ADVANCES IN
Immunology EDITED BY FRANK J. DIXON The Scripps Research Institute La Jolla, California ASSOCIATE EDITORS
...
19 downloads
1432 Views
29MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
ADVANCES IN
Immunology EDITED BY FRANK J. DIXON The Scripps Research Institute La Jolla, California ASSOCIATE EDITORS
FREDERICK ALT K. FRANK AUSTEN TADA~LI ITS U KI S H I M OTO FRITZMELCIIEHS JONATHAN
W. UHR
VOLUME 56
ACADEMIC PRESS San Diego New York Boston London Sydney Tokyo Toronto
This book is printed on acid-free paper. @
Copyright 0 1994 by ACADEMIC PRESS, INC. All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the publisher.
Academic Press, Inc.
A Division of Harcourt Brace & Company 525 B Street, Suite 1900, San Diego, California 92101-4495
United Kingdom Edition published by
Academic Press Limited 24-28 Oval Road. London NWI 7DX International Standard Serial Number: 0065-2776 International Standard Book Number: 0- 12-022456-9
PRINTED IN THE UNITED STATES OF AMERICA
9 4 9 5 9 6 9 1 9 8
99
BB
9 8 1 6 5 4 3 2 1
ADVANCES IN IMMUNOLOGY, VOL 56
Properties and Functions of Interleukin-10 TIM R. MOSMANN Department of Immunology, Universify of Alberta, Edmonton, Alberta, Canada T6G 2H7
1. Introduction
The initial discovery (1)that led to the characterization and cDNA cloning(2)ofinterleukin-10 ( ILlO) was the demonstration that supernatants from activated T cells could inhibit the secretion of cytokines by TH1 T cell clones. This activity was named cytokine synthesis inhibitory factor (CSIF); after the corresponding recombinant cDNA clone was obtained, it rapidly became clear that CSIF has a large number of functions mediated on multiple cell types and the name ILlO was assigned. ILlO inhibits several macrophage functions, including some microbicidal properties and presentation of antigen to T H 1 cells. In contrast, ILlO has generally enhancing or stirnulatory functions on B cells and mast cells. Since ILlO is produced by macrophages and other cell types in addition to the T cells from which it was originally identified, it is clear that IL10, in common with several other cytokines, has a much more complex role in the immune system than could be inferred from the original activity. II. Discovery
A. THE THlITH2 DICHOTOMY Many strong immune responses tend to involve either mainly delayed type hypersensitivity (DTH) or mainly antibody secretion, and there is considerable evidence that these two responses are often mutually exclusive (3,4).The discovery oftwo types of T helper clones in panels of both mouse (5) and human (6) T cell clones offers some explanation for the reciprocal expression of the two responses. When activated by antigedantigen-presenting cells (APC), TH 1 cells produce IL2, interferon-? (IFNy), and iymphotoxin (LT) (5,7-9); provide limited help for B cell responses (10);and strongly activate cellmediated responses. IFNy is a major macrophage-activating factor (11-13), TNF and IFNy activate granulocytes (14,15), and TH1 cells can initiate DTH reactions (16). The T H l cytokine pattern is often associated with strong DTH reactions in uivo. These functions of T H 1 cells are particularly appropriate for destroying the infected cells dur1 Copyright 0 1994 b y Academic Press, lnc. All rights of reproductmu in m y form reserved.
