσαμε νωρίτερα.
Η οξειδωτική φωσφορυλίωση προσέφερε ένα εξελικτικό πλεονέκτημα σΙα αρΧέγονα βακτήρια Όπως προαναφέραμε, τα πρώτα κύτταρα οτη Γη πρωτόγονα εuκαρuωτικά
-
-
προκαρuωτικά και
πιθανότατα κατανάλωναν οργανικά μόρια ποu
παράγονταν από γεωχημικές διεργασίες και παρήγαγαν ΑΤΡ με Ζύμωση.
ΠΑΔΙ01
Επειδή η αρΧέγονη ατμόσφαιρα δεν περιείχε οξuγόνο, τα κύπαρα αuτά Ζού σαν uπό αναερόβιες σuνθήκες κο! μάλ/ον αφαιρούσαν ηλεκτρόνια από κά ποιο οργανικό μόριο πλούσιο σε uδρογόνο (όπως η γλUκόΖη), για να 10 με ταφέροuν οτη σuνέχεια (μέσω τou
NADH
και τou
NADPH)
σ' ένα άλ/ο ορ
γανικό μόριο, προκαλώντας την αναγωγή τou. Τα «απόβλητα» αuτών των α ντιδράσεων
-
ανηγμένα οργανικά οξέα, Π.Χ. γαλακτικό ή μuρμηγκικό - προ
φανώς απ εκκρίνονταν οτο περιβάλ/ον (βλ. Εικόνα 13-4Α). Η απέκκριση των οργανικών οξέων φαίνεται ότι ελάπωσε το ρΗ τou περι
ΠΑΔΙ02
βάλ/οντος, εuνoώντας την επιβίωση κuπάρων 10 οποία ανέrnuξανδιαμεμβρα
νικές πρωτε'ί'νες ικανές ν' αντλούν Η+ έξω από το κuπαροδιάiΊuμα.Κατ' αuτόν τον τρόπο το κύπαρο απέφεuγετον κίνδuνονα γίνει πολύ όξινο (οτάδιο 1 οτην Εικόνα
14-41). Μια
από τις εν λόγω αντλίες ίσως χρησιμοποιούσε την ενέρ
γεια της uδρόλuσης τou ΑΤΡ για ν' aπoβάλ/ει Η+ από το Kύτi:αρO. Σuνεπώς, θα μπορούσε να είναι πρόγονος της σύγχρονης σuνθάσης τou ΑΤΡ.
Καθώς άρχισαν να ελαπώνονται τ' αποθέματα της Γης σε οuσίες κατάλ ληλες για Ζύμωση, οι οργανισμοί ποu κατόρθωσαν να βροuν έναν τρόπο ν'
αντλούν Η+ χωρίς να καταναλώνοuν ΑΤΡ βρέθηκαν σε πλεονεκτική θέση. Μπορούσαν ν' αποταμιεύοuν τις μικρές ποσότητι::ς ΑΤΡ ποu προέρχονταν α
πό τη Ζύμωση των μορίων των τροφών για να σuντηρήσοuν άλ/ες σημαντι κές κuτταρικές δραοτηριότητες. Σuνεπώς, πιέσεις επιλογής όπως η ένδεια τροφής ίσως οδήγησαν οτην ανάπτuξη των πρώτων πρωτεϊνών μεταφοράς η-
ΠΑΔΙ03
Εικόνα
14-41.
Η οξειδωτική φωσφορυλίωση
ίσως αναmύχθηκε σταδιακά, επειδή τα βα κτήρια που μπορούσαν να παράγουν ΑΤΡ χρησιμοποιώντας μια συνθάση του ΑΤΡ προ
ωθούμενη από πρωτόνια, τα οποία αντλούσε μια αλυσίδα μεταφοράς ηλεκτρονίων, είχαν πλεονέκτημα επιλογής.
Η Προέλευση των Χλωροπλαστών και των Μιτοχονδρίων
603
Εικόνα
14-42.
Μερικά σύγχρονα ανερόβια
βακτήρια οξειδώνουν το μυρμηγκικό οξύ χρησιμοποιώντας μια αλυσίδα μεταφοράς η
μuρμηγκικό οξύ επάνΟδος Η
ΕΞΩΚΥΤ
λεκτρονίων της κυπαρικής μεμβράνης τους.
ΤΑΡΙΟΣ
Σε τέτοια αναερόβια βακτήρια, μεταξύ των ο
ΧΩΡΟΣ
ποίων και το Ε.
CO/i,
+
στο κύπαρο ως πηγή ενέργειας
H-COOH
2Η+
+ C02
j
\
'-- .-/
η οξείδωση μεσολαβείται
από μια αλυσίδα μεταφοράς ηλεκτρονίων (και παράλληλα συλλογής ενέργειας) στην κυπα ρική μεμβράνη. Πρώτες ύλες είναι το μυρμη
ΚΥΤΤΑΡΟ ΔΙλ/γΜΑ
γκικό οξύ και το φουμαρικό, ενώ προ'ίόντα εί ναι το ηλεκτρικό και το
CO 2 • Στο εσωτερικό του
+
KUΠάΡOυ καταναλώνονται Η+, που αναπληρώ νονται στον εξωκυπάριο χώρο. Αυτό ισοδυνα
HC-COO11
HC-COO-
ΗΡ-CΟΟ-
φοuμαρικό
μεί με άντληση πρωτονίων προς τον εξωKUΠά
Ι
H2C-COOηλεκτρικό
ριο χώρο. Συνεπώς, αυτό το μεμβρανικό σύ στημα μεταφοράς ηλεκτρονίων μπορεί να δη μιουργήσει μια ηλεκτροχημική βαθμίδωση πρωτονίων διαμέσου της KUΠαΡΙKής μεμβρά νης. Το οξειδοαναγωγικό δυναμικό του ζεύ γους μυρμηγκικό οξύ-CΟ 2 είναι -420 mV ενώ του ζεύγους φουμαρικό-ηλεκτρικό είναι
mV.
+30
λεκτρονίων. Αυτές οι μετοφορικές πρωτε'ί'νες προσέφεραν στα κύπαρα Τη δυνοτότητο να χρησιμοποιούν Τη μετοκίνηση των ηλεκτρονίων μετοξύ μο
ρίων με διαφορεηκό οξειδοαναγωγικό δυναμικό ως πηγή ενέργειας για Τη
μετοφορά Η+ διαμέσου Της κυπαρικής μεμβράνης (στάδιο 2 στην Εικόνα
14-41). Ορισμένα
από αυτά ΤΟ κύπαρα ίσως χρησιμοποίησαν οργανικά οξέα
ακοτάλ/ηλα για Ζύμωση ΤΟ οποία είχαν αποβληθεί από γειτονικά κύπαρα για
ν' αποκτήσουν ΤΟ ηλεκτρόνια που διατηρούσαν το όλο σύστημα σε λειτουρ γία. Για παράδειγμα, μερικά σύγχρονα βακτήρια αυξάνουν στο μυρμηγκικό
οξύ, χρησιμοποιώντος Τη μικρή ποσότητο οξειδοαναγωγικής ενέργειας που προέρχετοι από Τη μετοφορά ηλεκτρονίων από το μυρμηγκικό στο φουμαρι
κό για ν' αντλήσουν Η+ (Εικόνα
14-42).
Με το χρόνο, ορισμένα βακτήρια μάλ/ον ανέπτυξαν συστήματο μετοφο
ράς ηλεκτρονίων συΖευγμένης με άντληση Η+ τόσο αποτελεσμαηκά ώστε μπορούσαν να «αιχμαλωτίΖουν» περισσότερη οξειδοαναγωγική ενέργεια απ'
όσο χρειάΖονταν για να διοτηρήσουν το εσωτερικό ρΗ τους. Αυτά ΤΟ κύπαρα πιθανότοτο ανέπτυξαν μεγάλες ηλεκτροχημικές βαθμιδώσεις πρωτονίων, ης οποίες μπορούσαν στη συνέχεια ν' αξιοποιήσουν για Την παραγωγή ΑΤΡ. Η
επάνοδος των Η+ στο κύπαρο μάλ/ον γινότον διαμέσου των προωθούμε
νων από ΤΟ ΑΤΡ αντλιών Η+. Έτσι, στην ουσία οι αντλίες λειτουργούσαν στην αντίθεΤη κοτεύθυνση και παρήγαγαν ΑΤΡ (βήμα
3 στην Εικόνα 14-41).
Επειδή αυτά ΤΟ κύπαρα βασίΖονταν πολύ λιγότερο σε αποθέματο τροφών κοτάλ/ηλων για Ζύμωση, τελικά αυξάνονταν εις βάρος των γειτόνων τους.
Τα φωτοσυνθεIlκάβακτήρια είχαν ακόμα λιγότερες απαιιήσεις από το περιβάλλοντους Από εξελικηκή άποψη, το κύριο ορόσημο στον ενεργειακό μετοβολισμό ασφαλώς υπήρξε ο σχημαησμόςφωτοχημικώνκέντρων αντίδρασης ικανών
να χρησιμοποιούνΤην ενέργεια του ηλιακού φωτός για να παράγουν μόρια όπως το
NADH.
Πιστεύετοι όη αυτό συνέβη σε πρώιμο στάδιο κοτά Την κυτ
τορική εξέλιξη, πριν από
3 και πλέον δισεκατομμύρια χρόνια,
στους προγό
νους των πράσινων θειοβακτηρίων. Τα σημερινά θειοβακτήρια χρησιμοποι
ούν Την ενέργεια του φωτός για τη μετοφορά ατόμων υδρογόνου (υπό μορ-
604
Κεφάλαιο 14: Παραγωγή Ενέργειας στα Μιτοχόνδρια και στους Χλωροπλάστες
Εικόνα φωτοσύστημα
Θ
;> -400
.s 'ο
'" :i ::>
'ο
'"
σινων θειοβακτηρίων μοιάζει με το φωτοσύ
στη μα Ι των φυτών και των κυανοβακτηρίων.
H++NA~
το φως
-300
προκαλεί
Και τα δύο χρησιμοποιούν ως αποδέκτες ηλε κτρονίων μια σειρά κέντρων σιδήρου-θείου. Τα κέντρα σιδήρου-θείου τελικά προσφέρουν
διαχωρισμό φορτίων
f
σύγχρονα πράσινα θειοβα
σύνθεσης που χρησιμοποιεί ως πηγή ηλε κτρονίων το H2 S. Το φωτοσύστημα των πρά
αναγωγάση
_____.(;:::;\ του ΝΑΟΡ ~-Q
g ιο
14-43. Τα
κτήρια πραγματοποιούν μια μορφή φωτο
τα ηλεκτρόνια υψηλής ενέργειας που απέκτη σαν στη φερρεδοξίνη
ο
(Fd).
Υπόδειγμα βακτη
ρίου αυτής της κατηγορίας είναι το
'9
.g -200
um tepidum,
Ch/orobi-
το οποίο ζει σε θερμές πηγές σε
συνθήκες υψηλής θερμοκρασίας και χαμηλής έντασης φωτός.
κατεύθυνση της ροής των ηλεκτρονίων
φή ενός ηλεκφονίου και ενός πρωτονίου) από το
H2S σΙΟ
ΝΑΟΡΗ, δημι
oυργώvτας έτσι την ισχυρή αναγωγική ισχύ που απαιτείται για τη δέσμευση
του άνθρακα (Εικόνα
14-43).
Το επόμενο βήμα, το οποίο θεωρείται ότι συνέβη με την εμφάνιση των
κυανοβακτηρίων πριν από
3 δισεκατομμύρια χρόνια,
ήταν η εξέλιξη οργανι
σμών ικανών να χρησιμοποιούν νερό ως πηγή ηλεκτρονίων για τη φωτοσύν θεση. Αυτό απαίτησε την εξέλιξη ενός ενΖύμου διάσπασης του νερού και την προσθήκη ενός δεύτερου φωτοσυστήματος, εν σειρά προς το πρώτο, ώστε να γεφυρωθεί το τεράσΙΙΟ Χάσμα οξειδοαναγωγικής ισΧύος μεταξύ Η 2 Ο και
ΝΑΟΡΗ (βλ. Εικόνα
14-37).
Οι συνέπειες αυτού του βιολογικού βήματος ή
ταν μεγάλες. Για πρώτη φορά υπήρξαν οργανισμοί μ' ελάχιστες χημικές απαι τήσεις από το περιβάλ/ον τους. Αυτά τα κύπαρα μπορούσαν να διασπαρούν και να εξελιΧθούν κατά τρόπους αδιανόητους για τα πρωιμότερα φωτοσυνθε τικά βακτήρια, τα οποία xρειάzovταν
H2S ή
οργανικά οξέα ως πηγή ηλεκτρο
νίων. Έτσι, σταδιακά συσσωρεύθηκαν μεγάλες ποσότητες βιολογικά συvτε θειμένων οργανικών υλικών που πρoσφέρovταν για Ζύμωση. Επίσης, για
πρώτη φορά απελευθερώθηκε οξυγόνο στην ατμόσφαιρα (Εικόνα
14-44).
Η παρουσία του οξυγόνου επέτρεψε την ανάπτυξη βακτηρίων που βασί Ζονταν σε αερόβιο μεταβολισμό για τη σύνθεση ΑΤΡ. Όπως εξηγήσαμε προηγουμένως, αυτοί οι οργανισμοί ήταν σε θέση ν' αξιοποιήσουν τη μεγά λη ποσότητα ενέργειας που απελευθερώνεται από την αποδόμηση των υδα
τανθράκων και άλλων οργανικών μορίων σε
CO2 και Η2 ο.
Καθώς συσσωρεύονταν οργανικές ενώσεις ως παραπροϊόν της φωτο
σύνθεσης, μερικά φωτοσυνθετικά βακτήρια γονοι του Ε.
-
μεταξύ των οποίων και οι πρό
coJi - έχασαν την ικανότητα να επιβιώνουν με βάση αποκλεισΙΙ
κά την ενέργεια του ηλιακού φωτός και κατέληξαν να εξαρτώvται αποκλεισΙΙ
κά από την κυπαρική αναπνοή. ΜιτοΧόνδρια αναπτύχθηκαν όταν ένα αρχέ γονο ευκαρυωτικό κύπαρο καταβρόΧθισε ένα τέτοιο βακτήριο (εξαρτώμενο από την αναπνοή). Φυτά αναπτύχθηκαν λίγο αργότερα, όταν ένας απόγονος αυτού του πρώιμου αερόβιου ευκαρυώτη αιχμαλώτισε ένα φωτοσυνθετικό
Η Προέλευση των Χλωροπλαστών και των Μιτοχονδρίων
605
20 ΕΠΙΠΕΔΑ
έναρξη ταχείας
ΟΞΥΓΟΝον ΣΤΗΝ
συσσώρευσης 02
ΑΤΜΟΣΦΑΙΡΑ
(%)
(κατανάλωση του
10
ΧΡΟΝΟΣ
(ΔΙΣΕΚΑΤΟΜΜΥΡΙΑ ΧΡΟΝΙΑ)
Fe 2+
των ωκεανών)
_ - - - - - - - - - - - - - - - - - - - - -.....4.6 ,--Ι
3.6
- - - - , - - - '
Ι
δημιουργία των ωκεανών και των
ηπείρων δημιουργία της Γης
~~I τα
πρώτα
ζωντανά
1.6
2.6
0.6
L--,-Ji προέλευσητων
φωτοσύνθεση με
φωτοσυνθετικών
απελευθέρωση 02
κυπάρων
κύτταρα
τα πρώτα φωτοσυνθετικά
διάδοση αερόβιας
κύτταρα
Τ
σήμερα
τα πρώτα
σπονδυλωτά
ευκαρυωτικών
διάσπαση νερού και
!
τα πρώτα πολυκύτταρα φυτά και ζώα
αναπνοής
Εικόνα 14-44. Η ζωή στη Γη εξελίχθηκε μέσα σε δισεκατομμύρια χρόνια. Με την εξέλιξη της μεμβρανικής διεργασίας της φωτοσύνθεσης, οι οργανισμοί έπαψαν να εξαρτώνται από έτοιμες οργανικές χημικές ενώσεις. Ήταν πλέον σε θέση να παράγουν τα δικά τους οργανικά μό ρια από αέριο
CO 2 . Ανάμεσα στην εμφάνιση βακτηρίων που διασπούσαν το νερό και απελευθέρωναν 02 κατά τη φωτοσύνθεση και στη συσ 02 στην ατμόσφαιρα μεσολάβησε πάνω από ένα δισεκατομμύριο χρόνια. Αυτό πιστεύεται ότι οφειλόταν στο γεγονός ότι το αρχικά παραγόμενο οξυγόνο αντιδρούσε με τον άφθονο δισθενή σίδηρο (Fe2 +) των αρχέγονων ωκεανών. Ο σίδηρος απομά σώρευση μεγάλων ποσοτήτων
κρυνε οξυγόνο από την ατμόσφαιρα και σχημάτιζε τις τεράστιες εναποθέσεις οξειδίων του σιδήρου που βρίσκουμε σε μερικά πετρώματα αυτής της ηλικίας. Το οξυγόνο άρχισε να συσσωρεύεται στην ατμόσφαιρα μόνο αφότου καταναλώθηκε ο σίδηρος. Η αερόβια αναπνοή που βασίζεται στις μεμβράνες μάλλον αναmύχθηκε σε απάντηση προς την αυξανόμενη ποσότητα του οξυγόνου στην ατμόσφαιρα. Η συνεχής
αύξηση του οξυγόνου στην ατμόσφαιρα αναχαιτίσθηκε από την εμφάνιση μη φωτοσυνθετικών οργανισμών που κατανάλωναν οξυγόνο.
βακτήριο, το οποίο έγινε έτσι ο πρόδρομος του XΛωρoπΛάσrη. Τα ευκαρυω τικά κύπαρα άρχισαν να προχωρούν σro θαυμασrό δρόμο της εξέλιξης που
τελικά οδήγησε σroυς πολύπλοκους πολυκύπαρους οργανισμούς μόνο α φού προηγουμένως απέκτησαν τους βακτηριακούς συμβιώτες που έγιναν μι
τοΧόνδρια και XΛωρoπΛάσrες (σrην περίπτωση των αλγών και των φυτών).
Ο τρόπος Ζωής '[ου MethanococcuS υποδηλώνει όη η χημειωσμωηκή σύΖευξη είναι αρΧέγονη διεργασία
Σήμερα, συνθήκες ανάλογες με εκείνες σrις οποίες πισrεύεται ότι έΖησαν τα πρώτα κύπαρα, πριν από
3.5-3.8 δισεκατομμύρια
χρόνια, επικρατούν κο
ντά σrις υδροθερμικές φλέβες σroν πυθμένα του ωκεανού. Οι φλέβες αυτές αντιπροσωπεύουν περιοχές όπου ο ρευσrός μανδύας της γης ανοίγει τον φλοιό της αυξάνοντας το εύρος του ωκεάνιου πυθμένα. Τα σύγχρονα είδη
των μικροοργανισμών που σχετίΖΟνται πιο σrενά με τον πιθανολογούμενο κοινό πρόγονο όλων των Ζωντανών οργανισμών εμφανίζουν το κοινό yvώρι
σμα ότι Ζουν σε υψηλή θερμοκρασία (από
75 ο C έως 95 ο C, κοντά
σro σημείο
βρασμού του νερού). Το γεγονός αυτό υποδηλώνει ότι το κοινό προγονικό
(αρΧέγονο) κύπαρο διαβιούσε κάτω από πολύ θερμές αναερόβιες συνθήκες. Το
Methanococcus jannaschii είναι
ένα από τα Αρχαία που Ζει σε υψηλή
θερμοκρασία. Απομονώθηκε από μια υδροθερμική φλέβα περίπου
2000
μέτρα κάτω από την επιφάνεια της θάλασσας και αυξάνει χρησιμοποιώντας ως τροφή αΠOκλεισrΙKά και μόνο ανόργανα υλικά σε συνθήκες πλήρους α-
606
Κεφάλαιο 14: Παραγωγή Ενέργειας στα Μιτοχόνδρια και στους Χλωροπλάστες
πουσίας φωτός και αέριου οξυγόνου. Το
ριο υδρογόνο (Η 2 ),
Methanococcus χρησιμοποιεί
αέ
CO 2 και αέριο άΖωτο (Ν2 ) που αναβλύΖουν από τη φλέ
βα. Ο τρόπος Ζωής του προσφέρει ενδείξεις για το πώς θα μπορούσαν τ' αρ Χέγονα κύπαρα να χρησιμοποιούν τη μεταφορά των ηλεκτρονίων για ν' α ποκτούν την ενέργεια και τα οργανικά μόρια που χρειάΖονταν από ανόργα νες πρώτες ύλες, οι οποίες αφθονούσαν στη θερμή αρΧέγονη Γη. Το
Methanococcus χρησιμοποιεί το αέριο
άΖωτο ως πηγή αΖώτου για ορ
γανικά μόρια, όπως τ' αμινοξέα. Με προσθήκη υδρογόνου ανάγει το Ν 2 σε αμμωνία (ΝΗ 3 ). Η μετατροπή αυτή επιτρέπει την ενσωμάτωση του αΖώτου σε
οργανικά μόρια. Η διεργασία της δέσμευσης του αΖώτου (nitrogen fixation) απαιτεί μεγάλη ποσότητα ενέργειας. Το ίδιο ισχύει και για τη διεργασία δέ
σμευσης του άνθρακα, με την οποία το βακτήριο μετατρέπει το
CO 2 σε σάκ
χαρα. Μεγάλο μέρος της ενέργειας που απαιτείται και για τις δύο διεργασίες προέρχεται από τη μεταφορά ηλεκτρονίων από το Η 2 στο
CO 2,
η οποία συ
νοδεύεται από την απελευθέρωση μεγάλων ποσοτήτων μεθανίου
(CH 4) ως
απόβλητου προϊόντος (το, βακτήριο παίρνει το όνομά του από το μεθάνιο, Ει κόνα 14-45Α). Με τον τρόπο αυτό παράγεται φυσικό αέριο. Ένα μέρος της συγκεκριμένης μεταφοράς ηλεκτρονίων συμβαίνει στη βακτηριακή μεμβρά
νη και οδηγεί σε άντληση πρωτονίων (Η+) διαμέσου της μεμβράνης. Η προ κύπτουσα ηλεκτροχημική βαθμίδωση των πρωτονίων υποκινεί μια συνθάση του ΑΤΡ της μεμβράνης για την παραγωγή ΑΤΡ. Η ανεύρεση της χημειω
σμωτικής σύΖευξης σ' έναν οργανισμό όπως το
Methanococcus υποδηλώνει
ότι η αποθήκευση της ενέργειας που προέρχεται από μεταφορά ηλεκτρο
νίων σε μια βαθμίδωση Η+ είναι εξαιρετικά αρχέγονη διεργασία. Ο μηχανισμός που χρησιμοποιείται από το
Methanococcus για τη
δέ
σμευση του άνθρακα είναι εντελώς διαφορετικός από την οδό δέσμευσης
Εικόνα
14·45. Το Methanococcus παράγει
ε
του άνθρακα στα φυτά, στις άλγες και στα κυανοβακτήρια. Όπως φαίνεται
νέργεια με τον μηχανισμό της χημειωσμωτι
στην Εικόνα 14-45Β το αέριο υδρογόνο (Η 2 ) δεν είναι μόνο πηγή των ηλε
κής σύζευξης αλλά δεσμεύει τον άνθρακα με
κτρονίων υψηλής ενέργειας για τη μεμβρανική διεργασία που παράγει ΑΤΡ,
μια οδό διαφορετική από την αντίστοιχη οδό των φυτών, των αλγών και των κυανοβακτη ρίων. Αυτό το βακτήριο της βαθιάς θάλασσας
χρησιμοποιεί αέριο υδρογόνο (Η 2 ) ως πηγή α
r 0-.
ναγωγικής δύναμης και στις δύο οδούς που ει κονίζονται εδώ. (Α) Παραγωγή ενέργειας. Η
παραγωγή ενέργειας και OJιόvτα
•
σηματοδοτικό μόριο
••
υποδοχέας
(Β)
ΥΠΟΔΟΧΕΙΣ ΠΟΥ ΣΥΝΔΕΟΝΤΑΙ ΜΕ G ΠΡΩΤΕϊΝΕΣ σηματοδοτικό μόριο
πρωτείνη
(η
G
ενεΡΥοποιημένο ένζυμο
ενεΡΥοποιημένη πρωτείνη
G
ΥΠΟΔΟΧΕΙΣ ΠΟΥ ΣΥΝΔΕΟΝΤΑΙ ΜΕ ΕΝΖΥΜΑ
σηματοδοτικό μόριο ----~~!iί!!!ι
___ σηματοδοτικόμόριο
στη μορφή ενός διμερούς
L ή
ανενεργός καταλυτική περιοχή
ενεΡΥός καταλυτική περιοχή
ενεργοποιημένο ένζυμο
Εικόνα 16·14. Οι τρεις κατηγορίες των υποδοχέων της κυπαρικής επιφάνειας. (Α) Οι υποδοχείς που συνδέονται με διαύλους ιόντων, α νοίγουν (ή κλείνουν) σε απάντηση στην πρόσδεση του συνδέτη τους. (Β) Η πρόσδεση συνδέτη-υποδοχέα που συνδέεται με μια G-πρωτεί\ιη συνοδεύεται από μεταβίβαση του σήματος σε μια πρωτεινη που συνδέεται με
GTP
(G-πρωτεινη) η οποία εφάmεται με τον υποδοχέα. Στη
συνέχεια, η πρωτεινη αυτή εγκαταλείπει τον υποδοχέα και ενεργοποιεί ένα ένζυμο (ή δίαυλο ιόντων) της KUΠαΡΙKής μεμβράνης. Για λόγους απλούστευσης, η G-πρωτεινη αποδίδεται στην εικόνα ως μονομερές μόριο, ενώ στην πραγματικότητα είναι ένα σύμπλοκο τριών υπομονά δων που διίστανται. (η Ένας υποδοχέας συνδεόμενος μ' ένα ένζυμο μόλις προσδεθεί με τον εξωKUΠάρΙO συνδέτη του ενεργοποιεί την εν ζυμική δράση που εντοπίζεται στην ενδοκυπάρια πλευρά του υποδοχέα. Πολλοί υποδοχείς που συνδέονται με ένζυμα έχουν ενζυμική ε νεργότητα (αριστερά), ενώ άλλοι βασίζονται σε ένζυμα με τα οποία σχετίζονται (δεξιά).
•,
Ερώτηση
164
δοΧέα, καταλαμβάνοντας τη θέση πρόσδεσης του συνδέτη, είτε προσδένο
Οι σηματοδοτικοί μηχανι
νται σroν υποδοΧέα σε κάποια άλ/η θέση, ανασrέλ/oντας ή υπερδιεγείρο
σμοί που χρησιμοποιούνται
ντας τη φυσιολογική δρασrηριότητά του. Με τον τρόπο αυτό, δρουν πολ/ά
από έναν υποδοΧέα μιας
φάρμακα και δηλητήρια (Πίνακας
σrερoειδoύςορμόνης και έ
της φαρμακευτικής βιομηχανίας είναι αφιερωμένο σrην ανεύρεση ουσιών οι
ναν υποδοΧέα που συνδέε
οποίες να επιφέρουν ένα καθορισμένο αποτέλεσμα μέσω της πρόσδεσής
ται μ' έναν δίαυλο ιόντων εί
τους σ' ένα συγκεκριμένο είδος υποδοΧέα της κυπαρικής επιφάνειας.
16-2). Μεγάλο
μέρος της δρασrηριότητας
ναι πολύ απλοί και περιλαμβάνουνπολύ λίγα συσrαΤΙKά. Μπορείάραγε να οδηγή
Οι υποδοχείς που συνδέονται με διαύλους ιόντων
σουν σε ενίσχυση του αρχικού σήματος
μετατρέπουν τα χημικά σήματα σε ηλεκτρικά
και, αν ναι, με ποιο τρόπο;
Οι υποδοχεις που συνδέονraι με δΙQύΛους ιόνrων (ίon-channel
linked receptors),
674
Κεφάλαιο 16: Κυτταρική Επικοινωνία
γνωσroί επίσης και ως διαυΛοιιόντων εΛεγΧόμενοι Q-
,
Πίνακας
16-2. Μερικές
Σηματοδοτικό μόριο
Ουσία
Valium
ουσίες που απoμιμoύvται φυσικά σηματοδοτικά μόρια.
γ-αμινOβOUΤυΡΙKό οξύ
και βαρβι-
(GABA)
τουρικά
Δράση σε υποδοχείς
Αποτέλεσμα
διεγείρουν GΑΒΑ-ενεργικούς
αΥχολυτική δράση, καταστολή
υποδοχείς που συνδέονται με διαύλους ιόντων
Νικοτίνη
ακετυλοχολίνη
διεγείρει χολινεργικούς υποδο-
χείς που συνδέονται με διαύλους ιόντων Μορφίνη και ηρωίνη
ενδορφίνες και εγκεφαλίνες
διεγείρουν υποδοχείς οπιούχων
αγγειοσύσπαση, αύξηση αρτηριακής πίεσης
αναλγητική δράση, ευφορία
που συνδέονται με G-πρωτε"ίνες Κουράριο
αναστέλλει χολινεργικούς υποδο-
ακετυλοχολίνη
χείς που συνδέονται με διαύλους ιόντων Στρυχνίνη
πό δ1Q616aστές
γλυκίνη
(transmitter-gated
ίοη
channe1s)
αναστολή νευρομυ'ίκής μεταβίβασης που οδηγεί σε παράλυση
αναστέλλει υποδοχείς γλυκίνης
αναστολή ανασταλτικών συνάψεων
που συνδέονται με διαύλους
στο νωτιαίο μυελό που προκαλεί
ιόντων
σπασμούς και μυΙκή σύσπαση
λειτουργούν με τον α
πλούστερο και αμεσότερο τρόπο. Πρόκειτοι για τους υποδοχείς που ε κτελούν τοχεία μετοβίβαση διαμέσου συνάψεων του νευρικού συοτήμα τος. Οι υποδοχείς αυτοί μετοτρέπουν απευθείας ένα χημικό σήμα, υπό
, μορφή
παλμού ενός νευρομετοβιβαοτή που εκΜετοι οτο εξωτερικό του
κυττάρου-οτόχου, σ' ένα ηλεκτρικό σήμα, υπό μορφή μιας μεTOβolΊής
δυναμικού διαμέσου της κυτταρικής μεμβράνης. Μόλις προσδεθεί ο νευροδιαβιβαοτής, οι υποδοχείς αυτής της κοτηγορίας υφίοτανωι μια
μεTOβolΊή διαμόρφωσης που οδηγεί οτο άνοιγμα ή το κλείσιμο του διαύ
λου για τη ροή ενός συγκεκριμένου ιόντος, όπως Na +, Κ+, Ca 2 + ή C1(βλ. Εικόνα 16-14Α). Ωθούμενα από την ηλεκτροχημική βαθμίδωσή τους διαμέσου της μεμβράνης, ΤΟ ιόντα εισρέουν οτο κύτταρο ή εκρέουν από αυτό, προκαλώντας μια μεTOβolΊή ΟΤΟ δυναμικό της μεμβράνης μέ σα σ' ένα, περίπου, χιλιοοτό του δευτερολέπτου. Η μετοβολή αυτή μπο ρεί να πυροδοτήσει μια νευρική ώση ή να μεωβάλει τη δράση άλλων
σημάτων. Όπως θα δούμε αργότερα, το άνοιγμα των διαύλων Ca 2 + έχει ειδικές συνέπειες, επειδή οι μετοβολές της ενδοκυττάριας συγκέντρω σής του μπορεί να επηρεάσουν σημαντικά την ενεργότηω πολλών ενΖύ
μων. Η λειτουργία των υποδοχέων που συνδέονται με διαύλους ιόντων μάς απασχόλησε λεπτομερώς οτο Κεφάλαιο
12.
Οι υποδοχείς που συνδέονται με διαύλους ιόντων αφθονούν οτο νευρικό σύοτημα και σε άλ/α ηλεκτρικώς διεγειρόμενα κύτταρα (όπως ΤΩ μυϊκά). Α ντίθετο, οι υποδοχείς που συνδέονται με G-πρωτείνες
(G-protein-linked receptors) όπως επίσης και οι υποδοχείς που συνδέονται με ένΖυμα (enzyme1inked receptors) χρησιμοποιούνται πρακηκά απ' όλα τα είδη κυττάρων του σώματος. Οι περισσότερες από ης υπόλοιπες παραγράφους αυτού του κε φαλαίου είναι αφιερωμένες σε αυτούς ακριβώς τους υποδοχείς και οτις διερ γασίες μεταβίβασης σημάτων που πυροδοτούν.
Γενικές Αρχές της Κυτταρικής Σηματοδότησης
675
Πολλές ενδοκυπάριες σηματοδΟIlκές πρωτεΊνες δρουν σαν μοριακοί διακόmες Τα σήματο που παραλαμβάνοντοι από υποδοχείς συνδεμένους με
G-
πρωτεΊνες ή με ένΖυμα μετοφέρονται σε περίτεχνα συστήματο μετοβίβασης
που σχηματίΖΟνται από ακολουθίες ενδοκυπάριων σηματοδοτικών μορίων. Εκτός από λίγα μικρά μόρια (όπως το κυκλικό 2
GMP, το
κυκλικό ΑΜΡ και το
Ca +), ΤΟ ενδοκυπάρια σηματοδοτικά μόρια είναι πρωτε'ίνες. Ορισμένες λει
τουργούν ως χημικοί μετοβιβαστές: απαντούν σ' ένα ορισμένο χημικό σήμα
και δημιουργούν ένα άλ/ο σήμα. ΆΛΛες λειτουργούν ως αΥΥελιοφόροι: πα ραλαμβάνουν ένα σήμα από ένα σημείο του κυπάρου και μετοκινούνται σ' έ να άλ/ο σημείο για να προκαλέσουν κάποια δράση (βλ. Εικόνα
16-8).
Οι περισσότερες από τις κύριες ενδοκυπάριες σηματοδοτικές πρωτεΊνες
λειτουργούν σαν μοριοκοfδιοκόrnες
(molecular switches): η παραλαβή
ενός
σήματος προκαλεί τη μετάπτωση των πρωτεϊνών από μια ανενεργό σε μια ε νεργό κατάσταση στην οποία παραμένουν έως ότου κάποια άλ/η διεργασία τις απενεργοποιήσει Η σημασία της απενεργοποίησης συχνά παραβλέπετοl.
Για ν' ανανήψει μια σηματοδοτική οδός μετά τη μετοβίβαση ενός σήματος και να είναι έτοιμη για τη μετάδοση ενός νέου σήματος, κάθε «μοριακός δια κόπτης» πρέπει να επανέλθει στην αρχική, μη διεγερμένη κατάστασή του. Ε
πομένως, σε κάθε βήμα, για κάθε μηχανισμό ενεργοποίησης πρέπει να υ
πάρχει ένας μηχανισμός απενεργοποίησης που είναι εξίσου σημαντικός για τη λειτουργία του συστήματος.
Οι πρωτε'ίVες που δρουν σαν μοριακοί διακόπτες γενικά ανήκουν σε μια από δύο κύριες κατηγορίες. Η πρώτη και πολύ μεγαλύτερη κατηγορία περι λαμβάνει πρωτεΊνες των οποίων η δραστικότητο ρυθμίΖετοι με φωσφορυ/\ίω ση (βλ. Κεφάλαιο
4, Εικόνα 4-41). Στις πρωτεΊνες
αυτές, ο «διακόπτης» γυρί-
Ζει προς μια κατεύθυνση από μια πρωτεϊνική κινάση, η οποία προσθέτει στην πρωτεΊνη μια φωσφορική ομάδα, και προς την αντίθετη κατεύθυνση από μια πρωτεϊνική φωσφατάση, η οποία αφαιρεί τη φωσφορική ομάδα (Εικόνα
16-
15Α). Πολ/ές από τις πρωτεΊνες-«διακόπτες» που ελέγχονται με φωσφορυ
/\ίωση είναι και οι ίδιες πρωτεϊνικές κινάσες και συχνά οργανώνονται σε α-
Εικόνα 16-15. Ενδοκυπάριες σηματοδΟTlκές πρωτε'ί"νες που δρουν σαν μοριακοί διακό
~ :ΣΑ~ΠΡόσδε:D η υδΡ~O- Θ
πτες. Και στις δύο περιmώσεις μια ενδοκυπά
ρια σηματοδοτική πρωτεΤνη ενεργοποιείται ή απενεργοποιείται από την προσθήκη ή την α
~ ~
φαίρεση, αντιστοίχως, μιας φωσφορικής ομά
.....
δας, Στο (Α) η φωσφορική ομάδα προστίθεται ομοιοπολικά στην πρωτεΤνη από μια πρωτε'ίνι
του GTP λυση του ενεργοποιεί GTP ενερ:
γοποιει
1 11 "....
κή κινάση, η οποία μεταφέρει την τελική φω σφορική ομάδα του ΑΤΡ στη σηματοδοτική πρωτεΤνη, Η φωσφορική ομάδα αφαιρείται α πό μια πρωτε'ίνική φωσφατάση, Στο
(8)
η ση
ματοδοτική πρωτεΤνη αναγκάζεται ν' ανταλλά ξει το
GDP
με
GTP.
GDP απενεργοποιεί
676
Η υδρόλυση του
GTP
σε
την πρωτεΤνη.
Κεφάλαιο 16: Κυτταρική Επικοινωνία
(Α)
ΣΗΜΑΤΟΔΟΤΗΣΗ ΜΕ ΦΩΣφοργΛΙΩΣΗ
(Β)
ΣΗΜΑΤΟΔΟΤΗΣΗ ΑΠΟ ΜΙΑ ΠΡΩΤΕϊΝΗ ΠΟΥ ΣγΝΔΕΕΤΑΙ ΜΕ ΤΟ
GTP
.
κοΛουθ{ες φωσφορυi\[ωσnς
(phosphorylation cascades):
μια πρωτεϊνική κι
νάση, που έχει ενεργοποιηθεί με φωσφορυλίωση, φωσφορυλιώνει την επό μενη πρωτεϊνική κινάση της ακολουθίας και ούτω καθεξής. Έτσι, το σήμα
προωθείται και παράλ/ηλα ενισχύεται, κατανέμεται και τροποποιείται. Η άλ/η κύρια κατηγορία πρωτεϊνών-«διακοπτών» που συμμετέχουν σrη σηματοδότηση περιλαμΒάνει πρωτε'ί'νες που συνδέονται με το
GTP.
Οι πρω
τε'ί'νες αυτές «παλινδρομούν» ανάμεσα σε μια ενεργό και μια ανενεργό κατά σrαση ανάλογα με το αν είναι συνδεδεμένες με το
16-158).
GTP ή το GDP
(Εικόνα
Οι μηχανισμοί που ελέγχουν τη μετάπτωση θα περιγραφούν σrην
επόμενη παράγραφο. Οι πρωτε'ί'νες που συνδέονται με το
GTP παίΖουν
ση
μαντικό ρόλο σε αρκετές σηματοδοτικές οδούς. Μια κατηγορία από αυτές τις πρωτε'ϊνες, yνωσrές και ως G-ΠΡωτε'ϊvες, έχουν κεντρική θέση σrη σηματο δότηση μέσω υποδοχέων που συνδέονται με G-πρωτε'ϊνες.
Υποδοχείs που συνδέΟνΙαι με
G-πρωιείvεs Οι υποδοχείς που συνδέονται με G-πρωτεΤνες
tors)
(G-protein-linked recep-
είναι η μεγαλύτερη οικογένεια υποδοχέων της κυπαρικής επιφάνειας.
Στα κύπαρα των θηλασrΙKών έχουν ήδη αναyνωρισrεί εκατοντάδες υποδο χείς αυτής της κατηγορίας, ΟΙ οποίοι συμμετέχουν σrις απαντήσεις σε μια τε
ράσrια ποικιλία εξωκυπάριων σηματοδοτικών μορίων, όπως ορμόνες, τοπι κούς διαμεσολαΒητές και νευρoδιαBιBασrές. Τα σηματοδοτικά μόρια ποικίλ
λουν τόσο ως προς τη λειτουργία όσο και ως προς τη δομή τους: μπορεί να είναι πρωτε'ί'νες, μικρά πεπτίδια ή παράγωγα αμινοξέων ή λιπαρών οξέων και για καθένα ξεxωρισrά υπάρχει ένας διαφορετικός υποδοχέας ή ομάδα υπο δοχέων.
Παρά την ποικιλία των αντίσroιxων σηματοδοτικών μορίων, όπως αποκα λύπτουν οι σχετικές αναλύσεις, όλοι οι υποδοχείς που συνδέονται με
G-
πρωτε'ϊνες έχουν παρόμοια δομή. Συγκεκριμένα, αποτελούνται από μια συ νεχή πολυπεπτιδική αλυσίδα που διαπερνά τη μεμΒράνη πάνω-κάτω επτά φορές (Εικόνα
16-16). Η υπεροικογένεια αυτή των υποδοχέωv με επτά δια (seven-pass transmembrane receptor proteins) περι
μεμΒραvικές α-έΛικες
Εικόνα
λαμΒάνει τη ροδοψίνη (τη φωτοευαίσθητη πρωτε'ί'νη των φωτοϋποδοχέων
ονται με G πρωτε'ί'νες έχουν παρόμοια δομή. Τα κυπαροπλασματικά τμήματα του υποδο
σroυς οφθαλμούς των σπονδυλωτών), τους οσφρητικούς υποδοχείς της μύ της των σπονδυλωτών και τους υποδοχείς που συμμετέχουν σro τελετουργι
κό του Ζευγαρώματος του Ζυμομύκητα. Από εξελικτική άποψη η προέλευση
16-16. Όλοι
οι υποδοχείς που συνδέ
χέα είναι υπεύθυνα για την πρόσδεση με την G πρωτεΊνη, Οι υποδοχείς που προσδένουν μό ρια σηματοδοτικών πρωτε'ίνών διαθέτουν μια μεγάλη εξωκυπάρια πολυπεmιδική αλυσίδα
αυτών των υποδοχέων είναι πολύ αρχέγονη, εφόσον δομικά ανάλογες μεμ
για τη σύνδεση του προσδέτη που στο σχήμα
Βρανικές πρωτε'ί'νες υπάρχουν ακόμα και σrα Βακτήρια, όπως η Βακτηριορο
φαίνεται με ανοιχτό πράσινο χρώμα, Οι υπο
δοψίνη, η οποία λειτουργεί ως φωτοευαίσθητη αντλία Η+ (Βλ. Κεφάλαιο
11).
δοχείς για μικρά σηματοδοτικά μόρια, όπως η αδρεναλίνη, διαθέτουν μικρές εξωκυπάριες
Ωσrόσo, σrα Βακτήρια οι πρωτε'ί'νες αυτές δεν δρουν ως υποδοχείς συνδεδε
περιοχές, Σε αυτούς τους υποδοχείς, η θέση
μένοι με G-πρωτε'ί'νες. Τα Βακτήρια δεν διαθέτουν G-πρωτε'ί'νες και ΟΙ επι
σύνδεσης του προσδέτη συχνά σχηματίζεται
φανειακοί υποδοχείς μέσω των οποίων ανιχνεύουν τις θρεπτικές ουσίες εί ναι συΖευγμένοι με διαφορετικά συσrήματα μεταΒίΒασης σημάτων.
μέσα στην κυπαρική μεμβράνη από τμήματα των διαμεμβρανικών περιοχών των αντίστοι χων υποδοχέων.
Υποδοχείς που Συνδέονται με G-Πρωτε'fνες
677
Η διέγερση των υποδοΧέων που συνδέονται με G-πρωτε'ί'νες ενεργοποιεί υπομονάδες των πρωτεϊνών αυτών 'ΟΙαν ένα εξωκυπάριο σηματοδοηκό μόριο προσδεθεί σ' έναν υποδοΧέα
επτά διαμεμβρανικών διαβάσεων, ο υποδοχέας υφίοτατοι μια αλλαγή δια μόρφωσης που τροποποιεί ΤΟ ενδοκυπάριο τμήμα του και καθιοτά δυνατή την αλληλεπίδραση με μια G-πρωτεΊνη που εντοπίΖετοι οτην κυπαροπλα σμαηκή πλευρά Της κυπαρικής μεμβράνης. Για να εξηγήσουμε ης συνέπειες αυτής Της αλληλεπίδρασης πρέπει προηγουμένως να εξετάσουμε Τη δομή και Τη λειτουργία των G-πρωτεϊνών.
Υπάρχουν αρκετές ποικιλίες G-πρωτεϊνών. Καθεμιά είναι ειδική για μια ορισμένη ομάδα υποδοΧέων και μια ορισμένη ομάδα ενδοκυπάριων πρω τεϊνών-οτόχων. Ωοτόσο, όλες οι G-πρωτεΊνες έχουν παρόμοια δομή και λειτουργούν με παρόμοιο τρόπο. Αποτελούντοι από τρεις πρωτεϊνικές υπο μονάδες, ης α, β και γ. Δύο από ης υπομονάδες συνδέοντοι με Την κυπα ρική μεμβράνη με μικρές λιπιδικές ουρές. Σε κοτάοταση ηρεμίας, η υπο
μονάδα α είναι συνδεδεμένη με
GDP (Εικόνα 16-17Α) και η G-πρωτεΊνη
είναι αδρανής. 'ΟΙαν ένας εξωκυπάριος συνδέΤης προσδεθεί οτον υποδο Χέα, ο υποδοχέας αλληλεπιδρά με Την G-πρωτεΊνη και Την ενεργοποιεί, α ναγκάΖοντος Την α υπομονάδα ν' αποβάλ/ει ΤΟ συνδεμένο
GDP
υποδοχέας
(A)~==::::
Εικόνα
16-17,
Οι G-πρωτε'ίΎες διίστανται σε
δύο σηματοδοτικές πρωτε"ί"νες όταν ενεργο ποιούνται, (Α) Σε μη διεγερμένη κατάσταση, τόσο ο υποδοχέας όσο και η G-πρωτεΤνη είναι
ΕΞΩΚΥΠΑΡΙΟΣ ΧΩΡΟΣ
ανενεργοί και μάλλον δεν έρχονται σε επαφή.
(8)
Η ενεργοποίηση του υποδοχέα από το ε
(B)~==::::
ξωκυπάριο σηματοδοτικό μόριο επιτρέπει στην G-πρωτείνη ν' αλληλεπιδράσει με τον υ
ΚΥΠΑΡΟΔΙΜΥΜΑ
ποδοχέα. (η Η πρόσδεση στον ενεργοποιημέ νο υποδοχέα ωθεί την α υπομονάδα της πρωτεΤνης ν' ανταλλάξει το
GGDP με GTP. Αυτό
οδηγεί σε διάσταση της G-πρωτεΤνης σε μια ε νεργοποιημένη α υπομονάδα και ένα σύμπλο κο βγ, που διαχέονται κατά μήκος της εσωτε ρικής επιφάνειας της κυπαρικής μεμβράνης
έως ότου συναντήσουν τις πρωτείνες-στόχους
~-1
BΙiΙ-Ί ενεργοποιημένες υπομονάδες της
τους. Ο υποδοχέας παραμένει ενεργός όσο εί ναι συνδεδεμένος με το εξωκυπάριο σηματο δοτικό μόριο και έτσι μπορεί να καταλύσει την
Ι
(Γ) ~::::::::::::
ενεργοποίηση εκατοντάδων ή χιλιάδων μο
tO
ρίων μιας G-πρωτεΤνης. Τόσο η υπομονάδα α όσο και η υπομονάδα γ της G-πρωτεΤνης συν δέονται ομοιοπολικά με λιπίδια (κόκκινο) που βοηθούν στην προσάραξη των υπομονάδων στην κυπαρική μεμβράνη.
678
Κεφάλαιο
16: Κυτταρική Επικοινωνία
G πρωτείνης
Ι
ενεργοποιημένη
α υπομονάδα
_
~
ενεργοποιημένο σύμπλεγμα βγ
και να ΤΟ
ανπκαταστήσει με
GTP.
Η ενεργοποίηση καταλήγει σε διάσταση της
πρωτε'ϊνης σε μια ενεργοποιημένη α υπομονάδα με συνδεμένο
G-
GTP και σ'
ένα σύμπλοκο βγ. Έτσι, παράγονται δύο ξεχωριστά μόρια που διαΧέονται ελεύθερα κατά μήκος της μεμβράνης (Εικόνα 16-17Β και Γ). Τα δύο ενερ γοποιημένα τμήματα μιας G-πρωτε'ϊνης, δηλαδή η υπομονάδα α και το σύ μπλοκο βγ, αλ/ηλεπιδρούν άμεσα με στόχους που εντοπίΖονται στην κυτ ταρική μεμβράνη, οι οποίοι με τη σειρά τους μεταβιβάΖουν το σήμα σε άλ
λους προορισμούς. Όσο περισσότερο χρόνο παραμείνουν συνδεδεμένοι οι στόχοι με την α υπομονάδα ή το σύμπλοκο βγ, τόσο πιο ισχυρό και πα
ρατεταμένο θα είναι το μεταδιδόμενο σήμα. Η συμπεριφορά της α υπομονάδας καθορίζει το χρονικό διάστημα που τα δύο ενεργοποιημένα τμήματα της G-πρωτε'ϊνης (η α υπομονάδα και οι βγ υ πομονάδες) δρουν ανεξάρτητα. Η α υπομονάδα διαθέτει ευγενή ενεργότητα
υδρoi\άσης του
GTP (GΤΡάση) και μετά από ένα ορισμένο χρονικό διάστημα υδρολύει το συνδεδεμένο GTP σε GDP. Κατόπιν επανασυνδέεται με το 00μπλοκο βγ, οπότε η μεταβίβαση του σήματος σταματά (Εικόνα 16-18). Γενικά, αυτό συμβαίνει λίγα δευτερόλεmα μετά την ενεργοποίηση της G-πρωτε'ϊνης. Το συγκεκριμένο σύστημα μάς επιτρέπει να τονίσουμε ξανά μια γενική αρχή της κυτταρικής σηματοδότησης: οι μηχανισμοί που διακόπτουν ένα σή
μα είναι εξίσου σημαντικοί με τους μηχανισμούς οι οποίοι το ενεργοποιούν (βλ. Εικόνα 16-15Β). Προσφέρουν πολ/ές δυνατότητες για έλεγχο προκα λούν όμως και πολ/ά ανεπιθύμητα συμβάντα. Ένα σχετικό παράδειγμα πα ρέχει το νόσημα χολέρα. Η χολέρα ΠΡOKαi\είται από ένα βακτήριο που πολ λαπλασιάΖεται στο έντερο όπου παράγει μια πρωτε'ϊνη γνωστή ως χοi\ερικΩ τοξίvη
(cholera toxin).
Η πρωτε'ϊνη αυτή εισέρχεται στα κύτταρα που επενδύ
ουν το έντερο και τροποποιεί την α υπομονάδα μιας G-πρωτε'ϊνης [ονομάζεται
Gs, επειδή,
όπως θα δούμε στη συνέχεια, διεγείρει
(stimulate) την αδενυλική GTP. Ε
Kυκi\άση] στερώντας της τη δυνατότητα να υδρολύει το προσδεμένο
16-5
πομένως, η τροποποιημένη α υπομονάδα παραμένει σε ενεργό κατάσταση α
Ερώmση
περιόριστα και συνεχίζει να μεταδίδει ένα σήμα στις πρωτε'ϊνες-στόχους της.
Οι υποδοχείς που συνδέο
Στα εντερικά κύτταρα, αυτό οδηγεί σε συνεχή εκροή CΓ και νερού προς τον
νται με G-ΠΡωτε'ϊνες, τις ε
αυλό του εντέρου με συνέπεια να ΠΡOKαi\Oύνται έντονες διάρροιες και βαριά
νεργοποιούν ελαττώνοντας
αφυδάτωση, η οποία συχνά είναι θανατηφόρος αν δεν ληφθούν επείγοντα
την ισχύ πρόσδεσης
μέτρα για την αναπλήρωση των απωλειών σε νερό και ιόντα.
GDP. Αυτό οδηγεί σε ταχεία
Μια παρόμοια κατάσταση συμβαίνει στον κοκκύτη, μια κοινή αναπνευστι
του
•,
διάσταση του προσδεμένου
κή λοίμωξη. Σήμερα, τα βρέφη υποβάλ/ονται υποχρεωπκά σε εμβολιασμό
GDP, το
εναντίον του κοκκύτη. Στην περίmωση του κοκκύτη, το παθογόνο βακτήριο
που υπάρχει στο κυπαροδιάλυμα σε α
εγκαθίσταται στον πνεύμονα, όπου παράγει μια πρωτεΤνη γνωστή ως KOKKV-
φθονία. Ποιες θα ήταν οι επιmώσεις μιας
πκΩ τοξίvη. Αυτή η πρωτε'ϊνη τροποποιείτην α-υπομονάδαμιας διαφορετι
μετάλλαξης στην α υπομονάδα μιας
κής G πρωτε'ϊνης [ονομάΖεται
Gj ,
επειδή avaστέλ/ει
(inhibits) την αδενυλlκή
οποίο αντικαθίσταται από
GTP,
G-
πρωτεΤνης, η οποία θα οδηγούσε σε ε
Kυκi\άση]. Η τοξίνη αδρανοποιεί την G-πρωτεΤνη, «κi\ειδώνoντάς» την σε α
λάττωση της συγγένειάς της για το
νενεργό κατάσταση, κατά την οποία είναι συνδεδεμένη με
χωρίς να μεταβάλ/ει σημαντικά τη συγ
κρυνση της
Gj ,
όπως η ενεργοποίηση της
Gs ,
GDP.
Η απομά
οδηγεί στη δημιουργία ενός
γένειά της για το
GTP; Συγκρίνατε
GDP
τις συ
παρατεταμένου, ακατάλ/ηλου σήματος. Παραδόξως, παρότι οι βιοχημικές
νέπειες αυτής της μετάλ/αξης με τις επι
δράσεις των δύο τοξινών είναι λεmομερώς γνωστές, δεν είναι σαφές πώς ε-
δράσεις της χολερικής τοξίνης.
Υποδοχείς που Συνδέονται με G-Πρωτεινες
679
Εικόνα
16·18.
προσδεμένο
πρωτεΤνη-στόχος
Η α υπομονάδα μιας G-πρω
τε'ί"νης απενεργοποιείται
GTP.
Ι
υδρολύοντας το
ΕΞΩΚΥΤΤΑΡΙΟΣ ΧΩΡΟΣ
Όταν μια ενεργοποιημένη
α υπομονάδα συναντήσει την πρωτε"ίνη-στόχο της και συνδεθεί μαζί της, την ενεργοποιεί (ή, ΚΥΤΤΑΡΟ
ορισμένες φορές, την απενεργοποιεΟ, Η ενερ
ΔΙΜΥΜΑ
γοποίηση διαρκεί όσο διαρκεί και η σύνδεση των δύο πρωτε'ίνών, Μετά από λίγα δευτερό
ενεργοποιημένο
λεmα, το
σύμπλοκο βγ
GTP που
βρίσκεται πάνω στην α υ
πομονάδα υδρολύεται σε
GDP από την εγγενή
ενεργότητα GΤΡάσης της α υπομονάδας, Η υ δρόλυση του
GTP απενεργοποιεί
ενεργοποιημένη
α υπομονάδα
την α υπομο
νάδα, η οποία διίσταται από την πρωτεΊνη-στό
χο και επανασυνδέεται μ' ένα σύμπλοκο βγ, σχηματίζοντας μια ανενεργό G-πρωτεΊνη, Η
ΕΝΕΡΓΟΠΟΙΗΣΗ ΜΙΑΣ ΠΡΩΤΕϊΝΗΣ-ΣΤΟΧ9ν
Ι
ΑΠΟ ΤΗΝ α ΥΠΟΜΟΝΑΔΑ ΜΙΑΣ
G ΠΡΩΤΕΙΝΗΣ
G-
πρωτε"ίνη είναι τώρα έτοιμη να συνδεθεί μ' ένα νέο μόριο υποδοχέα (βλ. Εικόνα
16-178), Τόσο
η ενεργοποιημένη α υπομονάδα όσο και το ε λεύθερο σύμπλοκο βγ μπορούν να ρυθμίζουν πρωτεΊνες-στόχους,
ΘΡ
Η ΥΔΡΟΛΥΣΗ τον GTP ΑΠΟ ΤΗΝ α ΥΠΟΜΟΝΑΔΑ
--1
ΠΡΟΚΜΕΙ ΤΗΝ ΑΠΕΝΕΡΓΟΠΟΙΗΣΗ ΤΗΣ ΚΑΙ ΤΗΝ
ΑΝΑΓΚΑΖΕΙ Ν' ΑΠΟΜΑΚΡΥΝΘΕΙ ΑΠΟ ΤΗΝ ΠΡΩΤΕϊΝΗ-ΣΤΟΧΟ
Ι
Η ΑΝΕΝΕΡΓΟΣ α ΥΠΟΜΟΝΑΔΑ ΕΠΑΝΑΣΥΝΔΕΕΤΑΙ
ΜΕ ΤΟ ΣΥΜΠΛΟΚΟ βγ ΚΑΙ ΞΑΝΑΣΧΗΜΑΤιΖΕI ΜΙΑ ΑΝΕΝΕΡΓΟ G ΠΡΩΤΕΙΝΗ
ανενεργός G πρωτε'ί\ιη
ανενεργός πρωτεί\ιη-στόχος
πωφελούνταl τα βακτήρια από αυτές τις δράσεις. Όπως και αν έχουν τα πράγματα, οι δύο τοξίνες μάς δείχνουν ότι όπως ένα αυτοκίνητο που επιτα
Χύνει ανεξέλεγκτα έτσι και οι ενδοκυπάριες σηματοδοτικές οδοί μπορεί να γίνουν επικίνδυνα υπερδραστήριες, είτε επειδή πατήθηκε το «μοριακό γκά ΖΙ» είτε επειδή κόπηκαν τα «μοριακά φρένα».
Μερικές G-πρωτε'i'νες ρυθμίΖουν διαύλους ιόντων Οι πρωτε'ί'νες-στόΧοι για τις υπομονάδες των G-πρωτεϊνών είναι δίαυλοι ιόντων ή μεμβρανlκά ένΖυμα. Οι διάφοροι στόΧοι επηρεάΖΟνται από διαφο-
680
Κεφάλαιο 16: Κυτταρική Επικοινωνία
ρετικά είδη G-πρωτεϊνών (σΙα κύπαρα των θηλασΙlκών έχουν ήδη ανακαλυ
φθεί περίπου 20) και σΙη συνέχεια οι διάφορες G-πρωτε'ίνες ενεργοποιούνται από διαφορετικούς υποδοχείς της κυπαρικής επιφάνειας. Έτσι, η πρόσδεση
ενός εξωκυπάριου σηματοδοτικού μορίου σ' έναν υποδοΧέα που συνδέεται με μια G-πρωτε'ίνη επιδρά μόνο σε ένα υποσύνολο πρωτεϊνικών σΙόχων, που
είναι κατάλ/ηλοl γι' αυτό το σήμα και γι' αυτό το είδος του κυπάρου. Πρώτα θα εξετάσουμε ένα παράδειγμα ρύθμισης διαύλων ιόντων μέσω G-πρωτεϊνών. Η καρδιακή συχνότητα ελέγχεται από δύο ομάδες νευρικών ι νών: η μια από αυτές επιταΧύνει την καρδιακή συχνότητα ενώ η άλ/η την ε
πιβραδύνει. Οι νευρικές ίνες που σηματοδοτούν την επιβράδυνση εκλύουν ακετυλοχολίνη, η οποία προσδένεται σΙα μυοκαρδιακά κύπαρα σ' έναν υπο δοΧέα που διασυνδέεται με μια G-πρωτεΙνη. Μόλις η ακετυλοχολίνη προσ δεθεί σΙον υποδοχέα, η G-πρωτεΙνη
(G i ) ενεργοποιείται, δηλαδή διίσΙαταl σε
μια α υπομονάδα και ένα σύμπλοκο βγ (Εικόνα 16-19Α). Στο συγκεκριμένο παράδειγμα, το ενεργό σηματοδοτικό συσΙατικό είναι το σύμπλοκο βγ. Το σύμπλοκο αυτό προσδένεται σΙην ενδοκυπάρια πλευρά ενός διαύλου Κ
+
της κυπαρικής μεμβράνης των μυοκαρδιακών κυπάρων και εξαναγκάΖει τον
δίαυλο να προσλάβει την ανοικτή διαμόρφωση (Εικόνα 16-19Β), οπότε κ+ εξέρχονται από το κύπαρο. Αυτό έχει ως συνέπεια να μεταβληθούν οι ηλε
κτρικές ιδιότητες του μυοκαρδιακού κυπάρου, το οποίο πλέον συσΙέλ/εται
λιγότερο συχνά. Η δράση του συμπλόκου βγ τερματίΖεται και ο δίαυλος κ+ ξανακλείνει μόλις αδρανοποιηθεί η α υπομονάδα (με υδρόλυση του συνδε δεμένου
GTP) και ξανασυνδεθεί
με το σύμπλοκο βγ για να σχηματίσει μια α
νενεργό G-πρωτεΙνη (Εικόνα 16-19Γ).
ακετυλοχολίνη
κλειστός δίαυλος κ+
(Α)
,:
,.~ ~'O
ενεργοποιημένη α υπομονάδα
ενεργοποιημένο σύμπλοκο βγ κυτταρική μεμβράνη ΕΞΩΚΥΠΑΡΙΟΣ χΩΡΟΣ
ΑΝΟΙΓΜΑ ΤΟΥ ΔΙΑΥΛΟΥ
!
ανοικτός δίαυλος κ+ Εικόνα
16-19. Μια G-πρωτεΊνη
διασυνδέει την
ενεργοποίηση ενός υποδοχέα με τη διάνοιξη
ενός διαύλου Κ+ στην κυπαρική μεμβράνη ε νός μυοκαρδιακού κυπάρου. (Α) Η πρόσδεση
ΚΥΠΑΡΟΔΙΜΥΜΑ
της ακετυλοχολίνης στον υποδοχέα της πάνω στα μυοκαρδιακά κύπαρα, ο οποίος ανήκει στην κατηγορία των υποδοχέων που συνδέο
Θ .-J ΑΠΕΝΕΡΓΟΠΟΙΗΣΗ
-!
κλειστόςδίαυλοςκ+
νται με G-πρωτε{νες, οδηγεί σε διάσταση της
G-πρωτείiιης σε ένα ενεργοποιημένο σύμπλοκο βγ και μια ενεργοποιημένη α υπομονάδα.
(8) Το
ενεργοποιημένο σύμπλοκο βγ συνδέεται σ' ένα δίαυλο Κ+ της κυπαρικής μεμβράνης και προ καλεί το άνοιγμά του. (Γ) Η απενεργοποίηση
ανενεργός πρωτείνη G
της α υπομονάδας με υδρόλυση του GTP την ε ξαναγκάζει να ξανασυνδεθεί με το σύμπλοκο βγ για να Ο)(Τ]ματίσει μια ανενεργό G-πρωτεϊνη. Τότε ο δίαυλος Κ+ κλείνει.
Υποδοχείς που Συνδέονται με G-Πρωτεινες
681
ΟΡΙσμένες G-πρωιε"ίνες ενεργοποιούν μεμ6ρανικά ένΖυμα Οι αλληλεπιδράσεις των G-πρωιεϊνών με διαύλους ιόντων προκαλούν μια άμεση μειοβολή στην κατάσταση και τη συμπεριφορά του κυπάρου. Οι
αλληλεπιδράσεις τους με ενΖυμlκούς στόχους έχουν πιο περίπλοκες συνέ πειες, καθώς οδηγούν στο σχηματισμό επιπρόσθετων ενδοκυπάριων σημα τοδοτικών μορίων. Τα πιο συνήθη ένΖυμα-στόχοι για τις G-πρωτε'ivες είναι η αδεvviΊικn κυκΛάσπ, η οποία είναι υπεύθυνη για την παραγωγή ενός μικρού
σηματοδοτικού μορίου, του κυκΛικού ΑΜΡ, και η φωσφoiΊIπάσπ
C,
η οποία
είναι υπεύθυνη για την παραγωγή δύο άλλων μικρών σηματοδοτικών μο
ρίων, της rριφωσφορικnς ιvοσιτόiΊnς και της δIαKυiΊoγiΊυKερόiΊπς. Τα δύο αυτά ένΖυμα ενεργοποιούνται από διαφορετικά είδη G-πρωτεϊνών και σχη ματίΖουν ΙΟ μικρά ενδοκυπάρια σηματοδοτικά μόρια υπό την επίδραση δια φόρων εξωκυπάριων σημάτων. Αυτή η σύΖευξη μπορεί να είναι είτε διεγερ τική (να διαμεσολαβείται από μια διεγερτική G-πρωτε'fνη) είτε ανασταλτική
(να διαμεσολαβείιοι από μια ανασταλτική G-πρωτε'iVη). Για λόγους απλού στευσης, θα περιορίσουμε τη συΖήτησή μας στις περιmώσεις εκείνες στις ο ποίες η ενεργοποιημένη G-πρωτε'ivη διεγείρει την ενΖυμlκή δράση. Τα μι
κρά ενδοκυπάρια σηματοδοτικά μόρια αυτών των οδών συχνά αποκαλού νται δεύτεροι αγγελιοφόροι
(second messengers)
(ενώ «πρώτοι αγγελιοφό
ροι» θεωρούνται ΙΟ εξωκυπάρια σήμαιο). Παράγονται σε μεγάλες ποσότητες όιον ενεργοποιείιοι το μεμβρανlκό ένΖυμο φωσφολιπάση
C-
-
Π.Χ. η αδενυλlκή κυκλάση ή η
και κατόπιν απομακρύνονται με διάχυση από τη θέση πα
ραγωγής τους και αναμειοδίδουν το σήμα σε όλο το κύπαρο (Εικόνα
16-20).
Διαφορετικοί δεύτεροι αγγελιοφόροι παράγουν διαφορετικές κυπαρl κές απαντήσεις. Πρώτα θα εξετάσουμε τις συνέπειες που έχει μια αύξηση της συγκέντρωσης του κυκλικού ΑΜΡ. Έτσι, θα συναντήσουμε μια από τις
σηματοδοτικές οδούς που ξεκινούν από υποδοχείς διασυνδεόμενους με G-πρωτε'fνες. Στη συνέχεια θ' ασχοληθούμε με τις δράσεις της διακυλο γλυκερόλης και της τριφωσφορικής lνοσιτόλης και θα γνωρίσουμε μια δια φορετική οδό.
ενεργοποιημένο σύμπλοκο βγ
ενεργοποιημένο ένζυμο ΕΞΩΚΥΠΑΡΙΟΣ ΧΩΡΟΣ
Εικόνα
16-20. Ένζυμα
ενεργοποιούμενα α
πό G-πρωτείΎες καταλύουν τη σύνθεση εν δοκυπάριων αγγελιοφόρων μορίων. Κάθε ε
ενεργοποιημένη αυπομονάδα G πρωτεινης
νεργοποιημένο ένζυμο δημιουργεί αγγελιοφό
ρα μόρια και το σήμα στο βήμα αυτό της οδού ενισχύεται πολύ. Το σήμα μεταφέρεται από τα αγγελιοφόρα μόρια, προσδένεται σε πρω
τεΊνες-στόχους μέσα στο κύπαρο και επηρεά ζει την ενεργότητά τους.
682
Κεφάλαιο 16: Κυτταρική Επικοινωνία
πολλά ενδοκυττάρια αγγελιοφόρα μόρια διαχέονται και δρουν σε πρωτεΤνες-στόχους σε διάφορα μέρη του κυττάρου
Η οδός του κυκλικού ΑΜΡ ενεργοπOlεί ένΖυμα και γονίδια Πολ/ά εξωκυπάρια σήματα τα οποία δρουν μέσω υποδοΧέων που δια
συνδέονται με G-πρωτεΤνες επηρεάΖουν την ενεργότητα της αδΕVΥλικής KUκλάσης (adenylate
cyclase)
και επομένως μεταβάλ/ουν την ενδοκυπάρια
συγκέντρωση του κυκλικούΑΜΡ
(cyclicAMP). Συνήθως,
η ενεργοποιημένη
ο ο ο 11
11
.: --.--
\//
-;-.
«
---=----"--- ----===-----==--------"=~-.-,
ΡΗΞΗ ΚΥΠΑΡΩΝ
ενδιάμεσα ινίδια ενισχύουν τα ζωικά κύπαρα. Όταν ένα στρώμα επιθηλιακών κυπάρων τεντώνεται από εξωτερικές δυ
νάμεις (που οφείλονται για παράδειγμα στην κυπαρική ανάmυξη ή στις κινήσεις των γειτονικών ιστών), τότε το δίκτυο των ενδιάμεσων ινι
δίων και των συνδέσμων των δεσμοσωματίων που εκτείνονται σε όλο το στρώμα, αναmύσσουν πίεση που περιορίζει το τέντωμα. Εάν υπήρ χαν μόνο οι σύνδεσμοι των δεσμοσωμάτων, τότε οι ίδιες δυνάμεις θα προκαλούσαν σημαντική παραμόρφωση των KUΠάρων μέχρι του βαθ μού να προκαλέσουν ακόμα και τη ρήξη της KUΠαΡΙKής μεμβράνης.
Ενδιάμεσα lνίδια
715
Εικόνα
17-6. Οι
κύριες κατηγορίες ενδιάμε
ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ
σων ινιδίων.
•
ΠΥΡΗΝΙΚΑ
Ι
κερατίνες
βιμεντίνη
νευρο'ίνίδια
σε επιθήλια
σε συνδετικό ιστό, μυΙκά κύπαρα και κύπαρα νευΡΟΥλοίας
σε νευρικά κύπαρα
πυρηνικές λαμίνες σε όλα τα εμπύρηνα κύπαρα
Τα ενδιάμεσα ινίδια του κυτταροπλάσματος μπορεί να ομαδοποιηθούν σε τρεις κατηγορίες: κύτταρα, μεvrfvnς
(1)
ιvfδιο κερατfvnς
(keratin filaments) σε επιθηλιακά (vimentin filaments) και ιvfδια συναφή τnς 6ι
(2) ιvfδια 6ιμεvrfvnς (vimentin-related) σε κύτταρα του συνδετικού
ιοιού, σε μυϊκά κύττα
ρα και οιηρικτικά κύτταρα του νευρικού συοιήματος (κύτταρα της νευρογλοί
ας) και
(3) vευροϊvfδια (neurofilaments) σε νευρικά κύτταρα. Τα ινίδια κάθε
κατηγορίας σχηματίΖΟνται με πολυμερισμό των αντίοιοιχων πρωτεϊνικών υ
πομονάδων (Εικόνα
17-6).
Η πιο ετερογενής οικογένεια είναι η οικογένεια των κερατινών. Για πα ράδειγμα, σε διαφορετικά επιθήλια υπάρχουν διαφορετικές ομάδες κερα
τινών: μια ομάδα οια κύτταρα που επενδύουν το έντερο και μια διαφορετι κή ομάδα οια επιδερμικά στρώματα του δέρματος. Ειδικές κερατίνες βρί σκονται οια μαλ/ιά οια φτερά και οια νύχια. Σε κάθε περίπτωση, τα lνίδια της κερατίνης σχηματίΖΟνται από ένα μείγμα διαφόρων υπομονάδων κε ρατίνης. Συνήθως, τα lνίδια της κερατίνης διαπερνούν το εσωτερικό των ε
πιθηλιακών κυττάρων από τη μια άκρη οιην άλ/η και τα lνίδια γειτονικών
επιθηλιακών κυττάρων διασυνδέOVΤ01 έμμεσα μέσω κυτταρικών συνδέ σμων που ονομάΖΟντΟ1 δεσμoσωμάrια και αναφέρονται οιο Κεφάλαιο
19.
(desmosomes)
(βλ. Εικόνα
17-3)
Τα άκρα των ινιδίων της κερατίνης α
γκυροβολούν οια δεσμοσωμάτια και τα ινίδια συνδέονται πλευρικά με άλ λα συστατικά του κυττάρου μέσω των σφαιρικών κεφαλών και των περιο Χών της ουράς που προεξέχουν από την επιφάνεια του συναρμολογημέ νου lνιδίου. Αυτή η δικτύωση, που έχει μεγάλη εκτατική δύναμη και σχη-,
ματίΖεταl από τα lνίδια σε όλο το επιθηλιακό οιρώμα, κατανέμει την πίεση που εφαρμόΖεται στο δέρμα όταν τεντώνετΟ1. Η σημασία αuτής της λει τουργίας αναδεlκνύετΟ1 από τη σπάνια κληρονομική ασθένεια του ανθρώ που που ονομάΖεται φυσαiΊιδώδnς επιδερμόiΊυσn
simplex), οιην οποία οι μεταλ/άξεις
(epidermolysis bullosa
γονιδίων της κερατίνης επηρεάΖουν το
σχηματισμό των ινιδίων της κερατίνης οιην επιδερμίδα. Έτσι, το δέρμα εί νΟ1 πολύ ευαίσθητο σε μηχανική κάκωση και ακόμα και μια ήπια πίεση
μπορεί να σπάσει τα κύτταρα προκαλώντας φουσκάλες οιο δέρμα. Πολ/ά από τα ενδιάμεσα ινίδια οιαθεροποιούνται περαιτέρω και ισχυρο
ποιούνται από επικουρικές πρωτείνες που διασυνδέουν τις δέσμες των ινιδίων σε ισχυρά αθροίσματα. Μια ιδιαίτερα ενδιαφέρουσα πρωτείνη αυτής της κατη-
716
Κεφάλαιο 17: Κυτταροσκελετός
0.5
μm
Εικόνα 17·7. Η πλεκτίνη συμβάλλει στο σχηματισμό δεσμίδων από ενδιάμεσα ινίδια και συνδέει αυτά τα ινίδια με άλλα δίκτυα πρωτεϊ νών του κυπαροσκελετού. Η πλεκτίνη (με πράσινο χρώμα) συνδέει τα ενδιάμεσα ινίδια (μπλε) με άλλα ενδιάμεσα ινίδια, μικροσωληνίσκους (κόκκινο) και ινίδια ακτίνης (δεν εικονίζονται), Στη συγκεκριμένη ηλεκτρονιομικρογραφία, τα κίτρινα στίγματα είναι σωματίδια χρυσού προσ δεδεμένα σε αντισώματα που αναγνωρίζουν την πλεκτίνη. Το δίκτυο των ινιδίων της ακτίνης έχει αφαιρεθεί ώστε ν' αποκαλυφθούν αυτές οι πρωτε'ίνικές συνδέσεις, (Από: Τ.Μ, Svitkina και G,G, Borisy, J. Ce/l ΒίοΙ. 135:991-1007, 1996, © The Rockefeller University Press),
γορίας είναι η πiΊεκrlνπ
(plectin).
Η πλεκτίνη συγκρατεί δέσμες ενδιάμεσων ι
νιδίων (ιδίως της βιμεντίνης) και επιπλέον συνδέει τα ενδιάμεσα ινίδια με μι κροσωληνίσκους, ινίδια ακτίνης και δομές συγκόλ/ησης των δεσμοσωματίων
(Εικόνα
17-7). Στον άνθρωπο,
οι μεταλ/άξεις του γονιδίου της πλεκτίνης προ
Ερώmσn
17-1
καλούν ένα βαρύ νόσημα που συνδυάΖει χαρακτηριστικά απλής φυσαλιδώ
Ποιο από τα επόμενα είδη
δους επιδερμόλυσης (οφεωεται σε διαταραχή της κερατίνης του δέρματος),
κυπάρων αναμένετε ότι πε
μυϊκής δυστροφίας (οφεωεται σε διαταραχή των ενδιάμεσων ινιδίων στους
ριέχει μεγάλη πυκνότητα
μυς) και νευΡOεKφύλισnς (οφεωεται σε διαταραχές των νευροϊνιδίων). Στον
ενδιάμεσων ινιδίων στο κυτ
ποντικό, η έλ/ειψη λειτουργικού γονιδίου πλεκτίνης προκαλεί το θάνατο μέσα
ταρόπλασμά του; Να εξηγή
σε λίγες ημέρες από τη γέwησn. Τα πάσχοντα Ζώα εμφανίζουν φυσαλίδες στο
σετε την απάντησή σας.
δέρμα και ανωμαλίες των σκελετικών μυών και του μυοκαρδίου. Συνεπώς,
Α.
Β. Ένα επιθηλιακό κύπαρο του δέρμα
προσφέρει στα κύπαρα την ισχύ που χρειάΖΟνται για ν' αντέξουν τις μηχανικές
πιέσεις που είναι συνυφασμένες με τη Ζωή των σπονδυλωτών.
αμοιβάδα που
διαβιώνει ελεύθερη)
φαίνεται ότι η πλεκτίνη ίσως δεν είναι αναγκαία για τον αρχικό σχηματισμό των ενδιάμεσων ινιδίων. Ωστόσο, Χάρη στη διασύνδεση των ινιδίων που επιτελεί,
Amoeba proteus (μια
•
τος
Γ. Ένα λείο μυϊκό κύπαρο της πεπτικής
οδού
Το πυρηνικό περίβλημα σΙηρίΖειοι από ένα πλέγμα
Δ.
ενδιάμεσων ινιδίων
Ε. Ένα νευρικό κύπαρο του νωτιαίου
Ενώ τα ενδιάμεσα ινίδια του κυπαροπλάσματος είναι ραβδόμορφα, τα ενδιάμεσα ινίδια που καλύπτουν και στηρίΖουν την έσω επιφάνεια της εσω τερικής πυρηνικής μεμβράνης είναι οργανωμένα σ' ένα διδιάστατο δίκτυο
Escherichia coli μυελού
Ζ. Ένα σπερμαΤΟΖωάριο Η. Ένα φυτικό κύπαρο
(Εικόνα
17-8). Τα ενδιάμεσα ινίδια αυτού του σκληρού πυρηνικού υμένα (nuclear lamina) κατασκευάΖΟνται από μια κατηγορία πρωτεϊνών των ινιδίων
που ονομάΖΟνται iΊαμlνες (δεν πρέπει να συγχέονται με τη iΊαμlνlνπ, η οποία είναι μια πρωτε'ϊνη του εξωκυπάριου στρώματος). Αντίθετα από τα κυπαρο πλασματικά ενδιάμεσα ινίδια πολ/ών κυπάρων που είναι πολύ σταθερά, τα ενδιάμεσα ινίδια του πυρηνικού υμένα αποσυναρμολογούνται και ανασχη ματίΖΟνται σε κάθε κυπαρική διαίρεση, όταν το πυρηνικό περίβλημα σπάΖει σε κομμάτια κατά τη διάρκεια της μίτωσης και επανασχηματίΖεται σε κάθε θυ γατρικό κύπαρο (βλ. Κεφάλαιο
19). Ενδιάμεσα lνίδια
717
ΚΥΠΑΡΟΔΙΜΥΜΑ
πυρηνικό περίβλημα
χΡωματίνη
(Α)
Εικόνα
17-8. Τα
ενδιάμεσα ινίδια που βρίσκονται κάτω από την πυρηνική μεμβράνη. (Α) Σχηματική διατομή του πυρηνικού περιβλήμα
τος. Τα ενδιάμεσα ινίδια του πυρηνικού υμένα επενδύουν την εσωτερική όψη του πυρηνικού περιβλήματος και θεωρείται ότι παρέχουν τις θέσεις πρόσδεσης της χΡωματίνης.
(6)
Ηλεκτρονιομικρογραφία ενός τμήματος του πυρηνικού υμένα από ένα ωοκύπαρο βατράχου. Ο υ
μένας σχηματίζεται από ένα τετραγωνισμένο πλέγμα ενδιάμεσων ινιδίων που αποτελούνται από λαμίνες. (Ο πυρηνικός υμένας άλλων κυτ ταρικών ειδών δεν είναι πάντοτε τόσο συμμετρικά οργανωμένος όσο φαίνεται σε αυτήν την εικόνα). (6, ευγενική προσφορά του Ueli Aebi).
(Α)
ΚΥΠΑΡΟ ΣΕ ΜΕΣΟΦΑΣΗ
Η αποσυναρμολόγηση και ο επαναΣXημαίlσμός του πυρηνικού υμένα ε
λέγχεται με φωσφορυλίωση και αποφωσφορυλίωση των λαμινών από πρω τεϊνικές κινάσες (αναφέρεται στο Κεφάλαιο
4).
Όταν οι λαμίνες φωσφορυ
λιώνονται, αλ/άΖουν διαμόρφωση με αποτέλεσμα να εξασθενίζει η σύνδεση κεντροσωμάτιο
μεταξύ των τετραμερών και ν' αποδιατάσσεται το ινίδιο. Η αποφωσφορυλίω ση στο τέλος της μίτωσης προκαλεί την επανασυναρμολόγηση των λαμινών
(8)
ΔΙΑΙΡΟΥΜΕΝΟ ΚΥΠΑΡΟ
(βλ. Εικόνα
19-18).
Μικροσωλnνίσκοι Οι μΙKΡOσωλnνίσκoι έχουν κρίσιμο οργανωτικό ρόλο σε όλα τα ευκα ρυωίlKά κύπαρα. Είναι μακρείς και σχετικά άκαμπτοι πρωτεϊνικοί κοίΛοι σω πόλοι της μιτωτικής
ατράκτου
(η
λήνες οι οποίοι μπορούν ν' αποσυναρμολογούνται γρήγορα σε μια θέση και να συναρμολογούνται σε μιαν άλλη. Σ' ένα τυπικό Ζωικό κύπαρο, οι μικρο
ΚΡΟΣΣΩΤΟ ΚΥΠΑΡΟ
σωληνίσκοι αναπτύσσονται από μια μικρή δομή που βρίσκεται κοντά στο κέ ντρο του κυπάρου και ονομάΖεται κεντροσωμάπο. Εκτείνονται προς την πε
ριφέρεια του κυπάρου και δημιουργούν ένα σύστημα τροχιών μέσα στο κύτ ταρο, κατά μήκος των οποίων μπορούν να μετακινηθούν κυστίδια, οργανί δια και άλ/α συστατικά του κυπάρου (Εικόνα 17-9Α). Οι μικροσωληνίσκοι καθώς και άλ/α συστήματα κυπαροπλασματικών μικροσωληνίσκων αποτε βασικό
λούν το τμήμα του κυπαροσκελετού που είναι κυρίως υπεύθυνο για τον κα
σωμάτιο
Εικόνα
17-9.
-
Οι τρεις εντοπίσεις των μικρο
σωληνίσκων στα ευκαρυωτικά κύπαρα. Αντί
θορισμό της θέσης των μεμβρανικών οργανιδίων μέσα στο κύπαρο και για την καθοδήγηση της ενδοκυπάριας μεταφοράς. Όταν ένα κύπαρο εισέρχεται στη φάση της μίτωσης οι μικροσωληνίσκοι
του κυπαροπλάσματος αποσυναρμολογούνται και μετά ανασυγκροτούνται σε μια περίπλοκη δομή που ονομάΖεται μπωπκή άτρακτος
θετα από τα ενδιάμεσα ινίδια, οι μικροσωληνί
Όπως αναφέρεται στο Κεφάλαιο
σκοι (σκούρο πράσινο) συνήθως προεκβάλ
σμό που θα διαχωρίσει εξίσου τα χρωμοσώματα στα δύο θυγατρικά κύπαρα
λουν από ένα κέντρο οργάνωσης όπως (Α) ένα κεντροσωμάτιο,
(6)
έναν πόλο ατράκτου ή (η
το βασικό σωμάτιο μιας βλεφαρίδας.
718
Κεφάλαιο 17: Κυτταροσκελετός
19, η μιτωίlKή
(mitotic spindle).
άτρακτος παρέχει το μηχανι
ακριβώς πριν από την κυπαρική διαίρεση (Εικόνα 17-9Β). Οι μικροσωληνί σκοι μπορούν επίσης να σχηματίσουν μόνιμες δομές, όπως για παράδειγμα,
ης τριχοειδείς δομές που χτυπούν ρυθμικά και ονομάΖΟνται και μασrfγιο
(flagella)
(Εικόνα
17 -9Γ).
Kpoaaof{cilia)
Οι δομές αυτές προεκβάλ/ουν από
την επιφάνεια πολ/ών ευκαρυωηκών κυπάρων, 10 οποία ης χρησιμοποιούν ως μέσο προώθησης ή για να σαρώνουν υγρό πάνω από ων κυπαρική επι φάνεια. Ο «πυρήνας» ενός ευκαρυωηκούκροσσού ή μαστιγίου είναι μια πο λύ οργανωμένη και σταθερή δεσμίδα από μικροσωληνίσκους.(Τα μαστίγια
των βακωρίων έχουν τελείως διαφορεηκή δομή και λεΙ1Ουργούν ως μέσα προώθησηςμε διαφορεηκόμηχανισμό).
Σ1Ο ψήμα αυτό πρώ1Ο θα εξετάσουμεω δομή και ω συναρμολόγηση
των μικροσωληνίσκωνκαι στη συνέχεια θ' αναφερθούμεστο ρόλο 1Ους στην οργάνωση1Ου κυπαροπλάσμα1Ος.Η οργανωηκή λεlΙουργία1Ους εξαρτά1ΟΙ από ω διασύνδεσηΤων μικροσωληνίσκωνμε επικουρικέςπρωτε'ϊνες, ειδικό τερα ης κιvηrnριεςπρωrεΤvεςπου προωθούν 10 οργανίδια κατά μήκος των τροχιών 1Ου κυπαροσκελε1Ού.Τέλος, θ' αναφερθούμεστη δομή και ω λει 1Ουργία των κροσσών και των μαστιγίων, στα οποία οι μικροσωληνίσκοιεί ναι μόνιμα συνδεδεμένοιμε κινπιήριες ΠΡωΙε'ϊνες που ισχυροποιούν10 χιύ πημά 1Ους.
Οι μικροσωλnνίσκοιείναι κοίλοι σωλήνες με
διακριτά δομικά άκρα Οι μικροσωληνίσκοι σχημωίΖονται από υπομονάδες τουμπουλίνnς
(tubulin).
Κάθε υπομονάδα είναι ένα διμερές που αποτελεί1ΟΙ από δύο πα
ρόμοιες σφαιρικές πρωτε'ϊνες που ονομάΖΟνται 0-1ΟvμποviΊfvη και
B-1OV-
μπουiΊfvη και συνδέον1ΟΙ ισχυρά με1Οξύ ιους με μη ομοιοπολικούς δε σμούς. Οι υπομονάδες ως 1Ουμπουλίνης επίσης επιστοιβάΖονται με1Οξύ 1Ους με μη ομοιοπολικούς δεσμούς και σχηματίΖουν 10 1Οίχωμα 1Ου κυλιν δρικού κοίλου μικροσωληνίσκου.Τελικά η κα1Οσκευή έχει ω μορφή ενός
κυλίνδρου που αποτελεί1ΟΙ από
ts),
13 παράλληλα
πρωτοϊvfδιο
(protofilamen-
δηλαδή γραμμικές αλυσίδες υπομονάδων 1Ουμπουλίνης σε όλο 10 μή
κος των οποίων εναλ/άσσονταιυπομονάδεςα- και β-1Ουμπουλίνης(Εικόνα
17-10).
Κάθε πρω1Οϊνίδιο έχει μια δομική πολικόω1Ο: η α-1Ουμπουλίνη ε
κτίθε1ΟΙ στο ένα άκρο και η β-1Ουμπουλίνη στο άλ/ο. Αυτή η πολικότητα, 10 κοιευθυντήριοβέλος που είναι ενσωμοιωμένοστη δομή, είναι ίδια σε όλα 10 πρω1Οϊνίδια και προσδίδει δομική πολικόω1Ο στον μικροσωληνίσκοως
σύνολο. Το ένα άκρο 1Ου μικροσωληνίσκου,που θεωρεί1ΟΙ 10 άκρο ως β 1Ουμπουλίνης, ονομάΖε1ΟΙ avv άκρο και 10 άλ/ο, ως α-1Ουμπουλίνης,ονο
μάΖε1ΟΙ niΊnv άκρο.
Ένας μικροσωληνίσκοςαυξάνει από έναν αρχικό δακτύλιο 13 μορίων 1Ουμπουλίνης: 10 διμερή ως 1Ουμπουλίνηςπροστίθεν1ΟΙξεχωριστά και οικο δομούν σταδιακά1Ον κοίλο σωλήνα. Ιη
vitro, σε πυκνό διάλυμα
καθαρής 1Ου
μπουλίνης, 10 διμερή ως 1Ουμπουλίνηςπροστίθενται και στα δύο άκρα ενός αυξανόμενουμικροσωληνίσκου,αν και στο συν άκρο προστίθεν1ΟΙπιο γρήγο ρα απ' ό,η στο πλην άκρο (γι' αυτό 10 λόγο αρχικά πήραν και την ονομασίασυν
και πλην άκρα). Η πολικόω1Ο1Ου μικροσωληνίσκου,10 γεγονός δηλαδή όη η δομή 1Ου έχει μια συγκεκριμένηκαΤεύθυνση, με δύο άκρα που έχουν διαφο-
Μικροσωληνίσκοι
719
Εικόνα
17-10.
Οι μlκροσωληνίσκοι είναι κοί
~β
λοι σωλήνες από τοuμποuλίνη. (Α) Σχεδιά γραμμα ενός μορίου τουμπουλίνης (ένα διμε ρές αβ) και ενός πρωτο"ίνιδίου και η τοποθέτη
α
σή του στο τοίχωμα του μικροσωληνίσκου. Πα
ετεροδιμερές τουμπουλίνης (= υπομονάδα μικροσωληνίσκου)
ρατηρείστε ότι όλα τα μόρια της τουμπουλί
νης είναι διευθετημένα στα πρωτο'ίνίδια με τον ίδιο προσανατολισμό έτσι ώστε ο μικροσωλη νίσκος να έχει μια καθορισμένη δομική πολικό
(Δ)
L--.J 10 nm
πρωτο'ίνίδιο
τητα. (Β και Γ). Σχηματικά διαγράμματα ενός μικροσωληνίσκου στα οποία φαίνεται ο τρό
ζ-'..~ _ Ξ ~_=_=-;: =~ r-
πος τοποθέτησης της τουμπουλίνης στο τοί χωμα του μικροσωληνίσκου. (Β) Τα
13
- r -r"1
Ι
συν
ι
άκρο
ι
μόρια
Ι Ι
σε διατομή. (Γ) Μια πλευρική άποψη ενός μι
Ι Ι
κρού τμήματος ενός μικροσωληνίσκου με τα
Ι Ι
μόρια της τουμπουλίνης διατεταγμένα σε σει
Ι
ρές ή πρωτο"ίνίδια. (Δ) Διατομή ενός μικροσω
ι
Ι
ι
ληνίσκου στην οποία διακρίνεται ο δακτύλιος των
13 ξεχωριστών
ι ι
υπομονάδων, η καθεμία α
1
ι ι
πό τις οποίες αντιστοιχεί σ' ένα ξεχωριστό δι μερές τουμπουλίνης. (Ε) Κατά μήκος άποψη
ι ι
ι ι
μικροσωληνίσκου στο ηλεκτρονικό μικροσκό
ι ι
πιο. (Δ. Ευγενική προσφορά του Rίchard Lίnck.
Ι
Ε. Ευγενική προσφορά του
Ι
50 nm
ι
ι Ι
Richard Wade).
Ι Ι Ι
ι ι ι
ι
(Α)
-L_
__ I_J .....
J
πλην
άκρο (η μικροσωληνίσκος
(Ε)
50 nm
ρετική χημική οντότητα και συμπεριφέρονται διαφορετικά, είναι κρίσιμη τόσο
για τη συναρμολόγηση των μικροσωληνίσκων όσο και για τη λειτουργία τους.
Εάν οι μικροσωληνίσκοι δεν είχαν πολικότητα, δεν θα μπορούσαν για παρά δειγμα να καθορίσουν την κατεύθυνση της ενδοκυπάριας μεταφοράς.
Το κεντροσωμάIlΟ είναι το κύριο κέντρο οργάνωσης των
μικροσωληνίσκων σΙα Ζωικά κύπαρα Στα κύπαρα, οι μικροσωληνίσκοι εκβλασταίνουν από εξειδικευμένα κέ
Epώmσn
•
17-2
Γιατί νομίζετε ότι είναι πολύ
ντρα οργάνωσης τα οποία ελέγχουν τον αριθμό, την εντόπιση και τον προ
σανατολισμό τους στο κυπαρόπλασμα. Για παράδειγμα, στα Ζωικά κύπαρα
ευκολότερο να προστεθεί
το KΕVΤΡOσωμάτιo, που συνήθως εντοπίΖεται στη μια πλευρά του πυρήνα ό
τουμπουλίνη σε προϋπάρ
ταν το κύπαρο δεν βρίσκεται στη μίτωση, οργανώνει τη συστοιΧία των μικρο
χοντες μικροσωληνίσκους
σωληνίσκων που απλώνονται ακτινωτά από αυτό το σημείο σε όλο το κυπα
από το να δημιουργηθεί έ
ρόπλασμα (βλ Εικόνα 17-9Α). Τα κεντροσωμάτια περιέχουν εκατοντάδες
νας νέος μικροσωληνίσκος
δομές σε σχήμα δακτυλίου που αποτελούνται από ένα άλ/ο είδος τουμπου
από την αρΧή; Εξηγείστε πώς η γ-του
λίνης, την γ-τουμπουλίνη. Κάθε δακτύλιος γ-τουμπουλίνης χρησιμεύει ως
μπουλίνη στο κεντροσωμάτιο βοηθά ώ
θέση εκκίνησης ή θέσΩ εμnvρnvωσnς
στε να ξεπεραστεί αυτό το εμπόδιο.
νός μικροσωληνίσκου (Εικόνα 17-11Α). Τα διμερή της αβ-τουμπουλίνης
(nucleation site)
για την ανάπτυξη ε
προστίθενται στο δακτύλιο της γ-τουμπουλίνης με ειδικό προσανατολισμό, με αποτέλεσμα το πλην άκρο κάθε μικροσωληνίσκου να ενσωματώνεται στο κεντροσωμάτιο και η ανάπτυξη να γίνεται μόνο στο συν άκρο, δηλαδή το ά κρο που προσανατολίΖεται προς τα έξω (Εικόνα
720
Κεφάλαιο 17: Κυτταροσκελετός
17-118).
Εικόνα θέσεις εμπυρήνωσης (δακτύλιοι γ-τουμπουλίνης)
0(\ ο
°rCJ>ci~
ς,
()
•
l
της τουμπουλί
ράσταση στην οποία φαίνεται ότι ένα κεντρο
σωμάτιο αποτελείται από ένα άμορφο στρώμα πρωτε'ίνης που περιέχει δακτυλίους της γ-το υ
μπουλίνης οι οποίοι αποτελούν τις θέσεις ε
>Ά: ~(:\~ : ~
17-11. Πολυμερισμός
νης σ' ένα κεντροσωμάTlΟ. (Α) Σχηματική πα
μπυρήνωσης για την αύξηση του μικροσωληνί
++~(\.:~++
00
Q
ο
ζεύγος KεVΤριδίων
+ (Β)
(Α)
+
μικροσωληνίσκοι αναmυσσόμενοι από τις θέσεις εμπυρήνωσης του KεVΤΡOσωματίOυ
σκου. Στα ζωικά κύπαρα, το κεντροσωμάτιο περιέχει ένα ζεύγος κεντριδίων, που το καθένα αποτελείται από μια κυλινδρική διάταξη μι κρών μικροσωληνίσκων. (Β) Ένα κεντροσωμά
τιο με προσκολλημένους μικροσωληνίσκους. Το πλην άκρο κάθε μικροσωληνίσκου μετά την ανάmυξή του από τον δακτύλιο εμπυρήνωσης ενσωματώνεται στο κεντροσωμάτιο, ενώ το συν άκρο κάθε μικροσωληνίσκουείναι ελεύθε ρο στο κυπαρόπλασμα.
Οι δακτύλιοι Της γ-1Ουμπουλίνης 1Ου κενφοσωματίου δεν πρέπει να συγ
Χέον1ΟΙ με 10 κενφίδιο (centrioles), περίεργες δομές που αποτελούν1ΟΙ από μια κυλινδρική συΟ1οιΧία ΚΟνΤών μικροσωληνίσκων ενσωμοιωμένων 010 κε νφοσωμάηοτων περισσότερωνΖωικών κυπάρων. Τα κενΤρίδια δεν παίΖουν
κανένα ρόλο κοιά Την εμπυρήνωσητων μικροσωληνίσκων010 κενΤροσωμά ηο (αρκούν μόνο οι δακτύλιοιΤης γ-1Ουμπουλίνης)και η λεnουργία1Ους πα ραμένει μυΟ1ήριο, κυρίως επειδή 10 φυηκά κύπαρα δεν περιέχουνκενΤρίδια. Όμως, όπως θα δούμε Ο1η συνέχεια, 10 κενφίδια είναι παρόμοια εάν όχι πα νομοιόωπαμε 10 Βασικά σωμάτιαπου σχημοιίΖουν10 κένφα οργάνωσηςΤων μικροσωληνίσκωνΟ1ους κροσσούς και Ο1α μαΟ1ίγια (βλ. Εικόνα 17-9Γ).
Οι θέσεις εμπυρήνωσης, όπως αυτές που παρέχουν οι δακτύλιοι Της γ 1Ουμπουλίνης 010 κενΤροσωμάηο, είναι απαραίΤητεςγια 1Ους μικροσωληνί σκους εφόσον είναι πολύ δυσκολότερονα ξεκινήσει ένας νέος μικροσωλη νίσκος από 10 μηδέν, συναρμολογών1Οςπρώ1Ο έναν δακτύλιο διμερών αβ 1Ουμπουλίνης, από 10 να προσθέτει 10 διμερή σε μια προϋπάρχουσαδομή μικροσωληνίσκου. In
vitro,
η ελεύθερη και καθαρή αβ-1Ουμπουλίνη, ό1Ον
βρίσκεται σε μεγάλη συγκένΤρωση, πολυμερίΖε1ΟΙ αυθόρμη1Ο. ΩΟ1όσο, 010 ΖωνΤανό κύπαρο, η συγκένΤρωσηΤης ελεύθερης αβ-1Ουμπουλίνηςείναι πο
λύ μικρή για να προωθήσει 10 πρώ1Ο και δύσκολο βήμα Της συναρμολόγη σης1Ου αρχικού δακτυλίου ενός καινούργιουμικροσωληνίσκου.Τα κύπαρα ελέγχουν 10 σχημαησμότων μικροσωληνίσκωνεπειδή διαθέ1Ουν κένΤρα οργάνωσηςπου περιέχουνθέσεις εμπυρήνωσηςκαι κρα1ΟύνΤη συγκένΤρω ση των ελεύθερωνυπομονάδωνΤης αβ-1Ουμπουλίνηςχαμηλή.
Η αvάπτυξη τωv μικροσωληvίσκωvπαρουσιάΖει δυvαμική αστάθεια Μόλις ένας μικροσωληνίσκοςεμπυρηνωθεί, 10 συν άκρο 1Ου συνήθως
αυξάνει από 10 κένΤΡΟ οργάνωσης προς 10 έξω, με προσθήκη υπομονάδων επί πολ/ά λεπτά. Μετά, απρόσμενα, ο μικροσωληνίσκοςυφίΟ1α1ΟΙ μια αλ/α γή που προκαλείΤη γρήγορη συρρίκνωσή1Ου με απώλεια υπομονάδωναπό
Μικροσωληνίσκοι
721
Εικόνα
17-12. Αύξηση
και συρρίκνωση σε μια
διάταξη μικροσωληνίσκων. Η διάταξη των μι κροσωληνίσκων που βρίσκεται σ' ένα κεντρο
σωμάτιο μεταβάλλεται συνεχώς, καθώς και μικροσωληνίσκοι αναπτύσσονται
νούργιοι
(κόκκινα βέλη) και παλιοί μικροσωληνίσκοι συρρικνώνονται (μπλε βέλη).
ω ελεύθερο άκρο ωυ. Μπορεί να συρρικνωθεί μερικώς και τότε, ω ίδιο ξαφ νικά, ν' αυξηθεί πάλι ή να εξαφανιστεί τελείως και ν' αντικατασταθεί από έ ναν νέο μικροσωληνίσκο που θα δημιουργηθεί από ων ίδιο δακτύλιο της γ ωυμπουλίνης (Εικόνα
17-12).
Αυτή η αξιοσημείωτη συμπεριφορά, που είναι γνωστή ως δυναμική αστά θεια, πηγάΖει από την ευγενή ικανότητα των μορίων της ωυμπουλίνης να υ δρολύουν
GTP.
Κάθε ελεύθερο διμερές ωυμπουλίνης περιέχει ένα ισχυρά
συνδεδεμένο μόριο
GTP που υδρολύεται
σε
GDP (ω οποίο όμως ακόμα πα
ραμένει ισχυρά συνδεδεμένο) αμέσως μετά την προσθήκη της υπομονάδας σ' έναν αυξανόμενο μικροσωληνίσκο. Τα μόρια της ωυμπουλίνης που είναι
συνδεδεμένα με
GTP συσκευάΖΟνται
αποτελεσματικά στο ωίχωμα ωυ μι
κροσωληνίσκου, ενώ τα μόρια της ωυμπουλίνης που περιέχουν
GDP έχουν
διαφορετική διαμόρφωση και διασυνδέονται λιγότερο ισχυρά μεταξύ ωυς. Όrαν ο πολυμερισμός γίνεται γρήγορα, τα μόρια της ωυμπουλίνης προ στίθενται στο άκρο ωυ μικροσωληνίσκου με μεγαλύτερη ταΧύτητα από την
ταΧύτητα υδρόλυσης ωυ προσδεδεμένου
GTP,
με αποτέλεσμα ω άκρο ωυ
μικροσωληνίσκου ν' αποτελείται αποκλειστικά από υπομονάδες ωυμπουλί νης με συνδεδεμένο
GTP.
Επειδή οι υπομονάδες τουμπουλίνης με
GTP
προσδένονται ισχυρά μεταξύ ωυς, σχηματίΖουν ένα κάλυμμα στο άκρο ωυ μικροσωληνίσκου, γνωστό ως κάΛυμμα
GTP(GTP cap), ω οποίο
εμποδίΖει
ων αποπολυμερισμό. Σε αυτή την κατάσταση και επειδή ο μικροσωληνίσκος
μπορεί ν' αποπολυμεριστεί μόνο με απώλεια υπομονάδων από το ελεύθερο άκρο ωυ, ο αναπτυσσόμενος μικροσωληνίσκος θα συνεΧίσει ν' aυξάνει. Ό μως, επειδή οι χημικές διεργασίες είναι απρόβλεπτες, συμπτωματικά η ωυ
μπουλίνη ωυ ελεύθερου άκρου ωυ μικροσωληνίσκου μπορεί να υδρολύσει το
GTP πριν
από την προσθήκη της επόμενης ωυμπουλίνης και, έτσι, τα ε
λεύθερα άκρα των πρωωϊνιδίων ν' αποτελούνται τώρα από υπομονάδες ωυ μπουλίνης με
GDP. Αυτό
ευνοεί την αποσυναρμολόγηση. Εφόσον τώρα ο υ
πόλοιπος μικροσωληνίσκος αποτελείται από τουμπουλίνη με GDP, ο αποπο λυμερισμός μόλις αρχίσει θα συνεχιστεί συχνά με καταστροφικό ρυθμό. Ο μικροσωληνίσκος αρχίΖει να συρρικνώνεται γρήγορα και ασταμάτητα και
μπορεί ακόμα να εξαφανιστεί (Εικόνα
17-13).
Τα μόρια της τουμπουλίνης που περιέχουν
GDP και
απελευθερώνονται
κατά τον αποπολυμερισμό του μικροσωληνίσκου προστίθενται στο απόθεμα των μη πολυμερισμένων μορίων στο κυπαροδιάλυμα. Για παράδειγμα, σε μια τυπική ινοβλάστη οποιαδήποτε στιγμή περίπου η μισή ωυμπουλίνη βρί-
722
Κεφάλαιο 17: Κυτταροσκελετός
σκεται στους μικροσωληνίσκους ενώ η υπόλοιπη είναι ελεύθερη στο κυττα ροδιάλυμα και παρέχει ένα απόθεμα υπομονάδων διαθέσιμων για την αύξη ση των μικροσωληνίσκων. (Αυτή η κατάσταση διαφέρει πολύ από την οργά
νωση των πιο σταθερών ενδιάμεσων ινιδίων: εδώ όλες οι υπομονάδες είναι
iHI~lf-'iI-~
με
GTP και
Ι μόρια τουμπουλίνης GTP προστίθενται • στο άκρο του μικροσωληνίσκου
_(J!
,"'Q!>
GDP
έτσι είναι πάλι διαθέσιμα να προστεθούν σ' έναν άλ/ο μικροσω
ληνίσκο που βρίσκεται στη φάση της αύξησης.
μόριο τουμπουλίνης με
flIlJC , Q!>
σχεδόν πλήρως συναρμολογημένες). Στη συνέχεια, τα μόρια της τουμπουλί νης που προστίθενται στη δεξαμενή ανταλ/άσσουν το προσδεδεμένο
--~
- - ~ προσδεδεμένο GTP
~ Ι η προσθήκη γίνεται ταχύτερα • από την υδρόλυση του GTP
rιιιιm;:Q!>
Οι μlκροσωληνίσκοι συντηρούνται από μια ισορροπία μεωξύ
,--~~~-----,I κάλυμμα
συναρμολόγησης και αποσυναρμολόγησης Χάρη στη δυναμική αστάθειά τους, οι μικροσωληνίσκοι υφίστανται συνε
~
GTP
ΑΝΑΠΤΥΣΣΟΜΕΝΟΣ ΜΙΚΡΟΣΩΛΗΝΙΣΚΟΣ
Χώς ταχεία αναδιαμόρφωση. Αυτή η ιδιότητα είναι αποφασιστικής σημασίας
για τη λειτουργία τους, όπως υποδηλώνουν οι δράσεις φαρμάκων που ανα στέλ/ουν τον πολυμερισμό ή τον αποπολυμερισμό της τουμπουλίνης. Ας ε
!
ξετάσουμε τη μιτωηκή άτρακτο, το δίκωο των μικροσωληνίσκων που καθο δηγεί τα χρωμοσώματα κατά τη διάρκεια της μίτωσης (βλ. Εικόνα
17 -9Β).
Ό
πρωτ6ίνίδια που περιέχουν τουμπουλίνη με GDP είναι ασταθή και ξεφλουδίζουν από το τοίχωμα του μικροσωληνίσκου
•
ταν ένα κύτταρο που βρίσκεται στη φάση της μίτωσης εκτεθεί στο φάρμακο
Koi1xlKfvn (colchicine), που προσδένεται ισχυρά στην ελεύθερη τουμπουλίνη και εμποδίΖει τον πολυμερισμό της σε μικροσωληνίσκους, η μιτωηκή άτρα
Ι τουμπουλίνη με GDP αποδεσμεύεται • στο κυπαροδιάλυμα
κτος γρήγορα εξαφανίΖεται και το κύτταρο σταματά στη μέση της μίτωσης, α νίκανο να κατανείμει τα χρωμοσώματά του σε δύο ομάδες. Αυτό αποδεικνύ ει όη η μιτωηκή άτρακτος φυσιολογικά διατηρείται από τη συνεχή ισορροπία
~-~μόριoτoυμπoυλίνης ~~
C$
με προσδεδεμένοGDP
μεταξύ προσθήκης και απώλειας υπομονάδων τουμπουλίνης: αν η προσθή κη της τουμπουλίνης παρεμποδιστεί από την κολχικίνη, η απώλεια της του
Εικόνα
μπουλίνης θα συνεχιστεί έως την εξαφάνιση της ατράκτου. Το φάρμακο raξόiΊn
(taxol)
ΣγΡΡIΚΝΟΥΜΕΝΟΣ ΜΙΚΡΟΣΩΛΗΝΙΣΚΟΣ
έχει την αντίθετη δράση στο μοριακό επίπε
δο. Προσδένεται ισχυρά στους μικροσωληνίσκους και εμποδίΖει την απώ λεια υπομονάδων. Επειδή όμως νέες υπομονάδες μπορούν να προστίθε νται, οι μικροσωληνίσκοι αυξάνουν αλλά δεν μπορούν να συρρικνωθούν. Εντούτοις, παρά ης διαφορές στις μοριακές λεπτομέρειες, η ταξόλη έχει την
17-13.
Πώς η υδρόλυση του
GTP
ε·
λέγχει την ανάπτυξη των μικροσωληνίσκων. Τα διμερή της τουμπουλίνης που περιέχουν
GTP
(κόκκινο) προσδένονται πιο ισχυρά μετα
ξύ τους από τα διμερή που περιέχουν
GDP
(σκούρο πράσινο). Επομένως, οι μικροσωληνί σκοι που έχουν νεοπροστεθειμένα διμερή του μπουλίνης με προσδεδεμένο
GTP
έχουν την
ίδια τελική επίδραση στο κύτταρο με την κολχικίνη και σταματά τα διαιρού
τάση ν' αυξάνουν. Μερικές φορές όμως, ιδίως
μενα κύτταρα στη μίτωση. Η πληροφορία που προκύπτει από τα προηγούμε
γή, οι υπομονάδες με «κάλυμμα
να είναι όη για να λειτουργεί η άτρακτος οι μικροσωληνίσκοι πρέπει να είναι
ουν το
σε θέση όχι μόνο να συναρμολογούνται αλλά και ν' αποσυναρμολογούνται. Η συμπεριφορά της ατράκτου αναφέρεται με περισσότερες λεπτομέρειες στο
Κεφάλαιο
19 όπου
θα εξετάσουμε τη μίτωση.
Η απενεργοποίηση ή καταστροφή της μιτωηκής ατράκτου πιθανόν θανα
τώνει τα δΙάιρούμενα κύτταρα. Τα καρκινικά κύτταρα, τα οποία διαιρούνται
όταν η αύξηση του μικροσωληνίσκου είναι αρ
GTP
σε
GDP πριν
GTP" υδρολύ
προλάβουν να προ
στεθούν νέες υπομονάδες GΤΡ-τουμπουλί νης. Έτσι, το «κάλυμμα» μονάδες που συνδέουν
GTP χάνεται. Οι υπο GDP προσδένονται λι
γότερο ισχυρά μεταξύ τους στο πολυμερές και απελευθερώνονται εύκολα από το ελεύθε ρο άκρο. Έτσι ο μικροσωληνίσκος αρχίζει να συρρικνώνεται αδιάκοπα.
ταχύτερα από τα περισσότερα κύτταρα του σώματος, μπορεί επομένως να
θανατωθούν επιλεκηκά με αvτιμπωΠKά φάρμακα
(antimitotic drugs)
που
σταθεροποιούν ή αποσταθεροποιούν τους μικροσωληνίσκους. Έτσι, φάρ μακα που είναι παράγωγα της κολχικίνης και της ταςόλης χρησιμοποιούνται γ1Ο την αντιμετώπιση του καρκίνου.
Σ' ένα φυσιολογικό κύτταρο, Χάρη στη δυναμική αστάθεια, το κεντρο-
Μικροσωληνίσκοι
723
Εικόνα
17-14.
Η επιλεκτική σταθεροποίηση
των μlκροσωληνίσκων μπορεί να πολώσει έ·
πυρήνας
Kεvτρo-
μικροσω-
καλυπτήρια
σωμάτιο
ληνίσκος
πρωτείνη
ασταθείς μικροσωληνίσκοι
ανθεκτικοί μικροσωληνίσκοι
να κύπαρο. Ένας νεοσχηματισμένος μικρο σωληνίσκος μπορεί να παραμείνει σταθερός
μόνον όταν και τα δύο άκρα του προφυλάσσο νται από αποπολυμερισμό. Στα κύπαρα, τα
πλην άκρα των μικροσωληνίσκων γενικώς προφυλάσσονται από τα κέντρα οργάνωσης απ' όπου και αναmύσσονται τα πρώτα ινίδια.
Τα συν άκρα αρχικά είναι ελεύθερα αλλά μπο ρεί να σταθεροποιηθούν από άλλες πρω τείνες. Εδώ, για παράδειγμα, απεικονίζεται έ να μη πολωμένο κύπαρο (Α), με νέους μικρο
σωμάηο (ή άλ/ο κένφο οργάνωσης) «εκωξεύει» συνεΧώς νέους μικροσω
σωληνίσκους που αναmύσσονται από το κε
ληνίσκους προς διάφορες κοτευθύνσεις, διερευνά ω περιβάλ/ον ή ωυς α
ντροσωμάτο και άλλους που συρρικνώνονται
ποσύρει. Όμως, ένας αυξανόμενος μικροσωληνίσκος μπορεί να πρoσrα
τυχαία προς πολλές κατευθύνσεις. Μερικοί α πό αυτούς τους μικροσωληνίσκους μπορεί τυ χαία να συναντήσουν πρωτε"ίΊιες (καλυmήριες πρωτεΊνες) σε μια εξειδικευμένη περιοχή του κυπαρικού φλοιού, να προσδεθούν σε αυτές
και έτσι να σταθεροποιήσουν τα συν άκρα τους
(8). Αυτή η επιλεκτική
σταθεροποίηση θα
οδηγήσει σ' έναν ταχύ επαναπροσανατολισμό των διατάξεων των μικροσωληνίσκων (η και
θα δημιουργήσει ένα κύπαρο με έντονα πο
τευθεί από ων αποπολυμερισμό όταν ω συν άκρο ωυ, για κάποιο λόγο, σrαθερoΠOΙηθεί μόνιμα εάν συνδεθεί μ' ένα άλλο μόριο ή μια κυτταρική
δομή έΤσΙ ώσrε να εμποδίΖετοι ο αποπολυμερισμός της ωυμπουλίνης. Ό ταν σrαθερoΠOΙηθεί με προσκόλ/ηση σ' ένα δομικό σroιxείo που βρίσκετοι σε μια μακρινή περιοχή ωυ κυττάρου, ο μικροσωληνίσκος δημιουργεί μια σχεηκά σrαθερή επικοινωνία μετοξύ αυτής της δομής και ωυ κενφοσωμα τίου (Εικόνα
17-14) _Το
κενφοσωμάηο μπορεί να παρoμoιασrεί μ' έναν
ψαρά που ρίχνει την πεωνιά: ότον τίποτο δεν δαγκώσει την άκρη της πεω
λωμένο σχήμα (Δ).
νιάς, η πεωνιά αποσύρεται γρήγορα και ρίχνεται ξανά, ότον όμως Τσιμπή
σει ένα ψάρι, η πεωνιά παραμένει τενΤωμένη συνδέΟνΤας ω ψάρι με ων ψαρά. Αυτή η απλή σrρατηγΙKή της Τυχαίας εξερεύνησης και της επιλεκη κής σrαθερoπoίησης δίνει τη δυνοτότητο σro κενΤροσωμάηο και σε άλλα
κένΤρα εμπυρήνωσης να δημιουργήσουν ένα πολύ οργανωμένο σύσrημα
Ερώmσn
μικροσωληνίσκων που συνδέουν επιλεγμένα φήματα ωυ κυττάρου. Ό
17-3
Η δυναμική ασrάθεια προ
•
καλεί την αύξηση ή τη συρ
ρίκνωση Των μικροσωληνί
σκων. Θεωρείσrε ένα μικρο
πως θα δούμε σrη συνέχεια, ω σύσrημα αυτό χρησιμοποιείται για την ε γKOTάσrαση των οργανιδίων.
Οι μlκροσωλnνίσκοι οργανώνουν το εσωτερικό του κυπάρου
σωληνίσκο που βρίσκεται
Τα κύπαρα έχουν την ικανότητα να φοποποιούν τη δυναμική ασrάθεια
σrη φάση της συρρίκνωσης.
των μικροσωληνίσκων ωυς για συγκεκριμένους σκοπούς. Για παράδειγμα,
Α. Τι πρέπει να συμβεί σro άκρο ωυ μι-
όταν τα κύπαρα εισέρχονΤαι σrη φάση της μίτωσης, οι μικροσωληνίσκοι αρ
κροσωληνίσκου ώσrε να σrαμOTήσει
χικά είναι πιο δυναμικοί και μεταπίπωυν συχνότερα από τη φάση αύξησης
να συρρικνώνετοι και ν' αρχίσει ν' αυ
σrη φάση συρρίκνωσης. ΈΤσΙ αποπολυμερίΖΟνΤαι γρήγορα και επανασυ
ξάνει;
ναρμολογούνΤαι, δημιουργώνΤας τη μnωηκή άφακτο. Από την άλ/η μεριά,
Β. Πώς θα επηρέαΖε αυτή Τη μετοφοπή
όταν ένα κύπαρο έχει διαφοροποιηθεί σ' ένα εξειδικευμένο είδος και έχει α
η αλλαγή Της συγκένφωσης της ωυ
ποκτήσει μlO oρισrΙKή τελική δομή, η δυναμική ασrάθεια των μικροσωληνί
μπουλίνης;
σκων συχνά Kατασrέλ/εται από πρωτε'ί'νες που προσδένΟνΤαι σrα άκρα των
Γ. Τι θα συνέβαινε εάν ω διάλυμα περι είχε μόνο
GDP και όχι GTP;
Δ. Τι θα συνέβαινε εάν ω διάλυμα περι είχε ένα ανάλογο ωυ
GTP ω
μικροσωληνίσκων και ωυς σrαθερoπoιoύν. Οι σrαθερoπoιημένoι μικροσω ληνίσκοι χρησιμεύουν για τη διοτήρηση της οργάνωσης ωυ κυπάρου.
οποίο
δεν μπορεί να υδρολυθεί;
Τα περισσότερα διαφοροποιημένα Ζωικά κύπαρα είναι ποΛωμένα: για
παράδειγμα, τα νευρικά κύπαρα προεκβάλ/ουν έναν νευράξονα από ω ένα
άκρο ωυς και δενδρίτες από ω άλ/ο. Τα κύπαρα που έχουν εξειδικευθεί για έκκριση έχουν ης συσκευές
Golgi ωποθετημένες
προς την πλευρά της έκ
κρισης κλπ. Η πολικότητα ωυ κυπάρου είναι μια έκφραση ωυ πολωμένου
724
Κεφάλαιο 17: Κυτταροσκελετός
KUΠαΡΙKό σώμα
)
'-~.J' ••
απόληξη του νευράξονα νευράξονας
••
--~-----""-..-.~-----.. -:.+.
.-
...._-......-
...;;..~~--~
Εικόνα 17-15. Μεταφορά κατά μήκος μικρο σωληνίσκων σ' έναν νευράξονα. Στα νευρικά κύπαρα όλοι οι μικροσωληνίσκοι του νευρά
ξονα (ένας έως μερικές εκατοντάδες) είναι προσανατολισμένοι προς την ίδια κατεύθυν ση, με τα συν άκρα τους προς την απόληξη του νευράξονα, Οι προσανατολισμένοι μικροσω
~-_.....:.~-.....;,
ληνίσκοι χρησιμοποιούνται σαν τροχιές (μονο πάτια) για την κατευθυνόμενη μεταφορά υλι
κών που συντίθενται στο κυπαρικό σώμα αλλά είναι απαραίτητα στην απόληξη του νευράξο
να (όπως οι μεμβρανικές πρωτεΊνες, που είναι απαραίτητες για την ανάmυξη), Για έναν νευ ράξονα που περνά από το νωτιαίο μυελό σ' έ να μυ της ωμοπλάτης σας, η διαδρομή χρειά
συmήματος των μικροσωληνίσκων που βρίσκονται
mo
εσωτερικό του και
βοηθά
mnv τοποθέτηση των οργανιδίων mn σωmή θέση μέσα mo κύπαρο και mnv καθοδήγηση της διακίνησης μεταξύ των διαφόρων τμημάτων του κυπάρου. Για παράδειγμα, mo νευρικό κύπαρο όλοι οι μικροσωληνίσκοι του νευράξονα είναι προσανατολισμένοι προς την ίδια κατεύθυνση με τα συν άκρα προς προς τις απολήξεις του νευράξονα (Εικόνα
17-15).
Κατά μήκος
αυτών των προσανατολισμένων τροχιών το κύπαρο μπορεί να mείι'Ίει φορτία από υλικά, όπως μεμβρανικά κυmίδια και πρωτε'ί'νες για έκκριση που παρα
σκευάΖΟνται
mo κυπαρικό
σώμα αλ/ά είναι απαραίτητα
mo απομακρυσμένο
ζεται περίπου δύο ημέρες. Εκτός από αυτή τη
διακίνηση υλικών προς τα έξω που προωθείται από μια ομάδα κινητήριων πρωτεϊνών (κόκκι νοι κύκλοι), υπάρχει και μια διακίνηση προς την αντίθετη κατεύθυνση, προς το κυπαρικό σώ μα, που προωθείται από μια διαφορετική ομά
δα κινητήριων πρωτεϊνών (μπλε κύκλοι). Η κί νηση προς το κέντρο (το κυπαρικό σώμα) με
ταφέρει υλικά που προσλαμβάνονται από το άκρο του νευράξονα ή που σχηματίστηκαν α πό την αποδόμηση πρωτε'ίνών και άλλων μο ρίων,
άκρο του νευράξονα. Μερικά από αυτά τα υλικά μετακινούνται με ταΧύτητα μεγαλύτερη από
cm την ημέρα,
γεγονός που σημαίνει ότι η μετακίνηση
mo άκρο
1Ο
ενός νευρά
ξονα μερικών Ζώων μπορεί να διαρκέσει μια εβδομάδα ή και περισσότερο. Όμως, η μετακίνηση κατά μήκος των μικροσωληνίσκων είναι απείρως ταΧύ
τερη και περισσότερο αποτελεσματική από την ελεύθερη διάχυση. Ένα πρω τεϊνικό μόριο που ταξιδεύει με απλή διάχυση θα χρειαmεί χρόνια για να φτά σει
mo άκρο ενός μεγάλου νευράξονα,
εάν φτάσει ποτέ (βλ. Ερώτηση
17-12).
Είναι σημαντικό να καταλάβουμε επίσης ότι οι μικροσωληνίσκοι των Ζω
ντανών κυπάρων δεν δρουν από μόνοι τους. Οι λειτουργίες τους, όπως και
των άλλων ινιδίων του κυπαροσκελετού, εξαρτώνται από μια μεγάλη ποικι λία επικουρικών πρωτεϊνών που προσδένονται mους μικροσωληνίσκους και εξυπηρετούν διάφορες λειτουργίες. Μερικές πρωτε'ί'νες που προσδένονται σε μικροσωληνίσκους τους mαθεροποιούν για να μην αποσυναρμολογού νται, ενώ άλλες συνδέουν τους μικροσωληνίσκους με άλ/α συmατικά του
κυπάρου ακόμα και με άλ/α είδη ινιδίων του κυπαροσκελετού. Έτσι, όλα τα συmατικά του κυπαροσκελετού αλ/ηλεπιδρούν μεταξύ τους και οι λειτουρ γίες τους μπορεί να συντονιmούν.
Οι μικροσωληνίσκοι επηρεάΖουν επίσης την κατανομή των μεμβρανών σ' ένα ευκαρυωτικό κύπαρο, κυρίως μέσω των κινητήριων πρωτεϊνών, οι ο
ποίες συνδέονται με τους μικροσωληνίσκους και κινούνται κατά μήκος τους. Όπως θα δούμε
mn συνέχεια,
οι κινητήριες πρωτε'ί'νες χρησιμοποιούν την ε
νέργεια της υδρόλυσης του ΑΤΡ για να μεταφέρουν οργανίδια, κυmίδια και άλ/α υλικά του κυπάρου κατά μήκος τροχιών που έχουν δημιουργηθεί από νημάτια ακτίνης και μικροσωληνίσκους μέσα
mo κυπαρόπλασμα. Μικροσωληνίσκοι
725
Οι κινητήριες πρωτείνες προωθούν την
ενδοκυπάριο μεταφορά Ότον παροτηρούμε ένα zωvτανό κύτταρο στο φωτονlκό μlκροσκόπlO, βλέπουμε όη το κυτταρόπλασμά του βρίσκεΤΟΙ σε δlOρκή κίνηση: ΤΟ μπο ΧόνδρlO ΚΟΙ τα μικρότερα μεμβρανικά οργανίδια ΚΟΙ κυστίδια μεTOKινOύVΤαι σπασμωδικά, δηλαδή, KινOύVΤOl για λίγο, σταματούν ΚΟΙ αρχίΖουν πάλι (Ει κόνα
17-16). Αυτή
η μετακίνηση με άΛματα είνOl πολύ πιο παρατετομένη
κοι κατευθυνόμενη από ης συνεχείς μετοκινήσεις
Brown που προκαλούν
οι
τυχαίες θερμικές κινήσεις. Τόσο οι μlκροσωληνίσκοι όσο κοι ΤΟ νημάηα της ακτίνης συμμετέχουν σε μετοκινήσεις με άλματο αλ/ά κοι σε άλλες κατευ θυνόμενες μετακινήσεις στα ευκαρυωηκά κύτταρα. Κοι στις δύο περιπτώ σεις, οι μετοκινήσεις προκαλούνται από ης κινητήριες πρωτείνες
proteins),
(motor
οι οποίες ΠΡOσδένOVΤOl στα νημάηα της ακτίνης ή στους μlκρο
σωληνίσκους κοι χρησιμοποιούν την ενέργεια που προέρχετOl από επανα
λαμβανόμενους κύκλους υδρόλυσης του ΑΤΡ γlO να μεTOKlνOύVΤOl σταθε ρά κατά μήκος των ινιδίων της ακτίνης ή των μικροσωληνίσκων προς μlO μόνο κατεύθυνση (βλ. Εικόνα
4-45).
Ταυτόχρονα, οι κινητήριες πρωτεΊνες
προσδένουν και άλ/α κυτταρικά συσταηκά κοι έτσι μετοφέρουν το φορτίο αυτό κατά μήκος των ινιδίων. Ο αριθμός των κινητήριων πρωτεϊνών που έ
χουν τουτοποιηθεί ανέρχετοι σε δεκάδες. Δlοφέρουν στο είδος του ινιδίου στο οποίο πρoσδένovταl, στην κατεύθυνση της μετοκίνησης κατά μήκος του
ινιδίου κοι στο φορτίο που μεταφέρουν. Οι κινπιήριες πρωτεΊνες που KινOύVΤOl κατά μήκος κυτταροπλασμαηκών
μικροσωληνίσκων, όπως στο νευράξονα ενός νευρικού κυττάρου, ανήκουν σε δύο κατηγορίες: οι κινησίνες
(kinesins) γενικά
μεTOKινOύVΤOl προς το συν
άκρο ενός μικροσωληνίσκου (μακριά από το KεVΤΡOσωμάηO, προς ΤΟ έξω
στην Εικόνα
17-15), ενώ οι δυνείνες (dyneins) KlνOύVΤOl προς το πλην άκρο (προς το KεVΤΡOσωμάτιO, προς ΤΟ μέσα στην Εικόνα 17-15). Οι κινησίνες κοι
οι δυνεΊνες περιέχουν δύο σφαιρικές κεφαλές που προσδένουν ΑΤΡ και μια ουρά (Εικόνα
17-17).
Οι κεφαλές αλληλεπιδρούν με τους μlκροσωληνί-
Εικόνα 17·16. Τα οργανίδια μετακινούνται κατά μήκος των μικροσωληνίσκων με διαφορετική ταχύτητα. Κινηματογράφηση καρέ-καρέ μιας επιπεδωμένης περιοχής από ένα νευρικό κύπαρο ασπόνδυλου. Φαίνονται άφθονα μεμβρανικά κυστίδια και μιτοχόνδρια, πολλά από τα οποία κινούνται. Ο λευκός κύκλος λειτουργεί ως σημείο αναφοράς. Οι εικόνες τραβήχτηκαν σε μεσοδιαστήματα ρολέmου. (Με την άδεια του Ρ.
726
Forscher).
Κεφάλαιο 17: Κυτταροσκελετός
400 χιλιοστών του δευτε
Εικόνα 17·17. Κινητήριες πρωτείΎες των μι κροσωληνίσκων. (Α) Οι κινησίνες και οι KUΠα ροπλασματικές δυνεΊνες είναι κινητήριες πρω τεΊνες των μικροσωληνίσκων που μετακινού
ελαφριές αλυσίδες
νται προς αντίθετες κατευθύνσεις κατά μήκος ενός μικροσωληνίσκου. Οι πρωτεΊνες αυτές
κινησίνη
(στην εικόνα έχουν σχεδιαστεί σε κλίμακα) εί ναι σύμπλοκα που αποτελούνται από δύο πα νομοιότυπες βαριές αλυσίδες και πολλές μι κρότερες ελαφριές αλυσίδες. Κάθε βαριά αλυ σίδα σχηματίζει μια σφαιρική κεφαλή που αλ ληλεπιδρά με τους μικροσωληνίσκους. (Β) Σχη ματική παράσταση μιας κινητήριας πρωτε'ίνης στην οποία φαίνεται το εξαρτώμενο από το πλην άκρο
~
ΑΤΡ "βάδισμα» κατά μήκος ενός νηματίου.
συν άκρο
10 nm
(Α)
(Β)
σκους κατά στερεοειδικό τρόπο, έτσι ώστε η κινησίνη να συνδέεται μ' έναν μικροσωληνίσκο μόνον όταν είναι στραμμένη προς τη σωστή κατεύθυνση. Η ουρά της κινητήριας πρωτε'ϊνης συνδέεται σταθερά με μερικά συστατικά του
κυπάρου, όπως ένα κυστίδιο ή ένα οργανίδιο, και έτσι καθορίΖει το είδος του φορτίου που πρόκειται να μεταφέρει (Εικόνα
17-18). Οι σφαιρικές
κεφαλές
της κινησίνης και της δυνε'ϊνης είναι ένΖυμα που υδρολύουν το ΑΤΡ (ΑΤΡά σες). Η υδρόλυση του ΑΤΡ παρέχει την ενέργεια για μια σειρά αλλαγών της διαμόρφωσης της κεφαλής μ' ένα μηχανισμό σύνδεσης, απελευθέρωσης
και επανασύνδεσης στους μικροσωληνίσκους, ο οποίος επιτρέπει στην κε φαλή να μετακινείται κατά μήκος των μlκροσωληνίσκων (βλ. Εικόνα
4-45).
Τα οργανίδια KlνoύVΤQl κατά μήκος των μlκροσωλnνίσκων Οι μlκροσωληνίσκοι και οι συνδεδεμένες κινητήριες πρωτε'ί\1ες παίΖουν σημαVΤΙKό ρόλο στην τοποθέτηση μεμβρανlκών οργανιδίων στο εσωτερικό ενός ευκαρυωτικού κυπάρου. Για παράδειγμα, στα περισσότερα Ζωικά κύτ ταρα οι αγωγοί του ενδοπλασματικού δικτύου φτάνουν σχεδόν μέχρι την πα ρυφή του κυπάρου, ενώ η συσκευή
Golgi βρίσκεται
στο εσωτερικό του κυτ-
ΚΙΝΗΣΙΝΕΣ
ΠΛΗΝ ΑΚΡΟ
..
Εικόνα 17-18. Οι κινητήριες πρωτείΎες που μεταφέρουν φορτία κατά μήκος των μικρο σωληνίσκων. Οι κινησίνες μετακινούνται προς το συν άκρο ενός μικροσωληνίσκου, ενώ οι δυ νεΊνες μετακινούνται προς το πλην άκρο. Και
ΣΥΝ
τα δύο είδη των κινητήριων πρωτε'ίνών των μι
ΑΚΡΟ
κροσωληνίσκων υπάρχουν σε πολλές μορφές
κινητήρια κεφαλή
και θεωρείται ότι κάθε μορφή μεταφέρει ένα
ουρά
διαφορετικό φορτίο. Το ελεύθερο άκρο της κι
φορτίο
ΔΥΝΕϊΝΕΣ
νητήριας πρωτεΊνης καθορίζει το είδος του φορτίου που θα μεταφερθεί από αυτήν.
Μικροσωλην(σκοι
727
Εικόνα 17·17. Κινητήριες πρωτείΎες των μι κροσωληνίσκων. (Α) Οι κινησίνες και οι KUΠα ροπλασματικές δυνεΊνες είναι κινητήριες πρω τεΤνες των μικροσωληνίσκων που μετακινού νται προς αντίθετες κατευθύνσεις κατά μήκος
ελαφριές αλυσίδες
ενός μικροσωληνίσκου. Οι πρωτεΤνες αυτές
κινησίνη
(στην εικόνα έχουν σχεδιαστεί σε κλίμακα) εί ναι σύμπλοκα που αποτελούνται από δύο πα
νομοιότυπες βαριές αλυσίδες και πολλές μι κρότερες ελαφριές αλυσίδες. Κάθε βαριά αλυ σίδα σχηματίζει μια σφαιρική κεφαλή που αλ ληλεπιδρά με τους μικροσωληνίσκους.
πλην άκρο
~
(8) Σχη
ματική παράσταση μιας κινητήριας πρωτεΤνης στην οποία φαίνεται το εξαρτώμενο από το ΑΤΡ «βάδισμα» κατά μήκος ενός νηματίου.
συν άκρο
10 nm
(Α)
(6)
σκους κατά σΤερεοειδικό φόπο, έτοι ώσΤε η κινησίνη να συνδέεται μ' έναν μικροσωληνίσκο μόνον ότον είναι σΤραμμένη προς τη σωσΤή κοτεύθυνση. Η ουρά της κινητήριας πρωτε'ί\ιης συνδέεται σΤαθερά με μερικά συσΤαnκά 1Ου
κυπάρου, όπως ένα κυσΤίδιο ή ένα οργανίδιο, και έτοι καθορίΖει 10 είδος 1Ου φορτίου που πρόκειτοι να μετοφέρει (Εικόνα 17-18). Οι σφαιρικές κεφαλές της κινησίνης και της δυνείνης είναι ένΖυμα που υδρoi\ύoυν 10 ΑΤΡ (ΑΤΡά σες). Η υδρόλυση 1Ου ΑΤΡ παρέχει την ενέργεια για μια σειρά αλλαγώντης διαμόρφωσηςτης κεφαλής μ' ένα μηχανισμό σύνδεσης, απελευθέρωσης
και επανασύνδεσηςσΤους μικροσωληνίσκους,ο οποίος εππρέπει σΤην κε φαλή να μετοκινείταικοτά μήκος των μικροσωληνίσκων(βλ Εικόνα 4-45).
Τα οργανίδια κινούνται κατά μήκος των μικροσωλnνίσκων Οι μικροσωληνίσκοι και οι συνδεδεμένες κινητήριες πρωτε'ί\ιες παίΖουν σημαVΤΙKό ρόλο σΤην 1Οποθέτηση μεμβρανικών οργανιδίων σΤΟ εσωτερικό ενός ευκαρυωnκού κυπάρου. Για παράδειγμα, σΤα περισσότερα Ζωικά κύτ τορα οι αγωγοί 1Ου ενδοπλασμαnκού δικτύου φτάνουν σχεδόν μέχρι την πα ρυφή 1Ου κυπάρου, ενώ η συσκευή
Golgi βρίσκεται
σΤΟ εσωτερικό 1Ου κυτ-
ΚΙΝΗΣΙΝΕΣ
ΠΛΗΝ ΑΚΡΟ
ΣΥΝ ΑΚΡΟ
Εικόνα 17-18. Οι κινητήριες πρωτε'ί'νες που μεταφέρουν φορτία κατά μήκος των μικρο σωληνίσκων. Οι κινησίνες μετακινούνται προς το συν άκρο ενός μικροσωληνίσκου, ενώ οι δυ νεΤνες μετακινούνται προς το πλην άκρο. Και τα δύο είδη των κινητήριων πρωτεϊνών των μι κροσωληνίσκων υπάρχουν σε πολλές μορφές και θεωρείται ότι κάθε μορφή μεταφέρει ένα διαφορετικό φορτίο. Το ελεύθερο άκρο της κι νητήριας πρωτεΤνης καθορίζει το είδος του φορτίου που θα μεταφερθεί από αυτήν.
Μικροσωληνίσκοι
727
Ισιορική Αναδρομή: ΑναΖπrώνrαs κινπrήριεs πρωrείνεs Υποθέσεις, παρατηρήσεις και μετρήσεις για τη μετακίνηση των
Με την τεχνική της βιντεομικροσκοπίας, το κυπαρόπλασμα που
οργανιδίων στο κυπαρόπλασμα άρχισαν να γίνονται περίπου από
εξωθείται από τον νευράξονα φαίνεται γεμάτο μικροσκοπικά σω
το μέσο του
ματίδια
ρου σ' ένα άλλο άρχισαν ν' αναγνωρίζονται μόλις στα μέσα της δε
30-50 nm έως μιτοχόνδρια μή 5000 nm - τα οποία μετακινούνται πάνω σε ινίδια του κυπαροσκελετού με ταχύτητα έως 5 μm ανά δευτερόλεmο. Αν το
καετίαςτου
αξονόπλασμα απλωθεί σε αρκετά λεmή επίστρωση μπορεί να δια
19°U αιώνα.
Ωστόσο, τα μόρια που καθοδηγούν αυτή
τη μετακίνηση οργανιδίων και κυστιδίων από ένα μέρος του κυπά
1980.
Γιατί τόση καθυστέρηση; Το πρόβλημα είχε να κάνει με τις πρω τε'ίνες ή, ακριβέστερα, με τη δυσκολία της μελέτης μεμονωμένων
πρωτε'ίνών ίπ
vitro. Για παράδειγμα, για να διερευνήσουν τη δράση
-
από κυστίδια διαμέτρου
κους περίπου
κριθούν ακόμα και ξεχωριστά ινίδια (Εικόνα
17-19).
Η μετακίνηση συνεχίζεται επί ώρες αφήνοντας τα περιθώρια για ποικίλες παρεμβάσεις και μελέτες. Για παράδειγμα, οι
Scott Brady ανακάλυψαν
Ray Lasek
ενός ενζύμου, οι βιοχημικοί πρέπει πρώτα ν' απομονώσουν το πο
και
ότι η μετακίνηση των οργανιδίων α
λυπεmίδιο: για το λόγο αυτό προκαλούν λύση των κυπάρων ή των
παιτείΑΤΡ. Η αντικατάσταση του ΑΤΡ από ανάλογα, όπωςτοΑΜΡ
ιστών και διαχωρίζουν τη συγκεκριμένη πρωτε'ίνη από τ' άλλα συ
ΡΝΡ, τα οποία προσδένονται στο ενεργό κέντρο του ενζύμου αλλά
στατικά του κυπάρου (βλ. Παραρτήματα
δεν μπορεί να υδρολυθούν (άρα δεν παρέχουν ενέργεια) αναστέλ
4-3
έως
4-5).
Στη συνέ
χεια, μπορούν να μελετήσουν την πρωτε'ίνη μεμονωμένα, ίπ
vitro,
ε
λει τη μετακίνηση.
λέγχοντας την έκθεσή της σε υποστρώματα, αναστολείς, ΑΤΡ, κλπ. Δυστυχώς, αυτή η προσέγγιση δεν είναι αποτελεσματική για τη με λέτη του κινητήριου εξοπλισμού ο οποίος είναι υπεύθυνος για την
Περιελισσόμενοι σωλήνες Για ν' αναγνωριστούν τα ξεχωριστά συστατικά που καθοδη-
ενδοκυπάρια μεταφορά. Οι τεχνικές που ήταν απαραίτητες για να προωθηθεί η έρευνα προήλθαν από δύο διαφορετικές πηγές. Πρώτον, οι εξελίξεις οι ο
ποίες σημειώθηκαν στη μικροσκοπία επέτρεψαν στους βιολόγους
γιγαντιαίος νευράξονας
να διαπιστώσουν ότι ένα λειτουργικό σύστημα μεταφοράς (που ε
καλαμαριού
ξακολουθούσε να προσδένει εξωκυπάριο υλικό) μπορούσε ν' α ποσπαστεί από το κατάλληλο είδος ζωντανού κυπάρου. Ταυτό χρονα, οι βιοχημικοί συνειδητοποίησαν ότι μπορούσαν να συναρ μολογήσουν ένα λειτουργικό σύστημα μεταφοράς αρχίζοντας από τις «πρώτες ύλες» (
Ο"
't""
πρωτεινη που προσδένεται πλευρικά
~
πρωτεινη καλύμματος (Kαλύmει τα άκρα)
Εικόνα 17-32. Οι κύριες κατηγορίες πρωτεϊνών που συνδέονται με ακτίνη και βρίσκονται στα κύπαρα των σπονδυλωτών. Η ακτίνη φαί νεται κόκκινη και οι πρωτε'ί\ιες που συνδέονται με την ακτίνη φαίνονται πράσινες,
χνες. ΊVlΛες ανάλογες πρωτεΊνες συγκρατούν τα νημάτια της ακτίνης σ' ένα
Ζελατινοειδές δίκτυο μέσα στον κυπaρικό φΛοιό, το στρώμα του κυπαροπλά σματος που βρίσκεται κάτω από την κυπαρική μεμβράνη. ΠρωτεΊνες που κό βουν τα νημάτια όπως η rΖεΛσοΛfvn (ή πηκτολυματίνη,
gelso!in), τεμαχίΖουν
τα νημάτια της ακτίνης σε μικρότερα κομμάτια και έτσι μετατρέπουν μια πη κτή ακτίνης σε μια πιο ρευστή κατάσταση. Τα νημάτια της ακτίνης συνδέονται επίσης με κινητήριες πρωτεlνες και σχηματίζουν δέσμες συστολής, όπως στα
μυϊκά κύπαρα. Μπορούν επίσης να χρησιμοποιηθούν σαν τροχιόδρομοι κα τά μήκος των οποίων οι κινητήριες πρωτεΊνες μεταφέρουν οργανίδια, μια
λειτουργία που είναι ιδιαίτερα εμφανής σε φυτικά κύπαρα. Στο υπόλοιπο τμήμα αυτού του κεφαλαίου, θα εξετάσουμε μερικές χαρα κτηριστικές δομές που σχηματίΖουν τα νημάτια της ακτίνης και θ' αναφέρου με πώς συμμετέχουν στο σχηματισμό τους διάφορα είδη πρωτεϊνών που
738
Κεφάλαιο 17: Κυτταροσκελετός
συνδέονται με Την ακτίνη. Θα ξεκινήσουμε με τον πλούσιο σε ακτίνη κυπα ρικό φΛοιό και το ρόλο του στην κυπαρική μετακίνηση και θα συνεχίσουμε
με το σύστημα συστολής των μυϊκών κυπάρων Υια να δώσουμε ένα παρά δεΙΥμα μιας σταθερής δομής που βασίΖεται σε νημάτια ακτίνης.
Ο φλοιός που είναι πλούσιος σε ακτίνη στηρίΖει την κυπαρική μεμβράνη των περισσότερων ευκαρυωηκών κυπάρων Μολονότι η ακτίνη βρίσκεται σε όλο το κυπαρόπλασμα ενός ευκαρυωτι κού κυπάρου, στα περισσότερα κύπαρα βρίσκεται συΥκεντρωμένη σ' ένα στρώμα ακριβώς κάτω από την κυπαρική μεμβράνη. Σε αυτή την περιοχή
που ονομάΖεται KuπαΡΙKός φλοιός
(cell cortex), τα νημάτια
της ακτίνης συν
δέονται με πρωτεΊνες και δημιουΡΥούν ένα δίκτυο το οποίο στηρίΖει την εξω τερική επιφάνεια του κυπάρου και τής προσδίδει μηχανική αντοΧή. Στα ερυ
θροκύπαρα, όπως αναφέρθηκε στο Κεφάλαιο
11, ένα απλό και κανονικό
δί
κτυο ινωδών πρωτεϊνών είναι προσκολ/ημένο στην κυπαρική μεμβράνη και παρέχει Την απαραίτητη υποστήριξη Υια τη διατήρηση του απλού δισκοει δούς σχήματος (βλ. Εικόνα
11-30). Ο κυπαρικός
φλοιός των άλλων Ζωικών
κυπάρων είναι παΧύτερος και πιο περίπλοκος και υποστηρίΖει μια πολύ με Υαλύτερη ποικιλία σχημάτων και κινήσεων. Περιέχει σπεκτρίνη και αΥκυρίνη
(ankyrin,
όπως και στα ερυθροκύπαρα), αλ/ά περιλαμβάνει επίσης και ένα
πυκνό δίκτυο νηματίων ακτίνης που προεξέχουν μέσα στο κυπαρόπλασμα, όπου διασυνδέονται και δημιουΡΥούν ένα τρισδιάστατο πλέΥμα. Αυτό το δί κτυο της ακτίνης του φλοιού ελέΥχει το σχήμα και τις μηχανικές ιδιόΤητες Της κυπαρικής μεμβράνης και της κυπαρικής επιφάνειας. Όπως θα δούμε, η α
ναδιάταξη της ακτίνης μέσα στο φλοιό παρέχει τη μοριακή βάση Υια τις αλ/α Υές του κυπαρικού σχήματος και της κίνησης των κυπάρων.
Ο ερπυσμός των κυπάρων εξαρτάται από την ακτίνη Πολ/ά κύπαρα μετακινούνται έρποντας πάνω σε επιφάνειες αντί να κο λυμπούν με τη βοήθεια κροσσών και μαστΙΥίων. Οι σαρκοφάΥες αμοιβάδες έρπουν διαρκώς αναΖητώντας τροφή. Τα λευκά κύπαρα του αίματος που ο νομάΖονται ουδετερόφιΛα μεταναστεύουν από την κυκλοφορία του αίματος προς τους ιστούς όταν «οσμίΖΟνται» μικρά διαχεόμενα μόρια που απελευθε ρώνονται από βακτήρια, τα οποία τελικά καταβροΧθίΖουν και καταστρέφουν.
Το οδηΥό άκρο ενός αναπτυσσόμενου νευράξονα αποκρινόμενο σε αυξητι κούς παράΥοντες, μεταναστεύει και ακολουθεί μια διαδρομή, προς τον συ ναπτικό στόΧο, οδηΥούμενο από διαχεόμενες χημικές ουσίες. Οι μοριακοί μηχανισμοί που ελέΥχουν αυτούς αλ/ά και άλ/ους τρόπους
ερπυσμού είναι δύσκολο ν' αναλυθούν. ΣυνεπάΥονται συντονισμένες αλ/α Υές πολ/ών μορίων σε διαφορετικές περιοχές του κυπάρου. Δεν υπάρχει έ
να απλό και εύκολα αναΥνωρίσιμο κινητικό ΟΡΥανίδιο, όπως είναι ένα μα στίΥΙΟ, το οποίο να είναι υπεύθυνο Υια μια τέτοια κίνηση. Γενικά όμως, είναι Υνωστό ότι στον ερπυσμό παίΖουν σημαντικό ρόλο τρεις αλ/ηλοσυνδεόμε νες διαδικασίες:
(1) το
κύπαρο δημιουΡΥεί προσεκβολές στο «μέτωπο» ή 0-
Νημάτια Ακτίνης
739
Εικόνα
17-33.
Πώς προωθεί ένα κύπαρο ο
φλοιός ακτίνης
.....s:ι==Il~~
φλοιός. Ο πολυμερισμός της ακτίνης στο οδη γό άκρο του κυπάρου ωθεί την κυπαρική μεμ
ελασματοπόδιο
&·~b
βράνη προς τα εμπρός και σχηματίζει καινούρ
γιες περιοχές φλοιού ακτίνης που εδώ φαίνο νται κόκκινες. Νέα σημεία αγκυροβόλησης δη
πολυμερισμός της ακτίνης στο συν άκρο προεκτείνει το ελασματοπόδιο
φλοιός υπό πίεση
μιουργούνται μεταξύ των νηματίων της ακτί
νης και της επιφάνειας (το υπόστρωμα) πάνω στην οποία έρπει το κύπαρο. Η πίεση του φλοιού τραβά τότε το σώμα του κυπάρου προς τα εμπρός. Καθώς το πίσω τμήμα του
μετακίνηση αποπολυμερισμένης ακτίνης
KUΠάΡOυ αποκολλάται από το υπόστρωμα και
...
αποσύρεται, τα νημάτια της ακτίνης στην απο
απόσυρση
συρόμενη περιοχή αποπολυμερίζονται και τα μόρια ακτίνης που απελευθερώνονται κινού
νται διαμέσου του KUΠαΡOδιαλύμαΤOς σε θέ σεις νέου πολυμερισμού. Ο ίδιος κύκλος επα
((. σημεία αγκυροβόλησης
ναλαμβάνεται ακατάπαυστα, μετακινώντας βήμα προς βήμα το κύπαρο προς τα εμπρός.
δηγό άκρο του,
(2)
οι προσεκβολές προσκολλώνται στην επιφάνεια πάνω
στην οποία έρπει το κύπαρο και
(3) το
υπόλοιπο κύπαρο παρασύρεται προς
τα εμπρός με έλξη από τα σημεία προσκόλ/ησης (Εικόνα
17-33).
Και οι τρεις διαδικασίες περιλαμβάνουν την ακτίνη, αλλά με διαφορετι κούς τρόπους. Το πρώτο στάδιο, η προσεκβολή της κυπαρικής επιφάνειας προωθείται από τον πολυμερισμό της ακτίνης. Το οδηγό άκρο μιας έρπου σας ινοβλάστης σε καλ/ιέργεια ανά τακτά χρονικά διαστήματα εκτείνει λεπτά
ελασματοπόδια
(lamellipodia)
(Εικόνα
17-34), τα
οποία περιέχουν ένα πυ
κνό πλέγμα νηματίων ακτίνης που είναι προσανατολισμένα με το συν άκρο
τους κοντά στην κυπαρική μεμβράνη. Πολ/ά κύπαρα εκτείνουν επίσης λε
πτές άκαμπτες προεκβολές που ονομάΖΟνται φιλοπόδια ή νηματοπόδια
(filopodia) στο οδηγό άκρο αλλά και σε ολόκληρη την επιφάνειά τους. Τα φι λοπόδια έχουν πλάτος περίπου 0.1 μm και μήκος 5-10 μm. Κάθε φιλοπόδιο περιέχει μια χαλαρή δέσμη 10-20 νηματίων ακτίνης τα οποία επίσης είναι προσανατολισμένα με το συν άκρο τους προς τα έξω. Το προωθούμενο άκρο (ο αυξητικός κώνος) ενός αναπτυσσόμενου νευράξονα εκτείνει ακόμα μα κρύτερα φιλοπόδια, με μήκος έως
50 μm, τα οποία
βοηθούν στη διερεύνηση
του περιβάλ/οντος και στο να βρίσκουν το σωστό δρόμο προς τον στόχο. Τα ελασματοπόδια και τα φιλοπόδια είναι διερευνητικές κινητές δομές που σχη ματίζονται και αποσύρονται με μεγάλη ταχύτητα. ΕικάΖεται ότι και οι δύο δο μές δημιουργούνται από μια ταχεία τοπική αύξηση νηματίων ακτίνης, τα ο
ποία εμπυρηνώνονται στην κυπαρική μεμβράνη και την ωθούν προς τα έξω χωρίς όμως να την σχίΖουν καθώς επιμηκύνονται Ο σχηματισμός και η αύξηση των ινιδίων ακτίνης στο προπορευόμενο ά
κρο ενός κυπάρου υποβοηθείται από διάφορες επικουρικές πρωτε'ϊνες που προσδένουν ακτίνη και συμβάλ/ουν στην εμπυρήνωση πολυμερών της ακτί νης στην κυπαρική μεμβράνη. Μια ομάδα πρωτεϊνών που σχετίΖοντω με τπν
aκτίνπ
740
Κεφάλαιο 17: Κυτταροσκελετός
(actin-related proteins, ARPs)
προάγουν τον σχηματισμό διακλαδι-
φλοιός
ελασματοπόδιο
νηματοπόδιο
Εικόνα 17-34.lνίδια ακτίνης σε μεταναστευτι κά ζωικά κύπαρα. (Α) Σχηματική απεικόνιση μιας ινοβλάστης με πεπλατυσμένα ελασματο πόδια και λεmά νηματοπόδια που προσεκβάλ λουν από την επιφάνειά της, ιδίως στις περιο χές του οδηγού άκρου. (8) Οι λεmομέρειες της διάταξης των ινιδίων της ακτίνης σε τρεις περιοχές της ινοβλάστης φαίνονται με αιχμές
από βέλη που προσανατολίζονται προς το συν άκρο των ινιδίων. (η Μικρογραφία ηλεκτρονι κού μικροσκοπίου σάρωσης στην οποία φαίνο νται τα ελασματοπόδια και τα νηματοπόδια στο
οδηγό άκρο μιας ανθρώπινης μεταναστευτικής ινοβλάστης σε καλλιέργεια. (Γ. Ευγενική προ σφορά του
Julian Heath).
σμένων ινιδίων ακτίνης. Αυτές οι πρωτε'ϊνες σχηματίΖουν ένα σύμπλοκο που προσδένε1Ο1 Ο1α προϋπάρχον1Ο ινίδιο ακτίνης, όπου οργανώνει την αύξηση
ενός νέου ινιδίου, ω οποίο αυξάνει υπό γωνία και έιοι σχημοιίΖει έναν πλευ
ρικό κλάδο (Εικόνα
17-35). Συνεπώς
αυτά 10 σύμπλοκα προάγουνων ΣΧπ
μαησμό ενός δισδιάΟ1αωυπλέγμαωςακτίνης. Με Τη βοήθεια επιπρόσθετων
πρωτεϊνών που προσδένουνακτίνη, αυτό ω πλέγμα υφίΟ1α1Ο1 συναρμολό γηση 010 πρόσθιο άκρο και αποσυναρμολόγηση010 οπίσθιο άκρο. Με αυτό
ων φόπο, προωθείω ελασμαωπόδιοπρος 10 εμπρός (Εικόνα 17-36).
'Orav 10 ελασμαωπόδιακαι 10 φιλοπόδια αγγίξουν μια ευνοϊκή επιφά-
Εικόνα 17-35. Η οργάνωση των ινιδίων της α κτίνης σ' ένα ελασματοπόδιο. Ευκίνητα κερα
τινοκύπαρα από το δέρμα βατράχου μονιμο ποιήθηκαν, ξηράνθηκαν, βάφηκαν με λευκό χρυσο και εξετάσθηκαν με ηλεκτρονικό μικρο σκόπιο. (Α) Τα ινίδια ακτίνης σχηματίζουν ένα πυκνό δίκτυο. Τα ταχέως αυξανόμενα άκρα τους τερματίζονται στο προπορευόμενο χεί λος του ελασματοποδίου (πάνω μέρος της ει
κόνας).
(8 και η
Μεγέθυνση των πλαισίων από
το (Α): παρατηρούνται συμβολές σχήματος γ
μεταξύ ξεχωριστών ινιδίων. (Με την άδεια της
Tatyana Svitkina και του Gary 80risy). Νημάτια Ακτίνης
741
Εικόνα
17-36. Το
προπορευόμενο χείλος ε·
•
νέο ινίδιο ακτίνης
προπορευόμενο χείλος
νός ελασματοποδίου προωθείται από τη συ
ναρμολόγηση ενός δικτύου ακτίνης. Η εμπυ ρήνωση νέων ινιδίων ακτίνης (κόκκινο) μεσο λαβείται από σύμπλοκα
ARP
(πορτοκαλί) στο
«μέτωπο» του δικτύου. Έτσι, τα νέα ινίδια είναι
προσκολλημένα στα πλάγια των παλαιών ινι δίων (βλ. Εικόνα
17-35).
Καθώς αυξάνουν αυ
τά τα ινίδια, ωθούν την κυπαρική μεμβράνη προς τα εμπρός. Τα συν άκρα των ινιδίων ακτί νης προστατεύονται από ειδικές πρωτεινες (μπλε). Έτσι, αποτρέπεται η περαιτέρω συναρ μολόγηση ή αποσυναρμολόγηση από τα πα λαιά συν άκρα στο μέτωπο του δικτύου. Η υ δρόλυση του ΑΤΡ που είναι προσδεδεμένο στις υπομονάδες της ακτίνης προάγει τον α ποπολυμερισμό στο οπίσθιο άκρο του συ
ο
μπλόκου της ακτίνης με τη δράση μιας πρω τεΊνης αποπολυμερισμού (πράσινο). Ο χωρο ταξικός διαχωρισμός της συναρμολόγησης α
ο
ο
πό την αποσυναρμολόγηση επιτρέπει στο δί
j
ο
κτυο ως σύνολο να προωθείται με σταθερή τα
Ι
χύτητα.
ο
ο
c.s
00
00
σύμπλοκο
πρωτείνη
ARP
αποπολυμερισμού
μονομερές ακτίνης
πρωτείνη καλύπτρας
νεια, κολ/ούν σε αυτήν: διαμεμβρανικές πρωτε1\ιες στην κυπαρική μεμβρά νη τους που ονομάΖονται IvτεγKp{νες
(integrins)
προσκολ/ώνται σε μόρια
του εξωκυπάριου στρώματος ή στην επιφάνεια ενός άλ/ου κυπάρου πάνω στο οποίο έρπει το μετακινούμενο κύπαρο. Στο μεταξύ, στην ενδοκυπάρια πλευρά της μεμβράνης του έρποντος κυπάρου, οι ιντεγκρίνες εμπυρηνώ νουν ή δεσμεύουν νημάτια ακτίνης, δημιουργώντας έτσι ένα ισχυρό αγκυρο
βόλιο για το σύστημα των νηματίων της ακτίνης μέσα στο έρπον κύπαρο (Ει κόνα
(Α)
17-37). Για να χρησιμοποιήσει αυτό το αγκυροβόλιο και να παρασύρει
~
10
μm
Εικόνα 17·37. Ενδοκυπάριες δεσμίδες νηματίων της ακτίνης και εξωκυπάρια συγκόλληση. Στο (Α), έχει χρησιμοποιηθεί ένα οmικό τέ χνασμα για ν' αναδειχθούν οι στενές επαφές (σκοτεινές κηλίδες) ανάμεσα σε μια ινοβλάστη και στο γυάλινο πλακίδιο στο οποίο επικάθεται. (Β) Η χρώση (μετά από μονιμοποίηση) του ίδιου κυπάρου με φθορίζοντα αντισώματα εναντίον της ακτίνης δείχνει ότι τα περισσότερα δε μάτια των νηματίων της ακτίνης του κυπάρου καταλήγουν σε αυτά τα σημεία επαφής ή κοντά σε αυτά. (Ευγενική προσφορά του
Ireland).
742
Κεφάλαιο 17: Κυτταροσκελετός
Grenham
το σώμα του προς τα εμπρός, το κύπαρο εκμεταλ/εύεται και εσωτερικές συ
Ερώτηση
οιολές, ώοιε να δημιουργηθεί μια δύναμη προώθησης (Εικόνα
17-6
Οι
Υποθέοιε όη τα μόρια ακιί
συοιολές αυτές επίσης εξαρτώνΙαι από ων ακιίνη, αλλά με διαφορετικό φό
νης ενός δερμαπκού κυπά
πο: μέσω ως αλληλεπίδρασης των νημοιίων ως ακτίνης με κινητήριες πρω
ρου σε καλλιέργεια έχουν
τεΊνες που ονομάΖΟνΙαι μυοσίνες
σημανθεί κοιά τέτοιο φόπο
17-33).
(myosins).
Δεν είναι ακόμα γνωοιό πώς ακριβώς παράγεται αυτή η δύναμη προώ
ώοιε ένα μόριο ανά
10,000
•,
θησης: υπεύθυνη πιθανόν είναι η συοιολή των δεσμίδων των νημοιίων ως
να φέρει μια φθορίΖουσα
ακτίνης του κυπαροπλάσματος ή η συοιολή του πλέγματος ως ακτίνης του
χρωοιική. Τι πιοιεύετε όη θα βλέποιε αν
κυπαρικού φλοιού ή και τα δύο. Ωοιόσο, όπως θα δούμε ευθύς αμέσως, οι
εξετάΖοιε το ελασματοπόδιο (προπορευ
γενικές αρχές του φόπου με τον οποίο αλ/ηλεπιδρούν οι κινηΤήριες πρω
όμενο άκρο) αυτού του κυπάρου σ' ένα
τεΊνες ως μυοσίνης με τα νημάηα ως ακτίνης για να προκαλέσουν κίνηση εί
μικροσκόπιο φθορισμού; Υποθέοιε όη
ναι γνωοιές.
το μικροσκόπιο έχει επαρκή ευαισθησία για ων ανίχνευση μεμονωμένων μορίων
Η ακτίνη διασυνδεέταl με τη μυοσίνη ΚΟ1 σχηματίΖει
που φθορίΖουν.
συmαλΙ1κές δομές Όλες οι κινηΤήριες πρωτεΊνες που εξαρτώνΙαι από ων ακτίνη ανήκουν
οιην οικογένεια ως μυοσίνης. Προσδένουν και υδρολύουν ΑΤΡ, το οποίο παρέχει ων ενέργεια για να κινηθούν κοιά μήκος των νημοιίων ως ακιίνης,
από το πλην άκρο του νημοιίου προς το συν άκρο. Η μυοσίνη μαΖί με ων α κτίνη ανακαλύφθηκαν πρώτα οιους σκελεηκούς μυς και πολ/ές από ης γνώ σεις μας για ων αλληλεπίδραση αυτών των δύο πρωτεϊνών προέΡΧΟνΙαι από μελέτες των σκελεηκών μυών. Στα κύπαρα υπάρχουν πολ/ά διαφορεηκά εί δη μυοσίνης, από τα οποία πιο άφθονα είναι εκείνα που ανήκουν οιις υπο οικογένειες της μυοσίvnς Ι και ως μυοσίvnς ΙΙ. Η μυοσίνη Ι βρίσκεται σε όλα
τα είδη των κυπάρων, έχει απλούοιερη δομή και μηχανισμό δράσης και θ' α
ναφερθούμε πρώτα σ' αυτήν. Τα μόρια ως μυοσίνης-Ι έχουν μόνο μια κεφαλή και μια ουρά (Εικόνα
17-
38Α). Η περιοχή ως κεφαλής αλληλεπιδρά με τα νημάηα ως ακιίνης και υ δρολύει το ΑΤΡ: αυτό παρέχει οιο μόριο ως μυοσίνης ω δυνατότητα να μετα κινείται κατά μήκος του νηματίου, ακολουθώνΙας έναν κύκλο πρόσδεσης, α
πελευθέρωσης και επαναπρόσδεσης. Η ουρά ποικίλει οια διάφορα είδη ως μυοσίνης και καθορίζει ποιο κυπαρικό συοιαηκό θα παρασυρθεί από τον κι νητήρα. Για παράδειγμα, η ουρά μπορεί να προσδεθεί σ' ένα συγκεκριμένο εί δος μεμβρανικού κυοιιδίου και να το προωθήσει μέσα οιο κύπαρο κατά μή κος των φοχιών που δημιουργούν τα νημάπα ως ακιίνης (Εικόνα
17-388), ή
οιην κυπαρική μεμβράνη και να τη μετακινήσει σε σχέση με τα νημάηα της α
κιίνης του φλοιού και, έιοι, να την παραμορφώσει ή να της δώσει ένα διαφο ρετικό σχήμα (Εικόνα
17-38Γ).
Η διάταξη των ινιδίων ακτίνης ελέγχετΟ1 από εξωκυπάρια σήματα Σης προηγούμενες παραγράφους εξετάσαμε πώς οι πρωτεΊνες που προσδένουν ακτίνη ρυθμίΖουν το μήκος, ων ενΙόπιση, ων οργάνωση και ω δυναμική συμπεριφορά Των ινιδίων ως ακιίνης. Η δράση αυτών των επικου-
Νημάτια Ακτίνης
743
Εικόνα
17-38.
Η βραχεία ουρά ενός μορίου
(Α)
μυοσίνης Ι περιέχει θέσεις πρόσδεσης για
μuοσίνη Ι ~70nm-+l
πολλά κυπαρικά συστατικά και για μεμβρά νες. (Α) Η μυοσίνη Ι έχει μια σφαιρική κεφαλή και μια ουρά που προσδένεται σ' ένα άλλο μό
ριο ή οργανίδιο του κυπάρου. Με αυτό τον τρόπο, η κεφαλή μετακινεί ένα κυστίδιο κατά μήκος ενός ινιδίου ακτίνης
(6),
ή ένα ινίδιο α
κτίνης σε σχέση με την κυπαρική μεμβράνη (η. Παρατηρείστε ότι σε κάθε περίmωση που απεικονίζεται εδώ, η κεφαλή της μυοσίνης «βαδίζει» προς το συν άκρο του νηματίου της
ακτίνης με το οποίο εφάmεται.
μuοσίνη Ι
KUΠαΡΙKή μεμβράνη
ρικών πρωτεϊνών ρυθμίΖετOl από εξωκυπάρια σήματα κοι επιτρέπει
mo κύτ
ταρο ν' αναδlOτάσσεl τον κυπαροσκελετό του απαvτώvτας σ' ερεθίσματα α πό το περιβάλλον του.
Οι δομικές αναδlOτάξεlς του κυτταροσκελετού της ακτίνης πυροδοτού vτol από Την ενεργοποίηση ποικίλων υποδοΧέων ενσωματωμένων ταρική μεμβράνη. Όλα τα σήματα φαίνετOl όl1 συγκλίνουν
mo
mnv κυτ
εσωτερικό
του κυττάρου προς μlO ομάδα mενά σχεl1Ζόμενων πρωτεϊνών που προσδέ
νουν
GTP, οι οποίες απαρτίΖουν την οικογένεια πρωτεϊνών Rho. Όπως εί δαμε mo ΚεφάλαlO 16, οι πρωτε'ίνες αυτού του είδους συμπερlφέροvτOl σαν
μορlOκοί «δlOκόπτες» που ελέγχουν διάφορες κυπαρlκές διεργασίες μεταπί πτovτας από μlO ενεργό κατάmαση νεργό κατάmαση
-
-
προσδεδεμένες με
προσδεδεμένες με
GDP -
GTP -
σε μlO ανε
κοι το αvτίmροφο (βλ. Εικόνα
16-15Β). ΣΤην περίπτωση του κυπαροσκελετού, η ενεργοποίηση δlOφορεη κών μελών Της οικογένεlOς
Rho επηρεάΖει
την οργάνωση των ινιδίων της α
κτίνης με δlOφορεl1κό τρόπο. Γιο παράδειγμα, η ενεργοποίηση της G-πρω τείνης
Cdc42 πυροδοτεί τον πολυμερlOμό
της ακτίνης κοι το σχημαl1σμό δε
σμών ώmε να δημlOυργηθούν lνοπόδlO, ενώ η ενεργοποίηση Της G-πρω τείνης
Rac προάγει
διπλώσεων (Εικόνα
τον σχημαl1σμό ελασματοποδίων κοι μεμβρανlκών ανα
17-39).
Αυτές οι εVΤυπωσlOKές και περίπλοκες δομικές αλλαγές συμβαίνουν ε πειδή καθένας από αυτούς τους μορlOκούς διακόπτες αλληλεπιδρά με πολ λές πρωτεΊ'νες-mόχους, μεταξύ άλλων πρωτεϊνικές κινάσες όπως επίσης και επικουρικές πρωτεΊ'νες που ελέγχουν την οργάνωση και τη δυναμική της α κτίνης. Για παράδειγμα, η ενεργοποίηση της
Cdc42 επαυξάνει Την ικανόΤητα
των συμπλόκων
mo σύμπλοκο
ARP να εμπυρηνώνουν ακτίνη. Η εμπυρήνωση της ακτίνης ARP επίσης αυξάνει από την πρωτε'ίVη Rac, η οποία επιπλέον
προάγει Την αφαίρεση του καλύμματος από τα πλην άκρα των ινιδίων ακτί-
744
Κεφάλαιο 17: Κυτταροσκελετός
Εικόνα 17·39. Η ενεργοποίηση G-πρωτεϊνών έχει σοβαρές επιπτώσεις στην οργάνωση των ινιδίων της ακτίνης στις lνοβλάστες. Σε αυτές τις μικρογραφίες η ακτίνη έχει χΡωσθεί με φαλλο'ίδίνη, ένα φθορίζον μόριο που προσ
δένεται σε ινίδια ακτίνης. (Α) Σε ινοβλάστες που βρίσκονται σε κατάσταση ηρεμίας, τα ινί δια ακτίνης εντοπίζονται κυρίως στον φλοιό. (Α) κύπαρα σε ηρεμία
(6) ενεργοποίηση της Rac
(η ενεργοποίηση της
Cdc42
(8) Η μικροένεση
στο κύπαρο μιας ενεργοποι
ημένης μορφής της μικρής, μονομερούς
πρωτεΤνης
Rac προκαλεί τον σχηματισμό
G
ενός
τεράστιου ελασματοποδίου που εκτείνεται α
νης. Αυτό προσφέρει επιπρόσθετες θέσεις για συναρμολόγηση ακτίνης στην
πό ολόκληρη την περίμετρο του κυπάρου. (η Η μικροένεση μιας ενεργοποιημένης μορφής
κυπαρική μεμβράνη, γεγονός που προάγει τον σχηματισμό μεγάλων ελα
της συγγενούς πρωτεΤνης
σματοποδίων.
σχηματισμό πολλλών μακριών ινοποδίων στην
Μια από τις πιο ελεγχόμενες αναδιατάξεις των στοιχείων του κυπαροσκε
Cdc42 προκαλεί τον
περιφέρεια του κυπάρου. (Από: Α.
Hall, Sci-
ence 279:509-514,1988. © AAAS).
λετού συμβαίνει όταν η ακτίνη αλ/ηλεπιδρά με τη μυοσίνη στις μυϊκές ίνες σε απάντηση προς σήματα από το νευρικό σύστημα. Στη συνέχεια θα εξετάσουμε πώς αυτή η μοριακή αλληλεπίδραση δημιουργεί τις ταχείες, επαναληπτικές, Ζωηρές κινήσεις που χαρακτηρίΖουν τη συστολή των μυών στα σπονδυλωτά. Ερώτηση
Μυϊκή συστολή
17-7
Στο οδηγό άκρο ενός έρπο
•,
Η μυϊκή συστολή είναι η πιο γνωστή και κατανοητή από τις κινήσεις των
ντος κυπάρου, τα συν άκρα
Ζωικών κυπάρων. Στα σπονδυλωτά, το τρέξιμο, το βάδισμα, το κολύμπι και
των νηματίων της ακτίνης εί
το πέταγμα εξαρτώνται από την ικανότητα των σκεΛεπκών μυών να συστέλ
ναι προσκολλημένα
λονται ισχυρά και να μετακινούν διάφορα οστά. Οι ακούσιες κινήσεις, όπως
κυπαρική μεμβράνη και τα
η άντληση της καρδιάς και η περισταλτική κίνηση του εντέρου βασίζονται α
μονομερή της ακτίνης προ
ντίστοιχα στον κaρδΙQκό μυ και στους Λείους μυς, οι οποίοι σχηματίΖονται α
στίθενται στα άκρα αυτά ωθώντας τη μεμ
στην
πό μυϊκά κύπαρα με διαφορετική δομή από αυτήν των σκελετικών μυών, αλ
βράνη προς τα έξω, με αποτέλεσμα να
λά χρησιμοποιούν την ακτίνη και τη μυοσίνη με παρόμοιο τρόπο για τη συ
σχηματίΖΟνται ελασματοπόδια και φιλο
στολή τους. Μολονότι τα μυϊκά κύπαρα είναι πολύ εξειδικευμένα, πολ/ές
πόδια. Τι νομίΖετε ότι συγκρατεί τα νημά
κυπαρικές κινήσεις - από τη μετακίνηση ολόκληρων κυπάρων έως την κίνη
τια στα άλλα άκρα τους και τα εμποδίΖει
ση των ενδοκυπάριων συστατικών
να προωθηθούν προς το εσωτερικό του
-
εξαρτώνται από την αλληλεπίδραση α
κτίνης-μυοσίνης. Πολ/ές από τις γνώσεις μας για τους μηχανισμούς των κυτ
κυπάρου;
ταριKών κινήσεων προήλθαν από μελέτες της συστολής των μυϊκών κυπά
ρων. Στις επόμενες παραγράφους θα εξετάσουμε πώς αλ/ηλεπιδρούν η α κτίνη και η μυοσίνη για να δημιουργήσουν κίνηση.
Η μυϊκή συστολή βασίΖεται σε δέσμες ακιίνnς και μυοσίνnς Η μυοσίνη των μυών ανήκει στις μυοσίνες της υΠΟΟ1κογένειας της μυοσί νης ΙΙ και έχει δύο κεφαλές με δράση ΑΤΡάσης και μια επιμήκη ραβδόμορ φη ουρά (Εικόνα 17-40Α). Η μυοσίνη ΙΙ σχηματίΖει συσταλτικές δομές με τα νημάτια της ακτίνης: οι πιο γνωστές και άφθονες υπάρχουν στα μυϊκά κύπα
ρα, αλλά βρίσκονται επίσης και σε πολ/ά είδη Ζωικών κυπάρων. Κάθε μόριο μυοσίνης-ΙΙ είναι διμερές και αποτελείται από ένα Ζεύγος πανομοιότυπων μορίων μυοσίνης που συγκρατούνται από τις ουρές. Έχει δύο σφαιρικές κε φαλές με δράση ΑΤΡάσης στο ένα άκρο και μια απλή ουρά με δομή σπειρο-
Μυϊκή Συστολή
745
Εικόνα 17·40. Μόρια μυοσίνης 11 συνδέονται μεταξύ τους και σχηματίζουν ινίδια μυοσί νης. (Α) Η μυοσίνη
11 αποτελείται
από ένα ζεύ
γος πανομοιότυπων μορίων μυοσίνης και έτσι έχει δύο κεφαλές και μια ουρά σπειροειδούς σπειράματος.
(8)
Οι ουρές της μυοσίνης
11 δια
συνδέονται και σχηματίζουν ένα ινίδιο μυοσί
(Α)
μόριο μυοσίνης
2:.
I1
7
κεφαλή
ουρα
~14----
150 nm
---_~I
νης από το οποίο προεξέχουν οι κεφαλές. Η γυμνή περιοχή στο μέσο του ινιδίου αποτελεί
(Β) νημάτιο μυοσίνης 11
γυμνή περιοχή
1 μm
14
•,
Ερώτηση
κεφαλές μυοσίνης
_ι-I~~
ται μόνο από ουρές.
~I
ειδούς-σπειράματος στο άλ/ο άκρο. Σύμπλοκα μορίων μυοσίνης ΙΙ προσδέ
17-8
Τόσο ΤΟ παχιά όσο και ίΟ
νονται μετοξύ τους μέσω των σπειροειδών σπειραμάτων της ουράς τους,
λεπτά ινίδιο των μυών α
σχηματίΖοντας ένα vnμάπο μυοσίvnς στο οποίο οι κεφαλές προεξέχουν από
παρτίΖΟνται από υπομονά
τα πλάγια (βλ. Εικόνα
17 -40Β).
δες που συγκρατούνται με
Το νημάτιο της μυοσίνης είναι πολικό και μοιάΖει σαν βέλος με δύο αιχ
τοξύ τους με ασθενείς μη ο
μές, όπου οι δύο ομάδες των κεφαλών προσανατολίΖΟνται προς αντίθετες
μοιοπολικούς δεσμούς. Ά
κατευθύνσεις μακριά από το κέντρο. Η μια ομάδα των κεφαλών συνδέεται
ραγε πώς κατοφέρνουμε να σηκώνουμε
με τα νημάτια της ακτίνης με έναν προσανατολισμό και τα μετακινεί προς μια
βαριά αντικείμενα;
κατεύθυνση, ενώ η άλ/η ομάδα των κεφαλών προσδένεται σε άλ/α νημάτια ακτίνης με αντίθετο προσανατολισμό και τα μετακινεί προς την αντίθετη κα τεύθυνση (Εικόνα
17-41). Το
συνολικό αποτέλεσμα είναι η ολίσθηση αντί
θετα προσανατολισμένων νηματίων της ακτίνης μεταξύ τους. Επομένως, ό ταν τα νημάτια της ακτίνης και τα νημάτια της μυοσίνης συγκροτούνται σε δε
σμίδα, η δεσμίδα μπορεί να παράγει μια δύναμη συστολής. Αυτό παρατηρεί ίΟι πιο ευδιάκριτα κατά τη μυϊκή συστολή, αλ/ά συμβαίνει και στις δέσμες συστοi\nς
(contractile bundles) των νηματίων
της ακτίνης και της μυοσίνης
(βλ. Εικόνα 17-29Β) που συγκροτούνται παροδικά σε μη μυϊκά κύπαρα και στον δaκτύΛlΟ συσrοi\nς
(contractile ring)
που κόβει ένα διαιρούμενο κύπα
ρο στα δύο με συσταλτικές κινήσεις και τράβηγμα προς ίΟ μέσα της κυπαρι κής μεμβράνης (αναφέρεται στο Κεφάλαιο
19).
Κα1ά 1η διάρκεια 1ης μυϊκής συστολής 1α ινίδια 1ης αΚ1ίνης
ολισθαίνουν πάνω στα ινίδια 1ης μυοσίνης Οι επιμήκεις ίνες του σκελετικού μυός είναι τεράστια απλά κύπαρα που
Εικόνα
17-41.
Μικρά δίπολα ινίδια που απο 11 προκαλούν
τελούνται από μόρια μυοσίνης
διολίσθηση των νηματίων της ακτίνης μετα
μυοσίνη ιι
ξύ τους, επιτυγχάνοντας έτσι τη βράχυνση των δεσμίδων που αποτελούνται από νημά τια ακτίνης. Η κεφαλή της μυοσίνης
11
βαδίζει
προς το συν άκρο του ινιδίου της ακτίνης με το οποίο εφάmεται.
746
Κεφάλαιο 17: Κuτταροσκελετός
κυπαρική μεμβράνη
(Α)
μυ'ίκό ινίδιο
σαρκομερίδιο
Εικόνα
17·42. Ένα
σαρκομερίδιο
σκελετικό μυϊκό κύπαρο. (Α) Σ' έναν ενήλικο άνθρωπο αυτά τα τεράστια πολυπύρηνα κύπαρα (ονομάζονται επίσης μυ"ί
κές ίνες) τυπικά έχουν διάμετρο
50
μm και μήκος μερικών εκατοστών, Περιέχουν πολλαπλά μυϊκά ινίδια στα οποία τα νημάτια της ακτίνης και
της μυοσίνης είναι διευθετημένα σε μια πολύ οργανωμένη δομή η οποία προσδίδει στο ινίδιο μια ραβδωτή ή γραμμωτή εμφάνιση. (Β) Ηλε κτρονιομικρογραφία μικρής μεγέθυνσης μιας διατομής κατά μήκος ενός σκελετικού μυ'ίκού κυπάρου ενός κουνελιού, στην οποία φαίνεται η συμμετρική οργάνωση των σαρκομεριδίων που αποτελούν τις συσταλτικές μονάδες των μυ'ίκών ινιδίων, (Β, με την άδεια του
Roger Craig) ,
σxηματίσrηKαν κατά τη 'διάρκεια της ανάπτυξης από τη σύντηξη πολ/ών μι κρότερων κυπάρων. Οι πυρήνες των κυπάρων που συμμετέχουν διατηρού νται σrη μυϊκή ίνα και τοποθετούνται κάτω ακριβώς από την κυπαρική μεμ
βράνη. Ο κύριος όγκος του κυπαροπλάσματος αποτελείται από μυϊκά lVlOlG
(myofibrils), τα
σroιxεία της συσroλής του μυϊκού κυπάρου. Αυτές οι κυλιν
δρικές δομές έχουν διάμετρο
1-2 μm και μήκος
όσο το μυϊκό κύπαρο (Εικό
να 17-42Α). Ένα μυϊκό ινίδιο αποτελείται από μια αλυσίδα παρόμοιων λεmών μονά
δων συσroλής που αποκαλούνται σαρκομερίδια ρίδιο έχει μήκος περίπου
2.5 μm.
(sarcomeres). Κάθε σαρκομε
Η συμμετρική διάταξη σε μια αλυσίδα προσ
δίδει σrα μυϊκά ινίδια των σπονδυλωτών μια ραβδωτή ή γραμμωτή εμφάνιση (Εικόνα
17-428). Τα σαρκομερίδια
δίσκος Ζ
είναι συγκροτήματα με υψηλή οργάνωση
που αποτελούνται από δύο είδη ινιδίων: τα ινίδια της ακτίνης και τα ινίδια της ειδικής μυϊκής μυοσίνης
11. Τα
ινίδια της μυοσίνης (χοvrρά ιvfδιa) είναι τοπο
θετημένα σro κέντρο κάθε σαρκομεριδίου, ενώ τα λεmότερα ινίδια της ακτίνης
(Λεmά ιvfδιa) εκτείνονται προς τα μέσα από τα άκρα του σαρκομεριδίου όπου αγκυροβολούν με τα συν άκρα τους σε μια δομή που είναι γνωστή ως δισκος Ζ και επικαλύmουν τα άκρα των ινιδίων της μυοσίνης (Εικόνα
Εικόνα
17·43. Σαρκομερίδια.
(Α) Λεmομέρεια του σκελετικού μυ'ίκού κυπάρου της
προηγούμενης φωτογραφίας, στην οποία φαίνονται δύο μυϊκά ινίδια και σημειώνεται η έ
κταση δύο σαρκομεριδίων. (Β) Σχηματική απεικόνιση ενός σαρκομεριδίου όπου φαίνο νται οι φωτεινές και σκοτεινές ζώνες που παρατηρούνται στο μικροσκόπιο. Σε κάθε άκρο του σαρκομεριδίου δημιουργείται η γραμμή Ζ που αντιπροσωπεύει σημεία προσκόλλη σης των νηματίων της ακτίνης. Καθένα από τα χοντρά νημάτια που βρίσκονται στο κέ ντρο αποτελείται από πολλά μόρια μυοσίνης
(Α)
17-43).
11. (Α. Ευγενική προσφορά του Roger Craig).
..
ιιι:
σαρκομερίδιο ~
2.2 mm
~=~ Ι
Ι
δίσκος Ζ
δίσκος Ζ
χοντρό νημάτιο μυοσίνης λεmό νημάτιο ακτίνης
-------
(Β)
Μυϊκή Συστολή
747
(Β)
Εικόνα 17-44. Το μοντέλο του ολισθαίνοντος νηματίου της μυϊκής συστολής. (Α) Τα νημάτια της ακτίνης και της μυοσίνης ενός σαρκομε ριδίου επικαλύmονται και έχουν ίδια σχετική πολικότητα στις δύο πλευρές της μέσης γραμμής. Θυμηθείτε ότι τα νημάτια της ακτίνης είναι προσκολλημένα με τα συν άκρα τους στο δίσκο Ζ και ότι τα νημάτια της μυοσίνης είναι διπολικά. (8) Κατά τη διάρκεια της συστολής, τα νη μάτια της ακτίνης και της μυοσίνης ολισθαίνουν χωρίς να βραχύνονται. Η κίνηση ολίσθησης προωθείται από τις κεφαλές της μυοσίνης που προχωρούν προς το συν άκρο του γειτονικού νηματίου της ακτίνης.
Η συστολή ενός μυϊκού κυπάρου οφείλεται στην ταυτόχρονη βράχυνση
όλων των σαρκομεριδίων, η οποία προκαλείται από την ολίσθηση των ινι δίων της ακτίνης πάνω στα lνίδια της μυοσίνης, χωρίς μεταβολή του μήκους των δύο ινιδίων (Εικόνα
17-44). Η κίνηση της ολίσθησης
δημιουργείται από
τις κεφαλές της μυοσίνης που προεξέχουν από τα πλάγια του νηματίου της μυοσίνης και αλ/ηλεπιδρούν με γειτονικά lνίδια της ακτίνης. Όταν ένας μυς
διεγείρεται ώστε να συσταλεί, οι κεφαλές της μυοσίνης αρχίΖουν να «περπα τούν» κατά μήκος του ινιδίου της ακτίνης με επαναλαμβανόμενους κύκλους προσκόλ/ησης και αποκόλ/ησης. Η συνδυασμένη αυτή δράση έλκει τα lνί δια της ακτίνης και της μυοσίνης να μετακινηθούν αντίθετα το ένα πάνω στο άλ/ο, προκαλώντας τη συστολή του σαρκομεριδίου. Μετά την ολοκλήρωση της συστολής, οι κεφαλές της μυοσίνης Χάνουν τελείως την επαφή τους με τα νημάτια της ακτίνης και ο μυς χαλαρώνει.
•,
Epώmσn
17-9
Κατά τη διάρκεια κάθε κύκλου προσκόλ/ησης και αποκόλ/ησης, μια κε
Να συγκρίνετε τη δομή των
φαλή μυοσίνης προσδένει και υδρολύεl ένα μόριο ΑΤΡ. Θεωρείται ότι αυτό
ενδιάμεσων ινιδίων με τη
προκαλεί μια σειρά αλ/αγών διαμόρφωσης του μορίου της μυοσίνης που με
δομή των ινιδίων της μυοσί
τακινούν το άκρο της κεφαλής κατά μήκος του νηματίου της ακτίνης προς το
νης-ΙΙ στα κύπαρα των σκε
συν άκρο κατά
5 nm περίπου.
Αυτή η κίνηση, που επαναλαμβάνεται σε κάθε
λετικών μυών. Ποιες είναι
κύκλο υδρόλυσης του ΑΤΡ, προωθεί το μόριο της μυοσίνης προς μια κατεύ
ΟΙ κύριες ομοιότητες Ποιες
θυνση κατά μήκος του ινιδίου της ακτίνης (Εικόνα
17-45). Με τον τρόπο
αυ
είναι οι κύριες δlOφορές; Πώς σχετίΖΟ
τό οι κεφαλές της μυοσίνης έλκουν το ινίδιο της ακτίνης και προκαλούν την
νται αυτές οι διαφορές της δομής με τη
ολίσθησή του πάνω στο ινίδιο της μυοσίνης. Κάθε ινίδιο μυοσίνης έχει περί
λειτουργία τους
που
748
Κεφάλαιο 17: Κυτταροσκελετός
300 κεφαλές μυοσίνης και κάθε κεφαλή μυοσίνης μπορεί να πραγματο-
νημάτιο ακτίνης πλην
συν
άκρο
άκρο
ΠΡΟΣΚΟΜΗΣΗ: Στην αρχή του κύκλου που φαίνεται σε αυτή την εικόνα, μια κεφαλή μυοσίνης, χωρίς προσδεδε μένο νουκλεοτίδιο, είναι προσκολλημένη ισχυρά πάνω σ' ένα νημάτιο ακτίνης σε μια "άκαμmη» διαμόρφωση (ονομάζεται έτσι, επειδή είναι υπεύθυνη για τη μεταθανά τια ακαμψία, rigor mortis). Σ' έναν ενεργά συστελλόμενο μυ, αυτή η κατάσταση διαρκεί πολύ λίγο και λήγει αμέσως μετά την πρόσδεση ενός μορίου ΑΤΡ στη μυοσίνη
ΑΠΕΛΕΥΘΕΡΩΣΗ: Ένα μόριο ΑΤΡ προσδένεται στην ευρεία σχισμή, στο «πίσω» μέρος της κεφαλής (δηλαδή στην πλευρά που είναι πιο μακριά από το νημάτιο της ακτίνης) και αμέσως προκαλεί μια μικρή αλλαγή της διαμόρφωσης των περιοχών που προσδένονται στην ακτίνη. Αυτό μειώνει τη συγγένεια της κεφαλής για την ακτίνη και της επιτρέπει να κινηθεί κατά μήκος του νηματίου. (Στο σχέδιο η απόσταση μεταξύ της κεφαλής και της ακτίνης φαίνεται μεγάλη για να τονιστεί η αλλαγή, στην πραγματικότητα όμως η κεφαλή παραμένει πολύ κοντά στην ακτίνη)
ΑΝΟΡΘΩΣΗ: Η σχισμή κλείνει σαν στρείδι γύρω από το μόριο του ΑΤΡ, πυΡΟδοτώντας μια μεγάλη αλλαγή του σχήματος που προκαλεί τη μετατόπιση της κεφαλής κατά μήκος του νηματίου, αε μια απόσταση περίπου 5 nm. Το ΑΤΡ υδρολύεται, αλλά το ADP και ο Ρί που παράγονται, παραμένουν προσδεδεμένα στην πρωτεινη
ΠΑΡΑΓΩΓΗ ΕΝΕΡΓΕΙΑΣ: Η ασθενής πρόσδεση της κεφα λής και της μυοσίνης στη νέα θέση πάνω στο νημάτιο της ακτίνης προκαλεί απελευθέρωση του ανόργανου φωσφο ρικού που παράγεται από την υδρόλυση του ΑΤΡ και ταυτόχρονα η κεφαλή προσδένεται ισχυρά στην ακτίνη. Η απελευθέρωση πυροδοτεί μια ισχυρή ώθηση, δηλαδή παράγει ενέργεια, η οποία αλλάζει τη διαμόρφωση και η κεφαλή ανακτά την αρχική της δομή. Κατά τη διάρκεια της ισχυρής ώθησης, η κεφαλή χάνει το προσδεμένο ADP και έτσι επιστρέφει για ν' αρχίσει ένας νέος κύκλος
ΙΣΧΥΡΗ ΩΘΗΣΗ
πλην άκρο
Εικόνα
17-45. Ο
συν
άκρο
ΠΡΟΣΚΟΜΗΣΗ: Στο τέλος του κύκλου, η κεφαλή της μυοσίνης είναι πάλι προσκολλημένη ισχυρά στο νημάτιο της ακτίνης με μια άκαμπτη διαμόρφωση. Παρατηρείστε ότι η κεφαλή έχει μετακινηθεί σε μια νέα θέση πάνω στο νημάτιο της ακτίνης
κύκλος αλλαγών που προκαλεί το «βάδισμα« ενός μορίου μυοσίνης κατά μήκος ενός νηματίου ακτίνης.
ποιήσει πέvτε περίπου KύKiΊoυς ανά δευτερόiΊεπω, η δε ταΧύτητα της oiΊί σθησης των ινιδίων της μυοσίνης ως προς τα ινίδια της ακτίνης είναι περίπου
15 μm
ανά δευτερόiΊεπω. Η ταΧύτητα αυτή επαρκεί για τη μετάπτωση ενός
σαρκομεριδίου από την πiΊήρη xάiΊαση
(3
μm) στην πiΊήρη συστoiΊή
(2
μm)
σε χρόνο μικρότερο από ω ένα δέκαω ωυ δευτερoiΊέπωυ. ΌiΊα τα σαρκο μερίδια ενός μυός είναι ενωμένα μεταξύ ωυς και πυΡOδOωύVΤαι σχεδόν ταυτόχρονα από ένα σύστημα σημαωδότησης που περιγράφεται στο επόμε-
Μυϊκή Συστολή
749
νο τμήμα. Έιοι, ολόκληρος ο μυς συσrέλ/εται πάρα πολύ γρήγορα, συνή
θως σ' ένα δέκατο του δευτερολέπτου.
Η μυϊκή συστολή πυροδοτείται από μια αιφνίδια /ξ
αυ πσπ του
Ca2+
Η δύναμη που προκαλεί τη μοριακή αλληλεπίδραση ανάμεσα σrα ινίδια της μυοσίνης και της ακτίνης δημιουργείται μόνο όταν ο σκελετικός μυς δε Χθεί κάποιο σήμα από το νευρικό σύσrημα. Το σήμα από τη νευρική απόλη ξη πυροδοτεί ένα δυναμικό ενέργειας (αναφέρεται σro Κεφάλαιο
12)
σrην
κυπαρική μεμβράνη του μυϊκού κυπάρου. Αυτή η ηλεκτρική διέγερση διαδί
δεται μέσα σε xιλιoσrά του δευτερολέπτου σε μια σειρά μεμβρανικών σωλή νων που ονομάΖονται εγκάροια σωΛnνάρια
(transverse tubules)
και εκτείνο
νται από την κυπαρική μεμβράνη προς τα μέσα γύρω από κάθε μυϊκό ινίδιο. Στη συνέχεια, το ηλεκτρικό σήμα μεταφέρεται στο σαρκοπΛασματικό δικωο,
ένα παρακείμενο σύσrημα διασυνδεδεμένων και πεπλατυσμένων Kυσrιδίων που περιβάλλει κάθε μυϊκό ινίδιο σαν μια δικτυωτή κάλιοα (Εικόνα
17-46).
Το σαρκοπλασματικό δίκτυο είναι μια εξειδικευμένη περιοχή του ενδο πλασματικού δικτύου σrα μυϊκά κύπαρα που περιέχει πολύ υψηλή συγκέ ντρωση ασβεσrίoυ. Σε απάντηση προς την εισερΧόμενη ηλεκτρική διέγερση,
ένα μεγάλο ποσό του Ca + απελευθερώνεται σro κυπαροδιάλυμα μέσω ιο 2
ντικών διαύλων της μεμβράνης του σαρκοπλασματικού δικτύου οι οποίοι α νοίγουν απαντώντας σrην αλλαγή του δυναμικού της κυπαρικής μεμβράνης
(Εικόνα 17-47). Όπως αναφέρθηκε σro Κεφάλαιο 16, το Ca
2
+
χρησιμοποι
είται ευρύτατα ως ενδοκυπάριο σηματοδοτικό ιόν για την αναμετάδοση μη
νυμάτων από έξω, μέσα σro κύπαρο. Στον μυ το Ca
2
+
αλληλεπιδρά με έναν
μοριακό διακόπτη που αποτελείται από εξειδικευμένες βοηθητικές πρω-
KUΠαΡΙKή μεμβράνη
μυ'ίκό ινίδιο
δίαυλοι απελευ
θέρωσης Ca + 2
εγκάρσια σωληνάρια σχηματίζονται από εγκοεασμούς της KUΠαΡΙKής μεμβράνης Ο.5μm
σαρκοπλασματικό δίκτυο
Εικόνα 17-46. Τα εγκάρσια σωληνάρια και το σαρκοπλασμαTlκό δίκτυο. (Α) Σχέδιο των δύο μεμβρανικών συστημάτων που μεταδίδουν το σήμα για τη συστολή από την κυτταρική μεμβράνη του μυϊκού κυττάρου σε όλα τα μυ'ίκά ινίδια μέσα στο κύπαρο.