2
TIM R. MOSMANN
ing infections by intracellular pathogens. In contrast, the TH2 cytokine pattern includes IL4, IL5, IL6, IL9, IL10, and P600 (IL13) (7,17), and TH2 cells are stimulatory for antibody responses but inhibitory for cell-mediated or DTH responses. TH2 cells stimulate B cells by production of IL4, IL5, IL6, and IL10. In very strong TH2 responses this can lead to an allergic reaction since IL4 induces switching to IgE ( 1 8 ~ 9and ) IL5 is the major growth and differentiation factor for eosinophils (20-22). Also, at least in the mouse, several TH2 cytokines (IL3, IL4, IL9, IL10) are stimulatory for mast cell proliferation and activation (23-26). As suggested by this brief description of TH1 and TH2 functions, the secretion of different patterns of cytokines contributes strongly to the major functional differences between these subtypes. Thus the cross-regulation of antibody and DTH responses may be explained in part by cross-regulation of the differentiation and activation of TH1 and TH2 T cells during an immune response. Some of the cross-inhibitory regulators of THl/TH2 derivation and function are known: IFNy is produced by TH1 cells and inhibits the proliferation of TH2 clones (27,28) whereas IL4 is produced by TH2 cells and inhibits the differentiation of TH1 cells (29,30). B. CSIF, A TH2 CYTOKINE THATINHIBITS TH1 CELLS Several years ago we were searching for a cross-regulatory cytokine that would be produced by TH2 cells and inhibit the functions of TH1 cells. We found that TH2 supernatants contained an activity that inhibited cytokine production in cocultures of TH1 cells, APC, and antigen (1).This effect was specific for TH1 cells since TH2 cells responded normally in the presence or absence of the TH2 supernatant factor, CSIF. After immunochemical and biochemical analysis indicated that CSIF was likely to be a novel cytokine, a cDNA clone encoding CSIF was isolated by expression cloning. Characterization of the recombinant cytokine revealed that additional activities of CSIF were already being analyzed in other laboratories. These activities included stimulation of proliferation of mast cells (26) and thymocytes (31).The name “interleukin-10” was then proposed (2). The mouse cDNA sequence was used to isolate a human homologue from a human T cell cDNA library (32), and the biological activities of the human recombinant ILlO were found to be similar to those of the mouse cytokine. Human ILlO acts on both mouse and human cells, whereas mouse ILlO acts on mouse but not human cells. In the sections that follow, the properties and functions of mouse and human ILlO are discussed together unless otherwise specified.
3
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
111. Physical Properties
Mouse ILlO is a homodimeric cytokine with an apparent molecular weight of about 35 kDa (1). During sodium dodecyl sulfate (SDS) gel electrophoresis mouse ILlO monomers migrate in two major bands corresponding to apparent molecular weights of 17 and 21 kDa. Treatment of mouse ILlO with N-glycanase, or synthesis in the presence of tunicamycin, results in nonglycosylated ILlO that migrates at 17 kDa (2).In contrast, human ILlO has little or no glycosylation and migrates as a single band at about 18 kDa. The functions ofglycosylated and nonglycosylated forms of mouse ILlO do not appear to be significantly different, at least in vitro. Chromatography on a hydrophic interaction column resolves three components, corresponding to glycosylation of both, one, or neither of the chains. All three forms have similar specific bioactivities (M. W. Bond, D. F. Fiorentino, and T. R. Mosmann, unpublished). Both mouse and human ILlO are unusually labile in acid solutions and activity is lost rapidly below a p H of5.5. Monoclonal antibodies raised against mouse ILlO revealed that, as for many other cytokines, a significant fraction of ILlO molecules appears to be nonfunctional and to display different antigenic determinants, since two monoclonal antibodies were isolated that bound ILlO but did not recognize any biologically active molecules (33).The properties of mouse and human ILlO are summarized in Table I. IV. cDNA Cloning
A cDNA library was derived from an activated TH2 clone (DlO) in the pcDSRa cloning vector (34)and pools of the resulting clones were screened for their ability to direct the synthesis of CSIF activity in COS cells. A full-length cDNA clone encoding CSIF activity was TABLE I PROPERTIES OF ILl0 AND RELATED GENESA N D PROTEINS
Mol wt Amino acids (mature)
CHO Acid lability Chromosome Exons
Mouse
Human
Viral
16,20
16 160
16