(8)
Ηλεκτρονιομικρογρα
φία στην οποία φαίνεται μια εγκάρσια διατομή δύο εγκάρσιων σωληναρίων και των γειτονικών διαμερισμάτων του σαρκοπλασματικού δι κτύου. (8, με την άδεια της Clara Franzini-Armstrong).
750
Κεφάλαιο 17: Κυτταροσκελετός
Εικόνα
ΑΥΛΟΣ ΤΟΥ ΕΓΚΑΡΣΙΟΥ
πρωτείνη ευαίσθητη στο δυναμικό
[
μεμβράνη
του διαύλου απελευ
2
ΣΩΛΗΝΑΡΙΟΥ (ΕΞΩΚΥΤΤΑΡΙΟΣ ΧΩΡΟΣ)
πολωμένη
17-47. Άνοιγμα
θέρωσης Ca + στη μεμβράνη του σαρκοπλα
++++
σματικού δικτύου από μια ευαίσθητη στο δυ
εκπολωμένη μεμβράνη του σωληναρίου
ναμικό διαμεμβρανlκή πρωτείνη του γειτονι κού εγκάρσιου σωληναρίου.
+++
--:':"'::-:-:::===~==~::"":'~
ΚΥΤΤΑΡΟΔΙλ/ΥΜΑ μεμβράνη
σαρκοπλα:
[
σματικου
.....-----1
δικτύου
ο 00 ο ο ο ο ο ο ο
δίαυλος απελευθέρωσηςCa2+0 ο ο
ο
ο
ο
ο
00000000 ΑΥΛΟΣΤΟΥ ΣΑΡΚΟΠΛΑΣΜΑΤιΚΟΥΔΙΚΤΥΟΥ
τεΙνες οι οποίες συνδέονταιισχυρά με τα ινίδlΟ της ακτίνης (Εικόνα 17 -48Α). Μια από αυτές τις πρωτεΊνες είναι η rροnομυοσ[vn, ένα άκαμπτο και ραβδό μορφο πρωτεϊνικό μόριο που προσδένεται στο αυλάκι της έλικας της ακτίνης
επικαλύπτοντας επτά μονομερή ακτίνης και εμποδίΖει τη σύνδεση των κεφα λών της μυοσίνης με τα ινίδlΟ της ακτίνης. Η άλ/η είναι η rρonovfvn, ένα
πρωτεϊνικό σύμπλοκο που περιλαμβάνει μια ευαίσθητη στο ασβέστιο πρω τεΊνη (rρonovfvn-C) η οποία δlΟσυνδέεται με το άκρο ενός μορίου τροπο μυοσίνης. 'Οταν αυξηθεί η συγκέντρωση του ασβεστίου στο κυπαροδιάλυμα,
το Ca
2
+
προσδένεται στην τροπονίνη και προκαλεί μlΟ αλ/αγή στο σΧήμα
της. Στη συνέχεlΟ αυτό προκαλεί μια ελαφρά μετατόπιση των μορίων της τρο πομυοσίνης επιτρέποντας σης κεφαλές της μυοσίνης να προσδεθούν στο ι
νίδιο της ακτίνης και ν' αρΧίσει η συστολή (Εικόνα
17-48Β).
Επειδή από την κυπαρική μεμβράνη το σήμα περνά (μέσω των εγκάρ σιων σωληναρίων και του σαρκοπλασματικού δικτύου) σε κάθε σαρκομερί διο του κυπάρου μέσα σε χιλιοστά του δευτερολέπτου, όλα τα μυϊκά ινίδlΟ
του κυπάρου συστέλ/ονται ταυτόχρονα. Η αύξηση του Ca
2
+
στο κυπαροδιά
λυμα σταματά αμέσως μετά τη δlΟκοπή του νευρικού σήματος, επειδή το
η θέση πρόσδεσης της μυοσίνης η τροπομυοσίνη παρεμποδίζει
ακτίνη
τροπομυοσίνη
τη θέση πρόσδεσης της μυοσίνης
ελευθερώνεται μετά τη μετακίνηση της τροπομυοσίνης με τη μεσολάβηση Ca2 +
σύμπλοκο τροπονίνης
10 nm
(Α)
Εικόνα
17-48. Ο έλεγχος
(Β)
της συστολής του σκελετικού μυός από την τροπονίνη. (Α) Ένα λεmό μυονημάτιο στο οποίο φαίνονται οι θέσεις
της τροπομυοσίνης και της τροπονίνης κατά μήκος του νηματίου της ακτίνης. Κάθε μόριο τροπομυοσίνης έχει εmά περιοχές με ομόλογες αλληλουχίες τοποθετημένες σε ίσες αποστάσεις. Πιστεύεται ότι καθεμιά συνδέεται με ένα μονομερές ακτίνης όπως φαίνεται στην εικόνα.
(8)
Σχεδιάγραμμα της εγκάρσιας διατομής ενός λεmού μυονηματίου που εικονογραφεί τη μικρή μετακίνηση της τροπομυοσίνης, η οποία
προκαλείται από την πρόσδεση του
Ca2+ στην τροπονίνη και επιτρέπει στις κεφαλές της μυοσίνης ν' αλληλεπιδρούν με την ακτίνη. Μυϊκή Συστολή
751
•,
Ερώmσn
17-10
Α. Θυμηθείτε από την Εικό
Ca2+ γρήγορα αντλείται πίσω στο σαρκοπλασματικό δίκτυο μέσω των πολυά ριθμων αντλιών ασβεστίου που βρίσκονται στη μεμβράνη του (αναφέρθηκε
17-48 ότι τα μόρια της
στο Κεφάλαιο 12). Μόλις η συγκέντρωση του Ca2+ επανέλθει στο επίπεδο
τΡοπονίνης είναι τοποθε
της ηρεμίας, τα μόρια της τΡοπονίνης και της τΡοπομυοσίνης επιστρέφουν
τημένα κατά μήκος ενός
στις αρχικές θέσεις τους, εμποδίΖουν την πρόσδεση της μυοσίνης και έτσι
ινιδίου της ακτίνης και ό
σταματούν τη συστολή.
να
τι σε κάθε έβδομο μόριο ακτίνης βρίσκεται και ένα μόριο τρο
Τα μυϊκά κύπαρα επιιελούν πολύ εξειδικευμένες
πονίνης. Πώς νομίΖετε ότι μπορούν να
λεlΙουργίες σΙο σώμα
τοποθετούνται τόσο συμμετρικά τα μό ρια της τΡοπονίνης; Τι συμπεραίνετε από αυτό για την πρόσδεση της τρο πονίνης στα ινίδια της ακτίνης;
Β. Τι νομίΖετε ότι θα συνέβαινε εάν ανα μείξετε ινίδια ακτίνης με: (α) μόνο τρο πονίνη, (β) μόνο τΡοπομυοσίνη ή (γ) τΡοπονίνη και τΡοπομυοσίνη και στη
συνέχεια προσθέσετε και μυοσίνη;
ΝομίΖετε ότι τα παραπάνω αποτελέ-
ξ
/
/
σματα ε αρτωνται απο το
Ca2+ ;
Αυτός ο εξαιρετικά εξειδικευμένος μηχανισμός της συστολής των μυϊκών κυπάρων πιστεύετια ότι εξελίΧθηκε από τις απλούστερες δεσμίδες συστολής των ινιδίων της μυοσίνης και της ακτίνης που βρίσκονται σε όλα τα ευκαρυω τικά κύπαρα. Η μυοσίνη-Π των μη μυϊκών κυπάρων ενεργοποιείται επίσης α
πό την αύξηση του Ca + στο κυπαροδιάλυμα, αλλά ο μηχανισμός ενεργο 2
ποίησης είναι αρκετά διαφορετικός. Η αύξηση του Ca 2 + οδηγεί στη φωσφο ρυλίωση της μυοσίνης Π, η οποία μεταβάλλει τη διαμόρφωση της μυοσίνης και της επιτρέπει ν' αλ/ηλεπιδράσει με την ακτίνη. Ένας παρόμοιος μηχανι
σμός ενεργοποίησης λειτουργεί στους Λείους μυς που υπάρχουν στα τοιχώ
ματα του στομάχου, του εντέρου, της μήτρας και των αρτηριών και σε πολ/ές άλλες δομές όπου απαιτούνται αργές συστολές αμείωτης έντασης. Οι συστο λές που παράγονται με αυτόν τον δεύτερο μηχανισμό είναι πιο αργές επειδή τα ενΖυμικά μόρια χρειάΖονται χρόνο ώστε να φτάσουν στις κεφαλές της μυοσίνης με διάχυση και να πραγματοποιήσουν τη φωσφορυλίωση ή την α
ποφωσφορυλίωση. Εντούτοις, επειδή αυτός ο μηχανισμός είναι λιγότερο ε ξειδικευμένος, έχει το πλεονέκτημα να προωθείται από ποικίλα εισερχόμενα
σήματα: έτσι, για παράδειγμα, η συστολή των λείων μυών πυροδοτείται από την αδρεναλίνη, τη σεροτονίνη, τις προσταγλανδίνες και πολ/ά άλλα εξω κυπάρια σήματα.
Εκτός από τους γραμμωτούς και τους λείους μυς, άλλα είδη μυών επιτε λούν ειδικές μηχανικές λειτουργίες στο σώμα. Ίσως ο πιο γνωστός από αυ
τούς τους μυς είναι το μυοκάρδιο, ο μυς που προωθεί την κυκλοφορία του αί ματος. Αυτό το αξιοσημείωτο όργανο συστέλλεται αυτόνομα χωρίς σταματη μό όλη τη Ζωή του οργανισμού (σ' έναν άνθρωπο περίπου 3 δισεκατομμύρια φορές). Έστω και λεπτές αλλαγές στην ακτίνη και τη μυοσίνη του μυοκαρδί
ου μπορεί να προκαλέσουν βαριά καρδιοπάθεια. Τα σαρκομερίδια των κυπάρων του σκελετικού μυός αντιπροσωπεύουν μια υπερβολική εξειδίκευση των βασικών συστατικών του κυπαροσκελετού
ενός ευκαρυωτικού κυπάρου. Στο Κεφάλαιο
18 εξετάΖουμε
μια λειτουργία
του κυπαροσκελετού με τόσο θεμελιώδη σημασία για όλα τα κύπαρα ώστε να δικαιολογεί ένα ολόκληρο κεφάλαιο: το μοίρασμα των συστατικών του κυπάρου σε δύο πανομοιότυπα σύνολα κατά τη διαδικασία της κυπαρικής διαίρεσης.
752
Κεφάλαιο 17: Κυτταροσκελετός
Βαοικέs έVVΟΙΕS •
Το κυπαρόπλασμα ενός ευκαρυωτικού κυπάρου mηρίΖεται και οργανώ νεται
mo χώρο
από τον κυπαροσκελετό που αποπλείται από τα ενδιάμε
σα ινίδια, τους μικροσωληνίσκους και τα ινίδια Της ακτίνης.
•
Τα ενδιάμεσα ινίδια είναι ανθεκτικά, ραβδόμορφα πολυμερή ινωδών πρωπϊνών που παρέχουν
ma
κύπαρα μηχανική ισχύ. Μερικά είδη βρί
σκονωι κάτω από Την πυρηνική μεμβράνη και σχημωίΖουντον πυρηνικό
υμένα, ενώ άλ/α είναι κατανεμημένασε όλο το κυπαρόπλασμα.
•
Οι μικροσωληνίσκοι είναι άκαμπτοι, κοίλοι σωλήνες που σχηματίΖονωι με πολυμερισμό των διμερών υπομονάδων Της τουμπουλίνης. Είναι πολωμέ νες δομές με ένα «πλην» άκρο που αυξάνει αργά και ένα «συν» άκρο που αυξάνει γρήγορα.
•
Οι μικροσωληνίσκοι εμπυρηνώνονωι και αναπτύσσονΙαι από κένΙρα ορ γάνωσης όπως το κενΙροσωμάτιο. Τα πλην άκρα των μικροσωληνίσκων είναι ενσωμωωμένα μέσα
•
mo κένΙΡΟ
οργάνωσης.
Πολ/οί από τους μικροσωληνίσκους ενός κυπάρου βρίσκονΙαι σε μια α mαθή, δυναμική κωάmαση κωά Την οποία μεωπίπτουν από μια φάση α
νάπτυξης σε μια φάση συρρίκνωσης. Οι μεταπτώσεις αυτές, που είναι yvωmές ως δυναμική αmάθεια, ελέγχονΙαι από Την υδρόλυση του που είναι συνδεδεμένο
•
GTP
ma διμερή της τουμπουλίνης.
Κάθε διμερές τουμπουλίνης έχει προσδεδεμένο ένα μόριο
GTP το οποίο GDP μετά Τη συναρμολόγηση Της τουμπουλίνης mo μικρο Η υδρόλυση του GTP μειώνει Τη συΥΥένεια Της υπομονάδας
υδρολύεται σε
σωληνίσκο.
με τις γεnονικές υπομονάδες Της, επομένως και Τη mαθερόΤητα του πολυ
μερούς, προκαλώνΙας Την αποσυναρμολόγησή του.
•
Οι μικροσωληνίσκοι mαθεροποιούVIαι από πρωπΊνες που καθηλώνουν το συν άκρο, μια διαδικασία που επηρεάΖει Τη θέση των μικροσωληνί σκων μέσα
mo
κύπαρο. Τα κύπαρα περιέχουν πολλές πρωπΊνες που
συνδέονΙαι με μικροσωληνίσκους οι οποίες mαθεροποιούν τους μικρο σωληνί~Koυς, τους διασυνδέουν με άλλα κυπαρικά διαμερίσματα και τους χρησιμοποιούν για εξειδικευμένες λεnουργίες.
•
Οι κινησίνες και οι δυνεΊνες είναι κινητήριες πρωτε'ίνες που χρησιμοποι ούν Την ενέργεια Της υδρόλυσης του ΑΤΡ για να μετακινηθούν προς μια ΚΩΙεύθυνση κωά μήκος των μικροσωληνίσκων. Μεωφέρουν ειδικά μεμ
βρανικά κυmίδια και άλ/α φορτία και με αυτόν τον φόπο συνΙηρούν Την οργάνωση του κυπαροπλάσματος
•
mo χώρο.
Τα μαmίγια και οι κροσσοί των ευκαρυωτών περιέχουν μια δέσμη
maeE-
ρών μικροσωληνίσκων. Η κίνησή τους προκαλείται από Την κάμψη των μι κροσωληνίσκων που προωθείται από μια κινητήρια πρωτεΊνη που ονομά Ζεται δυνε'ίνη των κροσσών.
•
Τα ινίδια Της ακτίνης είναι ελικοειδή πολυμερή μορίων ακτίνης. Είναι πιο εύκαμπτα από τους μικροσωληνίσκους και συχνά βρίσκονΙαι σε δέσμες ή σε δίκτυα που συνδέονΙαι με Την κυπαρική μεμβράνη.
•
Τα ινίδια Της ακτίνης είναι πολωμένες δομές με ένα άκρο που αυξάνει
Βασικές Έννοιες
753
γρήγορα και ένα άκρο που αυξάνει αργά. Η συναρμολόγηση και ο απο
πολυμερισμός τους ελέΥχονιοι από την υδρόλυση του ΑΤΡ το οποίο είναι ισχυρά συνδεδεμένο με κάθε μονομερές ακτίνης.
•
Η ποικιλία των σχημάτων και των λειτουργιών των ινιδίων της ακτίνης ε ξαρτάται από διάφορες πρωτε'ϊνες που προσδένουν ακτίνη. Αυτές οι πρω τε'ϊνες ελέγχουν τον πολυμερισμό των ινιδίων της ακτίνης, διασυνδέουν τα ινίδια σε χαλαρά δίκτυα ή άκαμπτες δέσμες, ΙΟ προσκολ/ούν στις μεμ βράνες ή μετακινούν ένα ινίδιο σε σχέση με ένα άλ/ο.
•
Οι μυοσίνες είναι κινητήριες πρωτε'ίνες που χρησιμοποιούν την ενέργεια της υδρόλυσης του ΑΤΡ για να κινηθούν κατά μήκος των ινιδίων της ακτί νης. Μεταφέρουν οργανίδια κατά μήκος της τροχιάς που ορίΖει ένα ινίδιο ακτίνης ή προκαλούν ολίσθηση μεταξύ γειτονικών ινιδίων της ακτίνης στις συσταλτικές δεσμίδες.
•
Ένα δίκτυο ινιδίων ακτίνης κάτω από την κυπαρική μεμβράνη, σχηματίΖει τον κυπαρικό φλοιό που είναι υπεύθυνος για το σχήμα και την κίνηση της
κυπαρικής επιφάνειας συμπεριλαμβανομένων και των κινήσεων που κά νει ένα κύπαρο όταν έρπει πάνω σε μια επιφάνεια.
•
Ποικίλες πρωτε'ϊνες που προσδένουν ακτίνη είναι απαραίτητες για την προώθηση του προπορευόμενου άκρου ενός κινητού κυπάρου, για την προσκόλ/ηση στο υπόστρωμα και για την έλξη του οπίσθιου άκρου του.
Όλες αυτές οι διεργασίες πυροδοτούνται από εξωτερικά ερεθίσματα που λειτουργούν μέσω μικρών G-πρωτεϊνών.
•
Στους μυς, τεράστιες συστοιχίες επικαλυπτόμενων ινιδίων ακτίνης και μυοσίνης δημιουργούν συστολές ολισθαίνοντας μεταξύ τους.
• Η συστολή πυροδοτείται από μια αιφνίδια αύξηση του Ca2+ του κυπαρο διαλύματος, η οποία, μέσω πρωτεϊνών που προσδένουν ασβέστιο, μειο φέρει το σήμα στο σύστημα της μυϊκής συστολής.
Βασικοί Όροι
754
Κεφάλαιο 17: Κυτταροσκελετός
δυναμική αστάθεια
κυπαρικός φλοιός
δυνε'ϊνη
κυπαροσκελετός
ελασματοπόδιο
μαστίγιο
ενδιάμεσο ινίδιο
μικροσωληνίσκος
ινίδιο ακτίνης
μυϊκό ινίδιο
ινοπόδιο
μυοσίνη
κεντρίδιο
οικογένεια πρωτεϊνών
κεντροσωμάτιο
πολικότητα
κινησίνη
πυρηνικός υμένας
κινητήρια πρωτε'ϊνη
σαρκομερίδιο
κροσσός
τουμπουλίνη
Rho
Ερωιήσειs Ερώτηση
στών διάχυσης σε μονάδες cmZΙSec είναι: 5 χ 10-6 για το μικρό μόριο, 5 χ 10-7 για το πρωτεϊνικό μόριο και 5 χ 10-8
17-11
για το κυστίδιο. Πόσο χρόνο θα χρειαστεί ένα μεμβρανικό
Ποιες από ης επόμενες προτάσεις είναι σωστές; Εξηγείστε
κυστίδιο για να φτάσει με απλή διάχυση στο άκρο ενός ά
την απάντησή σας.
ξονα μήκους
10 cm;
Α. Η κινησίνη μετακινεί ης μεμβράνες του ενδοπλασμαη
17-13
κού δικτύου κατά μήκος των μικροσωληνίσκων με απο
Ερώτηση
τέλεσμα το δίκτυο των σωλήνων του ΕΔ να επεκτείνεται
Γιατί τα ευκαρυωηκά κύτταρα (ιδίως τα Ζωικά) έχουν τόσο
σε ολόκληρο το κύτταρο.
μεγάλο και περίπλοκο κυτταροσκελετό; Να αναφέρετε ης
Β. Απουσία ακτίνης, τα κύτταρα μπορούν να σχηματίσουν
διαφορές μεταξύ βακτηρίων και Ζωικών κυττάρων που πι
μια λειτουργική μιτωηκή άτρακτο και να διαχωρίσουν
θανόν προέκυψαν κατά την εξέλιξη από την εμφάνιση με
τα χρωμοσώματά τους αλλά δεν μπορούν να διαιρε
ρικών ή όλων των συσταηκών του κυτταροσκελετού ενός
θούν.
σημερινού ευκαρυωηκού κυττάρου.
Γ. Τα ελασματοπόδια και τα φιλοπόδια είναι «αισθητήρες»
17-14
που προβάλ/ει το κύτταρο για να βρει σημεία προσκόλ
Ερώτηση
λησης στο υπόστρωμα πάνω στο οποίο έρπει στη συνέ
Εξετάστε τη δομή ενός ενδιάμεσου ινιδίου που φαίνεται
χεια.
στην Εικόνα
Δ. Το
GTP υδρολύεται
από την τουμπουλίνη για να προ
17-4. Το
ινίδιο αυτό έχει μια μοναδική πολι
κότητα. Μπορείτε να ξεχωρίσετε το ένα άκρο από το άλ/ο, με χημικά ή άλ/α μέσα; Να εξηγήσετε την απάντησή σας.
κληθεί η κάμψη του μαστιγίου.
Ε. Κύτταρα με δίκτυο ενδιάμεσων ινιδίων που δεν μπορεί
ν' αποπολυμεριστεί είναι καταδικασμένα να πεθάνουν. Ζ. Τα συν άκρα των μικροσωληνίσκων αυξάνουν ταχύτερα επειδή περιέχουν μεγαλύτερο κάλυμμα
Ερώτηση
17-15
Γιατί δεν υπάρχουν κινητήριες πρωτεΤνες οι οποίες να κι νούνται πάνω σε ενδιάμεσα ινίδια;
GTP.
Η. Τα εγκάρσια σωληνάρια των μυϊκών κυττάρων είναι
17-16
μια προέκταση της κυτταρικής μεμβράνης, της οποίας
Ερώτηση
αποτελούν συνέχεια. Παρομοίως, το σαρκοπλασμαη
Όταν τα κύτταρα εισέρχονται στη μίτωση, η υπάρχουσα
κό δίκτυο είναι μια προέκταση του ενδοπΛασμαηκού
διάταξη των μικροσωληνίσκων του κυτταροπλάσματος
δικτύου.
πρέπει να σπάσει γρήγορα και ν' αντικατασταθεί από τη μι
Θ. Η μετακίνηση της μυοσίνης πάνω στα νημάηα της ακτί
τωηκή άτρακτο που σχηματίΖεται για να διαχωρίσει τα χρω
νης σε μερικές περιπτώσεις πυροδοτείται από τη φω
μοσώματα στα δύο θυγατρικά κύτταρα. Το ένΖυμο κατανί
σφορυλίωση της τροπονίνης και σε άλλες από την
νη
,
προσ
δ
εση του
Ca2+ στην τροπονινη. ,
(katanin),
που πήρε το όνομά του από τα σπαθιά των
ΓιαπωνέΖων σαμουράι και ενεργοποιείται κατά την έναρξη της μίτωσης, τεμαχίΖει τους μικροσωληνίσκους σε μικρά
Ερώτηση
17-12
κομμάηα. Ποια νομίΖετε πως θα είναι η τύχη των τεμαχι
Ο μέσος χρόνος που χρειάΖεται ένα μόριο ή ένα οργανί
δίων των μικροσωληνίσκων που δημιουργούνται από την
διο για να διανύσει με διάχυση μια απόσταση Χ εκατοστών
κατανίνη; Να εξηγήσετε την απάντησή σας.
του μέτρου δίνεται από τη σχέση:
t"'" x2I2D όπου,
t είναι
Ερώτηση
ο χρόνος σε δευτερόλεπτα και
D είναι
μια
17-17
Το φάρμακο ταξόλη
(taxol)
εκχυλίΖεται από το φλοιό των
σταθερά για το μόριο ή το σωματίδιο που ονομάΖεται συ
δένδρων του τάξου και έχει αντίθετη δράση από την κολχι
ντελεστής διάχυσης. Χρησιμοποιώντας την παραπάνω
κίνη, ένα αλκαλοειδές του φθινοπωρινού κρόκου (Ζαφο
σχέση, να υπολογίσετε το χρόνο που χρειάΖεται ένα μικρό
ρά). Η ταξόλη προσδένεται ισχυρά στους μικροσωληνί
μόριο, μια πρωτεΊνη και ένα μεμβρανικό κυστίδιο για να
σκους και τους σταθεροποιεί. Όταν προστίθεται στα κύττα
διανύσει με διάχυση την απόσταση των
από το ένα
ρα προκαλεί τη συναρμολόγηση της ελεύθερης τουμπου
άκρο ενός κυττάρου στο άλ/ο. Οι συνήθεις ημές συντελε-
λίνης σε μικροσωληνίσκους. Αντίθετα, η κολχικίνη εμπο-
1Ο μm
Ερωτήσεις
755
δίΖει το σχημαησμό των μικροσωληνίσκων. Η τοξόλη είναι
Γ
το ίδιο κατοστροφική για ΤΟ διαιρούμενα κύπαρα όσο και η κοίΊχικίνη. Και οι δύο χρησιμοποιούνται ως ανηκαρκινι κά φάρμακα. ΒασΙΖόμενοι σης γνώσεις σας για τη δυναμι
κή των μικροσωληνίσκων, να προτείνετε για ποιο λόγο και
ΤΟ δύο φάρμακα είναι τοξικά για ΤΟ διαιρούμενα κύπαρα παρά ης αντίθετες δράσεις τους. Α
!ι
r---ι
Ερώτηση
17-18 χρόνος στους 37"C
Μια χρήσιμη τεχνική για τη μελέτη της κίνησης των μικρο
σωληνίσκων είναι να προσκολλήσουμε ης κινητήριες
Εικόνα Ε17-19
πρωτε'ϊνες με ης ουρές τους σ' ένα γυάλινο αντικειμενο φόρο πλακίδιο (αυτό γίνετοι πολύ εύκολα, επειδή οι ου ρές κολ/ούν πολύ εύκολα σε μια γυάλινη καθαρή επιφά
κόνων και να προτείνετε πιθανές εξηγήσεις για ης διαφο
νεια) και μετά να εναποθέσουμε τους μικροσωληνίσκους
ρές που παρατηρείτε.
πάνω σης κινητήριες πρωτε'ϊνες. Στη συνέχεια μπορούμε
να παρατηρήσουμε τους μικροσωληνίσκους στο φωτονι
Ερώmση 17-21
κό μικροσκόπιο, καθώς προωθούνται πάνω στη γυάλινη
Η μετοκίνηση των ινοβλαστών σε καλ/ιέργεια σταματά α
επιφάνεια από ης κεφαλές των κινητήριων πρωτεϊνών.
μέσως μετά την προσθήκη της κυτοχαλασίνης ενώ η κολ
Εφόσον όμως οι κινητήριες πρωτε'ϊνες προσκολ/ώνται
χικίνη εμποδίΖει ης ινοβλάστες να κινηθούν προς μια κα
στο γυάλινο πλακίδιο με Τυχαίο προσανατολισμό, τότε
τεύθυνση και ης αναγκάΖει να προεκβάλ/ουν ελασματο
πώς είναι δυνατόν οι επιμέρους μικροσωληνίσκοι να κι
πόδια προς Τυχαίες κατευθύνσεις. Η έγχυση αντισωμάτων
νούνται συντονισμένα, αντί να παρασύρονται σε μια διελ
εναντίον της βιμεντίνης στις ινοβλάστες δεν έχει ευδιάκρι
κυνστίδα; Προς ποια κατεύθυνση θα σύρονται οι μικρο
τες επιπτώσεις στη μετοκίνησή τους. Τι συμπεραίνετε από
σωληνίσκοι πάνω σ' ένα «στρώμα» μορίων κινησίνης
αυτές ης παροτηρήσεις για τη συμμετοχή των τριών διαφο
(πρώτο προς το συν άκρο ή το πλην άκρο);
ρεηκών ινιδίων του κυπαροσκελετού στη μετοκίνηση των ινοβλαστών;
Ερώmση
17-19
Ένα Τυπικό χρονοδιάγραμμα του πολυμερισμού καθαρής τουμπουλίνης για το σχημαησμό μικροσωληνίσκων φαί νετοι στην Εικόνα Ε17 -19. Α. Να εξηγήσετε ΤΟ διάφορα τμήματο της καμπύλης (ση
μειώνονται με ΤΟ γράμματο Α, Β και Γ). Να σχεδιάσετε
ένα διάγραμμα στο οποίο να φαίνεται η συμπεριφορά των μορίων της τουμπουλίνης σε καθεμιά από ης τρεις φάσεις.
Β. Ποια μορφή θα πάρει η καμπύλη εάν προστεθούν κε ντροσωμάηα στην αρΧή;
Ερώmση
17-20
Η ηλεκτρονιομικρογραφία της Εικόνας Ε17 -20Α προέρ χεται από έναν πληθυσμό μικροσωληνίσκων οι οποίοι αυ
ξάνουν γρήγορα. Η Εικόνα Ε17-20Β προέρχετοι από μι κροσωληνίσκους που υπόκεινται σε «κατοστροφική» συρ
ρίκνωση. Να σχολιάσετε ης διαφορές μετοξύ των δύο ει-
756
Κεφάλαιο 17: Κuτταροσκελετός
(Α)
Εικόνα Ε17-20
(Β)
Ερώmσn
Ερώmσn
17-22
17-23
Να συμπληρώσετε σωστά την πρόταση που ακολουθεί, ε
Ποια από τις επόμενες αλλαγές πραγματοποιείται κατά τη
ξηγώντας τους λόγους αποδΟΧής ή απόρριψης καθεμιάς
συστολή του σκελετικού μυ;
από τις τέσσερις φράσεις. Ο ρόλος του ασβεστίου στη μυϊ
Α. Οι δίσκοι Ζ απομακρύνονται μεταξύ τους.
κή συστολή είναι
Β. Τα νημάτια της ακτίνης συστέλλονταΙ.
..
Α. Να αποσπά τις κεφαλές της μυοσίνης από την ακτίνη.
Γ. Τα νημάτια της μυοσίνης συστέλλονταΙ.
Β. Να μεταδίδει το δυναμικό ενέργειας από την κυπαρική
Δ. Τα σαρκομερίδια βραΧύνονταΙ.
μεμβράνη στο σύστημα συστολής.
Γ. Να προσδένεται στην τροπονίνη και να την αναγκάΖει να μετακινεί την τροπομυοσίνη και έτσι να εκθέτει τα νη μάτια της ακτίνης στις κεφαλές της μυοσίνης. Δ. Να συντηρεί τη δομή των νηματίων της μυοσίνης.
Ερωτήσεις
757
Έλεγχοs ιου Κυιιαρικού Κύκλου και Κυιιαρικόs θάvαιοs
«Εκεί όπου εμφανίζεται ένα κύπαρο πρέπει να προϋπάρχει ένα άλ/ο κύτ τορο, όπως ακριβώς ΤΟ Ζώα προέρχονται μόνο από άλ/α Ζώα και ΤΟ φυτά α
πό άλ/α φυτά». Αυτό ω κυπαρικό δόγμα που διατυπώθηκε ω Γερμανό παθολογοανοτόμο
Rudolf Virchow,
1858 από ων
μετέδωσε ένα σημανηκό μή
νυμα για ω συνέχεια ως Ζωής. Τα κύπαρα παράγοντοι από κύπαρα και ο
μοναδικός τρόπος για ων παραγωγή περισσότερων κυπάρων είναι η διαίρε ση Των ήδη υπαρχόντων. ΌλΟ! οι Ζωντανοί οργανισμοί, από ω μονοκύπαρο βακτήριο έως ω πολυκύπαρο θηλασηκό, προκύπωυν από επανειλημμέ νους κύκλους κυπαρικής αύξησης και διαίρεσης που χρονικά ανάγονται
σων αρχή ως Ζωής πολύ πριν από τρία δισεκαωμμύρια χρόνια. Ένα κύπαρο αναπαράγεται διεκπεραιώνοντας μια ιεραρχική ακολουθία γεγονότων κοτά ω διάρκεια των οποίων διπλασιάΖει ω περιεχόμενό ωυ και κοτόπιν διαιρείται σΤα δύο. Αυτός ο κύκλος διπλασιασμού και διαίρεσης,
ΥνωσΤός ως κυπαρικός κύκλος
(cell cycle),
είναι ο βασικός μηχανισμός με
ων οποίο αναπαράγονται όλα ΤΟ έμβια όντα. Οι λεπωμέρειες ωυ κυπαρικού κύκλου ποικίλλουν από οργανισμό σε οργανισμό όπως επίσης και ανάλογα με τη διαφορεηκή φάση ως Ζωής ωυ. ΩσΤόσο, ορισμένα χαρακτηΡΙσΤικά εί
ναι Ο!κουμενικά: ο κυπαρικός κύκλος περιλαμβάνει ωυλάχισων ορισμένες διεργασίες ης οποίες πρέπει να διεκπεραιώσει ένα κύπαρο για να επηύχει ω βασικότερο σΤόχο ωυ, δηλαδή ν' αντιγράψει ης γενεηκές πληροφορίες ωυ
και να ης μετοβιβάσει σΤην επόμενη κυπαρική γενιά. Για να παραΧθούν δύο γενεηκώς τουτόσημα θυγατρικά κύπαρα, ω DΝΑ κάθε χρωμοσώμαως πρέ πει ν' αντιγραφεί με ΠΙσΤόωτο' σΤη συνέχεια, ΤΟ διπλασιασμένα χρωμοσώ
ματο πρέπει να διαχωΡΙσΤούν επακριβώς, έτσι ώσΤε καθένα από ΤΟ δύο θυ γατρικά κύπαρα να παραλάβει ένα αντίγραφο ολόκληρου ωυ γονιδιώμαως
(Εικόνα
18-1). Τις περισσότερες
φορές, σε κάθε κυπαρικό κύκλο ΤΟ κύπαρα
διπλασιάΖουν επίσης και ΤΟ οργανίδια και ΤΟ μακρομόριά ωυς ειδάλλως, σε
κάθε διαίρεση θα γίνονταν μικρότερα. Συνεπώς για να διαωρήσουν ω μέ γεθός ωυς ΤΟ κύπαρα πρέπει επίσης να συντονίσουν ων αύξηση με τη διαί ρεσή ωυς.
Επισκόπηση του κυπαρικού κύκλου Ο κυπαρικός κύκλος των ευκαρυωτικών KUΠάρων διαιρείται σε τέσσερις φάσεις Ένα κεντρικό σύστημα ελέγχου πυροδοτεί τις κύριες διεργασίες του KUΠαΡΙKOύ κύκλου Το σύστημα ελέγχου του κυπαρικού κύκλου Το σύστημα ελέγχου του KUΠαΡΙKOύ κύκλου βασίζεται στην κυκλική ενεργοποίηση πρωτεϊνικών κινασών Οι πρωτεϊνικές κινάσες που εξαρτώνται από τις κυκλίνες ρυθμίζονται από τη συσσώρευση και την αποδόμηση των κυκλινών Η ενεργότητα των Cd κινασών επίσης ρυθμίζεται με φωσφορυλίωση και αποφωσφορυλίωση Διαφορετικά σύμπλοκα κυκλίνης-Cd κινάσης πυροδοτούν διαφορετικά βήματα του KUΠαΡΙKOύ κύκλου Η S-Cdk πυροδοτεί την αντιγραφή του ΟΝΑ και αποτρέπει την επαναντιγραφή Οι Cd κινάσες είναι αδρανείς κατά το μεγαλύτερο μέρος της φάσης G, Το σύστημα ελέγχου του κυπαρικού κύκλου μπορεί να διακόψει τον κύκλο σε ειδικά σημεία ελέγχου Τα κύπαρα μπορούν να αποσυναρμολογήσουν το σύστημα ελέγχου και ν' αποσυρθούν από τον KUΠαΡΙKό κύκλο Προγραμματισμένος κυπαρικός θάνατος (απόmωση) Η απόmωση διεκπεραιώνεται με ενδOKUΠάρια πρωτεολυτική διεργασία Το πρόγραμμα του θανάτου ρυθμίζεταιαπό την οικογένεια ενδOKUΠάριων πρωτεϊνών Bcl-2 Εξωκυπάριος έλεγχος του αριθμού και του μεγέθους των κυπάρων Τα ζωικά κύπαρα χρειάζονται εξωκυπάρια σήματα για να διαιρεθούν, ν' αυξηθούν και να επιβιώσουν Τα μιτογόνα διεγείρουν την KUΠαΡΙKή διαίρεση Οι εξωKUΠάριOΙ αυξητικοί παράγοντες διεγείρουν την αύξηση των KUΠάρων Τα ζωικά κύπαρα χρειάζονται παράγοντες επιβίωσης για ν' αποφύγουν τον κυπαρικό θάνατο Μερικές εξωKUΠάριες σηματοδοτικές πρωτεινες αναστέλλουν την αύξηση, τη διαίρεση ή την επιβίωση των KUΠάρων
759
--------
Εικόνα
18·1.
Ο κuπαρικός κύκλος. Στη δι
~
πλανή εικόνα αποδίδεται η διαίρεση ενός υπο θετικού ευκαρυωτικού κυπάρου με δύο χρω μοσώματα. Σε κάθε κύκλο, παράγονται δύο γε νετικώς ταυτόσημα θυγατρικά κύπαρα.
3
---------
..
ΚΥΠΑΡΙΚ;- ®α/ρ~α':~~~~λ~~N
ΔΙΑΙΡΕΣΗ
ΚΑΙ ΑΥΞΗΣΗ ΤΟΥ ΚΥΠΑΡΟΥ
2
ΔΙΑΧΩΡΙΣΜΟΣ~ ~ ΧΡΩΜΟΣΩΜΑΤΩΝ
~
Για να ερμηνεύσουμε πώς αναπαράΥΟνται τα κύπαρα, πρέπει να εξετά σουμε τρία βασικά Ζητήματα: περιεχόμενό τους;
(2)
(1)
Με ποιο τρόπο τα κύπαρα διπλασιάΖουν το
Πώς κατανέμουν τα διπλασιασμένα συστατικά τους
και τα μοιράΖουν στα δύο;
(3)
Πώς συντονίΖουν όλες τις απαραίτητες δρα
στηριότητες Υια τις δύο προηΥούμενες διεΡΥασίες; Τα δύο πρώτα προβλήμα τα εξετάΖΟνται αλ/ού. Στο Κεφάλαιο
φής του
DNA,
ενώ στα Κεφάλαια
6 ασχοληθήκαμε με τον τρόπο αντΙΥρα 7, 11, 15 και 17 πεΡΙΥράφουμε πώς τα ευ
καρυωτικά κύπαρα συνθέτουν διάφορα άλ/α συστατικά όπως οι πρωτε'ί'νες,
οι μεμβράνες, τα ΟΡΥανίδια και τα ινίδια του κυπαροσκελετού. Στο Κεφάλαιο
19 θ'
ασχοληθούμε με το δεύτερο θέμα, δηλαδή τη φυσική διεΡΥασία της
κυπαρικής διαίρεσης.
Σε αυτό το κεφάλαιο εξετάΖουμε το τρίτο και δυσκολότερο πρόβλημα: συ Υκεκριμένα, πώς συντονίΖει το ευκαρυωτικό κύπαρο τα διάφορα βήματα του
αναπαραΥωΥικού κύκλου του. Για να εξασφαλίσουν τη σωστή εξέλιξη του κυπαρικού κύκλου, τα ευκαρυωτικά κύπαρα ανέπτυξαν ένα περίπλοκο δί κτυο ρυθμιστικών πρωτεϊνών Υνωστό ως σuστnμα εΛέγχου του κυπαρικοι} KUKiΊou. Στο κέντρο αυτού του συστήματος βρίσκεται μια τακτική σειρά βιο
χημικών διακοπτών που ελέΥχουν τα κύρια συμβάντα του κύκλου, μεταξύ
•,
Ερώτηση
18-1
Σχολιάστε την ακόλουθη
άλλων την αντΙΥραφή του
DNA και τον
διαχωρισμό των διπλασιασμένων
χρωμοσωμάτων.
διαπίστωση: «Όλα τα σύΥ
Για να συντονίσει αυτές τις δραστηριότητες, το σύστημα ελέΥχου του κυτ
χρονα κύπαρα προήλθαν α
ταρικού κύκλου απαντά σε ποικίλα εξωκυπάρια και ενδοκυπάρια σήματα.
πό μια αδιάκοπη σειρά κυτ
Στο εσωτερικό του κυπάρου, το σύστημα ελέΥχου παρακολουθεί την εξέλιξη
ταρικών διαιρέσεων που α
του κυπαρικού κύκλου και έτσι διασφαλίΖει ότι η αντΙΥραφή του
νάΥΟνται στην πρώτη κυπα
ολοκληρωθεί πριν αρχίσει η κυπαρική διαίρεση. Το σύστημα ελέΥχου πρέ
ρική διαίρεση». Συμφωνείτε απόλυτα με
πει επίσης να συνεκτιμά τις συνθήκες που επικρατούν στο εξωτερικό του κυτ
αυτή την άποψη;
τάρoυ. Σ' έναν πολυκύπαρο ΟΡΥανισμό, πρέπει να απαντά σε σήματα από
760
Κεφάλαιο 18: Έλεγχος του Κυτταρικού Κύκλου και Κυτταρικός Θάνατος
DNA θα έχει
άλ/α κύτταρα, όπως είναι τα σήματα που διεγείρουν την κυτταρική διαίρεση όταν χρειάΖΟνται περισσότερα κύτταρα. Επομένως, το σύστημα ελέγχου του κυτταρικού κύκλου παίΖει κεντρικό ρόλο στη ρύθμιση του αριθμού των κυτ
τάρων στους ιστούς του σώματος: όταν το σύστημα δυσλειτουργεί, μπορεί ν' αναmυχθεί καρκίνος. Στην αρχή του Κεφαλαίου θα παρουσιάσουμε σε γενικές γραμμές τα γε γονότα που συμβαίνουν κατά τη διάρκεια του κυτταρικού κύκλου. Στη συνέ χεια, θα εξετάσουμε πώς συντονίΖονται αυτές οι δραστηριότητες από το σύ στημα ελέγχου του κυτταρικού κύκλου που απαντά σε ενδοκυττάρια και εξω κυττάρια σήματα. Κατόπιν θα περιγράψουμε πώς οι πολυκύτταροι οργανι σμοί απαλλάσσονται από ανεπιθύμητα κύτταρα με τη διεργασία του προ γραμματισμένου κυπαρικού θανάτου (αλ/ιώς, απόπτωση), κατά την οποία το κύτταρο αυτοκτονεί όταν το επιτάσσουν οι ανάγκες του οργανισμού. Τέλος,
θα εξετάσουμε πώς ρυθμίΖεται ο αριθμός και το μέγεθος των κυπάρων υπό την επίδραση εξωκυττάριων σημάτων που ελέγχουν τη διαίρεση, την επιβίω ση και την αύξηση του κυττάρου.
Επισκόπηση ιου κυιιαρικού κύκλου Η κυριότερη λειτουργία του κυττάρου είναι να διπλασιάσει επακριβώς την τεράστια ποσότητα του DΝΑ των χρωμοσωμάτων και στη συνέχεια να μοιρά σει ισότιμα τα αντίγραφα σε γενετικώς ταυτόσημα θυγατρικά κύτταρα. Η
διάρκεια του κυτταρικού κύκλου ποικίλλει πολύ ανάλογα με το είδος του κυτ τάpoυ. Σε ιδανικές συνθήκες, ένας μονοκύτταρος σακχαρομύκητας μπορεί
να διαιρείται κάθε
90-120 λεπτά.
Από την άλ/η πλευρά, τα ηπατοκύτταρα ε
νός θηλαστικού, κατά μέσο όρο, διαιρούνται λιγότερο από μια φορά το χρό νο (Πίνακας
18-1).
Στη συΖήτηση που ακολουθεί θα εστιάσουμε την προσο
χή μας στην ακολουθία των γεγονότων που συμβαίνουν σε κύτταρα θηλαστι
κών που διαιρούνται αρκετά γρήγορα, με κύκλο Ζωής περίπου
24 ωρών,
και
θα περιγράψουμε το σύστημα ελέγχου του κυτταρικού κύκλου που διασφα λίΖει τη σωστή διαδοχή των συμβάντων.
Ο κυπορικός κύκλος των ευκορυωηκών κυπάρων διοφείιοι σε τέσσερις φάσεις Ο κυτταρικός κύκλος των ευκαρυωτικών κυττάρων παραδοσιακά διαιρεί-
Πίνακας
18·1. Η
διάρκεια του κύκλου ζωής μερικών ευκαρυωτικών κυπάρων.
Είδος κυπάρου
Διάρκεια κύκλου ζωής
Κύπαρα πρώιμου εμβρύου βατράχου
30λεmά
Κύπαρα ζύμης
1.5-3 ώρες "'12 ώρες "'20 ώρες "'1 έτος
Επιθηλιακά κύπαρα εντέρου lνοβλάστες θηλαστικού σε καλλιέργεια Ανθρώπινα ηπατοκύπαρα
Επισκόπηση του Κυτταρικού Κύκλου
761
•
Ερώτηση
18-2
ται σε τέσσερα σrάδια ή φάσεις. Παρατηρώντας σro μικροσκόπιο, τα δύο πιο
Κύτταρα ενός αυξανόμενου
εντυπωσιακά γεγονότα είναι η διαίρεση 1Ου πυρήνα, μια διεργασία yνωσrή
κυτταρικού πληθυσμού βά
ως μίτωσΩ
φηκαν με μια XρωσrΙKή η ο
(mitosis) και η διαίρεση 1Ου κυττάρου, yνωσrή και ως κυπαροκί vnan (cytokinesis). Από κοινού, οι δύο αυτές διεργασίες συνισroύν τη φάση
ποία φθορίΖει μόλις προσ
Μ 1Ου κυτταρικού κύκλου. Σ' ένα συνηθισμένο κύτταρο θηλασrΙKOύ, ολό
δεθεί σro ΟΝΑ. Έτσι, η έ
κληρη η φάση Μ διαρκεί περίπου μια ώρα, δηλαδή αποτελεί ένα πολύ μικρό
νταση 1Ου φθορισμού είναι
κλάσμα 1Ου συνολικού κυτταρικού κύκλου.
ανάλογη με την ποσότητα 1Ου ΟΝΑ κάθε
Η περίοδος που παρεμβάλλεται ανάμεσα σε δύο φάσεις Μ αποκαλείται
κυττάρου. Η μέτρηση της ποσότητας 1Ου
μεσ6φαση
ΟΝΑ σε κάθε κύτταρο γίνεται με μια συ
ψη ενός ήρεμου διαλείμμα1Ος, κατά τη διάρκεια 1Ου οποίου 10 κύτταρο α
σκευή, 1Ον διαλογέα κυττάρων ενεργο
πλώς αυξάνει σε μέγεθος. Στην πραγματικότηταόμως, η μεσόφαση είναι μια
ποιούμενο από 10 φθορισμό
(fluorescence-activated cell sorter, FAC5), η ο
πολύ δρασrήρια περίοδος για 10 κύτταρο και διαιρείται σrις υπόλοιπεςτρεις
(interphase).
Σ1Ο μικροσκόπιο, η μεσόφαση έχει την απατηλή ό
φάσεις1Ου κυτταρικούκύκλου. Κατά τη διάρκειατης φάσης S
(5
= synthesis,
ποία καταγράφει την περιεκτικότητα του
σύνθεση), 10 κύτταρο αντιγράφει10 ΟΝΑ 1Ου πυρήνα 1Ου, απαραίτητη προϋ
φθορισμού σε κάθε κύτταρο ξεxωρισrά.
πόθεση για να συμβείη κυτταρική διαίρεση. Η φάση 5 πλαισιώνεται από δύο
Ο αριθμός των κυττάρων με συγκεκριμέ
φάσεις κατά τις οποίες 10 κύτταρο συνεχίΖειν' αυξάνει. Η φάση G} (G =
νη ποσότητα ΟΝΑ αποδίδεται σro σχεδιά
είναι 10 μεσoδιάσrημαανάμεσα σro τέλος της φάσης Μ και την αρχή της φά
gap)
γραμμα της Εικόνας Ε18-2). Σε ποιες πε
σης 5 (σύνθεση 1Ου
ριοχές 1Ου διαγράμμα1Ος αναμένετε να
λος της φάσης 5 και την αρχή της φάσης Μ (Εικόνα
υπάρχουν κύτταρα που βρίσκονται σrις
κριμένα χρονικά
φάσεις
απόφαση αν θα προχωρήσεισrην επόμενη φάση ή αν θα σrαματήσει έτσι ώ
G1, 5, G2 και μίτωση; Ποια είναι η
μεγαλύτερη φάση 1Ου κυτταρικού κύκλου σroν συγκεκριμένο κυτταρικό πληθυσμό;
DNA), ενώ η φάση Gz10 μεσoδιάσrημαανάμεσα σro τέ 18-2). Υπάρχουν συγκε σημεία σrις φάσεις G1 και GZ όπου 10 κύτταρο παίρνει μια
σrε να έχει περισσότεροχρόνο για να πρoε1Oιμασrεί.
Κατά τη διάρκεια όλης της μεσόφασης, ένα κύτταρο συνεχίζεινα μεταγρά φει τα γονίδιά 1Ου, να συνθέτει πρωτε'ϊνες και ν' αυξάνεται σε μάζα. Από κοι νού, οι φάσεις G1 και
Α
G2 προσφέρουν επιπρόσθετο χρόνο σro κύτταρο για ν'
αυξηθεί και να διπλασιάσει τα κυτταροπλασματικά οργανίδιά 1Ου: αν η μεσό φαση διαρκούσε μόνο όσο θα χρειαΖόταν για να πραγμα1Οποιηθεί η αντιγρα φή 1Ου
DNA, 10 κύτταρο δεν θα διέθετε 10 χρόνο για να διπλασιάσειτη μάΖα
1Ου ΠΡΟ1Ού διαιρεθεί, οπότε θα γινόταν μικρότερο μετά από κάθε κυτταρική Β
διαίρεση. Πράγματι, αυτό ακριβώς συμβαίνει σε ορισμένες ειδικές περισrά
σεις. Για παράδειγμα, σrα έμβρυα μερικών Ζώων, οι πρώτες κυτταρικές διαι-
ο
σχετική ποσότητα DΝΑ ανά κύπαρο ΦΑΣΗΜ
Εικόνα Ε18·2
Εικόνα 18·2. Οι φάσεις του κυπαρικού κύ κλου. Η μεσόφαση περιλαμβάνει όλο τον κυτ ταρικό κύκλο εκτός από τη φάση Μ. Είναι μια περίοδος συνεχούς κυπαρικής αύξησης κατά
ΜΕΣΟΦΑΣΗ
τη διάρκεια της οποίας αντιγράφεται το ΟΝΑ.
Κατά τη διάρκεια της φάσης Μ διαιρείται πρώ τα ο πυρήνας και μετά το κυπαρόπλασμα. Η
φάση
G, είναι το διάκενο
και τη φάση
S, ενώ
μεσα στη φάση
762
ανάμεσα στη φάση Μ
η φάση
G2 το διάκενο ανά
S και τη φάση Μ.
ΦΑΣΗ S (αντιγραφή του DΝΑ)
Κεφάλαιο 18: Έλεγχος του Κυτταρικού Κύκλου και Κυτταρικός Θάνατος
ΦΑΣΗ
G,
ρέσεις μετά τη γονιμοποίηση (γνωστές ως διαιρέσεις της αυilάKωσης) χωρί
Ζουν ένα γιγαντιαίο ωάριο σε πολ/ά μικρότερα κύπαρα όσο πιο γρήγορα γί
νεται. Σε αυτούς τους κυπαρικούς κύκλους τα κύπαρα δεν αυξάνουν πριν δι αιρεθούν και οι φάσεις
G} και G2 βραΧύνονται δραστικά.
Το πρώτο σαφές σήμα ότι ένα κύπαρο είναι έτοιμο να εισέλθει στη φά ση Μ είναι η προοδευτική συμπύκνωση των χρωμοσωμάτων του, τα οποία είχαν αντιγραφεί προηγουμένως κατά τη διάρκεια της φάσης
S
(στο στά
διο αυτό, τα δύο αντίγραφα κάθε χρωμοσώματος παραμένουν ισχυρά
συνδεδεμένα το ένα με το άλ/ο). Η συμπύκνωση των χρωμοσωμάτων ση ματοδοτεί το τέλος της φάσης
G2. Στο στάδιο αυτό του κυπαρικού κύκλου,
τα χρωμοσώματα πρώτα είναι ορατά στο φωτονικό μικροσκόπιο σαν μα
κριές κλωστές, οι οποίες σταδιακά γίνονται βραΧύτερες και παΧύτερες με σύμπηξη (βλ. Κεφάλαιο
5).
Αυτή η συμπύκνωση αποτρέπει το μπέρδεμα
των χρωμοσωμάτων και επομένως διευκολύνει το διαχωρισμό τους κατά τη διάρκεια της μίτωσης.
Ένα κενΙρικό σύστημα ελέγχου πυροδοτεί τις κύριες διεργασίες του κυπαρικού κύκλου Το σύστημα ελέγχου του κυπαρικού κύκλου λειτουργεί περίπου όπως και
το σύστημα ελέγχου ενός αυτόματου πλυντηρίου. Το πλυντήριο λειτουργεί κατά στάδια: δέχεται νερό, το αναμειγνύει με το απορρυπαντικό, πλένει τα ρούχα, μετά τα ξεπλένει και τέλος τα στραΥΥίΖει. Αυτά τα βασικά στάδια του κύκλου της πλύσης είναι ανάλογα με τις θεμελιώδεις διεργασίες του κυπαρl κού κύκλου
-
αντιγραφή του
DNA, μίτωση
κλπ. Και στις δύο περιmώσεις ένα
ΣΥΝΑΡΜΟΛΟΓΗΣΗ
ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ
ΤΗΣ ΜΙΤΩΤΙΚΗΣ ΑΤΡΑΚΤΟΥ (βλ. Κεφάλαιο 19)
ΚΥΠΑΡΙΚΗΣ ΔΙΑΙΡΕΣΗΣ (βλ. Κεφάλαιο 19)
t
ενεΡΥοποίηση του μηχανισμού της μίτωσης
.
.t
.
εναρξη της αναφασης και πορεια προς την κυπαροκίνηση
Εικόνα
18-3. Ο έλεγχος του κυπαρικού κύ
κλου. Οι βασικές διεργασίες, όπως η αντιγρα ενεργοποίηση του μηχανισμού αντιγραφής του DNA
~ ΑΝΤΙΓΡΑΦΗ ΤΟΥ
(βλ. Κεφάλαιο
DNA 6)
φή του DΝΑ, η μίτωση και η KUΠαΡOKίνηση πυ ροδοτούνται από ένα σύστημα ελέγχου του κυπαρικού κύκλου, το οποίο ενεργοποιεί κα τάλληλους μηχανισμούς μόλις φτάσει σε ειδι κά σημεία του κύκλου.
Επισκόπηση του Κυτταρικού Κύκλου
763
κεντρικό σύστημα ελέγχου πυροδοτεί κάθε διεργασία με καθορισμένη ακο λουθία (Εικόνα
18-3). Το
ίδιο το σύστημα ελέγχου ρυθμίζεται σε ορισμένα
κρίσιμα σημεία του κύκλου με ανατροφοδότηση από τις διεργασίες που διεκπεραιώνονται Για παράδειγμα, ειδικοί αισθητήρες καταγράφουν τα επί
πεδα του νερού και αποστέλ/ουν σήματα στο σύστημα ελέγχου ώστε να μην αρχίσει το επόμενο στάδιο προτού ολοκληρωθεί εκείνο που βρίσκεται ήδη σε εξέλιξη. Αν δεν υπήρχε αυτή η ανατροφοδότηση, μια διακοπή ή μια κα
θυστέρηση σε οποιαδήποτε από αυτές τις διεργασίες θα μπορούσε ν' αποβεί καταστροφική.
Τα γεγονότα του κυτταρικού κύκλου επίσης πρέπει να συμβαίνουν σύμφωνα με ορισμένη ακολουθία, η οποία πρέπει να τηρείται έστω και αν ένα από τα επιμέρους στάδιά της διαρκεί περισσότερο από το κανονι κό. Όλο το ΟΝΑ του πυρήνα πρέπει να έχει αντιγραφεί προτού αρχίσει η διαίρεση του πυρήνα' αυτό σημαίνει ότι πριν από τη φάση Μ πρέπει να έ χει προηγηθεί μια πλήρης φάση
S. Αν
η σύνθεση του ΟΝΑ επιβραδυνθεί
ή σταματήσει (για παράδειγμα, εξαιτίας βλαβών του ΟΝΑ που απαιτούν ε πιδιόρθωση), η μίτωση και η κυτταρική διαίρεση πρέπει επίσης να καθυ
στερήσουν. Παρομοίως, προκειμένου να διαιρεθούν στα δύο, τα περισ σότερα κύτταρα πρέπει προηγουμένως να έχουν διπλασιαστεί σε μέγε
θος, ειδάλλως με κάθε κυτταρική διαίρεση θα γίνονταν όλο και μικρότε
•,
Ερώmση
ρα. Το σύστημα ελέγχου του κυτταρικού κύκλου επιτυγχάνει όλα αυτά με
18-3
κατάλληλα «μοριακά φρένα» ικανά να σταματούν τον κύκλο σε διάφορα
Τι θα μπορούσε να συμβεί
σημεία ελέγχου
αν ένα κύτταρο αντέγραφε
δεν πυροδοτεί το επόμενο βήμα του κύκλου αν προηγουμένως δεν προ
κατεστραμμένο ΟΝΑ προ
ετοιμαστεί το κύτταρο.
τού το διορθώσει;
(checkpoints).
Με αυτόν τον τρόπο, το σύστημα ελέγχου
Δύο σημαντικά σημεία ελέγχου υπάρχουν στις φάσεις μείο ελέγχου της φάσης
Gl
και
G2. Το ση
G1 επιτρέπει επίσης στο κύτταρο να εξακριβώσει αν
το περιβάλ/ον ευνοεί τον πολ/απλασιασμό προτού δεσμευτεί στη φάση S. Η αύξηση του κυττάρου εξαρτάται από τον επαρκή εφοδιασμό του σε θρεπτικές ουσίες και από άλ/ους παράγοντες από το εξωκυττάριο περιβάλ/ον. Αν οι ε ξωκυττάριες συνθήκες είναι δυσμενείς, τα κύτταρα σταματούν στη φάση
G1
και μπορεί ακόμα και να περάσουν σε μια κατάσταση ηρεμίας γνωστή ως
GO
Πολ/ά κύτταρα, μεταξύ των οποίων τα νευρικά και τα γραμμωτά μυϊκά κύττα ρα, παραμένουν σε φάση
GO διαβίου.
Το σύστημα ελέγχου της φάσης
G2 ε
πιτρέπει στο σύστημα να σταματά προτού πυροδοτήσει τη μίτωση. Επιπλέον,
επιτρέπει στο κύτταρο να ελέγξει αν έχει ολοκληρωθεί η αντιγραφή του ΟΝΑ προτού προχωρήσει στη μίτωση (Εικόνα
18-4).
Τα σημεία ελέγχου έχουν σημασία και από μια άλ/η άποψη: είναι σημεία
του κυτταρικού κύκλου στα οποία το σύστημα ελέγχου μπορεί να ρυθμιστεί από σήματα που προέρχονται από άλ/α κύτταρα. Μερικά από αυτά τα σήμα τα προάγουν την εξέλιξη του κυτταρικού κύκλου ενώ άλ/α την αναστέλ/ουν.
Στις παραγράφους που ακολουθούν θα παρουσιάσουμε τις πρωτεϊ'νες που απαρτίΖουν το κεντρικό σύστημα ελέγχου και στη συνέχεια θα εξετάσουμε τους παράγοντες οι οποίοι επηρεάΖουν τις αποφάσεις που λαμβάνονται στα
διάφορα σημεία ελέγχου.
764
Κεφάλαιο 18: Έλεγχος του Κυτταρικού Κύκλου και Κυτταρικός Θάνατος
Εικόνα
18·4. Δύο
σημεία ελέγχου στον κυτ
ταρικό κύκλο. Η ανατροφοδότηση από τα εν δOKUΠάρια συμβάντα του κυπαρικού κύκλου ΣΗΜΕΙΟ ΕΛΕΓΧΟΥ
όπως επίσης και διάφορα σήματα από το περι βάλλον του κυπάρου καθορίζουν αν το σύστη
G2
μα ελέγχου θα περάσει από συγκεκριμένα ση
μεία ελέγχου. Στη διπλανή εικόνα παρουσιά ζονται δύο σημαντικά σημεία ελέγχου, ένα στη φάση G" όπου το σύστημα ελέγχου καθορίζει αν το κύπαρο θα προχωρήσει στη φάση S, και ένα άλλο στη φάση
G2, όπου καθορίζεται αν το
κύπαρο θα προχωρήσει στη μίτωση.
ΣΗΜΕΙΟ ΕΛΕΓΧΟΥ
G,
Είναι ευνο'ίκό το περι όΝων; Έχει βλάβες το ΟΝΑ;
Το σύστημα ελέγχου του
κυτταρικού κύκλου Ο κυπαρικός κύκλος χρειάΖετω δύο ομάδες «μηχανικών εξαρτημάτων»: η μlO είνω απαραίτητη για την παρασκευή των νέων συστατικώντου αυξανό
μενου κυπάρου κω η άλ/η γlO την τοποθέτηση των συστατικών στη σωστή θέση κω την κατάλ/ηλη κατανομή τους όταν το κύπαρο δlOφείτω στα δύο
(βλ. Κεφάλωο 19). Ωστόσο, εξίσου σημαντικό είναι κω το σύστημα κεντρι κού ελέγχου που ενεργοποιεί κω απενεργοποιεί τα «εξαρτήματα» στον κα τάλ/ηλο χρόνο κω συντονίΖει όλες τις διεργασίες που παράγουν το τελικό προϊόν. Στο κύπαρο, η σωστή εξέλιξη του κυπαρικού κύκλου διασφαλίΖετω με τη ρύθμιση των σχετικών «εξαρτημάτων» από το σύσrημα ελέγχου του κυτ
ταρικού κύκλου
(cell cyc!e contro! system).
Στις παραγράφους που ακολουθούν πρώτα θα εξετάσουμε μερικές από τις βασικές αρχές λειτουργίας του κυπαρικού κύκλου. Στη συνέχεlO, θα πα ρουσιάσουμε τις πρωτε'ϊνες του συστήματος ελέγχου κω θ' αναλύσουμε πώς
συνεργάΖονται ώστε να προωθήσουν τις διαφορετικές φάσεις του κύκλου.
Το σύστημα ελέγχου του κυπαρικού κύκλου βασίΖεται arnV κυκλική εvεργοηοίηση ηρωτεϊvικώv κιvασώv Το σύστημα ελέγχου του κυπαρικού κύκλου καθοδηγεί τα «μηχανικά ε
ξαρτήματα» του κυπαρικού κύκλου μέσω της κυκλικής ενεργοποίησης κω α πενεργοποίησης κρίσιμων πρωτεϊνών που πυροδοτούν ή ρυθμίΖουν την α ντιγραφή του
DNA, τη μίτωση
Κεφάλωο
η φωσφορυλίωση (κω η αποφωσφορυλίωση) είναι ένας από
5,
και την κυπαροκίνηση. Όπως αναφέραμε στο
τους πιο κοινούς μηχανισμούς που χρησιμοποιούν τα κύπαρα γlO να μετα
βάλ/ουν τη δραστικότητα μιας πρωτεΊνης. Οι αντιδράσεις φωσφορυλίωσης
Το Σύστημα Ελέγχου του Κυτταρικού Κύκλου
765
που ελέγχουν τον κυτταρικό κύκλο διενεργούνται από μια ειδική ομάδα πρωτεϊνικών κινασών, δηλαδή ενΖύμων που KαIOi\ύOυν τη μειοφορά μιας
φωσφορικής ομάδας από το ΑΤΡ στην πλευρική αλυσίδα ενός συγκεκριμέ νου αμινοξέος της πρωτεΊνης-στόχου. Οι συνέπειες της φωσφορυλίωσης μπορεί ν' αναστραφούν γρήγορα με την αφαίρεση της φωσφορικής ομάδας
(αποφωσφορυλίωση), μια αντίδραση που διεξάγεται από μια άλ/η ομάδα ενΖύμων, ης πρωτεϊνικές φωσφοιάσες.
Σιο πολ/απλασιαΖόμενα κύτταρα, οι πρωτεϊνικές κινάσες του συστήμα τος ελέγχου του κυτταρικού κύκλου είναι παρούσες σε όλες ης φάσεις του κύκλου. Ωστόσο, ενεργοποιούνται μόνο σε ορισμένες κοιάλ/ηλες χρονικές περιόδους και αμέσως μετά απενεργοποιούνται γρήγορα. Επομένως, η ε νεργότηιο καθεμιάς από ης κινάσες αυξάνει και ελαττώνειοι με κυκλικό φό
πο. Για παράδειγμα, μερικές πρωτεϊνικές κινάσες ενεργοποιούνται προς το τέλος της φάσης
G1 και προωθούν το κύτταρο στη φάση S'
μια άλ/η κινάση
ενεργοποιείιοι λίγο πριν τη φάση Μ και προωθεί το κύτταρο στη μίτωση. Δεδομένου όη οι πρωτεϊνικές κινάσες του συστήματος ελέγχου του κυτ ιορικού κύκλου είναι παρούσες σε όλες ης φάσεις του κύκλου, πώς ενεργο ποιείιοι και απενεργοποιείιοι η ενΖυμlκή τους δράση στις κοιάλ/ηλες χρονι
κές περιόδους; Φαίνειοι όη για αυτό εν μέρει ευθύνειοι μια δεύτερη ομάδα πρωτεϊνών του συστήματος ελέγχου που αποκαλούνται κυκλίνες
(cyclins). Οι
ίδιες οι κυκλίνες δεν έχουν ενΖυμlκή ενεργότηιο, αλ/ά είναι απαραίτητες για την ενεργοποίηση των κινασών του κυτταρικού κύκλου, την οποία εΠlΙυγχά
νουν μέσω της πρόσδεσής τους στις κινάσες. Για το λόγο αυτό οι κινάσες του συστήματος ελέγχου του κυτταρικού κύκλου αναφέρονται ως πρωτεϊνικές κι
νάσες εξαρτώμενες από τις κυκλίνες
(cyclin-dependent protein kinases, Cd
κινάσες ή Cdks) (Εικόνα
18-5). Οι
θειο από ης
η συγκέντρωσή τους διακυμαίνειοι με κυκλικό φό
Cd κινάσες,
κυκλίνες ονομάστηκαν έιοι επειδή, αντί
πο κοιά τη διάρκεια του κυτταρικού κύκλου. Οι κυκλικές μειοβολές στη συ γκέντρωση των κυκλινών προωθούν την κυκλική συναρμολόγηση και ενερ
γοποίηση των συμπλόκων κυκλινών-Cdk. Η ενεργοποίηση αυτών των συ
μπλόκων πυροδοτεί ποικίλα συμβάντα του κυτταρικού κύκλου, όπως η είσο δος στη φάση Μ ή στη φάση
S.
Οι πρωτεϊνικές κινάσες που εξαρτώνται από ης κυκλίνες ρυθμίΖΟνται από τη συσσώρευση και την αποδόμηση των πρωτε"ίνική κινάση εξαρτώμενη από την κuκλίνη (Cd κινάση)
Εικόνα
18-5. Τα
δύο βασικά συστατικά ενός
συμπλόκου κυκλίνης-Cd κινάσης. Η πρωτε"ί νική κινάση που εξαρτάται από την κυκλίνη (Cd κινάση) είναι ένα ένζυμο που καταλύει τη φω σφορυλίωση διάφορων πρωτε"ίνών, ενώ η κυ κλίνη είναι μια ρυθμιστική πρωτεί\ιη απαραίτη τη για την ενζυμική ενεργοποίηση της Cd κινά σης. Το ενεργό σύμπλοκο φωσφορυλιώνει καί
ριες πρωτεΊνες του κυπάρου, αναγκαίες για την έναρξη ενός συγκεκριμένου βήματος του κυπαρικού κύκλου.
766
κυκλινών Η ρύθμιση της συγκέντρωσης των κυκλινών παίΖει σημαντικό ρόλο στο χρονικό προγραμμαησμό των συμβάντων του κυτταρικού κύκλου. Η κυκλίνη
που προωθεί ΙΟ κύτταρα στη φάση Μ ονομάΖεται Μ-κυκλίvn και το σύμπλο κό της με την αντίστοιχη
Cdk ονομάΖεται M-Cdk. Η
σύνθεση της Μ-κυκλίνης
αρχίΖει αμέσως μετά τη διαίρεση του κυττάρου και συνεχίΖεται σταθερά κα
θόλη τη διάρκεια της μεσόφασης. Η κυκλίνη συσσωρεύειοι και η συγκέ ντρωσή της αυξάνει σταδιακά. Αυτό συμβάλ/εl στο χρονικό προγραμμαησμό της αρχής της μίτωσης. Η επακόλουθη ιοχεία ελάττωση της συγκέντρωσης
της κυκλίνης πυροδοτεί την έξοδο από τη μίτωση (Εικόνα
Κεφάλαιο 18: Έλεγχος του Κυτταρικού Κύκλου και Κυτταρικός Θάνατος
18-6).
Εικόνα μεσόφαση
μίτωση
μεσόφαση
Cdk και
18·6.
Η άνοδος και η mώση της Μ
της συγκέντρωσης της Μ-κυκλίνης
κατά τη διάρκεια του κυπαρικού κύκλου σ' έ δραστικότητα
της
να ωοκύπαρο. Ενώ η δραστικότητα της Μ
____
Cdk αυξάνει
M-Cdk
και μηδενίζεται σε κάθε μίτωση, η
συγκέντρωση της κυκλίνης σταδιακά αυξάνει κατά τη διάρκεια της μεσόφασης, κορυφώνε ται στη μίτωση και πέφτει απότομα καθώς λή γει η μίτωση. Η συγκέντρωση της
M-Cd
κινά
σης δεν μεταβάλλεται κατά την εξέλιξη του
KUΠαΡΙKOύ κύκλου: το μόνο που αλλάζει είναι η δραστικότητά της.
Η αιφνίδια mώση της συγκέντρωσης της κυκλίνης κατά τη διάρκεια της μίτωσης οφείλεται Ο1ην τοχεία αποδόμησή της από 10 πρωτεολυTlκόσύΟ1η
μα που εξαρτάτοι από την ουβικουϊτίνη.Με κάθε μόριο Μ-κυκλίνηςσυνδέο νται ομοιοπολικάπολλά μόρια ουβικουϊτίνηςκαι 10 οδηγούνγια αποδόμηση
. Ο1α πρωτεασωμάTlα (βλ. Κεφάλαιο 7). ποιεί την Cdk (Εικόνα 18-7).
Η καΤΟΟ1ροφή της κυκλίνης αδρανο
Τι όμως ελέγχει 10 χρόνο ουβικουίτινίωσηςτων κυκλινών; Στην περίmω
ση της Μ-κυκλίνης, ένα πρωτεϊνικό σύμπλοκο ΥνωΟ1ό ως σύμπΛοκο που προάγειΤην ανάφaση (anaphase
promoting complex, APC) προσθέΤει
ουβι
κουϊτίνη Ο1ην κυκλίνη και σε άλλες πρωτε'lνες που εμπλέκονται Ο1η ρύθμιση της μίτωσης. ΩΟ1όσο, 10 APC δεν είναι ενεργό σε όλα ΤΟ Ο1άδια 1Ου κυπαρι κού κύκλου. Η δράση 1Ου ενεργοποιείτοι σε προχωρημένη φάση της μίτω σης σε μια διεργασία που εξαρτάται από τη δράση της
ηση της
M-Cdk με λανθάνοντα
M-Cdk. Η
ενεργοποί
χρόνο ενεργοποιεί 10 σύμπλοκο APC. Αυτό
οδηγεί σε ουβικουϊTlνίωση και αποδόμηση της Μ-κυκλίνης και έτοι σε απε
νεργοποίηση της
M-Cdk.
Κω' αυτόν 1Ον τρόπο, η
M-Cdk συνεισφέρει
Ο1ην
απενεργοποίησή της.
Το σύμπλοκο
APC δεν είναι αρμόδιο
αποκλεΙΟ1ικά για την αποδόμηση της
Μ-κυκλίνης. Όπως θα δούμε 010 Κεφάλαιο 19, ο διοχωρισμόςτων διπλασια σμένων χρωμοσωμάτων κατά 10 Ο1άδιο της aνάφaσηςτηςμίτωσης επίσης ε
ξαρτάται από 10 APC (εξάλλου σε αυτή τη δράση οφείλει και 10 όνομά 1Ου).
Η ενεργότητατων Cd κινασών επίσης ρυθμίΖεται με φωσφορυλίωσηκαι αποφωσφορυλίωση Η άνοδος και η mώση των επιπέδωντων κυκλινών παίζει σημαντικό ρόλο
Ο1η ρύθμισητης δράσης των Cdk κατά τη διάρκεια 1Ου κυπαρικού κύκλου. Ω-
μιτωτική
Cdk
d
'8
ןIΙ/-::.
ενεργός M-Cdk
Μ-κυκλίνη
ουβικοuϊτινίωση Μ-κυκλίνης.
καταστροφή
(J
\)
Εικόνα
18-7.
Η δραστικότητα των
Cd
κινα
σών ρυθμίζεται από την αποδόμηση των κυ αδρανοποιηση της
κλινών. Η ουβικουϊτινίωση της κυκλίνης προ
M-Cdk ανενεργός
Cdk
καλεί τελικά την καταστροφή της. Η απώλεια της κυκλίνης απενεργοποιεί την
Cd
Το Σύστημα Ελέγχου του Κυτταρικού Κύκλου
κινάση.
767
Ιστορική Αναδρομή: Ανακάλυψη των κυκλινών και των Για πολλά χρόνια οι βιολόγοι παρακολουθούσαν τα φαινόμενα
Cd κινασών
νώ κάτι τέτοιο δεν συμβαίνει με κυπαρόπλασμα από ένα αυλακού
της σύνθεσης του DΝΑ, της μίτωσης και της κυπαροκίνησης χω
μενο ωάριο που βρίσκεται σε άλλες φάσεις του κύκλου. Όταν πρω
ρίς να γνωρίζουν τίποτα για τους υποκείμενους μηχανισμούς. Το
τοπεριγράφηκε αυτό το φαινόμενο, η βιοχημική ταυτότητα και ο
σύστημα ελέγχου του KUΠαΡΙKOύ κύκλου ήταν ένα «μαύρο κουτί»
μηχανισμός δράσης του παράγοντα που ευθυνόταν για τη συγκε
στο εσωτερικό του KUΠάΡOυ. Δεν ήταν γνωστό ούτε καν αν υπήρ
κριμένη δράση ήταν άγνωστα: έτσι, η δράση αυτή ονομάστηκε α
χε ξεχωριστό σύστημα ελέγχου ή αν ο εξοπλισμός του KUΠαΡΙKOύ
πλώς πaΡάγοvraς προαγωγής της φάσης Μ
(M-phase promoting
κύκλου αυτοελεγχόταν. Ουσιαστική πρόοδος σημειώθηκε μόνο ό
factor ή MPF)
του κυπαροπλάσμα
ταν ανιχνεύθηκαν οι βασικές πρωτεινες του συστήματος ελέγχου
τος από διαφορετικά στάδια του κυπαρικού κύκλου με τη δοκιμα
και αναγνωρίστηκε ότι διέφεραν από τα συστατικά του εξοπλισμού
σία που παρουσιάζεται στην Εικόνα
του κυπαρικού κύκλου, δηλαδή τα ένζυμα και τις άλλες πρωτεινες
ση του
που διεκπεραιώνουν τις θεμελιώδεις διεργασίες της αντιγραφής
ταρικού κύκλου: συγκεκριμένα, αυξανόταν γρήγορα λίγο πριν από
του DΝΑ, του διαχωρισμού των χρωμοσωμάτων κλπ.
την αρχή της μίτωσης και μηδενιζόταν γρήγορα προς το τέλος της
Τα συστατικά του συστήματος ελέγχου του κυπαρικού κύκλου
που ανακαλύφθηκαν πρώτα ήταν οι κυκλίνες και οι κινάσες που ε ξαρτώνται από τις κυκλίνες
(Cdk) οι οποίες προωθούν τα κύπαρα
(Εικόνα
18-9). Από την εξέταση
18-6 διαπιστώθηκε ότι η δρά MPF μεταβαλλόταν σημαντικά κατά την εξέλιξη κάθε κυτ
μίτωσης (Εικόνα
18-1 Ο).
Όταν τελικά απομονώθηκε σε καθαρή μορφή, ο
MPF βρέθηκε να
περιέχει μια πρωτε·ίνική κινάση η οποία είναι απαραίτητη για τη
στη φάση Μ. Ανακαλύφθηκαν σε μελέτες με αντικείμενο την κυπα
δράση του. Ωστόσο, η
ρική διαίρεση που διεξήχθη καν σε ζωικά κύπαρα.
της. Όπως προαναφέραμε, απαραίτητη προϋπόθεση για να εκδη
MPF κινάση
δεν μπορεί να δράσει από μόνη
λώσει τη λειτουργία της είναι η πρόσδεση με μια ειδική πρωτείνη Πίσω στο ωάριο
(σήμερα γνωρίζουμε ότι είναι η Μ-κυκλίνη). Όπως θα δούμε στην ε
Τα γονιμοποιημένα ωάρια πολλών ζώων προσφέρονται ιδιαίτε ρα για βιοχημικές μελέτες του κυπαρικού κύκλου, επειδή είναι ε
πόμενη παράγραφο, οι κυκλίνες ανακαλύφθηκαν από ένα διαφο ρετικό είδος πειραμάτων.
ξαιρετικά μεγάλα και διαιρούνται γρήγορα. Για παράδειγμα, το ω άριο του βατράχου (Εικόνα
Xenopus έχει διάμετρο λίγο πάνω από 1 mm 18-8). Μετά τη γονιμοποίηση, αρχίζει την εμβρυ·ίκή ανά
Ψαρεύοντας στις αχιβάδες Η Μ-κυκλίνη αρχικά ταυτοποιήθηκε ως μια πρωτεινη της οποίας
mυξη με μια σειρά από ταχείς κύκλους διαίρεσης που το υποδιαι
η συγκέντρωση αυξανόταν βαθμιαία κατά τη διάρκεια της μεσόφα
ρούν σε πολλά μικρότερα κύπαρα. Αυτοί οι ταχείς κυπαρικοί κύ
σης και μετά μηδενιζόταν γρήγορα καθώς τα αυλακούμενα κύπα
κλοι αποτελούνται κυρίως από επαναλαμβανόμενες φάσεις
S και
ρα της αχιβάδας περνούσαν στη φάση Μ, η δε συμπεριφορά αυτή
Μ, ανάμεσα στις οποίες παρεμβάλλονται πολύ μικρές ή και καθό
επαναλαμβανόταν σε κάθε κυπαρικό κύκλο (Εικόνα
λου φάσεις
η ίδια η κυκλίνη δεν έχει ενζυμική δράση, ο ρόλος της στον έλεγχο
18-6).
Επειδή
G1 ή G2 . Ενώ συμβαίνουν αυτά, δεν πραγματοποιείται μεταγραφή γονιδίων: όλα τα μόρια του mRNA, όπως επίσης και οι
του κυπαρικού κύκλου αρχικά ήταν ασαφής. Ουσιαστική πρόοδος
περισσότερες πρωτεινες που απαιτούνται για αυτό το πρώιμο στά
σημειώθηκε όταν βρέθηκε ότι η κυκλίνη ήταν συστατικό του
διο της εμβρυ·ίκής ανάmυξης έχουν ήδη συσκευαστεί στο πολύ με
και ότι η παρουσία της ήταν απαραίτητη για να εκδηλώσει τη δρά
γάλο ωάριο κατά τη διάρκεια της ανάπτυξής του ως ωοκύπαρο
ση της η
MPF
MPF κινάση - δηλαδή, η μιτωτική Cd κινάση. Συνεπώς, ο
στην ωοθήκη της μητέρας. Σε αυτούς τους πρώιμους κύκλους δι αίρεσης (που αναφέρονται ως διαιρέσεις της αυλάκωσης,
cleavage divisions) δεν συμβαίνει κυπαρική αύξηση και όλα τα κύπαρα
του εμβρύου διαιρούνται συγχρονισμένα. Από ωάρια βατράχου που βρίσκονται σ' ένα συγκεκριμένο στά διο του κυπαρικού κύκλου μπορεί να παρασκευαστεί ένα αντιπρο σωπευτικό εκχύλισμα του σταδίου αυτού. Η βιολογική δράση ενός τέτοιου εκχυλίσματος μπορεί να ελεγχθεί με την ένεση του εκχυλί σματος σ' ένα ωοκύπαρο
Xenopus
(το άωρο προγονικό κύπαρο
του μη γονιμοποιημένου ωαρίου) και να παρατηρηθούν οι επιδρά σεις του στην εξέλιξη του κυπαρικού κύκλου. Το ωοκύπαρο του
Xenopus
προσφέρεται για τη μελέτη της δράσης που προωθεί τα
κύπαρα στη φάση Μ εφόσον έχει ολοκληρώσει την αντιγραφή του DΝΑ και έχει σταματήσει λίγο πριν από τη φάση Μ της πρώτης μει ωτικής διαίρεσης (βλ. Κεφάλαιο
20). Επομένως, βρίσκεται σ' ένα G2 ενός
στάδιο του κυπαρικού κύκλου που ισοδυναμεί με τη φάση μιτωτικού κυπαρικού κύκλου. Παράγοντας Μ
Σε παρόμοια πειράματα βρέθηκε ότι ένα εκχύλισμα από ένα ωά ριο της φάσης Μ προωθεί ακαριαία το ωοκύπαρο στη φάση Μ, ε-
O.5mm
Εικόνα
18-8. Ένα
ώριμο ωάριοΧenοΡUS προσφέρεται για τη
μελέτη της κuπαρικής διαίρεσης. (Με την άδεια του
Tony Mills).
ΕΝΕΣΗ ΚΥΠΑΡΟ ΠΜΣΜΑΤΟΣΑΠΟ
ΕΝΕΣΗ ΚΥΠΑΡΟ
ΠΜΣΜΑΤΟΣ ΑΠΟ
ΚΥΠΑΡΟΣΕ ΜΕΣΟΦΑΣΗ
εμφάνιση
ΚΥΠΑΡΟ ΣΕ ΦΑΣΗ Μ
aτράκτου
\
\
-(3 ΤΟ ΩΟΚΥΠΑΡΟ
ΤΟ ΩΟΚΥΠΑΡΟ
ΩΘΕΙΤΑΙ ΣΤΗ
ΔΕΝ ΕΙΣΕΡΧΕΤΑΙ ΣΤΗ ΦΑΣΗ Μ
ΦΑΣΗΜ
(Α)
Εικόνα
18-9. Ένα
(8)
πείραμα που δείχνει τη δράση του
σάγεται με ένεση σ' ένα ωοκύπαρο
Xenopus.
MPF.
(Α) Κυπαρόπλασμα που έχει ληφθεί από ένα ωάριο
Xenopus σε φάση Μ ει
Το κυπαρικό εκχύλισμα προωθεί το ωοκύπαρο στη φάση Μ της πρώτης μειωτικής διαίρε
σης και προκαλεί την αποδόμηση του πυρήνα και το σχηματισμό της ατράκτου.
(8) Όταν το κυπαρόπλασμα προέρχεται από ένα ωάριο
σε μεσόφαση, τότε το ωοκύπαρο δεν προωθείται στη φάση Μ. Συνεπώς το εκχύλισμα στο (Α) πρέπει να περιέχει κάποια δραστική ουσία (παράγοντας προαγωγής της φάσης Μ,
MPF) που πυροδοτεί την είσοδο στη φάση Μ.
MPF είναι ένα πρωτε'ίνικό σύμπλοκο που περιέχει δύο υπομονάδες - μια ρυθμιστική υπομονάδα, η οποία είναι μια κυκλίνη, και μια κα ταλυτική υπομονάδα, η οποία είναι η μιτωτική Cd κινάση. Μετά την ταυτοποίηση των συστατικών του MPF, απομονώθηκαν και άλλα είδη κυκλινών και Cd κινασών των οποίων η συγκέντρωση ή η δρα
κυπαρικού κύκλου. Μερικά από τα γονίδια αυτά βρέθηκε ότι κωδι τόσο ως προς την αλληλουχία των αμινοξέων τους όσο και ως
στικότητα αυξάνει και ελαπώνεται κατά τη διάρκεια του κυπαρι
στα ανθρώπινα κύπαρα.
κοποιούσαν κυκλίνες και
Cd κινάσες με εντυπωσιακή ομοιότητα
προς τη λειτουργία τους με τις ομόλογες πρωτεινες των βατράχων και των μυδιών. Πολύ γρήγορα, ανάλογα γονίδια ταυτοποιήθηκαν
κού κύκλου.
Πολλά από τα γονίδια ελέΥχου του κυπαρικού κύκλου έχουν με ταβληθεί τόσο λίγο κατά τη διάρκεια της εξέλιξης ώστε τα ανθρώ
Παντού τα ίδια πράγματα
πινα γονίδια λειτουργούν άριστα και σ' ένα κύπαρο σακχαρομύκη
τα. Για παράδειγμα, ας θεωρήσουμε έναν σακχαρομύκητα με βλά βη ενός ορισμένου γονιδίου της Cd κινάσης ή της κυκλίνης ο οποί
Ενώ οι βιοχημικοί ταυτοποιούσαν τις πρωτεωες που ρυθμίζουν τον κυπαρικό κύκλο στα έμβρυα του βατράχου, οι γενετιστές που
μελετούσαν τον σακχαρομύκητα για να προσεγγίσουν το ίδιο θέμα
ος αδυνατεί να διπλασιαστεί. Αν στον σακχαρομύκητα αυτόν εισα
ακολουθούσαν διαφορετική τακτική. Οι σακχαρομύκητες είναι μο
χθεί τεχνητά ένα αντίγραφο του αντίστοιχου ανθρώπινου γονιδίου,
νοκύπαροι μύκητες. Επειδή είναι σχετικά απλοί ευκαρυώτες που
τότε το κύπαρο θ' αποκτήσει την ικανότητα να διαιρείται φυσιολο
πολλαπλασιάζονται σχεδόν εξίσου γρήγορα με τα βακτήρια προ
γικά. Ασφαλώς, ακόμα και ο Δαρβίνος θα εντυπωσιαζόταν από αυ
σφέρονται ιδιαίτερα για τη γενετική ανάλυση των ευκαρυωτικών
τές τις σαφείς ενδείξεις για την εξελικτική συγγένεια των ανθρώ
κυπάρων. Έχουν απομονωθεί πολυάριθμα μεταλλαγμένα στελέχη
πων και των σακχαρομυκήτων. Παρά το ένα δισεκατομμύριο χρόνια
σακχαρομυκήτων που εμφανίζουν διαταραχές σε ειδικά σημεία
αποκλίνουσας εξέλιξης, όλα τα ευκαρυωτικά κύπαρα (σακχαρομύ
του κυπαρικού κύκλου. Από τη μελέτη των μεταλλαγμένων στελε
κητες, ζωικά ή φυτικά κύπαρα) για να ελέγξουν τα γεγονότα του
χών ταυτοποιήθηκαν πολλά γονίδια υπεύθυνα για τον έλεγχο του
κυπαρικού κύκλου τους χρησιμοποιούν ουσιαστικά τα ίδια μόρια.
μίτωση
μεσόφαση
δραστικότητα του
μίτωση
μεσόφαση
---.........::.
MPF
(M-Cdk)
Εικόνα
18·10.
Η διακύμανση της δραστικότητας του
MPF κατά τη
διάρκεια του κυπαρικού κύκλου σε έμβρυα
τητα της ουσίας η οποία προσδιορίστηκε με τη μέθοδο που παρουσιάζεται στην Εικόνα της μίτωσης και μηδενίζεται εξίσου γρήγορα προς το τέλος της μίτωσης.
Xenopus. Η δραστικό 18-9 αυξάνει γρήγορα λίγο πριν από την έναρξη
ανενεργός
ανενεργός
M-Cdk
g
ανασταλτική
κινάση
~
Μ κuκλίνη
\... μιτωτική
Εικόνα
Cdk
ενεργός ενεργοποιός
M-Cdk
~
φωσφορική
-:"",/:
M-Cdk
φωσφατάση
ανασταλτική
ομάδ&:α P~
Α
Ρ
~
;,,,,....
ενεργοποιο,ς φωσφορικη
ενεργαπαιός κινάση
ομάδα
18-11. Η ενεργοποίηση της M-Cdk με
επιλεκτική φωσφορυλίωση και αποφωσφο ρυλίωση. Το σύμπλοκο Μ-κυκλίνης-Cd κινά σης, μόλις σχηματιστεί είναι ενζυμικά ανενερ
Cd κινάση
γό, Αργότερα, η
φωσφορυλιώνεται
σε θέσεις απαραίτητες για την ενεργοποίησή της και σε άλλες θέσεις που αναστέλλουν τη δράση της. Στο σημείο αυτό, η
M-Cdk παραμέ
νει ανενεργός. Όπως εικονίζεται, τελικά ενερ γοποιείται από μια φωσφατάση που αφαιρεί τις ανασταλτικές φωσφορικές ομάδες. Δεν εί
οιόσο, τα πράγματα είναι πιο σύνθετα. Στην περίmωση της
M-Cdk,
η συγκέ
ντρωση της Μ-κυκλίνης αυξάνει οιαδιακά καθόλη τη μεσόφαση, ενώ η ενερ γότητα της
M-Cdk αυξάνει απότομα προς το τέλος της μεσόφασης (βλ. Εικόνα 18-6). Συνεπώς, τι πυροδοτεί αυτή την ταχεία ενεργοποίηση της M-Cdk; Για την ενεργοποίηση της M-Cdk απαιτείται κάτι περισσότερο από την α
πλή συσσώρευση της κυκλίνης. Συγκεκριμένα, προκειμένου να εκδηλωσει
ναι ακόμα γνωστό πώς συντονίζεται χρονικά
την ενΖυμική της δράση η κινάση πρέπει να φωσφορυλιωθεί σε μια ή περισ
αυτή η ενεργοποίηση.
σότερες θέσεις και παράλληλα ν' αποφωσφορυλιωθεί σε άλλες θέσεις. Η α φαίρεση των αναοιαλτικών φωσφορικών ομάδων από μια ειδική πρωτεϊνική φωσφατάση είναι το βήμα που ενεργοποιεί την
φασης (Εικόνα
18-11).
Όπως φαίνεται οιην
M-Cdk οιο τέλος της μεσό Εικόνα 18-12, μόλις ενεργο
ποιηθεί, το σύμπλοκο Μ-κυκλίνης-Cd κινάσης μπορεί να ενεργοποιήσει πε ρισσότερα ανάλογα σύμπλοκα. Αυτή η θετική ανατροφοδότηση προκαλεί την αιφνίδια, εκρηκτική αύξηση της ενεργότητας της
αδρανής
ενεργοποιός
ενεργoπ~ιάς
~ Θ
φωσφαταση
ανασταλτική
_
'\
ΘΕΤιΚΗ
ΑΝΑΤΡΟΦΟΔΟΤΗΣΗ
Ι
_
~"",::
ενεργός
M--Cdk
M-Cdk
18-12.
Η ενεργοποιημένη
φάση
M-Cdk ε
και συνεπώς ενεργοποιεί περισσότερα μόρια ρεί πλέον να ενεργοποιήσει περισσότερα σύ μπλοκα M-Cdk. Παρόλο που δεν εικονίζεται ε αναστέλ
λει την ανασταλτική κινάση της Εικόνας
Διαφορετικά σύμπλο
κύκλου. Για παράδειγμα, ενώ το σύμπλοκο Μ-κυκλίνης-Cd κινάσης δρα οιη
της ενεργοποιού φωσφατάσης, η οποία μπο
M-Cdk επίσης
Cd κινασών.
κα κυκλίνης-Cd κινάσης πυροδοτούν διαφορετικά βήματα του κυπαρικού
νεργοποιεί έμμεσα περισσότερη M-Cdk. Μό λις ενεργοποιηθεί, η M-Cdk φωσφορυλιώνει
δώ, η ενεργοποιημένη
δlαφορεIlκά βήματα του κυπαρικού κύκλου
και - οιους περισσότερους ευκαρυώτες -
ομάδα
ανενεργός
ΔlαφορεIlκά σύμπλοκα κυκλίνης-Cd κινάσης πυροδοτούν
Στον έλεγχο του κυπαρικού κύκλου εμπλέκονται πολ/ά είδη κυκλινών
~
-~~~~: ~~ ~ φωσφορικη Εικόνα
προωθεί α
πότομα το κύπαρο οιη φάση Μ.
φωσφατάση
δραστική
M-Cdk που
18-11,
G2 και πυροδοτεί την
είσοδο οιη φάση Μ, για την είσοδο οιη φάση
S ευθύνονται οι κυκλίνες μιας ξεχωριοιής κατηγορίας, Υνωοιές ως κυκfι[vες 5 και κυκΛίvες G/S, ΟΙ οποίες για το σκοπό αυτό προσδένονται σε διαφορετι κά μόρια Cd κινασών προς το τέλος της φάσης Gl . Άλλες κυκλίνες, Υνωοιές ως κυκΛίvες rnς φάσnς G1, δρουν νωρίτερα οιη φάση Gl , Οι κυκλίνες αυτές προσδένονται σε μόρια Cd κινασών και συμβάλ/ουν οιο σχηματισμό και την ενεργοποίηση των συμπλόκων Gι-κυκλινών-Cd κινασών και, έτσι, προω θούν το κύπαρο οιη φάση
S. Όπως θα δούμε αργότερα, οια Ζωικά κύπαρα Gl κυκλινών-Cd κινασών συνήθως εξαρτά
ο σχηματισμός των συμπλόκων
γεγονός που επίσης προάγει την ενεργοποίη
ται από την παρουσία εξωκυπάριων σηματοδοτικών μορίων που διεγείρουν
ση της
τη διαίρεση των κυπάρων. Τα ονόματα των ξεχωριοιών Kυκruνών και των α
M-Cdk.
νεργοποιημένη
Με αυτούς τους τρόπους, η ε
M-Cdk ενεργοποιεί έμμεσα πε ρισσότερα σύμπλοκα M-Cdk. Έτσι, η ενεργο ποίηση της M-Cdk είναι εκρηκτική.
770
ντίοιοιχων
Cdk δίνονται
οιον Πίνακα
18-2.
Η συγκέντρωση κάθε είδους κυκλίνης αυξάνει και κατόπιν πέφτει απότο-
Κεφάλαιο 18: Έλεγχος του Κυτταρικού Κύκλου και Κυτταρικός Θάνατος
Πίνακας
18·2, Οι κύριες
κυκλίνες και
Cd κινάσες
των σπονδυλωτών
Σύμπλοκο κυκλίνης/Cdk
Κυκλίνη
ΣυνοδόςCdk
G1-Cdk G1/S-Cdk S-Cdk M-Cdk
κυκλίνη Ο*
Cdk4, Cdk6 Cdk2 Cdk2 Cdk1**
κυκλίνη Ε κυκλίνη Α
κυκλίνη Β
*Τα θηλαστικά έχουν τρεις κυκλίνες **Το πρώτο όνομα της
Cdk1
D (Ο 1, Ο2 και
Ο3).
στα σπονδυλωτά ήταν
Cdc2.
μα σε μια ορισμένη χρονική σrιγμή ίΟυ κυπαρικού κύκλου λόγω της αποδό μη σης σro μονοπάτι της ουβικουϊτίνης. Η αύξηση της συγκένφωσης μιας κυ κλίνης συμβάλλει σrην ενεργοποίηση της αντίσroιxης
Cd κινάσης,
ενώ η TQ-
χεία mώση της επαναφέρειτη συγκεκριμένηκινάση σε ανενεργό KOTάσrαση
(Εικόνα 18-13). Επομένως, η βραδεία συσσώρευση μιας κυκλίνης έως ένα
ορισμένο κρίσιμο επίπεδο (έναν ουδό) αποτελεί έναν φόπο με ίΟν οποίο ίΟ σύσrημα ελέγχου ίΟυ κυπαρικού κύκλου μεφά TQ μεσoδιασrήμαω ανάμεσα σroυς διαδοχικούς κυπαρικούς κύκλους.
Κάθε
Cd κινάση
κατ' αναίΊογία προς την
M-Cdk για να δράσει
πρέπει να
φωσφορυλιωθεί και ν' αποφωσφορυλιωθεί KOTάλ/nίΊα. Κάθε σύμπλοκο κυ κλίνης-Cd κινάσης επιδρά σε μια διαφορετική ομάδα πρωτεϊvών-σrόxων μέ σα σro κύπαρο. ΈΤσΙ, κάθε σύμπλοκο πυροδοτεί τη μετάβαση σ' ένα διαφο ρετικό βήμα ίΟυ κύκλου. Για παράδειγμα, η M-Cdk φωσφορυλιώνει κρίσιμες πρωτε'ϊνες που προκαλούν συμπύκνωση των χρωμοσωμάτων, αποδόμηση ίΟυ πυρηνικού περιβiΊήμαίOς και αναδιοργάνωση των μικροσωληνίσκων ίΟυ
ενεργοποίηση του μηχανισμού της μίτωσης
U
t
6J &>- Μ;';---
~~Ι
ι
,
Ι (η
(Β)
κυπαρική μεμβράνη
Εικόνα
o~
ρικό τοί-
χωμα
,
\
f~r
~
/)I\~
(Α)
,
\
κυστίδια που φραγμοπλάστης προέρχονται από τη συσκευή Golgi
(Δ)
σχηματισμός νέου KUΠαΡΙKOύ τοιχώματος
Ι
ολοκληρωμένο νέο κυπαρικό τοίχωμα
(Ε)
50
μm
Η κυπαροκίνηση σ' ένα φυτικό κύπαρο. Στην αρχή της τελόφασης, ενώ τα χρωμοσώματα έχουν ήδη διαχωριστεί (Α), ένα
νέο κυπαρικό τοίχωμα αρχίζει να σχηματίζεται μέσα στο κύπαρο, στον ισημερινό της παλαιάς ατράκτου (Β). Οι πολικοί μικροσωληνίσκοι της μιτωτικής ατράκτου που απομένουν και κατά την τελόφαση σχηματίζουν τον φραγμοπλάστη και καθοδηγούν τα κυστίδια προς το κέ ντρο της ατράκτου. Εδώ, μεμβρανικά κυστίδια που προέρχονται από τη συσκευή Golgi και είναι γεμάτα με υλικό του κυτταρικού τοιχώματος συντήκονται για να σχηματίσουν το νέο κυπαρικό τοίχωμα (η, το οποίο αναmύσσεται προς την περιφέρεια για να φτάσει στην κυπαρική μεμβράνη και στο αρχικό κυπαρικό τοίχωμα. Η κυπαρική μεμβράνη και η μεμβράνη που περιβάλλει το νέο κυπαρικό τοίχωμα (και οι δύο με κόκκινο χρώμα) συντήκονται και έτσι διαχωρίζουν πλήρως τα δύο θυγατρικά κύπαρα (Δ). Στο (Ε) παρουσιάζεται μια μικρογραφία ενός φυ τικού κυπάρου σ' ένα στάδιο της τελόφασης που αντιστοιχεί στο (Β). Το κύπαρο έχει χΡωσθεί έτσι ώστε να αναδειχθούν τόσο οι μικροσω
ληνίσκοι όσο και οι δύο ομάδες των θυγατρικών χρωμοσωμάτων. Η εντόπιση του αυξανόμενου νέου κυπαρικού τοιχώματος υποδηλώνεται από τις αιχμές των βελών. (Ε. Με την άδεια του
Andrew Bajer).
ρικής διαίρεσης yνωσrή ως μείωση. Αν δεν συνέβαινε η μείωση, η σύνΙηξη
ενός ωαρίου μ' ένα σπερμαΤΟΖωάριο θα οδηγούσε σε διπλασιασμό του α ριθμού των χρωμοσωμάτων σε κάθε γενεά και η φυλετική αναπαραγωγή θα ήταν αδύνατη. Παρά το γεγονός όη τα μηχανικά XαΡKατηρισrΙKά της μείωσης είναι πα
ρόμοια με τ' ανIίσroιxα της μίτωσης, η συμπεριφορά των χρωμοσωμάτων εί ναι κάπως διαφορεηκή. Στο επόμενο κεφάλαιο, θα παρουσιάσουμε τη μείω
ση και θα εξετάσουμε πώς αυτή η εξειδικευμένη διεργασία κυπαρικής διαί ρεσης βρίσκεται σrη βάση των γενεηκών αρχών που καθορίΖουν τους κανό νες της κληρονομικότητας.
Βαοικέs έvvοιεs •
Η κυπαρική διαίρεση συμβαίνει κατά τη διάρκεια της φάσης Μ, οπότε πρώτα διαιρείται ο πυρήνας (μίτωση) και μετά το κυπαρόπλασμα (κυπα ροκίνηση).
•
Το
DNA ανηγράφεται
κατά τη φάση
S, προτού
αρχίσει η φάση Μ. Τα δύο
ανΙίγραφα κάθε διπλασιασμένου χρωμοσώματος (ονομάΖΟνΙαι αδελφές χρωματίδες) συνδέΟνΙαι σφιχτά με ης κοεΖίνες.
•
Η Μ φάση αρχίΖει από ης φωσφορυλιώσεις που πυροδοτεί η ενεργοποιη μένη
•
M-Cdk.
Η έναρξη της φάσης Μ σηματοδοτείται από τον σχημαησμό της μιτωηκής
Βασικές Έννοιες
815
ατράκτου που αποτελείται από μικροσωληνίσκους και διαχωρίζει τα θυγα τρικά χρωμοσώματα mους αντίθετους πόλους του κυττάρου.
•
Προτού συναρμολογηθεί η μιτωτική άτρακτος
mnv αρχή της φάσης Μ,
δι
πλασιάΖεται το κεντροσωμάτιο. Τα δύο θυγατρικά κεντροσωμάτια διαχω ρίΖΟνται και μετακινούνται προς τις αντίθετες πλευρές του πυρήνα για να σχηματίσουν τους δύο πόλους της ατράκτου.
•
Τόσο ο διαχωρισμός των χρωμοσωμάτων όσο και η συναρμολόγηση της ατράκτου βασίΖονται σε κινητήριες πρωτεΙνες που αλ/ηλεπιδρούν με τους μικροσωληνίσκους.
•
Οι μικρο σωληνίσκοι εκφύονται από τα κεντροσωμάτια. Ορισμένοι από αυτούς αλ/ηλεπιδρούν με μικροσωληνίσκους που εκφύονται από τον α
ντίθετο πόλο και με τον τρόπο αυτό μετατρέπονται mους πολικούς μικρο σωληνίσκους της ατράκτου.
•
Όταν αποδομείται το πυρηνικό περίβλημα, οι μικροσωληνίσκοι της ατρά κτου εισβάλ/ουν
mnv περιοχή
του πυρήνα. Μερικοί από αυτούς συλ/αμ
βάνουν τα διπλασιασμένα χρωμοσώματα μέσω της πρόσδεσής τους σε πρωτεϊνικά σύμπλοκα yvωmά ως κινητοχώροι, τα οποία σχετίζονται με το κεντρομερίδιο κάθε αδελφής χρωματίδης.
•
Μικροσωληνίσκοι από τους αντίθετους πόλους της ατράκτου έλκουν προς αντίθετες κατευθύνσεις τ' αντιγραμμένα χρωμοσώματα, κάνοντάς τα να παραταΧθούν
•
mov ισημερινό
της ατράκτου.
Τα θυγατρικά χρωμοσώματα παράγονται από τον αιφνίδιο διαχωρισμό των αδελφών χρωματίδων και έλκονται από την άτρακτο προς τους δύο πόλους. Οι δύο πόλοι επίσης απομακρύνονται μεταξύ τους, διαχωρίΖΟ
ντας έτσι ακόμα περισσότερο τις δύο ομάδες των χρωμοσωμάτων.
•
Η μετακίνηση των χρωμοσωμάτων από την άτρακτο προωθείται τόσο από τις κινητήριες πρωτεΙνες των μικροσωληνίσκων όσο και από τον πολυμε ρισμό και τον αποπολυμερισμό των χρωμοσωμάτων.
• r ύρω από τα δύο σύνολα των διαχωρισμένων χρωμοσωμάτων ανασχημα τίΖεται ένα πυρηνικό περίβλημα. Έτσι, προκύπτουν δύο νέοι πυρήνες και με τον τρόπο αυτό ολοκληρώνεται η μίτωση.
•
Κατά τη διάρκεια της φάσης Μ, τα μεγάλα μεμβρανικά οργανίδια, όπως το ενδοπλασματικό δίκτυο και η συσκευή
Golgi, κατακερματίΖονται
σε πολ/ά
μικρότερα κλάσματα, γεγονός που εξασφαλίΖει την ισότιμη κατανομή τους
ma θυγατρικά κύτταρα. •
Στα Ζωικά κύτταρα, η κυτταρική διαίρεση ολοκληρώνεται από έναν συ mαλτικό δακτύλιο νηματίων ακτίνης και μυοσίνης που συναρμολογείται
mo
μέσον της απόmασης ανάμεσα mους πόλους της ατράκτου και συ
mέλ/εται για να διαιρέσει το κυτταρόπλασμα
ma δύο.
Αντίθετα,
ma φυτι
κά κύτταρα η κυτταρική διαίρεση ολοκληρώνεται με το σχηματισμό ενός
νέου κυτταρικού τοιχώματος μέσα
πλασμα
816
Κεφάλαιο 19: Κυτταρική Διαίρεση
ma δύο.
mo
κύτταρο, που διαιρεί το κυτταρό
Βασικοί Όροι αδελφή χρωματίδη
μετάφαση
ανάφαση
μίτωση
απλοειδής
μιτωτική άτρακτος
αστέρας
πόλος της ατράκτου
Cdk φάσης
Μ
(M-Cdk)
προμετάφαση
δακτύλιος Υ-τουμπουλίνης
πρόφαση
διπλοειδής
σύμπλοκο που προάΥει την ανάφαση
καταστροφίνη
συμπύκνωση χρωμοσωμάτων
κεντροσωμάτιο
τελόφαση
κινάση εξαρτώμενη από την κυκλίνη
(Cdk)
(APC)
φάση Μ
κινητοχώρος
φραΥμοπλάστης
κοεΖίνη
χρωματίδη
κοντενσίνη κυπαροκίνηση
μείωση
Ερωιήσειs Ερώmση
Ζ. Για την αντΙΥραφή του
DNA απαιτούνται
πολυμερισμός
και αποπολυμερισμός των μικροσωληνίσκων καθώς και
19-5
οι κινητήριες πρωτεΙνες των μικροσωληνίσκων.
Ποιες από τις ακόλουθες δηλώσεις είναι σωστές; Δικαιο
Η. Οι μικροσωληνίσκοι εμπυρηνώνονται στα κεντρομερί
λΟΥείστε τις απαντήσεις σας.
δια και κατόπιν συνδέονται με τους κινητοχώρους, οι ο
Α. Τα κεντροσωμάτια αντΙΥράφονται ανεξάρτητα από τα
ποίοι είναι δομές που βρίσκονται στην περιοχή του κε
χρωμοσώματα.
ντροσωματίου των χρωμοσωμάτων.
Β. Κατά τη μίτωση το πυρηνικό περίβλημα κατακερματίΖε
19-6
ται. Έτσι, κατανέμεται στα θυΥατρικά κύπαρα όπως και
Ερώτηση
τα υπόλοιπα μεμβρανικά ΟΡΥανίδια, π.χ. το ενδοπλα
Περίπου πόσος χρόνος θα χρειαΖόταν Υια να σχηματιστεί
σματικό δίκτυο και η συσκευή
με επανειλημμένες κυπαρικές διαιρέσεις ενός Υονιμοποι
Γ. Από την αντΙΥραφή του
Golgi.
DNA ενός χρωμοσώματος
προ
ημένου ωαρίου ένα συσσωμάτωμα κυπάρων βάρους
70 1
κύπτουν δύο αδελφές χρωματίδες οι οποίες παραμέ
kg,
νουν ΖευΥαρωμένες καθώς παρατάσσονται στην πλάκα
νανΟΥραμμάριο και ο κάθε κυπαρικός κύκλος διαρκούσε
της μετάφασης.
24 ώρες;
Δ. Το συνολικό
DNA του
πυρήνα ενός κυπάρου που πα
ράΥεται από τη μείωση είναι μισό από το
DNA ενός
κυτ
αν κάθε κύπαρο μετά την κυπαρική διαίρεση ΖύΥΙΖε
Γιατί χρειάΖεται να μεσολαβήσει ένα πολύ μεΥα
λύτερο χρονικό διάστημα Υια τη δημιουΡΥία ενός ενηλίκου ανθρώπου βάρους
70 kg;
τάρoυ που παράΥεται από τη μίτωση.
Ε. Οι πολικοί μικροσωληνίσκοι συνδέονται με τα άκρα
Ερώτηση
19-7
τους και επομένως εκτείνονται συνεχώς από τον ένα
Με ποια σειρά συμβαίνουν τα ακόλουθα ΥεΥονότα κατά
πόλο της ατράκτου στον άλ/ο.
την κυπαρική διαίρεση;
Ερωτήσεις
817
Α. ανάφαση
ριγράφεΤΩΙ στο Κεφάλαιο
Β. μετάφαση
η δρα το αντίσωμα; Τι επιπτώσεις θα είχε η ένεση αυτού
17). Με ποιο τρόπο
πιστεύετε ό
Γ. προμετάφαση
του αντισώματος στα κύτταρα (α) στη μεΤΩκίνηση των χρω
Δ. τελόφαση
μοσωμάτων κατά την ανάφαση; (β) στην κυπαροκίνηση;
Ε.πανσέληνος
19-11
Ζ. μίτωση
Ερώτηση
Η.πρόφαση
Με οδηγό το Παράρτημα
19-1, σχεδιάστε
ΤΩ κύρια στάδια
της μίτωσης. Χρωματίστε μια αδελφή χρωματίδη και παρα
Epώman
κολουθείστε την στα διάφορα στάδια της μίτωσης και της
19-8
Στους ευκαρυωηκούς oργανισμoύς~ οι βραΧύτεροι κύκλοι
κυπαροκίνησης. Ποιο γεγονός δεσμεύει αυτή τη χρωμοτί
Ζωής (βραΧύτεροι ακόμα και από τους κύκλους Ζωής των
δη να καΤΩλήξει σ' ένα συγκεκριμένο θυγατρικό κύπαρο;
βακτηρίων) συναντώνται σε πολ/ά πρώιμα έμβρυα Ζώων.
Μετά την αρχική δέσμευση της χρωματίδης, μπορεί ν' α
Οι διαιρέσεις αυτές συμβαίνουν χωρίς σημαντική αύξηση
ναστραφεί η τύχη της; Τι θα μπορούσε να επηρεάζει αυτή
του βάρους του εμβρύου. Πώς γίνεΤΩΙ αυτό; Ποια φάση
τη δέσμευση;
του κυτταρικού κύκλου αναμένετε να είναι περισσότερο Ερώmση
μειωμένη;
19-12
Η μεΤΩκίνηση των χρωμοσωμάτων προς τους πόλους της Ερώmση
19-9
ατράκτου κατά τη διάρκεια της ανάφασης Α σχετίΖεΤΩΙ με
Σ' ένα κύπαρο θηλαστικού, ο χρόνος Ζωής ενός μικροσω
βράχυνση των μικροσωληνίσκων. Συγκεκριμένα, οι μι
ληνίσκου, από το σχημαησμό του με πολυμερισμό έως και
κροσωληνίσκοι αποπολυμερίΖΟνται στα άκρα που προ
την αυθόρμητη εξαφάνισή του με αποπολυμερισμό, ποι
σκολ/ώνται στους κινητοΧώρους. Σχεδιάστε ένα πρότυπο
κίλλει ανάλογα με το στάδιο του κυπαρικού κύκλου. Για έ
που να ερμηνεύει πώς ένας μικροσωληνίσκος μπορεί να
5 λε
βραΧύνεται και να παράγει δύναμη και παρόλα αυτά να
να κύτταρο που αυξάνεΤΩΙ ο μέσος χρόνος Ζωής είναι πτά της ώρας στη μεσόφαση και
15 δευτερόλεπΤΩ
στη μί
παραμένει σταθερά προσδεδεμένος στο χρωμόσωμα.
τωση. Αν το μήκος ενός μικροσωληνίσκου κοτά τη μεσό
φαση είναι κατά μέσο όρο
20 μm,
πώς θα μεΤΩβληθεί κα
Ερώτηση
19-13
τά τη διάρκεια της μίτωσης, με την παραδοχή όη η ΤΩΧύτη
Η ισορροπία μεΤΩξύ των κινητήριων πρωτεϊνών που προσ
ΤΩ σχημαησμού των μικροσωληνίσκων με την προσθήκη
δένονται στους πολικούς μικροσωληνίσκους στην περιοχή
υπομονάδων τουμπουλίνης είναι ίδια και στις δύο φάσεις;
επικάλυψης της μιτωηκής ατράκτου και κατευθύνονται
Αν ένα τυπικό κεντροσωμάηο ενός μεσοφασικού κυττά
προς ΤΩ συν ή ΤΩ πλην άκρα των μικροσωληνίσκων θεω
ρου διαθέΤει
θέσεις εκκίνησης για μικροσωληνί
ρείΤΩΙ όη βοηθά να καθοριστεί το μήκος της ατράκτου.
σκους, πόσες ανάλογες θέσεις αναμένετε να υπάρχουν
Πώς θα μπορούσε να συνεισφέρει σε αυτό κάθε είδος κι
στα κεντροσωμάηα ενός μιτωηκού κυττάρου, αν υποθέ
νητήριας πρωτεΊνης;
100
σουμε όη ο συνολικός αριθμός των μορίων της τουμπουλί νης που πολυμερίΖΟνται σε μικροσωληνίσκους είναι ο ί
Εικόνα
διος και σης δύο φάσεις;
Σε σπάνιες περιστάσεις, και οι δύο αδελφές χρωμοτίδες ε
19-14
νός διπλασιασμένου χρωμοσώματος καΤΩλήγουν στο ίδιο Ερώmση
19-10
θυγατρικό κύτταρο. Πώς θα μπορούσε να συμβεί αυτό;
Ένα αντίσωμα εναντίον της μυοσίνης παρεμποδίΖει τη με
Ποιες θα ήΤΩν οι πιθανές επιπτώσεις ενός τέτοιου μιτωη
ΤΩκίνηση των μορίων της μυοσίνης κοτά μήκος των νημα
κού λάθους;
τίων της ακτίνης (η αλληλεπίδραση μυοσίνης-ακτίνης πε-
818
Κεφάλαιο 19: Κυτταρική Διαίρεση
ΓΕVεlιιΟ 0.1
ματοδΟτΙκή πρωτεϊ\ιη (μια πρωτεϊνική Κlνάση τηςτυροσίνης) που κάνει ω κύτ
κύπαρα)
σχεδιάστηκε ειδικά έιοι ώστε ν' αναστέλ/ει τη δραστικό
τητα αυτής της κινάσης (Εικόνα
21-52) . Τα αποτελέσματα του Gleevec υπήρ
10
ξαν εντυπωσιακά: στους περισσότερους ασθενείς αναστέλ/εται ισχυρά ο α νώμαλος πολ/απλασιασμός και η επιβίωση των λευχαιμικών κυπάρων και ε
20
30
40
διπλασιασμοίτου πληθυσμού των καρκινικών κυπάρων
Εικόνα
21-51.
Ο καρκίνος συνήθως διαγι
πιτυγΧάνεται παρατεταμένη ύφεση. Το ίδιο φάρμακο είναι αποτελεσματΙκό σε
γνώσκεται αφού προηγουμένως αυξηθεί τό
μερικούς άλλους καρκίνους που σχετίζονται με παρόμοια ογκογονίδια.
σο ώστε να περιέχει εκατοντάδες εκατομμύ
Το παράδειγμα του
Gleevec μας κάνει να αισιοδοξούμε
ότΙ σύντομα, δια
ρια κύπαρα. Λογαριθμικό διάγραμμα της αύ ξησης ενός τυπικού καρκίνου. Προτού γίνει α
θέτοντας εξελιγμένες γνώσεις για τη μοριακή βιολογία του καρκίνου, θα κα
ντιληπτός ο καρκίνος μπορεί να περάσουν
τορθώσουμε να σχεδιάσουμε ορθολογικά αποτελεσματΙκές μεθόδους θερα
χρόνια: για παράδειγμα, ο χρόνος διπλασια
πείας για ακόμα μεγαλύτερο φάσμα τύπων καρκίνου.
σμού του καρκίνου του μαστού συνήθως είναι περίπου
100 ημέρες.
(Α) ΔΡΑΣΤΗΡΙΑ ΟΓΚΟΓΟΝΟΣ ΚΙΝΑΣΗ
_
-
σήμα για
πολλαπλασιασμό
_
ΛΕΥΧΑΙΜΙΑ
και επιβίωση
των KUΠάρων ενεργοποιός φωσφορική ομάδα
ογκογόνος κινάση
ΑΝΑΣΤΟΛΗ ΟΓΚΟΓΟΝογ ΚΙΝΑΣΗΣ ΜΕ
GLEEVEC κανένα σήμα
-
ΟΧΙ ΛΕΥΧΑΙΜΙΑ
ογκογόνος
κινάση
Εικόνα
21-52. Το φάρμακο Gleevec αναστέλλει
τη δράση μιας ογκογόνου πρωτείνης και αναχαιτίζει την αύξηση μερικών μορφών καρ
κίνου. (Α) Η χρόνια μυελογενής λευχαιμία χαρακτηρίζεται από υπερπαραγωγή λευκών αιμοσφαιρίων. Σχεδόν πάντοτε οφείλεται σε μια ει δική μετάλλαξη (μια χΡωμοσωμική μετάθεση), η οποία επηρεάζει το γονίδιο μιουργεί μια ογκογόνο μορφή του
Abl: η αντίστοιχη
Abl που
κωδικοποιεί μια κινάση της τυροσίνης. Η μετάλλαξη δη
πρωτεΊνη είναι υπερδραστήρια, φωσφορυλιώνει άλλες πρωτεΊνες ενώ δεν θα έπρεπε και
έτσι δημιουργεί ένα ενδοκυπάριο σήμα που προάγει την υπέρμετρη παραγωγή λευκών αιμοσφαιρίων. Το Gleevec προσδένεται στο θύλα κο πρόσδεσης του ΑΤΡ πάνω στην υπερδραστήρια κινάση και έτσι την εμποδίζει να μεταφέρει μια φωσφορική ομάδα από το ΑΤΡ σε μια τυ
ροσίνη των πρωτε'ίνών-στόχων της. Η αναστολή εμποδίζει την προώθηση ενός σήματος για πολλαπλασιασμό και επιβίωση των κυττάρων. Gleevec επίσης είναι αποτελεσματικό και εναντίον μερικών άλλων καρκίνων που σχετίζονται με ογκογονίδια τα οποία κωδικοποιούν πρω τε'ίνικές κινάσες παρόμοιες με την Abl. (8) Η δομή ενός συμπλόκου του Gleevec (μπλε) με την περιοχή κινάσης τυροσίνης της πρωτεΊνης Abl (διάγραμμα κορδέλας), όπως καθορίστηκε με κρυσταλλογραφία ακτίνων Χ. (Από: 1. Schindler et la., Science 289: 1938-1942, 2000. © AAAS). Το
Καρκίνος
915
Βαοικέs έvνΟΙΕS • •
ΟΙΙσΙοί αποτελούνιοι από κύπαρα και εξωκυπάριο σΙρώμα. Σιο φυτά, κάθε κύπαρο περιβάλλεται από εξωκυπάριο σΙρώμα υπό μορ φή ενός κυπαρικού τοιχώματος που αποτελείται από κυπαρίνη και άλλους πολυσακχαρίτες.
•
Τα γυμνά φυτικά κύπαρα είναι εύθραυσΙα αλλά μπορούν ν' ασκήσουν ω σμωτική ογκωτική πίεση σιο κυπαρικό τοίχωμα έτσι ώσΙε να διατηρούν τονΙσΙό.
•
Οι ίνες της κυπαρίνης σιο κυπαρικό τοίχωμα των φυτικών κυπάρων προσ δίδουν εκτατική ισχύ. Ά!\Λα συσΙατικά του τοιχώματος προσδίδουν αντοχή σΙη συμπίεση.
•
Ο προσανατολισμός σΙον οποίο εναποτίθεται η κυπαρίνη ελέγχει και την κατεύθυνση σΙην οποία θα αυξηθεί το φυτό.
•
Οι συνδετικοί ΙσΙοί των Ζώων παρέχουν μηχανική σΙήριξη και αποτελού νται από εξωκυπάριο σΙρώμα και λίγα διάσπαρτα κύπαρα.
•
Τα οργανικά συσΙατικά του σΙρώματος παράγονται από τα κύπαρα του συνδετικού ΙσΙού που είναι ενσωματωμένα σιο σΙρώμα (σΙους περισσότε ρους συνδετικούς ΙσΙούς αποκαλούνταιινοβΜσΙες).
•
Στο εξωκυπάριο σΙρώμα των Ζώων, εκτατική ισχύ παρέχει το κολλαγόνο, μια ινώδης πρωτεΊνη.
•
Η τάση μεταδίδεται από τον κυπαροσκελετό ενός κυπάρου του συνδετι κού ΙσΙού σΙις ίνες του κολλαγόνου μέσω της διαμεμβρανικής πρωτείνης
ιντεγκρίνη και της εξωκυπάριας πρωτεΊνης-ινωδονεκτίνη.
•
Οι γλυΚΟΖαμινογλυκάνες
(GAGs)
σχηματίΖουν σύμπλοκα με πρωτείνες
(πρωτεογλυκάνες), τα οποία γεμίΖουν τους χώρους ανάμεσα σΙα κύπαρα και προσδίδουν αντοχή σε συμπίεση.
•
Κύπαρα που διασυνδέονται με επιθηλιακά φύλλα επενδύουν όλες τις ε ξωτερικές και τις εσωτερικές επιφάνειες του σώματος των Ζώων.
•
Στα επιθηλιακά φύλλα, αντίθετα από τον συνδετικό ΙσΙό, η τάση μεταδίδε ται απευθείας από κύπαρο σε κύπαρο μέσω των διακυπάριων συνδέσμων.
•
Οι πρωτείνες της οικογένειας των καντερινών διαπερνούν την κυπαρική μεμβράνη των επιθηλιακών κυπάρων και προσδένονται σε παρόμοιες κα ντερίνες των γειτονικών επιθηλιακών κυπάρων.
•
Σ' ένα σύνδεσμο προσκόλλησης οι καντερίνες προσδένονται σε νημάτια ακτίνης, ενώ σ' ένα δεσμοσωμάτιο προσδένονται σε νημάτια κερατίνης.
•
Τα νημάτια ακτίνης που διασυνδέονται από κύπαρο σε κύπαρο μέσα σ' έ να επιθήλιο μπορεί να συσΙαλούν, αναγκάΖοντας το επιθήλιο να καμφθεί.
•
Τα ημιδεσμοσωμάτια προσκολλούν τη βασική πλευρά ενός επιθηλιακού κυπάρου σΙον βασικό υμένα.
•
Οι σΙεγανοί σύνδεσμοι «σφραγίΖουν» τα γειτονικά επιθηλιακά κύπαρα και δημιουργούν έναν φραγμό σΙη διάχυση διαμέσου του επιθηλίου.
•
Οι χασμοσύνδεσμοι σχηματίΖουν διαύλους που επιτρέπουν σΙα μικρά μό ρια και σΙα ιόντα να περνούν από κύπαρο σε κύπαρο. Τα πί\ασμοδέσμα τα των φυτών έχουν την ίδια λειτουργία αλλά διαφορετική δομή.
916
Κεφάλαιο 21 : Ιστοί και Καρκίνος
•
Οι περισσότεροι ιστοί των σπονδυίΊωτών είναι περίπίΊοκα μείΥματα κυττα ρικών τύπων που υπόκεινται σε συνεχή ανακύκλωση.
•
Η δομή του ενήίΊικου ΟΡΥανισμού συντηρείται και ανανεώνεται με τις ίδιες βασικές δΙεΡΥασίες που τη δημιουΡΥούν στο έμβρυο: κυτταρική επικοινω-
· •
νία, επιίΊεκτική διακυττάρια προσκόλ/ηση και κυτταρική μνήμη.
Νέα, τείΊικώς διαφοροποιημένα κύτταρα παράΥΟνται από τ' αρΧέΥονα κύτ ταρα' συνήθως μέσω της παραΥωΥής πολ/απίΊασιαΖόμενων πρόδρομων κυττάρων.
•
Τα εμβρυϊκά αρΧέΥονα κύτταρα μπορεί να διατηρηθούν επ' αόριστον σε καλ/ιέΡΥεια, διατηρώντας την ικανότητα να διαφοροποιούνται σε οποιο δήποτε είδος κυττάρων του σώματος.
•
Με την τεχνική της μεταμόσχευσης πυρήνων, θεωρητικά μπορεί να παρα
χθούν εξατομικευμένα αρΧέΥονα κύτταρα Υια οποιονδήποτε ενήίΊικο. Αυ τή η τεχνική ονομάΖεται «θεραπευτική κλωνοποίηση».
•
Τα καρκινικά κύτταρα παραβαίνουν εΥωιστικά τους περιορισμούς που διατηρούν την κανονική ΟΡΥάνωση των ιστών: πολ/απίΊασιάΖονται όταν δεν πρέπει και διεισδύουν σε περιοχές που θα έπρεπε να αποφεύΥουν.
•
Ο καπνός προκαίΊεί περισσότερους καρκίνους από οποιοδήποτε άλ/ο με ταλ/αξΙΥόνο του περιβάλ/οντος.
•
Ο καρκίνος προκύπτει από τη συσσώρευση πολ/ών σωματικών μεταλ/ά ξεων σε μια κυτταρική σειρά.
•
Τα καρκινικά κύτταρα είναι Υενετικώς ασταθή και χαρακτηρίζονται από υ ψηίΊή συχνότητα μεταλ/άξεων. Πολ/ά εμφανίΖουν μεΥάίΊες χρωμοσωμι
κές ανωμαίΊίες.
•
Τα καρκινικά κύτταρα συνήθως εκφράΖουν το ένΖυμο τείΊομεράση. Αυτό τους επιτρέπει να συνεΧίσουν να διαιρούνται όταν τα φυσιοίΊΟΥικά κύτταρα κανονικά θα σταματούσαν.
•
Τα περισσότερα καρκινικά κύτταρα του ανθρώπου φέρουν μεταλ/άξεις στο Υονίδιο ρ53. Έτοι επιβιώνουν και διαιρούνται, έστω και αν το ΟΝΑ τους έχει υποστεί βiΊάβες.
•
Οι μεταλ/άξεις που προάΥουν τον καρκίνο δρουν μετατρέποντας πρωτοο ΥΚΟΥονίδια σε υπερδραστήρια ΟΥΚΟΥονίδια ή αδρανοποιώντας ΟΥκοκατα σταίΊτικά Υονίδια.
•
ΟΥκοκατασταίΊτικά Υονίδια μερικές φορές αναγνωρίΖΟνται από τη μείΊέτη σπάνιων ΟΙΚΟΥενών μορφών καρκίνου: τα μέίΊη των προσβεβίΊημένων οι ΚΟΥενειών έχουν κληρονομήσει μια μετάλ/αξη στο ένα αντίΥραφο του ΥΟ νιδίου.
Βασικές Έννοιες
917
Βασικοί Όροι αναπαραγωγική κλωνοποίηση
καντερίνη
αρχέγονο εμβρυϊκό κύτταρο
καρκίνος
αρχέγονο κύτταρο
κολλαγόνο
βασικό
κορυφαίο
βασικός υμένας
κυτταρική μνήμη
γενεηκή ασrάθεια
κυτταρική συμβολή
γλυΚΟΖαμινογλυκάνη
κυτταρικό τοίχωμα
δεσμοσωμάηο
μετάσrαση
εξωκυττάριο σrρώμα
ογκογονίδιο
ημιδεσμοσωμάηο
OγKOKαTOσrαληKό γονίδιο
θεραπευηκή κλωνοποίηση
σrεγανή σύνδεση
ισrός
χασμοσύνδεσμος
Ερωιήσειs
Ερώmση 21-10 Ποιες από ης ακόλουθες ουσίες θα αναμένατε να διασπεί ρονται ανάμεσα σrα κύτταρα διαμέσου: (α) χασμοσυνδέ
Epώmon21-9
σμων και (β) πλασμοδεσμάτων: γλουταμικό οξύ,
Ποιες από ης ακόλουθες διαπισrώσεις είναι σωσrές; Δι
κυκλικό ΑΜΡ, Ca
KαιOλOγήσrε ης απαντήσεις σας.
πίδια.
2
+,
mRNA,
G-πρωτεινες, μεμβρανικά φωσφολι
Α. Οι χασμοσύνδεσμοι συνδέουν τον κυτταροσκελετό ε νός κυττάρου με τον κυτταροσκελετό ενός γειτονικού
Ερώτηση 21-11
κυττάρου ή με το εξωκυττάριο σrρώμα.
Σxoλιάσrε την ακόλουθη φράση: «Αν ΤΟ φυηκά κύτταρα
Β. Ένα μαραμένο φύλλο μοιάΖει με ξεφούσκωτο λάσrιxo ποδηλάτου.
r. Χάρη σrην άκαμπτη δομή τους, οι πρωτεογλυκάνες
περιείχαν ενδιάμεσα ινίδια ΤΟ οποία θα τους προσέδιδαν αντοχή σrην πίεση, τότε το κυτταρικό τοίχωμά τους θα ήτον
αν
περιττό».
θίσrανται σε μεγάλες συμπιεσrΙKές δυνάμεις. Δ. Ο βασικός υμένας είναι μια εξειδικευμένη σrιβάδα εξω
Ερώmση
21-12
κυττάριου σrρώματoς σrην οποία προσκολλώνται φύλ
Οι χασμοσύνδεσμοι διεκπεραιώνουν τη μετοβολική και η
λα επιθηλιακών κυττάρων.
λεκτρική σύΖευξη των κυττάρων μέσω της ανταλλαγής μι
Ε. Τα κύτταρα του δέρματος αποπίmουν συνεΧώς και ανα
κρών μετοβολιτών και ιόντων. Με αυτό το δεδομένο, κατά
νεώνονται κάθε λίγες εβδομάδες. Επομένως, για να γί
τη γνώμη σας, για ποιο λόγο οι νευρώνες επικοινωνούν
νει ένα μόνιμο τοτουάΖ είναι απαραίτητο να εναποτεθεί
κυρίως μέσω συνάψεων και όχι μέσω χασμοσυνδέσμων;
XρωσrΙKή κάτω από την επιδερμίδα.
Ζ. Τα αρΧέγονα κύτταρα δεν είναι διαφοροποιημένα. Ω
Ερώmση
21-13
σrόσo, είναι καθορισμένα και αποδίδουν μόνο ειδικούς
Η Ζελατίνη αποτελείτοι κυρίως από κολλαγόνο, το οποίο
κυτταρικούς τύπους.
ευθύνεται για την αξιοσημείωτη διαταηκή ισχύ του συνδε-
918
Κεφάλαιο 21 : Ιστοί και Καρκίνος
τικού ισroύ. Το κολ/αγόνο είναι το βασικό συσrαΤΙKό του
180
Ζελέ. Ωσrόσo, όπως γνωρίΖετε από πρώτο χέρι, όταν τρώτε
160
Ζελέ φράουλα, το Ζελέ δεν έχει καμιά διατατική ισχύ. Γιατί; (f ω
.'!> 140 σ > :::>
Ερώτηση 21-14
>-
ο
«Η δομή ενός οργανισμού καθορίΖεται από το γονιδίωμα
ο
ο
120
ό ο
που περιέχει το ωάριο». Σε ποιες ενδείξεις βασίΖεται αυτή
~
-σ
>
η διαπίσrωση; Mάλισrα, ένας φίλος, σας προκαλεί και προ
100
σ
:::> Ο
τείνει να αντΙKατασrήσετε το ΟΝΑ του ωαρίου ενός πελαρ
.~
80
'" '" 5" Q. σ
γού με ανθρώπινο ΟΝΑ και να δείτε αν θα προκύψει ένα μωρό. Τι απάντηση θα του δώσετε;
60
3
.5
5
Ερώτηση
40
21-15 20
Οι λευχαιμίες, δηλαδή οι καρκίνΟ! που προκύπτουν από
μεταλλάξεις Ο! οποίες προκαλούν υπέρμετρη παραγωγή
0-----
λευκών αιμοσφαιρίων, εκδηλώνονται σε μικρότερη ηλικία από άλλες μορφές καρκίνου. Γιατί άραγε συμβαίνει αυτό; Ερώτηση
10
20
30
40
50
60
70
80
ηλικία
Εικόνα Ε21-16
21-16
Eξετάσrε προσεκτικά τη γραφική παράσrαση της Εικόνας
Ε21-16 που αποδίδει την επίπτωση του καρκίνου του πα
τικών ορμονών) αυξάνουν την επίπτωση ορισμένων μορ
Χέος εντέρου σrις γυναίκες σε σΧέση με την ηλικία. Γιατί
φών καρκίνου. Για το λόγο αυτό μερικά από τα πρώτα α
είναι τόσο απότομη η κλίση της καμπύλης αν οι μεταλ/ά
ντισυλ/ηπτικά Χάπια που περιείχαν μεγάλες συγκεντρώ
ξεις συμβαίνουν με την ίδια συχνότητα σε όλη τη διάρκεια
σεις oισrρoγόνων τελικά αποσύρθηκαν, επειδή βρέθηκε
της Ζωής ενός ανθρώπου;
ότι αύξαναν τον κίνδυνο ανάmυξης του καρκίνου του εν δομητρίου.
Ερώτηση
21-17
Transexual άνδρες
που χρησιμοποιούν σκευ
άσματα oισrρoγόνων για να αποκτήσουν γυναικεία χαρα
Οι βαρείς Kαπνισrές όπως επίσης και οι βιομηχανικοί ερ
κτηρισrΙKά έχουν αυξημένο κίνδυνο καρκίνου του μασroύ.
γάτες οι οποίοι εκτίθενται για βραχύ χρονικό διάσrημα σ'
Τα υψηλά επίπεδα των ανδρογόνων (αρσενικές φυλετικές
ένα χημικό καρκινογόνο που προκαλεί μεταλλάξεις σro
ορμόνες) αυξάνουν τον κίνδυνο ορισμένων άλλων μορ
ΟΝΑ συνήθως δεν αναπτύσσουν καρκίνους XαραKτηρισrι
φών καρκίνου, όπως είναι ο καρκίνος του πρoσrάτη. Με
κούς για τη συνήθεια ή το επάΥΥελμά τους προτού περά
αυτά τα δεδομένα, δικαιούται κανείς να συμπεραίνει ότι τα
σουν
oισrρoγόνα και τα ανδρογόνα είναι μεταλ/αξιγόνα;
10, 20 ή ακόμα
περισσότερα χρόνια. Προτείνατε μια
ερμηνεία για αυτή τη μεγάλη χρονική Kαθυσrέρηση.
Ερώτηση Ερώτηση
21-18
21-19
Είναι κληρονομικό νόσημα ο καρκίνος;
Τα υψηλά επίπεδα των oισrρoγόνων (των θηλυκών φυλε-
Ερωτήσεις
919
Απαvιήσειs Κεφάλαιο Απάντηση
Απάντηση
1
1-3
Είναι εξαιρετικά απίθανο να δημιουργήσατε ένα νέο οργανισμό
1-1
με αυτό το πείραμα. Πολύ πιθανότερο είναι να έπεσε στον θρε
Η Ζωή δεν καθορίΖεται εύκολα από μια συλ/ογή ιδιοτήτων, ό
πτικό Ζωμό σας ένας σπόρος από τον αέρα, να βλάστησε και να
πως φαίνεται από τον Πίνακα ΑΙ-Ι. Οι ηλεκτρικές σκούπες εί
απέδωσε τα κύπαρα που παρατηρήσατε. Στα μέσα του 190υ αι
ναι πολύ οργανωμένα αντικείμενα, προσλαμβάνουν ύλη και ε
ώνα, ο
νέργεια σε κίνηση απαντώντας σε ερεθίσματα από τον χειριστή.
διαψεύσει την ευρέως διαδεδομένη άποψη ότι η Ζωή μπορούσε
Από την άλ/η πλευρά, δεν αναπαράγονται, δεν αυξάνουν και
ν' αναπτυχθεί αυθόρμητα. Έδειξε ότι οι κλειστές φιάλες ποτέ
δεν αναπτύσσονται
δεν
-
όμως το ίδιο συμβαίνει και με τα ηλικιωμέ
Louis Pasteur
avamuooouv κάτι
επινόησε μια «έξυπνη» συσκευή για να
αν προηγουμένως υποβληθούν σε απο
να Ζώα. Οι πατάτες δεν είναι ευαίσθητες στα ερεθίσματα Κ.Ο.Κ.
στείρωση με θερμότητα. Για να ξεπεράσει τις αντιρρήσεις όσων
Είναι παράδοξο ότι οι κλασικοί ορισμοί της Ζωής συνήθως δεν
ισχυρίΖονταν ότι γι' αυτό ευθυνόταν η έλ/ειψη οξυγόνου ή ότι η
αναφέρουν ότι οι Ζωντανοί οργανισμοί στη Γη αποτελούνται κυ
θέρμανση σκότωνε τη Ζωογόνο ουσία, χρησιμοποίησε μια ειδι
ρίως από οργανικά μόρια, δηλαδή ότι η Ζωή βασίΖεται στον άν
κή φιάλη με λεπτό «αυχένα κύκνου» που σχεδιάστηκε έτσι ώστε
θρακα. Απ' όσο γνωρίζουμε, τα βασικά «πληροφοριακά μακρο
ν' αποτρέπει την επιμόλυνση της καλλιέργειας με σπόρους από
μόρια»
τον αέρα (Εικόνα ΑI-3). Οι καλ/ιέργειες σε αυτές τις φιάλες δεν
- DNA,
ΗΝΑ και πρωτεινες
-
είναι τα ίδια σε κάθε Ζω
ντανό είδος.
εμφάνισαν ποτέ ενδείξεις Ζωής, παρότι μπορούσαν να συντη ρούν τη Ζωή, όπως φάνηκε όταν λίγη «σκόνη» από τον «αυΧένα»
Απάντηση
1-2
της φιάλης μεταφέρθηκε στο καλ/ιεργητικό υλικό.
Οι περισσότερες τυχαίες αλλαγές στο σχέδιο των υποδημάτων θα οδηγούσαν σε ελαπώματα και τα υποδήματα θα ήταν λιγότερο
Απάντηση
1-4
χρήσιμα: τα υποδήματα χωρίς σόλα, με πολ/ές σόλες ή με περίερ
6 χ 1039 (= 6 χ 1027 g/10-12 g) βακτήρια θα είχαν ίσπ μάΖα με τη
γο μέγεθος προφανώς δεν θα είχαν Ζήτηση στην αγορά. ΆΛΛες
μάΖα της γης. Σύμφωνα με την εξίσωση που περιγράφει την εκ tJ2
°~ t = 2642 min (ή 44 ώρες). Αυ
θετική αύξηση, 6 χ 1039
=2
το μέγεθος). Τέλος, λίγες αλλαγές θα μπορούσε να οδηγήσουν σε
τό αντιπροσωπεύει μόνο
πιο επιθυμητά υποδήματα: για παράδειγμα, σόλες με αδρή αντί
κατομμυρια χρονια περασαν
132 γενιές, ενώ στα τελευταία 3.5 δισε5 χ 1014 γενιες. / Π ροφανως, / η συ-
αλλαγές θα ήταν ουδέτερες (π.χ. μικρές παραλλαγές στο χρώμα ή
/
/
/
λεία επιφάνεια θα ήταν καλύτερες για βάδισμα στη βροχή, υποδή
νολική μάζα των βακτηρίων στον πλανήτη μας απέχει πολύ από
ματα χωρίς ψηλά τακούνια θα ήταν πιο άνετα για περπάτημα. Το
τη μάΖα της γης. Αυτό δείχνει ότι εκθετική αύξηση συμβαίνει μό
παράδειγμα αυτό δείχνει ότι οι τυχαίες αλλαγές μπορεί να οδηγή
νο για πολύ λίγες γενιές, δηλαδή για πολύ μικρές χρονικές πε
σουν σε ουσιαστικές βελτιώσεις αν ο αριθμός των δοκιμών είναι
ριόδους σε σύγκριση με την εξέλιξη. Σε κάθε ρεαλιστικό σενά
αρκετά μεγάλος και επιπλέον αν ασκούνται πιέσεις επιλογής.
ριο, τα αποθέματα της τροφής πολύ σύντομα περιορίζονται και ε πιβάλλουν περιορισμούς στην αύξηση. Αυτή η απλή εξίσωση μάς δείχνει ότι η ικανότητα για αύξηση και ταχεία διαίρεση όταν
Πίνακας Α 1·1. Υποθετικά σκορ της «ζωής» για μια ηλεκτρική σκούπα, μια πατάτα και έναν άνθρωπο
υπάρχει άφθονη τροφή είναι μόνο ένας από τους παράγοντες
Ηλεκτρική Χαρακτηριστικό
σκούπα
Πατάτα
Άνθρωπος
1. Οργάνωση
Ναι
Ναι
Ναι
2. Ομοιοστασία 3. Αναπαραγωγή 4. Ανάmuξη
Ναι
Ναι
Ναι
Όχι
Ναι
Ναι
Όχι
Ναι
Ναι
Ναι
Ναι
Ναι
Ναι
Όχι
Ναι
5. Ενέργεια 6. Ανταπόκριση σε ερεθίσματα
7.
Προσαρμογή
Όχι
Ναι
Ναι
αυθεντική
φιάλη με
φιάλη
«αυχένα κύκνου»
Εικόνα Α1·3
Απαντήσεις
921
ρη και επιτρέπει την παρατήρηση αντικειμένων μεΥέθΟl.Jς ακό
χώρος που φαίνεται ότι προέρχεται από το κυτταροδιάλυμα του μεμβράνη που φαίνεται ότι προέρχεται από τη
μα και
αρχέγονου αερόβιου βακτηρίου (περιέχει ΟΝΑ)
10 nm.
Για την εξέταση των δομικών λεπτομερειών των
μικροσωληνίσκων, των μιτοχονδρίων και των βακτηρίων χρειά
Ζεται το ηλεκτρονικό μικροσκόπιο. Ωmόσο, αν προηΥΟl.Jμένως
μεμβράνη ενός αερόβιου μικροβίου
χρωσθούν με ειδικές χρωmικές, η εντόπισή ΤΟl.Jς μπορεί να κα
θοριmεί με το φωτονικό μικροσκόπιο. Απάντηση
1-8
Επειδή οι βασικές λεΙΤΟI.JΡΥίες των Κl.Jττάρων μοιάΖΟl.Jν τόσο πο Μ, πολλές πληροφορίες σl.JΥκεντρώθηκαν από τη μελέτη των πρότuπων σl.Jmημάτων. Η μαΥιά των Ζl.Jθοποιών είναι ένα καλό πρότuπo σύmημα επειδή τα κύτταρα των Ζl.Jμομl.Jκήτων είναι πο
λύ απλούmεΡα από τ' ανθρώπινα καρκινικά κύτταρα. Οι ZUΜOμό κητες μπορεί να καλ/ιεΡΥηθούν χωρίς πολ/ά έξοδα και σε τερά
μεμβράνη που φαίνεται ότι προέρχεται από την κυτταρική μεμβράνη του αρχέγονου ευκαρυωτικού κυττάρου
mιες ποσότητες. Επίσης, μπορεί να
I.JnOBAneOUV σε Υενετική
και
βιοχημική τροποποίηση πολό ευκολότερα από τ' ανθρώπινα κότ
ταρα. Αl.Jτά τα χαρακτηριmικά μάς επιτρέΠΟl.Jν να διαλεl.Jκάνοl.J
Εικόνα Α1·5
με ΤΟl.Jς βασικούς κανόνες ΠΟΙ.J καθορίΖΟl.Jν πώς αl.JξάνΟl.Jν και πώς διαιρούνται τα κύτταρα. Τα καρκινικά κύτταρα διαιρούνται, ενώ δεν θα έπρεπε (και επομένως δημΙΟI.JΡΥούν όΥΚΟl.Jς). Η βα
ΠΟΙ.J επηρεάΖΟl.Jντην επιβίωση ενός είδΟl.Jς. Η τροφή Υενικά είναι
σική κατανόηση ΤΟΙ.J ελέΥΧΟI.J της Κl.Jτταρικής διαίρεσης σχετίζεται
λΙΥοmή και τα κότταρα ΠΟΙ.J μποροόν να προσαρμοmοόν καΜτε
άμεσα με το πρόβλημα ΤΟΙ.J καρκίνοl.J. ΠράΥματι, το Εθνικό
ρα σε μεταβαλ/όμενο περιβάλ/ον και έΧΟl.Jν αποκτήσει πιο περί
τοότο Καρκίνοl.J των ΗΠΑ, η Αμερικανική Αντικαρκινική Εται
!vml-
τεχνα μέσα Υια τη χρησιμοποίηση διαφορετικών πηΥών τροφής
ρεία και πολ/ά άλ/α ιδρύματα ΠΟΙ.J επιδιώΚΟl.Jν να
σl.Jχνά έΧΟl.Jν ένα μεΥάλο OI.JναΥωνιmικό πλεονέκτημα.
ληλες θεραπείες Υια τον καρκίνο I.JnomnpΊZol.JV ισχl.Jρά τη βασι
BpOI.JV κατάλ
κή έρευνα σε ποικίλες πτuxές της Κl.Jτταρικής διαίρεσης σε διά Απάντηση
1-5
φορα πρότuπα σl.Jmήματα, όπως οι Ζl.Jμομόκητες.
Βλ. Εικόνα ΑI-5. Απάντηση
Απάντηση
1-6
1-9
ΕλέΥξτε τις απαντήσεις σας χρησιμοποιώντας το Γλωσσάριο και
Τα εl.JκαΡl.Jωτικά κότταρα μπορεί να καταβΡΟΧθίσΟl.Jν Οl.Jσίες ό
10 Παράρτημα 1-2.
πως τα σωματίδια της τροφής και να τα καταναλώσΟl.Jν εΥωιmι
1-10
κά. Αντίθετα, τα βακτήρια δεν διαθέΤΟl.Jν κάποιο τρόπο Υια να
Απάντηση
σl.Jλ/αμβάνΟl.Jν κομμάτια τροφής. ΕξάΥΟl.Jν Οl.Jσίες ΠΟΙ.J αποδο
Α. Λάθος. Οι κληρονομικές πληροφορίες κωδικοποιούνται
μοόντα μόρια της τροφής
mo περιβάλ/ον,
αλ/ά τα προϊόντα της
αποδόμησης τα μοιράΖΟνται με άλ/α κότταρα ΠΟΙ.J βρίσκονται
mnv ίδια περιοΧή.
mo
ΟΝΑ ΤΟΙ.J Κl.Jττάροl.J, το οποίο με τη σειρά ΤΟΙ.J κωδικοποιεί τις πρωτε'ϊνες. Β. Σωmό. Τα βακτήρια δεν έΧΟl.Jν Πl.Jρήνα.
Γ. Λάθος. Τα φl.Jτά αποτελοόνται από εl.JκαΡl.Jωτικά κύτταρα ΠΟΙ.J Απάντηση
1-7
περιέΧΟl.Jν
Το φωτονικό μικροσκόπιο είναι ποΜ πιο εόκολο
mn χρήση
και
απαιτεί ποΜ απλοόmερα εξαρτήματα. Αντικείμενα μεΥέθΟl.Jς
1
μm διακρίνονται εόκολα. Το κατώτερο (θεωρητικό) διακριτικό όριο είναι
0.2 μm και επιβάλλεται
από το μήκος κύματος ΤΟΙ.J 0-
ρατοό φωτός. Το ορατό φως είναι «αθώο» και διέρχεται εύκολα από το νερό: έτσι, κάνει εφικτή την παρατήρησητων Ζωντανών
Κl.Jττάρων. Από την άλ/η πλευρά, το ηλεκτρονικόμικροσκόπιο
mo
Κl.Jτταρόπλασμά ΤΟl.Jς χλωροπί'lάmες. Οι χλω
ροπί'lάmες θεωρείται ότι προέρχονται από προκαΡl.Jωτικά κύτταρα.
Δ. Σωmό. Ο αριθμός των χρωμοσωμάτων ποικίλει από ΟΡΥανι σμό σε ΟΡΥανισμό αλ/ά είναι mαθερός σε όλα τα κύτταρα ΤΟΙ.J ίδιοl.J ΟΡΥανισμού. Ε. Λάθος. Το Κl.Jτταροδιάλl.Jμα είναι ό,τι απομένει από το
Kl.Jna-
ρόπλασμα αν αφαιρεθούν όλα τα ΟΡΥανίδια.
είναι ποΜ πιο περίπλοκο, τόσο από την άποψη της επεξεΡΥα
Ζ. Σωmό. Το Πl.Jρηνικό περίβλημα είναι μια διπλή μεμβράνη και
σίας ΤΟΙ.J δείΥματος (ΠΟΙ.J πρέπει να κοπεί σε πολύ λεπτές τομές,
τα μιτοΧόνδρια περιβάλ/ονται τόσο από μια εσωτερική όσο
να χρωσθεί με ηλεκτρονιόΠl.Jκναβαριά μέταλ/α και ν' αφl.Jδα
και από μια εξωτερική μεμβράνη.
τωθεί εντελώς) όσο και ως προς την ίδια τη φύση lOI.J. Τα κύττα
Η. Λάθος. Τα πρωτόΖωα είναι μονοκότταροι ΟΡΥανισμοί και ε
ρα δεν είναι δl.Jνατό να παρατηρηθούν Ζωντανά. Η διακριτική ι
πομένως δεν έΧΟl.Jν διάφΟΡΟl.Jς ιmούς. Ωmόσο, έΧΟl.Jν περί
κανότητα ΤΟΙ.J ηλεκτρονικού μικροσκοπίοl.J είναι πολύ μεΥαΜτε-
πλοκη δομή με πολύ εξειδικεl.Jμένα τμήματα.
922
Απαντήσεις
Θ. Εν μέρει σωσrό. Τα υπεροξεισωμάτια και τα λυσοσωμάτια
μόνο ένα ή λίγα βακτήρια αποκτούν μια μετάλλαξη που τα κάνει
περιέχουν ένΖυμα τα οποία καταλύουν την αποδόμηση ου
ανθεκτικά στη δράση του. Τα αντιβιοτικά που είναι δηλητηριώ
σιών που παράγονται αο κυπαροδιάλυμα ή προσλαμβάνο
δη για τα βακτήρια, για παράδειγμα επειδή προσδένονται σε ο
νται από το κύπαρο.
ρισμένες βακτηριακές πρωτε'ίνες, δεν θα ήταν αποτελεσματικά αν η επιφάνεια των πρωτεϊνών είχε ελαφρώς αλλάξει ώστε η
Απάντηση
1-11
πρόσδεση να είναι ασθενέστερη ή να μην πραγματοποιείται κα
Κατά μέσο όρο, ένα εγκεφαλικό κύπαρο Ζυγίζει 10-8 g (= 1000 g/10 11 ). Επειδή 1 g νερού καταλαμβάνει όγκο 1 ml = 1 cm3 (=
/ / / / 10-14 m3 (10-8 ενος κυπαρου ειναι = g χ 10-6 10-6 m3) , ο ογκος 3 m /g). Η κυβική ρίζα αυτού του μεγέθους είναι 2.1 χ 10-5 m, ή 21 μm (106 μm = 1 m). Η σελίδα του βιβλίου έχει επιφάνεια 0.057 m2 (= 21 cm χ 27.5 cm) και κάθε κύπαρο αφήνει ένα αποτύπω μα έκτασης 441 χ 10-12 m2 (2.1 χ 10-5 m χ 2.1 χ 10-5 m). Επο μένως, 129 χ 106 (= 0.057 m2/441 χ 10-12 m2) κύπαρα χωρούν σε αυτή τη σελίδα αν απλωθούν σε μια απλή αιβάδα. Άρα, 1011 κύπαρα θα καταλάμβαναν 775 σελίδες (= 1011/129 χ 106).
θόλου. Αυτά τα μεταλλαγμένα βακτήρια θα συνέΧΙΖαν να διαι ρούνται γρήγορα ενώ τα «φυσιολογικά» βακτήρια θ' αναχαιτίζο νταν. Μέσα σε σύντομο χρονικό διάσrημα, τ' ανθεκτικά βακτή
ρια θα επικρατούσαν στην καλ/ιέργεια. Απάντηση
1-16
1013 = 2(t/1). Επομένως, θα χρειαΖόταν να μεσολαβήσουν μόνο 43 ημέρες [t = 13/1og(2)]. Αυτό ερμηνεύει το γιατί ορισμένοι καρκίνοι εξελίσσονται εξαιρετικά γρήγορα. Ωσrόσo, πολ/ά
καρκινικά κύπαρα αναπτύσσονται πολύ πιο αργά ή πεθαίνουν επειδή δεν αιματώνονται επαρκώς. Έτοι, στην πραγματικότητα,
Απάντηση
1-12
η εξέλιξη του καρκίνου συνήθως είναι βραδύτερη.
Σε αυτό το φυτικό κύπαρο, το Α είναι ο πυρήνας, το Β ένα κενο
1-17
τόπιο, το Γ είναι το κυπαρικό τοίχωμα και το Δ ένας χλωροπλά
Απάντηση
αης. Το άνυσμα της κλίμακας είναι περίπου
Τα Ζωντανά κύπαρα εξελίΧθηκαν από την άβια ύλη, αλ/ά αυξά
10 μm,
όσο και η
νουν και πολ/απλασιάΖΟνται. Όπως και τα υλικά από τα οποία
διάμετρος του πυρήνα.
προήλθαν, διέπονται από τους νόμους της φυσικής, της θερμο Απάντηση
1-13
δυναμικής και της χημείας. Για παράδειγμα, δεν μπορούν να
Τα τρία κύρια ινίδια είναι τα νημάτια της ακτίνης, τα ενδιάμεσα ι
δημιουργήσουν ενέργεια
νίδια και οι μικροσωληνίσκοι. Τα νημάτια της ακτίνης εμπλέκο
συγκροτημένες δομές χωρίς παροχή ενέργειας. Όλες, πρακτι
de
ηονο ούτε και να κατασκευάσουν
νται αις ταχείες μετακινήσεις των κυπάρων, όπως η μυϊκή συαο
κά, οι διεργασίες του κυπάρου, όπως ο μεταβολισμός, η κατά
λή. Τα ενδιάμεσα ινίδια παρέχουν μηχανική ααθερότητα. Οι μι
λυση, η συναρμολόγηση των μεμβρανών και η αντιγραφή του
κροσωληνίσκοι λειτουργούν σαν τις ράγες του σιδηρόδρομου για
ΟΝΑ μπορεί να γίνουν κατανοητές ως περίπλοκες χημικές αντι
ενδοκυπάριες μετακινήσεις και ευθύνονται για τον διαχωρισμό
δράσεις οι οποίες είναι δυνατό ν' αναπαραΧθούν πειραματικά
των χρωμοσωμάτων κατά την κυπαρική διαίρεση. Άλλες λειτουρ
και να μελετηθούν σε δοκιμαστικούς σωλήνες.
γίες όλων αυτών των ινιδίων παρουσιάζονται αο Κεφάλαιο
17.
Παρά τη βασική αυτή αναγωγή, ένα Ζωντανό κύπαρο είναι κάτι περισσότερο από το άθροισμα των τμημάτων του. Για παρά
Απάντηση
1-14
δειγμα, δεν θα παρασκευάσουμε ένα κύπαρο αν αναμείξουμε
Τα μεταλλαγμένα κύπαρα επικρατούν αην καλ/ιέργεια μετά
20
τυχαία σ' έναν δοκιμαστικό σωλήνα πρωτεϊνες, νουκλεϊνικά ο
ώρες, δηλαδή σε λιγότερο από μια μέρα. Χρησιμοποιώντας την
ξέα και άλλες χημικές ουσίες. Το κύπαρο λειτουργεί χάρη στην
εξίσωση που δίνεται αην ερώτηση, βλέπουμε ότι ο αριθμός των
οργανωμένη δομή του, η οποία είναι προϊόν της εξελικτικής ι
αρχικών βακτηριακών κυπάρων «' μπορεί να έχει δύο έwοιες. Η πρώτη ανα
Aπdvmσn2-5
φέρεται στην κατευθυνόμενη ασυμμετρία, για παράδειγμα σε
Α. Τα ιόντα υδρωνίου (Η 3 Ο+) προκύmουν από τη διάσπαση του
γραμμικά πολυμερή όπως τα πολυπεmίδια, τα οποία έχουν ένα
νερού σε πρωτόνια και ιόντα υδροξυλίου και την επακόλου-
Ν- και ένα C-άκρο, ή τα νουκλεϊνικά οξέα, τα οποία έχουν ένα
Απαντήσεις
925
3' και ένα 5' άκρο. Επειδή δεσμοίσχπματίΖονΙαιμόνο ανάμεσα στην αμινοομάδα και την καρβοξlJλομάδατων αμινοξέων ενός
πολlJπεmιδίΟlJκαι ανάμεσα στα 3' και ΤΟ 5' άκρα των νΟlJκλεο
δημΙΟlJργούνΤαι από τη σlJνάθροιση τριαΚlJλογλlJκερο
nOlJ λών.
Η. Σωστό. Μεμονωμένα, οι δεσμοί αlJτοί είναι ασθενείς και δια
ηδίων ενός νΟlJκλεϊνικούοξέος, ΤΟ νΟlJκλεϊνικά οξέα και ΤΟ πο
σπώνται εύκολα με θερμικές κινήσεις. Ωστόσο, επειδή οι αλ
λlJπεπτίδια πάνΙα έΧΟlJν δύο διαφορεηκά άκρα, γεγονός nOlJ
ληλεπιδράσεις ανάμεσα σε δύο μακρομόρια περιλαμβάνΟlJν πολλούς ανάλογΟlJς δεσμούς, η σlJνολική σύνδεση μπορεί
προσδίδει στ' ανΙίστοιχα μόρια μια ορισμένη πολικότητο.
να είναι πολύ ισΧlJρή. Επίσης, επειδή δεσμοί lJδρογόνΟlJ
Η δεύτερη έwοια ΤOlJ όΡΟlJ έχει να κάνει με τον διαχωρισμό
TOlJ ηλεκτρικού
σχηματίΖΟνται μόνο ανάμεσα σε κοτάλληλα τοποθετημένες
φορτίΟlJ σ' ένα μόριο ή έναν δεσμό. ΑlJτό το εί
δος της πολικότητος επιτρέπει τον σχημαησμό των δεσμών
ομάδες των αλληλεπιδρώνΤων μακρομορίων, η σύνδεση με
lJ-
δεσμούς lJδρογόνΟlJ είναι και πολύ ειδική.
δρογόνΟlJ. Επειδή η διaλlJτότητο στο νερό (ή, αλλιώς, lJδροφι λία) ενός μορίΟlJ εξαρτάτοι από το να είναι πολικό, με αlJτή την έwοια ο όρος «πολικός» μερικές φορές χρησιμοποιείται για να
Απάvrnσn
δηλώσει τη διαλlJτότητο στο νερό.
Α. Ένα μόριο ΚlJπαρίνης έχει μοριακό βάρος η χ 1(Η)
Απάvrnσn
όη εύκολα ανΙιστρέφονΙαι με lJδρόλlJση (το νερό αφθονεί στο κύπαρο). ΑlJτό επιτρέπει στα κύπαρα ν' αποδομούν ΤΟ μακρο μόριά ΤΟlJς (ή ΤΟ μακρομόρια άλλων οργανισμών
nOlJ
έΧΟlJν
προσλάβει ως τροφή) και ν' αποδίδΟlJν ακέραιες lJπομονάδες μπορεί ν' «αναΚlJκλωθούν», δηλαδή να χρησιμοποιηθούν
για τον σχημαησμό νέων μακρομορίων.
Απάvrnσn
2-10
Πολλές από ης λεΙΤΟlJργίες
[12(C) + 2 χ + 16(0)]. Το η είναι άγνωστο' ωστόσο, μπορούμε να
καθορίσΟlJμε πόσο σlJμβάλλει κάθε στοιχείο στο βάρος της
2-9
Ένα κύριο πλεονέκτημα των ανΙιδράσεων σlJμπύκνωσης είναι
nOlJ
2-12
nOlJ επιτελούν
ΤΟ μακρομόρια βασί
ΚlJπαρίνης. Η σlJμβολή των ατόμων ΤOlJ άνθρακα είναι
40% [= 12/{12 + 2 +16) χ 100%]. ΣlJνεπώς, στην ΚlJπαρίνη nOlJ σχηματίΖει αlJτή Τη σελίδα περιέΧονΙαι 2 g ατόμων άνθρακα (40% των 5 g). Το ατομικό βάρος ΤOlJ άνθρακα είναι 12 g/mole Kaι ένα mole (γραμμομόριο) περιέχει 6 χ 1023 άτομα ή μόρια. Άρα, η σελίδα αlJτή περιέχει 1023 άτομα άνθρακα [= [2 g/12 (g/mole)] χ 6 χ 1023 (μόριοΙ mole)]. Β. Ο όγκος της σελίδας είναι 4 χ 10-6 m3 (= 21 cm χ 27.5 cm χ 0.07 mm) και αντιστοιχεί σ' έναν κύβο με πλεlJρά μήΚΟlJς 1.6 cm (= 4 χ 10-6 m3). Εφόσον η σελίδα περιέχει 1023 άτο
ΖΟνται στην ικανότητά ΤΟlJς να σlJνδέονΤαι και ν' αποσlJνδέΟνΤαι
μα άνθρακα, σε κάθε πλεlJρά OlJΤOU ΤOlJ κύβΟlJ παρατάσσο
εύκολα. Το γεγονός αlJτό επιτρέπει στα κύπαρα ν' αναδιοργα
νται περίΠΟlJ 4.6 χ 107 άτομα άνθρακα. Επομένως, το πάχος
νώνΟlJν το εσωτερικό ΤΟlJς ότον μετοκινούνΤαι ή ότον δια1Ρού
της σελίδας καλύπτετοι περίΠΟlJ από
νΙαι και να μετοφέΡΟlJν σuσταηKά από οργανίδιο σε οργανίδιο.
κα (= 4.6 χ 107 χ 0.07 χ 10-3 m/l.6 χ 10-2 m).
Οι ομοιοπολικοί δεσμοί θα ήτον πολύ ισχlJροί και μόνιμοι για
Γ. Αν επιστοιβαχθούν σφιχτά μετρο
μια τέΤοια λεΙΤΟlJργία.
0.2 nm θα
200,000 άτομα
άνθρα
350,000 άτομα άνθρακα με διά (0.07
κάλlJπτον το πάχος αlJτής της σελίδας
mm). Απάvrnσn
2-11
Δ. Η διαφορά των δύο lJπολογισμών αντικατοπτρίζει:
Α. Σωστό. Όλοι οι ΠlJρήνες αποτελούνται από θεηκά φορησμέ
(1)
όη τα
άτομα ΤOlJ άνθρακα δεν είνaι ΤΟ μοναδικά άτομα στην
KlJna-
να πρωτόνια και μη φορησμένα νετρόνια. Η μόνη εξαίρεση
ρίνη και
είναι ο ΠlJρήνας ΤOlJ lJδρογόνΟlJ,
βώς διατετογμένων μορίων (όπως ένα διαμάντι είναι ένα δί
nOlJ
αποτελείται μόνο από
(2)
όη το χαρτί δεν είναι ένα ατομικό δίκωο επακρι
κωο επακριβώς διατετογμένων ατόμων άνθρακα) αλλά ένα
ένα πρωτόνιο.
ωχαίο πλέγμα ινών
Β. Λάθος. Τα άτομα είναι ηλεκτρικώς ΟlJδέτερα. Ο αριθμός των
nOlJ περιέχει
πολλά κενά.
θεηκά φορησμένων πρωτονίων είναι πάντα ίσος με τον αριθ
Απάvrnσn
μό των αρνηηκά φορησμένων ηλεκτρονίων. Γ. Σωστό-αλλά μόνο για τον ΠlJρήνα ΤOlJ ΚlJπάΡΟlJ (βλ. Κεφά
λαιο
1)
και όχι για τον ΠlJρήνα ΤOlJ ατόμΟlJ
nOlJ
σlJιητείτοι σε
2-13
Α.
2, 8 και 8 ηλεκτρόνια, αντιστοίχως. Β. lJδρογόνο κέρδος 1 ή απώλεια 1 ήλιο
αlJτό το κεφάλαιο. Δ. Λάθος. Τα στοιχεία μπορεί να έΧΟlJν διαφορεηκά ισότοπα, ΤΟ
ήδη είναι πλήρες
οξlJγόνο
κέρδος
οποία διαφέΡΟlJν μόνο ως προς τον αριθμό των νετρονίων
άνθρακας
κέρδος
ΤΟlJς.
νάτριο
Ε. Σωστό. Σε ορισμένα ισότοπα, ο αριθμός των νετρονίων απο σταθεροποιεί τον ΠlJρήνα, ο οποίος αποσlJvrίθεται σε μια διεργασία
nOlJ αΠOKaλείTOΙ
ραδιενεργός απόσβεση.
Ζ. Σωστό. Χαρακτηριστικά παραδείγματο είναι τα κοκκία ΤOlJ
γλlJκογόνΟlJ (ένα πoλuμεpές της γλlJκόΖης)
nOlJ
lJπάΡΧΟlJν
στα ηπατοκύπαρα και ΤΟ λιποσταγονίδια των λΙΠΟΚlJπάρων
926
Απαντήσεις
χλώριο
Γ. Το ήλιο
nOlJ έχει πλήρως
2 4 ή απώλεια 4 απώλεια 1 κέρδος 1 σlJμπληρωμένη εξώτερη στιβάδα εί
ναι χημικώς αδρανές. ΑνΙίθετο, το νάτριο και το χλώριο είναι
πολύ δραστικά Kaι εύκολα αποδίδΟlJν σταθερά ιόνΙα Na + και CΓ
nOlJ
σχημοτίΖΟlJν ιοντικούς δεσμούς. Το οξlJγόνο πρέπει
να προσλάβει δύο ηλεκτρόνια, ενώ το lJδρογόνο μπορεί να
συμπεριφερθεί με δύο φόπους, δηλαδή να κερδίσει ή να χά
Γ. Σωσrό. Ο σκελετόςτων νουκλεϊνικώνοξέων αποτελείταιαπό
σει ένα ηλεκτρόνιο. Σ' έναν ομοιοπολικό δεσμό ανάμεσα σro
εναί\ί\ασσόμενες μονάδες ριβόΖης (ή δεοξυριβόΖης σro
οξυγόνο και το υδρογόνο, όπως σro νερό ή σro υδροξύλιο,
DNA) και φωσφορικών
τα ηλεκτρόνια έλκονται προς το άτομο του οξυγόνου. Επομέ
είναι σάκχαρα.
νως, ο δεσμός είναι πολικός, με αρνηηκό φορτίο σro άτομο του οξυγόνου και θεηκό φορτίο σro άτομο του υδρογόνου.
ομάδων. Η ριβόΖη και η δεοξυριβόΖη
Δ. Σωσrό. Περίπου τα μισά από τα
20 αμινοξέα
που υπάρχουν
σrη φύση έχουν υδρόφοβες πλευρικές αλυσίδες. Σης πτυχω
Ένας δεσμός οξυγόνου-άνθρακα επίσης είναι πολικός. Αντί
μένες πρωτεΤνες, ποί\ί\ές από ης αλυσίδες αυτές προσανατο
θετα, σ' έναν δεσμό υδρογόνου-άνθρακα και τα δύο αλ/ηλε
λίΖονται προς το εσωτερικό της πρωτείνη ς επειδή απωθού
πιδρώντα άτομα μοιράΖΟνται τα ηλεκτρόνια πιο ισόημα, οπό
νται από το νερό.
τε ο δεσμός είναι μη πολικός.
Ε. Σωσrό. Οι υδρόφοβες υδρογονανθρακικές ουρές περιέχουν μόνο μη πολικούς δεσμούς. Συνεπώς, δεν μπορούν να συμ
Aπdvmon 2-14
μετάσχουν σro σχημαησμό δεσμών υδρογόνου και απωθού
Ένα άτομο θείου είναι πολύ μεγαλύτερο από ένα άτομο οξυγό
νται από το νερό. Οι σχεηκές αρΧές εξετάΖΟνται λεπτομερώς
νου. Εξαιτίας του μεγαλύτερου μεγέθους του, τα εξώτατα ηλε
σro Κεφάλαιο 11. 2. Λάθος. Το ΗΝΑ περιέχει ης βάσεις αυτές, ενώ το DNA αντί για U περιέχει Τ. Οι βάσεις Τ και U μοιάΖουν πολύ, αλ/ά δια
κτρόνιά του δεν έλκονται προς τον πυρήνα τόσο ισχυρά όσο τα ηλεκτρόνια ενός ατόμου οξυγόνου προς τον αντίσroιxo πυρή
να. Για το λόγο αυτό, ο δεσμός υδρογόνου-θείου είναι πολύ λι
φέρουν κατά μια μεθυλομάδα.
γότερο πολικός από τον δεσμό υδρογόνου-οξυγόνου. Εξαιτίας της μειωμένης πολικότητας, το άτομο του θείου ενός μορίου
Aπdvmon 2-17
H2S δεν έλκεται ισχυρά προς τα άτομα υδρογόνου ενός γειτονι κού μορίου H2S, οπότε δεν σχηματίΖΟνται δεσμοί υδρογόνου.
Α. (α) 400 (= 202), (β) 8000 (= 20\ (γ) 160,000 (= 204). Β. Μια πρωτείνη μοριακού βάρους
πό Aπdvmon
2-15
διαφορεηκοί τρόποι για να παρασKευασrεί μια τέτοια πρω
Οι αντιδράσεις αποδίδονται διαγραμμαηκά σrην Εικόνα όπου
4800 αποτελείται περίπου α 40 αμινοξέα. Επομένως, υπάρχουν 1.1 χ 1052 (= 2040)
f'.2-15,
R1 και R2 είναι πλευρικές αλυσίδες αμινοξέων.
Aπdvmon 2-16 Α. Λάθος. Οι ιδιότητες μιας πρωτεΤνης εξαρτώνται τόσο από τα αμινοξέα που περιέχει όσο και από τη σειρά με την οποία αυ
τεΤνη. Κάθε ξεxωρισrό πρωτεϊνικό μόριο ΖυγίΖει 8 χ 10-21 g (= 4800/6 χ 1023). Συνεπώς, ένα μείγμα που θα περιείχε έ να μόριο από κάθε πιθανή αί\ί\ηλουΧία θα Ζύγιζε 9 χ 1031 g (= 8 χ 10-2Ι g χ 1.1 χ 1052), δηλαδή θα ήταν 15,000 φορές βαρύτερο από το βάρος του πλανήτη που Ζυγίζει 6 χ 1024 kg. Μάί\ί\ον θα xρειαzόσασrαν ένα μεγάλο δοχείο.
τά συνδέονται μεταξύ τους. Η ποικιλότητα των πρωτεϊνών ο
Γ. Δεδομένου όη οι περισσότερες κυπαρικές πρωτεΤνες είναι α
φείλεται σroν σχεδόν απεριόρισro αριθμό των τρόπων με
κόμα μεγαλύτερες από την πρωτείνη του παραδείγματός μας,
τους οποίους μπορεί να συνδυασroύν σε μια γραμμική ακο
είναι σαφές όη τα Ζωντανά κύπαρα χρησιμοποιούν ένα μι
λουθία
20 διαφορεηκά
αμινοξέα.
κροσκοπικό κλάσμα του συνόλου των δυνατών αί\ί\ηλου
Β. Λάθος. Τα λιπίδια συναρμολογούνται σε διπλoσrιβάδες με
χιών.
μη ομοιοπολικές δυνάμεις. Επομένως, μια μεμβράνη δεν εί Απάντηση
ναι ένα μακρομόριο.
2-18
Επειδή όλα τα Ζωντανά κύπαρα αποτελούνται από χημικές ενώ σεις και επειδή όλες οι χημικές αντιδράσεις (είτε πραγματοποι ούνται σε Ζωντανά κύπαρα είτε σro δOKιμασrΙKό σωλήνα) υπα
R1
R2
Ι H2 N-C-COOH
Ι
+ H2N-C-COOH
~ Η,Ο JΙ,o ~
ΥΔΡΟΛΥΣΗ Ι 1 ΣΥΜΠΥΚΝΩΣΗ
κούν σroυς ίδιους κανόνες, η κατανόηση των βασικών χημικών αρχών έχει OυσιασrΙKή σημασία για την κατανόηση της βιολο
γίας. Στα επόμενα κεφάλαια θ' αναφέξουμε συχνά σrις συγκε
κριμένες αρΧές, σrις οποίες βασίΖΟνται όλες οι περίπλοκες διερ
γασίες και αντιδράσεις που πραγματοποιούνται σrα κύπαρα.
Aπ6vmon
2-19
Α. Οι δεσμοί υδρογόνου προϋποθέτουν αλ/ηλεπιδράσεις ειδι R1
Ο
R2
Ι 11 Ι H2 N-C-C-N-C-COOH Ι Ι Ι Η
Εικόνα Α2·15
Η
Η
κών ομάδων: η μια ομάδα πάντα είναι ένα άτομο υδρογό νου που συνδέεται μ' έναν πολικό δεσμό μ' ένα άτομο οξυ γόνου ή αΖώτου, ενώ η άλ/η συνήθως είναι ένα άτομο αΖώ του ή οξυγόνου. Οι δυνάμεις
van der Waals
είναι ασθενέ
σrερες και αναπτύσσονται ανάμεσα σε δύο οποιασδήποτε ά-
Απαντήσεις
927
1Ομα βρεθούν αρκετά κοντά. Τόσο οι δεσμοί υδρογόνου ό
,
σο και οι δυνάμεις
~ ]υδΡόψοβο
van der Waals είναι
αλληλεπιδράσεις μι
κρού βεληνεκούς που ενεργοποιούνται μόνο όταν δύο μό
]uδρόψιλο
ρια βρίσκονται ήδη κοντά 10 ένα στο άλ/ο. Επομένως, και τα
ΑΕΡΑΣ
δύο αυτά είδη δεσμών μπορεί να θεωρηθούν ως ένα μέσο για τον λεπτό συντονισμό μιας αλληλεπίδρασης,δηλαδή συμβάλ/ουνστην κατάλ/ηλητοποθέτηση δύο μορίων (το έ να σε σχέση με το άλ/ο) που έχουν ήδη βρεθεί κοντά-κοντά με διάχυση.
Β. Δυνάμεις van
der Waals
θα σχηματίΖονταν και στα τρία πα
ραδείγματα, ενώ δεσμοί υδρογόνου μόνο στο (γ). Απάντηση
2-20
Ανάμεσα στις υπομονάδες των μακρομορίων, Π.Χ. στις πλευρι κές αλυσίδες των αμινοξέων μιας πολυπεπτιδικής αλυσίδας, σχηματίΖΟνται μη ομοιοπολικές αλ/ηλεπιδράσεις που κάνουν
την πολυπεπτιδική αλυσίδα να προσλάβει μοναδικό σΧήμα. Στις αλ/ηλεπιδράσεις αυτές περιλαμβάνονται δεσμοί υδρογόνου,
ιοντικές αλ/niΊεπιδράσεις, αλ/ηλεπιδράσεις
van der Waals
και
υδρόφοβες αλ/ηλεπιδράσεις. Επειδή οι συγκεκριμένες αλ/η
Εικόνα Α2-21
λεπιδράσεις είναι ασθενείς, διασπώνται σχετικά εύκολα. Συνε πώς, τα περισσότερα μακρομόρια μπορεί να αποπτυχωθούν με θέρμανση, που αυξάνει τις θερμικές κινήσεις.
μία σχηματισμού δεσμών υδρογόνου κάνει τις υδρογοναν θρακικές αλυσίδες υδρόφοβες.
Απάντηση
2-21
Τα αμφιπολικά μόρια έχουν ένα υδρόφιλο και ένα υδρόφοβο άκρο. Τα υδρόφιλα άκρα τους μπορεί να σχηματίσουν δεσμούς υδρογόνου με το νερό, ενώ τα υδρόφοβα άκρα απωθούνται α
Na
Θ. Λάθος. Τα
Na +CΙ-,
και CΙ σχηματίΖουν έναν ιοντικό δεσμό,
εδώ όμως έχει σχεδιαστεί ένας ομοιοπολικός δε
σμός.
Ι. Λάθος. Το άτομο του οξυγόνου προσελκύει τα ηλεκτρόνια
πό το νερό επειδή διαταράσσουν τη δομή του. Συνεπώς, τα υ
περισσότερο απ' ότι 10 ά1Ομο 1Ου άνθρακα. Επομένως, η πο
δροφόρα άκρα των αμφιπολικών μορίων τείνουν να εκτίθενται
λικότητα των δύο δεσμών θα έπρεπε ν' αναστραφεί.
στον αέρα στη διάφαση αέρα-νερού ή να συσσωματώνονται
Κ. Πρόκειται για τη σωστή δομή της γλυκόΖης.
(βλ. Εικόνα Α2-21).
Λ. Σχεδόν σωστό. Είναι πιο σωστό να δείξουμε ότι μόνο ένα υ
Απάντηση
2-22
δρογόνο Χάνεται από την ομάδα -ΝΗ2 και ότι η ομάδα -ΟΗ
Χάνεται από την ομάδα -COOH.
Α, Β. Τόσο ο (Α) όσο και ο (Β) είναι σωστοί χημικοί τύποι του α
μινοξέος φαινυλαλανίνη. Σ1Ον τύπο (Β), η φαινυλαλανίνη παρουσιάΖεται στην ιοντισμένη μορφή που βρίσκουμε σ' ένα
υδατικό διάλυμα, όπου η βασική αμινοομάδα είναι πρωτο
Κεφάλαιο
3
νιωμένη και η όξινη καρβοξυλομάδα είναι αποπρωτονιωμέ
Απ6ντηση3-1
νη.
Η εξίσωση αυτή αντιπροσωπεύει μια μεγάλη ομάδα διαφορετι
Γ. Λάθος. Από αυτή τη δομή ενός πεπτιδικού δεσμού λείπει ένα
άτομο υδρογόνου που κανονικά συνδέεται με το άΖωτο. Δ. Λάθος. Αυτός ο χημικός τύπος μιας βάσης αδενίνης περι λαμβάνει έναν επιπλέον διπλό δεσμό, δημιουργώντας έτσι έ
κών αντιδράσεων που καταλύονται από πολ/ά διαφορετικά έν Ζυμα. Επειδή τα σάκχαρα είναι πιο περίπλοκα μόρια από 10 CO2 και 10 Η 2 Ο, η αντίδραση αυτή δημιουργείμια πιο οργανωμένη
κατάσταση στο εσωτερικό 1Ου κυπάρου. Όπως υπαγορεύει ο
να πεντασθενές άτομο άνθρακα και ένα τετρασθενές άτομο
δεύτερος νόμος της θερμοδυναμικής,σε πολ/ά βήματα κατά
αΖώτου.
μήκος της οδού των αντιδράσεωνπου συνοψίζονταισε αυτή την
Ε. Λάθος. Σε αυτόν τον τύπο ενός τριφωσφορικού νουκλεοτιδί
εξίσωση παράγεται θερμότητα.
ου θα έπρεπε να υπάρχουν δύο επιπλέον ά1Ομα οξυγόνου, 10 καθένα ανάμεσα σε δύο ά1Ομα φωσφόρου.
Ζ. Πρόκειταιγια 1Ον σωστό τύπο της αιθανόλης.
Απ6ντηση3-2 Η οξείδωση ορίΖεται ως αφαίρεση ηλεκτρονίων. Επομένως, η
Η. Λάθος. Το νερό δεν σχηματίζει δεσμούς υδρογόνουμε ά1Ο
(Α) είναι οξείδωση, ενώ η (Β) αναγωγή. Το κόκκινο ά1Ομο άν
μα υδρογόνου συνδεδεμέναμε ά1Ομα άνθρακα. Η αδυνα-
θρακα στην αντίδραση (Γ) σε μεγάλο βαθμό παραμένει αμετά-
928
Απαντήσεις
βλητο. Αντίθετα, το γειτονικό μαύρο άτομο του άνθρακα Χάνει
X~Y
ένα άτομο υδρογόνου (δηλαδή ένα ηλεκτρόνιο και ένα πρωτό νιο) και άρα οξειδώνεται. Το κόκκινο άτομο του άνθρακα σrnν αντίδραση (Δ) οξειδώνεται επειδή Χάνει ένα άτομο υδρογόνου, ενώ το άτομο του άνθρακα στην αντίδραση (Ε) ανάγεται επειδή προσλαμβάνει ένα άτομο υδρογόνου.
+χ
ΔG Ο
Aπ6vmσn3-3
Χ
Α. Οι δύο καταστάσεις του κέρματος, Κ και Γ, έχουν την ίδια πι
_
L
αναποδογύρισμα της Κ σε Γ, ή το αντίστροφο. Συνεπώς, για
= Ο.
1
γ Ζ
ναμη, δηλαδή μια δlOφορά ενέργειας, που θα ευνοούσε το
τη συγκεκριμένη αντίδραση η ΔG
v
ΔG Ο
θανότητα. Επομένως, δεν υπάρχει κάποlO προωθηηκή δύ
Ο
_
Ωστόσο, μια αντί
Ζ
δραση θα συμβεί αν μέσα στο κουτί ο αριθμός των κερμάτων με την «κορώνα» (Κ) προς τα πάνω διαφέρει από τον αριθμό των κερμάτων με τα «γράμματα» (Γ) προς τα πάνω. Στην πε
ρίπτωση αuτή, η δlOφορά της συγκέντρωσης ανάμεσα στα Κ και Γ δημιουργεί μlO προωθηηκή δύναμη, μlO ΔG
#
Ο, για
την αντίδραση, έως ότου επιτευΧθεί ισορροπία, οπότε Κ = Γ. Β. Ο βαθμός rnς ανατάραξης αντιστOlχεί στη θερμόrnτα που πα ράγεται από τη «θερμική» κίνηση των κερμάτων. Η ενέργεlO ενεργοποίησης της αντίδρασης είναι η ενέργεια που πρέπει
να δαπανηθεί έτσι ώστε ν' αναποδογυρίσει το κέρμα. Το «έν Ζυμο» θα μπορούσε να επιταΧύνει το αναποδογύρισμα ελατ
ΔG Ο
ρούσε να είναι ένας μαγνήτης μετέωρος πάνω από το κουτί
ηου θα βοηθούσε στην ανόρθωση των κερμάτων. Το «ένΖυ
Χ_ Ζ
_!_-
τώνoντας την αναγκαία ενέργεια. Γιο παράδειγμα, θα μπο
Ζ
Εικόνα Α3-4
μο» δεν θα επηρέαΖε το σημείο της ισορροπίας (ίσος αριθμός Κ και Γ) αλ/ά θα εΠl1άχυνε την επέλευση της ισορροπίας, ε
πειδή παρουσία του ενΖύμου περισσότερα κέρματα θ' ανα
τωθεί το ενεργειακό φράγμα ενεργοποίησης, περισσότερα μό
ποδογύΡιζαν προς τη μια ή την άλ/η πλευρά.
ρια θα έχουν επαρκή ενέργεια για να αντιδράσουν. Η πεΡΙΟΧή κάτω από την καμπύλη από το σημείο Α έως την άπειρη ενέρ
Aπ6vmσn3-4
γεlO ή από το σημείο Β έως την άπειρη ενέργεια υποδηλώνει Ο
Βλ. Εικόνα Α3-4. Προσέξτε όη η ΔG χ ~ Υ είναι θεηκή, ενώ τόσο
τον συνολικό αριθμό των μορίων που θ' αντιδράσουνμε ή χω
η ΔGΟΥ~Ζ όσο και η ΔGΟΥ~Ζ είναι αρνηηκές. Το διάγραμμα δεί
ρίς το ένΖυμο, αντιστοίχως. Παρόλο που δεν έχει σχεδlOστείστη
χνει επίσης όη ΔG\~Ζ = ΔGΟΧ~Υ
+ ΔGΟΥ~Ζ' Από τα δεδομέ
σωστή κλίμακα, ο λόγος της επιφάνειας αυτών των δύο περlO
να που δίνονται στην Εικόνα
δεν γνωρίΖουμε, κατά περί
Χών πρέπει να είναι 107.
3-13
σταση, πόσο υψηλή είναι η ενέργεlO ενεργοποίησης. Επομέ
νως, ορίΖεται αυθαίρετα και αποδίδεται με την έντονη γραμμή. Η ενέργεlO ενεργοποίησης κάθε αντίδρασης θα μπορούσε να ελαπωθεί από ένα ένζυμο το οποίο θα κατέλυε την αντίδραση, επιταΧύνοντάς την (στικτές γραμμές).
,§ Aπ6vmσn3-5
Q.
Η ταΧύτητα της αντίδρασης θα μπορούσε να περιορίζεται:
(J'
(1)
α
πό τη συγκέντρωση του υποστρώματος, δηλαδή το πόσο συχνά
ένα μόριο
(2)
CO 2 συγκρούεται με το
μόρια που διαθέτουν
~
ενεργό κέντρο του ενΖύμου,
(3)
Ι
Q. σ
ενέργεια ανά μόριο
Β
• ι-Α
μόρια που διαθέτουν αρκετή ενέργεια για να προχωρήσουν σε μια μη καταλυόμενη αντίδραση
από το πόσο
γρήγορα μπορεί το ένΖυμο ν' απελευθερώσει τα προϊόντα της α ντίδρασης ώστε να είναι ελεύθερο να προσδέσει το επόμενο υ πόστρωμα. Το διάγραμμα της Εικόνας Α3-5 δείχνει όη αν ελατ-
καταλυόμενη αντίδραση
::1. 'Β
από το πόσες από αυτές ης συγκρούσεις είναι αρκετά ισχυ
ρές έτσι ώστε να προωθήσουν την αντίδραση,
αρκετή ενέργεια για να προχωρήσουν σε μια
'ο
Εικόνα Α3-5
Απαντήσεις
929
Απάvmσn3-6
κλάσμα των συγκεντρώσεων αυτής της εξίσωσης είναι μικρότε
Όλες οι ανIlδράσεις είναι ανIlσφεπτές. Εφόσον η ένωση ΑΒ
ρο από
μπορεί να διασπαστεί σε Α και Β πρέπει επίσης να είναι δυνατή
είναι μια σταθερά για την αντίδραση που δεν ποικίλει ανάλογα
1 και ο λογάριθμός του είναι αρνηIlκός αριθμός.
Η ΔGΟ
και η ένωση των Α και Β για τον σχημαIlσμό ΑΒ. Το ποια αντί
με ιις συνθήκες της αντίδρασης. Αντίθετα, η ΔG εξαρτάται από
δραση θα επικρατήσει εξαρτάται από τη σταθερά ισορροπίας και
ιις συγκεντρώσεις των ΑΤΡ,
από τη συγκέντρωση των Α, Β και ΑΒ (όπως εξηγείται στην Εικό
ρουν ελαφρά από κύπαρο σε κύπαρο.
ADP και
Ρ, που μπορεί να διαφέ
να 3-20). Προφανώς, όταν απομονώθηκε το ένΖυμο η ενεργότη τά του ανιχνεύθηκε παρέχοντας τα Α και Β σε σχεIlκά μεγάλες
Απάvmσn3-9
ποσότητες και μετρώντας την ποσότητα του παραγόμενου ΑΒ.
Οι αντιδράσεις Β, Γ, Δ και Ε πρέπει να συΖευχθούν με άλλες, ε
Ωστόσο, μπορούμε να υποθέσουμε όIl στο κύπαρο υπάρχει με
νεργειακά ευνοϊκές αντιδράσεις. Σε κάθε περίπτωση, σχηματί
γάλη συγκέντρωση του ΑΒ, οπότε, υπό κανονικές συνθήκες, το
ΖΟνται δομές υψηλότερης τάξης οι οποίες είναι πιο περίπλοκες
+
και έχουν δεσμούς υψηλότερης ενέργειας από ιις πρώτες ύλες.
Β. (Αυτή η ερώτηση βασίζεται σ' ένα πραγμαIlκό παράδειγμα στο
Αντίθετα, η αντίδραση Α είναι μια καταβολική αντίδραση που ο
οποίο ένα ένΖυμο απομονώθηκε και ονομάστηκε σύμφωνα με
δηγεί σε ενώσεις χαμηλότερης ενεργειακής κατάστασης και
την αντίδραση προς μια κατεύθυνση, ενώ αργότερα βρέθηκε όIl
συμβαίνει αυθόρμητα.
ένζυμο στην πραγμαIlκότητα καταλύει την αντίδραση ΑΒ ~ Α
στα Ζωντανά κύπαρα καταλύει την αντίστροφη αντίδραση).
Απάvmσn3-10 Απάvmσn3-7
Α. Σχεδόν σωστό, αλ/ά υπό αυστηρή θεώρηση λάθος. Επειδή
Α. Οι βράΧοι της Εικόνας 3-31Β παρέχουν την ενέργεια για την
τα ένΖυμα αυξάνουν την ταΧύτητα αλ/ά δεν αλ/άΖουν το ση
ανύψωση του κουβά. Το ΑΤΡ προωθεί την αντίδραση και ε
μείο ισορροπίας μιας αντίδρασης, η αντίδραση αυτή πάντοτε
πομένως αντιστοιχεί στους βράχους. Οι θρυμμαIlσμένοι βρά
θα συμβαίνει έστω και αν απουσιάζει το ένΖυμο, αν και με ε
χοι στο έδαφος αντιστοιχούν στα
και (Ρ), δηλαδή στα
λάχιστη ταΧύτητα. Επιπλέον, διάφορες ανταγωνιστικές αντι
προϊόντα που προκύπτουν όταν το ΑΤΡ απελευθερώσει την ε
δράσεις μπορεί να καταναλώνουν πιο γρήγορα το υπόστρω
νέργειά του και ολοκληρώσει το έργο του. Στην αντίδραση, η
μα και έτσι να παρακωλύουν ακόμα περισσότερο την επιθυ
υδρόλυση του ΑΤΡ είναι συΖευγμένη με τη μετατροπή του Χ
μητή αντίδραση. Επομένως, από πρακτική άποψη, χωρίς έν
σε Υ. Επομένως, το Χ είναι η πρώτη ύλη (υπόστρωμα), που α
Ζυμο μερικές αντιδράσεις μπορεί να μην προχωρούν σχεδόν
ADP
ντιστοιχεί στον κουβά στο έδαφος, η οποία μετατρέπεται στο Υ (προϊόν), που αντιστοιχεί στον κουβά στο υψηλότερο σημείο.
Β. (α) Ο βράχος που προσκρούει στο έδαφος αντιστοιχεί στη μάταια υδρόλυση του ΑΤΡ. Αν δεν υπήρχε ένα ένζυμο το ο ποίο θα χρησιμοποιούσε την ενέργεια της υδρόλυσης του
καθόλου. Β. Λάθος. Τα ηλεκτρόνια υψηλής ενέργειας μεταφέρονται ευ κολότερα, δηλαδή είναι προσδεδεμένα πιο χαλαρά στο μό
ριο-δότη. Αυτό δεν σημαίνει όIl μετακινούνται και ταχύτερα. Γ. Σωστό. Η υδρόλυση ενός μορίου ΑΤΡ σε ΑΜΡ παράγει επί
ΑΤΡ για να προωθήσει μια κατά τα άλ/α μη ευνοϊκή αντίδρα
σης ένα μόριο πυροφωσφορικού (ΡΡί), το οποίο με τη σειρά
ση, η ενέργεια που αποθηκεύεται στον φωσφοανυδΡΙIlκό
του υδρολύεται σε δύο μόρια φωσφορικού. Αυτή η δεύτερη
δεσμό θα χανόταν υπό μορφή θερμότητας. (β) Η ενέργεια
αντίδραση απελευθερώνει σχεδόν την ίδια ποσότητα ενέρ
που αποθηκεύεται στο Υ θα μπορούσε να χρησιμοποιηθεί
γειας με την αρχική υδρόλυση του ΑΤΡ και έτσι περίπου δι
για να προωθήσει μια άλ/η αντίδραση. Αν το Υ αντιπροσώ πευε την ενεργοποιημένη μορφή ενός μορίου, Π.Χ. ενός αμι
νοξέος Χ, τότε θα μπορούσε να συμμετάσχει σε μια αντίδρα ση συμπύκνωσης για να σχηματίσει έναν πεΠIlδlκό δεσμό κατά την πρωτεϊνοσύνθεση.
πλασιάΖει την απόδοση σε ενέργεια. Δ. Σωστό. Η οξείδωση είναι η αφαίρεση ηλεκτρονίων, που ε
λαπώνει τη διάμετρο του ατόμου του άνθρακα. Ε. Σωστό. Το ΑΤΡ, για παράδειγμα, μπορεί να προσφέρει είτε ενέργεια είτε μια φωσφορική ομάδα. Ζ. Λάθος. Τα Ζωντανά κύπαρα έχουν επιλέξει ένα συγκεκριμέ
Απάvmσn3-8
νο είδος χημείας στο οποίο οι περισσότερες οξειδώσεις απε
Η ελεύθερη ενέργεια ΔG που προέρχεται από την υδρόλυση του
λευθερώνουν ενέργεια. Ωστόσο, υπό διαφορεIlκές συνθή
ΑΤΡ εξαρτάται τόσο από τη ΔGΟ όσο και από ιις συγκεντρώσεις
κες, όπως σε μια ατμόσφαιρα που θα περιείχε υδρογόνο, οι
του υποστρώματος και των προϊόντων. Στην περίmωση αυτή:
αναγωγές θ' απελευθέρωναν ενέργεια. Η. Λάθος. Όλα τα κύπαρα, ανάμεσά τους και τα κύπαρα τόσο
ΔG
[ADP]x[P]
των ψυχρόαιμων όσο και των θερμόαιμων Ζώων, ακιινοβο
[ΑΤΡ]
λούν συγκρίσιμες ποσότητες θερμότητας Χάρη στις μεταβο
= -12 kcal/mole = -7,3 kcal/mole + 0,616 Ιη - - - -
λικές αντιδράσεις τους. Στην περίπτωση των βακτηριακών
Η ΔG είναι μικρότερη από τη ΔGΟ επειδή στα κύπαρα η συγκέ
κυπάρων, αυτό γίνεται προφανές από τη θέρμανση της κο
millimoles) ενώ η 10 μΜ). Επομένως, το
Θ. Λάθος. Η σταθερά ισορροπίας της αντίδρασης Χ ~ Υ πα-
ντρωση του ΑΤΡ είναι υψηλή (της τάξης των
συγκέντρωση του
930
ADP χαμηλή
Απαντήσεις
(περίπου
πριάς.