157 +(-)
+
1 5
-
+
-
1 1
4
TIM R . MOSMANN
obtained, and the sequence of the open-reading frame was unrelated to any of the known cytokines. Thus the molecule that mediated CSIF activity was identified as a new cytokine and named IL10. A cDNA clone for human ILlO was isolated by screening a human T cell cDNA library by cross-hybridization with oligonucleotide probes based on the mouse cDNA sequence (32). A rat ILlO cDNA clone was isolated by concanavalin A (Con A) stimulation of T cells from a parasiteinfected rat, followed by polymerase chain reaction (PCR) using primers based on conserved regions of the mouse and human clones (35). The amplified product was then cloned. The nucleotide sequences of the open-reading frames of human and rat IL10 are 81 and 91% homologous to mouse IL10, respectively. The N-terminal 18 amino acids of the open-reading frame are consistent with the presence of a secretion-leader sequence, and mouse and human cDNA clones are readily expressed as secreted proteins in monkey COS cells. The Ntermini of recombinant mouse and human ILlO are Gln22 and SerlS, respectively. There are two potential N-linked glycosylation sites in mouse ILlO and one in human IL10. There are four cysteines in the mature human ILlO protein and five in mouse IL10, although both proteins are noncovalent homodimers (1,36). The 3'-untranslated region of the mRNA contains AT-rich regions similar to those which confer messenger RNA instability in other cytokine mRNAs. Figure 1 shows the protein sequence homologies between human, rat, and mouse IL10, as well as two ILl0-related genes in herpesviruses (discussed below). V. Gene Structure
The genomic clone for ILlO was also isolated from mouse cells (37). The gene contains five exons and spans approximately 5.1 kb of the genome. The noncoding upstream regions of the ILlO gene contain sequences that are also found in the upstream regulatory regions of several other cytokine genes. The mouse and human ILlO genes are both on chromosome 1 (37). VI. Production
Among mouse T cell clones, ILlO is produced by the TH2 and THO subsets of helper (CD4') T cells but not by TH1 cells or CD8+ T cell clones (1,2,33). A subset of mature CD4+ thymocytes expressing low levels of heat-stable antigen also produces ILlO and several other cytokines (38).In all cases, T cells only produce ILlO after stimulation with antigen or polyclonal activators. Among human T cell clones, many but not all clones produce ILlO (39,40), including TH2-like
5
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
ILlO EBV BcRFl EHV-"ILlO" Rat ILlO Mouse ILlO HLlIMn
M
H
s
s
L
-
-
m
u
~
~
m
.ERFUW.Q.....YLAFBX-----TQ.CN..---Q.................T.. .FRAS.-- ...... .A..W.IMCYDSE.Q I I . PI'L. TS..H. .HE..A............. .FG...--.... L . .A..KT.K.HS..N.....V....E..A...Q......K.. .FG...--.... L. .T.M.1.R..YSRED.N.....VOQ...LE.. T...Q......T..
W ILlO Q--Q--QDFDmm
EBV XRFl EV . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . E A .D ............ EHV-"ILlO" . . . .M ..................................... HSTCQE.IH(......K.... Rat ILlO . . . .I....................... K...V........-..E..E.L.....K.... Mouse ILlO . . . .I......................... V. ......-KIIG. E..E.L.....K....
HUmnILlO
EBV -1
......................
I ...............................
I.A.
EHV-"ILlO' .V ...................... S..S......V...................T.MK . Rat ILlO wIQ ...................... D.....D..V....N.......C....V.L.MK . Mouse ILlO .M......................SD.....CQ. V. ...N.......C.....MI .MKS FIG.1. Sequences of mammalian and viral ILlos.
clones and T cells that produce IFNy but little or no IL4 (41). Thus the production of ILlO may not be as precisely confined to T cell subsets in humans, or alternatively, genuine human T H l clones may be less commonly isolated in tissue culture. ILlO is also produced by rat T cells (35). In addition to T cells, a number of other cell types produce this cytokine. Macrophages appear to be a major source of ILlO (42) and synthesis occurs in response to activation by, e.g., lipopolysaccharide (LPS) which also induces synthesis of other cytokines such as IL1, tumor necrosis factor (TNF), and IL6. Mouse mast cell lines express significant levels of ILlO mRNA (2). Normal mouse B cell populations produce ILlO after stimulation (43) and the major B cell producers of ILlO are found in the L y l B cell subset (44). Human B cells also produce IL10, especially after Epstein-Barr (EB) virus transformation (45,46). ILlO is produced by keratinocytes and keratinocyte cell lines (47,48), particularly after exposure to ultraviolet light (Table 11).