ραμένει αμετάβλητη. Αν το Υ απομακρυνθεί από μια δεύτερη
αντίδραση, τότε περισσότερο Χ θα μετατραπεί σε Υ έτσι ώστε ο λόγος Χ προς Υ να παραμείνει σταθερός.
οξείδωση της γλυκόΖης σε
CO 2 και Η2 ο.
Β. Η συνολική απόδοση της παραγωγής του ΑΤΡ είναι περίπου
53% και
ορίΖεται ως ο λόγος του αριθμού των μορίων ΑΤΡ
που παράγονται στην πραγματικότητα
Aπ6vmσn 3-11 Η διαφορά ελεύθερης ενέργειας (ΔGΟ) ανάμεσα στα Β και Α που οφείλεται στους τρεις δεσμούς υδρογόνου είναι
kcal/mole.
(= 30) προς τον αριθ
μό των μορίων ΑΤΡ που θα μπορούσε να παραΧθούν αν όλη
-3
(Σημειώστε ότι η ελεύθερη ενέργεια του Β είναι χα
η ενέργεια ενός μορίου γλυκόΖης μπορούσε να συλ/εγεί ως
(= 57). 1 γραμμομορίου γλυκόΖης, 322 kcal (το 47% των διαθέσιμων 686 kcal σ' ένα γραμμομόριο
χημική ενέργεια στο ΑΤΡ
Γ. Κατά την οξείδωση
μηλότερη από εκείνη του Α, επειδή για να συμβεί η διάσπαση
υπόλοιπο
των δεσμών που θα μετατρέψει το Β στο Α απαιτείται κατανάλω
γλυκόΖης που δεν αποθηκεύονται ως χημική ενέργεια στο
ση ενέργειας. Επομένως, η τιμή της ΔGΟ για τη μετάβαση Α ~ Β
ΑΤΡ) απελευθερώνονται ως θερμότητα. Αυτή η ποσότητα ε
είναι αρνητική). Συνεπώς, η σταθερά ισορροπίας για την αντί
νέργειας θα αύξανε τη θερμοκρασία του σώματός σας κατά
δραση είναι περίπου
4.3"C (= 357 kcaV75 kg).
ισορροπίας τα μόρια
100 (Πίνακας 3-1), δηλαδή σε κατάσταση του Β θα είναι 100 φορές περισσότερα α
πό τα μόρια του Α. Αν υπήρχαν τρεις επιπλέον δεσμοί υδρογό
μοκρασίας κατά
νου η ΔGΟ θα αύξανε στα
να γραμμομόριο γλυκόΖης
-6 kcal/mole οπότε και η σταθερά ι σορροπίας θα αύξανε κατά 100 φορές και θα γινόταν 104. Έτσι,
σχετικά μικρές διαφορές ως προς την ενέργεια μπορεί να έχουν
μεγάλες επιπτώσεις στην ισορροπία.
Πρόκειται για μια σημαντική πο
σότητα θερμότητας, αν αναλογιστούμε ότι η άνοδος της θερ
4 ο C θα οδηγούσε σε υψηλό πυρετό και ότι έ (180 g) δεν είναι παρά δύο κού
πες Ζάχαρη.
Δ. Αν η απόδοση σε ενέργεια ήταν μόνο
20%, αντί για 53% ό 80% της διαθέσιμης
πως στο παραπάνω παράδειγμα, τότε το
ενέργειας θ' απελευθερωνόταν υπό μορφή θερμότητας και
Aπ6vmσn
θα έπρεπε να διαφύγει από το σώμα σας. Η παραγωγή θερ
3-12
Α. Η σταθερά ισορροπίας ορίζεται ως Κ = [ΑΒ]/([Α] χ [Β]). Οι
αγκύλες υποδηλώνουν τη συγκέντρωση. Συνεπώς, αν η συ
γκέντρωση καθενός από τα Α, Β, ΑΒ είναι 1 μΜ (10-6 Μ), τό τε η Κ θα ισούται με
106 Μ-Ι (= 10-6/10-6
χ
10-6).
Β. Παρομοίως, αν η συγκέντρωση καθενός από τα Α, Β και ΑΒ
είναι
1 μΜ (10-9 Μ), η Κ θα ισούται με 109 Μ-'.
Γ. Αυτό το παράδειγμα δείχνει ότι οι πρωτεΤνες που αλ/ηλεπι
δρούν και βρίσκονται στα κύπαρα σε χαμηλές συγκεντρώ
μότητας θα αύξανε κατά
1.5 φορές
και το σώμα σας σίγουρα
θα υπερθερμαινόταν.
Ε. Ο χημικός τύπος του ΑΤΡ είναι
Cl0H12013NsP3 και το μοριακό βάρος του ισούται με 503 g/mole. Συνεπώς, σε κατάσταση η ρεμίας, σε 24 ώρες το σώμα σας υδρολύει περίπου 80 γραμ μομόρια (= 40 kg/0.503 kg/mole) ΑΤΡ (αυτό αντιστοιχεί περί που σε απελευθέρωση 1000 kcal χημικής ενέργειας). Επειδή κάθε γραμμομόριο γλυκόΖης αποδίδει 30 γραμμομόρια ΑΤΡ,
σεις πρέπει να συνδέονται μεταξύ τους με υψηλή συγγένεια
αυτή η ποσότητα ενέργειας θα παραγόταν από την οξείδωση
προκειμένου σε κατάσταση ισορροπίας σημαντικό κλάσμα
480 g γλυκόΖης (= 180 g/mole χ 80 moles/30).
των μορίων να είναι συνδεδεμένα. Στη συγκεκριμένη περί πτωση, η ελάπωση της συγκέντρωσης κατά τρεις τάξεις μεγέ
Aπ6vmσn
θους (από τα μΜ στα ηΜ) προ()ποθέτει μια αντίστοιχη αλ/αγή
Ο επιστήμονας αυτός σίγουρα είναι απατεώνας. Τα
της σταθεράς ισορροπίας κατά τρεις τάξεις μεγέθους ώστε να
ΑΤΡ θ' αποθήκευαν
διατηρηθεί το πρωτεϊνικό σύμπλοκο ΑΒ ( ~
γειας, κάτι που σημαίνει ότι η απόδοση της παραγωγής του ΑΤΡ
ρης ενέργειας, Εικόνα
από τη γλυκόΖη θα ήταν το εξωφρενικό
3-20). Αυτό
-4.3 kcal ελεύθε αντιστοιχεί περίπου σε 4-
5 επιπρόσθετους δεσμούς υδρογόνου.
3-15 684 kcal (= 57
χ
12 kcal) 99.7%.
57 μόρια
χημικής ενέρ Με αυτή την α
πόδοση, σχεδόν καθόλου ενέργεια δεν θ' απελευθερωνόταν υ πό μορφή θερμότητας, ενώ η απελευθέρωση αυτή επιβάλλεται
Aπ6vmσn 3-13
από τους νόμους της θερμοδυναμικής.
Η διαπίστωση είναι σωστή. Το κριτήριο για το αν μια αντίδραση
θα πραγματοποιηθεί αυθόρμητα είναι η ΔG, και όχι η ΔGΟ, που
Aπ6vmσn
λαμβάνει υπόψη τις συγκεντρώσεις των αντιδρώντων. Για παρά
Α. Στον Πίνακα
δειγμα, μια αντίδραση με αρνητική ΔGΟ δεν θα συνέβαινε αυ θόρμητα αν τα προϊόντα της ήταν ήδη σε περίσσεια, δηλαδή σε
μεγαλύτερη συγκέντρωση απ' ό,τι σε κατάσταση ισορροπίας. Α ντίθετα, μια αντίδραση με θετική ΔGΟ θα μπορούσε να εξελιΧθεί αυθόρμητα αν υπήρχε μια τεράστια περίσσεια υποστρώματος.
3-16 3-1
βλέπουμε ότι μια μεταβολή ελεύθερης ε
νέργειας της τάξης των
4.3 kcal/mole αντιστοιχεί σε μια στα θερά ισορροπίας 10-3, δηλαδή [Α*]/[Α] = 10-3. Επομένως, η συγκέντρωση του Α * είναι 1000 φορές μικρότερη από τη συ
γκέντρωση του Α. Β. Ο λόγος του Α προς το Α* θα παρέμενε αμετάβλητος. Η ε λάπωση της ενέργειας ενεργοποίησης θα επιτάχυνε την αντί
Aπ6vmσn
δραση, δηλαδή θα επέτρεπε να συμβαίνουν περισσότερες
3-14
Α. Η ενέργεια που διαθέτουν
57 μόρια
ΑΤΡ
(=686/12)
αντι
στοιχεί στην ενέργεια που απελευθερώνεται από την πλήρη
μετατροπές Α ~ Α * και Α * ~ Α στη μονάδα του χρόνου, αλ λά δεν θα επηρέαΖε το σημείο ισορροπίας.
Απαντήσεις
931
Aπόvmση 3-17
τερη αναλογία μορίων του υποστρώματος μπορεί να υπερβεί το
Α. Ο μεταλ/αγμένος οργανισμός θα ήταν μια μάλ/ον ασφαλής
«εμπόδιο» της ενέργειας ενεργοποίησης. Ωστόσο, πολ/ά υπο
-12 kcaVmole
στρώματα θα μπορούσαν ν' αντιδράσουν με πολ/ούς διαφορετι
ενέργειας. Αυτή η ποσότητα ενέργειας μετατοπίζει το σημείο
κούς τρόπους και η θερμότητα θα επαύξανε όλες τις σχετικές πι
ισορροπίας μιας αντίδρασης περίπου κατά
(στον
θανές οδούς. Αντίθετα, ένα ένΖυμο προσδίδει επιλεκτικότητα και
τροφή. Η υδρόλυση του ΑΤΡ παρέχει περίπου
108 φορές
σε μια
διευκολύνει μόνο μια συγκεκριμένη οδό, η οποία επιλέΧθηκε
σταθερά ισορροπίας 104. Επομένως -12 kcaVmole αντιστοι χούν περίπου σε 108. Σημειώστε ότι για τις συΖευγμένες αντι
κατά την εξέλιξη έτσι ώστε να είναι επωφελής για το κύπαρο. Ε
δράσεις οι ενέργειες των επιμέρους αντιδράσεων προστίθε
του ενΖύμου και η κοτόσουπα ασκεί την ευεργετική δράση της με
νται ενώ οι σταθερές ισορροπίας πολ/απλασιάΖΟνται). Συνε
άλ/ους μηχανισμούς, άΥνωστους μέχρι σήμερα.
Πίνακα
3-1
βλέπουμε ότι
-5.7 kcaVmole αντιστοιχούν
πομένως, η θερμότητα δεν μπορεί να υποκαταστήσει τη δράση
πώς, αν η ενέργεια της υδρόλυσης του ΑΤΡ δεν ήταν δυνατό να χρησιμοποιηθεί από το ένζυμο, η ποσότητα του παραγο
Aπdvmon 3-20
μένου δηλητηρίου θα ήταν κατά 108 φορές μικρότερη. Το
Α. Όταν
~, τότε το άθροισμα
[5] «
([5]
+ ~) θα προσεΥΥίΖει
την τιμή της ~. Επομένως, η εξίσωση απλουστεύεται ως ε
παράδειγμα αυτό δείχνει ότι η σύΖευξη μιας αντίδρασης με την υδρόλυση ενός ενεργοποιημένου μορίου-φορέα μπορεί
ξής: ταχύτητα = νmax~
να μετατοπίσει δραστικά το σημείο ισορροπίας.
γη με τη συγκέντρωση του υποστρώματος.
Β. Στην περίπτωση αυτή, ο μεταλ/αγμένος οργανισμός θα ήταν
Β. Όταν
[5], δηλαδή,
η ταχύτητα είναι ανάλο
[5] = ΚΜ , τότε το πηλίκο [5]/([5]
+~) θα ισούταιμε
%.
μια επικίνδυνη τροφή. Η ελάπωση της ταχύτητας της αντί
Επομένως, η ταχύτητα της αντίδρασης θα είναι ίση με το μισό
δρασης δεν θα επηρέαΖε το σημείο ισορροπίας της και αν η
της μέγιστης ταχύτητας.
αντίδραση αφηνόταν να εξελιχθεί επί αρκετά μεγάλο χρόνο,
Γ. Αν
[5] »
([5] + ~) θα προσεΥΥίΖει την [5]/([5] + ΚΜ )] = 1 και η αντίδραση
~, τότε το άθροισμα
ο μεταλ/αγμένος οργανισμός θα γέμΙΖε δηλητήριο. Η ισορ
τιμή του
ροπία της αντίδρασης ίσως να μην επιωγχανόταν ποτέ, επο
θα διεξάγεται με τη μέγιστη ταχύτητα νmax'
[5].
Επομένως,
μένως δεν θα ήταν σκόπιμο να ρισκάρει κανείς.
Aπdvmon 3-21
Aπdvmon
3-18
Η συγκέντρωση του υποστρώματος είναι
1 mM.
Η τιμή αυτή
Το ένΖυμο Α είναι επωφελές. Επιτρέπει την αλ/ηλομεταφοπή
προκύπτει από την εξίσωση, αλ/ά είναι απλούστερο να προσέ
δύο μορίων-φορέων ενέργειας, τα οποία στην φιφωσφορική
ξουμε ότι η επιθυμητή ταχύτητα
μορφή τους είναι και τα δύο απαραίτητα σε πολ/ές μεταβολικές
σή από τη μέγιστη ταχύτητα ν max' όπου η συγκέντρωση του υπο
αντιδράσεις. Όσο ΑΟΡ σχηματίζεται, μετατρέπεται γρήγορα σε
στρώματος τυπικά ισούται με ΚΜ . Οι δύο καμπύλες που καλείστε
ΑΤΡ και έτσι το κύπαρο διατηρεί έναν υψηλό λόγο
ATP-ADP.
(50 μΜ!sec)
είναι ακριβώς η μι
να σχεδιάσετε παρουσιάΖΟνται στην Εικόνα Α3-21. Η γραφική
Εξαιτίας του ενΖύμου Α, που ονομάΖεται φωσφοκινάση των νου
παράσταση της σχέσης Ι/ταχύτητα προς
κλεοτιδίων, ένα μέρος του ΑΤΡ χρησιμοποιείται για να διατηρεί
γραμμή, επειδή η αναδιάταξη της πρόωπης εξίσωσης δίνει την
εξίσου υψηλό και τον λόγο
εξίσωση που αναφέρεται στην Ερώτηση 3-23Β.
GTP-GDP.
1/[5]
είναι μια ευθεία
Το ένΖυμο Β θα ήταν πολύ καταστροφικό για το κύπαρο. Τα
κύπαρα χρησιμοποιούν το
NAD+ ως δέκτη ηλεκφονίων σε κα
Απάvmση
3-22 [5] είναι
πολύ μικρότερη από την ΚΜ , τότε το ενερ
ταβολικές αντιδράσεις. Για να μπορούν ν' αποδομούν τη γλυκό
Αν η τιμή της
Ζη και να παράγουν ΑΤΡ πρέπει να διατηρούν αυτή τη μορφή
γό κέντρο του ενΖύμου θα είναι κατεξοΧήν μη κατειλημμένο. Αν
του φορέα σε υψηλή συγκέντρωση. Αντίθετα, το ΝΑΟΡΗ χρησι
η
μοποιείται ως δότης ηλεκτρονίων σε βιοσυνθετικές αντιδράσεις
ριορίΖεται από τη συγκέντρωση του ενΖύμου (επειδή οι περισσό
και διατηρείται σε υψηλά επίπεδα στα κύπαρα ώστε να είναι δυ
τερες καλυτικές θέσεις θα είναι κατειλημμένες).
[5]
είναι πολύ μεγαλύτερη από την ~, τότε η ταχύτητα θα πε
νατή η σύνθεση των νουκλεοτιδίων, των λιπαρών οξέων και άλ
3-23
λων απαραίτητων μορίων. Επειδή το ένΖυμο Β θα εξαντλούσε τ'
Aπόvmση
αποθέματα του κυπάρου τόσο σε NAD+ όσο και σε NADPH, θα
Α, Β. Τα δεδομένα στα δύο ορθογώνια πλαίσια χρησιμοποιή
ελάπωνε την ταχύτητα τόσο των καταβολικών όσο και των βιο
θηκαν για να σχεδιαστεί η κόκκινη καμπύλη και η κόκκινη
συνθετικών αντιδράσεων.
γραμμή στην Εικόνα Α3-23. Από τα δεδομένα αυτά προκύ
Aπdvmon3-19
τι τα δεδομένα ερμηνεύονται πολύ ευκολότερα στη γραμμική
Επειδή τα ένΖυμα είναι καταλύτες, οι ενΖυμικές αντιδράσεις πρέ
καμπύλη, επειδή η καμπύλη στο (Α) προσεΥΥίΖει αλ/ά ποτέ
mει ότι η ~ είναι
πει να είναι θερμοδυναμικά εφικτές. Ένα ένΖυμο απλώς ελαπώ
1 μΜ και η ν max 2 μΜ!mίη. Παρατηρείστε ό
δεν φτάνει τη ν max'
νει το φράγμα της ενέργειας ενεργοποίησης το οποίο επιβραδύ
Γ. Είναι σημαντικό να τονιστεί ότι παράγεται μια πολύ μικρή ποσό
νει την ταχύτητα μιας αντίδρασης. Αντίθετα, η θερμότητα παρέχει
τητα προϊόντος, επειδή αλ/ιώς η ταχύτητα της αντίδρασης θα ε
στα υποστρώματα περισσότερη κινητική ενέργεια. Έτσι μεγαλύ-
λαπωνόταν καθώς θα εξαντλούνταν το υπόστρωμα και θα ΣUσ-
932
Απαντήσεις
0.07 r - - - - - - - - - - - - - - - - - - ,
100r-------------------,
~
0.05
.~
s
3 χ 106 --7 lη(3 χ 106 )/lη(4) = 10.7.
πουρίνη (βλ. Π.Χ. Ερώτηση
Συνεπώς, κατά μέσο όρο, μια αλληλουΧία μήκους
5-6). Συνεπώς, οι οκτώ πιθανοί συνδυασμοί είναι ν-Α, V-G, W-A, W-G, X-C, Χ-Τ, Y-C και Υ
νου
Τ. Ωστόσο, εξαιτίας της εντόπισης των ομάδων που δρουν ως
κλεοτιδίων θα είναι μοναδική στο γονιδίωμα. Αν ο ίδιος υπο
δότες και δέκτες δεσμών υδρογόνου, σε κανέναν από αυ
λογισμός εκτελεστεί και για το μέγεθος του γονιδιώματος ε
τούς τους συνδυασμούς δεν θα σχηματίΖονταν σταθερά Ζεύ
νός Ζωικού κυττάρου, τότε προκύπτει ότι το ελάχιστο μήκος
γη βάσεων, όπως φαίνεται για το Ζεύγος ν-Α στην Εικόνα
πρέπει να είναι
Α5-6, όπου θα μπορούσε να σχηματιστεί μόνο ένας δεσμός
16 νουκλεοτίδια.
11
Αυτό δείχνει ότι μια σχετικά
βραχεία αλ/ηλουΧία μπορεί να σημάνει μια μοναδική αλ/η
υδρογόνου.
λουΧία στο γονιδίωμα και να χρησιμοποιηθεί ως ταυτότητα Απάντηση
για ένα συγκεκριμένο γονίδιο.
5-7
Επειδή ΟΙ κλώνοι συγκρατούνται με δεσμούς υδρογόνου ανά Απάντηση
5-5
μεσα στις βάσεις, η σταθερότητα της έλικας σε μεγάλο βαθμό ε συχνά λάθος
ξαρτάται από τον αριθμό των δεσμών υδρογόνου που μπορεί να
βάσεις, τότε οι γενετικές πληροφορίες δεν θα μεταβιβάΖονταν
σχηματιστούν. Συνεπώς, η σταθερότητα καθορίΖεται από δύο
με ακρίβεια. Έτσι, η Ζωή όπως την ξέρουμε δεν θα υπήρχε. Πα
παραμέτρους, δηλαδή από τον αριθμό των Ζευγών των νουκλε
ρόλο που οι βάσεις μπορεί να σχηματίσουν τα Ζεύγη βάσεων
οτιδίων και από τον αριθμό των δεσμών υδρογόνου που συνει
Αν κατά την αντιγραφή του
DNA ενσωματώνονταν
που αναφέρονται στην ερώτηση, τα Ζεύγη αυτά δεν χωρούν στη
σφέρει το κάθε Ζεύγος. Όπως φαίνεται στην Εικόνα
δομή της διπλής έλικας. Συγκεκριμένα, στο Ζεύγος
Ζεύγος Α-Τ συνεισφέρει δύο δεσμούς υδρογόνου, ενώ ένα Ζεύ
A-C η γωνία
5-6,
ένα
με την οποία προσδένεται στον σακχαροφωσφορικό σκελετό η
γος
Α είναι πολύ διαφορετική, ενώ στο Ζεύγος
δεσμούς υδρογόνου) «τήκεται}} σε χαμηλότερη θερμοκρασία
A-G,
όπου αλ/ηλεπl
G-C τρεις.
Επομένως, η έλικα Γ (που περιέχει συνολικά
34
δρούν δύο μεγάλοι δακτύλιοι πουρίνης η απόσταση ανάμεσα
και ακολουθούν η έλικα Β (που περιέχει συνολικά
στους δύο σακχαροφωσφορικούς κλώνους αυξάνει πολύ. Επο
υδρογόνου) και η έλικα Α (με
μένως, η ενσωμάτωση λάθος βάσεων σε μια αλυσίδα ΟΝΑ δεν
είναι η πιο σταθερή, κυρίως λόγω της υψηλής περιεκτικότητάς
είναι καθόλου ευνοϊκή από ενεργειακή άποψη και τέτοια λάθη
της σε
συμβαίνουν πολύ σπάνια.
ριβάλ/ον με ακραία θερμοκρασία, όπως μερικά βακτήρια που
GC.
78 δεσμούς
65 δεσμούς
υδρογόνου), η οποία
Πράγματι, το ΟΝΑ των οργανισμών που Ζουν σε πε
Ζουν σε γεωθερμικές φλέβες, έχει ασυνήθιστα υψηλή περιεκτι Απάντηση
5-6
κότητα σε
GC.
νο μόριο με ιδιότητες πρακτικά ταυτόσημες με τις ιδιότητες
Απάντηση
5-8
του γνήσιου ΟΝΑ. Η ν θα έπρεπε να Ζευγαρώνει πάντα με Επομένως, τα μακρομόρια θα μπο
Το ΟΝΑ θ' αυξανόταν κατά 2.5 χ 106 φορές (= 5 χ 10-3/2 χ 10-9 m). Συνεπώς, η προέκταση θα είχε μήκος 2500 χιλιόμετρα,
ρούσε να πρoέρxovταl από έναν Ζωντανό οργανισμό ο ο
δηλαδή θα ήταν περίπου ίση με την απόσταση του Λονδίνου α
ποίος θα χρησιμοποιούσε τις
πό την Κωνσταντινούπολη, του Σαν Φρανσίσκο από το Κάνσας
ίδιες αρχές για την αντιγραφή
Σίτυ, του Τόκυο από το νότιο άκρο της Ταϊβάν και της Μελβούρ
του γονιδιώματός του. Κατά
νης από το Κερνς. Τα γειτονικά νουκλεοτίδια θ' απείχαν μεταξύ
την εξέλιξη, ως δομικοί λίθοι
τους περίπου
του ΟΝΑ στη γη θεωρητικά θα
μιας στοίβας
Α. Οι βάσεις ν,
την Χ και η
W,
χ και Υ μπορεί να σχηματίσουν ένα δίκλω
W με την Υ.
0.85 mm (απόσταση που ισοδυναμεί με το πάχος 12 σελίδων αυτού του βιβλίου). Ένα γονίδιο με 1000 Ζεύγη νουκλεοτιδίων θα είχε μήκος περίπου 85 cm.
ήταν δυνατό να έχουν επιλε γεί διαφορετικές βάσεις, όπως οι ν,
W, χ και Υ.
(Παρομοίως,
Απάντηση
υπάρχουν πολύ περισσότερα αμινοξέα από τα
20 που
5-9
Α. Για να καθορισθεί κάθε Ζεύγος νουκλεοτιδίων θα χρειάΖΟ
επιλέ
νταν δύο
bits
(για παράδειγμα, οι δυαδικοί κωδικοί για τα
χθηκαν κατά την εξέλιξη για
τέσσερα διαφορετικά νουκλεοτίδια, το καθένα Ζευγαρωμένο
την
με το κατάλ/ηλο ταίρι του, θα μπορούσε να είναι
παρασκευή
όλων
των
πρωτεϊνών).
και
Β. Καμιά από τις βάσεις ν,
W,
Β. Ολόκληρο το ανθρώπινο γονιδίωμα (3 χ 109 Ζεύγη νουκλε οτιδίων) θα μπορούσε να χωρέσει σε 2 CDs (3 χ 109 χ 2 bits/4.8 χ 109 bits).
χ
καιγ δεν μπορεί ν' αντικατα στήσει τις Α, Τ,
G ή C.
Για να
διατηρηθεί η απόσταση ανάμε Απάντηση
σα στους δύο σακχαροφωσφο ρικούς κλώνους μιας διπλής έ-
938
Απαντήσεις
00,01, 10
11).
Εικόνα Α5-6
Α. Σωστό.
5-10
Β. Λάθος. Οι πρωτε'ϊνες του πυρήνα των νουκλεοσωματίων έ χουν διάμετρο περίπου
11 nm.
Ένα μοντέλο του τρόπου με
τον οποίο συσκευάΖονται Υια να σχηματίσουν ένα ινίδιο δια
μέτρου
πρωτε'ϊνης, της αιμοσφαιρίνης. Ο πυρήνας Β προέρχεται από έ
να λεμφοκύτταρο, το οποίο μεταΥράφει ενεΡΥά πολ/ά διαφορε τικά Υονίδια.
30 nm παρουσιάΖεται mnv Εικόνα 5-24. Aπ6vτnσn 5-14
Aπ6vτnσn
Η έλικα Α είναι δεξιόmροφη. Η έλικα
5-11
Οι ερμηνείες των όρων δίνονται
C είναι αριmερόmροφη.
Γλωσσάριο. Το ΟΝΑ συ
Η έλικα Β έχει έναν δεξιόmροφο και έναν αριmερόmροφο
ναρμολΟΥείται με εξειδικευμένες πρωτεϊ'νες Υια να σχηματίσει
κλώνο. Υπάρχουν αρκετοί τρόποι Υια να διαπιmώσει κανείς τη
χρωματίvn. Σ' ένα πρώτο επίπεδο συσκευασίας, οι ιmόνες σχη
χειρότητα μιας έλικας. Για έλικες με κάθετο προσανατολισμό
mo
ματίΖουν τον πυρήνα των vουκl1εοσωματίωv. Σ' ένα νουκλεοσω
(όπως οι έλικες της Εικόνας Ε5-14), αν οι κλώνοι που βρίσκο
μάτιο, το ΟΝΑ περιελίσσεται Υύρω από αυτόν τον πυρήνα δύο
νται μπροmά κατευθύνονται προς τα δεξιά, τότε η έλικα είναι
φορές. Στο διάmημα που παρεμβάλ/εται ανάμεσα σε δύο πυρη
δεξιόmροφη, ενώ αν κατευθύνονται προς τ' αριmερά η έλικα
νικές διαιρέσεις, δηλαδή κατά τη μεσόφαση, η ΧΡωμαrίvn των
είναι αριmερόmροφη.
μεσοφασικώv χρωμοσωμάrωv βρίσκεται σε σχετικά εκτεταμένη (χαλαρή) μορφή και είναι διάσπαρτη
mov πυρήνα.
Ωmόσο, με
ρικές περιοχές της, που αποκαλούνται εrεΡΟΧΡωμarίvn, παρα μένουν σφιχτά συσκευασμένες και είναι ανενεΡΥές από μετα Υραφική άποψη. Κατά τη διαίρεση του πυρήνα (μίτωση), τ' αντι Υραμμένα χρωμοσώματα συμπυκνώνονται
mn μορφή των μιrω
rικώv χρωμοσωμάrωv, τα οποία είναι μεταΥραφικώς ανενεΡΥά
και προορίζονται Υια κατανομή
ma θυΥατρικά κύτταρα.
Aπ6vτnσn 5-12
Aπ6vτnσn 5-15 Μέσα
mov πυρήνα του νουκλεοσωματίου ο λόΥος συσκευασίας είναι 4.5 [(146 bp χ 0.34 nm/bp)/(l1 nm) = 4.5]. Επειδή υπάρ χουν επιπλέον 54 bp συνδετικού ΟΝΑ, ο λόΥος συσκευασίας Υια το ΟΝΑ με διάταξη «Χάντρες πάνω σε μια αλυσίδα» (beadson-a-string) είναι 2.3 [(200 bp χ 0.34 nm/bp)/(l1 nm + {54 bp χ 0.34 nm/bp}) = 2.3]. Αυτό το πρώτο επίπεδο συσκευασίας α ντιπροσωπεύει μόλις το 0.023% (2.3/10,000) της συνολικής συ μπύκνωσης που συμβαίνει κατά τη μίτωση.
Οι αποικίες είναι αθροίσματα κυττάρων που προέρχονται από έ
να ιδρυτικό κύτταρο και αυξάνουν καθώς τα κύτταρα διαιρού
Aπ6vτnσn
νται όλο και περισσότερες φορές. Στην κάτω αποικία της Εικό
Τα οκταμερή των ιmονών καταλαμβάνουν περίπου το
νας
όΥκου του πυρήνα. Ο όΥκος του πυρήνα είναι:
5-27Α, το Υονίδιο
ΑΟΕ2 αδρανοποιείται όταν τοποθετείται
5-16 V = 4/3 χ 3.14 χ (3 χ 103 nm)3 V = 1.13 χ 1011 nm 3
κοντά σ' ένα τελομερίδιο. Προφανώς όμως μπορεί να ενεΡΥΟ ποιηθεί αυθόρμητα σε λίΥα κύτταρα τα οποία αποκτούν λευκό χρώμα. Μόλις ενεΡΥοποιηθεί αυθόρμητα σ' ένα κύτταρο, το ΥΟ
νίδιο ΑΟΕ2 συνεχίΖει να είναι ενερΥό mους αΠΟΥόνους αυτού του κυττάρου, οδηΥώντας
κύτταρα (λευκοί τομείς)
mnv εμφάνιση σωρών από λευκά mnv αποικία. Το αποτέλεσμα αυτό δεί
9% του
Ο όΥκος των οκταμερών των ιmονών είναι:
V = 3.14 χ (4.5 nm)2 χ (5 nm) χ (32 χ 106) V = 1.02 χ 1010 nm 3 Ο λόΥος του όΥκου των οκταμερών των ιmονών προς τον όΥΚΟ
χνει ότι η αδρανοποίηση ενός Υονιδίου που τοποθετείται κοντά
του πυρήνα είναι
σ' ένα τελομερίδιο μπορεί ν' αναmραφεί όπως επίσης και ότι η
ταλαμβάνουν περίπου
0.09.
Συνεπώς, τα οκταμερή των ιmονών κα
9% του
όΥκου του πυρήνα. Επειδή το
αλ/αΥή αυτή μπορεί να μεταβιβαmεί mις επόμενες Υενεές (βλ.
ΟΝΑ επίσης καταλαμβάνει περίπου
Εικόνα
το ΟΝΑ και οι ιmόνες αθροιmικά καταλαμβάνουν περίπου
8-24). Η αλ/αΥή mnv έκφραση του Υονιδίου ΑΟΕ2
προ
φανώς οφείλεται σε μια αυθόρμητη αποσυμπύκνωση της δομής
9% του
όΥκου του πυρήνα,
18%
του όΥκου του πυρήνα.
της χρωματίνης Υύρω από το Υονίδιο.
Aπ6vτnσn Aπ6vτnσn
5-17
Αντίθετα από τις περισσότερες πρωτείνες, οι οποίες συσσωρεύ
5-13 παρατηρούνται περιοχές της
ουν αλ/αΥές αμινοξέων κατά την εξέλιξη, οι λειτουΡΥίες των ι
χρωματίνης με διαφορετική πυκνότητα: οι περιοΧές με μεΥάλη
mονών προϋποθέτουν την παρουσία σχεδόν όλων των αμινο
Στις ηλεκτρονιομΙΚΡΟΥραφίες
ετεροχρωματίνη, ενώ η λΙΥότερο
ξέων τους. Για το λόΥΟ αυτό, η αλ/αΥή σε οποιαδήποτε θέση εί
συμπυκνωμένη χρωματίνη έχει μικρότερη πυκνότητα. Η χρω
ναι επιβλαβής Υια το κύτταρο. Οιιmόνες είναι εξαιρετικά εξειδι
ματίνη του πυρήνα Α βρίσκεται κυρίως
κευμένες Υια τη λειτουΡΥία τους.
πυκνότητα αντιmοιχούν
mnv
mn
μορφή της συμπυ
κνωμένης, μεταΥραφικά ανενεΡΥού ετεροχρωματίνης. Αντίθε τα,
mo
μεyαίΊUτερo μέρος της η χρωματίνη του πυρήνα Β είναι
αποσυμπυκνωμένη και επομένως δυνητικά ενεΡΥός Υια μετα
Κεφάλαιο
6
Υραφή. Ο πυρήνας Α προέρχεται από ένα δικτυοερυθροκύττα
Aπ6vτnσn 6-1
ρο, ένα πρόδρομο κύτταρο του ερυθροκυττάρου, το οποίο σε
Α. Η απόmαση ανάμεσα mις διΧάλες αντΙΥραφής
μεΥάλο βαθμό έχει «αφιερωθεί»
mnv
παραΥωΥή μιας μόνο
ναι περίπου 280
nm
και αντιmοιχεί σε
#4 και #5 εί 824 νουκλεοτίδια (=
Απαντήσεις
939
28010,34). Αυτές οι δύο διΧάλες θα συγκρούονταν περίπου σε 8 δευτερόλεπτα. Οι διΧάλες #7 και #8 απομακρύνονταιη μια από την άλ/η και επομένως δεν θα συγκρουστούνποτέ. Β. Το συνολικό μήκος του ΟΝΑ που φαίνεται στην ηλεκφονιο μικρογραφία είναι περίπου 1.5 μm και αντιστοιχεί σε
4400
νουκλεοτίδια. Αυτό το ΟΝΑ αποτελεί μόνο το
περί
0,002%
που [= (440011.8 χ 108) χ 100%] του συνολικού ΟΝΑ του
καθυστερημένος κλώνος θα περιλάμβανε κλάσματα αποτε λούμενα τόσο από ΗΝΑ όσο και από ΟΝΑ. Ε. Χωρίς την ΟΝΑ ελικάση, η ΟΝΑ πoλUΜεράση θα σταματήσει
επειδή δεν μπορεί να διαχωρίσει τους κλώνους του ΟΝΑ εκ μαγείου που βρίσκονται μπροστά της. Έτοι, θα συντεθεί λίγο ή καθόλου ΟΝΑ. Ζ. Χωρίς την πριμάση δεν μπορεί να συντεθούν ΗΝΑ εκκινητές
ούτε στον προπορευόμενο ούτε στον καθυστερημένο κλώνο.
κυπάρου μιας μύγας.
Επομένως, δεν μπορεί ν' αρχίσει αντιγραφή του ΟΝΑ.
Απάvmσn6-2 Μολονότι η διεργασία μπορεί να φαίνεται άσκοπη, κατά τη διάρ
Εικόνα6-4
κεια της σύνθεσης των εκκινητών δεν γίνεται επιδιόρθωση των
Οι βλάβες του ΟΝΑ που προκαλούνται από αντιδράσεις απαμί
λαθών. Για ν' αρΧίσει η σύνθεση ενός νέου εκκινητή πάνω σ' έ
νωσης και αποπουρίνωσης συμβαίνουν αυθόρμητα. Δεν είναι
ένα νουκλεοτίδιο πρέπει να το
αποτέλεσμα της αντιγραφής και άρα έχουν την ίδια πιθανότητα
ποθετηθεί στη σωστή θέση και στη συνέχεια να συνδεθεί με ένα
να συμβούν είτε στον ένα είτε στον άλ/ο κλώνο. Αν τα ένΖυμα ε
δεύτερο νουκλεοτίδιο, μετά με ένα τρίτο Κ.Ο.Κ. Έστω και αν αυ
πιδιόρθωσης του ΟΝΑ αναγνώΡΙΖαν τέτοιες βλάβες μόνο πάνω
τά τα τρία πρώτα νουκλεοτίδια Ζευγάρωναν τέλεια με τον κλώνο
σε νεοσυντεθειμένους κλώνους
εκμαγείο, το τΡινουκλεοτίδιο που προκύπτει, όπως όλα τα βρα
παρέμεναν ανεπιδιόρθωτες. Συνεπώς, η διαπίστωση είναι ανα
χέα ολιγονουκλεοτίδια, προσδένεται με πολύ μικρή συγγένεια.
κριβής.
να κομμάτι μονόκλωνου
DNA,
DNA, τότε
οι μισές βλάβες θα
Έτοι, θα ήταν δύσκολο να διακριθούν οι σωστές από τις «λάθος» βάσεις από έναν υποθετικό έλεγχο της πιστότητας. Συνεπώς, το
Εικόνα6-5
έργο της πριμάσης είναι να «συνθέτει κάτι που προσδένεται αρ
Ο ιός του AIDS (ιός της ανοσοανεπάρκειας του ανθρώπου,
κετά καλά και να μην πολυσκοτίζεται για την πιστότητα». Αργότε
είναι ένας ρετΡοϊός και συνθέτει ΟΝΑ από ένα ΗΝΑ εκμαγείο
ρα, οι αλ/ηλουΧίες αυτές αφαιρούνται και αντικαθίστανται από
χρησιμοποιώντας την αντίστροφη μεταγραφάση. Αυτό συχνά ο
HIV)
την ΟΝΑ πολυμεράση, η οποία χρησιμοποιεί ως εκκινητή το α
δηγεί σε μεταλλάξεις στο γονιδίωμα του ιού. Στην πραγματικό
κριβές, σωστά διορθωμένο, νεοσυντεθειμένο ΟΝΑ. Η ΟΝΑ πο
τητα, οι ασθενείς με
λυμεράση, αντίθετα από την πριμάση, έχει το πλεονέκτημα ότι
ποικιλίες του Ηιν οι οποίες διαφέρουν γενετικά από τον αρχικό
προσθέτει το νέο νουκλεοτίδιο σ' έναν προϋπάρχοντα κλώνο.
ιό που τους μόλυνε. Αυτό δημιουργεί μεγάλα προβλήματα στην
Με τον τρόπο αυτό, το νέο νουκλεοτίδιο συγκρατείται ισχυρά στη
αντιμετώπιση της λοίμωξης: τα φάρμακα που αναστέλ/ουν απα
θέση του, οπότε μπορεί να ελεγΧθεί η πιστότητα του Ζευγαρώμα
ραίτητα ένΖυμα του ιού δρουν μόνο παροδικά, επειδή νέα στε
τός του με το επόμενο νουκλεοτίδιο πάνω στον κλώνο-εκμαγείο.
λέχη του ιού τα οποία είναι ανθεκτικά σε αυτά τα φάρμακα ανα
Συνεπώς, καθώς η ΟΝΑ πολυμεράση γεμίΖει το κενό, ελέγχει
πτύσσονται γρήγορα με μεταλλάξεις.
παράλ/ηλα για λάθη τον νέο κλώνο ΟΝΑ που συνθέrει.
AIDS
συχνά φέρουν πολ/ές διαφορετικές
Οι ΗΝΑ ρεπλικάσες (ΗΝΑ πολυμεράσες που συνθέτουν ΗΝΑ χρησιμοποιώντας ως εκμαγείο το ΗΝΑ) δεν ελέγχουν ούτε και
Εικόνα6-3
αυτές την πιστότητα του αντιγράφου. Επομένως, οι ΗΝΑ ιοί που
Α. Χωρίς την ΟΝΑ πολυμεράση δεν μπορεί να πραγματοποιη
αντιγράφουν απευθείας το ΗΝΑ γονιδίωμά τους επίσης μεταλ
θεί αντιγραφή. Οι ΗΝΑ εκκινητές θα σχηματιστούν στην αφε
λάσσονται συχνά. Σ' έναν τέτοιο ιό, το γεγονός αυτό προκαλεί
τηρία της αντιγραφής.
αλλαγές στις πρωτεΊνες του περιβλήματος που κάνουν τον με
Β. Η ΟΝΑ λιγκάση συνδέει τα κλάσματα ΟΝΑ που παράγονται
ταλ/αγμένο ιό να φαίνεται «νέος» στο ανοσοποιητικό σύστημα.
στον καθυστερημένο κλώνο. Αν απουσίαΖε η λιγκάση, οι νε
Συνεπώς, ο ιός δεν καταστέλ/εται από την ανοσία που έχει ανα
οσυντεθειμένοι κλώνοι ΟΝΑ θα παρέμεναν ως κλάσματα
πωΧθεί εναντίον της προηγούμενης ποικιλίας. Αυτό εν μέρει
χωρίς όμως να λείπουν νουκλεοτίδια.
ερμηνεύει την τακτική εμφάνιση νέων στελεΧών του ιού της γρί
Γ. Χωρίς τον ολισθαίνοντα συνδετήρα, η ΟΝΑ πολυμεράση συ
πης και του ιού του κοινού κρυολογήματος.
χνά θα έπεφτε από το ΟΝΑ εκμαγείο. θεωρητικά θα μπορού
σε να ξαναπροσδεθεί και να συνεΧίσει, αλλά η συνεΧής από
Απάvmσn6-6
σπαση και ανασύνδεση θα ήταν χρονοβόρος και θα επιβρά
Αν ο παλαιός κλώνος «επιδιορθωνόταν» χρησιμοποιώντας ως
δυνε πολύ την αντιγραφή του ΟΝΑ.
υπόστρωμα τον νέο κλώνο που περιέχει ένα λάθος αντιγραφής,
Δ. Αν απουσίαΖαν τα ένΖυμα που απομακρύνουν τους ΗΝΑ εκ
τότε το λάθος θα γινόταν μια μόνιμη μετάλλαξη στο γονιδίωμα.
κινητές, τα ΗΝΑ κλάσματα θα παρέμεναν ομοιοπολικά συν
Κατά τη διεργασία αυτή, οι παλαιές πληροφορίες θα Χάνονταν.
δεδεμένα με τα νεοσυντεθειμένα ΟΝΑ κλάσματα. Ωστόσο,
Επομένως, αν τα ένΖυμα επιδιόρθωσης δεν διέκριναν τους δύο
στην περίπτωση αυτή τα κλάσματα δεν θα συνδέονταν, επει
κλώνους, τότε η πιθανότητα να διορθωθεί ένα λάθος αντιγρα
δή η ΟΝΑ λιγκάση δεν συνδέει ΟΝΑ με ΗΝΑ. Επομένως, ο
φής θα ήταν μόνο
940
Απαντήσεις
50%.
Aπdvmon6-7 Πρόκειται για εντελώς λάθος συλλογισπκή. Ένα είδος δεν είναι δυνατό να μετατραπεί σε κάποιο άλλο είδος απλώς εισάγοντας
θεση του DNA από βαριά νουκλεοτίδια (π.χ. ο κόκκινος κλώνος mnv Εικόνα 6-4 που παράγεται κατά τον πρώτο γύρο της αντι γραφής) οδηγεί mo σχηματισμό υβριδικών μορίων DNA που πε
1% τυχαίες βάσεις στο DNA του. Είναι εξαιρετικά απίθανο οι 5000 μεταλλάξεις που θα συσσωρεύονταν καθημερινά αν δεν γινόταν επιδιόρθωση του DNA να εντοπίζονταν στις θέσεις όπου διαφέρουν οι αλληλουχίες του DNA του ανθρώπου και του χι
ριέχουν έναν ελαφρύ, αρχικό κλώνο και έναν βαρύ, νεοσυντε
μπαΤΖή. Επίσης είναι πολύ πιθανό ότι με τόσο υψηλή συχνότητα
πό έναν ελαφρύ και έναν βαρύ κλώνο (το πορτοκαλί/κόκκινο
θειμένο κλώνο. Μετά από έναν ακόμα γύρο αντιγραφής σε μέσο που περιέχει βαριά ισότοπα, εμφανίζονται δύο μορφές
DNA σε ί
σες περίπου αναλογίες: η μια μορφή είναι και πάΝ ένα υβρίδιο α
μεταλλάξεων πολλά βασικά γονίδια θ' αδρανοποιούνταν, οδη
DNA της Εικόνας 6-4) και έχει ενδιάμεση
γώντας σε κυτταρικό θάνατο. Επιπλέον, το σώμα σας αποτελείται
μορφή αποτελείται από δύο βαρείς κλώνους (το κόκκινοΙ πράσι
περίπου από
νο
1013 κύτταρα. Για να μετατραπείτε σε πίθηκο, θα έ
πρεπε ν' αλλάξουν πολλά κύτταρα και όχι μόνο ένα. Ακόμα και τότε, για να επιφέρουν αλλαγές
mo σχέδιο του σώματός
σας (ό
DNA της
Εικόνας
6-4)
πυκνότητα, ενώ η άλλη
και έχει υψηλή πυκνότητα. Κατά τη
διάρκεια των επακόλουθων γύρων αντιγραφής παράγεται περισ σότερο βαρύ
DNA και η αναλογία του DNA ενδιάμεσης
πυκνότη
πως Π.Χ. για να βγάλετε ουρά) πολλές από αυτές τις αλλαγές θα
τας ελαττώνεταΙ. Επομένως, τα αποτελέσματά σας συμφωνούν α
έπρεπε να συμβούν κατά τη διάρκεια της ανάmυξης.
πόλυτα με την υπόθεση που επιχειρήσατε να ελέγξετε.
Απάντηση
6-8
Εικ6να6-10
Α. Λάθος. Η σύνθεση του
DNA mov προπορευόμενο
και τον
καθυmερημένο κλώνο καταλύεται από ταυτόσημα μόρια
Αν υπήρχε μόνο μια αφετηρία αντιγραφής που θα καθέλκυε
Η διχάλα αντιγραφής είναι ασύμμετρη,
DNA πολυμεράσης σε αντίθετες κατευθύνσεις πάνω mo DNA με ταΧύτητα 100 νουκλεοτιδίων ανά δευτερόλεπτο, τό
επειδή ο καθυmερημένος κλώνος συντίθεται σε τμήματα τα
τε ο αριθμός των νουκλεοτιδίων που θ' αντιγράφονταν μέσα σε
οποία κατόπιν διασυνδέονταΙ.
24 ώρες θα ήταν 1.73 χ 107 (= 2 χ 100 χ 24 χ 60 χ 60). Έ τσι, για ν' αντιγραφούν μέσα σε 24 ώρες και τα 6 χ 109 νουκλε
DNA πολυμεράσης.
Β. Λάθος. Οι ΗΝΑ εκκινητές αφαιρούνται από μια ΗΝΑ νουκλε
Okazaki είναι τα τμήματα του νεοσυντεθει DNA τα οποία τελικά συνενώνονται για να σχηματιmεί
δύο μόρια
άση. Τα κλάσματα
οτίδια του
μένου
(= 6 χ 109/1.73 χ 107) αφετηρίες αντιγραφής. Συνεπώς, οι
ο νέος καθυmερημένος κλώνος.
mn διορθωτική
10,000 περίπου
DNA πολυμεράση έχει εντυπωσιακά χαμηλή συχνότητα λάθους (1:10\ Επιπλέ ον, καθώς το 99% των λαθών της επιδιορθώνονται από τα έν Ζυμα επιδιόρθωσης του DNA, η τελική συχνότητα λάθους γί νεται 1: 109.
Γ. Σωmό. Χάρη
δράση της, η
Δ. Σωmό. Μεταλλάξεις θα συσσωρεύονταν γρήγορα και θα κα τέmρεφαν τα γονίδια. Ε. Σωmό. Αν
mo DNA εμφανΙΖόταν μια εσφαλμένη βάση, τα DNA θα μπορούσαν ν' αναγνωρί
ένΖυμα επιδιόρθωσης του
σουν το αταίριαmο Ζεύγος που θα σχημαΤΙΖόταν όχι όμως και
να διακρίνουν τον κλώνο
mov οποίο
DNA του
είχε εισαΧθεί η λάθος
κυττάρου θα χρειάΖονταν
rouMxImov 348
αφετηρίες αντιγραφής που εκτιμάται ότι περιέ
χει το ανθρώπινο γονιδίωμα επαρκούν και με το παραπάνω για να ικανοποιήσουν αυτή την ελάχιmη απαίτηση.
Εικ6να6-11 Α. Η ένωση Α είναι η τριφωσφορική διδεοξυκυτοσίνη
(ddCTP), η οποία διαφέρει από την dCTP επειδή έχει μια λιγότερη 3'υδροξυλομάδα mov σακχαρικό δακτύλιό της. Η ddCTP ανα γνωρίΖεται από την DNA πολυμεράση όπως και η dCTP και ενσωματώνεται mo DNA. Ωmόσο, επειδή δεν διαθέτει την κρίσιμη 3' -υδροξυλομάδα,η προσθήκητης σ' έναν αυξανό μενο κλώνο DNA δημιουργεί ένα «αδιέξοδο» mo οποίο δεν
βάση. Επομένως, η πιθανότητα να επιδιορθωθεί ο σωmός
μπορεί να προmεθούν επιπρόσθετα νουκλεοτίδια. Επομέ
κλώνος θα ήταν μόνο
νως, αν η
50%.
Ζ. Σωmό. Συνήθως, για να μετατραπεί ένα φυσιολογικό κύττα ρο σε καρκινικό πρέπει προηγουμένως να συμβούν πολλές μεταλλάξεις ειδικού τύπου. Μια μετάλλαξη σ' ένα κύτταρο που κωδικοποιεί ένα ένΖυμο επιδιόρθωσης του
DNA μπορεί
να κάνει ένα κύτταρο πιο ευπαθές σε συσσώρευση επιπρό
ddCTP
προmεθεί σε μεγάλη περίσσεια, θα συντί
θενται κλώνοι που θα καταλήγουν
mo πρώτο G (το νουκλεο C) το οποίο θα συνα ντά το ένΖυμο πάνω mov κλώνο-εκμαγείο. Εκεί, αντί για C θα ενσωματώνονται ddCTP, οπότε η επέκταση του συγκεκρι
τίδιο που είναι συμπληρωματικό με το
μένου κλώνου θα mαματά.
mύχθηκαν σε κανονικές συνθήκες, όπως αναμενόταν, έχει χα
ddCTP προmεθεί σε αναλογία περίπου 10% της διαθέ dCTP, τότε θα ενσωματώνεται mov αυξανόμενο κλώ νο απέναντι σε νουκλεοτίδια G του κλώνου-εκμαγείο με πι θανότητα 10%. Επομένως, θα συντίθεται ένας πληθυσμός κλασμάτων DNA, από το μήκος των οποίων μπορεί να καθο ριmεί η εντόπιση των νουκλεοτιδίων G πάνω mov κλώνο-εκ
μηλή πυκνότητα. Μετά από μια γενεά αύξησης σε μέσο που πε
μαγείο. Το πείραμα αυτό είναι η βάση των μεθόδων που χρη
ριέχει βαριά ισότοπα, το
σιμοποιούνται για τον καθορισμό της αλληλουχίας των νου-
σθετων μεταλλάξεων και έτσι να επιταΧύνει την έναρξη του
σιμης
καρκίνου.
Aπdvmon6-9 Το
Β. Αν η
DNA που απομονώθηκε
από τα αρχικά κύτταρα τα οποία ανα
DNA έχει
ενδιάμεση πυκνότητα: η σύν-
Απαντήσεις
941
κλεοτιδίων ενός τμήματος ΟΝΑ (βλ. ΚεφάίΊαιο
10).
Το ίδιο χημικό φαινόμενο αξιοποιείται από το φάρμακο
3' -αΖιδο-3'-δεοξυθιμιδίνη (Α2Τ) το οποίο χρησιμοποιείται ευρέως για την αντιμετώπισητου AIDS σε ασθενείς μοίΊυσμέ νους με τον ιό HIV. Στα κότταρα, η Α2Τ μετατρέπεται σε ddCTP και έτσι αναστέλ/ει τη σόνθεση του ΟΝΑ και την αντι
1. έναρξη της σύνθεσης [ου κλάσματος Okazaki
γραφή του ιou. Το φάρμακο έχει βαριές παρενέργειες, επει δή δεν ασκεί εκλεκτική δράση στο ΟΝΑ του ιοό, αλ/ά επηρε άΖει επίσης την αντιγραφή και την επιδιόρθωση και του κυπα
ρικοόΟΝΑ. Γ. Η ένωση Β είναι η μονοφωσφορική
(ddCMP), η οποία
δεν διαθέτει οότε την
διδεοξυκυτοσίνη
5' -τριφωσφορικήο
μάδα οότε την 3' -υδροξυίΊομάδαστον σακχαρικό δακτόίΊιό της. Επομένως, δεν μπορεί να προσφέρει την ενέργεια που
προωθείτην αντίδραση ποίΊυμερισμοότων νουκλεοτιδίωνσε ΟΝΑ και δεν ενσωματώνεταιστο αντιγραφόμενοΟΝΑ. Έτοι, δεν αναμένεταινα επηρεάΖειτην αντιγραφήτου ΟΝΑ.
Απάvmσn 6-12 Για να χρησιμοποιεί την ενέργεια της υδρόίΊυσης της
3' τριφω
σφορικής ομάδας για τον ποίΊυμερισμό, η αόξηση του κλώνου
θα έπρεπε να γίνεται στην αντίθετη κατεόθυνση, δηίΊαδή 3' ~
5'.
2.
η σύνθεση του κλάσματος
Okazaki
βρίσκεται περίπου στο μέσο της
Εικόνα Α6·13
Στην περίmωση αυτή, η διορθωτική δράση θα μποροόσε να
γίνει από μια νουκλεάση με δραστικότητα 5' ~
3'. Αυτό το σε
νάριο που περιγράφειτον υποθετικό οργανισμό είναι ίδιο με ε
παραΧθεί ο οργανισμός, το είδος θα εξαίΊειφθεί. Αν το ΟΝΑ των
κείνο που εικονίΖεταιστην Εικόνα 6-15, με την εξαίρεση ότι εκεί
αναπαραγωγικών κυπάρων δεν είναι αρκετά σταθερό, θα συσ
όίΊες οι φωσφορικές και τριφωσφορικές ομάδες βρίσκονται στη
σωρευθοόν πολ/ές μεταλ/άξεις και θα μεταβιβαστοόν στις επό
δεξιά πίΊευρά των δομών του ΟΝΑ και των νουκλεοτιδίων.
μενες γενιές. Έτοι, το είδος δεν θα διατηρηθεί.
Aπάvmσn
Απάvmσn 6·16
6-13
ΒίΊ. Εικόνα Α6-13.
Όπως φαίνεται στην Εικόνα Α6-16, η θυμίνη και η oυραKίiΊη
Απάvmσn
νωθοόν. Η απαμίνωση της αδενίνης και της γουανίνης παράγει
δεν περιέχουν αμινοομάδες και επομένως δεν μπορεί ν' απαμι
6-14
Οι δόο κλώνοι του βακτηριακοό χρωμοσώματος περιέχουν
χ
δακτυίΊίους πουρίνης που κανονικά δεν βρίσκονται στα νουκλε
106 νουκίΊεοτίδια. Κατά τον ποίΊυμερισμό των τριφωσφορικών
ϊνικά οξέα. Αντίθετα, η απαμίνωση της κυτοσίνης παράγει ουρα
6
νουκλεοτιδίων σε ΟΝΑ, για κάθε νουκλεοτίδιο που προστίθεται
KίiΊη. Επομένως, αν το ΟΝΑ περιείχε oυραKίiΊη, τα ένΖυμα επι
διασπώνται δόο φωσφοανυδριτικοί δεσμοί: το τριφωσφορικό
διόρθωσης δεν θα μποροόσαν να διακρίνουν αν μια oυραKίiΊη
νουκλεοτίδιο υδροίΊόεται για ν' αποδώσει το μονοφωσφορικό
είναι η κατάλ/ηίΊη βάση για τη θέση αυτή ή ένα ίΊάθος που προ
νουκλεοτίδιο που προστίθεται στον αυξανόμενο κλώνο ΟΝΑ
έκυψε από αυθόρμητη απαμίνωση. Ωστόσο, τα κόπαρα δεν έ
και το πυροφωσφορικό που απείΊευθερώνεται υδρoΊΊUεται σε
χουν αυτό το δίίΊημμα επειδή στο ΟΝΑ τους χρησιμοποιείται η
φωσφορικό. Επομένως, σε κάθε γόρο αντιγραφής του βακτη
θυμίνη. Συνεπώς, αν στο ΟΝΑ βρεθεί μια βάση ουρακίίΊης, μπο
ριακοό ΟΝΑ υδρoΊΊUoνται 1.2 χ 107 δεσμοί υψηίΊής ενέργειας. Αυτό απαιτεί 4 χ 105 (= 1.2 χ 107/30) μόρια γίΊυκόΖης που Ζυ γίΖουν 1.2 χ 10- Ι6 g (= 4 χ 105 μόρια χ 180 g/mole/6 χ 1023
ρεί αυτόματα να αναγνωριστεί ως λάθος, να εκταμεί και ν' αντι
μόρια/mοles), δηίΊαδή περίπου
Απάvmσn
0.01 % του
συνοίΊικοό βάρους
του κυπάρου.
κατασταθεί από κυτοσίνη.
6-17
Α. Χωρίς τείΊομερίδια και τείΊομεράση, σε κάθε γόρο αντιγρα φής τα άκρα των χρωμοσωμάτων θα συρρικνώνονταν επειδή
Απάvmσn 6-15
δεν θα υπήρχε κάποια
Η φράση είναι σωστή. Αν το ΟΝΑ των σωματικών κυπάρων δεν
θεση του ΟΝΑ που συμπίΊηρώνεταιμετά την αφαίρεση του
είναι αρκετά σταθερό (δηίΊαδή, αν συσσωρεόει μεταλ/άξεις πο
εκκινητή του πιο πρόσφατα συντεθειμένου κλάσματος ΟΝΑ
ΊΊU γρήγορα) ο οργανισμός θα πεθάνει (για παράδειγμα, από
πάνω στον καθυστερημένοκλώνο. Το πρόβλημααυτό δεν α
καρκίνο). Επειδή, αυτό συχνά μπορεί να συμβαίνει προτοό ανα-
νακόπτει για τα βακτηριακά χρωμοσώματατα οποία δεν έ-
942
Απαντήσεις
3' -ΟΗ ομάδα για να ξεκινήσειτη σόν
DNA,
καθώς και πάλι θα έπρεπε να χρησιμοποιηθεί ένας
ΗΝΑ εκκινητής.
Απάvmσn
6-18
Οι ιοί δεν μποροόν να Ζήσουν ως αυτόνομοι οργανισμοί: δεν
έχουν μεταβολισμό, δεν επικοινωνοόν με άίΊίΊους ιοός και δεν
αδενίνη
αναπαράγΟνΙαι από μόνοι τους. Άρα, δεν διαθέτουν καμία από τις ιδιότητες που κανονικά σχετίΖΟνΙαι με τη Ζωή. Μάλιστα, μπο
ρεί ακόμα και να κρυσταίΊίΊωθοόν μέσα στα κόπαρα και εκτρέ πουν τις φυσιολογικές βιοσυνθετικές λειτουργίες του κυπάρου στο έργο της παραγωγής περισσότερων ανΙιγράφων τους. Ω στόσο, κανένας ιός δεν μπορεί ν' αναπαραΧθεί χωρίς να εκμε ταίΊίΊευτεί ένα κόπαρο ξενιστή. Επομένως, η μόνη ιδιότητα της
γουανίνη
«Ζωής» που εμφανίΖουν οι ιοί είναι η ικανότητά τους να κατευ
θόνουν την αναπαραγωγή τους μόλις βρεθοόν μέσα σ' ένα κότ ταρο.
-
Απάvmσn 6-19 Κάθε φορά που ένα ανΙίγραφο ενός μεταθετοό στοιχείου εν σωματώνεται στο χρωμόσωμα, η αίΊίΊαγή μπορεί να είναι ου δέτερη, επωφελής ή επιβλαβής για τον οργανισμό. Επειδή οι
οργανισμοί που συσσωρεόουν επιβλαβή ένθετα στοιχεία θα υ πόκεινΙΟ σε αρνητική επιλογή, ο ποίΊίΊαπλασιασμός των μετα θετών στοιχείων ελέγχεται από τη φυσική επιλογή. Αν ανα
-
πτυσσόταν ένα μεταθετό στοιχείο ικανό να ποίΊίΊαπλασιάΖεται ΚΑΜΙΑ ΜΕΤΑΒΟΛΗ
ανεξέλεγκτα, τότε η επιβίωση του οργανισμοό-ξενιστή θα ήταν
μάίΊίΊον απίθανη. Για το λόγο αυτό, τα περισσότερα τρανσπο Ζόνια έχουν εξελιΧθεί κατά τέτοιο τρόπο ώστε να μετατίθενΙαι σπάνια. Για παράδειγμα, ποίΊίΊά τρανσΠΟΖόνια συνθέτουν σπά νια ποΜ μικρές ποσότητες της τρανσΠΟΖάσης που απαιτείται
ο
:(J:: ουρακίλη
για τη μετακίνησή τους.
-
ΚΑΜΙΑ ΜΕΤΑΒΟΛΗ
κυκλικό DΝΑ
γραμμικό DΝΑ
ι
κλώνος-εκμαγείο
~~~~'\~~~~ΓOH3'5'
Εικόνα Α6-16
Ι!!!
ΑΝΑ εκκινητής
χουν άκρα: θα υπάρχει πάνΙοτε διαθέσιμη μια
3' -ΟΗ για να
!
καθοδηγήσειτην ΟΝΑ πολυμεράση που ανΙικαθιστά τον
ΕΚΚΙΝΗΤΗ
ΗΝΑ εκκινητή με ΟΝΑ (Εικόνα Α6-17) . Τα τελομερίδια και η
3' άκρο ενός
ΟΝΑ κλώνου με επαναληπτικέςαίΊίΊηλουΧίεςΟΝΑ που προ
!
στίθενΙαι απευθείαςαπό την τελομεράσηχωρίς να χρειάΖεται
κάποιο εκμαγείο (βλ. Εικόνα 6-18). Μερικές από αυτές τις ε παναλήψεις ΧάνονΙαι σε κάθε γόρο ανΙιγραφής, αίΊίΊά ανα
HO!!ιl 3'
ΕΠΙΔΙΟΡΘΩΣΗDΝΑ
!
3'
~~~~====ΓOH3'
πληρώνΟνΙαι στη συνέχεια.
5' ι
Β. Όπως φαίνεται στην Εικόνα Α6-17, τα τελομερίδια και η τε λομεράση θα ήταν απαραίτητα ακόμα και αν το τελευταίο κλάσμα του καθυστερημένου κλώνου είχε συνΙεθεί υπό την
καθοδήγηση της πριμάσης στο
5'
r=·]\ ~5' HO!!ιl
τελομεράση παρεμποδίΖουν τη συρρίκνωση των χρωμοσω
μάτων, επειδή τα τελομερίδια προεκτείνουν το
!
ΑΦΑΙΡΕΣΗ ΑΝΑ
.]\
3'
άκρο του χρωμοσωμικοό
ΧΑΜΕΝΑ ΝΟΥΚΛΕΟTlΔIΑ! (Α)
(Β)
Εικόνα Α6-17
Απαντήσεις
943
Aπdvrnon 6-20
Χώνονται (δηλαδή, ν' αποκτούν τρισδιάστατη δομή) ενόσω συ
Α. Αν η μόνη αφετηρία αντιγραφής εντΟΠΙΖόταν ακριβώς στο κέντρο του χρωμοσώματος, η αντιγραφή του
DNA θα
διαρ
ντίθενται (βλ. Π.Χ. Εικόνα
7-5),
ενώ το
DNA είναι
μια εκτεταμέ
νη διπλή έλικα.
κούσε πάνω από 8 ημέρες [= 75 χ 106 νουκλεοτίδια!(100 νουκλεοτίδια!sec)]. Επομένως, η ταΧύτητα της αντιγραφής θα
Aπdvrnon
περιόΡΙΖε σημαντικά την ταΧύτητα της κυπαρικής διαίρεσης.
Από πρώτη ματιά, η καταλυτική ενεργότητα μιας ΗΝΑ πολυμερά
7-3
(Αν η αφετηρία εντΟΠΙΖόταν στο ένα άκρο του χρωμοσώμα
σης που χρησιμοποιείται για τη μεταγραφή θα μπορούσε ν' α α
τος η αντιγραφή θα διαρκούσε ακόμα περισσότερο.
ντικαταστήσει επαρκώς την πριμάση. Αν σκεφτούμε όμως πιο
Β. Αν ένα άκρο ενός χρωμοσώματος δεν «καλυπτόταν» από ένα
προσεκτικά, θα διαπιστώσουμε ότι υπάρχουν ορισμένα σοβαρά
τελομερίδιο, σε κάθε γύρο αντιγραφής θα έχανε νουκλεοτί
προβλήματα:
δια και σταδιακά θα συρρικνωνόταν. Με τον καιρό, βασικά
για τη σύνθεση των εκκινητών θα έπρεπε να δραστηριοποιείται
γονίδια θα Χάνονταν και τελικά το κύπαρο θα πέθαινε.
κάθε λίγες εκατοντάδες βάσεις, μια απόσταση πολύ μικρότερη
Γ. Αν δεν υπήρχε ένα κεντρομερίδιο για να τα προσκολ/ά στη
(1) Η ΗΝΑ πολυμεράση
που θα χρησιμοποιούνταν
από την απόσταση των υποκινητών πάνω στο
DNA. Επομένως,
η
μιτωτική άτρακτο, τα δύο νέα χρωμοσώματα που παράγονται
έναρξη της σύνθεσης θα έπρεπε να διεξάγεται ανεξάρτητα από
από την αντιγραφή δεν θα μπορούσε να κατανεμηθούν με α
τους υποκινητές ή, εναλ/ακτικά, το
κρίβεια στα δύο θυγατρικά κύπαρα. Συνεπώς, πολ/ά θυγα
περισσότερους εκκινητές, όμως και τα δύο ενδεΧόμενα θα δημι
τρικά κύπαρα θα πέθαιναν επειδή δεν θα παραλάμβαναν μια
ουργούσαν προβλήματα στον έλεγχο της μεταγραφής
πλήρη ομάδα χρωμοσωμάτων.
ρομοίως, οι ΗΝΑ εκκινητές που xρησιμoπoιoύvται στην αvτιγρα
DNA θα έπρεπε να έχει πολύ
φή είναι πολύ βραΧύτεροι από τα μόρια του
(2).
Πα
mRNA. Επομένως,
η
ΗΝΑ πολυμεράση θα έπρεπε να τερματίζει πολύ πιο συχνά απ' ό,τι κατά τη μεταγραφή. Ο τερματισμός θα έπρεπε να συμβαίνει
Κεφάλαιο 7 Aπdvrnon
αυθόρμητα, δηλαδή να είναι ανεξάρτητος από την παρουσία
7-1
μιας αλ/ηλουχίας τερματισμού στο
Η απάντηση δίνεται καλύτερα με τα λόγια του ίδιου του
Francis
Crick, ο οποίος εισήγαγε τον όρο στα μέσα της δεκαετίας του 1950: «Ονόμασα την ιδέα αυτή κεντρικό δόγμα για δύο, νομί Ζω, λόγους: είχα ήδη χρησιμοποιήσει την προφανή λέξη υπόθε ση στον όρο υπόθεση της αλ/ηλουΧίας
DNA,
ή, εναλ/ακτικά, θα έ
πρεπε να υπάρχουν πολύ περισσότερες αλ/ηλουΧίες τερματι
σμού. Για άλ/η μια φορά και τα δύο αυτά σενάρια θα δημιουρ γούσαν προβλήματα στον έλεγχο της μεταγραφής. Παρόλο που το πρόβλημα αυτό θα μπορούσε να ξεπεραστεί
(sequence hypothesis)
αν ειδικές πρωτείνες ελέγχου προσδένονταν στην ΗΝΑ πολυ
που προτείνει ότι οι γενετικές πληροφορίες κωδικοποιούνται
μεράση κατά τη διάρκεια της αντιγραφής, στην πραγματικότητα
στην αλ/ηλουΧία των βάσεων του
έχει επιλυθεί κατά την εξέλιξη με τη χρησιμοποίηση ξεχωριστών
DNA και
επιπλέον επιθυμού
σα να υποδηλώσω ότι αυτή η νέα υπόθεση ήταν πιο κεντρική
ενΖύμων με εξειδικευμένες ιδιότητες. Ωστόσο, μερικοί μικροί
και πιο ισχυρή ... Όπως αποδείΧθηκε, η λέξη δόγμα προκάλεσε
DNA ιοί πράγματι
περισσότερο θόρυβο απ' όσο άξιζε. Πολ/ά χρόνια αργότερα ο
νιστή για να συνθέσουν εκκινητές που ~ρειάZOνται για την αντι
Jacques Monod μού
γραφή τους.
υπέδειξε ότι μάλ/ον δεν είχα καταλάβει τη
χρησιμοποιούν την ΗΝΑ πολυμεράση του ξε
σωστή έwοια της λέξης δόγμα, δηλαδή μια πεποίθηση που δεν
7-4
επιδέχεται αμφισβήτηση. Στην πραγματικότητα, γενικά συμφω
Απάντηση
νώ με αυτή την άποψη, αλ/ά επειδή θεωρούσα ότι όλες οι θρη
Το πείραμα αυτό δείχνει πολύ παραστατικά ότι το ριβοσωμάτιο
σκευτικές πεποιθήσεις δεν στηρίΖονταν σε σοβαρά πειστήρια,
δεν ελέγχει το αμινοξύ που προσδένεται σ' ένα μόριο
χρησιμοποίησα τη λέξη κατά τον τρόπο που εγώ την εwοούσα,
Μόλις ένα αμινοξύ συΖευχθεί με ένα μόριο
όχι όπως την εwοεί όλος ο κόσμος, και απλά την εφάρμοσα σε
τιο θα ενσωματώσει «τυφλά» το συγκεκριμένο αμινοξύ στην κα
tRNA. tRNA, το ριβοσωμά
μια μεγαλειώδη υπόθεση η οποία, όσο και αν ήταν ευλογοφα
τάλ/ηλη θέση, σύμφωνα με το ταίριασμα ανάμεσα στο κωδικό
νής, εκείνη την εποχή δεν είχε άμεση πειραματική στήριξη».
νιο και το αντικωδικόνιο. Ένα σημαντικό μέρος της σωστής α
(Francis Crick, What Mad Pursuίt,
νάγνωσης του γενετικού κώδικα, δηλαδή το ταίριασμα ενός κω
σελ.
109).
δικονίου με το κατάλ/ηλο αμινοξύ, διενεργείται από τις συνθε Απάντηση
7-2
τάσες που ταιριάΖουν σωστά τα μόρια
tRNA με τα αμινοξέα.
Στην πραγματικότητα, οι ΗΝΑ πολυμεράσες δεν μετακινούνται καθόλου, επειδή έχουν μονιμοποιηθεί και επικαλυφθεί με μέ
Aπdvrnon
ταλ/ο στα πλαίσια της προετοιμασίας του δείγματος για την πα
Το
ρατήρηση με το ηλεκτρονικό μικροσκόπιο. Ωστόσο, προτού μο
τα του κλώνου του
7-5
νιμοποιηθούν μετακινούνταν από τ' αριστερά προς τα δεξιά, ό
5'-3', αντίθετα από την πολικότη DNA που λειτουργεί ως εκμαγείο. Άρα, η αλ ληλουΧία του mRNA θα είναι 5' -GMAAAAGC-CGUUM-3'.
πως υποδηλώνει η βαθμιαία επιμήκυνση των ΗΝΑ μεταγράφων.
Η τριπλέτα υΜ είναι ένα κωδικόνιο τερματισμού. Το καρβοξυ
Τα ΗΝΑ μετάγραφα είναι βραΧύτερα επειδή αρχίΖουν να πτυ-
τελικό αμινοξύ κωδικοποιείται από το αμέσως προηγούμενο
944
Απαντήσεις
mRNA θα έχει
πολικότητα
κωδικόνιο, δηλαδή το
της συρραφής. Η απλούστερη ερμηνεία είναι ότι το αντίστοιχο
λικό αμινοξύ
CGU, και είναι μια αργινίνη. Το αμινοτε κωδικοποιείται από το κωδικόνιο GM και είναι έ
γονίδιο περιέχει ένα εξόνιο μήκους
να γλουταμικόοξύ. Σημειώστε ότι συμβατικά η αλ/ηλουχίαπου
νιο «Ε2» της Εικόνας Α7-8) και ότι το εξόνιο αυτό χάθηκε κατά
δίνεται γιο ένα γονίδιο είναι η αλ/ηλουχίατου κλώνου που δεν
την επεξεργασία του μεταλλαγμένου πρόδρομου
173 νουκλεοτιδίων
(το εξό
mRNA.
Για
χρησιμοποιείταιως εκμαγείο γιο τη σύνθεση του ΗΝΑ. Η αλ/η
παράδειγμα, αυτό θα μπορούσε να συμβεί αν η μετάλλαξη άλ
λουχία αυτή είναι ίδια με την αλ/ηλουχίατου ΗΝΑ μεταγράφου,
λαΖε την 3' θέση συρραφήςτου προηγούμενουιντρονίου ( ανθρώπινοι> γο
νιδιώματος είναι παρόν στο mRNA και μόλις το
1/3
τοι> γονιδιώ
ματος μεταγράφεται σε ΗΝΑ. Ακόμα και αν σuνuπολογίσοuμε
χίες) εξελίσσεταιμε ταΧύτητα παρόμοια με των ΙVΤpOνίων.
Γ. Τα γονίδια β-σφαιρίνης τοι> ανθρώποι>και τοι> ποντικού είναι επίσης ομόλογα στο
5'
άκρο τοuς, όπως φαίνεται από το ά
ou-
θροισμα των στιγμάτων κατά μήκος της διαγώνιας γραμμής
νολική εικόνα δεν αλλάΖει: πάνω από το μισό γονιδίωμα δεν
τοι> πρώτοι> εξονίοι> (Εικόνα Α9-10Β). Αuτές οι αλ/ηλΟUΧίες
φαίνεται να έχει κάποια λειτοuργία αλλά είναι «άχρηστο».
αvτιστoιxoύνστις ρuθμιστικές περιοΧές πριν από την αφετη
τις ρuθμιστικές περιοχές και άλλες κρίσιμες αλ/ηλΟUΧίες, η
ρία της μεταγραφής. Η ρuθμιστική λειτοuργία αuτής της πε Απάντηση
9-9
ριοχής έχει περιορίσει την εξελικτική απόκλισή της (όπως
Τα αθροίσματα γονιδίων Ηοχ είναι γεμάτα περίπλοκες και εκτε
σuμβαίνει και με τα εξόνια ποι> κωδικοποιούνπρωτε'ίνη). Οι
νείς ρuθμιστικές αλ/ηλΟUΧίες ποι> διασφαλίΖοuν τη σωστή έκ
λειτοuργικέςαλ/ηλοuχίες, οι οποίες uπόκειvται σε πιέσεις ε
φραση των ξεχωριστών γονιδίων Ηοχ στον κατάλληλο χρόνο
πιλογής, anOKMvOUV πολύ βραδύτερα από τις αλ/ηλΟUΧίες
και στον κατάλ/ηλο τόπο κατά την εξέλιξη. Η ενσωμάτωση με
χωρίς λεΙΤΟUΡγία.
ταθετών στοιχείων στ' αθροίσματα Ηοχ δεν εuνοείται επειδή θα
Δ. Το διάγραμμα δείχνει ότι το πρώτο ιντρόνιο έχει σχεδόν ίδιο
παρέβλαπτε τη σωστή ρύθμιση των γονιδίων Ηοχ. Η σύγκριση
μήκος στα γονίδια τοι> ανθρώποι> και τοι> ΠOVΤΙKoύ, ενώ το
της αλ/ηλοuχίας των γονιδίων Ηοχ τοι> ποντικού, τοι> αροuραί
μήκος τοι> δεύτεροι> ιντρονίοι> διαφέρει πολύ (Εικόνα
οι> και τοι> μπαμποuΊνοu αποκαλύπτει uψηλή σuχνότητα διατη
10Β), για άγνωστο λόγο.
9-
ρημένων μη κωδικοποιητικών στοιχείων, εύρημα ενδεικτικό για Απάντηση
την παPOUΣία άφθονων ρuθμιστικών αλ/ηλοuχιών.
9-11
Οι ηλεκτρονικοί uπολογιστές χρησιμοποιούν πεΡίπΓ.ιοκοuς αλ Απάντηση
γορίθμοuς για την αναγνώριση εξονίων. Οι σχετικοί αλγόριθμοι
9-10
Α. Τα εξόνια στο γονίδιο β-σφαιΡίνης τοι> ανθρώποι> αντιστοι χούν στις θέσεις ομολογίας με το
cDNA, το οποίο
είναι ένα ά
μεσο αντίγραφο τοι> ΟΝΑ και σuνεπώς δεν περιέχει ιντρόνια. Τα ιντρόνια αντιστοιχούν στις περιοΧές ανάμεσα στα εξόνια. Οι θέσεις των ιντρονίων και των εξονίων στο γονίδιο β-σφαι ρίνης τοι> ανθρώποι> επισημαίνονται στην Εικόνα Α9-10Α. Β. Από τις θέσεις των εξονίων, όπως καθορίΖΟνται στην Εικόνα
σuνδuάΖοuν στατιστικά δεδομένα από γνωστά γονίδια για να ε vτοπίσοuν άγνωστα γονίδια. Τέτοια δεδομένα είναι:
1. Ένα
εξόνιο ποι> κωδικοποιεί πρωτε'ίνη θα έχει ανοιχτό πλαί
σιο ανάγνωσης ποι> θα ταιριάΖει με το πλαίσιο ανάγνωσης
των γειτονικών εξονίων.
2. Τα εσωτερικά
εξόνια (δηλαδή όλα τα εξόνια ενός γονιδίοι> ε
κτός από το πρώτο και το τελεuταίο) έχουν σήματα συρραφής
Α9-10Α, είναι εμφανές ότι τα δύο πρώτα εξόνια τοι> γονιδίοι>
στα δύο άκρα τους. Αυτά τα σήματα σχεδόν πάvτα
β-σφαιΡίνης τοι> ανθρώποι> έχοuν ομόλογες αλληλΟUΧίες
ναι
στο γονίδιο β-σφαιΡίνης τοι> ποντικού (Εικόνα Α9-10Β). Ω
3. Τα
στόσο, μόνο το πρώτο μισό τοι> τρίτοι> εξονίοι> από το ανθρώ
στο
(98.1 %) εί
5' άκρο και GT στο 3' άκρο.
εναλ/ακτικά κωδικόνια για τα περισσότερα αμινοξέα δεν
χρησιμοποιούνται με την ίδια σuχνότητα. Αυτό μπορεί ν' α ξιοποιηθείγια την αναγνώριση πραγματικών εξονίων.
πινο γονίδιο είναι ομόλογο με το γονίδιο β-σφαιΡίνης τοι> ΠOVΤΙKoύ. Η ομόλογη πεΡΙΟΧή τοι> τρίτοι> εξονίοι> περιέχει
AG
4. Τα
εξόνια και τα ΙVΤpόνια έχοuν χαρακτηριστικό μήκος. Στον
κωδικοποιητικές περιοχές, ενώ το μη ομόλογο τμήμα αντι
άνθρωπο, τα εξόνια έχουν διάμεσο μήκος
προσωπεύει την
οτιδίων. Τα ιντρόνια σuνήθως είναι πολύ μεγαλύτερα: έχουν
3'
αμετάφραστη πεΡΙΟΧή τοι> γονιδίοu.
διάμεσο μήκος περίπου
Επειδή αuτή η πεΡΙΟΧή τοι> γονιδίοι> δεν κωδικοποιείπρω-
2 kb
120 Ζεύγη νουκλε
σε περιοΧές του γονιδιώματος
(Β) OMOΛOΓlA ΜΕΤΑΞΥΤΩΝ (Α) ΕΞΟΝΙΑ ΣΤΟ
cDNA ΤΗΣ
(f
.~ Q::> -
σ
Ο
t::
~.~
CΩ.
...
50% περιεκτικό τητα σε GC.
5. Το
εναρκτήριο κωδικόνιο για την πρωτεϊνοσύνθεση (σχεδόν
πάντοτε είναι το
Απόντηση
9-15
Β. Η δημιουργία γονιδίων
de novo από την τεράστια ποσότητα
μη χρησιμοποιούμενου, μη κωδικοποιητικού DNA που χαρ
κτηρίΖει το γονιδίωμα των ευκαρυωτών δεν θεωρείται ως ση
σχετίΖεται με γειτονικά νουκλεοτίδια
μαντική διεργασία για την εξέλιξη. Η εισαγωγή μεταίΊίΊάξεων
που αυξάνουν την αναγνώρισή του από τους μεταγραφικούς
που θα δημιουργούσε μια κωδlκοποιητική αίΊίΊηλουΧία με τα
παράγοντες.
συνοδά ρυθμιστικά στοιχεία γίνεται με πολύ μικρή ταΧύτητα,
6. Το τελευταίο
ATG)
εξόνιο έχει ένα σήμα (συνηθέστερα το ΜΤΑΑΑ)
για κοπή και πολυαδενυλίωση κοντά στο
3'
άκρο του.
καθόλου ικανή να ερμηνεύσει την παρατηρούμενη ταΧύτητα
των εξελικτικών αίΊίΊαγών.
Ο στατιστικόςχαρακτήραςαυτών των δεδομένωνσε συνδυασμό
9-16
με τη χαμηλή συχνότητα των κωδlκοποιητικώνπληροφοριών
Απόντηση
στο γονιδίωμα (2-3%) και τη συχνότητα της εναίΊίΊακτικής συρ
Α. Οι συνώνυμες αίΊίΊαγές δεν μεταβάίΊίΊουν την αίΊίΊηλουΧία αμι
ραφής (περίπου
60% των
ανθρώπινων γονιδίων) δείχνουν πό
νοξέων της πρωτείνης. Για το λόγο αυτό δεν υπόκεινται σε
σο αξιοθαύμαστα αποτελεσματικοί είναι οι διαθέσιμοι αλγόριθ
πιέσεις επιλογής, οι οποίες λειτουργούν στο επίπεδο της λει
μοι που αναγνωρίΖουν περίπου
τουργίας της πρωτείνης (και των επιmώσεών της στη συνολι
και περίπου
70% των
ξεχωριστών εξονίων
20% των γονιδίων του ανθρώπινου
γονιδιώματος.
κή ευρωστία του οργανισμού). Αντίθετα, οι μη συνώνυμες αλ
λαγές, ΟΙ οποίες οδηγούν σε αντικατάσταση ενός αμινοξέος Απόντηση
9-12
από ένα νέο αμινοξύ, έχουν τη δυνατότητα να μεταβάίΊίΊουντη
Σε μια τυχαία αίΊίΊηλουΧία
DNA, καθένα
από τα
64 διαφορετικά 3 α
κωδlκόνια θα δημιουργείται με την ίδια συχνότητα. Επειδή
πό τα
64 κωδlκόνια
είναι κωδlκόνια τερματισμού, η αναμενόμε
νη συχνότητά τους είναι
1:21 (64/3 = 21.3).
λειτουργία της κωδlκοποιούμενης πρωτείνης (και έτσι ν' αλ
λάξουντην ευρωστία του οργανισμού). Επειδή οι περισσότε ρες υποκαταστάσεις αμινοξέων είναι επιβλαβείς για τη λει τουργία της πρωτείνης, υπόκεινται σε αρνητική επιλογή.
Β. Το γονίδιο της lστόνης Η3 πρέπει να είναι τόσο πολύ προσε Απόντηση
9-13
Γονίδιο είναι κάθε αίΊίΊηλουΧία
κτικά «συντονισμένο» στη λειτουργία της πρωτείνης, ώστε ό
DNA που
μεταγράφεται ως ενι
λες οι υποκαταστάσεις αμινοξέων είναι επιβλαβείς και υπό
αία μονάδα και παράγει ένα λειτουργικό ΗΝΑ ή κωδικοποιεί
κεινται σε αρνητική επιλογή. Η ακραία διατήρηση της ιστό
μια πολυπεπτιδική αλυσίδα ή μια ομάδα στενά σχεΤΙΖόμενων
νης Η3 είναι ένδειξη γlO τον αυστηρό καθορισμό της λει
πολυπεmιδlκών αλυσίδων (lσομορφές της πρωτείνης). Αυτός ο
τουργίας της, που μάίΊίΊον προκύπτει από εκτενείς αίΊίΊηλεπι
ορισμός θέτει ως προϋπόθεση τη μεταγραφή: συνεπώς, η πε
δράσεις με άλλες πρωτείνες και με το μόνιμο υπόστρωμά
ριοχή ελέγχου είναι επίσης μέρος του γονιδίου.
της, δηλαδή το
DNA.
Γ. Η ιστόνη Η3 δεν βρίσκεται σε μια «προστατευόμενη» θέση (έ Απόντηση
9-14
Σε πρώτη άποψη, η αξιοσημείωτη αντοχή του γενετικού κώδικα
να «άβατο») του γονιδιώματος, επειδή υφίσταται συνώνυμες αίΊίΊαγές νουκλεοτιδίων με την ίδια ταΧύτητα με άίΊίΊα γονίδια.
στις μεταίΊίΊάξεις θα μπορούσε να θεωρηθεί ως ένδειξη για το
9-17
γεγονός ότι εκτέθηκε στις δυνάμεις της φυσικής επιλογής. Σύμ
Απόντηση
φωνα με αυτό το σκεπτικό, δεν θα ήταν παράλογο να υποθέ
Α. Τα δεδομένα στο φυλογενετικό δέντρο (βλ. Εικόνα Ε9-17)
σουμε ότι η αντοχή στις μεταίΊίΊάξεις είναι πολύτιμο χαρακτηρι
καταρρίmουν την υπόθεση ότι τα γονίδια της αιμοσφαιρίνης
στικό για έναν γενετικό κώδικα που θα επέτρεπε στους οργανι
των φυτών προήλθαν από ΟΡΙΖόντlO μεταφορά γονιδίων.
σμούς να διατηρούν επαρκείς πληροφορίες ώστε να εξειδικεύ
ΕξετάΖοντας τα πιο οικεία «κλαδιά» του δέντρου, διαπιστώ
ουν περίπλοκους φαινοτύπους. Συνεπώς, θα ήταν μάίΊίΊον απί
νουμε ότι τα σπονδυλωτά (από τα ψάρια έως τον άνθρωπο)
θανο να βρούμε έναν κώδικα τόσο αλάνθαστο όσο ο δικός μας.
συναθροίζονται σε μια στενά σχεΤΙΖόμενη ομάδα ειδών. Επι
Τα πράγματα όμως δεν είναι τόσο απλά. Αν θεωρήσουμε ότι
πλέον, οι σχέσεις στο δέντρο της Εικόνας Ε9-17 είναι συμβα
η αντοχή στις μεταίΊίΊάξεις είναι θεμελιώδες γνώρισμα κάθε κώ
τές με τη σειρά της διακλάδωσης σύμφωνα με τις εξελικτικές
δικα ικανού να στηρίξει την πολυπλοκότητα οργανισμών όπως
σχέσεις μεταξύ αυτών των ειδών: τα ψάρια «διακλαδίστηκαν»
ο άνθρωπος, τότε οι μόνοι κώδικες που θα μπορούσαμε να παρ
(διαχωρίστηκαν) πριν από τ' αμφίβια, τα ερπετά πριν από τα
τηρήσουμε θα ήταν οι «ανθεκτικοί» στα λάθη.
Πέρα από αυτές τις θεωρίες, υπάρχουν ισχυρές ενδείξεις ότι ο
πτηνά, ενώ τελευταία διακλαδίστηκαν τα θηλαστικά σε μlO «σφιχτή» ομάδα. Τα φυτά επίσης συγκροτούν μια διακριτή ο
κώδικας δεν είναι στατικός και άρα θα μπορούσε ν' ανταποκρι
μάδα που εμφανίΖει σαφείς εξελικτικές σχέσεις: η βρώμη (έ
θεί στις δυνάμεις της φυσικής επιλογής. ΠαραίΊίΊαγές του κλασι
να μονοκοτυλήδονο) απέκλινε πριν από το μΠΙΖέλι, το αλ
κού γενετικού κώδικα έχουν αναγνωριστεί στο πυρηνικό και στο
φάλφα και τον λωτό (δικοτυλήδονα). Οι αλληλουχίες των
μιτοχονδριακό γονιδίωμα αρκετών οργανισμών. Σε κάθε περί
φυτικών αιμοσφαιρινών φαίνεται ότι απέκλιναν στο μακρινό
mωση, ένα ή λίγα κωδlκόνια απέκτησαν ένα νέο μήνυμα.
εξελικτικό παρελθόν, πριν ή κατά την εμφάνιση των μαλα-
Απαντήσεις
953
κίων, των εντόμων και των νηματωδών. Οι σχέσεις στο δέ
ληλουΧία τμημάτων του ΟΝΑ που απέχουν περισσότερο από
ντρο υποδηλώνουν ότι τα γονίδια της αιμοσφαιρίνης προήλ
τον εκκινητή.
θαν από κάποιον κοινό πρόγονο. Β. Αν τα γονίδια της αιμοσφαιρίνης των φυτών είχαν προκύψει
Απάντηση
10-3
από ΟΡΙΖόντια μεταφορά γονιδίων από μια παράσιτη νημα
Η παρουσία μιας μετάλλαξης σ' ένα γονίδιο δεν σημαίνει ανα
τέλμινθα, στο φυλογενετικό δέντρο της Εικόνας Ε9-17 οι αλ
γκαστικά ότι η πρωτεΊνη που εκφράζεται από το γονίδιο αυτό θα
ληλουχίες τους θα συναθροίΖονταν μαΖί με τις αλ/ηλουχίες
είναι ελαπωματική. Για παράδειγμα, η μετάλλαξη θα μπορούσε
των νηματωδών.
ν' αλ/άΖει ένα κωδικόνιο σ' ένα άλ/ο κωδικόνιο που όμως κα θορίζει το ίδιο αμινοξύ και έτσι δεν αλ/άΖει την αλλnίΊoυxία των
Απάντηση 9-18
αμινοξέων της πρωτεΊνης. Εναλλακτικά, η μετάλλαξη μπορεί να
Σε κάθε ανθρώπινη σειρά νέες μεταλλάξεις θα εισάγονται με
προκαλέσει μια αντικατάσταση ενός αμινοξέος από ένα άλ/ο,
συχνότητα 10-10 αλ/αγές ανά νουκλεοτίδιο ανά κυπαρική γε
αλ/ά σε μια θέση που δεν είναι σημαντική για την mύχωση ή τη
νεά και η διαφορά μεταξύ δύο ανθρώπινων σειρών θ' αυξάνει
λειτουργία της πρωτεΊνης. Για να εκτιμήσετε την πιθανότητα να
με τη διπλάσια συχνότητα. Για να συσσωρευθούν 10-3 διαφορές ανά νουκλεοτίδιο θα χρειαστούν 10-3/(2 χ 10-10) κυπαρικές γε
προκύψει μια ελαπωματική πρωτεΊνη από μια τέτοια μετάλλαξη,
νεές, που αντιστοιχούν σε (1/200) χ 10-3/(2 χ 10-10)
λάξεις του γονιδίου της β-σφαιρίνης στον άνθρωπο. Επομένως,
γενεές ανθρώπων, ή περίπου
750,000 χρόνια.
= 25,000
πρέπει να διαθέτετε πληροφορίες σχετικά με τις Υνωστές μεταλ
Στην πραγματι
θα έπρεπε να ΥνωρίΖετε επακριβώς την αλ/αγή που επήλθε στο
κότητα, ασφαλώς και δεν προήλθαμε όλοι από ένα Ζεύγος γε
μεταλ/αγμένο γονίδιο και να ερευνήσετε αν η αλ/αγή αυτή έχει
νετικώς ταυτόσημων αρΧέγονων ανθρώπων, αλ/ά μάλ/ον από
κάποιες Υνωστές ή προβλέψιμες επιπτώσεις στη λειτουργία της
μια σχετικά μικρή «ιδρυτική» γενεά ανθρώπων που ήδη εμφάνι
κωδικοποιούμενης πρωτεϊ'vης. Αν ο σύντροφός σας έχει δύο
Ζαν γενετική ποικιλότητα. Αυτός ο «ιδρυτικός» πληθυσμός φαί
φυσιολογικά αντίγραφα του γονιδίου της σφαιρίνης, τότε κανέ
νεται ότι έΖησε περίπου πριν από
να από τα παιδιά σας δεν θα εκδηλώσει την ασθένεια (τη θα
150,000 χρόνια.
Ωστόσο, υ
πάρχουν επίσης ενδείξεις για πιο πρόσφατους «ιδρυτικούς υπο
λασσαιμία), αλλά, κατά μέσο όρο, σε ποσοστό
πληθυσμούς» στην απαρχή ειδικών υποπληθυσμών των σύγ
ρείς του ελαπωματικού γονιδίου σας.
50% θα ήταν φο
χρονων ανθρώπων. Απάντηση
10-4
Παρόλο που αρκετές ερμηνείες είναι δυνατές, η απλούστερη εί
Κεφάλαιο Απάντηση
ναι ότι ο ΟΝΑ ανιχνευτής έχει υβριδιστεί κατά κύριο λόγο με το
10
αντίστοιχο μόριο
10-1
Α. Η πέψη με το ένΖυμο
mRNA,
το οποίο, μόλις εκφραστεί, τυπικά εί
ναι παρόν σε πολύ περισσότερα αντίγραφα απ' ό,τι το γονίδιο.
Eco RI παράγει
δύο προϊόντα:
Τα κύπαρα που υβρίζονται συχνά προφανώς εκφράΖουν το γο
5' ·ΜGΜΠGCGGΜΠCGΑGCΠΜGGGCCGCGCCGΜGCΠΤΑΜ-3·
νίδιο σε υψηλό επίπεδο και επομένως περιέχουν πολ/ά μόρια
3' -ΠCΠΜCGCCΠΜGCΤCGΜΠCCCGGCGCGGCΠCGΑΜΠΤ-5'
του συγκεκριμένου
mRNA.
Β. Η πέψη με το ένΖυμο Alu Ι παράγει τρία προϊόντα:
10-5
5' -ΜGΜΠGCGGΜΠCGΑGCΠΜGGGCCGCGCCGΜG CΠΤΑΜ-3'
Απάντηση
3' -ΠCΠΜCGCCΠΜGCΤCGΜΠCCCGGCGCGGCΠC GΑΜΠΤ-5'
Α. Μετά από έναν επιπλέον γύρο πολ/απλασιασμού θα υπάρ
Γ. Η αλ/ηλουΧίαδεν περιέχει καμία θέση διάσπασηςαπό το έν Ζυμο Not Ι. Δ. Επομένως, η πέψη και με τα τρία ένΖυμα παράγει τα εξής προϊόντα:
χουν
2 γκρι, 4 πράσινα, 4 κόκκινα
και
22
κίτρινα κλάσματα
και μετά από έναν ακόμα γύρο θα υπάρχουν να,
5 κόκκινα
και
52
2 γκρι, 5 πράσι
κίτρινα κλάσματα. Επομένως, τα κλά
σματα ΟΝΑ που αποδίδονται κίτρινα αυξάνουν εκθετικά και
5' -ΜGΜΠGCGGΜΠCGΑGCΠΜGGGCCGCGCCGΜG CΠΤΑΜ-3'
τελικά κυριαρχούν στα άλ/α προϊόντα της αντίδρασης. Το
3' -ΠCΠΜCGCCΠΑGCΓCGΜΠCCCGGCGCGGCΠCGΑΜΠΤ-5'
μήκος τους καθορίΖεται ακριβώς από την αλ/ηλουΧία του
ΟΝΑ η οποία παρεμβάλλεται ανάμεσα στους δύο εκκινητές Απάντηση 10-2
Αν ο λόγος των τριφωσφορικών διδεοξυριβονουκλεοσιδίων προς τα τριφωσφορικά δεοξυριβονουκλεοσίδια αυξηθεί, ο
που χρησιμοποιούνται για τον πολ/απλασιασμό.
Β. Η μάΖα ενός μορίου ΟΝΑ μήκους
500 Ζευγών νουκλεοτι
δίων είναι 5.5 χ 10- Ι9 9 [= 2 χ 500 χ 330 (g/mole)/6 χ 1023
πολυμερισμός του ΟΝΑ θα τερματίΖεται πιο συχνά και έτσι θα
(μόρια/mοle)]. Αν αγνοήσουμε την περιπλοκότητα των λί
παράγονται βραΧύτεροι κλώνοι ΟΝΑ. Οι συνθήκες αυτές εί
γων πρώτων βημάτων της αντίδρασης (που παράγουν μα
ναι ευνοϊκές για τον καθορισμό βραχειών αλ/ηλουχιών νου
κρύτερα προϊόντα τα οποία αποτελούν ένα ελάΧιστο κλά
κλεοτιδίων, δηλαδή των αλ/ηλουχιών που βρίσκονται κοντά
σμα του τελικού προϊόντος), αυτή η ποσότητα προϊόντος πε
στον εκκινητή που χρησιμοποιήθηκε για την αντίδραση. Αντί
ρίπου διπλασιάΖεται σε κάθε βήμα πολ/απλασιασμού. Επο
θετα, αν ο λόγος αυτός ελαπωθεί, μπορεί να καθοριστεί η αλ-
μένως, 100 χ 10-9 9 = 2 Ν χ 5.5 χ 10- Ι9 g, όπου Ν είναι ο
954
Απαντήσεις
αριθμός των βημάτων πολλαπΛασιασμού της αντίδρασης.
ρια
Αν επιΛύσουμε την εξίσωση αυτή ως προς το Ν [Ν =
ώστε να επιτρέψουν στους εκκινητές να υβριδιστούν για να
log
DNA, τα οποία,
σε κάθε κύκλο, πρέπει ν' αποδιαταΧθούν
(1.81 χ 10 11 )/log(2)] προκύπτει ότι Ν = 37.4. Επομένως, 40 μόνο κύκΛοι πολλαπΛασιασμού με την αντίδραση PCR
Ε. Λάθος. Η πέψη του γενωμικού ΟΝΑ με νουκλεάσες περιορι
επαρκούν για την παραγωγή ΟΝΑ από ένα μόνο μόριο σε
σμού που αναΥνωρίΖουν αλ/ηλουΧίες τεσσάρων νουκλεοτι
ποσότητα που προσφέρεται για πειραματικούς χειρισμούς
δίων παράγει κλάσματα, τα οποία, κατά μέσο όρο, έχουν μή
και βιοχημικές αναλύσεις. Στο εργαστήριο, η όΛη διεργα
κος
σία διαρκεί μόΛις
κος των παραγόμενων κλασμάτων εμφανίΖει μεγάΛες απο
4, περίπου,
ώρες.
μπορεί ν' αντιγραφεί ξανά ο κλώνος του ΟΝΑ.
256 νουκλεοτίδια.
Ωστόσο, στην πραγματικότητα, το μή
κλίσεις από αυτόν τον μέσο όρο.
Aπ6ντησn
10-6
Ζ. Σωστό. Για την αντιγραφή του
mRNA σε μονόκΛωνο
ΟΝΑ
Όπως συμβαίνει με τα περισσότερα γονίδια των θηΛαστικών,
πρώτα απαιτείται η αντίστροφη μεταγραφάση. Στη συνέχεια,
το γονίδιο της «γοητειάσης» πιθανότητα θα περιέχειιντρόνια.
για τη σύνθεση του δεύτερου κλώνου ΟΝΑ απαιτείται η ΟΝΑ
Τα βακτήρια δεν διαθέτουν τον αναγκαίο μηχανισμό συρρα φής για την αφαίρεση των ιντρονίων, και επομένως από το γο
νίδιο αυτό δεν μπορεί να εκφραστεί η σωστή πρωτε"ί"νη. Για την έκφραση των περισσότερων γονιδίων των θηλαστικών σε βα κτηριακά γονίδια, πρέπει να χρησιμοποιηθεί μια
cDNA εκδοχή
του γονιδίου.
ποΛυμεράση.
Η. Σωστό. Χρησιμοποιώντας κατάλληΛο αριθμό
VNTRs για
κά
θε άτομο μπορεί να δημιουργηθεί μια ξεχωριστή γενετική
ταυτότητα (βλ. Εικόνα
10-30).
Θ. Σωστό. Αν τα κύτταρα του ιστού δεν μεταγράφουν ένα γονί διο, τότε το γονίδιο αυτό δεν θ' αντιπροσωπεύεται σε μια
cD-
ΝΑ βιβΛιοθήκη που θα παρασκευάΖεται από τον συγκεκριμέ Aπ6ντησn
10-7
νο ιστό, ενώ, αντίθετα, θ' αντιπροσωπεύεται σε μια γενωμική
Γενική επιδίωξη της κυτταρικής βιολογίας είναι ν' ανακαλύψει
βιβλιοθήκη που παρασκευάΖεται από τον ίδιο ιστό.
πώς Λειτουργεί κάθε κύτταρο. Ωστόσο, οι περισσότερες διερ γασίες είναι πολύ δύσκοΛο να μελετηθούν σε μεμονωμένα
Aπ6ντησn
κύτταρα. Αν όμως διαθέτουμε έναν πΛηθυσμό ταυτόσημων
Οι κυτταρικές σειρές των αρΧέγονων εμβρυϊκών κυττάρων του
10-9
κυττάρων, τότε τ' αποτελέσματα της ανάλυσης για τις Λειτουρ
ανθρώπου προέρχονται από την έσω κυτταρική μάΖα. Έχουν
γίες των μεμονωμένων κυττάρων θα είναι αξιόπιστα. Αντίθετα,
την ικανότητα να πολ/απΛασιάΖονται επ' άπειρον και ν' αποδί
αν ο πληθυσμός είναι μείγμα κυτταρικών τύπων, η ανάλυση θ'
δουν οποιοδήποτε μέρος του σώματος. Αν η διαφοροποίησή
αφορά στις ιδιότητες του μείγματος, οι οποίες δεν είναι βέβαιο
τους καθοδηγηθεί κατάλ/ηλα σε καλλιέργεια
ότι θα περιγράφουν με ακρίβεια τις ιδιότητες κάθε ξεχωριστού
έρευνας
κυττάρου.
κανών ν' αντικαθιστούν ή να επιδιορθώνουν ιστούς που έχουν
-
-
πεδίο εντατικής
θα μπορούσε ν' αποτεΛέσουν μια πηγή κυττάρων ι
παραβΛαφθεί από νοσήματα ή Τραυματισμούς. Aπ6ντησn
10-8
Α. Λάθος. Θέσεις περιορισμού υπάρχουν σε όλη την έκταση του
DNA, δηλαδή τόσο μέσα
όσο και ανάμεσα στα γονίδια.
Β. Σωστό. Το ΟΝΑ φέρει ένα αρνητικό φορτίο σε κάθε φωσφο ρική ομάδα και συνολικά έχει αρνητικό φορτίο.
Γ. Λάθος. Οι κλώνοι που απομονώνονται από
Aπ6ντησn
10-10
Α. Η αλ/ηλουΧία του
DNA, από το 5ce προς το 3ce άκρο της, δια
βάΖεται αρχίζοντας από το κάτω μέρος της πηκτής, όπου μετα
ναστεύουν τα μικρότερα κλάσματα του ΟΝΑ. Κάθε Ζώνη προ
cDNA βιβΛιοθή
κύπτει από την ενσωμάτωση του κατάλληλου Τριφωσφορικού
κες δεν περιέχουν ποτέ αλληΛουΧίες υποκινητών. Οι αλλη
διδεοξυριβονουκλεοσιδίου· όπως θ' ανέμενε κανείς, καμιά
λουΧίες αυτές δεν μεταγράφονται και επομένως δεν είναι
Ζώνη δεν έχει την ίδια κινητικότητα με κάποια άλ/η Ζώνη. Έ
τμήμα των μορίων
τοι, η αλ/ηΛουΧία του ΟΝΑ μπορεί να καθοριστεί διαβάΖοντας
mRNA που γείο για την παραγωγή cDNA.
χρησιμοποιούνται ως εκμα
Δ. Σωστό. Κάθε αντίδραση ποΛυμερισμού παράγει δίκλωνα μό-
τις Ζώνες με τη σειρά, προχωρώντας από το κάτω μέρος της
πηκτής προς τα πάνω και εντοπίζοντας το σωστό νουκλεοτί-
(Α)
5' -TATAAACTGGACAACCAGTTCGAGCTGGTGTTCGTGGTCGGTTTTCAGAAGATCCTAACGCTGACG-3' 3' -ATATTTGACCTGTTGGTCAAGCTCGACCACAAGCACCAGCCAAAAGTCTTCTAGGATTGCGACTGC-5'
(8)
5· πάνωκλώνοςτοuΟΝΑ 3· TATAAACTGGACAACCAGTTCGAGCTGGTGTTCGTGGTCGGTTTTCAGAAGATCCTAACGCTGACG 1 LeuLysLeuGluAsnGlnPheGlnLeuValPheValValGlyPheGlnLysIleLeuThrLeuThr 2 IleAsnTrpThrThrSerSerSerTrpCysSerTrpSerValPheArgArgSer Arg 3 ThrGlyGlnProValArgAlaGlyValArgGlyArgPheSerGluAspprOAsnAlaAs~
Εικόνα Α10-10
Απαντήσεις
955
διο, σύμφωνα με τη στήλη στην οποία βρίσκεται η Ζώνη.
τιδίων. ΕξετάΖοντας προσεκτικά τις αλ/ηλουΧίες των νουκλε
Η αλ/ηλουΧία των νουκλεοτιδίων του πάνω κλώνου (Εικό
οτιδίων των περιοΧών που αναλύθηκαν με τη μέθοδο αυτή,
να ΑΙ0-Ι0Α) προέκυψε από την Εικόνα ΕΙ0-Ι0 ενώ η αλ/η
μπορεί να ταυτοποιηθεί η θέση και η αλ/ηλουΧία των υποψή
λουΧία του κάτω κλώνου καθορίστηκε με βάση τους κανόνες
φιων γονιδίων.
συμπληρωματικότητας των βάσεων.
Β. Στη συνέχεια, η αλ/ηλουΧία του ΟΝΑ μπορεί να μεταφραστεί
Aπ6ντησn
10-12
σε μια αλ/ηλουχία αμινοξέων χρησιμοποιώντας τον γενετικό
Αν συγκρίνουμε το μέγεθος των δεικτών με τις θέσεις διάσπα
κώδικα. Ωστόσο, δυνητικά, και οι δύο κλώνοι του ΟΝΑ θα
σης, διαπιστώνουμε ότι η πέψη με το ένΖυμο
μπορούσε να μεταγραφούν σε ΗΝΑ και να μεταφραστούν σε
δύο κλάσματα
πρωτείνη, ενώ για κάθε κλώνο υπάρχουν τρία δυνητικά πλαί
ποδίδει ένα κλάσμα
σια ανάΥνωσης. Συνεπώς, από τη συγκεκριμένη αλ/ηλουΧία
αποδίδει τρία
του ΟΝΑ θεωρητικά μπορεί να κωδικοποιηθούν έξι αλλη
θροίσουμε το μήκος των κλασμάτων κάθε στήλης, προκύπτει ένα συνολικό μήκος
σης για τον πάνω κλώνο, μόνο ένα δεν διακόπτεται από ένα
ΝΑ πρέπει να είχε μήκος
κωδικόνιο τερματισμού (Εικόνα ΑΙ 0-1 ΟΒ).
Επειδή η πέψη κους
10 kb,
αποδίδει
4 kb και 6 kb, αντιστοίχως η πέψη με το Not Ι α 10 kb· τέλος, η πέψη με τα Eco RI + Not Ι κλάσματα 6 kb, 3kb και 1 kb, αντιστοίχως. Αν α
λουΧίες αμινοξέων. Από τα τρία δυνητικά πλαίσια ανάγνω
Επίσης κωδικόνια τερματισμού περιέχουν και δύο από τα
Eco RI
10 kb. Συνεπώς, το αρχικό μόριο του D10 kb (10,000 Ζεύγη νουκλεοτιδίων). με το ένΖυμο Not Ι αποδίδει ένα κλάσμα μή
το αρχικό μόριο ΟΝΑ θα μπορούσε να είναι ένα
τρία πλαίσια ανάΥνωσης του κάτω κλώνου. Το τρίτο πλαίσιο
γραμμικό μόριο χωρίς καμία θέση περιορισμού για το
δίνει την ακόλουθη αλ/ηλουΧία αμινοξέων:
Ωστόσο, η ερμηνεία αυτή απορρίπτεται από τα αποτελέσματα
Not Ι.
ντιστοιχεί στην πρωτείνη που κωδικοποιείται από τη συγκε
Eco RI + Not Ι. ΓνωρίΖουμε ότι η Eco R! αποδίδει δύο κλάσματα 4 kb και 6 kb και ότι κατά τη διπλή πέψη το κλάσμα των 4 kb διασπάται από το Not Ι σε δύο κλάσματα μεγέθους 3 kb και 1 kb, αντιστοίχως. Επομένως, το ΟΝΑ περιέχει μια θέση περιορισμού Not Ι και ά
κριμένη αλ/ηλουχία ΟΝΑ.
ρα πρέπει να είναι κυκλικό, εφόσον όταν πέπτεται μόνο με το
SerAlaleuGlySerSerGluAsnArgProArgThrProAlaArgThrGlyCysProValIle Με βάση τις διαθέσιμες πληροφορίες δεν είναι δυνατό να καθοριστεί ποιο από τα δύο «ανοιχτά πλαίσια ανάΥνωσης» α
της ταυτόχρονης πέψης με
πέψη μόνο με το
Not Ι Aπ6ντησn
10-11
προκύπτει μόνο ένα κλάσμα μεγέθους
10 kb.
Αν τοπο
θετήσουμε τις θέσεις περιορισμού πάνω σ' ένα κυκλικό μόριο
Α. Η πέψη του γενωμικού ΟΝΑ του ανθρώπου με το ένΖυμο
ΟΝΑ έτσι ώστε ν' αποδίδονται κλάσματα του συγκεκριμένου
Hae ΠΙ θα παρήγαγε περίπου 11 χ 106 διαφορετικά κλάσμα τα [= 3 χ 109/104], με το ένΖυμο Eco RI περίπου 730,000 διαφορετικά κλάσματα [= 3 χ 109/46] και με το Not Ι περίπου 46,000 διαφορετικά κλάσματα [= 3 χ 109/48]. Επίσης, θα
μεγέθους, θα προκύψει ο χάρτης που παρουσιάΖεται στην Ει
Aπ6ντησn
παράγονταν ορισμένα επιπλέον κλάσματα επειδή το πατρικό
Αν τα ένΖυμα επιδιόρθωσης δράσουν στο πλασμίδιο προτού α
και το μητρικό χρωμόσωμα είναι μεν πολύ όμοια αλ/ά δεν έ
ντιγραφεί, το πλασμίδιο πράγματι θα επιδιορθωθεί στα κύπαρα.
χουν ταυτόσημη αλ/ηλουΧία ΟΝΑ.
κόνα ΑΙ0-12.
10-13
Ωστόσο, τα ένΖυμα επιδιόρθωσης δεν είναι σε θέση να διακρί
Β. Θα παραΧθεί μια ομάδα επικαλυπτόμενων κλασμάτων ΟΝΑ.
νουν ποιος κλώνος ΟΝΑ περιέχει τη μετάλ/αξη και ποιος το σω
Οι βιβλιοθήκες που δημιουργούνται από ομάδες επικαλυ
στό νουκλεοτίδιο. Επομένως, στα μισά από τα κύπαρα που έ
πτόμενων κλασμάτων ενός γονιδιώματος είναι πολύτιμες ε
χουν υποστεί μεταμόρφωση από το αταίριαστο πλασμίδιο το φυ
πειδή μπορεί να χρησιμοποιηθούν για να καθοριστεί η σειρά
σιολογικό γονίδιο θ' αποκατασταθεί ενώ στα υπόλοιπα κύπαρα
διάφορων κλωνοποιημένων αλ/ηλουχιών σε σΧέση με την
ο φυσιολογικός κλώνος θα μετατραπεί ώστε να ταιριάΖει με τον
πραγματική σειρά τους πάνω στο χρωμόσωμα, άρα και η αλ
μεταλλαγμένο και έτσι η μετάλλαξη θα διαδοθεί. Τα κύπαρα
ληλουΧία του ΟΝΑ ενός μεγάλου τμήματος ΟΝΑ. Αλ/ηλου
που περιέχουν ένα πλασμίδιο με την επιθυμητή μετάλ/αξη μπο-
χίες από το άκρο ενός κλωνοποιημένου τμήματος ΟΝΑ χρη
σιμοποιούνται ως ανιχνευτές υβριδισμού για την ανεύρεση και άλ/ων κλώνων της βιβλιοθήκης που περιέχουν αυτές τις
Νο!!
αλ/ηλουΧίες και πιθανόν θα μπορούσε να επικαλύπτονται. Επαναλαμβάνοντας αυτή τη διεργασία, σταδιακά συνθέτου με ένα μεγάλο τμήμα ΟΝΑ με συνεχή αλ/ηλουΧία (βλ. Ερώ τηση
10-17). Η επίπονη τεχνική της «βάδισης
πάνω στο χρω
μόσωμα» έχει χρησιμοποιηθεί για τον καθορισμό της αλ/η
Eco
λουΧίας περιοΧών του γονιδιώματος που είναι Υνωστό ότι πε ριέχουν σημαντικά γονίδια, για τις οποίες όμως δεν υπάρ χουν πληροφορίες σχετικά με την αλ/ηλουΧία των νουκλεο-
956
Απαντήσεις
ΕlκόναΑ10-12
ΑΙ
ρει να ταυτοποιηθούν, για παράδειγμα με υβριδισμό μ' έναν
Χία ανάμεσα στις αλληλουχίες που απομονώθηκαν από τη βι
μονόκλωνο ΟΝΑ ανιχνευτή που επιτρέπει τη διάκριση του φυ
βλιοθήκη θα ήταν μεγάλη (βλ. Ερώτηση
σιολογικού από το μεταλ/αγμένο γονίδιο.
10-5).
Ο ανιχνευτής
#2 πρακτικά είναι άχρηστος, επειδή μόνο το 1/7776 του ΟΝΑ στο μείγμα θα υβριδιΖόταν τέλεια με το επιθυμητό γονίδιο. Για
Απάvrnσn
10-14
την ανάλυση των αλ/ηλουχιών που απομονώθηκαν θα μπο
Α. Ο γενετικός κώδικας είναι εκφυλισμένος: εκτός από την τρυ πτοφάνη και τη μεθειονίνη, για κάθε αμινοξύ υπάρχουν πε ρισσότερα από ένα δυνητικό κωδικόνιο. Επομένως, για την
ρούσατε να χρησιμοποιήσετε τον ανιχνευτή
#3. Οι αλ/ηλου Χίες που υβριδίΖΟνται με τους ανιχνευτές # 1 και #3 είναι πο λύ πιθανό να περιέχουντο επιθυμητόγονίδιο.
ανίχνευση μιας αλ/ηλουΧίας νουκλεοτιδίων με βάση μόνο
Β. Η πληροφορίαότι η πε;1Τιδική αλ/ηλουχια #3 περιέχει το τε
την αλ/ηλουΧία των αμινοξέων της πρωτείνης που κωδικο
λευταίο αμινοξύ της πρωτεΤνης είναι πολύτιμη, επειδή αυτό
ποιεί πρέπει να παρασκευαστούν πολ/ά ολιγονουκλεοτίδια
σημαίνει ότι οι άλλες δύο πεπτιδικές αλ/ηλουΧίες πρέπει να
και να χρησιμοποιηθούν από κοινού, ώστε να διασφαλιστεί
προηγούνται,δηλαδή να εντοπίζονταιπιο κοντά στο αμινοτε
ότι το μειγμα θα περιέχει ένα ολιγονουκλεοτιδιο που θα ται
λικό άκρο της πληροφορίας. Η γνώση αυτής της σειράς έχει
ριάΖει επακριβώς με την αλ/ηλουχια του ΟΝΑ του γονιδΙου.
σημασία, επειδή οι ΟΝΑ εκκινητές επεκτείνονται από τις
Για τις τρεις πεπτιδικές αλ/ηλουχίες αυτής της ερώτησης,
ΟΝΑ πολυμεράσεςμόνο από τα 3ce άκρα τους. Κατά τη διάρ
πρέπει να παρασκευαστούν οι εξής ολιγονουκλεοτιδικοι ανι
κεια μιας αντίδρασης
χνευτές (οι εναλλακτικές βάσεις στην ίδια θέση γράφονται
πρέπει να είναι αντικριστά (βλ Εικόνα
μέσα σε παρενθέσεις):
νας εκκινητής για
λουΧία Ilεmfδιο
Μ
οκτώ (= 23) διαφορετικά ολιγονουκλεοτΙδια.
δεύτερη πεπτιδική αλ/ηλουχια ειναι πολύ πιο περΙπλοκο. Η και η
Ser,
Arg
κωδικοποιούνται από έξι διαφορετικά
κωδικόνια: επομένως, θα έπρεπε να συντεθούν 7776 (= 65) διαφορετικά ολιγονουκλεοτίδια. Ωστόσο, αυτό δεν θα μπο ρούσε να γινει χρησιμοποιώντας απλώς ένα διαφορετικό νουκλεοτιδιο για κάθε βάση, επειδή οι διαφορετικές βάσεις
κάθε κωδικονιου δεν είναι ανεξάρτητες. (Για παράδειγμα, η
Ser έχει ως
πρώτη βάση του κωδικονιου την Α ή την Τ, ως
δεύτερη βάση την ή
C.
Ilεπτfδιο
G ή την C και ως τριτη οποιαδήποτε από τις
Ωστόσο, όταν η πρώτη βάση ειναι η Α, η δεύτερη
ειναι πάντα η
G και η τριτη μπορει να είναι μόνο Τ ή C).
άκρο του να
# 1 θα ήταν η επιλογή σας για τον δεύτερο εκκι
νητή. Λόγω του μεγάλου εκφυλισμού του, ο ανιχνευτής
#2
και πάλι θα ήταν μια ακατάλ/ηλη επιλογή.
Γ. Τα άκρα του τελικού προϊόντος προέρχονται από τους εκκι νητές που έχουν και οι δύο μήκος
νως, έχει πολ/απλασιαστεί μήκους
15 νουκλεοτίδια. Επομέ ένα τμήμα του cDNA του γονιδίου
270 νουκλεοτιδίων.
90 αμινοξέα.
Το τμήμα αυτό θα κωδικοποιεί
Ilροσθέτοντας και τ' αμινοξέα που κωδικοποι
ούνται από τους εκκινητές, προκύπτει μια κωδικοποιητική αλ
ληλουΧία
100 αμινοξέων.
Η αλ/ηλουΧία αυτή μάλ/ον δεν α
ντιπροσωπεύει ολόκληρη την πρωτεΙ\ιη επειδή δεν γνωρίΖου
με την εντόπιση του πεπτιδίου
# 1 στην αλ/ηλουΧία της πρω CTATκωδικοποιείτην πεπτιδική αλ/ηλουΧία #2.
τεΤνης. Ωστόσο, παρατηρούμε ότι η αλ/ηλουΧία
CACGCTΠAGG
Επομένως, η πληροφορία αυτή επιβεβαιώνει ότι το προϊόν
PCR πράγματι
κωδικοποιεί ένα κλάσμα της πρωτείνης που εί
χατε απομονώσει αρχικά.
3:
5ce-TA (C,T)
3ce
ναι συμπληρωματική με το κωδικόνιο της Τrp):
Ο ανιχνευτής
2:
Το μειγμα των ολιγονουκλεοτιδιων που αντιπροσωπεύουν τη
G,A,T,
βασίΖεται στην πεπτιδική αλ/η
πρέπει να έχει αλ/ηλουΧία συμπληρωματικήμε
5ce-(TC) TGCAT (G,A,T,C) CC (G,A) Μ (G,A) TA-3ce
5ce-(T,C) Τ (G,A,T,C) (Α,Τ) (G,C) (G,A,T,C) (A,C) G (G,A,T,C) (T,C) Τ (G,A,T) (A,C) G (G,A,T,C)-3ce
η
έ
αντιστοιχεί στο πρώτο νουκλεοτίδιο της αλ/ηλουχΙας που εί
(A,G)-3ce
Λόγω του διπλού εκφυλισμού σε τρεις θέσεις, θα χρειάΖονταν
Leu,
PCR που
10-27). Επομένως,
την αλ/ηλουΧίατου ανιχνευτή #3 (ώστε το
1:
5ce-TGGATGCA (C,T) CA (C,T)
Ilεπτfδιο
#3
PCR, τα 3ce άκρα των δύο «εκκινητών»
Π
(C,T) GG (G,A,T,C) ATGCA (A,G)-3ce
Απάvrnσn
Λόγω της ύπαρξης τριών διπλών και ενός τετραπλού εκφυλι
10-15
Η βιοχημεία των πρωτεϊνών εξακολουθεί να έχει μεγάλη σημα
σμού, για το μείγμα θα χρειάΖονταν 32 (= 23 χ 4) διαφορετι
σία, κυρίως επειδή προσφέρει τον σύνδεσμο ανάμεσα στην αλ
κές αλ/ηλουχΙες.
ληλουΧία των αμινοξέων (που μπορεί να καθοριστεί από την αλ
Για τη διαλογή της βιβλιοθήκης σας με υβριδισμό, πρώτα μάλ
ληλουΧία του ΟΝΑ) και τις λειτουργικές ιδιότητες της πρωτεΙ\ιης.
λον θα χρησιμοποιούσατε τον ανιχνευτή
Για παράδειγμα, εξακολουθούμε να μην είμαστε σε θέση να
χουν μόνο οκτώ αλ/ηλουχΙες
#1.
Επειδή υπάρ
DNA, ο λόγος της σωστής
προς
προβλέψουμε την πτύχωση μιας πολυπεπτιδικής αλυσίδας με
τις λανθασμένες αλ/ηλουχιες θα είναι ο υψηλότερος. Έτσι,
βάση την αλληλουχΙα των αμινοξέων της. Έτσι, σε πολ/ές περι
κατά τη διαλογή της βιβλιοθήκης το σήμα θα ήταν ισχυρό και
πτώσεις, πληροφορίες σχετικά με τη λειτουργία της πρωτείνης
επομένως η πιθανότητα να βρίσκεται η επιθυμητή αλ/ηλου-
(π.χ. την καταλυτική ενεργότητά της) δεν συνάγονται από τη γνώ-
Απαντήσεις
957
ση της αλ/ηλΟUΧίας αλλά πρέπει να ΣUγKενφωθOύν πειραματι
βλημάτων είναι να χρησιμοποιούνται γενωμικοί κλώνοι, οι ο
κά αναλύοντας τις ιδιότητες της πρωτείνης. Επιπλέον, οι δομικές
ποίοι, Χάρη στο μεγάλο μήκος τοuς, uπερκαλύπτοuν την επα
πληροφορίες
ναληπτική αλ/ηλΟUΧία τou ΟΝΑ.
nou μπορεί να
σuγκεντρωθούν από τη μελέτη αλ
ληλΟUΧΙών τou ΟΝΑ αναγκαστικά είναι ατελείς. Για παράδειγμα, από τη μελέτη αuτή δεν προκύmοuν πληροφορίες σχετικά με τις
Aπdvmσn 10-18
τροποποιήσεις των πλεuρικών αλuσίδων των πρωτεϊνών (όπως η
Α. Τα βρέφη
2 και 8 έχοuν ταuτόσημα πρόωπα και μάλ/ον είναι 3 και 6. Αuτά τα Ζεu
φωσφορuλίωση), την πρωτεολuτική επεξεργασία της, την πα
αδέλφια. Το ίδιο ισχύει και για τα βρέφη
ροuσία ισχuρά προσδεδεμένων σuνενΖύμων, ή τη διασύνδεση
γάρια είναι μονΟΖuγωτικά δίδuμα. Τα δύο άλλα Ζεuγάρια
της πρωτε'ίνης με άλλες πολuπεπτιδικές αλuσίδες.
μάλ/ον είναι διΖuγωτικά δίδuμα, επειδή τα uπόλοιπα πρόω πα διαφέροuν. Τα δΙΖuγωτικά δίδuμα, όπως και όλα τ' αδέλ
Aπdvmσn
φια, έχοuν κοινό το μισό γονιδίωμά τοuς. Σuνεπώς, περίποu
10-16
Τα προϊόντα θα περ!λαμβάνοuν έναν μεγάλο αριθμό διαφορε
οι μισοί πολuμορφισμοίVNΤR θα είναι ταuτόσημοι. Με αuτό
τικών μονόκλωνων μορίων
το κριτήριο, αδέλφια είναι τα βρέφη
DNA,
ένα για κάθε νοuκλεοτίδιο
της αλ/η!ΊΟUΧίας. Ωστόσο, τα προϊόντα αuτά θα έχοuν ένα από τέσσερα διαφορετικά χρώματα, ανάλογα με το διδεοξuριβονοu κλεοτίδιο
nou τερμάτισε
την αντίδραση πολuμερισμού της
ou-
και
1 και 7 και τα
βρέφη
4
5.
Β. Με την ίδια στρατηγική, τα βρέφη μπορεί να «ταιριάξοuν» με τοuς γονείς τοuς. Κάθε Ζώνη στην ανάλuση ενός βρέφοuς
γκεκριμένης αλuσίδας τou ΟΝΑ. Ο διαχωρισμός με ηλεκφο
πρέπει να έχει το «ταίρι» της στην ανάλuση ενός από τοuς γο
φόρηση σε πηκτή θ' αποδώσει μια σειρά από Ζώνες,
νείς. Επίσης, κάθε βρέφος θα έχει
xouv μεταξύ τοuς κατά
nou
απέ
ένα νοuκλεοτίδιο. Το χρώμα κάθε Ζώνης
50% κοινούς
πολuμορφι
σμούς νΝΤΗ με καθέναν από τοuς γονείς τou. Σuνεπώς, ο
uποδηλώνει το νοuκλεοτίδιο τou εκμαγείοu στη σuγκεκριμένη
βαθμός σύμπτωσης παιδιού-γονιού θα είναι ίδιος με τον α
θέση της αλ/ηλοuχίας. Η μέθοδος
ντίστοιχο βαθμό μεταξύ δύο διΖuγωτικών αδελφών.
nou περιγράφηκε
εδώ απο
τελεί τη βάση της στρατηγικής για τον καθορισμό της αλληλοu
Χίας των νοuκλεοτιδίων τou ΟΝΑ
nou ακολοuθούν
τα περισσό
Aπdvmσn
10-19
τερα αuτοματοποιημένα μηχανήματα ανάλuσης της αλ/ηλοu
Μεταλ/αγμένα βακτήρια
Χίαςτοu ΟΝΑ (Εικόνα ΑΙ0-16).
πάγοu φαίνεται ότι έχοuν αναπωχθεί πολ/ές φορές στη φύση.
nou
Ωστόσο, επειδή τα βακτήρια
Aπdvmσn
δεν παράγοuν την πρωτεΤνη τou
nou
παράγοuν την πρωτεΤνη τou
πάγοu έχοuν ένα μικρό πλεονέκτημα αύξησης, θα ήταν δύσκο
10-17 δεν θα μπορούσε να χρησιμοποιηθούν ε
λο να βρεθούν μεταλλαγμένα βακτήρια στη φύση (και επιπλέον
πειδή δύο κλώνοι
τα βακτήρια αuτά θα ήταν δύσκολο να εΠιΖήσοuν έχοντας ν' α
προέρχονται
cDNA δεν επικαλύmονται ακόμα και όταν από γονίδια nou βρίσκονται δίπλα-δίπλα στο
ντιμετωπίσοuν τον ανταγωνισμό των φuσιολογικών ομολόγων
Α. Οι
cDNA κλώνοι
τοuς). Η γενετική μηχανική,
χρωμόσωμα.
Β. Τέτοιες επαναληπτικές αλ/ηλΟUΧίες ΟΝΑ μπορεί να περι
μεταλ/άσσονται εσκεμμένα
nou χρησιμοποιεί γονίδια τα οποία ίη vitro, διεuκολύνει πολύ τη δημι
πλέξοuν το βάδισμα πάνω στο χρωμόσωμα, επειδή η δια
οuργία τέτοιων μεταλλαγμένων στελεΧών. Επομένως, οι επι
δρομή θα έμοιαΖε να διακλαδίΖεται σε πολ/ές κατεuθύνσεις
πτώσεις, εuμενείς και δuσμενείς, από τη χρησιμοποίηση ενός
ταuτόχρονα. Η γενική αρχή για την αποφuγή τέτοιων προ-
γενετικώς φοποποιημένοu μικροοργανισμού για πρακτικούς
λόγοuς σχεδόν δεν διακρίνονται από τις επιπτώσεις
nou θα είχε
η χρησιμοποίηση ενός φuσικού μεταλλαγμένοu στελέχοuς. Πράγματι, από πολύ παλιά, στελέχη βακτηρίων και Ζuμομuκή
G Α
-
-
των επιλέγονται για επιθuμητά γενετικά χαρακτηριστικά τοuς
nou τα κάνοuν κατάλ/ηλα
για βιομηχανικές εφαρμογές, όπως η
παραγωγή ωριού και κρασιού. Ωστόσο, οι δuνατότητες της γε
C C
νετικής μηχανικής είναι απεριόριστες και, όπως σuμβαίνει με
G
πρόβλεπτες σuνέπειες. Επομένως, ο πειραματισμός με το ανα
Α
σuνδuασμένο ΟΝΑ uπόκειται σε ρύθμιση και ο κίνδuνος των
C
διαφόρων προγραμμάτων εκτιμάται προσεκτικά από ειδικές ε
Τ
κάθε τεχνολογία, uπάρχει κάποιος κίνδuνος να προκύψοuν α
Τ
πιτροπές προτού χορηγηθεί έγκριση. Οι γνώσεις μας έχοuν εξε
G Τ
λιχθεί τόσο ώστε να μπορεί να προβλεφθούν με αρκετή βεβαιό
Α
τητα οι επιπτώσεις μερικών αλ/αγών, όπως η διαταραχή ενός βακτηριακού γονιδίοu. Άλ/ες εφαρμογές, όπως η θεραπεία της
γαμετικής σειράς για την επιδιόρθωση νοσημάτων τou ανθρώ Εικόνα Α10-16
958
Απαντήσεις
nou,
μπορεί να έχοuν πολύ πιο περίπλοκη έκβαση. Για το λόγο
αυτό θα χρειαστούν πολύ περισσότερα χρόνια έρευνας
KQl ηθι
κού προβληματισμού προτού καθοριστεί αν τελικά θα εφαρμο στούν τέτοιες θεραπείες.
Κεφάλαιο Απάντηση
11
11-1
Το νερό είνQl ένα ρευστό και έτσι οι δεσμοί υδρογόνου μεταξύ των μορίων του νερού δεν είναι στατικοί. Συνεχώς ΣΧηματίΖΟ
VIQl KQl
βαλίνη
ισολεuκίνη
αλανίνη
Εικόνα Α 11-5
καταστρέφονται πάλι λόγω των θερμικών κινήσεων.
Οταν ένα μόριο νερού βρεθεί κοντά σ' ένα υδρόφοβο μόριο, τότε οι κινήσεις του θα περιοριστούν και θα έχει λιγότερους γεί τονες για ν' αλ/ηλεπιδράσεl, επειδή δεν μπορεί να σχηματίσει
υδρόφιλη. Η ομάδα ΟΗ και οι ομάδες
κανένα δεσμό υδρογόνου προς την πλευρά του υδρόφοβου μο
είνQl πολικές, μπορούν να σχηματίσουν δεσμούς υδρογόνου
C-O-C στο Triton Χ-Ι00
ρίου. Επομένως θα σχηματίσει δεσμούς υδρογόνου μ' έναν πε
με το νερό και επομένως είναι υδρόφιλες. Αντίθετα, τα πράσινα
ριορισμένο αριθμό μορίων νερού που βρίσκοντQl πλησιέστερα
τμήματα των μορίων είναι είτε υδρογονανθρακικές αλυσίδες ή
σε αυτό. Η σύνδεση με λιγότερα μόρια έχει ως αποτέλεσμα μια
αρωματικοί δακτύλιοι
πιο τακτοποιημένη δομή του νερού όπως η δομή του κλωβού
μπορούσε να σχηματίσουν δεσμούς υδρογόνου με το νερό. Ά
της Εικόνας
ρα είναι υδρόφοβα (βλ. Εικόνα Α11-5).
KQl
11-9. Αυτή
η δομή παρομοιάΖεΤQl με τον πάγο αν
είναι πιο ασταθής, λιγότερο οργανωμένη
λιγότερο εκτεταμένο ακόμα
KQl από
KQl μ'
ένα πολύ μικρό κρύσταλ/ο
ώνει την εντροπία του συστήματος (βλ. Κεφάλαιο
δεν έχουν πολικές ομάδες που θα
ένα δίκτυο
πάγου. Ο σχηματισμός οποιασδήποτε οργανωμένης δομής μει
VQl μη
KQl
3) KQl αυτό εί
Απάντηση
11-6
Στις πρωτείνες, οι α-έλικες χρησιμοποιούνται συχνά για να δια
περνούν τις λιπιδικές διπλοστιβάδες. Οι α-έλικες είναι κατάλ/η λες για το σκοπό αυτό επειδή εκθέτουν υδρόφοβες πλευρικές
ευνοϊκό ενεργειακά.
αλυσίδες των αμινοξέων στο υδρόφοβο εσωτερικό της λιπιδl Απάντηση Το
(8)
11-2
κής διπλοστιβάδας αλ/ά απομονώνουν τους πολικούς πεπτιδl
είνQl η σωστή αναλογία για τη συναρμολόγηση της λιπι
κούς δεσμούς του πολυπεπτιδικού σκελετού από την υδρόφοβη
δικής διπλοστιβάδας, επειδή επιδρούν περισσότερο δυνάμεις
φάση (βλ. Εικόνες
αποκλεισμού του νερού παρά ελκτικές δυνάμεις μεταξύ των λι
ρικοί ασυνήθιστοι τρόποι διαμόρφωσης μιας πολυπεmιδlκής α
πιδικών μορίων. Εάν τα λιπιδικά μόρια σχημάΤΙΖαν δεσμούς με
λυσίδας ώστε να επιτευχθεί το ίδιο αποτέλεσμα, όπως φαίνετQl
11-22 έως 11-25). Υπάρχουν
ωστόσο
KQl με
ταξύ τους, η διπλοστιβάδα θα ήταν λιγότερο ρευστή και πιθανόν
στη μικρή θηλειά του φωτoσυνθεnKoύ κέντρου αντίδρασης. Αυ
να γινόταν άκαμπτη εάν οι αλληλεπιδράσεις ήταν ισχυρές.
τό δείχνει εμφανώς την σημασία του προσδιορισμού της τρισ διάστατης δομής, η οποία σήμερα είναι Υνωστή μόνο για λίγες
Απάντηση
11-3
μεμβρανlκές πρωτεΛιες.
Η ρευστότητα της διπλοστιβάδας περιορίΖεΤQl αυστηρά στο ένα
11-7
επίπεδο: τα λιπιδικά μόρια μπορούν να διaxέοντQl πλευρικά αλ
Απάντηση
λά δεν μεταπηδούν εύκολα από τη μια μονοστιβάδα στην άλ/η.
Μερικά από τα μόρια των δύο διαφορετικών διαμεμβρανικών
Επομένως, ειδικές κατηγορίες λιπιδικών μορίων που εισχω
πρωτεϊνών είνQl προσκολ/ημένα στα ινίδια της σπεκτρίνης του
ρούν στη μια μονοστιβάδα παραμένουν σε αυτήν, εκτός εάν με
κυπαρικού φλοιού. Αυτά τα μόρια δεν είναι ελεύθερα να περι
ταφερθούν ενεργά από ένα ένζυμο
-
μια φi\ιπάση.
στρέφονται ή να διαχέονται στο επίπεδο της μεμβράνης. Υπάρ χει όμως περίσσεια των διαμεμβρανlκών πρωτεϊνών σε σχέση
Απάντηση
11-4
με τις διαθέσιμες θέσεις προσκόλ/ησης στον φλοιό και, έτσι,
Τόσο στην α-έλικα όσο και στο β-απύθμενο βαρέλι, οι πολικοί
μερικά από τα μόρια των διαμεμβρανlκών πρωτεϊνών μπορούν
πεπτιδικοί δεσμοί του πολυπεπτιδικού σκελετού μπορούν να
να περιστρέφοντQl
θωρακιστούν πλήρως από το υδρόφοβο περιβάλ/ον της λιπιδι
μεμβράνης. Πράγματι, μετρήσεις της κινητικότητας των πρωτεϊ
KQl να διαΧέονται
ελεύθερα στο επίπεδο της
κής διπλοστιβάδας μέσω των υδρόφοβων πλευρικών αλυσίδων
νών αποκαλύπτουν την ύπαρξη δύο διαφορετικών πληθυσμών
των αμινοξέων. Εσωτερικοί δεσμοί υδρογόνου μεταξύ των πε
για κάθε διαμεμβρανlκή πρωτείνη, που αντιστοιχούν στις προσ
πτιδικών δεσμών σταθεροποιούν την α έλικα
δεδεμένες και στις ελεύθερες πρωτείνες.
Απάντηση
KQl το β βαρέλι.
11-5
Η σουλφονική ομάδα στο
Απάντηση
SDS είναι
φορτισμένη
KQl επομένως
11-8
Οι διαφορετικοί τρόποι με τους οποίους οι μεμβρανlκές πρω-
Απαντήσεις
959
τείνες περιορίΖονται σε διαφορετικές μεμβρανικές περιοχές συ νοψίΖονται στην Εικόνα
Γ. Οι σχημαΤΙΖόμενες διπλοστιβάδες θα ήταν πολύ λιγότερο
Η κινητικότητα των μεμβρανι
ρευστές. Ενώ μια φυσιολογική λιπιδική διπλοστιβάδα έχει το
κών πρωτεϊνών μειώνεται δραστικά όταν προσδεθούν σε άλ/ες
ιξώδες του ελαιόλαδου, μια διπi\oστιβάδα που αποτελείται α
11-35.
πρωτείνες, όπως του κυτταροσκελετού ή του εξωκυττάριου
πό τα ίδια λιπίδια τα οποία όμως έχουν κορεσμένες υδρογο
στρώματος. Η κινητικότητα των πρωτεϊνών δεν επηρεάΖεται ό
νανθρακικές ουρές θα είχε τη συνοχή του χοιρινού λίπους.
ταν δεν προσδένονται σε άλ/ες πρωτείνες. Οι πρωτε'ίνες περιο
Δ. Οι σχημαΤΙΖόμενες διπλοστιβάδες θα ήταν πολύ περισσότερο
ρίΖΟνται σε μεμβρανικές περιοΧές μέσω φραγμών, όπως είναι
ρευστές. Επίσης, επειδή τα λιπίδια συσκευάΖΟνται μεταξύ
οι στεγανοί σύνδεσμοΙ. Η ρευστότητα της λιπιδικής διπλοστιβά
τους λιγότερο καλά, θα υπήρχαν πολ/ά κενά και η διπλοστι
δας δεν επηρεάΖεται σημαντικά από το αγκυροβόλημα των μεμ
βάδα θα ήταν πιο διαπερατή σε μικρά υδατοδιαλυτά μόρια.
βρανικών πρωτεϊνών. Η πληθώρα των λιπιδικών μορίων ρέει
Ε. Εάν υποθέσουμε ότι τα λιπιδικά μόρια είναι τελείως αναμε
γύρω από τις προσκολ/ημένες πρωτείνες όπως το νερό γύρω α
μειγμένα, η ρευστότητα της μεμβράνης δεν θα μεταβληθεί.
πό την προβλήτα ενός λιμανιού.
Σε τέτοιες διπλοστιβάδες όμως, τα κορεσμένα λιπιδικά μόρια
ΕΙκόνα
ρούν να συσκευάΖΟνται πιο σφικτά, και επομένως θα σχημά
έχουν την τάση να συναθροίζονται μεταξύ τους, επειδή μπο
11-9
ΤΙΖαν τμήματα πολύ μειωμένης ρευστότητας. Ετσι η διπλοστι
Ολες οι προτάσεις είναι σωστές. Α, Β, Γ, Δ. Η λιπιδική διπλοστιβάδα είναι ρευστή επειδή τα λιπι
δικά μόρια της διπλοστιβάδας υφίστανται αυτές τις κινήσεις. Ε. Τα γλυκολιπίδια περιορίΖΟνται κυρίως στη μονοστιβάδα των
βάδα δεν θα έχει ομοιόμορφες ιδιότητες σε όλη την επιφά νειά της. Επειδή στα λιπιδικά μόρια μια κορεσμένη και μια α
κόρεστη υδρογονανθρακική αλυσίδα συνδέονται στην ίδια
μεμβρανών που βρίσκεται από την άλ/η πλευρά του κυτταρο
υδρόφιλη κεφαλή, κανονικά τέτοιος διαχωρισμός δεν παρα
διαλύματος. Μερικά ειδικά γλυκολιπίδια, όπως η φωσφατι
τηρείται στις κυτταρικές μεμβράνες.
δυλο-ινοσιτόλη (αναφέρεται στο Κεφάλαιο
βρίσκονται
Ζ. Οι σχηματιΖόμενες διπλοστιβάδες θα είχαν σχεδόν τις ίδιες ι
ειδικά στη μονοστιβάδα που είναι σε επαφή με το κυτταρο
διότητες. Κάθε λιπιδικό μόριο θα διαπερνούσε τώρα ολόκλη
διάλυμα.
ρη τη μεμβράνη με μια από τις δυο κεφαλές να εκτίθεται σε
16),
Ζ. Η αναγωγή των διπλών δεσμών (με υδρογόνωση) επιτρέπει
κάθε επιφάνεια της μεμβράνης. Τέτοια λιπιδικά μόρια συνα
στα λιπιδικά μόρια να συσκευάΖΟνται πιο κοντά το ένα στο
ντώνται στις μεμβράνες θερμόφιλων βακτηρίων τα οποία
άλ/ο, με αποτέλεσμα την αύξηση του ιξώδους, δηλαδή, μετα
μπορούν να Ζήσουν σε θερμοκρασίες που προσεγγίΖουν την
τρέπει το λάδι σε μαργαρίνη.
θερμοκρασία βρασμού του νερού. Οι διπλοστιβάδες τους δεν
Η. Παραδείγματα αποτελούν τα ένΖυμα που συμμετέχουν στη σηματοδότηση (αναφέρονται στο Κεφάλαιο
16).
Θ. Οι πολυσακχαρίτες είναι τα κύρια συστατικά της βλέwας και
διαχωρίΖΟνται σε υψηλές θερμοκρασίες, όπως οι συνήθεις διπλοστιβάδες, επειδή οι δύο αρχικές μονοστιβάδες είναι τώ
ρα συνδεδεμένες ομοιοπολικά σε μια μονή μεμβράνη.
της γλοιώδους ουσίας. Ο γλυκοκάλυκας που αποτελείται α πό πολυσακχαρίτες και ολιγοσακχαρίτες είναι ένα πολύ ση
Απάvmση
μαντικό λιπαντικό' για παράδειγμα, για τα κύτταρα που επεν
Το σχήμα των λιπιδικών μορίων είναι σχεδόν κυλινδρικό. Αντί
11-12
δύουν εσωτερικά τα αιμοφόρα αγγεία ή μετακινούνται στο
θετα, τα μόρια των απορρυπαντικών έχουν σχήμα κώνου ή σφή
κυκλοφορικό σύστημα.
νας. Για παράδειγμα, ένα λιπιδικό μόριο μόνο με μια υδρογο νανθρακική ουρά θα ήταν απορρυπαντικό. Για να κάνετε ένα λι
Απάντηση
11-10
Σ' ένα διδιάστατο ρευστό τα μόρια είναι ελεύθερα να μετακι
πιδικό μόριο απορρυπαντικό θα πρέπει να κατασκευάσετε την υδρόφιλη κεφαλή μεγαλύτερη ή ν' απομακρύνετε μια από τις
νούνται μόνο σ' ένα επίπεδο. Αντίθετα σ' ένα κανονικό ρευστό
ουρές έτσι ώστε να μπορεί να σχηματιστεί ένα μικύλ/ιο. Επίσης
τα μόρια μπορούν να κινηθούν σε τρεις διαστάσεις.
τα μόρια των απορρυπαντικών έχουν πιο κοντές υδρογοναν
θρακικές ουρές από τα λιπίδια. Αυτό τα καθιστά ελαφρώς υδα Απάvmση
11-11
τοδιαλυτά και έτσι σε υδατικό διάλυμα τα μόρια των απορρυπα
Α. Θα προέκυπτε ένα απορρυπαντικό. Η διάμετρος της «κεφα
ντικών εξέρχονται και εισέρχονται συχνά στα μικύλ/ια. Εξαιτίας
λής» του λιπιδίου θα ήταν πολύ μεγαλύτερη από τη διάμετρο
της ιδιότητας αυτής, υπάρχουν πάντα μερικά μονομερή μόρια
της υδρογονανθρακικής ουράς με αποτέλεσμα το σχήμα του
απορρυπαντικών στο υδατικό διάλυμα και επομένως μπορούν
μορίου να είναι πιο πολύ κωνικό παρά κυλινδρικό και τα μό
να εισχωρούν σε λιπιδικές διπλοστιβάδες και να διαλυτοποιούν
ρια να συναθροίΖΟνται σε μικύλ/ια και όχι σε διπλοστιβάδες.
μεμβρανικές πρωτε'ίVες (βλ. Εικόνα
11-27).
Β. Οι σχημαΤΙΖόμενες διπλοστιβάδες θα ήταν πολύ πιο ρευστές.
Επίσης οι διπλοστιβάδες θα ήταν λιγότερο σταθερές επειδή
Απάvmση
οι μικρότερες υδρογονανθρακικές ουρές είναι λιγότερο υ
Όταν τα βακτήρια ευθυγραμμιστούν, υπάρχουν περίπου
δρόφοβες και έτσι οι δυνάμεις που προωθούν το σχηματισμό
μόρια λιπιδίων (το καθένα πλάτους
της διπλοστιβάδας μειώνονταΙ.
πίδιο στη μια άκρη του βακτηρίου και σ' ένα άλ/ο στην άλ/η ά-
960
Απαντήσεις
11-13 0.5 nm)
4000
ανάμεσα σ' ένα λι
κρη. Έτσι, αν ένα από αυτά τα μόρια αρχίσει να κινείται προς
την κατεύθυνση του άλ/ου ανταλ/άσσοντας θέση με γειτονικά
μόρια κάθε 10-7 δευτερόλεmα, θα χρειαστεί μόλις 4 χ 10-4 δευ τερόλεπτα (= 4000 Χ 10-7 δευτερόλεπτα) για να φτάσει στο άλ λο άκρο. Στην πραγματικότητα όμως, το μόριο του λιπιδίου θ' α κολουθήσει τυχαίες διαδρομές και όχι μια συγκεκριμένη κατεύ θυνση με αποτέλεσμα να χρειαστεί σαφώς περισσότερο χρόνο
(1
δευτερόλεπτο) για να φτάσει στο άλ/ο άκρο. Αν μια μπάλα
του πινγκ-πονγκ (διαμέτρου
4 cm)
Εικόνα Α11·17
αντάλλασσε θέση με την γει
τονική της κάθε 10-7 δευτερόλεπτα, η ταΧύτητά της θα ήταν
1,440,000 km/h (::::::4 cm/10-7δευτερόλεπτα). Αν μετακινείτο μόνο προς μια κατεύθυνση, θα έφτανε στην άλ/η άκρη σε 1.5 χ 10-15 δευτερόλεπτα, ενώ μια τυχαία διαδρομή θα διαρκούσε σα φώς περισσότερο (",,2 χιλιοστά του δευτερολέπτου).
Aπdvmσn
11-17
Η σύντηξη των μεμβρανών δεν μεταβάλλει τον προσανατολι σμό των μεμβρανικών πρωτεϊνών με τα συνδεδεμένα έγχρωμα σήματα: το τμήμα κάθε διαμεμβρανικής πρωτε'ίνης που εκτίθε
Aπόντησn
ται στο κυπαροδιάλυμα παραμένει πάντα εκτεθειμένο στο κυτ
11-14
Οι μεμβρανικές πρωτε'ίνες καθηλώνουν τη λιπιδική διπλοστιβά
ταροδιάλυμα και το τμήμα που εκτίθεται προς τα έξω παραμένει
δα στον κυπαροσκελετό ενισχύοντας έτσι την κυπαρική μεμβρά
πάντοτε εκτεθειμένο έξω (Εικόνα Αl1-7). Σε
νη με αποτέλεσμα ν' αντέχει στις δυνάμεις που ασκούνται σε αυ
της μεμβράνης μειώνεται και η ανάμιξη των μεμβρανικών πρω
O°C η ρευστότητα
τήν όταν το ερυθροκύπαρο διέρχεται μέσα από μικρά αιμοφόρα
τεϊνών είναι πολύ πιο αργή.
αΥΥεία. Οι μεμβρανικές πρωτεΊνες μεταφέρουν επίσης θρεmικά
Aπdvmσn
υλικά και ιόντα διαμέσου της κυπαρικής μεμβράνης.
11-18
Η έκθεση υδρόφοβων πλευρικών αλυσίδων των αμινοξέων στο
Aπdvmσn
νερό είναι μη ευνοϊκή ενεργειακά. Υπάρχουν δύο τρόποι με
11-15
Καθεμιά από τις υδρόφιί\ες όψεις των πέντε διαμεμβρανικών α
τους οποίους τέτοιες αλυσίδες αποκλείονται από το νερό ώστε
ελίκων που διαπερνούν τη μεμβράνη συνεισφέρει μια διαφορε
να επιτευΧθεί μια κατάσταση περισσότερο ευνοϊκή ενεργειακά.
τική υπομονάδα και πιστεύεται ότι οργανώνονται έτσι ώστε να
Πρώτον, μπορούν να σχηματίσουν διαμεμβρανικά τμήματα που
σχηματίσουν έναν πόρο διαμέσου της λιπιδικής διπλοστιβάδας.
διαπερνούν την λιπιδική διπλοστιβάδα. Αυτό προϋποθέτει ότι
Εσωτερικά, ο πόρος επικαλύπτεται από τις υδρόφιί\ες πλευρικές
θα υπάρχουν περίπου
αλυσίδες των αμινοξέων. Τα ιόντα μπορούν να περάσουν μέσω
μένες διαδοχικά σε μια πολυπεπτιδική αλυσίδα. Δεύτερον, οι υ
του υδρόφιλου πόρου. Οι υδρόφοβες πλευρικές αλυσίδες των
δρόφοβες πλευρικές αλυσίδες των αμινοξέων μπορεί ν' απομο
αμινοξέων αλληλεπιδρούν με τις υδρόφοβες λιπιδικές ουρές
νωθούν στο εσωτερικό της διπλωμένης πολυπεπτιδικής αλυσί
της διπλοστιβάδας.
δας. Αυτό είναι μια από τις σημαντικότερες δυνάμεις που «κλει
20 τέτοιες
πλευρικές αλυσίδες τοποθετη
δώνει» την πολυπεπτιδική αλυσίδα σε μια μοναδική τρισδιάστα Aπόντησn
τη δομή. Σε κάθε περίπτωση, οι υδρόφοβες δυνάμεις στη λιπι
11-16
Υπάρχουν περίπου
100 μόρια
λιπιδίων (φωσφολιπίδια και χο
ληστερόλη) για κάθε πρωτεϊνικό μόριο στην μεμβράνη
50,000)/(800+386)].
[= (2
χ
δική διπλοστιβάδα ή στο εσωτερικό μιας πρωτε'ίνης βασίΖΟνται στις ίδιες αρΧές.
Μια παρόμοια αναλογία παρατηρείται σε
Aπdvmσn
πολ/ές κυπαρικές μεμβράνες.
11-19
(Α) Τα ψάρια της Ανταρκτικής Ζουν σε θερμοκρασίες κάτω από το μηδέν και είναι ψυχρόαιμα. Για να διατηρούν τις μεμβράνες ΥΔΡΟΦΙΛΟΣ ΠΟΡΟΣ
τους ρευστές σε αυτές τις θερμοκρασίες έχουν υψηλό ποσοστό
υδρόφιλη όψη
ακόρεστων φωσφολιπιδίων. λιπιδική
διπλοστοιβάδα
Aπdvmσn
11-20
Η αλ/ηλουΧία Β είναι πιο πιθανό να σχηματίσει μια διαμεμβρα
νική έλικα. Αποτελείται κυρίως από υδρόφοβα αμινοξέα και συ νεπώς μπορεί να ενσωματωθεί σταθερά σε μια λιπιδική διπλο στιβάδα. Αντίθετα, η αλ/ηλουΧία Α περιέχει πολ/ά πολικά αμι υδρόφοβη όψη
Εικόνα Α11·15
νοξέα
(5, Τ, Ν, Q), ενώ η αλ/ηλουΧία C πολ/ά φορτισμένα αμι R, Η, Ε, D) των οποίων η παρουσία δεν ευνοείται στο
νοξέα (Κ,
υδρόφοβο εσωτερικό της λιπιδικής διπλοστιβάδας.
Απαντήσεις
961
Κεφάλαιο Aπ6vmσn
ρα κατειλημμένη, η πρωτείνη-φορέας μπορεί να μεταπέσει
12
στην αρχική διαμόρφωση μόνο αφού προηγουμένως «ξε
12-1
φορτωθεί» το διαλυτό μόριο Α.
Α. Η μεταφορά που διεκπεραιώνεται από μια πρωτεΤνη-φορέα
διαμεμβρανική πρωτεΊνη με τις ακόλουθες ιδιότητες δύο θέ
μπορεί να περιγραφεί με μια ανάλογη εξίσωση:
+ S::;;:::=:
(1) CP όπου
CPS ~ CP
σεις πρόσδεσης, μια για το διαλυτό μόριο Α και μια για το Β.
+ S*
S είναι το διαλυτό μόριο, S* είναι το διαλυτό
Η πρωτεΊνη μπορεί ν' αλ/άΖει διαμόρφωση και να ταλαντεύε
μόριο στην
άλ/η πλευρά της μεμβράνης (εξακολουθεί να είναι το ίδιο μό
ριο, τώρα όμως βρίσκεται σε διαφορετικό περιβάλ/ον) και
CP
είναι η πρωτεΤνη φορέας.
Β. Η εξίσωση αυτή είναι χρήσιμη επειδή περιγράφει ένα στάδιο πρόσδεσης που ακολουθείται από ένα στάδιο απελευθέρω σης. Η μαθηματική επεξεργασία αυτής της εξίσωσης είναι παρόμοια με αυτήν που περιγράφηκε για τα ένΖυμα (βλ Ει
κόνα
3-25). Έτοι,
οι πρωτεΤνες-φορείς χαρακτηρίΖΟνται από
μια τιμή ΚΜ που περιγράφει τη συΥΥένειά τους για το διαλυτό μόριο και μια τιμή ν max που περιγράφει τη μέγιστη ταχύτητα
μεταφοράς. Για μεγαλύτερη ακρίβεια θα μπορούσε να συ μπεριληφθεί στην εξίσωση και η αλ/αγή της διαμόρφωσης της πρωτεΤνης-φορέα:
(2α)
CP
ται μεταξύ δύο καταστάσεων: με τις δύο θέσεις εκτεθειμένες αποκλειστικά στη μια ή στην άλ/η πλευρά της μεμβράνης. Η
πρωτεΤνη μπορεί να μεταπίπτει από τη μια διαμόρφωση στην άλ/η μόνο όταν η μια θέση πρόσδεσης είναι κατειλημμένη,
αλ/ά δεν μπορεί ν' αλ/άξει διαμόρφωση αν και οι δύο θέσεις είναι κατειλημμένες ή κενές. Παρατηρείστε ότι αυτοί οι κανόνες παρέχουν ένα εναλ/α
κτικό πρότυπο από αυτό που φαίνεται στην Εικόνα
12-14.
Ε
τοι, υπάρχουν δύο δυνατοί τρόποι για τη σύΖευξη της μεταφο ράς δύο διαλυτών μορίων:
(1) να υπάρχουν
συνεργατικές θέ
σεις πρόσδεσης των διαλυτών μορίων που επιτρέπουν στην
αντλία να ταλαντεύεται τυχαία μεταξύ των δύο διαμορφώσεων όπως φαίνεται στην Εικόνα
12-14 ή (2) τα δύο διαλυτά
μόρια
να προσδένονται ανεξάρτητα και η αλ/αγή της διαμόρφωσης να εξαρτάται τώρα από την κατάληψη των θέσεων πρόσδε
+ S::;::::::::::= CPS::;::::::::::= CP*S* ~ Cp* + S* (2β)
Γ. Ενας αντιμεταφορέας μπορεί παρομοίως να σχεδιαστεί ως
CP::;::::::::::= Cp*
σης. Εφόσον η δομή των συΖευγμένων μεταφορέων δεν έχει
ακόμα προσδιοριστεί, δεν γνωρίΖουμε ποιόν από τους δύο μηχανισμούς χρησιμοποιούν αυτές οι αντλίες.
όπου
CP*
είναι η πρωτεΊνη-φορέας μετά την αλ/αγή της δια
μόρφωσης που εκθέτει το προσδεμένο διαλυτό μόριο στην
Aπ6vmσn
άλ/η πλευρά της μεμβράνης. Ο υπολογισμός αυτός χρειάΖε
Εάν η αντλία
ται μια δεύτερη εξίσωση (2β) που επιτρέπει στην πρωτεΤνη
αναστέλ/εται μερικώς από την ουαμπα'ί\ιη ή τη δακτυλίτιδα, δη
φορέα να επιστρέψει στην αρχική διαμόρφωση.
μιουργεί μια ηλεκτροχημική βαθμίδωση
Γ. Οι εξισώσεις δεν περιγράφουν τη συμπεριφορά των διαύλων
12-3 Na+-κ+ δεν λειτουργεί με πλήρη απόδοση επειδή Na+ που
είναι λιγότε
ρο απότομη από αυτήν των κυπάρων χωρίς φάρμακα. Συνε-
'C a 2 +Ν+λ - a ειτουργει'λ' ιγοτερο
,
λ ε-
επειδή τα διαλυτά μόρια που περνούν μέσω των διαύλων δεν
πως, ο αντιμεταφορεας
προσδένονται σε αυτούς με τον τρόπο που ένα υπόστρωμα
σματικά και το Ca + απομακρύνεται από το κύπαρο πιο αργά.
προσδένεται σ' ένα ένΖυμο.
Όταν αρχίσει ο επόμενος κύκλος της μυϊκής συστολής, θα υ
αποτε
2
πάρχουν ακόμα υψηλά επίπεδα Ca + στο κυπαροδιάλυμα. Η είσοδος του ίδιου αριθμού ιόντων Ca 2 + μέσα στο κύπαρο θ' 2
Aπ6vmσn
12-2
Α. Οι ιδιότητες προσδιορίΖουν έναν συμμεταφορέα
αυξήσει ακόμα περισσότερο την συγκέντρωση του, σε σύγκρι
Β. Δεν χρειάζεται να καθοριστούν επιπλέον ιδιότητες. Το σημα
ση με τα κύπαρα στα οποία δεν έχουν προστεθεί τα φάρμακα,
ντικό χαρακτηριστικό που εξασφαλίΖει τη σύΖευξη των δύο
και θα οδηγήσει σε ισχυρότερη και πιο παρατεταμένη συστολή.
διαλυτών μορίων είναι ότι η πρωτεΊνη δεν μπορεί ν' αλ/άξει
Επειδή η αντλία
διαμόρφωση εάν έχει προσδεθεί μόνο ένα από τα διαλυτά
σε όλα τα Ζωικά κύπαρα, όπως η διατήρηση της ωσμωτικής ι
μόρια. Το διαλυτό μόριο Β που προωθεί τη μεταφορά του Α
σορροπίας και η δημιουργία της βαθμίδωσης του
βρίσκεται σε περίσσεια στην πλευρά της μεμβράνης από την
σιμοποιείται για να τροφοδοτήσει πολ/ούς μεταφορείς, σε με
οποία αρχίζει η μεταφορά και τον περισσότερο χρόνο κατα
γαλύτερες συγκεντρώσεις τα φάρμακα είναι θανατηφόρα δη
λαμβάνει τις θέσεις πρόσδεσής του. Σε αυτή την κατάσταση η
λητήρια.
Na+-κ+
εκπληρώνει ουσιαστικές λειτουργίες
Na+ που χρη
πρωτεΊνη-φορέας δεν αλ/άΖει διαμόρφωση αλ/ά περιμένει έως ότου κάποια στιγμή προσδεθεί ένα διαλυτό μόριο. Με τις
Aπ6vmσn124
δύο θέσεις πρόσδεσης κατειλημμένες, η πρωτεΤνη αλ/άΖει
Καθεμιά από τις ορθογώνιες κορυφές αντιστοιχεί στο άνοιγμα
διαμόρφωση. Τώρα στην άλ/η πλευρά της μεμβράνης εκτί
ενός μόνο διαύλου που επιτρέπει τη διέλευση ενός μικρού ρεύ
θεται η θέση πρόσδεσης για το Β, που είναι κυρίως κενή, ε
ματος. Όπως φαίνεται από τη καταγραφή, οι δίαυλοι που βρί
πειδή υπάρχει πολύ λίγο Β σε αυτή την πλευρά της μεμβρά
σκονται στο τεμαΧίδιο της μεμβράνης ανοιγοκλείνουν συχνά.
νης. Παρότι η θέση πρόσδεσης για το Α είναι τώρα συχνότε-
Κάθε δίαυλος παραμένει ανοικτός για πολύ μικρό, κάπως μετα-
962
Απαντήσεις
βλητό, διάστημα που είναι κατά μέσο όρο περίπου
10 χιλιοστά
πό το άνΟΙΥμά τους, η ροή του κ+ μέσω ελεΥΧόμενων από την
του δευτερολέπτου. Όταν ανοίξουν, οι δίαυλοι επιτρέπουν τη
τάση διαύλων του κ+ και διαύλων διαφυΥής του κ+ μπορεί ν' α
διέλευση ενός μικρού ρεύματος μοναδικής έντασης (4 ρΑ, ένα picoampere = 10-12 Α). Σε κάποια χρονική στΙΥμή το ρεύμα δι
ποκαταστήσει το αρχικό δυναμικό ηρεμίας της μεμβράνης αμέ
σως μετά τη διέλευση του δυναμικού ενέΡΥειας
(95 λέξεις).
πλασιάΖεται, ένδειξη ότι στο ίδιο μεμβρανlκό τμήμα άνοιξαν ταυτόχρονα δύο δίαυλοι.
Απάντηση
12-7
Αν η ακετυλοχολίνη παραληφθεί ή προστεθεί στο διάλυμα έ
Εάν ο αριθμός των λειτουΡΥικών υποδοΧέων της ακετυλοχολί
ξω από την πιπέπα, θα μετρηθεί μόνο το ρεύμα ηρεμίας. Η ακε
νης μειωθεί με τα αντισώματα, ο νευροδιαβιβαστής (ακετυλοχο
τυλοχολίνη πρέπει να προσδεθεί στο εξωκυπάριο τμήμα των
λίνη) που απελευθερώνεται από ης νευρικές απολήξεις δεν θα
μορίων του υποδοΧέα της ακετυλοχολίνης Υια ν' ανοίξει ο δίαυ
μπορέσει να διεΥείρεl τη συστολή του μυός (ή θα δράσει αδύνα
λος στο μεμβρανlκό τεμαΧίδιο που φαίνεται στην Εικόνα
μα).
12-22.
Η κυπαροπλασματική πλευρά της μεμβράνης βρίσκεται στο διά
λυμα έξω από το μικροηλεκτρόδιο. Απάντηση
Απάντηση
12-8
Κατ' αναλΟΥία με την αντλία
12-5
Το δυναμικό ισορροπίας του κ+ είναι-90
να
Na+-κ+ που φαίνεται στην Εικό
12-12, το ΑΤΡ μπορεί να υδρολυθεί και να
δώσει μια φω
mV [= 62 mV 10glO (5 mM/140 mM)] και του Na+ είναι +72 mV [= 62 mV !Og10 (145 mM/10 mM)]. Οι δίαυλοι διαφυΥής του κ+ στην κυπαρική μεμ
μόριο έχει προσδεθεί στην εσωτερική πλευρά της μεμβράνης
βράνη ενός κυπάρου σε ηρεμία επιτρέπουν στο κ+ να φτάνει σε
τήσει μια αλλαΥή της διαμόρφωσης (στάδιο
ισορροπία, επομένως το δυναμικό της μεμβράνης του κυπάρου
διαλυτό μόριο θα δεσμευτεί και θα εκτεθεί στην «εξωτερική»
πλησιάΖει τα -90 mV. Οταν ανοίΥουν οι δίαυλοι του Na+, εισρέει Na+, οπότε το δυναμικό της μεμβράνης αντιστρέφει την πολικό τητά του και φτάνει σε μια τιμή κοντά στα +72 mV που είναι η τι μή ισορροπίας Υια το Na +. Μετά το κλείσιμο των διαύλων του Na +, οι δίαυλοι διαφυΥής του κ+ επιτρέπουν στο Κ+, που δεν
πλευρά. Το φωσφορικό μπορεί ν' απομακρυνθεί από την
σφορική ομάδα στην πρωτε'ί'νη-φορέα μόνο όταν το διαλυτό (στάδιο
1 --ο> 2).
Η προσάρτηση του φωσφορικού θα πυροδο
2
--ο>
3).
Έτσι, το
πρωτε'ί'νη μόνο όταν το διαλυτό μόριο διασταθεί από την πρω τε'ί'νη και τότε η κενή, μη φωσφορυλιωμένη, πρωτε'ί'νη μπορεί να μεταπέσει στην αρχική κατάσταση (στάδιο
3 --ο> 4)
(Εικόνα
Α12-8).
βρίσκεται πλέον σε ισορροπία, να εξέρχεται από το κύπαρο έως ότου αποκατασταθεί το δυναμικό της μεμβράνης στην τιμή ισορ
Απάντηση
ροπίας Υια το Κ+, περίπου
Α. Λάθος. Η κυπαρική μεμβράνη περιέχει πρωτε'ί'νες που εξα
-90 mV.
12-9
σφαλίΖουν επιλεκηκή διαπερατότητα σε πολ/ά φορησμένα Απάντηση
12-6
'Οταν το δυναμικό ηρεμίας της μεμβράνης ενός νευράξονα πέ σει κάτω από μια οριακή τιμή, οι ελεΥχόμενοι από την τάση δί
αυλοι του
Na+ που βρίσκονται σε άμεση Υειτνίαση ανοίΥουν και Na+. Αυτό εκπολώνει την μεμβράνη
μόρια. Αντίθετα, μια καθαρή λιπιδlκή διπλοστιβάδα χωρίς πρωτε'ίνες είναι αδιαπέραστη απ' όλα τα φορτισμένα μόρια.
Β. Λάθος. Οι πρωτεΙνες-δίαυλοι δεν προσδένουν τα διαλυτά μόρια που περνούν από αυτές. Η επιλεκηκότητα μιας πρω
επιτρέπουν την είσοδο του
τεΙνης-διαύλου εξαρτάται από το μέΥεθος του πόρου και από
περισσότερο αναΥκάΖοντας πιο απομακρυσμένους διαύλους
φορησμένες περιοχές στην είσοδο του πόρου που προσελ
του Na+ που ελέΥΧΟνται από την τάση ν' ανοίξουν. Έτσι δημι ουΡΥείται ένα κύμα εκπόλωσης το οποίο μεταδίδεται ΥρήΥορα
κύουν ή απωθούν ιόντα με το κατάλ/ηλο φορτίο.
Γ. Σωστή Υια τα Ζωικά κύπαρα. Τα κύπαρα περιέχουν ένα πυ
κατά μήκος του νευράξονα και ονομάΖεται δυναμικό ενέΡΥειας.
κνό διάλυμα πολ/ών μορίων που προκαλεί ωσμωηκή εισροή
Επειδή οι δίαυλοι του Na+ απενεΡΥοποιούνται ΥρήΥορα μετά α-
νερού. Αν τα ιόντα δεν αντλούνται διαρκώς προς τα έξω Υια
Εικόνα Α 12-8
Απαντήσεις
963
να διατηρηθεί η ωσμωτική ισορροπία, τα κύπαρα τελικά θα
μεταφοράς. Η παθητική μεταφορά ενός διαλυτού μορίου γί
διαρραγούν. Λάθος για τα φυτικά κύπαρα, τους σακχαρομύ
νεται «κατηφορικά» προς την κατεύθυνση της συγκέντρω
κητες και τα βακτήρια. Παρότι το νερό τείνει να εισρέει ί\όγω
σης ή της ηλεκτροχημικής βαθμίδωσης, ενώ η ενεργός με
της ώσμωσης, τα κύπαρα αυτά περιβάλ/ονται από ένα σκλη
ταφορά γίνεται «ανηφορικά» και επομένως χρειάΖεται μια
ρό κυπαρικό τοίχωμα που εμποδίΖει τη ρήξη της κυπαρικής
πηγή ενέργειας. Ενεργός μεταφορά μπορεί να πραγματο
μεμβράνης.
ποιηθεί από πρωτείνες-φορείς αλ/ά όΧΙ από πρωτεΤνες-δι
Δ. Λάθος. Οι πρωτείνες-φορείς είναι πιο αργές. Εχουν ιδιότη τες παρόμοιες με αυτές των ενΖύμων, δηλαδή προσδένουν
θεί και από τις δύο.
διαλυτά μόρια και χρειάΖεται ν' αλ/άξουν διαμόρφωση κατά
Γ. Και οι δύο όροι περιγράφουν μεταβολές της ενέργειας που
τη διάρκεια του κύκλου λειτουργίας τους. Αυτό περιορίΖει το
συμμετέχουν στην μετακίνηση ενός ιόντος από τη μια πλευρά
μέγιστο ρυθμό μεταφοράς περίπου σε
μόρια α
της μεμβράνης στην άλ/η. Το δυναμικό της μεμβράνης ανα
νά δευτερόλεπτο, ενώ οι πρωτεΙ\/ες-δίαυλοι μπορούν να δια
φέρεται στην μεταβολή της ηλεκτρικής ενέργειας. Η ηλεκτρο
κινήσουν έως
χημική βαθμίδωση είναι η συνισταμένη της μεταβολής της η
1,000,000 διαλυτά
1000 διαλυτά
μόρια ανά δευτερόλεmο.
Ε. Σωστή. Η βακτηριοροδοψίνη μερικών φωτοσυνθετικών βα
2.
αύλους, ενώ παθητική μεταφορά μπορεί να πραγματοποιη
λεκτρικής ενέργειας και της αλ/αγής της χημικής ενέργειας,
κτηρίων μετακινεί Η+, χρησιμοποιώντας ενέργεια που προ
που σχετίΖεται με τη μετακίνηση μεταξύ μιας περιοχής υψη
σλαμβάνει από το ορατό φως.
λής συγκέντρωσης και μιας περιοχής χαμηλής συγκέντρω
Σωστή. Τα περισσότερα Ζωικά κύπαρα περιέχουν στην κυπα
σης. Το δυναμικό της μεμβράνης ορίΖεται ανεξάρτητα από το
ρική μεμβράνη διαύλους διαφυγής Κ+ οι οποίοι συνήθως εί
ιόν ενώ η ηλεκτροχημική βαθμίδωση εξαρτάται από τη βαθμί
ναι ανοικτοί. Η συγκέντρωση του κ+ στο εσωτερικό του κυτ
δωση της συγκέντρωσης ενός συγκεκριμένου ιόντος και επο
τάρου παραμένει μεγαλύτερη απ' ότι στο εξωτερικό επειδή το
μένως είναι μια παράμετρος που εξαρτάται από το ιόν.
δυναμικό της μεμβράνης είναι αρνητικό και επομένως εμπο
Δ. Μια αντλία είναι μια εξειδικευμένη πρωτείνη-φορέας που
δίΖει τα θετικά φορτισμένα ιόντα του Κ+ να διαφύγουν. Επί
χρησιμοποιεί ενέργεια για να μεταφέρει ένα διαλυτό μόριο
σης το κ+ αντλείται διαρκώς μέσα στο κύπαρο από την αντλία
Na+-K+.
«ανηφορικά», αντίθετα από την ηλεκτροχημική βαθμίδωση.
Ε. Και τα δύο μεταδίδουν σήματα με ηλεκτρική δραστηριότητα.
Η. Λάθος. Ενας συμμεταφορέας προσδένει δυο διαφορετικά
Τα καλώδια είναι κατασκευασμένα από χαλκό, οι νευράξο
διαλυτά μόρια στην ίδια πλευρά της μεμβράνης. Αν αναπο
νες όμως όχΙ. Η ισχύς του σήματος που μεταδίδεται από έναν
δογυρίσει δεν θα μετατραπεί σε αντιμεταφορέα, ο οποίος ε
νευράξονα δεν μειώνεται επειδή αυτοενισχύεται, ενώ το σή
πίσης προσδένει δύο διαλυτά μόρια αλ/ά σε αντίθετες πλευ
μα σ' ένα καλώδιο μειώνεται με την απόσταση (λόγω διαρ
ρές της μεμβράνης.
ροής του ρεύματος στο μονωτικό περίβλημα).
Θ. Λάθος. Η κορυφή ενός δυναμικού ενέργειας αντιστοιχεί σε μια παροδική μετατόπιση του δυναμικού της μεμβράνης από
μια αρνητική σε μια θετική τιμή. Η εισροή του
2. Και τα δύο επηρεάΖουν
την ωσμωτική πίεση του κυπάρου. Έ
να ιόν είναι ένα διαλυτό μόριο που φέρει ένα φορτίο.
Na+ προκαλεί
το δυναμικό της μεμβράνης αρχικά να μετακινηθεί προς το
Aπdvmσn
μηδέν και κατόπιν ν' αναστραφεί, με αποτέλεσμα το εσωτε
Μια γέφυρα επιτρέπει τη διέλευση οχημάτων με μια σταθερή
ρικό του κυπάρου να φορτιστεί θετικά. Τελικά, το δυναμικό
συνεχή ροή. Η είσοδος μπορεί να σχεδιαστεί έτσι ώστε ν' απο
ηρεμίας αποκαθίσταται από την έξοδο του κ+ διαμέσου των
κλείονται, για παράδειγμα, τα υπερμεγέθη φορτηγά και μπορεί
ελεγΧόμενων από την τάση διαύλων κ+ και των διαύλων δια
να κλείνει περιοδικά με μια πύλη. Κατ' αντιστοιΧία, οι δίαυλοι ε
φυγής του Κ+.
12-12
πιτρέπουν τη διέλευση ιόντων διαμέσου της μεμβράνης με ε λεγΧόμενη ροή, επιβάλ/οντας περιορισμούς στο μέγεθος και το
Aπdvmσn
12-10
φορτίο του ιόντος.
Οι διαπερατότητες κατά σειρά είναι: Ν 2 (μικρό και μη πολικό)
>
Αντίθετα, ένα οχηματαγωγό πλοίο φορτώνει οΧήματα στη
νερό (μικρό και πολι
μια όΧθη και τα ξεφορτώνει στην άλλη όΧθη. Η διαδικασία αυ
κό) > γλυκόΖη (μεγάλη και πολική) > Ca 2+ (μικρό και φορτι
τή είναι πιο αργή. Κατά τη διάρκεια του φορτώματος, μερικά ο
αιθανόλη (μικρή και ελαφρώς πολική) σμένο)
>
> ΗΝΑ (πολύ μεγάλο και φορτισμένο).
χήματα μπορεί να επιλεγούν επειδή ταιριάΖουν καλύτερα στο κατάστρωμα του οχηματαγωγού. Κατ' αντιστοιχία, οι πρω
Aπdvmσn
12-11
τείνες-φορείς προσδένουν διαλυτά μόρια στη μια πλευρά της
Α. Και οι δύο διεκπεραιώνουν τη μετακίνηση δύο διαφορετικών
μεμβράνης και κατόπιν, αφού αλλάξουν διαμόρφωση, απε
διαλυτών μορίων διαμέσου της μεμβράνης. Οι συμμεταφο
λευθερώνουν τα διαλυτά μόρια στην άλ/η πλευρά. Η εξειδι
ρείς μετακινούν και τα δυο μόρια προς την ίδια κατεύθυνση
κευμένη πρόσδεση επιτρέπει την επιλογή των μορίων για με
ενώ οι αντιμεταφορείς μετακινούν τα διaί\υτά μόρια προς α
ταφορά. Όπως και στην περίπτωση της συΖευγμένης μεταφο
ντίθετες κατευθύνσεις.
ράς, μερικές φορές πρέπει να περιμένετε να γεμίσει το οχημα
Β. Και τα δυο πραγματοποιούνται από μεμβρανικές πρωτείνες
964
Απαντήσεις
ταγωγό για να φύγετε.
Aπ6vmσn
πτωση Α. Εντούτοις, τα μόρια της αντλίας που βρίσκονται στη
12-13
Η ακετυλοχολίνη μεταφέρεται σιο εσωτερικό των κυσηδίων μέ
μεμβράνη με τον αντίθετο προσανατολισμό θα είναι τελείως
σω ενός ανημεταφορέα Η+ -ακετυλοχολίνης της μεμβράνης ιου
ανενεργά (δηλαδή δεν θα μπορούσαν, όπως λανθασμένα
κυσηδίου. Η βαθμίδωση του Η+ που προωθεί την πρόσληψη,
θα υπέθετε κανείς, ν' αντλήσουν ιόντα προς την αντίθετη κα
δημιουργείται από μια αντλία Η+ της μεμβράνης του κυσηδίου
τεύθυνση), επειδή ΙΟ ΑΤΡ δεν έχει πρόσβαση για να φωσφο
που προωθείται από το AT~ (γι' αυτό το Μγο η αντίδραση εξαρ
ρυλιώσει ης κατάλ/ηλες θέσεις πάνω σε αυτά τα μόρια. Αυτές
τάται από 10 ΑΤΡ). Όταν αυξάνει το ρΗ του διαλύματοςπου πε
οι θέσεις κανονικά βρίσκονται εκτεθειμένες στο κυπαροδιά
ριβάλ/ειτα κυστίδια, αυξάνει και η βαθμίδωσητων Η+: σε υψη
λυμα. Το ΑΤΡ είναι πoi\ό φορησμένο και δεν μπορεί να δια
Μ ρΗ υπάρχουνλιγότερα ιόντα Η+ στο διάλυμα έξω από τα κυ
περάσει μεμβράνες χωρίς την βοήθεια εξειδικευμένων πρω
στίδια ενώ ο αριθμός των ιόντων στο εσωτερικό παραμένει ο ί
τεϊνών-φορέων.
Ε. Το ΑΤΡ θα υδρολυθεί και τα ιόντα
διος. Αυτό εξηγείτον αυξημένο ρυθμό της πρόσληψης.
Na + και Κ+ θ' αντληθούν
διαμέσου της μεμβράνης, όπως περιγράφηκε για την περί
Aπ6vmσn 12-14
mωση Α. Αμέσως όμως το Κ+ θα ξαναεισέλθει στο εσωτερικό
Η βαθμίδωση του δυναμικού (ηλεκτρική τάση) διαμέσου της
των κυστιδίων μέσω των διαύλων διαφυγής του Κ+. ΤΟ Κ+ θα
μεμβράνης είναι περίπου
150,000 V/cm.
Αυτό το εξαιρεηκά ι
μετακινηθεί «κατηφορικά» προς τη βαθμίδωση της συγκέ
σχυρό ηλεκτρικό πεδίο είναι πoi\ό κοντά στο όριο στο οποίο τα
ντρωσης ιου Κ+ που έχει δημιουργήσει η αντλία
Na+-Κ+.
Με
μονωηκά υλικά, όπως η λιπιδική διπλοσηβάδα, καταστρέφο
κάθε ιόν Κ+ που μετακινείται μέσα στο κυστίδιο διαμέσου ιου
νται και παύουν να λειτουργούν ως μονωτές. Το ισχυρό πεδίο
διαύλου διαφυγής, ένα θεηκό φορτίο μετακινείται διαμέσου
αντιπροσωπεύει το μεγάλο ποσό της ενέργειας που μπορεί ν' α
της μεμβράνης σχηματίΖοντας ένα μεμβρανικό δυναμικό το
ποθηκευτεί στις ηλεκτρικές βαθμιδώσεις διαμέσου της μεμβρά
οποίο είναι θεηκό στο εσωτερικό των κυστιδίων. Τελικά, το
νης και ης ακραίες ηλεκτρικές δυνάμεις που υφίστανται οι πρω
Κ+ θα σταματήσει να εισέρχεται μέσω των διαύλων διαφυγής
τε'ί'νες μιας μεμβράνης. Μια τάση
δημιουργούσε
όταν το δυναμικό της μεμβράνης εξισορροπήσει τη βαθμίδω
στιγμιαία μ' εκκένωση ένα ηλεκτρικό τόξο διαμέσου μιας σχι
ση της συγκέντρωσης. Το σενάριο που περιγράφεται εδώ εί
σμής εύρους
ναι ελαφρώς απλοποιημένο: στα κύπαρα των θηλαστικών η
1 cm (δηλαδή,
150,000 V θα
ο αέρας είναι ανεπαρκές μονωηκό
αντλία Na+-Κ+ μετακινεί τρία ιόντα νατρίου έξω από το κύπα
για πεδία τέτοιας ισχύος).
ρο για κάθε δύο ιόντα καλίου που αντλεί στο εσωτερικό, δη Aπ6vmσn
12-15
μιουργώντας έτσι ένα ηλεκτρικό ρεύμα διαμέσου της μεμ
Α. Τίποτα. ΧρειάΖεται ΑΤΡ για την προώθηση της αντλίας
Na +-
Κ+.
βράνης το οποίο συμμετέχει μερικώς στο δυναμικό ηρεμίας της μεμβράνης (το οποίο συνεπώς αντιστοιχεί μόνο κατά
Β. Το ΑΤΡ θα υδρολυθεί και το Na + θ' αντληθεί μέσα στα κυστί δια δημιουργώντας μια βαθμίδωση συγκεντρώσεων διαμέ
προσέγγιση στην κατάσταση ισορροπίας για τη μετακίνηση
του Κ+ μέσω των διαύλων διαφυγής του Κ+).
σου της μεμβράνης. Ταυτόχρονα, ΙΟ Κ+ θ' αντληθεί έξω από τα κυστίδια δημιουργώντας μια βαθμίδωση συγκεντρώσεων
Aπ6vmσn
Κ+ αντίθετης πολικότητας. Οταν αντληθούν όλα τα ιόντα Κ+
Οι ιοντικοί δίαυλοι μπορεί να ελέγχονται από προσδέτες, τάση
έξω από τα κυστίδια ή καταναλωθεί το ΑΤΡ, η αντλία θα στα
και μηχανική πίεση.
12-16
ματήσεΙ.
Γ. Η αντλία
Na+-Κ+ θα λεnουργήσει σύμφωνα με τα στάδια 1, 2 και 3 της Εικόνας 12-12. Ομως, επειδή όλα τα στάδια της
Aπ6vmσn
12-17
ρά, η αποφωσφορυλίωση και η αλ/αγή της διαμόρφωσης
Ο όγκος του κυπάρου είναι 10- Ι2 λίτρα (= 10-15 m3 ) και επομέ νως περιέχει 6 χ 104 ιόντα ασβεστίου (= 6 χ 1023 μόρια/γραμ μομόριο χ 100 χ 10-9 γραμμομόρια/λίτρο χ 10- Ι2 λίτρα). Επο
δεν μπορεί να συμβεί απουσία Κ+. Επομένως, η αντλία
μένως, για ν' αυξηθεί η ενδοκυπάρια συγκέντρωση του ασβε
αντίδρασης πρέπει να πραγματοποιηθούν με αυστηρή σει
Na +-
Κ+ θα παραμείνει σε φωσφορυλιωμένη κατάσταση περιμέ νοντας επ' αόριστον κάποιο ιόν καλίου.Ο αριθμός των ιό ντων νατρίου που θα μεταφερθεί θα είναι ελάχιστος επειδή καθένα από τα μόρια της αντλίας είχε λεnουργήσει μια μό νο φορά.
Παρόμοια πειράματα, στα οποία κάθε φορά παραλείπο νται συγκεκριμένα ιόντα και αναi\όoνται οι επιπτώσεις, έχουν
στίου πέντε φορές, στο κύπαρο πρέπει να εισέλθουν
2,940,000 επιπλέον ιόντα ασβεστίου (σημειώστε όη μια συγκέντρωση 5 μΜ αντιστοιχεί σε 3 χ 106 ιόντα στο εσωτερικό του κυπάρου, α πό τα οποία 60,000 βρίσκονται εκεί πριν ανοίξουν οι δίαυλοι). Επειδή καθένας από τους 1000 διαύλους επιτρέπει τη διέλευση
106 ιόντων ανά δευτερόλεπτο, κάθε δίαυλος πρέπει να μείνει α 3 χιλιοστά του δευτερολέπτου.
νοικτός μόνο για
χρησιμοποιηθεί για να προσδιοριστούν τα διαδοχικά στάδια
λεnουργίας της αντλίας Na+-Κ+.
Δ. Το ΑΤΡ θα υδρολυθεί και τα ιόντα
Aπ6vmσn
12-18
Na + και Κ+ θ' αντληθούν
Τα Ζωικά κύπαρα προωθούν ης περισσότερες διαδικασίες με
διαμέσου της μεμβράνης, όπως περιγράφηκε για την περί-
ταφοράς διαμέσου της κυπαρικής μεμβράνης με τη βοήθεια της
Απαντήσεις
965
ηλεκφοχημικής βαθμιδωσης του
Na +. Το ΑΤΡ
και δεν μπορεί να διαπεράσει την μεμβράνη χωρίς τη βοήθεια
ειναι απαραιτη
το για να προμηθεύει με ενέργεια την αντί\fα Na +-κ+ ώστε να
μιας πρωτείνης μεταφοράς.
Γ. Για την αιθανόλη υπολογίστηκε μια γραμμική σχέση μεταξύ
διατηρειται η βαθμίδωση του Na +.
της συγκέντρωσης και της ταχύτητας μεταφοράς. Έτσι, σε
Απάντηση
12-19
mM η ταχύτητα μεταφοράς είναι 10 μmοΙ/λεπτό mM η ταχύτητα είναι 2 μmοVλεmό.
Α. Όταν Η+ αντλειται διαμέσου της μεμβράνης προς το εσωτε
και σε
0.5 100
ρικό των ενδοσωματιων, προκύπτει μια ηλεκφοχημική βαθ
Για τη μεταφορά του οξικού, που πραγματοποιείται μέσω
μιδωση (αποτελειται από ένα ηλεκτρικό δυναμικό και τη βαθ
μιας πρωτείνης μεταφοράς, η σχέση ανάμεσα στη συγκέ
μιδωση της συγκέντρωσης) και το εσωτερικό του κυστιδίου
ντρωση,
φορτίΖεται θετικά. Τα δύο αυτά συστατικά προστίθενται στην
από την εξίσωση
ενέργεια που είναι αποθηκευμένη στη βαθμίδωση και κατα
ενΖυμικές αντιδράσεις:
ναλώνεται για να τη δημιουργήσει. Η ηλεκτροχημική βαθμί
S και την ταχύτητα μεταφοράς μπορεί να περιγραφεί Michaelis-Menten που αντιστοιχεί σε απλές
(1) ταχύτητα
δωση επομένως θα περιορίσει τη μεταφορά περισσότερων
μεταφοράς
(rate)
= Vmax χ S/[~ + S]
πρωτονίων. Όταν όμως η μεμβράνη περιέχει και διαύλους
θυμηθείτε από το Κεφάλαιο
CΙ-, το αρνητικά φορτισμένο CΙ- θα εισρεύσει στα ενδοσωμά
προσδιορίσουμε την
3 (βλ. Ερώτηση 3-20) ότι για να Vmax και την ~, χρησιμοποιούμε ένα τέ η εξίσωση Michaelis-Menten μετασχημα
τια και θα μειώσει το ηλεκτρικό δυναμικό. Συνεπώς, η άντλη
χνασμα με το οποίο
ση περισσότερων Η+ διαμέσου της μεμβράνης είναι λιγότε
τίΖεται ώστε να είναι δυνατή η αποτύπωση των δεδομένων σε
ρο δαπανηρή ενεργειακά και έτσι το εσωτερικό των ενδοσω
ευθεία γραμμή. Ένας απλός μετασχηματισμός είναι:
ματίων μπορεί να γίνει πιο όξινο.
(2) 1/rωώmta = (ΚJ\'max)(1/S)
Β. ΝαΙ. Όπως εξηγήθηκε στο (Α), μερική οξύνιση επιτυγχάνεται
Απάντηση
+ 1Nmax
(δηλαδή, μια εξίσωση του τύπου Υ = αχ
και απουσία των διαύλων του CΙ-.
12-20
Ο υπολογισμός του Ι/ταχύτητα και του
l/S
+b)
από τα συγκεκρι
Α. Βλ Εικόνα ΑΙ2-20 (Α).
μένα δεδομένα και η αποτύπωσήτους σ' ένα καινούργιο διά
Β. Η ταχύτητα μεταφοράς της ένωσης Α είναι ανάλογη της συ
γραμμα όπως φαίνεται στην Εικόνα Α12-19(Β) δίνει μια ευ θεία γραμμή. Η ΚΜ
γκέντρωσής της, ένδειξη ότι η ένωση Α μπορεί να διαχέεται
(= 1.0 mM)
και η
Vmax (= 200 μmοVmίη)
προσδιορίΖΟνται από το σημείο τομής της γραμμής με τον ά
διαμέσου των μεμβρανών χωρίς άλ/η βοήθεια. Η ένωση Α πιθανότατα είναι η αιθανόλη επειδή είναι ένα μικρό και σχε
ξονα των Υ (ΙΝ max) και από την κίΊιση της (K~ max)' ΓνωρίΖΟ
τικά μη πολικό μόριο που μπορεί να διαχέεται ελεύθερα δια
ντας τις τιμές της ΚΜ και της
Vmax μπορούμε να υπολογίσουμε 0.5 mM και 100 mM οξικού χρη σιμοποιώντας την εξίσωση (1). Τα αποτελέσματα είναι 67 μmοVλεmό και 198 μmοVλεmό, αντίστοιχα.
τις ταχύτητες μεταφοράς για
μέσου της λιπιδικής διπλοστιβάδας. Αντίθετα, η ταχύτητα μεταφοράς για την ένωση Β φτάνει σε κορεσμό σε υψηλές συγκεντρώσεις, ένδειξη ότι η ένωση Β μεταφέρεται μέσω μιας πρωτείνης μεταφοράς. Η ταχύτητα με
12-21
ταφοράς δεν μπορεί ν' αυξηθεί πέρα από μια μέγιστη ταχύτη
Απάντηση
τα με την οποία λειτουργεί αυτή η πρωτείνη. Η ένωση Β πιθα
Το μεμβρανικό δυναμικό και η υψηλή εξωκυπάρια συγκέντρω
νότατα είναι το οξικό ανιόν, επειδή είναι φορτισμένο μόριο
ση του
.06 .05 .04
Yv
Na + εξασφαλίΖουν μια μεγάλη ηλεκτροχημική προωθη-
s 0.1 0.3 1.0 3.0 10.0
Ys 10.0 3.3 1.0 0.33 0.1
V 18 46 100 150 182
.03
κλίση = ~ Vmax
.02 .01
~ σημείοτομής= 3
συγκέντρωσητου διαλυτού μορίου (Α)
(mM) (8)
Εικόνα Α 12-20
966
Ο
579
Απαντήσεις
YVmax
024
6
8
10
Ys
τική δύναμη κοι ένα μεγάλο απόθεμα ιόνΙων Na +: έτσι, μόλις α
από τη διάσπαση του δεσμού υψηλής ενέργειας δεν μπορεί να
νοίξουν οι υποδοχείς της ακετυλοχολίνης, ΟΙΟ κύπαρο θα ει
«δεσμευτεί» γιο την παραγωγή ΑΤΡ. Επομένως, οιην Εικόνα
13-6, η ανΙίδραση
σέλθουν κυρίως ιόνΙα Na +
που ανΙΙΟΙΟ1χεί ΟΙΟ βέλος με την αιχμή προς
τα κάτω θα εξακολουθούσε να διεξάγεται, χωρίς όμως να υπάρ
Aπdvmσn
χει η «τροχαλία» που διεκπεραιώνει τη σύΖευξη με τη σύνθεση
12-22
Η ποικιλότητα των διαύλων με «πύλες» νεuρoδΙOβιβαOIών είναι
του ΑΤΡ. Το αρσενικό δαπανά μεταβολική ενέργεια με την απο
καλό πράγμα για τη βιομηχανία επειδή αυξάνει την πιθανότητα
σύΖευξη πολ/ών ανΙιδράσεων μεταφοράς φωσφορικών ομά
νΌναπτυχθούν νέα φάρμακα, ειδικά γιο κάθε είδος διούλου.
δων με τον ίδιο μηχανισμό. Αυτό εξηγεί γιατί είνοι τόσο δηλητη
Καθένας από τους ποικίλους υποτύπους αυτών των διούλων εκ
ριώδες.
φράΖεται σε μια μικρή ομάδα νευρώνων. Έτσι, θεωρητικά, θα
μπορούσε να σχεδιαοιούν ή ν' ανακαλυφθούν φάρμακα ώοιε
AπόνIησn
να επηρεάΖουν ειδικούς υποτύπους σε μιο ορισμένα ομάδα
Η οξείδωση των λιπαρών οξέων διασπά την ανθρακική αλυσίδα
13-3
νευρώνων και, συνεπώς, ν' ασκούν επιλεκτική δράση σε ιδιοί
σε μονάδες από δύο άτομα άνθρακα (ακετυλομάδες) που συ
τερες περιοχές του εγκεφάλου.
vdmOVIOl οιο CoA. ΑνΙίθετα, κατά τη βιογέwησή τους τα λιπα
ρά οξέα σχηματίΖΟνΙαι από τη διασύνδεση ακετυλομάδων. Επο
μένως, τα περισσότερα λιπαρά οξέα έχουν άρτιο αριθμό ατό
Κεφάλαιο Aπdvmσn
μων άνθρακα.
13
Aπdvmσn
13-1
Γιο να συνεχιοιεί η γλυκόλυση, τα κύπαρα πρέπει ν' αναγεν
νούν το
13-4
Επειδή η λειτουργία του κύκλου του κιτρικού οξέος είνοι να
NAD+ από το NADH. Αυτό δεν θα μπορούσε να γίνει αν δεν υπήρχε η Ζύμωση. Χωρίς το αναγεwημένο NAD+, το βή μα 6 της γλυκόλυσης (δηλαδή η οξείδωση της 3-φωσφορικής
της οξείδωσης, η συνολική ανΙίδραση είνοι σκόπιμο να επιμερί
γλυκεριναλδευδης σε 1,3-διφωσφογλυκερινικό (Παράρτημα
χρησιμοποιούνΙαν μιο ένωση με δύο άτομα άνθρακα, οι χημι
13-1) δεν
θα μπορούσε να συμβεί και το προϊόν 3-φωσφορική
κές δυνατότητες θα ήταν πολύ πιο περιορισμένες κοι θα ήταν α
γλυκεριναλδευδη θα συσσωρευόταν. Το ίδιο θα συνέβαινε σε
δύνατο να σχηματιοιούν τόσα πολ/ά ενδιάμεσα. Γιο παράδειγ
κύπαρα ανίκανα να παράγουν πυροοιαφυλικό ή οιθανόλη: ού
μα, προσέξτε ότι πολ/ές από τις ανΙιδράσεις του κύκλου οξει
συλλέγει την ενέργειο που απελευθερώνεται κατά τη διάρκεια Ζετοι σε όσο περισσότερα βήματα γίνεται (βλ. Εικόνα
13-1). Αν
τε τα κύπαρα αυτά θα μπορούσαν ν' αναγεwήσουν το NAD+, ο
δώνουν άτομα άνθρακα που έχουν πραγματοποιήσει περισσό
πότε η γλυκόλυση θα αναοιελ/όταν οιο ίδιο βήμα.
τερους από έναν γύρους κοι επομένως δεν προέρχονΙΟΙ άμεσα
από την ακετυλομάδα που προοιέθηκε πρόσφατα.
Aπdvmσn
13-2
Το αρσενικό ενσωματώνετοι οιο προϊόν του βήματος
6 της γλυ
Aπdvmσn
13-5
κόλυσης οπότε σχηματίΖετοι 1-αρσενο-3-φωσφογλυκερινικό
Το οξυγόνο πράγματι επιοιρέφει οιην ατμόσφαιρα ως μέρος του
(Εικόνα Α13-2). Εξαιτίας της ευαισθησίας του σε υδρόλυση οιο
CO 2. Ωοιόσο, το CO2 που απελευθερώνεται από τα κύπαρα δεν
νερό, ο δεσμός υψηλής ενέργειος καταοιρέφετοι προτού το μό
περιέχει τα ίδιο άτομα οξυγόνου που καταναλώθηκαν οια πλαί
ριο που τον περιέχει φτάσει με διάχυση οιο επόμενο ένΖυμο. Το
σια της ανΙίδρασης της οξειδωτικής φωσφορυλίωσης κοι μετα
προϊόν της υδρόλυσης, δηλαδή το 3-φωσφογλυκερινικό, είναι
τράπηκαν σε νερό. Αυτό φαίνετοι άμεσα αν επωάσει κανείς Ζω
το ίδιο προϊόν που σχηματίζεται κανονικά οιο βήμα
7 με τη δρά
νΙανά κύπαρα σε μια ατμόσφαιρα με μοριοκό οξυγόνο που ανΙί
ση της κινάσης του φωσφογλυκερινικού. Επειδή όμως η υδρό
γιο το συνηθισμένο οιη φύση ισότοπο 160 περιέχει ένα διοφορε τικό ισότοπο, το 180. Σ' ένα τέτοιο πείραμα, διαπιοιώνουμεότι ό
λυση συμβαίνει μη ενΖυμικά, η ενέργεια που απελευθερώνεται
λο το
CO 2 που
απελευθερώνεται από τα κύπαρα περιέχει μόνο
16ο. Επομένως, τα άτομα του οξυγόνου των μορίων του CO2 που απελευθερώνΟνΙαι δεν προέρχονΙΟΙ άμεσα από την ατμόσφαιρα
Ο Ο
11
~
/
C Ι
O'lll//lAs-OΙ Ο
Η-γ-ΟΗ CΗρΘ
Ο
~
/
ΟΗ
C Ι
-τ-:ι---· Η-γ-ΟΗ ΗΡ
CΗρΘ
αλ/ά από οργανικά μόριο τα οποία πρώτα παρασκεύασε το κύτ ταρο γιο να τα οξειδώσει οιη συνέχειο ως καύσιμα.
Aπdvmσn
13-6
Τα άτομα του άνθρακα οια μόριο των σακχάρων ήδη είναι εν μέ
ρει οξειδωμένα, ανΙίθετα απ' ό,τι συμβαίνει με όλα (εκτός από το πρώτο οιη σειρά), τα άτομα του άνθρακα των αλυσίδων των λι παρών οξέων. Κατά συνέπεια, τα δύο από τα έξι άτομα άνθρακα
Εικόνα Α 13-2
της γλυκόΖης ΧάνΟνΙαι ως
CO 2 κατά τη μετατροπή του πυροοιαΑπαντήσεις
967
Ε. Σωστό. Αν συνέβαινε μόνο σε ένα βήμα, τότε όλη η ενέργεια
θ' απ ελευθερωνόταν διαμιάς και θα ήταν αδύνατο να αξιο ποιηθεί αποτελεσματικά για να προωθήσει άλλες αvιιδρά σεις, όπως τη σύνθεση του ΑΤΡ. Ζ. Λάθος. Μοριακό οξυγόνο
(02)
χρησιμοποιείται μόνο στο τε
λευταίο βήμα της αvιίδρασης.
Η. Σωστό. Τα φυτά μετατρέπουν το
CO 2 σε
σάκχαρα συλ/έγο
vιας την ενέργεια του φωτός κατά τη φωτοσύνθεση. Κατά τη διεργασία αυτή παράγεται
02
που απελευθερώνεται από τα
φυτικά κύτταρα.
Θ. Σωστό. Τα κύτταρα που αυξάνουν υπό αναερόβιες συνθήκες χρησιμοποιούν τη γλυκόλυση για να οξειδώνουν τα σάκχα
ρα σε πυροσταφυλικό. Τα Ζωικά κύτταρα μετατρέπουν το πυ ρο σταφυλικό σε γαλακτικό, χωρίς παράλ/ηλα να παράγεται
μεταβολίτες
CO 2. Ωστόσο,
Εικόνα Α13-7
οι Ζυμομύκητες μετατρέπουν το πυροσταφυλι
κό σε αιθανόλη και
CO2 . Αυτό το αέριο CO 2, που απελευθε
ρώνεται από τους Ζυμομύκητες κατά τη Ζύμωση, κάνει τη Ζύ
φυλικού σε ακεωλο-CοΑ και μόνο τα υπόλοιπα τέσσερα μπο
μη του ψωμιού να φουσκώνει και τη μπύρα και τη σαμπάνια
ρούν να εισέλθουν στον κύκλο του κιτρικού οξέος, όπου συλ/έ
ν' αφρίΖουν.
γεται το μεγαλύτερο μέρος της ενέργειας. Avιίθετα, όλα τα άτομα
13-9
του άνθρακα ενός λιπαρού οξέος μετατρέπονται σε ακεωλο
Απάντηση
CoA
Ο Δαρβίνος εξέπνευσε το άτομο του άνθρακα σ' ένα μόριο
CO 2.
Αφού παρέμεινε για κάποιο χρόνο στην ατμόσφαιρα, το μόριο
Aπdvmoη
13-7
του CO 2 εισήλθε σ' ένα φυτικό κύτταρο, όπου «δεσμεύτηκε» από
Ο κύκλος συνεχίΖεται επειδή τα ενδιάμεσα αναπληρώνονται
τη φωτοσύνθεση και μετατράπηκε σ' ένα τμήμα ενός μορίου
σύμφωνα με τις ανάγκες από αντιδράσεις που συγκλίνουν στον
σακχάρου. Αυτά τα πρώτα στάδια είναι βέβαιο ότι συνέβησαν
κύκλο του κιτρικού οξέος (αvιί ν' αποκλίνουν από αυτόν). Μια
κατ' αυτόν τον τρόπο. Ωστόσο, από το σημείο αυτό και μετά, το ά
από τις πιο σημαVΙΙKές αVΙιδράσεις αυτού του είδους είναι η με
τομο του άνθρακα θα μπορούσε να έχει ακολουθήσει πολ/ές
τατροπή του πυροσταφυλικού σε οξαλοξικό από το ένΖυμο καρ
διαφορετικές οδούς. Για παράδειγμα, το σάκχαρο θα μπορούσε
βοξυλάση του πυροσταφυλικού:
να έχει αποδομηθεί από το φυτικό κύτταρο σε πυροσταφυλικό ή
Πυροοιαφυλικό
+ CO2 + Η 2 Ο ~ οξαλοξικό + ΑΟΡ + Ρί + 2Η+
ακεωλο-CοΑ τα οποία θα μπορούσε να έχουν εισέλθει σε βιο
Η αvιίδραση αυτή είναι ένα από τα πολ/ά παραδείγματα της πε
συνθετικές αVΙιδράσεις για το σχηματισμό ενός αμινοξέος. Το α
ρίτεχνης εξισορρόπησης και συνεργασίας των μεταβολικών ο
μινοξύ θα μπορούσε να ενσωματωθεί σε μια φυτική πρωτε'ί\ιη, ό
δών ώστε όλοι οι μεταβολίτες που είναι απαραίτητοι για το κύττα
πως ένα ένΖυμο ή μιC;Ι πρωτε'ί\ιη που συγκροτεί το κυτταρικό τοί
ρο να διατηρηθούν στα κατάλ/ηλα επίπεδα (βί\. Εικόνα Α13-7).
χωμα. Εσείς, με τη σειρά σας, θα μπορούσατε να είχατε φάει τα
λαχταριστά φύλ/α του φυτού στη σαλάτα σας και κατόπιν να εί Απάντηση
13-8
χατε πέψει την πρωτεΊνη στο έVΙερό σας, οπότε θα παράγOVΙαν
Α Λάθος. Αν αυτό συνέβαινε, τότε η αvιίδραση θα ήταν άχρη
ξανά αμινοξέα. Με την κυκλοφορία του αίματος, το αμινοξύ πι
στη για το κύτταρο, καθώς δεν θα ήταν δυνατό να συλ/εγεί
θανόν προσλήφθηκε από ένα αναπωσσόμενο ερυθροκύτταρο
χημική ενέργεια σε χρήσιμη μορφή (π.χ. ΑΤΡ) για να χρησι
για να χρησιμοποιηθεί στη σύνθεση των πρωτεϊνών του, όπως η
μοποιηθεί σε μεταβολικές διεργασίες. (Τα κύτταρα όμως θα
αιμοσφαιρίνη. Βεβαίως, αν θέλουμε, μπορούμε να κάνουμε το
ήταν Ζεστά!).
σενάριο της τροφικής αλυσίδας πολύ πιο σύνθετο. Για παρά
Β. Λάθος. Καμιά διεργασία μετατροπής ενέργειας δεν έχει απο
τελεσματικότητα
100%. Θυμηθείτε
δειγμα, το φυτό ίσως έχει φαγωθεί από ένα Ζώο, που με τη σειρά
ότι η εVΙΡOπία του σύμπα
του έγινε τροφή για σας. Επιπλέον, επειδή ο Δαρβίνος πέθανε
vιoς πρέπει πάVΙα ν' αuξάνει: για τις περισσότερες αVΙιδρά
πριν από 100 και πλέον χρόνια, το άτομο του άνθρακα μπορεί να
σεις αυτό επιωγχάνεται με απελευθέρωση θερμότητας.
πραγματοποίησε μια τέτοια διαδρομή πολλές φορές. Ωστόσο,
Γ. Σωστό. Τα άτομα του άνθρακα της γλυκόΖης είναι πιο ανηγ
μένα από τ' αντίστοιχα άτομα του
CO 2 ,
που είναι πλήρως ο
ξειδωμένα.
σε κάθε γύρο θα έπρεπε ν' αρχίΖει ξανά ως πλήρως οξειδωμένο
αέριο
CO 2 και να εισέρχεται στον έμβιο κόσμο μετά την αναγω
γή του κατά τη διάρκεια της φωτοσύνθεσης.
Δ. Λάθος. Η αvιίδραση πράγματι παράγει κάποια ποσότητα νε
13-10
ρού, αλ/ά το νερό είναι τόσο άφθονο στη βιόσφαιρα ώστε η
Απάντηση
ποσότητα αυτή δεν είναι παρά μια «σταγόνα στον ωκεανό».
Οι Ζυμομύκητες αuξάνOυν πολύ καλύτερα υπό αερόβιες συνθή-
968
Απαντήσεις
κες. Υπό αναερόβιες συνθήκες δεν μπορούν να διεκπεραιώ
ΒΗΜΑ ΒΗΜΑ
σουν rnν οξειδωτική φωσφορυλίωση και επομένως υποχρεώ
1
Ι
νovιαι να παράγουν όλο το ΑΤΡ που xρειάzovιαι με τη γλυκό λυση, που είναι λιγότερο αποτελεσματική. Ενώ κατά τη γλυκό
ΒΗΜΑ
ΒΗΜΑ
3
4
2
λυση ένα μόριο γλυκόΖης αποδίδει καθαρά δύο μόρια ΑΤΡ, η ε πιπρόσθετη χρησιμοποίηση του κύκλου του κιτρικού οξέος και
της οξειδωτικής φωσφορυλίωσης εκτινάσσει την ενεργειακή α πόδοση περίπου στα
Aπ6vmσn
1
30 μόρια ΑΤΡ.
8.0
1
13-11
Η ποσόrnτα της ελεύθερης ενέργειας που αποθηκεύεται στον φωσφορικό δεσμό της φωσφορικής κρεατίνης είναι μεγαλύτε
14.2
ρη από την αvιίστoιxη ποσότητα των ανυδριτικών δεσμών του
0.6
ΑΤΡ. Επομένως, η υδρόλυση της φωσφορικής κρεατίνης μπο
----.1-
--r--t
L...-..-.I
ρεί να συΖευχθεί άμεσα με την παραγωγή του ΑΤΡ: φωσφορική κρεατίνη
+ ADP
-?
Η ΔGΟ για αυτή rnν αvιίδραση είναι -3
κρεατίνη
kcaVmole,
+ ΑΤΡ
5.3
κάτι που υπο
δηλώνει ότι προχωρεί γρήγορα προς τα δεξιά, όπως γράφεται πιο πάνω.
03 (Α)
Aπ6vmσn
13-12
Η ακραία εξελικτική διατήρηση της γλυκόλυσης είναι ένδειξη ό
(Β)
L f
Εικόνα Α13·14
τι όλα τα σημερινά κύπαρα πρoέρxovιαι από ένα κοινό αρχέγο
νο κύπαρο (βλ. Κεφάλαιο
1). Επομένως,
οι αvιιδράσεις της γλυ
Aπ6vιησn
13-15
κόλυσης πρέπει να εξελίχθηκαν μόνο μια φορά και κατόπιν να
Α. Το πυροσταφυλικό μετατρέπεται σε ακετuλο-CοΑ και το ση
μεταβιβάzovιαν κληρονομικά καθώς εξελίσσovιαν τα κύπαρα.
μασμένο άτομο 14C απελευθερώνεται ως αέριο 14C02 (βλ. Ει
Η μεταγενέστερη επινόηση rnς οξειδωτικής φωσφορυλίωσης ε
κόνα 13-8Β).
πέτρεψε στις επακόλουθες αvιιδράσεις να συλ/έγουν 15πί\άσια
Β. AKOλOυθώvιας το σημασμένο άτομο σε κάθε αvιίδpαση του
ποσότητα ενέργειας απ' ό,τι είναι δυνατό μόνο από τη γλυκόλυ
κύκλου που παρουσιάΖεται στο Παράρτημα
ση. Αυτή η αξιοσημείωτη αποτελεσματικότητα προσεΥΥίΖει το θε
νετε οτι το ρα δ ιενεργο
13-2, διαπιστώ, 14C τελ ικα' συγKεVΙpωνεται , στο ο ξ α λ ο-
ωρητικό όριο και επομένως πρακτικά καταργεί τη δυνατότητα για
ξικό. Ωστόσο, η ανάλυση επίσης αποκαλύπτει ότι δεν βρίσκε
περαιτέρω βελτιώσεις. Συνεπώς, η δημιουργία εναλ/ακτικών ο
ται πλέον στην κετονομάδα αλ/ά στη μεθυλενομάδα του οξα
δών δεν θα οδηγούσε σε κάποιο προφανές πλεονέκτημα το ο
λοξικού (Εικόνα Α13-15).
,
ποίο θα μπορούσε να έχει επιλεγεί κατά την εξέλιξη. Aπ6vιησn
Aπdvmσn
13-13
Όπως συΖητείται στο κείμενο, από κάθε μόριο γλυκόΖης που ο ξειδώνεται παράγovιαι
30 μόρια ΑΤΡ, σύμφωνα με την αvιί δραση C6H120 6 (γλυκόΖη) + 602 - ? 6C0 2 + 6Η 2 Ο + ενέργεια.
13-16
Παρουσία μοριακού οξυγόνου, η οξειδωτική φωσφορυί\ίωση μετατρέπει το μεγαλύτερο μέρος του NADH του κυπάρου σε NAD+. Επειδή η Ζύμωση απαιτείΝΑDΗ, αναστέλ/εται έvιoνα από την παρουσία του αερίου οξυγόνου.
Επομένως, για κάθε πέvιε μόρια ΑΤΡ που παράγovιαι κατανα
λώνεται ένα μόριο
02' Συνεπώς, το κύπαρο καταναλώνει 2 χ 108 μόρια 02/min, κάτι που αvιιστoιxεί σε κατανάλωση 3.3 χ 10-16 moles (= 2 χ 108/6 χ 1023) ή 7.4 χ 10-15 λίτρων (= 3.3 χ 10-16 χ 22.4) ανά λεπτό. Ο όγκος του κυπάρου είναι 10-15 m3 [= (10-5)3], δηλαδή 10-12 λίτρα. Άρα, το κύπαρο καταναλώνει σε αέριο 02 περίπου το 0.7% του όγκου του ανά λεπτό ή το σύ νολο του όγκου του μέσα σε 2 ώρες και 15 λεmά.
Aπdvmσn
COOΙ C=O 14 Ι
Ι COO-
Ι 2 COO-
CH 2
προσθήκη ραδιενεργού οξαλοξικού στο εκχύλισμα
13-14
Όλες οι αvιιδράσεις έχουν αρνητικές τιμές ΔG και επομένως είναι ενεργειακά ευνοϊκές (για τα ενεργειακά διαγράμματα βλ ΕικόναΑ13-14).
COOΙ 14C =O Ι
CH
ραδιενεργό οξαλοξικό που απομονώθηκε μετά από ένα γύρο του κύκλου του κιτρικού οξέος
Εικόνα Α13-15
Απαντήσεις
969
Κεφάλαιο
γερισίνη, τα κ+ θα προωθηθούν προς το στρώμα από το ηΛε
14
κτρικό δυναμικό της εσωτερικής μεμβράνης (αρνηηκό στο ε
Aπ6vmσn Η
14-1
DNP κάνει ης μεμβράνες
σωτερικό, θεηκό στο εξωτερικό). Η εισροή των θετικά φορη διαπερατές από τα πρωτόνια και έ
σμένων κ+ θα εξαΛείψει το ηΛεκτρικό δυναμικό της μεμβρά
τσι καταστρέφει, ή σε πολύ μικρές συγκεντρώσεις εΛαπώνει, τη
νης. Αντίθετα, η συνιστώσα της συγκέντρωσης της βαθμίδω
βαθμίδωση των πρωτονίων διαμέσου της εσωτερικής μιτοχον
σης των Η+ (δηΛαδή η διαφορά του ρΗ) δεν επηρεάΖεται α
δριακής μεμβράνης. Τα κύπαρα συνεχίζουν να οξειδώνουν τα
πό τη νιγερισίνη. Επομένως, Χάνεται μόνο ένα μέρος από
μόρια των τροφών και τροφοδοτούν με ηΛεκτρόνια την αλυσίδα
την προωθηηκή δύναμη που καθιστά ενεργειακά ευνοϊκή τη
μεταφοράς των ηΛεκτρονίων, αΛΛά τα ιόντα Η+ που αντΛούνται
ροή των ιόντων Η+ προς το στρώμα.
διαμέσου της μεμβράνης επιστρέφουν στα μιτοΧόνδρια σ' έναν μάταιο κύκλο. Η ενέργειά τους δεν μπορεί ν' αξιοποιηθεί για να
Aπdvmσn
προωθήσει τη σύνθεση του ΑΤΡ και έτσι απεΛευθερώνεται υπό
Α. Μια τέτοια τουρμπίνα που περιστρέφεται ανάποδα είναι μια
μορφή θερμότητας. Οι ασθενείς που Λαμβάνουν μικρές δόσεις
ηΛεκτροκίνητη αντΛία νερού, ανάΛογα απ' ό,η συμβαίνει στη
14-4
βάρος επειδή τ' αποθέματα Λίπους που διαθέτουν
συνθάση του ΑΤΡ όταν χρησιμοποιεί την ενέργεια της υδρό
χρησιμοποιούνται πιο γρήγορα για να τροφοδοτήσουν την αΛυ
Λυσης του ΑΤΡ για ν' αντΛήσει πρωτόνια αντίθετα από την η
σίδα μεταφοράς των ηΛεκτρονίων, καθώς η όΛη διεργασια α
Λεκτροχημική βαθμίδωσή τους διαμέσου της εσωτερικής μι
DNP Χάνουν
πΛώς «κατασπαταλά» ενέργεια.
τοχονδριακής μεμβράνης.
Ένας παρόμοιος μηχανισμός παραγωγής ενέργειας χρησι
Β. Η σύνθεση του ΑΤΡ θα σταματήσει όταν η ενέργεια που μπο
μοποιείται από έναν εξειδικευμένο ιστό καφέ Λιποκυπάρων,
ρεί ν' αντΛήσει από τη βαθμίδωση των πρωτονίων εξισωθεί
που αφθονεί στα νεογνά του ανθρώπου και στα Ζώα που πέ
με τη μεταβοΛή της εΛεύθερης ενέργειας που απαιτείται για
φτουν σε XEIμEplG νάρκη. Τα κύπαρα αυτά εΙναι γεμάτα μιτο
την παραγωγή του ΑΤΡ. Σε αυτό το σημείο ισορροπίας δεν
Χόνδρια που δαπανούν ένα μέρος από τη βαθμίδωση των πρω
θα συμβαίνει ούτε καθαρή σύνθεση ούτε καθαρή κατανάΛω
τονιων τους απΛώς για να θερμάνουν τον οργανισμό. Το χρώμα
ση ΑΤΡ.
τους εΙναι καφέ επειδή είναι γεμάτα μΙΤΟΧόνδρια, τα onOlG πε ριέχουν σε μεγάΛη συγκέντρωση διάφορες έγχρωμες πρω τείνες, όπως τα κυτοχρώματα.
Γ. Καθώς το κύπαρο καταναΛώνει το ΑΤΡ, ο Λόγος ΑΤΡ:
ADP
στο στρώμα πέφτει κάτω από το σημείο ισορροπίας που μόΛις περιγράψαμε και η συνθάση του ΑΤΡ χρησιμοποιεί την ενέρ γεια που έχει αποθηκευτεί στη βαθμίδωση των πρωτονίων για
Aπ6vmσn 14-2
να συνθέσει ΑΤΡ, έτσι ώστε ν' αποκαταστήσει τον αρχικό λό
Η εσωτερική μιτοχονδριακή μεμβράνη είναι η θέση όπου διεξά
γο
γεται η οξειδωηκή φωσφορυΛίωση και παράγει το μεγαλύτερο
πέσει κάτω από την ημή της στο σημείο ισορροπίας, η συνθά
ATP:ADP.
Αντίθετα, όταν η ηΛεκτροχημική βαθμίδωση
μέρος του ΑΤΡ του κυπάρου. Οι ακροΛοφιες ειναι τμήματα της
ση του ΑΤΡ χρησιμοποιεί ΑΤΡ στο στρώμα για ν' ανακτήσει
εσωτερικής μιτοχονδριακής μεμβράνης που πτυΧώνονται προς
τη βαθμίδωση.
τα μέσα. Επομένως, τα μιτοΧόνδρια που έχουν υψηλότερη πυ κνότητα ακροΛοφιών διαθέτουν και μεγαλύτερη επιφάνεια ε
Aπ6vmσn
σωτερικής μεμβράνης, επομένως και μεγαλύτερη ικανότητα να
Α. Ένα Ζεύγος ηΛεκτρονίων που περνά από το
14-5 NADH
στο
02
διενεργούν οξειδωηκή φωσφορυΛίωση. Ο καρδιακός μυς δα
διαμέσου των τριών αναπνευστικών συμπΛόκων προωθεί την
πανά μεγάΛα ποσά ενέργειας κατά τη διάρκεια των συνεΧών συ
άντΛηση
στοΛών του, ενώ τα κύπαρα του δέρματος έχουν μικρότερες ε
ενός μορίου ΑΤΡ απαιτούνται τέσσερα Η+: τρία για τη σύνθε
νεργειακές απαιτήσεις. Συνεπώς, η αυξημένη πυκνότητα ακρο
ση από το
Λοφιών των μυοκαρδιακών κυπάρων αυξάνει και την ικανότητά
ροδιάΛυμα. Επομένως, από κάθε μόριο ΝΑΟΗ συντίθενται
τους για παραγωγή ΑΤΡ. Αυτό είναι ένα αξιοσημείωτο παρά
δειγμα για το πώς τα κύπαρα προσαρμόΖουν τον αριθμό των ξε χωριστών συσταηκών τους σύμφωνα με ης ανάγκες τους.
10 Η+ διαμέσου της μεμβράνης. Για την παραγωγή ADP
και ένα για την εξαγωγή του ΑΤΡ στο κυπα
2.5 μόρια ΑΤΡ. Β. Από την οξείδωση ενός μορίου γΛυκόΖης στον κύκλο του κι τρικού οξέος παράγονται
20 μόρια
ΑΤΡ, ενώ από την πΛήρη
οξείδωση ενός μορίου γΛυκόΖης παράγονται
Aπ6vmσn
14-3
Α. Η
εξαΛείφει πΛήρως την ηΛεκτροχημική βαθμίδωση
DNP
Aπdvmσn
30 μόρια ΑΤΡ:
14-6
των πρωτονίων. Τα ιόντα Η+ που αντΛούνται στη μια πΛευρά
Μπορούν ν' αναφερθούν τέσσερις βασικοί ρόΛοι για ης πρω
της μεμβράνης ρέουν εΛεύθερα προς τα πίσω' έτσι, διαμέσου
τείνες που συμμετέχουν στην όΛη διεργασία. Πρώτον, το χημι
της μεμβράνης δεν μπορεί ν' αποθηκευθεί ενέργεια.
κό περιβάλ/ον που παρέχουν οι πΛευρικές αΛυσίδες των αμινο
Β. Μια ηΛεκτροχημική βαθμίδωση αποτεΛείται από δύο συσταη
ξέων μιας πρωτείνης καθορίΖει το οξειδοαναγωγικό δυναμικό
κά: μια βαθμίδωση συγκέντρωσης και ένα ηΛεκτρικό δυναμι
κάθε ιόντος
κό. Αν η μεμβράνη γίνει διαπερατή από τα ιόντα Κ+ με τη νι-
καθορισμένη σειρά από το ένα συσταηκό στο άλ/ο, ν' αποδί-
970
Απαντήσεις
Fe. Έτσι,
τα ηΛεκτρόνια μπορεί να περνούν με μια
μιτοχονδριακό στρώμα και το κυπαροδιάλυμα είναι σχετικά μι Πίνακας Α 14·5
κρή (μια μονάδα ρΗ). Αντίθετα, μεγάλο μέρος της ενέργειας
Διεργασία
Άμεσο προ'ίόν
Γλυκόλυση
2ΝΑΟΗ
ΤελικόΑΤΡ
3
(κυπαροδιάλυμα) 2ΑΤΡ
2 5
Οξείδωση του
2 ΝΑΟΗ
πυροσταφυλικού
στρώμα)
(μιτοχονδριακό
Οξείδωση του
6 ΝΑDΗ
ακετυλο-CοΑ
2 FADH 2
3
(δύο μόρια ανά
2GTP
2
που αποθηκεύεται στη μιτοχονδριακή ηλεκτροχημική βαθμίδω
ση των πρωτονίων οφείλεται στο ηλεκτρικό δυναμικό της μεμ βράνης (βλ Εικόνα
14-12).
Αντίθετα, οι xίΊωρoπiΊάστες διαθέτουν ένα ιδιαίτερο μικρότε ρο διαμέρισμα στο οποίο αντλούνται τα πρωτόνια. Έτσι, μπορεί να επιτευχθούν πολύ υψηλότερες διαφορές συγκέντρωσης (έ
(μιτοχονδριακό στρώμα) 15
μόριο γλυκόζης)
ως και
3 μονάδες ρΗ).
Μεγάλο μέρος της ενέργειας που απο
θηκεύεται στη βαθμίδωση των Η+ του θυλακοειδούς χώρου ο φείλεται στη διαφορά της συγκέντρωσης των Η+ ανάμεσα στον θυλακοειδή Χώρο και το στρώμα.
Συνολική απόδοση ανά μόριο γλυκόζης
30 Απάvmση
14-9
Όλες οι φράσεις είναι σωστές. Α. Πρόκειται για αναγκαία συνθήκη. Αν δεν ίσχυε, τα ηλεκτρό δουν την ενέργειά τους σε μικρά βήματα και να προσδένονται
νια δεν θα ήταν δυνατό ν' αφαιρεθούν από το νερό οπότε
πιο ισχυρά καθώς προχωρούν. Δεύτερον, οι πρωτείνες τοποθε
δεν θα συνέβαινε και η αντίδραση που διασπά τα μόρια του
τούν τα ιόντα
νερού (Η 2 Ο -72Η+
Fe έτσι ώστε τα ηλεκτρόνια
να μετακινούνται απο
τελεσματικά ανάμεσά τους. Τρίτον, εμποδίΖουν τα ηλεκτρόνια
+ 1;202 + 2e-).
Β. Αυτή η μεταφορά επιτρέπει στην ενέργεια του φωτονίου ν' α
να παραίΊείψουν ένα ενδιάμεσο βήμα' επομένως, όπως γνωρί
ξιοποιηθεί ως ενέργεια που μπορεί να χρησιμοποιηθεί για
Ζουμε και για άλ/α ένΖυμα (βλ. Κεφάλαιο
χημικές μετατροπές.
4),
διοχετεύουν τη
ροή των ηλεκτρονίων κατά μήκος μιας καθορισμένης πορείας.
Γ. Μπορεί να ισχυριστεί κανείς ότι αυτό ήταν ένα από τα πιο ση
Τέταρτον, οι πρωτείνες διασυνδέουν τη μετακίνηση των ηλε
μαντικά εμπόδια που έπρεπε να ξεπεραστούν κατά την εξέλι
κτρονίων κατά μήκος της ενεργειακής βαθμίδας τους με την ά
ξη της φωτοσύνθεσης: τα μερικώς ανηγμένα μόρια οξυγό
ντληση των πρωτονίων διαμέσου της μεμβράνης και έτσι αξιο
νου, όπως η ρίΖα του υπεροξειδίου
ποιούν την ενέργεια που απελευθερώνεται και την αποθηκεύ
στικά, αντιδρούν και καταστρέφουν σχεδόν όλα τα βιολογι
ουν σε μια βαθμίδωση πρωτονίων η οποία στη συνέχεια χρησι
κώς ενεργά μόρια. Επομένως, αυτά τα ενδιάμεσα πρέπει να
02-' είναι επικίνδυνα δρα
παραμείνουν ισχυρά προσδεδεμένα στα μέταλ/α του ενερ
μοποιείται για την παραγωγή ΑΤΡ.
γού κέντρου του ενΖύμου έως ότου και τα τέσσερα ηλεκτρό Απάvmση
14-7
νια αφαιρεθούν από τα δύο μόρια του νερού. Αυτό προϋπο
Δεν θα ήταν αποδοτικό να χρησιμοποιηθεί ο ίδιος φορέας σε
θέτει τη διαδοχική δέσμευση τεσσάρων φωτονίων από το ίδιο
δύο βήματα. Για παράδειγμα, αν η ουβικινόνη μπορούσε να με
αντιδραστικό κέντρο.
ταφέρει nίΊεκτρόνια στην οξειδάση του κυτοχρώματος με άμεσο
τρόπο, τότε όταν τα ηλεκτρόνια θα συλ/έγονταν από τη δεϋδρο
Απάvmση 14-10
γονάση του
το σύμπλοκο των
Α. Η φωτοσύνθεση παράγει σάκχαρα (κυρίως σουκρόΖη) που
διαφορά δυναμι
μεταφέρονται με τον οπό από τα φωτοσυνθετικά κύπαρα στα
NADH συχνά θα παρακαμπτόταν κυτοχρωμάτων b-c]. Με δεδομένη τη μεγάλη
κού ανάμεσα στην ουβικινόνη και την οξειδάση του κυτοχρώ
κύπαρα των ΡΙΖών. Εκεί, τα σάκχαρα οξειδώνονται με γλυκό
ματος, μια μεγάλη ποσότητα ενέργειας θ' απελευθερωνόταν υ
λυση στο κυπαρόπλασμα και με οξειδωτική φωσφορυλίωση
πό μορφή θερμότητας και έτσι θα σπαταλιόταν. Παρομοίως, η
στα μιτοΧόνδρια για να παραΧθεί ΑΤΡ. Επίσης, χρησιμοποι
άμεση μεταφορά των ηλεκτρονίων από τη δεϋδρογονάση του
c θα οδηγούσε επίσης του συμπλόκου των κυτοχρωμάτων b-c]. NADH
στο κυτόχρωμα
σε παράκαμψη
ούνται ως δομικοί λίθοι για πολ/ούς άλ/ους μεταβολίτες. Β. Τα μιτοΧόνδρια είναι απαραίτητα ακόμα και κατά τη διάρκεια
της ημέρας σε κύπαρα που περιέχουν xίΊωρoπiΊάστες για να
εφοδιάσουν το κύπαρο με ΑΤΡ που προέρχεται από οξειδω Απάvmση
14-8
τική φωσφορυλίωση. Η 3-φωσφορική γλυκεριναλδευδη που
Τα πρωτόνια που αντλούνται διαμέσου της εσωτερικής μιτοχον
παράγεται από τη φωτοσύνθεση στους xίΊωρoπiΊάστες μετα
δριακής μεμβράνης στον διαμεμβρανικό χώρο εξισορροπού
κινείται προς το κυπαροδιάλυμα και τελικά χρησιμοποιείται
νται στο κυπαροδιάλυμα, που λειτουργεί σαν τεράστια δεξαμε
ως πηγή ενέργειας για να προωθήσει την παραγωγή ΑΤΡ στα
νή Η+. Τόσο στο μιτοχονδριακό στρώμα όσο και στο κυπαρο
μιτοΧόνδρια.
διάλυμα διεξάγονται πολ/ές μεταβολικές αντιδράσεις που απαι
14-11
τούν περίπου ουδέτερο ρΗ. Επομένως, η διαφορά της συγκέ
Απάντηση
ντρωσης των Η+, ΔρΗ, που μπορεί να επιτευΧθεί ανάμεσα στο
Α. Σωστό. Το
NAD+ και οι κινόνες είναι παραδείγματα ενώσε-
Απαντήσεις
971
ων που δεν έχουν ιόντα μετάλ/ων αλ/ά μπορεί να συμμετά
νόμενης οξείδωσης ξεκινά από την οξειδάση του κυτοχρώματος
σχουν σε μεταφορές ηλεκτρονίων.
και προχωρεί προς τα πίσω διαμέσου των συστατικών της αλυσί
Β. Λάθος. Το δυναμικό οφείλεται σε πρωτόνια (Η+) που α
δας μεταφοράς των ηλεκτρονίων, καθώς κάθε συστατικό ανα
ντλούνται διαμέσου της μεμβράνης από το στρώμα προς τον
κτά τη δυνατότητα να μεταφέρει τα ηλεκτρόνιά του σε επόμενα
διαμεμβρανικό χώρο. Τα ηλεκτρόνια παραμένουν προσδε
συστατικά.
δεμένα σε φορείς ηλεκτρονίων στην εσωτερική μιτοχονδρια ΑπάνΤηση
κή μεμβράνη.
Γ. Σωστό. Και τα δύο συστατικά συνεισφέρουν στην προωθητι
14-14
Καθώς η οξειδωμένη ουβικινόνη ανάγεται, προσλαμβάνει από
κή δύναμη που καθιστά ενεργειακώς ευνοϊκή τη ροή των Η+
το νερό δύο ηλεκτρόνια αλ/ά και δύο πρωτόνια (Εικόνα
πίσω προς το στρώμα.
Κατά την οξείδωση, τα πρωτόνια αυτά απελευθερώνονται. Αν η
Δ. Σωστό. Και τα δύο μετακινούνται γρήγορα στο επίπεδο της
14-20).
αναγωγή συμβαίνει στη μια πλευρά της μεμβράνης και η οξεί
δωση στην άλ/η πλευρά, για κάθε ηλεκτρόνιο που μεταφέρεται,
μεμβράνης.
Ε. Λάθος. Τα φυτά χρειάΖΟνται μιτοΧόνδρια για την παραγωγή
ένα πρωτόνιο θ' αντλείται διαμέσου της μεμβράνης. Επομένως,
ΑΤΡ σε κύπαρα που δεν περιέχουν χί\ωροπί\άστες, όπως τα
η μεταφορά των ηλεκτρονίων από την ουβικινόνη συνεισφέρει
κύπαρα των ΡΙΖών. Επιπλέον, όμως, τα μιτοΧόνδρια παρά
άμεσα στη δημιουργία της βαθμίδωσης των Η+.
γουν το μεγαλύτερο μέρος του ΑΤΡ του κυπαροδιαλύματος
Aπdvrnon
σε όλα τα φυτικά κύπαρα.
14-15
Ζ. Σωστό. Απαραίτητη προϋπόθεση για τη φυσιολογική λειτουρ
Τα φωτοσυνθετικά βακτήρια και τα φυτικά κύπαρα χρησιμοποι
γία της χί\ωροφύλ/ης είναι η ικανότητά της ν' απορροφά το
ούν τα ηλεκτρόνια που προέρχονται από την αντίδραση 2Η 2 Ο
+ 4Η+ + 02 για την αναγωγή του NADP+ σε NADPH, το
φως. Η αίμη απλώς τυχαίνει να είναι μια έγχρωμη ένωση από
~ 4e-
την οποία παίρνει κόκκινο χρώμα το αίμα.
οποίο στη συνέχεια χρησιμοποιείται για την παραγωγή χρήσι
Η. Λάθος. Η χί\ωροφύλ/η απορροφά φως και μεταφέρει ενέρ
γεια υπό μορφή ενός ενεργοποιημένου ηλεκτρονίου, ενώ ο σίδηρος της αίμης είναι ένας απλός φορέας ηλεκτρονίων.
Θ. Λάθος. Το περισσότερο ξηρό βάρος ενός δέντρου προέρχε
ται από τον άνθρακα του
CO 2 που
έχει δεσμευθεί κατά τη
μων μεταβολιτών. Αν τα ηλεκτρόνια χρησιμοποιούνΤαν για την
παραγωγή Η 2 εκτός από
02' τότε τα
κύπαρα θα έχαναν όποιο
πλεονέκτημα αποκτούν διενεργώντας την αντίδραση, επειδή στην περίπτωση αυτή τα ηλεκτρόνια δεν θα μπορούσε να χρησι μοποιηθούν σε μεταβολικώς χρήσιμες αντιδράσεις.
διάρκεια της φωτοσύνθεσης.
Aπdvrnon
14-12
ΑπάνΤηση
14-16
Α. Η αλλαγή των διαλυμάτων δημιουργεί μια βαθμίδωση ρΗ
ΧρειάΖΟνται τρία πρωτόνια. Η ακριβής τιμή της ΔG για τη σύν
διαμέσου της θυλακοειδούς μεμβράνης. Η ροή των ιόντων
θεση του ΑΤΡ εξαρτάται από τις συγκεντρώσεις των ΑΤΡ,
Η+ κατά μήκος του ηλεκτροχημικού δυναμικού τους προω
ADP
υψηλότερος
θείτη συνθάση του ΑΤΡ, η οποία μετατρέπει τoADP σε ΑΤΡ.
είναι ο λόγος της συγκένΤρωσης του ΑΤΡ προς τη συγκέντρωση
Β. Το φως δεν είναι απαραίτητο επειδή η βαθμίδωση των Η+ ε
και Ρί (όπως περιγράφεται στο Κεφάλαιο του
ADP,
3). Όσο
τόσο περισσότερη ενέργεια χρειάΖεται για την παρα
γωγή επιπρόσθετου ΑΤΡ. Άρα, η χαμηλότερη τιμή των
caVmole ισχύει
11 k-
για συνθήκες στις οποίες τα κύπαρα έχουν κα
ταναλώσει πολύ ενέργεια και συνεπώς έχουν ελαπώσει τον κα νονικό λόγο
γκαθίσταται τεχνητά χωρίς να χρειάΖεται η προωθούμενη α
πό το φως αλυσίδα μεταφοράς ηλεκτρονίων.
Γ. Τίποτα. Η βαθμίδωση των Η+ θα ήταν σε λάθος κατεύθυνση, οπότε η σύνθεση του ΑΤΡ δεν θα λειτουργούσε. Δ. Το πείραμα προσέφερε ενδείξεις υπέρ του χημειοωσμωτικού
ATP:ADP.
μοντέλου δείχνοντας ότι μια βαθμίδωση Η+ από μόνη της ε Aπdvrnon Όταν το
παρκεί για να προωθήσει τη σύνθεση του ΑΤΡ.
14-13
02 δεν είναι
διαθέσιμο, όλα τα συστατικά της μιτοχον
14-17
δριακής αλυσίδας μεταφοράς ηλεκτρονίων θα συσσωρεύονται
ΑπάνΤηση
στην ανηγμένη μορφή τους. Αυτό συμβαίνει επειδή τα ηλεκτρό
Α. Όταν τα κυστίδια εκτίθενται στο φως, τα ιόντα Η+ (που προ
νια που προέρχονται από το
NADH εισέρχονται
δα αλ/ά δεν μπορεί να μεταφερθούν στο
μεν στην αλυσί
02' Επομένως,
η αλυ
σίδα μεταφοράς των ηλεκτρονίων σταματά με όλα τα συστατικά της σε ανηγμένη μορφή. Αν ξαφνικά ξαναπροστεθεί
02'
οι φο
ρείς των ηλεκτρονίων της οξειδάσης του κυτοχρώματος θα οξει δωθούv του
ξω διαμέσου της συνθάσης του ΑΤΡ, οδηγώντας σε παραγω γή ΑΤΡ στο διάλυμα που περιβάλ/ει τα κυστίδια σε απάντηση στο φως.
Β. Αν τα κυστίδια εμφανίσουν διαρροή, τότε δεν θα μπορούσε
02 η 0-
να δημιουργηθεί βαθμίδωση Η+ και έτσι η συνθάση του ΑΤΡ
γίνεται επειδή μετά την προσθήκη του
ξειδάση του κυτοχρώματος προσφέρει αμέσως τα ηλεκτρόνιά
972
κυστιδίων από τη βακτηριοροδοψίνη ρέουν ξανά προς τα έ
nplV από τους αντίστοιχους φορείς της δεϋδρογονάσης
NADH. Αυτό
της στο
έρχονται από το Η 2 Ο) τα οποία ανΤλούνΤαι στο εσωτερικό των
02 και άρα
οξειδώνεται. Στη συνέχεια, ένα κύμα αυξα-
Απαντήσεις
δεν θα λειτουργούσε. Γ. Η χρησιμοποίηση συστατικών από πολύ διαφορετικούς ορ-
γανισμούς είναι ένα ισχυρότατο πειραματικό εργαλείο. Επει
χημειωσμωτική σύΖευξη ανάμεσα στη μεταφορά των ηλεκτρο
δή οι δύο πρωτείνες προέρχονται από τόσο διαφορετικές πη
νίων και σε μια συνθάση του ΑΤΡ.
γές, είναι μάλ/ον απίθανο ν' αναmύξουν άμεση λειτουργική
14-20
αλ/ηΛεπίδραση. Επομένως, το πείραμα αυτό υποδηΛώνει ι
Απάντηση
σχυρά ότι η μεταφορά των ηΛεκτρονίων και η σύνθεση του
Οι φράσεις Α και Β είναι σωστές. Η φράση Γ είναι λάθος, επει
ΑΤΡ είναι ανεξάρτητα γεγονότα. Επομένως, η προσέγγιση
δή οι χημικές αντιδράσεις που διενεργούνται σε κάθε κύκλο εί
αυτή είναι έγκυρη.
ναι εντελώς διαφορετικές, έστω και αν το συνολικό αποτέλεσμα είναι το ίδιο με το αναμενόμενο για την απΛή αναστροφή.
Απάντηση
14-18
Το οξειδοαναγωγικό δυναμικό του
FADH 2 είναι
πολύ χαμηΛό
Απάντηση
14-21
για να επιτρέψει τη μεταφορά ηΛεκτρονίων στο σύμπΛοκο της
Αυτό το πείραμα υποστηρίζει ένα μοντέΛο για τη Λειτουργία της
δεϋδρογονάσης του
συνθάσης του ΑΤΡ που περιλαμβάνει δύο βήματα. Σύμφωνα με
NADH αλ/ά
αρκετά υψηλό για τη μεταφο
ρά ηλεκτρονίων στην ουβικινόνη (Εικόνα ηΛεκτρόνια από το
FADH 2 μπορεί να
Συνεπώς, τα
αυτό το μοντέΛο, η ροή των πρωτονίων διαμέσου της βάσης της
εισέλθουν στην αλυσίδα
συνθάσης προωθεί την περιστροφή της κεφαλής, η οποία με τη
14-21).
μεταφοράς των ηλεκτρονίων μόνο σε αυτό το βήμα (Εικόνα
σειρά της προκαλεί τη σύνθεση ΑΤΡ. Στο πείραμά τους, οι συγ
Α14-18). Επειδή παρακάμπτεται το σύμπλοκο της δεϋδρογονά
γραφείς επέτυχαν ν' αποσυνδέσουν αυτά τα δύο βήματα. Αν η
σης του
NADH, λιγότερα ιόντα Η+ αντΛούνται διαμέσου της
μηχανική περιστροφή της κεφαλής επαρκούσε για την παραγωγή
μεμβράνης και παράγεται Λιγότερο ΑΤΡ. Το παράδειγμα αυτό
του ΑΤΡ χωρίς να χρειάζεται βαθμίδωση πρωτονίων, τότε η συν
δείχνει την ευεΛιξία της αλυσίδας μεταφοράς των ηλεκτρονίων.
θάση του ΑΤΡ θα ήταν μια πρωτεϊνική μηχανή η οποία πράγματι
Η ικανότητα χρησιμοποίησης πολύ διαφορετικών πηγών ηΛε
θα Λειτουργούσε σαν «μοριακή τουρμπίνα". Το πείραμα αυτό θα
κτρονίων από το περιβάλ/ον για την τροφοδοσία της μεταφο
ήταν πολύ εντυπωσιακό επειδή θα κατεδείκνυε άμεσα τη σχέση
ράς των ηλεκτρονίων θεωρείται ότι υπήρξε ένα βασικό γνώρι
ανάμεσα στη μηχανική κίνηση και την ενΖυμική ενεργότητα. Α
σμα στην πρώιμη εξέλιξη.
σφαλώς θα έπρεπε να δημοσιευθεί και θα γινόταν «κλασικό".
Απάντηση
14-19
Απάντηση
14-22
Αν αυτά τα βακτήρια χρησιμοποιούσαν μια βαθμίδωση πρωτο
Μεταφορά ηΛεκτρονίων και αναγωγή του κυτοχρώματος
νίων για να συνθέσουν ΑΤΡ κατά τρόπο ανάλογο με άλ/α βα
βαίνει μόνο στο πείραμα (Ε). Στο μείγμα αυτό έχει ανασυσταθεί
κτήρια (δηλαδή με λιγότερα πρωτόνια στο εσωτερικό) θα έπρε
ένα τμήμα της αλυσίδας μεταφοράς ηΛεκτρονίων, οπότε τα ηλε
πε ν' αυξήσουν το ρΗ του κυτταροπλάσματός τους ακόμα πε
κτρόνια μπορούν να ρέουν στην ενεργειακώς ευνοϊκή αντίδρα
ρισσότερο από το ρΗ του περιβάλ/οντος (ρΗ
ση από την ανηγμένη ουβικινόνη στο σύμπλοκο των κυτοχρω
με κυτταροπλασματικό ρΗ μεγαλύτερο από
10). Τα
κύτταρα
10 δεν θα ήταν βιώ
μάτων
b-c)
και από εκεί στο κυτόχρωμα
c.
c συμ
Μολονότι ενεργεια
σιμα. Επομένως, τα βακτήρια αυτά πρέπει να χρησιμοποιούν
κώς ευνοϊκή, η μεταφορά που περιγράφεται στο (Α) δεν μπορεί
βαθμιδώσεις ιόντων διαφορετικών από το Η+ (π.χ. του Na+) στη
να συμβεί αυθόρμητα χωρίς το σύμπΛοκο των κυτοχρωμάτων
b-
c) για να καταλύσει την αντίδραση. Στα υπόλοιπα πειράματα δεν συμβαίνει ροή ηΛεκτρονίων, άσχετα από την παρουσία του συ
μπΛόκου των κυτοχρωμάτων
b-c):
στα πειράματα (Β) και
σο η ουβικινόνη όσο και το κυτόχρωμα
(2) τό
c είναι οξειδωμένα'
στα
πειράματα (Γ) και (Η) και τα δύο μόρια είναι ανηγμένα' τέλος, 2ΗΡ
στα πειράματα (Δ) και (Θ), η ροή των ηΛεκτρονίων δεν ευνοείται ενεργειακά επειδή το ανηγμένο κυτόχρωμα
c έχει χαμηλότερη
ελεύθερη ενέργεια από την οξειδωμένη ουβικινόνη. δεϋδΡΟΥονάση του ηλεκτρικού ενσω ματωμένη στη μεμβράνη που έχει προσδέσει FADH 2 φουμαρικό
ΤΟΥ
) ΚΙΤΡΙΚΟΥ/ " - ΟΞΕΟΣ
--
Εικόνα Α14-18
Κεφάλαιο Απάντηση
15
15-1
Παρότι το πυρηνικό περίβΛημα σχηματίΖει μια συνεχή μεμβρά
νη, έχει εξειδικευμένες περιοχές που περιέχουν ειδικές πρω τείνες και χαρακτηριστική εμφάνιση. Μια τέτοια εξειδικευμένη περιοχή είναι η εσωτερική πυρηνική μεμβράνη. Οι μεμβρανικές
πρωτείνες πράγματι διαχέονται ανάμεσα στην εσωτερική και την εξωτερική πυρηνική μεμβράνη στις επαφές που σχηματίΖο-
Απαντήσεις
973
νται γύρω από τους πυρηνικούς πόρους. Οι πρωτείνες όμως
τήσει η μετατόπιση μόλις φτάσει η αλληλουΧία λήξης της με
που διεκπεραιώνουν ιδιαίτερες λειτουργίες στην εσωτερική
ταφοράς. Η σύνθεση συνεχίζεται και δημιουργείται ένα πρω
μεμβράνη παραμένουν αγκυροβολημένες εκεί αλληλεπιδρώ
τεϊνικό τμήμα που παραμένει στο κυπαροδιάλυμα έως ότου
ντας με άλλα συστατικά, όπως τα χρωμοσώματα και ο πυρηνι
να φτάσει η αλληλουΧία έναρξης της μεταφοράς, οπότε αρΧί
κός υμένας, ένα πρωτεϊνικό δίκτυο που βρίσκεται κάτω από την
Ζει πάλι η μετατόπιση. Η κατάσταση τώρα μοιάΖει με αυτήν
εσωτερική πυρηνική μεμβράνη και συμβάλλει στη δομική ακε
που περιγράφηκε στο (Α) και το καρβοξυτελικό άκρο της
ραιότητα του πυρηνικού περιβλήματος.
πρωτεΤνης μετατοπίΖεται στον αυλό του ΕΔ. Επομένως, η
Aπdvmσn
Τόσο το αμινοτελικό όσο και το καρβοξυτελικό άκρο βρίσκο
πρωτε1\ιη που προκύπτει διαπερνά δύο φορές τη μεμβράνη.
15-2
Η έκφραση των γονιδίων στα ευκαρυωτικά κύπαρα είναι πιο
νται στον αυλό του ΕΔ και η θηλειά μεταξύ των δύο διαμεμ
πολύπλοκη από την έκφραση των γονιδίων στα προκαρυωτικά.
βρανικών περιοΧών είναι εκτεθειμένη στο κυπαροδιάλυμα
Ειδικότερα, τα προκαρυωτικά κύπαρα δεν έχουν ιντρόνια που διακόmουν τις κωδικές αλληλουΧίες Ιων γονιδίων τους και έτσι
(Εικόνα Α15-4Β). Γ. Η πρώτη αλληλουΧία του σήματος πρέπει ν' αποκοπεί και ν'
μεταφραστεί αμέσως μετά τη μεταγραφή
ακολουθεί μια εσωτερική αλληλουΧία λήξης της μεταφοράς
του χωρίς να χρειάΖεται επιπλέον επεξεργασία (αναφέρεται στο
και στη συνέχεια ν' ακολουθούν Ζεύγη αλληλουχιών έναρξης
ένα
mRNA μπορεί να
Κεφάλαιο
7).
Πράγματι, στα προκαρυωτικά κύπαρα τα ριβοσω
και λήξης της μεταφοράς (Εικόνα Α15-4Γ).
mRNA πριν τε
Αυτά τα παραδείγματα δείχνουν πώς μπορεί να δημιουργηθούν
λειώσει η μεταγραφή. Αυτό θα είχε καταστροφικές επιπτώσεις
περίπλοκες διαμορφώσεις με απλές παραλλαγές και συνδυα
στα ευκαρυωτικά κύπαρα επειδή τα περισσότερα μετάγραφα
σμούς των δύο βασικών μηχανισμών που παρουσιάΖΟνται στις
του
Εικόνες
μάτια αρχίΖουν τη μετάφραση των περισσότερων
RNA πρέπει
να συρραφούν πριν αρΧίσει η μετάφραση. Το
15-15 και 15-16.
πυρηνικό περίβλημα διαχωρίΖει τις διαδικασίες της μεταγραφής και της μετάφρασης και τοπικά και χρονικά. Ένα πρωτογενές
Aπdvmσn
μετάγραφο
Α. Τα καλύμματα της κλαθρίνης δεν συναρμολογούνται απου
RNA συγκρατείται
στον πυρήνα έως ότου υποστεί τη
15-5
mRNA, και τότε
σία ανταmινών, ΟΙ οποίες συνδέουν την κλαθρίνη με τη μεμ
μόνο μπορεί να εγκαταλείψει τον πυρήνα και να μεταφραστεί α
βράνη. Σε υψηλές συγκεντρώσεις κλαθρίνης και υπό κατάλ
πό τα ριβοσωμάτια.
ληλες ιοντικές συνθήκες, δημιουργούνται κλωβοί κλαθρίνης
σωστή επεξεργασία, ώστε να δημιουργηθεί ένα
οι οποίοι μοιάΖουν με άδεια κελύφη που δεν έχουν άλλες
Aπdvmσn
πρωτείνες και δεν περιέχουν μεμβράνη. Αυτό αποδεικνύει ό
15-3
Ένα μόριο
προσκολλάται στη μεμβράνη του ΕΔ μέσω
τι η πληροφορία για το σχηματισμό των κλωβών της κλαθρί
των ριβοσωματίων που το μεταφράΖουν. Επειδή αυτός ο πληθυ
νης περιέχεται στα ίδια τα μόρια της κλαθρίνης τα οποία συ-
mRNA
σμός των ριβοσωματίων δεν είναι στατικός, το
mRNA μετακινεί
ται συνεχώς σε σχέση με το ριβοσωμάτιο. Τα ριβοσωμάτια που
έχουν περατώσει τη μετάφραση διίστανται από το
mRNA και τη μεμβράνη
του ΕΔ, αλλά το
3'
άκρο του
mRNA παραμένει
(~
προ
σκολλημένο σε άλλα ριβοσωμάτια, που στρατολογήθηκαν τε
λευταία από τη δεξαμενή του κυπαροδιαλύματος, προσκολλή
θηκαν στο
mRNA και μεταφράΖουν ακόμα το mRNA. Σε κάθε μόριο mRNA που είναι συνδεδεμένο με τη μεμ βράνη προσκολλώνται περίπου 10-20 ριβοσωμάτια και ο αριθ μός αυτός εξαρτάται από το μήκος του mRNA. Aπdvmσn
5'
άκρο του
(Α)
15-4
Α. Η εσωτερική σηματοδοτική αλληλουΧία αγκυροβολεί στη μεμβράνη όπως φαίνεται στην Εικόνα
15-16.
Επειδή όμως
δεν υπάρχει αλληλουΧία λήξης της μεταφοράς, το καρβοξυ τελικό άκρο της πρωτεΤνης συνεχίΖει να μετατοπίΖεται προς τον αυλό του ΕΔ. Επομένως η πρωτε'ί\ιη που προκύπτει έχει την αμινοτελική περιοχή της στο κυπαροδιάλυμα (ακολου
θείται από ένα μονό διαμεμβρανικό τμήμα) και το καρβοξυ τελικό άκρο στον αυλό του ΕΔ (Εικόνα Α15-4Α). Β. Η αμινοτελική αλληλουΧία του σχήματος αρχίΖει τη μετατόπι ση της αμινοτελικής περιοχής της πρωτεΊνης έως ότου σταμα-
974
Απαντήσεις
Εικόνα Α15·4
•
~~=c=
νεπώς έχουν την ικανότητα να αυτοσυναρμολογούντα1.
ρος, ΤΟ σύμπλοκο τρανσφερίνης-σιδήρου μπορεί να προσδεθεί
Β. Απουσία κΛαθρίνης, οι ανταmίνες συνεχίζουν να προσδένο
mov υποδοΧέα
της τρανσφερίνης
mnv επιφάνεια
του κυπάρου
νται σε υποδοχείς της μεμβράνης, αλ/ά δεν μπορεί να δημι
και να ενδοκυπαρωθεί. Στις όξινες συνθήκες του ενδοσωματίου,
ουργηθεί κάλυμμα κΛαθρίνης και έτσι δεν σχηματίΖονται ε
η τρανσφερίνη απελευθερώνει τον σίδηρο αλ/ά παραμένει προσ
σοΧές καλυμμένες με κΛαθρίνη ή κυmίδια.
δεδεμένη με τον υποδοΧέα της τρανσφερίνης, ο οποίος επιmρέ
Γ. ΣχηματίΖΟνται εσοχές καλυμμένες με κΛαθρίνη που εγκολ
πώνονται πολύ βαθιά
mnv μεμβράνη
αλ/ά δεν μπορούν ν' α
ποκοπούν και να δημιουργήσουν κΛειmά κυmίδια.
φεl
mnv κυπαρική
επιφάνεια, όπου το ρΗ του περιβάλ/οντος
του αίματος είναι ουδέτερο. Το ουδέτερο ρΗ προκαλεί την απε λευθέρωση της τρανσφερίνης από τον υποδοΧέα
Δ. Τα προκαρυωτικά κύπαρα δεν πραγματοποιούν ενδοκυπά
mnv κυκλοφο
ρία, όπου μπορεί να προσδέσει ένα νέο ιόν σιδήρου και να επα
ρωση. Επομένως, ένα προκαρυωτικό κύπαρο δεν περιέχει
ναλάβει τον κύκλο. Ο σίδηρος που έχει απελευθερωθεί
υποδοχείς με κατάλ/ηλες αλυσίδες
δοσωμάτιο, όπως η
mo
κυπαροδιάλυμα για
την πρόσδεση της ανταπτίνης. Άρα, η κΛαθρίνη δεν μπορεί
να προσδεθεί, με αποτέλεσμα να μην είναι δυνατή η συναρ
ποτελεσματικά τον σίδηρο ακόμα και όταν ΟΙ συγκεντρώσεις του
μολόγηση καλυμμάτων κΛαθρίνης.
Απάντηση
mo εν LDL mnv Εικόνα 15-32, μετακινείται ma λυ σοσωμάτια και από εκεί μεταφέρεται mo κυffiαροδιάiΊυμα. Το σύmημα αυτό επιτρέπει ma κύπαρα να προσλαμβάνουν α
mo αίμα είναι πολύ χαμηλές. Ο σίδηρος που είναι προσδεδεμέ νος mnv τρανσφερίνη συγκεντρώνεται mnv κυπαρική επιφά
15-6
Η προκατασκευασμένη αλυσίδα σακχάρων εξασφαλίΖει καλύ
νεια μέσω της πρόσδεσης με τους υποδοχείς της τρανσφερίνης.
τερο ποιοτικό έλεγχο. Οι συναρμολογημένες αλυσίδες των ολl
Στη συνέχεια συγκεντρώνεται ακόμα περισσότερο
γοσακχαριτών ελέγχονται για την ορθότητα της δομής τους πριν
να κυmίδια κΛαθρίνης που συλ/έγουν τους υποδοχείς της τραν
προmεθούν
σφερίνης. Με τον τρόπο αυτό, η τρανσφερίνη ανακυκλώνεται
mnv
πρωτείνη. Εάν γίνει ένα λάθος κατά τη
διακή προσθήκη σακΧάρων
mnv
ma-
πρωτείνη, τότε ολόκληρη η
πρωτείνη πρέπει ν' απορριφθεί. Επειδή απαιτείται πολύ περισ
ma καλυμμέ
μεταξύ του αίματος και των ενδοσωματίων, απελευθερώνοντας τον σίδηρο που χρειάζονται τα κύπαρα για ν' αναmυχθούν.
σότερη ενέργεια για να κατασκευαmεί μια πρωτείνη απ' ό,τι μια
15-9
μικρή αλυσίδα σακΧάρων, π διαδικασία αυτή είναι πολύ πιο οι
Απάντηση
κονομική mρατηγlκή. Επίσης, μόλις προmεθεί ένας διακΛαδl
Α. Σωmή.
Ζόμενος ολιγοσακχαρίτης σε μια πρωτεΤνη, είναι ηολύ δυσκο
Β. Λάθος. Οι σηματοδοτικές αλ/ηλουΧίες που κατευθύνουν τις
λότερο για τα ένΖυμα να τροποηοιήσουν τις διακλαδώσεις του
πρωτεlνες προς το ΕΔ περιέχουν μια αλ/ηλουΧία οκτώ ή πε
από το να τροποποιήσουν έναν ελεύθερο διακλαδΙΖόμενο ολl
ρισσότερων υδρόφοβων αμινοξέων. Η αλ/ηλουΧία που φαί
γοσακχαρίτη. Η δυσκολία αυτή γίνεται φανερή καθώς η πρω
νεται εδώ περιέχει πολ/ές υδρόφιλες πλευρικές αλυσίδες α
τείνη μετακινείται προς την κυπαρική επιφάνεια; παρότι ΟΙ αλυ
μινοξέων, όπως των φορτισμένων αμινοξέων
σίδες των σαΚΧάρων τροποποιούνται συνεχώς από ένΖυμα
και
ma
διάφορα διαμερίσματα της εκκριτικής οδού, οι τροποποιήσεις αυτές συχνά είναι ατελείς. Έτσι προκύπτει η αξιοσημείωτη ετε ρογένεια των γλυκοπρωτεϊνών που εγκαταλείπουν το κύπαρο. Η ετερογένεια σε μεγάλο βαθμό οφείλεται
mnv
περιορισμένη
Lys και των μη KalSer.
φορτισμένων υδρόφιλων
His, Arg, Asp αμινοξέων Gln
Γ. Σωmή. Διαφορετικά δεν θα μπορούσε ν' αγκυροβολήσουν
mn
σωmή μεμβράνη mόΧΟ ή να τοποθετήσουν ένα σύμπλο
κο σύντηξης
mn θέση
αγκυροβόλησης.
πρόσβαση που έχουν τα ένΖυμα mους διακΛαδΙΖόμενους ολιγο
Δ. Σωmή.
σακχαρίτες, οι οποίοι είναι προσδεδεμένοι
Ε. Σωmή. Οι πρωτεΤνες των λυσοσωματίων επιλέγονται
mnv επιφάνεια
των
πρωτεϊνών. Η ετερογένεια επίσης εξηγεί γιατί είναι πολύ πιο δύ
κτυο
trans Golgi
mo
δί
και συσκευάΖΟνται σε κυmίδια μεταφοράς
σκολο να μελετηθούν οι γλυκοπρωτεΤνες από τις μη γλυΚΟΖυ
που τις παραδίδουν
λιωμένες πρωτείνες.
γούν, υποχρεωτικά θα εισέλθουν
mo
όψιμο ενδοσωμάτιο. Εάν δεν επιλε
ma
κυmίδια μεταφοράς
που μετακινούνταισυmηματικά προς την κυπαρική επιφά
Απάντηση
15-7
νεια.
Θα σχηματιmούν συσσωματώματα εκκριτικών πρωτεϊνών μέσα
mov αυλό του
ΕΔ, όπως ακριβώς και
mo δίκτυο trans Golgi.
Ε
Ζ. Λάθος. Τα λυσοσωμάτια επίσης αποδομούν εσωτερικά ορ γανίδια με αυτοφαγοκυπάρωση.
πειδή τα συσσωματώματα αφορούν ειδικά τις εκκριτικές πρω
Η. Λάθος. Τα μιτοΧόνδρια δεν συμμετέχουν mn μεταφορά με
τεΤνες, οι πρωτεΤνες του ΕΔ αποκλείονται από τα συσσωματώμα
κυmίδια. Οι γλυκοπρωτεΤνες που συναρμολογούνται απο
τα αυτά. Τελικά, τα συσσωματώματα θ' αποδομηθούν.
κΛειmlκά
mo
ΕΔ δεν μπορεί να μεταφερθούν
ma μιτοΧόν
δρια. Απάντηση
15-8
Η τρανσφερίνη χωρίς προσδεδεμένο σίδηρο δεν αλ/ηλεπιδρά
Απάντηση 15-10
με τον υποδοΧέα της και κυκλοφορεί
mo αίμα μέχρι να συναντή
Πρέπει επίσης να περιέχουν ένα σήμα πυρηνικού εντοπισμού.
σει και να προσδέσει ένα ιόν σιδήρου. Οταν προσδεθεί ο σίδη-
Οι πρωτείνες που περιέχουν πυρηνικό σήμα εξόδου πηγαινο-
Απαντήσεις
975
έρχονιοι ανάμεσα σων πυρήνα και το κυτταρόπλασμα. Ένα
μέσα
παράδειγμα είναι η πρωrεTνη ΑΙ η οποία προσδένει mRNA mov
διευκολύνουν τις αλληλεπιδράσεις της σωmής
πυρήνα και το οδηγεί διαμέσου των πυρηνικών πόρων. Οτ:αν εί
την
ναι
mo
mo
ΕΔ μαΖΙ με τις
SNARE σε
κυmίδια μειοφοράς και
v-SNARE με
t-SNARE mo δίκτυο cis Golgi.
κυτταροδιάλυμα, το σήμα του πυρηνικού εντοπισμού
διασφαλίΖει την επιmροφή της πρωτεΤνης ΑΙ έτσι μπορεί να συμμετέχει
mn μεταφορά
mov
και άλλων
πυρήνα και
Aπdvmon
mRNA.
Η συναmική μεταβίβαση συνεπάγεται απελευθέρωση νευροδια
15-13
βιβαmών με εξωκυπάρωση. Κατά τη διάρκεια αυτού του βήματος,
Aπdvmon
15-11
η μεμβράνη των συναmικών κυmιδίων συντήκειοι με την κυπα
Ο ιός της γρίπης εισέρχεται
ma κύπαρα με ενδοκυπάρωση και
ρική μεμβράνη των νευρικών απολήξεων. Για να καιοσκευα
απελευθερώνειοι ma ενδοσωμάτια, όπου το ρΗ είναι όξινο και
mούν νέα συναmικά κυmίδια, η μεμβράνη πρέπει να υποχωρή
αυτό ενεργοποιεί την πρωτεΤνη της σύντηξης του ιού. Στη συνέ
σει από την κυπαρική μεμβράνη με ενδοκυπάρωση. Το mάδιο
χεια, η πρωτεΤνη του ιού συντήκεται με τη μεμβράνη του ενδο
αυτό της ενδοκυπάρωσης παρεμποδίζεται όιον η δυναμίνη είναι
σωματίου απ ελευθερώνοντας το γονιδίωμα του ιού
κυπα
ελαπωματική, εφόσον η πρωτεΤνη είναι απαραίτητη για την απο
Η ΝΗ 3 είναι ένα μικρό μόριο που
κοπή των κυmιδίων ενδοκυπάρωσης που είναι καλυμμένα με
ροδιάλυμα (Εικόνα
AI5-1l).
mo
διεισδύει εύκολα mις μεμβράνες. Ετσι, μπορεί να εισέλθει σε ό
κλαθρίνη. Το κλειδί για την αποκρυπωγράφηση του ρόλου της
λα ΙΟ ενδοκυπάρια διαμερίσματα, και
δυναμίνης προέκυψε από ηλεκτρονιομικρογραφίες των συνάψε
mo ενδοσωμάτιο,
με διά
χυση. Όιον βρεθεί σ' ένα διαμέρισμα που έχει όξινο ρΗ, η ΝΗ 3
ων των μειολ/αγμένων εντόμων (Εικόνα ΑI5-Ι3). Παρατηρείmε
προσδένει Η+ και σχηματίΖει ΝΗ 4 +, που είναι ένα φορτισμένο
ότι υπάρχουν πολ/ές εγκολπώσεις της κυτταρικής μεμβράνης
ιόν και δεν μπορεί να διαπεράσει τη μεμβράνη με διάχυση. Ε
που μοιάΖουν με φιάλες, οι οποίες αντιπροσωπεύουν βαθιά ε
πομένως ΙΟ ιόντα ΝΗ 4 + συσσωρεύονται ma όξινα διαμερίσμα
γκολπωμένες εσοχές κλαθρίνης που δεν μπορούν να αποκο
ιο, αυξάνοντας το ρΗ τους. Παρότι το ρΗ του ενδοσωματίου εί
πούν. Τα ορατά περιλαίμια γύρω από τους λαιμούς αυτών των ε
ναι αυξημένο, η ενδοκυπάρωση των ιών συνεχίΖεται αλλά επει
γκολπώσεων αποτελούνται από τη μεταλ/αγμένη δυναμίνη.
δή η πρωτεΤνη σύντηξης των ιών δεν ενεργοποιείται, οι ιοί δεν
μπορούν να εισέλθουν
mo
κυτταροδιάλυμα. Θυμηθείτε αυτό
την επόμενη φορά που θα κολ/ήσετε συνάχι και μπορείτε να πάτε σε ένα mάβλο.
Aπdvmon
15-14
Οι δύο πρώτες προτάσεις είναι σωmές. Η τρίτη όχι. Έπρεπε να είναι: «Επειδή το περιεΧόμενο του αυλού του ΕΔ ή οποιουδήπο τε άλ/ου διαμερίσματος της εκκριτικής οδού ή της οδού ενδο
Aπdvmon
15-12
κυπάρωσης δεν αναμειγνύειοι ποτέ με το κυπαροδιάλυμα, οι
Α. Το πρόβλημα είναι ότι ΙΟ κυmίδιαπου έχουν δύο διαφορετι κά είδη
v-SNARE mις
μεμβράνες τους, μπορούν να προσα
ράξουν σε δύο διαφορετικές μεμβράνες.
πρωτεΤνες που συμμετέχουν σε αυτές τις οδούς δεν χρειάΖεται ποτέ πια να επανεισαΧθούν». 'Οτ:αν το πυρηνικό περίβλημα και
το ΕΔ θρυμματίζονται κατά τη μίτωση, σχηματίζουν κυmίδια και
Β. Η απάντηση σε αυτό το πρόβλημα δεν είναι ακόμα γνωmή,
αλλά μπορούμε να υποθέσουμε ότι ΙΟ κύπαρα διαθέτουν μη
το περιεΧόμενό τους διαχωρίΖειοι από το κυπαροδιάλυμα μέσω της μεμβράνης του κυmιδίου.
χανισμούς που ενεργοποιούν ή καιοmέλ/ουν την ικανότηιο
προσάραξης των
SNARE. Για παράδειγμα,
αυτό μπορεί να ε
πιτευχθεί με τη βοήθεια άλλων πρωτεϊνών που πακετάρονται
Aπdvmon
15-15
Η πρωτεΤνη θα μειοτοπιmεί μέσα
mo
ΕΔ. Η σηματοδοτική αλ
ληλουΧία για το ΕΔ αναγνωρίΖειοι αμέσως μετά την εμφάνισή της από το ριβοσωμάτιο. Το ριβοσωμάτιο θα προσκολ/ηθεί
mn
μεμβράνη του ΕΔ και η αυξανόμενη πολυπεπτιδική αλυσίδα θα μειοφερθεί διαμέσου του διαύλου μειοτόπισης του ΕΔ. Επομέ",-~~~~~~
...:K=υπαΡΙKή μεμβράνη
*ενδοκυπάρωση
Παραχωρήθηκε από
Εικόνα Α 15·11
976
Απαντήσεις
Εικόνα Α 15·13
Kazuo Ikeda
νως, η αλληλουΧία του πυρηνικού εντοπισμού δεν θα εκτεθεί
λογική πρωτεΙνη, ή
ποτέ στο κυπαροδιάλυμα. Δεν θα συναντήσει ποτέ πυρηνικούς
λουΧία σηματοδότησης του ΕΔ και εμποδίΖει την είσοδο της
υποδοχείς εισαγωγής και δεν θα εισέλθει στον πυρήνα.
πρωτε"ίνης στο ΕΔ.
(2)
η μετάλλαξη απενεργοποιεί την αλλη
(3) Μια
άλλη εξήγηση ίσως είναι ότι η μετάλ
λαξη άλλαξε την αλληλουΧία και δημιούργησε ένα σήμα συ
Απάντηση
15-16
γκράτησης στο ΕΔ, με αποτέλεσμα η μεταλλαγμένη πρωτεΙνη
Οι πρωτε"ίνες θα εισέλθουν στον πυρήνα αφού πρώτα συντε
να παραμένει στο ΕΔ. Θα μπορούσε κανείς να διακρίνει τους
θούν, διπλωθούν και συναρμολογηθούν σε σύμπλοκα εάν χρει
παραπάνω τρόπους χρησιμοποιώντας φθορίΖοντα αντισώματα
άΖεται. Αντίθετα, οι μη διπλωμένες πολυπεmιδικές αλυσίδες με
εναντίον της πρωτεΙνης και να παρακολουθήσει τη μεταφορά
τατοπίζονται μέσα στο ΕΔ ενόσω κατασκευάΖΟνται στα ριβοσω
της πρωτεΙνης στα κύπαρα (βλ Παράρτημα
(1)
4-6).
μάτια. Τα ριβοσωμάτια συναρμολογούνται μέσα στον πυρήνα, αλλά λειτουργούν στο κυπαροδιάλυμα και τα ενΖυμικά σύμπλο
Aπdvmon
κα που καταλύουν τη σύνθεση του
Κριτική: «Η
RNA και τη συρραφή
συναρ
15-19
Dr. Outonalimb προτείνει την μελέτη της βιοσύνθε φοργκετίνης (forgetin), μιας πρωτεΙνης σημαντικού εν
μολογόύνται στο κυπαροδιάλυμα όμως λειτουργούν στον πυρή
σης της
να. Έτσι, τα ριβοσωμάτια και τα ενΖυμικά σύμπλοκα πρέπει να
διαφέροντος. Όμως, η κύρια υπόθεση στην οποία στηρίΖεται
μεταφερθούν άθικτα διαμέσου των πυρηνικών πόρων.
(2) Οι πυ
αυτή η πρόταση χρειάΖεται επιπλέον επιβεβαίωση. Ειδικότερα,
ρηνικοί πόροι είναι πύλες που είναι πάντα ανοικτές για τα μικρά
είναι αμφισβητήσιμο αν η φOργKετΊVη είναι πράγματι μια εκκρι
μόρια. Αντίθετα, οι δίαυλοι μετατόπισης της μεμβράνης του ΕΔ
νόμενη πρωτεΙνη όπως προτείνεται. Οι σηματοδοτικές αλλη
κανονικά είναι κλειστοί και ανοίγουν μόνο όταν ένα ριβοσωμά
λουΧίες για το ΕΔ κανονικά βρίσκονται στο αμινοτελικό άκρο.
τιο προσκολληθεί στη μεμβράνη και η μεταΤΟΠΙΖόμενη πολυπε
Οι καρβοξυτελικές υδρόφοβες αλληλουΧίες θ' αποκαλυφθούν
πτιδική αλυσίδα κλείσει στεγανά τον δίαυλο προς το κυπαροδιά
από το ριβοσωμάτιο μόνο μετά το τέλος της σύνθεσης της πρω
λυμα. Είναι σημαντικό η μεμβράνη του ΕΔ να παραμένει αδια
τεΙνης και γι' αυτό δεν μπορεί ν' αναΥνωρισθούν από το ΣΑΣ
πέραστη από μικρά μόρια κατά τη διάρκεια της μετάθεσης, επει 2
κατά τη διάρκεια της μετάφρασης. Επομένως, η μετατόπιση της
δή το ΕΔ είναι η κύρια πηγή Ca + στο κύπαρο και η απελευθέρωση του
Ca2+
στο
'λ υμα κυπαρο δ ια
ρά (αναφέρεται στο Κεφάλαιο
' να ελ'εΥχεται αυστηπρεπει 16). (3) Τα σήματα τοποθέτησης
στον πυρήνα δεν αποκόπτονται μετά την είσοδο της πρωτεΊνης
φοργκετίνης μ' έναν μηχανισμό που εξαρτάται από το ΣΑΣ είναι
απίθανη και γι' αυτό μάλλον θα παραμείνει στο κυπαροδιάλυ μα. Η
Dr. Outonalimb πρέπει
να λάβει υπόψη τις παρατηρήσεις
αυτές εάν υποβάλλει μια αναθεωρημένη πρόταση».
στον πυρήνα, ενώ αντίθετα, τα σηματοδοτικά πεπτίδια του ΕΔ συνήθως κόβονται Τα σήματα του πυρηνικού εντοπισμού είναι
Aπdvmon
απαραίτητα για την επαναληπτική επανεισαγωγή πυρηνικών
Η συσκευή
πρωτεϊνών μετά την απελευθέρωσή τους στο κυπαροδιάλυμα
τα της μεμβράνης του ΕΔ. Οι περιοΧές αυτές του ΕΔ ίσως απο
κατά τη διάρκεια της μίτωσης όταν θρυμματίΖεται το πυρηνικό πε
κολλήθηκαν, δημιουργώντας ένα καινούργιο διαμέρισμα (Ει
ρίβλημα.
κόνα Α15-20), το οποίο συνεχίΖει να επικοινωνεί με το ΕΔ μέσω
15-20 Golgi πιθανόν
προέκυψε από εξειδικευμένα τμήμα
κυστιδίων μεταφοράς. Για να είναι όμως χρήσιμο το νέο διαμέ-
Aπdvmon
15-17
Η παροδική ανάμειξη του περιεχομένου του πυρήνα και του κυπαροδιαλύματος κατά τη διάρκεια της μίτωσης ενισΧύει την
άποψη ότι το εσωτερικό του πυρήνα και το κυπαροδιάλυμα έ χουν εξελικτική συγγένεια. Πράγματι, μπορεί κανείς να υποθέ σει ότι ο πυρήνας είναι ένα τμήμα του κυπαροδιαλύματος που περικυκλώθηκε από το πυρηνικό περίβλημα και η επικοινωνία μπορεί να γίνει μόνο μέσω των πυρηνικών πόρων.
Aπdvmon
15-18
Η ισχύουσα εξήγηση είναι ότι η αλλαγή ενός μόνο αμινοξέος
προκαλεί ελαφρώς λανθασμένο δίπλωμα της πρωτεΊνης. Έτσι, παρότι η πρωτεΙνη εξακολουθεί να δρα ως αναστολέας των πρωτεασών, οι πρωτεωες συνοδοί του ΕΔ παρεμποδίΖουν την έξοδό της από αυτό το οργανίδιο. Επομένως, η πρωτεΙνη συσ
σωρεύεται στον αυλό του ΕΔ και τελικά αποδομείται. Εναλλα κτικές ερμηνείες μπορεί να είναι:
(1)
η μετάλλαξη επηρεάΖει τη
σταθερότητα της πρωτε"ίνης μέσα στην κυκλοφορία του αίματος
και έτσι αποδομείται πολύ γρηγορότερα στο αίμα από τη φυσιο-
Εικόνα Α 15-20
Απαντήσεις
977
ρισμα
Golgi, πρέπει
να εξεΛίχθηκαν παράλ/ηΛα και τα κυστίδια
Απάντηση
Λα ως αΥΥελιοφόρος από ένα κύπαρο σ' ένα άλ/ο μέσω του ε ξωκυπάριου υγρού.
μεταφοράς.
15-21
Απάvmση
16-4
Αυτή είναι μια ερώτηση του τύπου: η κότα γέwησε τ' αυγό ή το
Στην περίπτωση του υποδοΧέα των στεροειδών, ένα σύμπΛοκο
αυγό την κότα; Πράγματι, τα σημερινά κύπαρα δεν αντιμετωπί
ορμόνης και υποδοΧέα
Ζουν ποτέ αυτή την κατάσταση, μοΛονότι μάλ/ον αποτέΛεσε ένα
γοποιήσει τη μεταγραφή. Επομένως, ανάμεσα στην πρόσδεση
σημαντικό πρόβΛημα κατά τη δημιουργία των πρώτων κυπά
του συνδέτη και την ενεργοποίηση της μεταγραφής δεν συμβαί
ρων. Καινούργιες κυπαρικές μεμβράνες δημιουργούνται με ε
νει καμία ενίσχυση. Η ενίσχυση συμβαίνει αργότερα, επειδή α
1: 1 προσδένεται στο DΝΑ για να ενερ
πέκταση των μεμβρανών που υπάρχουν και το ΕΔ δεν κατα
πό τη μεταγραφή ενός γονιδίου παράγovται ποΛλά μόρια
σκευάΖεται ποτέ εκ νέου
mRNA και
(de novo).
Θα υπάρχει πάντοτε κάποιο
από τη μετάφραση κάθε μορίου παράγονται πολ/ά
κομμάτι του ΕΔ με διαύΛους μετατόπισης για να ενσωματωθούν
μόρια πρωτε'ί\ιης (βλ Κεφάλαιο
νέοι δίαυΛοι μετατόπισης. Επομένως η κΛηρονομικότητα δεν
Χέων που συνδέονται με διαύλους ιόντων, κατά το χρονικό διά
7).
Στην περίπτωση των υποδο
περιορίΖεται στη μεταβίβαση του γονιδιώματος: τα οργανίδια ε
στημα που θα παραμείνει ανοιΧΤός, ένας μόνο δίαυΛος επιτρέ
νός κυπάρου πρέπει επίσης να περάσουν από γενιά σε γενιά.
πει τη δίοδο σε χιΛιάδες ιόντα: αυτό λειτουργεί ως το βήμα ενί
Πράγματι, η προέλευση των διαύΛων μετατόπισης του ΕΔ μπο
σχυσης στο συγκεκριμένο σηματοδοτικό σύστημα.
ρεί να ιχνηΛατηθεί σε δομικώς παρόμοιους διαύΛους μετατόπι σης της κυπαρικής μεμβράνης των προκαρυωτικών κυπάρων.
16-5
Απάvmση
Η μεταλ/αγμένη
Απάvmση
15-22
νεργοποιημένη
G πρωτείνη θα παρέμενε σχεδόν συνεΧώς ε καθώς το GDP θα διίστατο αυθόρμητα, αφή
Α. Εξωκυπάριος χώρος
νοντας το
Β. ΚυπαροδιάΛυμα
γοποιημένου υποδοΧέα που διασυνδέεται με τη συγκεκριμένη
Γ. Πλασματική ή κυπαρική μεμβράνη
πρωτεΊνη. Επομένως, οι επιπτώσεις για το κύπαρο θα ήταν πα
Δ. ΚάΛυμμα κλαθρίνης
ρόμοιες με τις επιπτώσεις της χοΛερικής τοξίνης, η οποία τρο
Ε. Μεμβράνη βαθιά εγκοΛπωμένης εσοχής καλυμμένης με κλα θρίνη
GTP να
ποποιεί την α υπομονάδα ώστε να μην μπορεί να υδρολύσει το
GTP για ν'
Ζ. Δεσμευμένα μόρια φορτίου
Η. Αυλός βαθιά εγκοΛπωμένης εσοχής καλυμμένης με κλαθρίνη
προσδένεται ακόμα και απουσία του ενερ
απενεργοποιηθεί. Αντίθετα όμως από την περίmω
ση της χοΛερικής τοξίνης, η μεταλ/αγμένη
G πρωτείνη δεν θα
παρέμενε μόνιμα ενεργοποιημένη: θα μπορούσε ν' απενερ γοποιηθεί κανονικά αΛλά κατόπιν θα επανενεργοποιούνταν
ακαριαία από τη διάσταση του
Κεφάλαιο Απάvmση
16
16-1
του
GDP
και την επαναπρόσδεση
GTP.
Απάvmση
16-6
Τα περισσότερα μόρια που χρησιμοποιούνται για παρακρινή
Η ταχεία αποδόμηση διατηρεί τα επίπεδα του κυκΛικού ΑΜΡ
σηματοδότηση είναι πολύ βραΧύβια και αποδομούνται γρήγορα
χαμηλά. Όσο χαμηλότερα είναι τα επίπεδα του
μετά την απελευθέρωσή τους από τα κύπαρα. Επιπλέον, μερικά
γαλύτερη θα είναι και η αύξηση της ενεργότηταςτης αδενυΛικής
μόρια προσκολ/ώνται στο εξωκυπάριο στρώμα και έτσι δεν α
κυκλάσης που παράγει νέο κυκλικό ΑΜΡ. Αν είχατε έναν τρα
φήνονται να διαχυθούν ποΛύ μακριά, ή απεΛευθερώνονται σ' έ
πεΖικό Λογαριασμό
ναν περιορισμένο χώρο, όπως η συναπτική σχισμή ανάμεσα σ'
τε θα διπΛασιάΖατε τις καταθέσεις σας. Αν όμως ο Λογαριασμός
ένα νευρικό και ένα μυϊκό κύπαρο, όπου περιορίΖεται η διάχυ
σας είχε μόνο
ση στον περιβάλ/οντα Χώρο.
θέσεις σας θα δεκαπλασιάΖονταν. Συνεπώς, από την ίδια κατά
cAMP τόσο
με
100 ευρώ και καταθέτατε άλ/α 100 ευρώ τό
10 ευρώ
και καταθέτατε άλ/α
100, τότε
οι κατα
θεση θα προέκυπτε πολύ μεγαλύτερη αναλογική αύξηση.
Απάvmση
16-2 16-7
Κάθε φωτόνιο προκαΛεί την υδρόΛυση
Απάvmση
κού
Η επιφάνεια της κυπαρικής μεμβράνης είναι μικρή σε σχέση με
ρές
80,000 μορίων κυκλι GMP, δηλαδή το σήμα πολ/απΛασιάΖεται κατά 80,000 φο (= 200 χ 4000 χ 0.1).
τη συνοΛική επιφάνεια των μεμβρανών του κυπάρου (βλ Κεφά
Λαιο Απάvmση
16-3
15). Το
ενδοπΛασματικό δίκτυο γενικά είναι ποΛύ πιο ά
φθονο και διατρέχει όλο τον χώρο του κυπάρου, ως ένα τερά
Οι ποΛικές ομάδες είναι υδρόφιΛες και η χοΛηστερόΛη, που έ
στιο δίκτυο μεμβρανικών σωλήνων και φύλ/ων. Αυτό εξασφα
χει μόνο μια ομάδα -ΟΗ, είναι πολύ υδρόφοβη για να Λειτουρ
ΛίζεΙ την ομοιογενή απεΛευθέρωση Ca2+ σε όΛη την έκταση του
γήσει αποτεΛεσματικά ως ορμόνη. Ένα Λιπίδιο που είναι πρα
κυπάρου, που έχει σημασία επειδή η ταχεία απομάκρυνση των
κτικά αδιάΛυτο στο νερό δεν θα μπορούσε να μετακινείται εύκο-
ιόντων Ca 2+ από το κυπαροδιάΛυμα μέσω των αντΛιών Ca2+
978
Απαντήσεις
δεν επιτρέπει στο Ca + να διαΧέεται σε σημαντική απόσταση μέ 2
τις οποίες συνδέει το σάκχαρο με τη διακυΛογΛυκερόΛη. Η ΙΡ 3 παράγεται με μια απΛή υδρόΛυση.
σα στο KυτταΡOδιMUΜα.
Ε. Λάθος. Η καΛμοδουΛίνη ανιχνεύεται, αλ/ά δεν ρυθμίΖει τα Απάντηση
16-8
/ επιπε / δ α του Ca2+ . δ οκυτταρια Ζ. Σωστό. ΒΛ. Εικόνα 16-38 Η. Λάθος. Το Ras είναι ένα πρωτο-ογκογονίδιο. εν
Κάθε αντίδραση που εμπΛέκεται στην ενίσχυση του σήματος
πρέπει ν' απενεργοποιείται, ώστε η σηματοδοτική οδός να επα
Γίνεται ογκο
νέρχεται στο επίπεδο ηρεμίας. Επομένως, και οι δύο διακόπτες
γονίδιο, δηΛαδή προάγει την ανάπτυξη του καρκίνου, όταν
είναι εξίσου σημαντικοί.
περιέχει μεταλ/άξεις που το διατηρούν συνεχώς σε ενεργό κατάσταση.
Απάντηση
16-9
Θ. Σωστό. ΒΛ. Εικόνα
16-30.
Επειδή κάθε αντίσωμα διαθέτει δύο θέσεις για σύνδεση με το α ντιγόνο, η πρόσδεση στους υποδοχείς μπορεί να προκαλέσει τη
Απάντηση
συσσώρευση των μορίων του υποδοΧέα πάνω στην κυτταρική ε
1. Θα
16-12
αναμένατε ένα υψηλό επίπεδο δραστικότητας της πρω
πιφάνεια. Αυτό είναι πιθανό να ενεργοποιήσει υποδοχείς με
τε'ί'νης
δράση κινάσης της τυροσίνης, οι οποίοι ενεργοποιούνται με αυ
γοποιηθεί αποτεΛεσματικά.
τοφωσφορυΛίωση μόΛις συμπΛησιάσουν οι περιοχές με δραστι κότητα κινάσης διαφορετικών μορίων υποδοΧέα. Η ενεργοποί ηση των υποδοΧέων που συνδέονται με
G πρωτε'ί'νες
είναι πιο
περίπΛοκη επειδή ο συνδέτης πρέπει να προκαΛέσει μια συγκε κριμένη μεταβοΛή διαμόρφωσης. ΠοΛύ Λίγα ειδικά αντισώματα
επειδή η πρωτεΤνη δεν θα μπορούσε να απενερ
Ras,
2. Επειδή
μερικά μόρια της
Ras
έχουν ήδη προσδέσει
3. Η απάντηση
Ras θα είχαν
προσδέσει
GTP.
σ' ένα σήμα θα ήταν ποΛύ βραδύτερη επειδή η ε
ξαρτώμενη από το σήμα αύξηση των μορίων της
προκαλέσουν τη μεταβοΛή της διαμόρφωσης που ενεργοποιεί
χουν προσδέσει
τον υποδοΧέα.
δο μορίων
4. Η
16-10
η
μεγαΛύτερη από το κανονικό, αλ/ά θα υφίστατο κορεσμό ό ταν όΛα τα μόρια της
μιμούνται τόσο KαiΊά τους συνδέτες των υποδοΧέων ώστε να
Απάντηση
GTP,
δράση της σε απάντηση προς ένα εξωκυττάριο σήμα θα ήταν
αύξηση
Ras
που έ
GTP θα συνέβαινε σ' ένα ήδη υψηλό επίπε Ras προσδεδεμένων με GTP. της ενεργότητας της Ras σε απάντηση προς ένα
σήμα επίσης θα ήταν αυξημένη σε σύγκριση με τα φυσιοΛογι
Όσο περισσότερα βήματα υπάρχουν σε μια σηματοδοτική οδό
κά κύτταρα.
τόσο περισσότερα σημεία διατίθενται στο κύτταρο για να ρυθμί
16-13
σει την οδό, να ενισΧύσει το σήμα, να συνδυάσει σήματα από
Απάντηση
διαφορετικές οδούς και να διοχετεύσει το σήμα προς διάφορες
Α. Και τα δύο είδη σηματοδότησης μπορεί να έχουν μεγάΛο βε
κατευθύνσεις (βΛ. Εικόνα
Ληνεκές: οι νευρώνες μπορούν ν' αποστείλουν δυναμικά ε
16-8).
νέργειας κατά μήκος ποΛύ μακριών νευραξόνων (για σκε Απάντηση
16-11
φθείτε τον αυχένα μιας καμηΛοπάρδαΛης) και οι ορμόνες
Α. Σωστό. Για παράδειγμα, η αKετυΛoXOί'lίνη εΛαττώνει τη συ
μεταφέρονται με την κυκλοφορία του αίματος σε όΛο τον ορ
χνότητα της συστοΛής των μυοκαρδιακών κυττάρων μέσω
γανισμό. Επειδή σε μια σύναψη οι νευρώνες εκκρίνουν με
της πρόσδεσής της σ' έναν υποδοΧέα που συνδέεται με μια
γάΛες ποσότητες νευροδιαβιβαστών σ' έναν μικρό, KαiΊά κα
G-πρωτε'ί'νη και διεγείρει τη συστοΛή των γραμμωτών μυϊκών
θορισμένο χώρο ανάμεσα σε δύο κύτταρα, οι συγκεντρώσεις
κυττάρων μέσω της πρόσδεσής της σ' έναν διαφορετικό υπο
των νευροδιαβιβαστών στις συνάψεις είναι υψηΛές: επομέ
δοΧέα της ακετυΛοχοΛίνης, ο οποίος είναι ένας δίαυΛος ιό
νως, οι υποδοχείς των νευροδιαβιβαστών, προκειμένου να
ντων που εΛέγχεται από τον συνδέτη.
προσδέσουν τα αντίστοιχα μόρια δεν χρειάΖεται να έχουν για
Β. Λάθος. Η ακετυΛοχοΛίνη είναι βραΧύβια και ασκεί τις δράσεις
αυτά υψηΛή συγγένεια. Αντίθετα, οι ορμόνες αραιώνονται
της τοπικά. Πράγματι, οι επιπτώσεις από την παράταση του
πάρα πολύ στην κυκλοφορία του αίματος, όπου κυκΛοφο
χρόνου Ζωής της είναι καταστροφικές. Οι ενώσεις που ανα
ρούν σε πολύ μικρές συγκεντρώσεις: επομένως, οι υποδο
στέλ/ουν το ένΖυμο ακετυΛοχοΛινεστεράση, το οποίο κανονι
χείς των ορμονών γενικά προσδένουν τις αντίστοιχες ορμό
κά διασπά την ακετυΛοχοΛίνη στις νευρομυϊκές συνάψεις, εί
νες με εξαιρετικά υψηλή συΥΥένεια.
ναι εξαιρετικά τοξικές: ένα παράδειγμα, είναι η σαρίνη, ένα νευρικό αέριο που χρησιμοποιείται στον χημικό πόΛεμο.
Β. Ενώ ή νευρωνική σηματοδότηση είναι μια «ιδιωτική υπόθε ση», όπου ένας νευρώνας «συνομιΛεί» με μια επίλεκτη ομάδα
Γ. Σωστό. Τα σύμπΛοκα βγ που είναι εΛεύθερα νουκΛεοτιδίων
κυττάρων-στόχων μέσω ειδικών συνάψεων, η ορμονική ση
μπορούν να ενεργοποιήσουν διαύΛους ιόντων, ενώ οι α-υπο
ματοδότηση είναι μια «δημόσια ανακοίνωση», στην οποία τα
μονάδες που είναι προσδεδεμένες με
μπορούν να ε
κύτταρα-στόΧοι «αισθάνονται» τα επίπεδα της ορμόνης στο
νεργοποιήσουν ένΖυμα. Οι τριμερείς G-πρωτε'ί'νες που είναι
αίμα. Η νευρωνική σηματοδότηση είναι ποΛύ ταχεία, καθώς
συνδεδεμένες με
περιορίΖεται μόνο από την ταΧύτητα μετάδοσης του δυναμι
GDP βρίσκονται
GTP
σε ανενεργό κατάσταση.
Δ. Σωστό. Η ΡΙΡ 2 περιέχει τρεις φωσφορικές ομάδες, μια από
κού ενεργείας και τις Λειτουργίες της σύναψης, ενώ η ορμο-
Απαντήσεις
979
νική σηματοδότηση είναι βραΔUτερη, επειδή περιορίζεται α
ρίς την εξωκυπάρια περιοχή για την πρόσδεση του σuνδέτη,
πό τη ροή του αίματος και τη διάχυση σε μεγαλύτερες απο
ο μεταλ/αγμένος υποδοΧέας δεν μπορεί να ενεργοποιηθεί και έτσι είναι ανενεργός (Εικόνα 16-16Α).
στάσεις.
Β. Αuτός ο μεταλ/αγμένος uποδΟΧέας επίσης είναι ανενεργός, Απάντηση
16-14
Α. Το κύπαρο περιέχει
αλ/ά η παρουσία τοι> θ' αναστείλει τη σηματοδότηση από
100,000 μόρια Χ και 10,000 μόρια Υ (=
ταΧύτητα σύνθεσης Χ μέση διάρκεια Ζωής).
τοuς φυσιολογικούς uποδοχείς. Μόλις ο σuνδέτης προσδε
θεί είτε στον φυσιολογικό είτε στον μεταλ/αγμένο υποδοΧέα
Β. Μετά από ένα δευτερόλεπτο, η συγκέντρωση του Χ θα έχει αυξηθεί κατά
θα προκαλέσει τον διμερισμό τοuς. Για να ενεργοποιηθούν
10,000 μόρια, οπότε το κύπαρο θα περιέχει συ 110,000 μόρια Χ, δηλαδή 10% περισσότερα μόρια
δύο φυσιολογικοί υποδοχείς πρέπει να σuμπλησιάσουν ώ
απ' ό,τι περιείχε προτού αυξηθεί η ταΧύτητα σύνθεσης του Χ.
ρίσσεια μορίων του μεταλ/αγμένοι> uποδοχέα, οι φuσιολογι
Η συγκέντρωση του Υ επίσης θ' αυξηθεί κατά
10,000 μόρια,
κοί uποδοχείς σuνήθως θα σχηματίΖοuν μεικτά διμερή, στα
δηλαδή θα διπλασιαστεί (για λόγους απλούστευσης, στον υ
οποία η ενδοκuπάρια περιοχή δεν μπορεί να ενεργοποιηθεί
πολογισμό αυτό μπορούμε ν' αγνοήσουμε την αποδόμηση,
επειδή ο συνοδός τοuς θα είναι μεταλ/αγμένος (Εικόνα Α16
επειδή κατά τη διάρκεια του ενός δευτερολέπτου της διέγερ
16Β).
νολικά
στε να μπορεί να φωσφορuλιωθούν. Αν όμως uπάρxει πε
σης τα Χ και Υ είναι σχετικά σταθερά).
Γ. Εξαιτίας της μεγαλύτερης αναλογίας αύξησής του, το Υ είναι
Απάντηση
16-17
το προτιμώμενο σηματοδοτικό μόριο. Ο υπολογισμός επιση
Η φράση είναι σωστή. Μόλις προσδεθεί ο σuνδέτης, οι διαμεμ
μαίνει την παράδοξη αλ/ά σημαντική αΡΧή ότι ο χρόνος που
βρανικές έλικες των υποδοΧέων πολ/απλών διόδων, όπως οι
χρειάΖεται για να ενεργοποιηθεί ένα σήμα καθορίΖεται από το
uποδοχείς που συνδέονται με G-πρωτεΊνες, μετατοπίΖονται και
χρόνο Ζωής του σηματοδοτικού μορίου.
Απάντηση
16-15
Οι πληροφορίες που μεταδίδονται από μια σηματοδοτική οδό
(Α) διαμεμβρανικές έλικες των
του κυπάρου περιέχονται στη συγκέvrρωσn του αγγελιοφόροu,
υποδοχέων
είτε αuτός είναι ένα μικρό μόριο είτε μια φωσφορuλιωμένη πρω τεΊνη. Επομένως, για να μπορεί ν' ανΙXνΕUθεί μια αλ/αγή, ο αρ χικός αγγελιοφόρος πρέπει να καταστραφεί. Όσο πιο ασταθής είναι ο αγγελιοφόρος, τόσο ταχύτερα μπορεί το σύστημα ν' α παντά σε αλ/αγές. Η ανθρώπινη επικοινωνία βασίΖεται σε μη νύματα ποι> εκφέρονται μόνο μια φορά και γενικά δεν ερμη νεύονται με βάση την αφθονία αλ/ά το περιεχόμεvότοuς. Έτσι, ας μην σκοτώσοuμε τοuς αγγελιοφόρους: μπορεί να χρησιμο
ποιηθούν περισσότερο από μια φορά. Απάντηση
16-16
Α. Ο μεταλ/αγμένος uποδΟΧέας με δραστικότητα κινάσης της
ΤUΡOσίνης είναι ανενεργός και η παροuσία τοι> δεν έχει
ou-
(Β)
νέπειες για τη λειτοuργία του φuσιολογικού uποδΟΧέα. Χω-
~~ (Α)
περιοχή κινάσης
~~
~LJ=lFI Εικόνα Α16-16
980
Απαντήσεις
. .
ενζυμική περιοχή των υποδοχέων
Εικόνα Α 16·17
αναδιατάσσονται η μια σε σχέση με την άλλη (Εικόνα Α16
δείξεις ότι ένας τέτοιος μηχανισμός συμβάλει στη ρύθμιση του
17Α). Αυτή
αριθμοό των κυττάρων, τόσο στους αναmυσσόμενους όσο και
η μεταβολή διαμόρφωσης γίνεται αντιληπτή στη μια
πλευρά της μεμβράνης εξαιτίας μιας αλ/αγής στη διάταξη των
στους ενήλικους ιστούς (Εικόνα
18-27).
κυτταροπλασματικών βρόχων. Ένα μοναδικό διαμεμβρανικό
16-21
τμήμα δεν επαρκεί για να μεταδώσει άμεσα ένα σήμα διαμέ
Απάντηση
σου της μεμβράνης, εφόσον μόλις προσδεθεί ο συνδέτης δεν πραγματοποιούνται αναδιατάξεις στη μεμβράνη. Μετά την
Οι δίαυλοι Ca 2 + που ενεργοποιοόνται από το Ca 2+ δημιουρ γοόν μια θετική ανατροφοδότηση: όσο περισσότερο Ca2+ απε
πρόσδεση του συνδέω, οι υποδοχείς μονής διόδου (όπως οι
λευθερώνεται, τόσο περισσότεροι δίαυλοι ανοίγουν. Επομέ
υποδοχείς με δραστικότητα κινάσης της τuρoσίνης) διμερίΖΟ
νως, το σήμα του Ca2+ στο κυτταροδιάλυμα διαδίδεται εκρηκτι
νται και έτσι φέρνουν τις ενδοκυττάριες ενΖυμικές περιοχές
κά σε όλη την έκταση του μυϊκού κυττάρου, εξασφαλίΖοντας έτσι
τους κοντά-κοντά ώστε η μια να μπορεί να ενεργοποιήσει την
ότι όλα τα νημάτια της ακτίνης/μυοσίνης θα συσταλοόν σχεδόν
άλ/η (Εικόνα ΑI6-Ι7Β).
συγχρονισμένα.
Aπdvmon
Aπdvmon
16-18
16-22
Και στις δόο περιπτώσεις, η ενεργοποίηση βασίΖεται σε πρω
Η Κ2 ενεργοποιεί την ΚΙ. Αν η ΚΙ ενεργοποιηθεί μόνιμα, θα
τε1\ιες που καταl\Uουν την ανταλλαγή
G-
παρατηρηθεί μια απάντηση ανεξάρτητα από την κατάσταση της
Ενώ, οι υποδοχείς που συνδέο
Κ2. Αν η σειρά αναστρεφόταν, η ΚΙ θα έπρεπε να ενεργοποιεί
νται με G-πρωτεΊνες επιτελούν αυτή τη λειτουργία άμεσα, οι υ
την Κ2, κάτι που δεν μπορεί να γίνει επειδή στο παράδειγμά μας
ποδοχείς που συνδέονται με ένΖυμα συναρμολογούν πολ/α
η Κ2 περιέχει μια αδρανοποιητική μετάλλαξη.
πρωτε1\ιη ή στην πρωτε1\ιη
Ras.
GDP/GTP πάνω
στην
πλές πρωτείνες προσαρμογής σ' ένα σηματοδοτικό σόμπλοκο μόλις ενεργοποιηθούν με φωσφορυλίωση. Μια από αυτές τις
Aπdvmon
πρωτεΊνες επιστρατεύει μια ειδική πρωτεΊνη που ενεργοποιεί
Α. Εξωκυττάριο σήμα ~ υποδοχέας με δράση κινάσης της τu
την πρωτε1\ιη
Ras.
16-23
ροσίνης ~ προσαρμοστική πρωτε1\ιη ~ πρωτεΊνη που ενερ
γοποιεί την
Aπdvmon
16-19
Ras
~ κινάση της κινάσης της ΜΑΡ κινάσης ~
κινάση της ΜΑΡ κινάσης ~ ΜΑΡ κινάση ~ ρυθμιστική πρω
Επειδή η ενδοκυττάρια συγκέντρωση του Ca2+ είναι τόσο χαμη λή, μια εισροή σχετικά λίγων ιόντων Ca2+ προκαλεί μεγάλες αλ λαγές στη συγκέντρωση του Ca2+ στο κυτταροδιάλυμα. Έτσι, μια δεκαπλάσια αόξηση του Ca2+ μπορεί να επιτευχθεί με μια
τείνη γονιδίων ή
εξωκυττάριο σήμα ~ υποδοχέας που συνδέεται με
G-npw-
τεΊνη ~ G-πρωτεΊνη ~ φωσφολιπάση C ~ ΙΡ3 ~ Ca2+ ~
αόξηση της συγκέντρωσης του Ca2+ της τάξης των μmοΙes, δη
καλμοδουλίνη ~ CaΜ-κινάση ~ ρυθμιστική πρωτε1\ιη γονι
λαδή με ποl\U λιγότερα ιόντα απ' ό,τι θα χρειαΖόταν για ν' αλλά
δίων
ξει σημαντικά η συγκέντρωση ενός περισσότερο άφθονου ιό
ή
ντος, όπως το Na +. Στους μυς, μέσα σε μsec (10-6 sec) μπορεί να επιτευχθεί μια υπερδεκαπλάσια αύξηση με απελευθέρωση Ca2 +
τεΊνη ~ G-πρωτεΊνη ~ αδενυλlκή κυκλάση ~ κυλικό ΑΜΡ
εξωκυττάριο σήμα ~ υποδοχέας που συνδέεται με
από τις ενδοκυττάριες αποθήκες του σαρκοπλασματικοό δικτό ου, ένα αποτέλεσμα που θα ήταν δόσκολο να επιτευχθεί αν χρειάζονταν αλ/αγές της τάξης των
mmoles.
G-npw-
~ ΡΚΑ ~ ρυθμιστική πρωτε1\ιη γονιδίων
Β.
TGF-B ~ υποδοχέας TGF-B ~ ρυθμιστική
πρωτεΊνη
SMAD
ή
κυτταροκίνη ~ υποδοχέας κυτταροκίνης ~ JAΚ κινάση ~
Aπdvmon
16-20
ρυθμιστική πρωτείνη
STAT
Σ' έναν πολυκύτταρο οργανισμό, όπως ένα Ζώο, τα κύτταρα πρέπει να εΠΙΖοόν μόνο όταν και όπου χρειάΖεται. Αυτό μπορεί
να διασφαλιστεί με απλό τρόπο, αρκεί η επιβίωση των κυττάρων
Aπdvmon
να εξαρτάται από σήματα προερχόμενα από άλ/α κότταρα. Για
Τα Ζώα και τα φυτά πιστεύεται ότι ανέπτuξαν ανεξάρτητα την
παράδειγμα, ένα έκτοπο κύτταρο μάλ/ον δεν θα κατόρθωνε να
ιδιότητα ν' αποτελοόνται από πολλά κόπαρα. Συνεπώς, ει
παραλάβει όλα τα σήματα επιβίωσης που χρειάΖεται (καθώς θα
κάΖεται ότι ανέπτυξαν επίσης και μερικοός διαφορετικοός
16-24
είχε ακατάλ/ηλους γείτονες) και επομένως θα αυτοκτονούσε. Η
σηματοδοτικούς μηχανισμούς για την επικοινωνία μεταξό
τακτική αυτή μπορεί επίσης να συμβάλει στη ρόθμιση του αριθ
των κυττάρων τους. Από την άλλη πλευρά, επειδή τα Ζώα και
μοό των κυττάρων: αν το κότταρο Α εξαρτάται από ένα σήμα επι
τα φυτά μάλλον προέρχονται από ένα κοινό ευκαρυωτικό
βίωσης από το κύτταρο Β, τότε ο αριθμός των κυττάρων Β θα έ
προγονικό κότταρο αναμένεται να μοιράΖΟνται μερικοός εν
λεγχε τον αριθμό των κυττάρων Α παράγοντας μια περιορισμέ
δοκυττάριους ορσηματοδοτικούς μηχανισμούς που χρησι
νη ποσότητα του σήματος επιβίωσης, οπότε θα επιβίωνε μόνο έ
μοποιούσε το κοινό προγονικό κύτταρο για ν' απαντά στο
νας ορισμένος αριθμός κυττάρων Α. Πράγματι, υπάρχουν εν-
περιβάλ/ον του.
Απαντήσεις
981
Κεφάλαιο Aπ6vmσn
GTP,
17
δηλαδή όταν οι υπομονάδες της τουμπουλίνης
κρο του είναι όλες προσδεδεμένες με
17-1
mo
ά
GDP. Οι υπομονάδες GTP από το διά
της τουμπουλίνης που είναι φορτωμένες με
Τα κύτταρα που μεταναmεύουν γρήγορα από μια θέση σε μια
λυμα θα προmεθούν σε αυτό το άκρο αλ/ά θα παραμείνουν
άλλη, όπως οι αμοιβάδες (Α) και τα σπερμαΤΟΖωάρια
για λίγο, είτε επειδή υδρολύουντο
χρειάΖΟνται ενδιάμεσα ινίδια
mo
(2),
δεν
κυτταρόπλασμά τους επειδή
GTP, είτε επειδή
πέφτουν,
καθώς αποσυναρμολογείται ο μικροσωληνίσκος. Εάν όμως
δεν αναπτύσσουν ούτε δέχονται μεγάλες ελαmικές δυνάμεις.
ικανός αριθμός υπομονάδων που φέρουν
Τα φυτικά κύτταρα (Η) πιέΖονται και τεντώνονται από τον αέρα
αρκετά γρήγορα ώmε να καλύψει τις υπομονάδες της του
και το νερό, αλ/ά αντέχουν σε αυτές τις δυνάμεις βασΙΖόμενα
μπουλίνης που έχουν
κυρίως
τότε θα
ma σκληρά κυτταρικά τοιχώματά τους και όχι mov
κυτ
ταροσκελετό τους. Τα επιθηλιακά κύτταρα (Β), τα λεία μυϊκά
GTP
προmεθεί
GDP mo άκρο του μικροσωληνίσκου, ξανασχηματιmεί το κάλυμμα GTP και θα ευνοηθεί η
αύξηση του μικροσωληνίσκου.
κύτταρα (Γ) και οι επιμήκεις άξονες των νευρικών κυττάρων (Ε)
Β. Η ταχύτητα προσθήκης της GΤΡ-τουμπουλίνης θα είναι με
περιέχουν άφθονα κυτταροπλασματικά ενδιάμεσα ινίδια, τα ο
γαλύτερη σε υψηλότερες συγκεντρώσεις τουμπουλίνης. Ε
ποία εμποδίΖουν τη ρήξη τους καθώς τεντώνονται και συμπιέΖΟ
πομένως, η συχνότητα με την οποία οι μικροσωληνίσκοι με
νται από τις κινήσεις των ιmών που τα περιβάλ/ουν.
ταπηδούν
mnv
κατάmαση αύξησης είναι μεγαλύτερη όσο
Όλα τα κύτταρα που προαναφέρθηκαν περιέχουν τουλάΧι
αυξάνει η συγκέντρωση της τουμπουλίνης. Η συνέπεια αυτής
mov ενδιάμεσα ινίδια mov πυρηνικό υμένα τους. Τα βακτήρια, όπως τα Escherichia coli (Δ), δεν περιέχουν τίποτα παρόμοιο.
της ρύθμισης είναι ότι το σύmημα ισορροπεί μόνο του: όσο
συρρικνώνονται οι μικροσωληνίσκοι (με αποτέλεσμα ν' αυ ξάνει η συγκέντρωση της ελεύθερης τουμπουλίνης), τόσο
Aπ6vmσn
17-2
συχνότερα οι μικρο σωληνίσκοι θ' αρχίΖουν να ξαναυξάνουν.
Δύο διμερή τουμπουλίνης έχουν μικρότερη συγγένεια μεταξύ
Αντίθετα, όσο μεγαλώνουν οι μικροσωληνίσκοι, τόσο θα μει
τους (λόγω του περιορισμένου αριθμού θέσεων αλ/ηλεπίδρα
ώνεται η συγκέντρωση της ελεύθερης τουμπουλίνης και η τα
σης) απ' ό,τι έχει ένα διμερές τουμπουλίνης για το άκρο ενός μι
χύτητα προσθήκης της GΤΡ-τουμπουλίνης θα γίνεται μικρό
κροσωληνίσκου (όπου υπάρχουν πολ/ές δυνατές θέσεις αλ/η
τερη. Σε κάποια mιγμή, η υδρόλυση του
λεπίδρασης τόσο άκρο με άκρο των διμερών της τουμπουλίνης
σει» την προσθήκη της GΤΡ-τουμπουλίνης, το κάλυμμα
που προmίθενται σ' ένα πρωτοϊνίδιο όσο και πλευρικές αλ/ηλε
θα καταmραφεί και ο μικροσωληνίσκος θα μεταπέσει
πιδράσεις των διμερών της τουμπουλίνης με υπομονάδες του μπουλίνης σε γειτονικά πρωτοϊνίδια σχηματίζοντας την δακτυ
GTP
θα «προφτά
GTP mnv
κατάmαση συρρίκνωσης.
Γ. Εάν υπάρχει μόνο το
GDP,
οι μικροσωληνίσκοι θα συνεχί
λιοειδή εγκάρσια τομή). Επομένως, για ν' αρχίσει η κατασκευή
σουν να συρρικνώνονται και τελικά θα εξαφανιmούν, επειδή
ενός μικροσωληνίσκου, αρκετά διμερή τουμπουλίνης πρέπει να
τα διμερή τουμπουλίνης με
βρεθούν αρκετά κοντά και να παραμείνουν προσδεδεμένα με
νεια μεταξύ τους και δεν προmίθενται mαθερά mους μικρο
ταξύ τους για αρκετό χρονικό διάmημα έως ότου προmεθούν
σωληνίσκους.
και άλ/α μόρια τουμπουλίνης. Μόνον όταν συναρμολογηθεί έ
Δ. Εάν υπάρχει
GTP αλ/ά
GDP
έχουν πολύ μικρή συγγέ
δεν μπορεί να υδρολυθεί, οι μικρο
νας αριθμός διμερών τουμπουλίνης, θα επιτραπεί η πρόσδεση
σωληνίσκοι θα συνεχίσουν ν' αυξάνουν έως ότου χρησιμο
της επόμενης υπομονάδας. Επομένως, ο σχηματισμός αυτών
ποιηθούν όλες οι ελεύθερες υπομονάδες της τουμπουλίνης
των αρχικών «θέσεων εμπυρήνωσης» είναι σπάνιος και δεν συμβαίνει αυθόρμητα mις συγκεντρώσεις της τουμπουλίνης
Aπ6vmσn
που υπάρχουν
Εάν όλοι οι βραχίονες της δυνεΤνης ήταν εξίσου ενεργοί, τότε
ma κύτταρα.
17-4
Τα κεντροσωμάτια περιέχουν προσυναρμολογημένους δα
δεν θα υπήρχε αξιοσημείωτη μετακίνηση του ενός μικροσωλη
κτυλίους γ-τουμπουλίνης (mους οποίους οι υπομονάδες της
νίσκου σε σχέση με τον άλλο όπως απαιτείται για την κάμψη
γ-τουμπουλίνης συνδέονται μεταξύ τους με πολύ ισχυρότερες
(φανταmείτε έναν κύκλο από εwέα αρσιβαρίmες, ο καθένας α
πλευρικές αλληλεπιδράσεις από αυτές του διμερούς της αβ
πό τους οποίους προσπαθεί ν' ανασηκώσει τον διπλανό του α
τουμπουλίνης), mους οποίους μπορεί να προσδεθούν τα δι
πό το έδαφος: εάν τα καταφέρουν όλοι, τότε ολόκληρη η ομάδα
μερή της αβ-τουμπουλίνης. Οι συνθήκες πρόσδεσης των διμε
πρέπει ν' ανυψωθεΩ). Πρέπει επομένως να ενεργοποιηθούν ε
ρών της αβ-τουμπουλίνης είναι παρόμοιες με αυτές της προ
πιλεκτικά λίγα μόρια δυνεΤνης
σθήκης στο άκρο ενός συναρμολογημένου μικροσωληνί
Καθώς μετακινούν τους διπλανούς μικροσωίΊηνίσκους προς
σκου. Οι δακτύλιοι της γ-τουμπουλίνης
mn
μια πλευρά της βλεφαρίδας.
κεντοσωμάτιο
την κορυφή της βλεφαρίδας, η βλεφαρίδα κάμπτεται προς την
μπορεί να θεωρηθούν ως μόνιμες προσυναρμολογημένεςθέ
αντίθετη πλευρά από την πλευρά που περιέχει τις ενεργοποιη
σεις «εμπυρήνωσης».
μένες δυνεΤνες.
Aπ6vmσn 17-3
Aπ6vmσn
Α. Ο μικροσωληνίσκος συρρικνώνεται όταν χάσει το κάλυμμα
Κάθε πρωτεΤνη που προσδένει ακτίνη και mαθεροποιεί σύ-
982
Απαντήσεις
mo
17-5
μπίΊοκα δύο ή περισσότερων μονομερών ακτίνης χωρίς να ε
μυοσίνης είναι προσανατοίΊισμένα με τις κεφαίΊές τους προς την
μποδίΖει τα άκρα που χρειάΖΟνται για την αύξηση του νηματίου,
ίδια κατεύθυνση. Αυτή η ποίΊικότητα είναι απαραίτητη για την α
θα διευκοίΊύνει την έναρξη ενός νέου νηματίου (εμπυρήνωση).
νάπτυξη της ικανότητας συστοίΊής των μυών.
Aπdvmon
Aπdvmon
17-6
17-10
Ορατά είναι μόνο τα φθορίΖοντα μόρια ακτίνης που έχουν συ
Α. Τα διαδοχικά μόρια της ακτίνης στο νημάτιο της ακτίνης εί
ναρμοίΊογηθεί σε ινίδια. Τα μη ποίΊυμερισμένα μόρια ακτίνης
ναι πανομοιότυπα ως προς τη θέση και τη διαμόρφωση. Με
διαΧέονται τόσο γρήγορα- ώστε παράγουν ένα διάχυτο, αχνό, ο
τά την πρόσδεση μιας πρώτης πρωτεΤνης (όπως της φοπονί
μοιόμορφο σήμα. Επειδή στο πείραμά σας έχουν σημανθεί τό
νης) στο νημάτιο της ακτίνης, δεν είναι πίΊέον δυνατό για μια
σο ίΊίγα μόρια ακτίνης
δεύτερη πρωτεΤνη ν' αναγνωρίΖει κάθε έβδομο μονομερές
(1:10,000),
θα υπάρχει το ποίΊύ ένα ση
μασμένο μονομερές ακτίνης ανά ινίδιο (βίΊ. Εικόνα
17-30) . Το
ακτίνης σ' ένα «γυμνό» νημάτιο ακτίνης. Η τΡοπομυοσίνη ό
είΊασματοπόδιο έχει πολ/ά ινίδια ακτίνης, από τα οποία μερικά
μως προσδένεται κατά μήκος του νηματίου της ακτίνης κα
επικαίΊύπτονται και έτσι αποδίδουν ένα τυχαίο, στικτό πρότυπο
ίΊύπτοντας ακριβώς εmά μονομερή ακτίνης και έτσι παρέχει
μορίων ακτίνης.
ένα μοριακό «χάρακα» που μετρά το μήκος εmά μονομερών
Αυτή η τεχνική ( που χρησιμοποιείται ευρέως σε μελέτες με αVΤΙKείμενo
δα-για παράδειγμα, των αμινοξέων μιας πρωτεΊνης ή των νου
τον ερπυσμό των κυπάρων.
κλεοτιδίων του ΟΝΑ. Γενικά, η αλ/ηλουΧία ενός μακρομορί ου καθορίΖει την ακριβή βιολογική λειτουργία του.
ΑΜΡ
(5' -μονοφωσφορική
αδεvoσίνη)
Ένα από τα τέσσερα νουκλεοτίδια στο
aλ/nλoυxία-σήματoς
(Signal sequence)
Λλ/ηλουΧία αμινοξέων που κατευθόνει μια πρωτεΊνη σε μια
RNA.
Το ΑΜΡ παρά
γεται από την ενεργειακά ευνοϊκή υδρόλυση του ΑΤΡ (βλ Ει κόνα
3-41).
ειδική θέση του κυπάρου, όπως ο πυρήνας, τα μιτοΧόνδρια ή
άμυλο
το ενδοπλασματικό δίκτυο.
Πολυσακχαρίτης που αποτελείται εκλεκτικά από μονάδες γλυκόΖης και χρησιμοποιείται ως απόθεμα ενέργειας στα φυ
aλ/nλoυxία ΤΑΤΑ (ΤΑΤΑ box) Χαρακτηριστική αλ/ηλουΧία πλοόσια σε Τ και Α που βρίσκε ται στην πεΡΙΟΧή του υποκινητή πολ/ών ευκαρυωτικών γονι
δίων και καθορίΖει την αφετηρία της μεταγραφής.
τικά κόπαρα.
αμφmοruκή (ή αμφmαθής,
amphipathic)
Ένωση που διαθέτει υδρόφοβες και υδρόφιλες περιοΧές, για παράδειγμα, ένα μόριο φωσφολιπιδίου ή αΠOρρυπαVΤΙKOό.
αλ/οστερική πρωτείνη ΠρωτεΊνη που βρίσκεται σε δόο ή περισσότερες διαμορφώ σεις ανάλογα με την πρόσδεση ενός μορίου (συνδέτης) σε μια θέση διαφορετική από την καταλυτική θέση. Οι αλ/οστε ρικές πρωτεΊνες που αΠOτελOόVΤαι από πολ/απλές υπομονά δες συχνά εμφανίΖουν μια συνεργητική δράση στην πρόσδε ση του συνδέτη.
Όρος που αναφέρεται σε μια βιοχημική αντίδραση ή σε μια
σειρά αvτιδράσεων στην οποία μεγάλα μόρια παράγovται α πό άλ/α μικρότερα. Βιοσυνθετικός. αναγνώριση
αλυσιδωτή αVΤίδραση πολυμεράσης reactίon,
αναβολικός
(polyrnerase chaίn
PCR)
Τεχνική για την ποσοτική αόξηση (επαόξηση) ειδικών περιο
Χών του ΟΝΑ με πολ/απλοός κόκλους πολυμερισμοό, ο κα θένας από τους οποίους ακολουθείται από μια σόVΤOμη πε ρίοδο θέρμανσης ώστε να διαxωρίzovται οι συμπληρωματικοί κλώνοΙ.
-
βλ. μοριακή αναγνώριση.
αναγωγή (reductίon) Η προσθήκη ηλεκτρονίων σ' ένα άτομο, όπως συμβαίνει κα τά την προσθήκη υδρογόνου σ' ένα μόριο ή την αφαίρεση ο
ξυγόνου από ένα μόριο. Το αvτίθετo της οξείδωσης (βλ. Εικό
να
3-12).
αναερόβιος Όρος που αναφέρεται σ' ένα κόπαρο, έναν οργανισμό ή μια
αμιοιο Μόριο που περιέχει μια καρβονυλομά
δα συνδεδεμένη με μια αμίνη.
μεταβολική διεργασία που λειτουργεί απουσία αέρα ή, πιο
σωστά, απουσία μοριακοό οξυγόνου.
ανακάτεμα ή ανάμειξη εξoVΊων
αμινομάδα (-ΝΗ Ζ )
Ασθενώς βασική λειτουργική ομάδα που προέρχεται από την αμμωνία (ΝΗ 3 ). Σε υδατικό διάλυμα, μια αμινομάδα μπορεί
να προσλάβει ένα πρωτόνιο και να φέρει ένα θετικό φορτίο. αμινοξύ
(exon shuffling)
Εξελικτική διεργασία με την οποία δημΙOυργOόVΤαι νέα γονί δια από τη συνένωση συνδυασμών εξονίων που αρχικά ήταν
ανεξάρτητα και κωδικοποιοόσαν διαφορετικές πρωτεϊνικές περιοΧές.
αναπvoή (respίration)
Οργανικό μόριο που περιέχει μια αμινομάδα και μια καρβο
Γενικός όρος για κάθε διεργασία ενός κυπάρου στην οποία η
ξυλομάδα. Τα α-αμινοξέα (εκείνα στα οποία η αμινομάδα
πρόσληψη μορίων 02 είναι συΖευγμένη με την παραγωγή
και η καρβοξυλομάδα συνδέovται με το ίδιο άτομο άνθρα
CO2 ·
κα) λειτουργοόν ως δομικοί λίθοι των πρωτεϊνών (βλ Πα ράρτημα
ανάπτυξη
2-5).
Η διαδοχή των αλ/αγών με την οποία ένα γονιμοποιημένο ω
αμινοτελικό άκρο
1000
-
βλ Ν-άκρο.
Γλωσσάριο
άριο σχηματίΖει ένα πολυκόπαρο φυτό ή Ζώο.
αντιμεrαφoρέας
αναστολή από ανάδρομη τροφοδότηση
(feedback inhibitίon)
(antiport)
Μεμβρανική μεταφορική πρωτείνη που μεταφέρει δύο δια
Μια μορφή μεταβολικού ελέγχου σων οποία 10 τελικό προϊόν
φορετικά ιόντα ή μικρά μόρια διαμέσου μιας μεμβράνης προς
μιας αλυσίδας ενΖυμικώναντιδράσεωνελαπώνειτην ενεργό
αντίθετες κατευθύνσεις, είτε ταυτόχρονα είτε διαδοχικά.
τητα ενός ενΖύμου που δρα σ' ένα αρχικό στάδιο της μεταβο αντιπαράλ/nλoς
λικής οδού.
11
Σε παράλληλη διάταξη αλ/ά με αντί θετο προσανατολισμό.
ανασυνδυασμός(recombίnatίon)
Ένα παρά
Η διεργασίακατά την οποία χρωμοσώματαή μόρια ΟΝΑ δια
δειγμα είναι οι δύο κλώνοι της διπλής
σπώνται και τα κλάσματα ανασυνδέονταισε νέους συνδυα
έλικας 1Ου ΟΝΑ.
σμούς. Μπορείνα συμβεί ίη νίνο, για παράδειγμαμέσω 1Ου ε πιχιασμού κατά τη διάρκεια της μείωσης, ή ίη
vitro,
χρησιμο
αντίστροφη μεrαγραφάση
(reverse transcriptase)
ποιώντας καθαρό ΟΝΑ και ένΖυμα που διασπούν και συνδέ
ΈνΖυμο των ρετροϊών που παράγει ένα δίκλωνο ΟΝΑ αντί
ουν 1Ους κλώνους 1Ου ΟΝΑ.
γραφο από ένα μονόκλωνο ΗΝΑ εκμαγείο.
αντίσωμα (ανοσοσφαιρίvn)
ανάφαση
Στάδιο της μίτωσης κατά τη διάρκεια ίΟυ οποίου οι δύο ομά δες χρωμοσωμάτων διαχωρίζονται και απομακρύνονται η μια από την άλλη. Περιλαμβάνει την ανάφαση Α (τα χρωμοσώμα
τα μετακινούνται προς 1Ους δύο πόλους της ατράκτου) και την ανάφαση Β (οι πόλοι της ατράκτου απομακρύνονται ο ένας α
πό1Ονάλ/ο).
ση προς ένα ξένο μόριο ή έναν εισβάλλονταμικροοργανισμό.
Προσδένεταιισχυρά στο ξένο μόριο ή κύπαρο και με ίΟν τρό πο αυτό το αδρανοποιείή ίΟ σημαδεύειγια καταστροφή.
αντλία ΔιαμεμβρανικήπρωτεΊνη που προωθείτην ενεργό μεταφορά ιόντων και μικρών μορίων διαμέσου της λιπιδικής διπλοστι
ανιόν Αρνητικά φορτισμένο ιόν, Π.Χ. ίΟ CΙ- ή ίΟ
Πρωτε"lνη που παράγεται από τα Β-λεμφοκύπαρασε απάνω
CH3COO-.
βάδας.
αντλία Na+-Κ+
αvnγόνο Μόριο που αναγνωρίΖεται από ένα μόριο αντισώμα1Ος και
προσδένεται ειδικά σε αυτό. ΟνομάΖεται έτσι επειδή προκα λείτην άνοση αντίδραση (απάντηση) που παράγει τα αντισώ ματα.
(Na+-Κ+ ΑΤΡάση, αντλία νατρίου)
Διαμεμβρανική πρωτεΊνη-φορέας που βρίσκεται στην κυπα
ρική μεμβράνη των περισσότερων Ζωικών κυπάρων, η οποία
αντλεί Na + έξω από 10 κύπαρο και κ+ στο εσωτερικό1Ου κυτ τάρoυ' χρησιμοποιώνταςτην ενέργεια που προέρχεται από
την υδρόλυση1Ου ΑΤΡ.
αvnγραφη του ΟΝΑ (ΟΝΑ replicatίon)
aπλoειδης (haploid)
Η διεργασία με την οποία παράγεται ένα αντίγραφο ενός μο
Περιλαμβάνει μόνο μια ομάδα χρωμοσωμάτων, Π.Χ. ένα
ρίου ΟΝΑ.
σπερμα1ΟΖωάριο ή ένα βακτήριο (βλ επίσης διπλοειδής).
αντίδραση αφυδότωσης (dehydratίon reactίon)
-
βλ αντίδραση
συμπύκνωσης.
απλότυπος
(haplotype block)
Συνδυασμός αλ/ηί\ομόρφων και άλλων ΟΝΑ δεικτών που μεταβιβάζονται ως σύνολο επί πολ/ές γενεές.
αντίδραση συμπύκνωσης Είδος χημικής αντίδρασης στην οποία δύο οργανικά μόρια
απόπτωση
-
βί\. προγραμματισμένος κυπαρικός θάνα1Ος.
συνδέονται μεταξύ 1Ους μ' έναν ομοιοπολικό δεσμό με ταυτό χρονη αφαίρεση ενός μορίου νερού. Αποκαλείται επίσης και αντίδρασης αφυδάτωσης.
απορρυπαντικό Σαπωνοειδής ένωση με μια υδρόφοβη ουρά και μια υδρόφι λη κεφαλή. Χρησιμοποιείται ευρέως από 1Ους βιοχημικούς
αντικωδικόνιο (antίcodon) Άλ/ηλουΧία τριών νουκλεοτιδίων σ' ένα μόριο μεταφορικού
για τη διαλυ1Οποίηση των μεμβρανικών πρωτεϊνών και άλλων υδρόφοβων μορίων.
ΗΝΑ η οποία είναι συμπληρωματική με 10 κωδικόνιο ενός
μορίου αγγελιοφόρουΗΝΑ. Το αντικωδικόνιοσυνταιριάΖεται
αριθμός ανακύκλωσης
(turnover number)
μ' ένα αμινοξύ που συνδέεται ομοιοπολικά με 10 μόριο 1Ου
Στην ενΖυμική κατάλυση, ο αριθμός των μορίων 1Ου υπο
μεταφορικούΗΝΑ.
στρώμα1Ος που μετατρέπονται σε προϊόν ανά δευτερόλεπ1Ο
Γλωσσάριο
1001
και ανά μόριο ενΖUμοu. Παρά το γεγονός ότι ο αριθμός ανα
ρει ένα κόπαρο σε αόξηση ή πολ/απλασιασμό. Παραδείγμα
κόκλωσης διαφορετικών ενΖόμων ποικίλλει πoΛU, αρκετά
τα είναι ο επιδερμικός αuξητικός παράγοντας
χνά ξεπερνά το
1000, ένδειξη
ou-
για την εντuπωσιακή KoτoλUTl
ξητικός παράγοντας των αιμοπεταλίων
(EGF) (PDGF).
και ο OU-
κή ισχό των ενΖόμων.
αφεmρία αντιγραφής (replicatίon οήgin) αρχaιo6ακrήρια
Η θέση ενός βακτηριακοό, ιικοό ή εuκαρuωτικοu χρωμοσώ
Η μια από τις δόο διαιρέσεις των προκαρuωτών. Σuνήθως
ματος από την οποία αρχίζει η αντιγραφή τou
DNA.
βρίσκονται σε αφιλόξενο περιβάλ/ον (π.χ. θερμές πηγές ή α
αφυλετική αναπαραγωγή
λατοόΧο νερό).
Κάθε είδος αναπαραγωγής (όπως η εκβλάστηση στο
αρχέγονο (σrε?ιΕXΙaίO) κύτταρο
(stem cell)
Hydra,
η διμερής σχάση στα βακτήρια, η μιτωτική διαίρεση των εuκα
Σχετικά αδιαφοροποίητο κόπαρο ικανό να σuνεχίσει να διαι
ρuωτικών μικροοργανισμών) ποι! δεν περιλαμβάνει δημι
ρείται επ' αόριστον. Αποδίδει θuγατρικά κόπαρα ποι! διαφο
οuργία και σόντηξη γαμετών. Παράγει ένα άτομο γενετικώς
ροποιοόνται σε ειδικοός τuποuς κuπάρων.
ταuτόσημο με τον γονέα.
aτoμικό βάρος
Β-πωχωτό φύλ/ο
Η μάΖα τou ατόμοι! ενός ισοτόποι! εκφραΖόμενη σε
daltons.
aτoμικός αριθμός
Πρόωπο πτUXωσης ποι! uπάρχει σε
W
πολ/ές πρωτεΤνες, στο οποίο γειτονικές ~ περιοΧές μιας πολuπεπτιδικής αλuσί-
Ο αριθμός των πρωτονίων στον πuρήνα τou ατόμοι! ενός στοι
δας σuνδuάΖΟνται μεταξό τοuς με δε-
χείοu.
σμοός uδρογόνοu και σχηματίΖοuν μια
άκαμπτη, επίπεδη δομή. άτομο
Το μικρότερο σωματίδιο ενός στοιχείοι! ποι! εξακολοuθεί να διατηρεί τις χαρακτηριστικές χημικές ιδιότητές τou.
6ακrήριo Γενικό όνομα για ένα προκαρuωτικό κόπαρο. Τα βακτήρια
διακρίνονται σε δόο εξελικτικά αρΧέγονες ομάδες: τα ΑΤΡ
(5' -τριφωσφορική
αδεvoσίνη)
EuBa-
κτήρια (ονομάΖονται επίσης και βακτήρια) και τα Αρχαιοβα
Τριφωσφορικό νοuκλεοτίδιο ποι! αποτελείται από αδενίνη, ρι
κτήρια (επίσης ονομάΖΟνται και Αρχαία).
βόΖη και τρεις φωσφορικές ομάδες. Είναι ο κόριος φορέας της
χημικής ενέργειας στα κόπαρα. Οι τελικές φωσφορικές ομά
6aκτnριoρoδoψίνη
δες είναι πολό δραστικές από χημική άποψη: η uδρόλuση ή η
Φωτοαπορροφητική πρωτεΤνη με ιώδες χρώμα ποι! uπάρχει
μεταφορά τοuς σ' ένα άλ/ο μόριο ΣUμβαίνει με απελεuθέρωση
στην κuπαρική μεμβράνη τou αλόφιλοι! βακτηρίοι!
μεγάλης ποσότητας ελεόθερης ενέργειας (βλ. Εικόνα
terium halobium:
2-23).
Halobac-
αντλεί πρωτόνια έξω από το κόπαρο σε α
πάντηση προς το φως.
αριθμός του Ο
Avogadro αριθμός των daltons
(μονάδες μοριακής μάΖας) σ' ένα
Βασικό σωμάτιο
-
βλ. κεντριόλιο.
γραμμάριο. Ισοόται με τον αριθμό των μορίων σε Μ γραμμά ρια μιας οuσίας με μοριακό βάρος Μ
daltons.
Η τιμή τou είναι
6.02 χ 1023.
Βασικός ΕντΟΠΙΖόμενος κοντά στη βάση. Η βασική επιφάνεια ενός
κuπάροu βρίσκεται απέναντι στην κορuφαία επιφάνεια (βλ. ασrέρας
βασικός uμένας).
Αστεροειδές σόστημα μικροσωληνίσκων ποι! εκφόονται από ένα κεντροσωμάτιο ή από τον ένα πόλο της μιτωτικής ατρά
Εκείνος ποι! έχει τις ιδιότητες μιας βάσης. Αλκαλικός.
ΚTou.
αυλός
βασικός
βασικός υμένας
(lumen)
(basaI lamina)
Κοιλότητα ποι! περικλείεται από ένα επιθηλιακό φόλ/ο (σ' έ
Λεπτή στιβάδα εξωκuτ
ναν ιστό) ή από μια μεμβράνη (σ' ένα κόπαρο), για παράδειγ
τάριοι! στρώματος ποι!
μα, ο αuλός τou ενδοπλασματικοό δικτUοu.
διαχωρίΖει
επιθηλιακά
φόλλα και πολλά είδη
αυξητικός παρ6γovτας
(growth factor)
Εξωκuπάριο σηματοδοτικό πολuπεπτιδικό μόριο ποι! διεγεί-
1002
Γλωσσάριο
κuπάρων, όπως τα μuϊ-
κά κόπαρα ή τα λιποκότ-
ωρα, από τον συνδετικό ισrό. Μερικές φορές ονομάΖεΤαΙ βα
cDNA -
Βλ συμπΛηρωματικό
DNA
σική μεμβράνη.
γαμέmς
Είδος κυπάρων ενός διπΛοειδούς οργανισμού που φέρει μό
βάση
Μόριο που παραλαμβάνει ένα πρωτόνιο σε διάλυμα. Ο ίδιος
νο μια ομάδα χρωμοσωμάτων και έχει εξειδικευτεί για φυΛε
όρος αναφέρεΤαΙ επίσης σrις πουρίνες και τις πυριμιδίνες του
τική αναπαραγωγή. Ένα σπερμαΤΟΖωάριο ή ένα ωάριο.
DNA και ίΟυ RNA. βιβλιοθήκη
γαμεrικό (βλασrικό) κύπαρο
DNA (DNA library)
ΣυΛΛογή κΛωνΟΠΟ1ημένων μορίων
DNA.
Συνήθως αντι
προσωπεύει είτε ένα ολόκΛηρο γονιδίωμα (γενωμική βι βΛιοθήκη) είτε τ' αντίγραφα των μορίων
mRNA που απομο (cDNA βι
νώνονται από ένα κύπαρο ή ένα ισrΙKό δείγμα βΛιοθήκη)
(germ cell)
Κύπαρο που ανήκει σrην εξειδικευμένη κυπαρική σειρά που
.
σχηματίΖει τους γαμέτες (ωάρια ή σπερμαΤΟΖωάρια) ενός πο
Λυκύπαρου Ζώου ή φυτού.
GDP (5'
διφωσφορική γουανοσίvn)
Νουκλεοτίδιο που παράγεΤαΙ με υδρόΛυση της τεΛικής φω σφορικής ομάδας του GTP. ΜόΛις βρεθεί εΛεύθερο σε διάλυ μα, το
βιοσυνθετικ6ς
ΑναφέρεΤαΙ σrις διεργασίες με τις οποίες τα Ζωντανά κύπαρα παράγουν οργανικά μόρια.
GDP επαναφωσφορυΛιώνεται
γρήγορα σε
GTP, συνή
θως με μεταφορά της τεΛικής φωσφορικής ομάδας από το ΑΤΡ σrην αντίδραση: ΑΤΡ
+ GDP ~ ADP + GTP.
γενεαλογικό δέντρο
βιοχημεία Η μελέτη των χημικών ενώσεων και αντιδράσεων που συνα ντούμε σroυς Ζωντανούς οργανισμούς.
βλεφαρίδa!Kρoσσός
Η προέΛευση ενός Ζώου.
γενετική (genetίcs) Η μεΛέτη των γονιδίων ενός οργανισμού που βασίζεται σrην
(ciliurn)
Τριχοειδής προσεκβοΛή της επιφάνειας ενός κυπάρου που περιέχει ένα κεντρικό δεμάτιο μικροσωΛηνίσκων και μπορεί
κληρονομικότητα και σrην ΠOΙKιiΊότηω.
γενετική διαλογή (genetίc
screen)
να εκτεΛεί επανειΛημμένους ΧΤόπους. ΠοΛυάριθμοι κροσσοί
ΑναΖήτηση ενός ορισμένου φαινοτόπου μέσα σε μια συλ/ογή
προωθούν τη μετακινηση υγρών πάνω από επιθηΛιακά φύΛ
μεταλ/αγμένων σrεΛεxών.
Λα, Π.Χ. σroυς πνεύμονες.
γενετική μηχανική (genetίc engineeήng) βλεφαριδοφ6ρο
(ciliate)
συνδυασμένου
-
βΛ. τεχνοΛογία ανα
DNA
Τύπος μονοκύπαρου ευκαρυωτικού οργανισμού (πρωτόΖωο) που έχει σrην επιφάνειά του ποΛυάριθμες βΛεφαρίδες. Οι
γενετικός κώδικας (genetίc
code)
βΛεφαρίδες χρησιμοποιούνται για κολύμβηση, σίτιση και για
Το σύνοΛο των κανόνων που καθορίζουν την αντισr01Xία α
τη σύλ/ηψη των θηραμάτων.
νάμεσα σrις φιπλέτες των νουκλεοτιδίων του
DNA ή του RNA
(κωδικόνια) και σr' αμινοξέα των πρωτεϊνών.
VΠ1BX
Η μέγισrη Ταχύτητα μιας ενΖυμικής αντίδρασης, που επιτυγ
γενετικ6ς χάρτης
Χάνεται αμέσως μετά την προσθήκη του υπoσrρώμαίOς σε συ
Γραφική αναπαράσrαση της σειράς των γονιδίων σrα χρωμο
γκέντρωση κορεσμού.
σώμαω σε απoσrάσεις οι οποίες αντισroιxoύν σroν βαθμό α να συνδυασμού που συμβαίνει μεταξύ τους.
C-όκρο (καρβοξυτελικό όκρο) Το άκρο μιας ποΛυπεmιδικής αΛυσίδας που φέρει μια εΛεύ
θερη ομάδα καρβοξυΛικού οξέος.
γενικός μεταγρaφικ6ς παράγοντας Κάθε πρωτείνη που πρέπει να συναρμοΛογηθεί γύρω από την αλ/ηΛουΧία ΤΑΤΑ για ν' αρχίσει η μεταγραφή των περισσότε
Cd κινάση (κινάση που εξαρτάται dependent kinase)
από mv κυκλίvn,
cyclin
Πρωτεϊνική κινάση η οποία για να δράσει πρέπει να σχηματί
ρων ευκαρυωτικών γονιδίων.
γλυκογόνο
σει σύμπΛοκο με ένα μόριο κυκλίνης. Διαφορετικά σύμΜοκα
ΠοΛυσακχαρίτης που αποτεΛείΤαΙ αΠOκλεισrΙKά από μονάδες
κινάσης-κυκΛίνης πυροδοτούν TG διάφορα βήματα του
γΛυκόΖης και χρησιμοποιείΤαΙ για αποθήκευση ενέργειας σrα
Cd
κύκλου της κυπαρικής διαίρεσης με φωσφορυΛίωση ειδικών
Ζωικά κύπαρα. Μεγάλα κοκκία γΛυκογόνου αφθονούν ιδιαί
πρωτεϊνών-σrόxων.
τερα σrα ηπατικά και TG μυϊκά κύπαρα.
Γλωσσάριο
1003
γλυΚΟΖαμινογλυκάνη
νεργοποιούνταιαπό την πρόσδεση μιας ορμόνης ή ενός άλ
(GAG)
Οικογένεια πολυσακχαριτών υψηλού μοριακού βάρους που
λου συνδέτη σ' έναν μεμβρανικό υποδοΧέα.
περιέχουν αμινοσάκχαρο και σχηματίΖουν ΠΡOσrατευTlKά πε
γραμμομόριο (mole)
ριβλήματα γύρω από τα Ζωικά κύτταρα.
Μ γραμμάρια μιας ουσίας, όπου Μ η σχετική μοριακή μάΖα
της (μοριακό βάρος). Ένα γραμμομόριο οποιασδήποτε ου
γλυκόΖη Σάκχαρο με έξι άτομα άνθρακα που παίζει κύριο ρόλο σroν μετα βολισμό των Ζωντανών κυττά
ρων. Αποθηκεύεται σε πολυμερή μορφή ως γλυκογόνο σrα Ζωικά
κύτταρα και ως άμυλο σrα φυTlκά κύτταρα (βλ. Παράρτημα
σίας περιέχει
ς:Η 2 ΟΗ
Η/Υ --ο" ΟΗ Ι
c
Η
Ι'\.. ΟΗ
ΗΟ ~I
ν
c
GTP (5' τριφωσφορική
γουανοσίνη)
Κύριο τριφωσφορικό νουκλεοτίδιο που χρησιμοποιείται σrη
Η ./ ι
I~ Η
σύνθεση του ΗΝΑ και σε μερικές αντιδράσεις μεταφοράς ε
C-C Ι Η
6.02 χ 2023 μόρια.
Ι ΟΗ
νέργειας. Παίζει ειδικό ρόλο σrη συναρμολόγηση των μικρο σωληνίσκων, σrην πρωτεϊνοσύνθεση και σrην κυτταρική ση
2-3).
ματοδότηση.
γλυκολιπίδιο Μεμβρανικό λιπίδιο που φέρει μια μικρή υδατανθρακική α λυσίδα συνδεδεμένη με μια υδρόφοβη ουρά.
DAG -
Βλ. διακυλογλυκερόλη.
δακώMoςγ~oυμπoυλίνης Πρωτεϊνικό σύμπλοκο σrα κεντροσωμάτια που οργανώνει τη
γλυκόλυση Οικουμενική μεταβολική οδός σro κυτταροδιάλυμα, κατά την οποία τα σάκχαρα αποδομούνται ατελώς και παράγεται ΑΤΡ.
συναρμολόγηση των μικροσωληνίσκων.
dalton Μονάδα μοριακής μάΖας. ΟρίΖεται ως το ένα δωδέκατο της
γλυκοπρωτεΤνη Κάθε πρωτεΤνη που φέρει μια ή περισσότερες ομοιοπολικά συνδεδεμένες ολιγοσακχαριτικές αλυσίδες. ΓλυκοπρωτεΤνες είναι οι περισσότερες εκκρινόμενες πρωτεΤνες και οι περισ σότερες πρωτεΤνες που εκτίθενται σrην εξωτερική επιφάνεια της κυτταρικής μεμβράνης.
μάΖας ενός ατόμου άνθρακα 12 (1.66χ 10-24 g). Είναι περί που ίσο με τη μάΖα ενός ατόμου υδρογόνου.
δεαKεruλάση των ιστονών
(histone deacetylase)
ΈνΖυμο που αφαιρεί ακετυλομάδες από τα κατάλοιπα λυσί νης των ιστονών. Η Kατάσrαση ακετυλίωσης των ισroνών λει τουργεί ως σήμα που προσελκύει άλλες πρωτε'ίνες οι οποίες
γονιοιο
ενεργοποιούν ή Kατασrέλ/oυν τη μεταγραφή.
Η περιοχή του ΟΝΑ που ελέγχει ένα ξεxωρισrό κληρονομικό
χαρακτηριστικό ενός οργανισμού. Συνήθως αντισroιxεί μόνο σε μια πρωτεωη ή ΗΝΑ.
δέκτης ηλεκτρονίων
(electron acceptor)
Άτομο ή μόριο που εύκολα προσλαμβάνει ηλεκτρόνια. Μόλις προσλάβει ένα ηλεκτρόνιο, λέμε ότι υπέσrη αναγωγή.
γονιδίωμα
(genome)
Το σύνολο των γενεTlκών πληροφοριών ενός κυττάρου ή ε
δεvδρπης
(dendrite)
νός οργανισμού (ή τα μόρια ΟΝΑ που μεταφέρουν αυτές τις
Αποφυάδα ενός νευρικού κυττάρου, συνήθως διακλαδισμέ
πληροφορίες)
νη και σχετικά βραχεία, που δέχεται ερεθίσματα από άλλα
.
νευρικά κύτταρα.
γονιμοποίηση
Ακολουθία γεγονότων που αρχίΖει όταν ένα σπερμαΤΟΖωάριο
δεoξυρι6oνoυκλεϊvικό οξύ
-
βλ. ΟΝΑ.
έλθει σ' επαφή μ' ένα ωάριο, οπότε ακολουθεί σύντηξή τους και περαιτέρω ανάπτυξη.
δέσμευση του αΖώτου
(nitrogen fίxatίoη)
Η ενσωμάτωση του αΖώτου από την ατμόσφαιρα σε αΖωτούχα
γονότυπος
οργανικά μόρια. Διενεργείται από βακτήρια του εδάφους και
(genotype)
Το ειδικό σύνολο των γονιδίων που φέρει ένα ορισμένο κύτ
από κυανοβακτήρια.
ταρo ή οργανισμός.
δέσμευση του άνθρακα
G πρωτεΤνες (G proteins) Μεγάλη οικογένεια πρωτεϊνών που προσδένουν
GTP.
Είναι
σημαντικά ενδιάμεσα σrις σηματοδοτικές οδούς. Συνήθως ε-
1004
Γλωσσάριο
(earbon fίxatίon)
Η διεργασία με την οποία τα πράσινα φυτά ενσωματώνουν ά τομα άνθρακα από το διοξείδιο του άνθρακα της ατμόσφαι
ρας σε σάκχαρα. Το δεύτερο στάδιο της φωτοσύνθεσης.
διαλυτή ουσία
δεσμός - βλ χημικός δεσμός.
(solute)
Κάθε μόριο διαλυμένο σ' ένα υγρό. Το υγρό είναι ο διαλύτης.
δεσμός υδρογόνου διαμόρφωση(conformatίon)
Ασθενής χημικός δεσμός ανάμεσα σ' ένα ηλεκφοαρνητικό άτομο, όπως
ένα άτομο αΖώτου ή οξυγόνου, και σ' ένα άτομο υδρογόνου συνδεδεμένο
Η"
Ειδική διάταξη των ατόμων ενός μορίου. Το ακριβές σχήμα OIIIIIIIIIlIIH - 0 -
Η/
μιας πρωτείνης ή ενός μακρομορίουσε φεις διαστάσεις.
διαυλική πρωτείνη (channel protein)
μ' ένα άλ/ο ηλεκτροαρνητικό άτομο.
Μια πρωτείνη που σχηματίΖει έναν στενό υδρόφιλο πόρο
δεσμός υψηλής ενέργειας
διαμέσου μιας μεμβράνης, επιτρέποντας σε ιόντα ή μικρά
(high-energy bond)
Ομοιοπολικός δεσμός του οποίου η υδρόλυση απελευθερώ νει ασυνήθιστα μεγάλη ποσότητα ελεύθερης ενέργειας υπό
τις συνθήκες που επικρατούν στο κύπαρο. Παράδειγμα είναι οι φωσφοανυδριτικοί δεσμοί του ΑΤΡ και ο θειολεστερικός
δεσμός του ακετυλο-CοΑ.
άλλη.
δίαυλος
ΟΟ
Υδρόφιλος πόρος με πρωτεϊνι κά τοιΧώματα σε μια λιπιδική μεμβράνηο οποίος επιτρέπειτη
δεσμοσωμάτιο(desmosome)
διέλευση επιλεγμένωνιόντων ή
Εξειδικευμένος διακυπάριος σύν
μορίων.
δεσμος. Συνήθως σχηματίΖεται α
πό δύο επιθηλιακά κύπαρα, όπου
δίαυλος ελεγχόμενος από το δυναμικό
μεσολαβούν μόρια καντερίνης και
(voltage-gated channel)
Μεμβρανική πρωτείνη που επιτρέπει εκλεκτικά σε ορισμένα
χαρακτηρίΖεται από πυκνές πρωτε
ιόντα, όπως το
ϊνικές πλάκες στις οποίες εισχω
Na +, να διαπεράσουνμια μεμβράνη. Ο δίαυ
λος ανοίγει από αλ/αγές του δυναμικούτης μεμβράνης. Βρί
ρούν ενδιάμεσα ινίδια των δύο γει
σκεται κυρίως σε ηλεκτρικώς διεγειρόμενακύπαρα, όπως τα
τονικών κυπάρων.
δεύτερος αγγελιοφόρος
μόρια να μετακινούνται παθητικά από τη μια πλευρά στην
νευρικά και τα μυϊκά κύπαρα.
(second messenger)
Μικρό ενδοκυπάριο μόριο που σχηματίΖεται στο κυπαροδιά λυμα ή απελευθερώνεται εκεί σε απάντηση προς ένα εξωκυτ τάριο σήμα. Ο δεύτερος αΥΥελιοφόρος μεταδίδει το σήμα στο εσωτερικό του κυπάρου. Παραδείγματα είναι το και το Ca 2+.
cAMP,
η ΙΡ3
δίαυλος ελεγχόμενος από συνδέτη
(ligand-gated channel) Ιοντικός δίαυλος που ανοίγει από την πρόσδεση ενός μικρού μορί ου, όπως ένας νευροδιαβιβαστής.
δίαυλος ιόντων (ίοη
δευτεροταγής δομή
channel) ή ΙOVΤΙKός
δίαυλος
Διαμεμβρανική πρωτε'ίνη που σχηματίΖει έναν υδρόφιλο δί
Κανονικό, τοπικό πρότυπο πτύχωσης ενός πολυμερούς μορίου. Στις πρωτεΤνες, οι α-έλικες και τα β-πτυχωτά φύλ
λα.
αυλο διαμέσου της λιπιδlκής διπλοστιβάδας μέσω του οποίου
μπορεί να διαχυθούν συγκεκριμένα ανόργανα ιόντα ακολου θώντας την ηλεκτροχημική βαθμίδωσή τους.
διαγovιδιαKός
(transgenic)
δίαυλος που ενεργοποιείται από μηχανική δύναμη
(Για ένα φυτό ή Ζώο) που διαθέτει, σε σταθερά ενσωματωμέ
(stress-actίvated
νη μορφή, ένα ή περισσότερα γονίδια προερχόμενα από ένα
Μεμβρανική πρωτείνη που επιφέπει την εκλεκτική είσοδο ει
άλ/ο κύπαρο ή οργανισμό και μπορεί να τα μεταβιβάσει στις
δικών ιόντων σ' ένα κύπαρο και ανοίγει με μηχανική δύναμη.
channel)
επόμενες γενεές.
διαφοροποίηση (differentίatίon)
διακυλογλυκερόλη
(diacylglycerol, DAG)
Λιπίδιο που παράγεται από τη διάσπαση των φωσφολιπι
Η διεργασία με την οποία ένα κύπαρο αλ/άΖει και αποκτά έ να ξεχωριστό εξειδικευμένο γνώρισμα.
δίων lνοσιτόλης σε απάντηση προς εξωκυπάρια σήματα. Αποτελείται από δύο αλυσίδες λιπαρών οξέων συνδεδεμέ
διάχυση
νες με τη γλυκερόλη και λειτουργεί ως σηματοδοτικό μό
Η διασπορά μορίων και μικρών σωματιδίων από μια θέση σε
ριο που συμβάλλει στην ενεργοποίηση της πρωτεϊνικής κι
μια άλλη μέσω τυχαίων κινήσεων που προωθούνται από τη
νάσης
θερμότητα.
C.
Γλωσσάριο
1005
διμερές
ΟΝΑ μικροσυστοιχία (ΟΝΑ microarray)
(dimer)
Μια δομή που αποτελείται από δύο ισοδύναμες υπομο
Γυάλινο πλακίδιο πάνω στο
νάδες. Μερικές φορές, όταν οι δύο υπομονάδες διαφέ
οποίο τοποθετούνται με τα
ρουν, χρησιμοποιείται ο όρος «ετεροδιμερές»
κτική σειρά δεκάδες χιλιάδες
(hetero-
βραχέα μόρια
dimer).
DNA.
Καθένα
από αυτά τα κί\άσματα
δι6ρθωση λαθών
(proofreading) ή έλεγχος πιστ6mτας Η διεργασία με την οποία η DNA πολυμεράση διορθώνει ί\άθη της καθώς μετακινείται κατά μήκος του DNA.
τα
ένα ειδικό γονίδιο και επιτρέ πει να μελετηθούν ταυτόΧρο να τα
διπλή έλικα
DNA
λειτουργεί ως ανιχνευτής για
(double helίx)
mRNA μετάγραφα
χι
λιάδων γονιδίων.
Η τυπική διαμόρφωση ενός μορίου
DNA ΟΝΑ πολυμεράση (ΟΝΑ polymerase)
στην οποία δύο κλώνοι περιελίσσονται ο έ
-
βλ. πολυμεράση.
νας γύρω από τον άλ/ο με Ζευγάρωμα των
δ6mς ηλεκτρονίων
βάσεων ανάμεσα στους κλώνους.
(electron donor)
Μόριο που εύκολα αποδίδει ηλεκτρόνια. Μόλις συμβεί αυτό, διπλοειδής
λέμε ότι υπέστη οξείδωση.
Περιλαμβάνει δύο σύνολα ομόλογων χρωμοσωμάτων και επομένως δύο αντίγραφα κάθε γονιδίου ή γενετικού τό
Drosophila melanogaster Είδος μικρής μύγας, που κοινώς ονομάΖεται φρουτόμυγα.
που.
Χρησιμοποιείται ευρύτατα σε γενετικές μελέτες με αντικείμενο
διπλός δεσμός
την ανάπτυξη.
Είδος χημικού δεσμού ανάμεσα σε δύο άτομα, που σχηματί
δύναμη νοο
Ζεται με συνεισφορά τεσσάρων ηλεκτρονίων.
der Waals
Ασθενής ελκτική δύναμη που οφείλεται σε κυμαινόμενα ηλε
διοaκxαρfmς
κτρικά φορτία η οποία αναπτύσσεται ανάμεσα σε δύο άτομα
Μόριο υδατάνθρακα, όπως η σουκρόΖη, που αποτελείται α
που απέχουν
πό δύο ομοιοπολικά συνδεδεμένες μονοσακχαριτικές μο
να λειτουργούν ισχυρές απωθητικές δυνάμεις.
0.3-0.4 nm.
Σε μικρότερη απόσταση, αρχίΖουν
νάδες.
δυναμική αστάθεια δισθενές
(dynamic instability)
Η ιδιότητα των μικροσωληνίσκων ν' αυξάνουν και να συρρι
(bivalent)
Ένα διπλασιασμένο χρωμόσωμα Ζευγαρωμένο με το ομόλο
κνώνονται επανειΛημμένα με προσθήκη και απώλεια υπομο
γό του διπλασιασμένο χρωμόσωμα στην αρχή της μείωσης.
νάδων τουμπουλίνης στα εκτεθειμένα άκρα τους.
διοουλφυδριλικ6ς δεσμός (δεσμός
δυναμικό δράσης (actίon potentίal)
5-5)
Ομοιοπολικός δεσμός που σχηματίΖεται ανάμεσα σε δύο
Ταχύ, παροδικό, αυτο-διαδιδόμενο ηλεκτρικό σήμα στην κυτ
σουλφυδριλικές ομάδες δύο καταλοίπων κυστεΊνης. Έ
ταριKή μεμβράνη ενός κυττάρου όπως ένας νευρώνας ή ένα
νας κοινός τρόπος για τη σύνδεση δύο πρωτεϊνών ή δια
μυϊκό κύτταρο. Μια νευρική ώση.
φορετικών τμημάτων της ίδιας πρωτεΊνης στον εξωκυττά
δυνείνη
ρω χώρο.
(dynein)
Μέλος της οικογένειας μεγάλων κινητήριων πρωτεϊνών που
διχάλα αντιγραφής (replicatίon
διεκπεραιώνουν μια εξαρτώμενη από το ΑΤΡ μετακίνηση κα
fork)
ΠερΙΟΧή σε σχήμα γ ενός αντιγραφόμενου μορίου
DNA στην
οποία διαχωρίΖΟνται οι δύο αρχικοί κλώνοι και συντίθενται οι
τά μήκος των μικροσωληνίσκων. Η δυνεΊνη είναι υπεύθυνη για την κάμψη των κροσσών.
δύο νέοι θυγατρικοί κλώνοΙ.
ειδικ6mτα
-
βλ. μοριακή ειδικότητα
ΟΝΑ (δεoξυριβoνoυκλεϊVΙK6 οξύ) Δίκλωνο πολυνουκλεοτίδιο που σχηματίΖεται από δύο ξεχω ριστές αλυσίδες δεοξυριβονουκλεοτιδίων. Λειτουργεί ως φο
έκκριση
Παραγωγή και έκλυση μιας ουσίας από ένα κύτταρο.
ρέας των γενετικών πληροφοριών.
εκκρπικό κυστίδιο ΟΝΑ λιγκάση (ΟΝΑ
1006
Γλωσσάριο
Iigase) -
βλ. λιγκάση.
(secretory vesicle)
Μεμβρανικό οργανίδιο στο οποίο αποθηκεύονται πριν από
την απελευθέρωσή τους τα μόρια που προορίζονται για έκκρι
εναρκτήριο
tRNA tRNA που
ση. Μερικές φορές αποκαλείται εκκριτικό κοκκίο επειδή το
Εξειδικευμένο
βαθυχρωματικό περιεΧόμενο κάνει το οργανίδιο να φαίνεται
ρει το αμινοξύ μεθειονίνη.
αρχίζει τη μετάφραση. Πάντοτε φέ
σαν ένα μικρό πυκνό αντικείμενο.
ενδιάμεσο ινίδιο εκμαγείο
(intermediate filarnent)
Ινώδες πρωτεϊνικό νημάτιο (διαμέτρου περίπου
(template)
10 nm)
που
Μια μοριακή δομή που λειτουργεί ως υπόδειγμα για την πα
σχηματίζει σχΟ1νοειδή δεμάτια στα Ζωικά κύπαρα. Συχνά πα
ραγωγή άλλων μορίων. Επομένως, μια ειδική αλληλουΧία
ρέχει εκτατική ισχύ για αντίσταση στην τάση που ασκείται στο
νουκλεοτιδίων του ΟΝΑ μπορεί να δράσει ως εκμαγείο για να
κύπαρο από έξω.
κατευθύνει τη σύνθεση ενός νέου κλώνου ΟΝΑ με συμπλη
ενδOKUΠάρωση (endocytosΊS)
ρωματική αλ/ηλουΧία.
Η πρόσληψη υλικών από ένα κύπαρο με μια εγκόλπωση της
εκτύπωση κατά
Southem (Southem bIottίng)
κυπαρικής μεμβράνης που οδηγεί στη δημιουργία ενός εν
Τεχνική κατά την οποία κλάσματα ΟΝΑ πρώτα διαχωρίΖΟνται
δοκυπάριου, μεμβρανικού κυστιδίου (βλ. επίσης πινοκυπά
με ηλεκτροφόρηση, έπειτα καθηλώνονται σ' ένα φίλτρο και
ρω ση και φαγοκυπάρωση).
τέλος ανιχνεύονται μ' έναν σημασμένο ανιχνευτή (ένα σημα
σμένο νουκλεϊνlκό οξύ). Επινοήθηκε από τον
Ed Southern.
ενδοκυπάρωση διαμεσολαβούμενη από υποδοχείς
(receptor-
mediated endocytosΊS) εKφραzόμεvn αλ/nλoυXΊα-σήμα
(expressed sequence tag, EST) Άλ/ηλουΧία νουκλεοτιδίων (μήκους συνήθως 300-500 νου κλεοτιδίων) που προέρχεται από το mRNA ενός οργανισμού. Μεγάλες συλ/ογές EST χρησιμεύουν επειδή επισημαίνουν
Μηχανισμός επιλεκτικής πρόσληψης από τα Ζωικά κύπαρα
στον οποίο ένα μακρομόριο προσδένεται σ' έναν υποδοΧέα της κυπαρικής μεμβράνης και εισέρχεται στο κύπαρο ως κυ
στίδιο επικαλυμμένο με κλαθρίνη.
τις κωδικοποιητικές περιοχές των γονιδιωμάτων.
ενδοπλασμαπκό δίκτυο έκφραση γονιδίου
retίculum,
(gene expression)
(endoplasmic
ER)
Η διεργασία με την οποία ένα γονίδιο ασκεί τη δράση του σ'
Ένα λαβυρινθώδες μεμβρανικό διαμέ
ένα κύπαρο ή έναν οργανισμό, συνήθως κατευθύνοντας τη
ρισμα στο κυπαρόπλασμα των ευκα
σύνθεση ενός μορίου ΗΝΑ που μπορεί να μεταφραστεί σε μια
ρυωτικών κυπάρων, όπου εκκρίνονται
πρωτεΙνη με χαρακτηριστική δράση.
τα λιπίδια και παρασκευάΖΟνται ΟΙ μεμ βρανικές πρωτείνες.
ελασματοπ6διο
(larnel1ipodium)
Δυναμική φυλ/οειδής προσεκβολή της κυπαρικής μεμβρά
νης ενός Ζωικού κυπάρου, ιδίως όταν μεταναστεύει πάνω σε
ενδοσωμάτιο Μεμβρανικό διαμέρισμα ενός ευκαρυωτικού κυπάρου διαμέ
μια επιφάνεια.
σου του οποίου τα ενδοκυπαρωμένα υλικά προχωρούν προς
ελεύθερη ενέργεια
τα λυσοσωμάτια.
(G)
Ενέργεια που μπορεί ν' αποσπαστεί από ένα σύστημα για την εκτέλεση χρήσιμου έργου, όπως η προώθηση μιας χημικής
ενέργεια δεσμού Η ισχύς του χημικού δεσμού ανάμεσα σε δύο άτομα, η οποία
αντίδρασης.
μετράται από την ενέργεια (σε XιiΊlOθερμίδες!γραμμoμόριo) που χρειάΖεται για τη διάσπασή του.
έλικα Επιμήκης δομή που περιελίσσεται κανονικά
γύρω από έναν κεντρικό άξονα (βλ. επίσης ενέργεια ενεργοποίησης
α-έλικα).
Η επιπρόσθετη ενέργεια που πρέπει ν' αποκτήσει ένα μόριο
εμβρυϊκό αρχέγονο κύπαρο (embιyonic
stem οοll, ES οοll)
Αδιαφοροποίητο κύπαρο που προέρχεται από την έσω κυπα
για να ξεπεράσει το φράγμα της ενέργειας για να συμμετά σχει σε μια συγκεκριμένη χημική αντίδραση.
ρική μάΖα ενός πρώιμου εμβρύου θηλαστικού. Τα εμβρυϊκά αρΧέγονα κύπαρα μπορεί να διατηρηθούν επ' αόριστον ως
ενεργό κέντρο (actίve
site)
κυπαρική σειρά σε καλ/ιέργεια. Ωστόσο, όταν τοποθετηθούν
Η πεΡΙΟΧή της επιφάνειας ενός ενΖύμου στην οποία προσδέ
στο κατάλ/ηλο περιβάλ/ον μπορεί να διαφοροποιηθούν σε
νεται ένα μόριο υποστρώματος προτού συμμετάσχει σε μια
οποιοδήποτε είδος κυπάρων του ενήλικου σώματος.
καταλυόμενη αντίδραση.
Γλωσσάριο
1007
εξίσωση
ενεργοποιημένος φορέας
Nemst
Μικρό μόριο που περιέχει μια χημική ομάδα σε δεσμό υψηλής
Ποσοτική έκφραση που συσχετίζει τον λόγο των συγκεντρώ
ενέργειας. Λειτουργεί ως δότης ενέργειας ή μιας χημικής ομά
σεων ενός ιόντος στις δύο πλευρές μιας διαπερατής μεμβρά
δας σε πολ/ές διαφορετικές χημικές αντιδράσεις. Χαρακτηριστι
νης σε κατάαταση ισορροπίας με τη διαφορά δυναμικού δια
κά παραδείγματα είναι το ΑΤΡ, το ακετυλο-CοΑ και το NADH.
μέσου της μεμβράνης.
ενεργοποιητής (actίvator)
εξόvιo
Στα βακτήρια, μια πρωτεΤνη ποι> προσδένεται σε μια ειδική περιοχή του
DNA για να
επιτρέψει τη μεταγραφή ενός γειτο
νικού γονιδίου.
(exon)
Το τμήμα ενός ευκαρυωτικού γονιδίου που μεταγράφεται σε ΗΝΑ και κωδικοποιεί την αλ/ηλουΧία των αμινοξέων ενός τμήματος μιας πρωτεΤνης (βλ. επίσης ιντρόνιο).
ενεργός μεταφορά
εξωKuπάριo στρώμα (extracellUΙar matrίx)
Η μετακίνηση ενός μορίου διαμέσου μιας μεμβράνης που
Περίπλοκο δίκτυο πολυσακχαριτών (όπως οι γλυΚΟΖαμινο
προωθείται από την υδρόλυση του ΑΤΡ ή κάποιο άλ/ο είδος
γλυκάνες ή η κυτταρίνη) και πρωτεϊνών (όπως το κολ/αγόνο)
μεταβολικής ενέργειας.
που εκκρίνονται από τα κύτταρα. Ένα δομικό συατατικό των ιατών που επίσης επηρεάΖει την ανάπτυξη και τη φυσιολογία
ένζυμο
τους.
Μια πρωτεΤνη που καταλύει μια ειδική χημική αντίδραση.
εξωKUΠόρωση
ένζυμο περιορισμού (restrίctίon
enzyme) ή νουκλεάση περιορι σμού (restrictίon nuclease)
κύτταρο τα περισσότερα εκκρινόμενα μόρια. Τα μόρια ou-
σκευάΖΟνται σε μεμβρανικά κυατίδια τα οποία συντήκονται με
Μια νουκλεάση που αναγνωρίΖει μια ειδική βραχεία αλ/ηλουΧΊα νου
κλεοτιδίων του
την κυτταρική μεμβράνη και απελευθερώνουν το περιεΧόμε
illt,
DNA και διασπά το
DNA σε αυτή την αλ/ηλουΧία.
Τα
νό τους ατον εξωκυττάριο Χώρο.
~~
διαφορετικά ένΖυμα περιορισμού νουκλεοτιδίων.
καθώς ωριμάΖεΙ. Για ένα ευκαρυωnκό ΗΝΑ, η επεξεργασία
Χρησι
συνήθως περιλαμβάνει την προσθήκη της καλύmρας, τη συρ
μοποιούνται ευρέως στην τεχνολο
γία του ανασυνδυασμένου ενισχυτής
ραφή και την πολυαδενυλίωση.
DNA.
εωδιόρθωση aταίριαστων Ζευγών
(enhancer)
Ρυθμιστική αλ/ηλουΧία του
DNA ατην
οποία ηροσδένονται
ρυθμιστικές πρωτεΛ/ες επηρεάζοντας τη μεταγραφή ενός δομι κού γονιδίου το οποίο μπορεί ν' απέχει Χιλιάδες Ζεύγη βάσεων.
Διεργασία με την οποία ένα μόριο
DNA ανασυνδυάΖεται
με έ
να άλ/ο μόριο και ενσωματώνεται σε αυτό. Για παράδειγμα, το γονιδίωμα ενός ρετροϊού ενσωματώνεται στο γονιδίωμα ε νός κυττάρου-ξενιστή.
(entropy)
Θερμοδυναμικός όρος που μετρά τον βαθμό της αταξίας ενός
(mismatch repair)
Σημαντικός μηχανισμός επιδιόρθωσης λαθών κατά την αντι γραφή του
DNA.
Πυροδοτείται από την παρουσία αταίρια
ατων Ζευγών βάσεων.
επιδιόρθωση του ΟΝΑ (ΟΝΑ
ενσωμάτωση (integratίon)
εντροπία
επεξεργασία RNA Γενικός όρος για τις τροποποιήσεις που υφίαταται ένα ΗΝΑ
αναγνωρίζουν διαφορετικές αλ/η
λουΧίες
(exocytosis)
Η διεργασία με την οποία εξάγονται από ένα ευκαρυωnκό
repair)
Όρος που αναφέρεται συνολικά στις διεργασίες που επιδιορ θώνουν τις επιβλαβείς αλ/αγές οι οποίες επηρεάΖουν τη συ νέχεια ή την αλ/ηλουΧία ενός μορίου
DNA.
επιθήλιο Ένα κυτταρικό φύλ/ο που καλύmει ή επενδύει μια εξωτερική επιφάνεια ή μια κοιλότητα.
συστήματος. Όσο μεγαλύτερη είναι η εντροπία τόσο μεγαλύ τερη είναι και η αταξία του συστήματος.
επικαλυμμένο κυατίδιο Μικρό μεμβρανικό οργανίδιο μ' έ
εξέλιξη
ναν κλωβό
(κάλυμμα)
πρωτεϊνών
Σταδιακή αλ/αγή σ' έναν πληθυσμό Ζωντανών οργανισμών
προς την πλευρά του κυτταροδιαλύ
που πραγματοποιείται με μεταλ/άξεις και φυσική επιλογή μέ
ματος. ΣχηματίΖεται με αποκοπή από
σα σε πολ/ές γενεές. Η διεργασία με την οποία δημιουργού
μια επικαλυμμένη περιοχή της μεμ
νται νέα είδη Ζωντανών οργανισμών.
βράνης.
1008
Γλωσσάριο
επιχιασμός
Ζύμωση
(crossing-over)
Η διεργασία με την οποία δύο ομόλογα χρωμοσώματα σπά
Η αποδόμηση οργανικών μορίων χωρίς τη συμμετοχή μορια
Ζουν σε αντίστοιχες θέσεις και επανασυνδέονται για να σχη
κού οξυγόνου. Η οξείδωση είναι λιγότερο πλήρης απ' ό,τι
ματίσουν δύο ανασυνδυασμένα χρωμοσώματα.
στις αερόβιες διεργασίες και αποδίδει λιγότερη ενέργεια.
Escheήchίa
coli (Ε. coli)
Ραβδόσχημο βακτήριο το οποίο
κανονικά βρίσκεται στο παχύ έ-
ντερο των ανθρώπων και άλλων
Q;;e-Q.
ηλεκτρόνιο Θεμελιώδες υποατομικό σωματίδιο. Η μονάδα του αρνητικού φορτίου
(e-).
ηλεκτροχημική βαθμίδωση
θηλαστικών και χρησιμοποιείται
(electrochemical gradient)
Προωθητική δύναμη που αναγκάΖει ένα ιόν να μετακινηθεί
ευρύτατα στη βιοϊατρική έρευνα.
διαμέσου μιας μεμβράνης. Προκαλείται από διαφορές της
εσωτερική μεμβράνη
συγκέντρωσης των ιόντων και του ηλεκτρικού δυναμικού στις
Μεμβράνη ενός ευκαρυωτικού κυττάρου διαφορετική από
δύο πλευρές της μεμβράνης.
την κυτταρική μεμβράνη. Παράδειγμα είναι οι μεμβράνες του ενδοπλασματικού δικτύου και της συσκευής
ημιδεσμοσωμ6τιο
Golgi.
Εξειδικευμένη κυτταρική συμβολή ανάμεσα σ' ένα επιθηλια
κό κύτταρο και στον υποκείμενο βασικό υμένα.
εrερόzυγoς Οργανισμός με ανόμοια αλ/ηλόμορφα για ένα γονίδιο.
θειολεστερικός δεσμός εrερoxρωματίνη
Δεσμός υψηλής ενέργειας που σχηματίΖεται με μια αντίδρα
(heterochromatin)
Περιοχή ενός χρωμοσώματος που παραμένει ασυνήθιστα συ
ση συμπύκνωσης ανάμεσα σε μια όξινη ομάδα (ακυλομάδα)
μπυκνωμένη και μεταγραφικά ανενεργός κατά τη μεσόφαση.
και μια θειολική ομάδα
(-SH). Για παράδειγμα, βρίσκεται στο
OKEIυAoCoA και σε πολλά σύμπλοκα ενΖύμου-υποστρώμα ευβακτήρια (eubacteήa)
τος.
Ο κατάλ/ηλος όρος για τα κοινά βακτήρια. Χρησιμοποιείται
θερμίδα (caιοήe)
για να τα διακρίνει από τα αρχαιοβακτήρια.
Μονάδα θερμότητας. Μια θερμίδα είναι η ποσότητα της θερ
ευκαρυώmς
μότητας που χρειάΖεται για ν' αυξηθεί η θερμοκρασία
Ζωντανός οργανισμός που αποτελείται από ένα ή περισσότε
μαρίου νερού κατά
1 γραμ
1 ο C.
ρα κύτταρα με χαρακτηριστικό πυρήνα και κυτταρόπλασμα. Ο όρος περιλαμβάνει τα Ζώα, τα φυτά, τους μύκητες και τα πρω
θέση πρόσδεσης
(binding site)
Η περιοχή στην επιφάνεια μιας πρωτεl\ιης
τόΖωα, όχι όμως και τα βακτήρια (προκαρυώτες).
λότητα ή μια αύλακα
Ζεύγος βάσεων
συνήθως μια κοι
η οποία έχει συμπληρωματικό σχήμα
μ' ένα άλ/ο μόριο (τον συνδέτη) και επομένως μπορεί να το
Δύο νουκλεοτίδια σ' ένα μόριο ΗΝΑ ή
DNA που
νουν με δεσμούς υδρογόνου, για παράδειγμα, το και το Α με το Τ ή το
-
-
Ζευγαρώ
προσδέσει μέσω του σχηματισμού πολ/απλών ασθενών (μη
G με το C
ομοιοπολικών) δεσμών.
U. ίη VΊtro
Όρος που χρησιμοποιείται από τους βιοχημικούς για να περι
Ζυγώmς Διπί\οειδές κύτταρο που σχηματίζεται από τη σύντηξη ενός αρσε νικού και ενός θηλυκού γαμέτη. Ένα γονιμοποιημένο ωάριο.
γραφεί μια διεργασία που πραγματοποιείται σ' ένα απομονω μένο υποκυτταρικό εκΧύλισμα. Επίσης, χρησιμοποιείται από τους κυτταρικούς βιολόγους κατά την αναφορά σε κύτταρα
που αυξάνουν σε καλ/ιέργεια.
Ζύμη Κοινός όρος για αρκετές οι κογένειες μονοκύτταρων μυ
κήτων.
Περιλαμβάνει
είδη
ίηvίνo
Σ' ένα ακέραιο κύτταρο ή οργανισμό.
που χρησιμοποιούνται για τη Ζύμωση της μπύρας και την
παρασκευή του ψωμιού, ό
ινοβλάστη (fίbroblast) Κοινό είδος κυττάρων που βρίσκεται στον συνδετικό ιστό και
πως επίσης και είδη που προ
εκκρίνει ένα εξωκυττάριο στρώμα πλούσιο σε κολ/αγόνο και
καλούν νοσήματα.
άλ/α μακρομόρια. Μεταναστεύει και πολ/απλασιάΖεται γρή-
Γλωσσάριο
1009
γορα κατά την επούλωση των τραυμάτων και σε ιστική καλ
νιστή, από το οποίο απελευθερώνονται νέα σωματίδια ιού για
λιέργεια.
να μολύνουν άλ/α κύπαρα. Συχνά είναι παθογόνος.
ινοπ6διο (fίlopodiurn)
ισομερές (σrερεoϊσoμερές)
Μακριά, λεmή αποφυάδα στην επιφάνεια ενός Ζωικού κυπά
Μέλος μιας ομάδας ουσιών που περιέχουν τα ίδια άτομα και
ρου που περιέχει ακτίνη. Μερικές φορές έχει εξερευνητική
έχουν τον ίδιο χημικό τύπο (π.χ.
λειτουργία, όπως στον αυξητικό κώνο ενός αναΠΤUσσόμενOυ
ως προς τη χωροταξικήδιάταξη αυτών των ατόμων. Δύο οπτι
νευρικού κυπάρου.
κά ισομερή είναι κατοπτρικά είδωλα το ένα του άλ/ου.
ινοσπόλη
ΟΗ
Σάκχαρο με έξι υδροξυλομάδες που αποτελεί το υδατανθρακικό τμήμα των φωσφολιπιδίων της ινοσιτόλης.
H~ ΟΗ ΟΗ ΗΟ
ΟΗ
ισομορφή
αλ/ά διαφέρουν
(isoform)
Μια από τις διάφορες μορφές της ίδιας πρωτε'fνης που διαφέ
ρουν κάπως ως προς την αλληλουΧία των αμινοξέων τους. Μπορεί να παράγονται από διαφορετικά γονίδια ή με εναλ/α κτική συρραφή
Μρ6νιο (ίηποη)
C6 H120 6 ),
(alternative splicing) RNA μεταγράφων
του ί
διου γονιδίου.
Η περιοχή ενός ευκαρυωτικούγονιδίου που δεν κωδικοποιεί
μια πρωτεϊνική αλληλουΧία αλ/ά μεταγράφεταισε
RNA και
ισορροπία
στη συνέχεια αφαιρείται με τη διεργασία της συρραφής του
Σε χημικό πλαίσιο, μια κατάσταση στην οποία δύο αντιστρε
RNA έτσι
πτές αντιδράσεις πραγματοποιούνται με την ίδια ακριβώς τα
ώστε να παραΧθεί
mRNA.
(ΟνομάΖεται έτσι επειδή
παρεμβάλ/εται ανάμεσα στα τμήματα του
RNA που
κωδικο
Χύτητα, οπότε δεν συμβαίνει καμιά χημική μεταβολή.
ποιούν πρωτεΤνες).
ισότοπο ινώδης πρωτείνη
(isotope)
Μια από τις μορφές ενός ατόμου που έχουν την ίδια χημεία
Μια πρωτεΤνη με επίμηκες σχήμα. Συνήθως, μια πρωτεΤνη, ό
αλ/ά διαφέρουν ως προς τον ατομικό αριθμό. Μπορεί να εί
πως το κολ/αγόνοή η πρωτεΤνητων ενδιάμεσωνινιδίων, ικα
ναι σταθερό ή ραδιενεργό.
νή να συγκροτείμακριές νηματοειδείςδομές. ισrόνες
ιόν
Ομάδα βασικών πρωτεϊνών, πλούσιων σε αργινίνη και λυσί
Άτομο ή μόριο που φέρει ένα ηλεκτρικό φορτίο, θετικό ή αρ
νη, που διασυνδέονται με το
DNA στα χρωμοσώματα.
νητικό.
ισrός
ιόν υδρογόνου (Η+)
Οργανωμένο συνάθροισμα εξειδικευμένων κυπάρων που
Ένα πρωτόνιο σε υδατικό διάλυμα εκφράΖει την οξύτητα. Τα
σχηματίζει ένα χαρακτηριστικό μέρος ενός φυτού ή ενός Ζώου.
πρωτόνια αυτά συνδέονται εύκολα με μόρια νερού και σχη
ματίΖουν Η 3 Ο+ (ιόντα υδρωνίου). Έτσι, τα ιόντα υδρογόνου γενικά είναι σπάνια.
Kαθυσrερημένoς κλώνος
(lagging strand)
Ο ένας από τους δύο νεοσυντεθειμένους κλώνους του
DNA σε
μια διχάλα αντιγραφής. Ο καθυστερημένος κλώνος παράγεται σε
ιόν υδρωνίου (Η 3Ο+)
ασυνεχή τμήματα τα οποία αργότερα συνδέονται ομοιοπολικά.
Το ιόν που δημιουργείται από την προσθήκη ενός πρωτονίου καλμοδουΜνη
σ' ένα μόριο νερού.
(CaM)
Μικρή πρωτεΤνη που προσδένει Ca 2 +, η οποία τροποποιείτη ιονπκός δεσμός
(ionic bond)
Ελκτική δύναμη που συγκρατεί δύο ιόντα, το ένα θετικό και το
δραστηριότηταπολ/ών ενΖύμων και άλ/ων πρωτεϊνών σε α-
,
παντηση προς μετα
β ο λ' ες
,
της συγκεντρωσης του
Ca2+ .
άλ/ο αρνητικό.
CaM κινάση (κινάση εξαρτώμενη από το σύμπλοκο ασβεσrίoυ/ καλμοδουΜνης)
ιός Λοιμώδες σωματίδιο που αποτελείται από ένα νουκλεϊνικό οξύ (ΗΝΑ ή
ΈνΖυμο που φωσφορυλιώνει πρωτεΤνες-στόχους σε απάντη ση προς μια αύξηση των ιόντων Ca2+ μέσω της αλ/ηλεπίδρα
DNA) που περικλείεται
σής του με την καλμοδουλίνη.
σ' ένα πρωτε
ϊνικό περίβλημα. Αντιγράφεται με πα ρασιτισμό σε βάρος του αναπαραγω
γικού μηχανισμού ενός κυπάρου-ξε-
1Ο 1Ο
Γλωσσάριο
καντερίνη
Μέλος μιας οικογένειας πρωτεϊνών που μεσολαβούν στην ε-
ξαρτώμενη αηό το ασβέσrιo διακυττάρια προσκόλ/ηση σroυς
κατευθυνόμενη μεταλλαξιOγΈVεση Τεχνική για την εισαγωγή μεταλλάξεων σε ειδικές θέσεις του
Ζωικούς ισroύς.
ΟΝΑ.
KαρβOVΥλOμάδα
(-C=O)
Χημική ομάδα που αποτελείται από ένα ά
τομο άνθρακα ηου συνδέεται με διπλό δε
/
c
Ο
κατιόν
Θετικά φορτισμένο ιόν, όπως το Na + ή το
CH3NH 3+.
σμό μ' ένα άτομο οξυγόνου.
κεντρικό δόγμα καρβοξυλομάδα
(-COOH)
Η αρχή που ορίΖει ότι
Χημική ομάδα που αποτελείται από ένα άτομο άνθρακα το
οι γενετικές πληροφο
οποίο συνδέεται με διπλό δεσμό μ' ένα άτομο οξυγόνου
ρίες
και με απλό δεσμό με μια υδροξυλομάδα. Τα μόρια που
ΟΝΑ σro ΗΝΑ και από
περιέχουν μια καρβοξυλομάδα είναι ασθενή οξέα (καρβο
εκεί σrlς πρωτε'ί\ιες.
ρέουν
από
το
ξυλικά οξέα).
κεντριόλιο (centrίole) καρβοξυτελικό άκρο
-
βλ. C-άκρο.
Βραχεία κυλινδρική παράταξη μικροσωληνίσκων. Στα Ζωικά κύτταρα συνήθως βρίσκεται κατά Ζεύγη σro κέντρο ενός κε
καρκίνος
ντροσωματίου. Ανάλογες δομές υπάρχουν σrη βάση των
Νόσημα που προκαλείται από μεταλλαγμένα κύτταρα τα 0-
κροσσών και των μασrlγίων, όπου αποκαλούνται βασικά σω
ηοία ξεφεύγουν από τους φυσιολογικούςμηχανισμούςελέγ
μάτια.
χου της κυτταρικής διαίρεσης και διεισδύουν και αποικίΖουν τους lσrOύς του σώματος.
κέντρο αντίδρασης Στις φωτοσυνθετικές μεμβράνες, ένα εξειδικευμένο Ζεύγος
καρυότυπος Η πλήρης ομάδα χρωμοσωμάτωντου κυττάρου σε παράταξη
μορίων χλωροφύλ/ης που επιτελούν φωτοχημικές αντιδρά σεις.
σύμφωνα με το μέγεθος, το σχήμα και τον αριθμό.
κέντρο σιδήρου-θείου (ίron-sulfur καταβολισμός
center)
Ομάδα ατόμων μέσα σ' ένα είδος πρωτεϊνών, η οποία αποτε
Το σύσrηματων ενΖυμικά καταλυόμενωναντιδράσεωνσ' ένα
λείται από άτομα σιδήρου που συνδέονται με άτομα θείου και
κύτταρο με το οποίο περίπλοκα μόρια αποδομούνταισε άλλα
με τις πλευρικές αλυσίδες καταλοίπων Kυσrε'ϊνης.
απλoύσrεpαμε ταυτόχρονηαπελευθέρωσηενέργειας. Τα εν διάμεσα αυτών των αντιδράσεωνμερικές φορές ονομάΖΟνται καταβολίτες.
κεντρομερίδlο
(centromere)
Περlσφlγμένη περιοχή
ενός μιτωτικού χρωμο-
καταλύτης
Kενrρoμερίδιo
σώματος που συγκρα
Ουσία που επιταΧύνει μια χημική αντίδραση χωρίς η ίδια να
τεί τις αδελφές χρωμα
υφίσroται μεταβολή. Τα ένΖυμα είναι καταλύτες που αποτε
τίδες. Επίσης, η περιο
λούνται από πρωτε'ί\ιη.
χή πάνω σro ΟΝΑ όπου σχηματίΖεται ο κlνητοΧώρος ως θέση προσκόλ/ησης για
καταστολέας (repressor)
μικροσωληνίσκους από τη μιτωτική άτρακτο.
Μια πρωτε'ϊνη που προσδένεται σε μια ειδική περιοχή του ΟΝΑ για να παρεμποδίσει τη μεταγραφή ενός γειτονικού γο νιδίου.
κεντροσωμάτιο
(centrosome)
Κεντρικά εντΟΠIΖόμενο οργανίδιο των Ζωικών κυττάρων. Εί ναι το κύριο κέντρο οργάνωσης των μlκροσωληνίσκων και δι
καταστολέας τρυmοφάvnς
πλασιάΖεται για να σχηματίσει τους πόλους της ατράκτου κατά
Βακτηριακή πρωτε'ϊνη η οποία, παρουσία τρυπτοφάνης,
τη διάρκεια της μίτωσης. Στα περισσότερα Ζωικά κύτταρα πε
προσδένεται σε μια ειδική περιοχή του ΟΝΑ και διακόπτει την
ριέχει ένα Ζεύγος κεντριολίων.
παραγωγή των ενΖύμων βιοσύνθεσης της τρυπτοφάνης. Κlνάση
καταστροφίvn
ΈνΖυμο που μεταφέρει μια φωσφορική ομάδα από το ΑΤΡ (ή
Πρωτε'ί\ιη που αποπολυμερίΖεl και έτσι απoσrαθερoΠOΙεί τους
από ένα άλ/ο τριφωσφορικό νουκλεοσίδιο) σ' ένα άλ/ο μό
μlκροσωληνίσκους.
ριο (βλ. επίσης πρωτεϊνική κινάση).
Γλωσσάριο
1Ο 11
κινάση εξαρτώμενηαπό mv κυκλίνη
-
βλ.
κλίμaκαpH
Cdk
Κοινό μέτρο της οξότητας ενός διαΛUματoς: το