~
6
TIM R. MOSMANN
TABLE I1 PRODUCTION OF ILlO
T cells TH2 TH 1 CD8' Mast cell lines Keratinocytes B cells (Lyl)
Mouse
Human
+ +
+ + +? +
-
+ + +
Vil. Biological Effects of Ill0
A. EFFECTSON MACROPHAGES ILlO inhibits the synthesis of several cytokines that are normally secreted by human and mouse monocytes/macrophages in response to activation by LPS (Table 111). These cytokines include IL1, GMCSF, TNF, IL6, IL8, IL10, and IL12 (42,49) (T. Germann, E. Rude, and T. R. Mosmann, unpublished). The production of ILlO by macrophages can be inhibited by ILlO itself (42), thus the secretion of ILlO by macrophages appears to be self-limited. ILlO is secreted relatively late compared to other cytokines, so macrophages may secrete substantial amounts of various cytokines before ILlO inhibition occurs. IFNy also inhibits macrophage secretion of ILlO (50).Thus ILlO and IFNy in some circumstances can each inhibit the synthesis of the other cytokine contributing to a direct cross-inhibitory network. Because ILlO inhibits macrophage cytokine synthesis there are also secondary effects on macrophage function. For example ILlO inhibits the ability of macrophages to kill larvae of Schistosoma mansoni (51). Killing activity is induced by IFNy, which in turn induces TNFa synthesis. ILlO appears to act by blocking the synthesis of TNFa, since supplementation of the cultures with T N F a restored the ability to kill (52). At least part of the killing activity induced by TNFa may be due to the induction of nitric oxide synthesis, which is also downregulated by ILlO in a number of systems (51,53,54). The inhibition of macrophage cytotoxic activity by ILlO is distinct from the mechanisms triggered by two other suppressive agents, IL4 and TGFP, since both of these agents synergize with ILlO to cause increased inhibition of macrophage killing (55).This is consistent with the demonstration that ILlO inhibits macrophage cytokine synthesis by enhancing mRNA
7
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
TABLE 111 FUNCTIONS OF ILlO ~
Macrophages Cytokine production (IL1, IL6, IL8, IL10, IL12, TNF) NO production APC function (for TH1) NK cells Cytokine production T cells Cytokine synthesis CTL differentiation B cells Proliferation MHC I1 expression Antibody secretion Mast cells Proliferation (costimulus) Protease expression In vioo DTH induction DTH effector function
~~
Mouse
Human
Viral
1
1
.1
-1
1
1 1
1
1
.1 t
1
J
t
T
t
5
t t t
1
1
degradation, whereas TGFP appears to act at the translational level (56). In addition to inhibiting cytokine secretion by activated macrophages, ILlO inhibits expression of MHC class I1 antigens on certain classes of monocytes/macrophages (57). In contrast, ILlO stimulates the expression of FcyRl on human monocytes (58).This latter effect is unusual in that ILlO and IFNy mediate similar effects, instead of the usual antagonistic effects of these two cytokines in other assays. Another indirect effect of ILlO that is probably mediated partly via suppression of cytokine synthesis by activated macrophages is the function that was initially used to characterize ILlO-the inhibition of cytokine synthesis by T H 1 cells. Cell-free stimulation methods, such as anti-CD3 antibodies or Con A, induce TH1 synthesis of IFNy that is not inhibited by ILlO (1). TH1 cells stimulated by nonmacrophage APC, e.g., B cells, are also resistant to the effects of ILlO (59). However, when T H 1 cells are stimulated by antigen presented by whole spleen cell populations or macrophages, ILlO partially blocks the secretion of cytokines by the T cells (1). Pretreatment of the macrophage populations with ILlO reduces their subsequent ability to stimu-
8
TIM R. MOSMANN
late T H 1 IFNy production, whereas pretreatment of the T cells has no effect (59). In the absence of exogenous IL2, the proliferation of T cells is also inhibited by IL10, via an effect on the macrophage APC (60), probably due to inhibition of endogenous IL2 production. Thus the CSIF activity of ILlO is mediated via macrophage APC. We and others have examined ILlO inhibition of TH1 stimulation in more detail and found that at least part of this effect appears to be mediated via inhibition of IL12 synthesis. A costimulator required for T H 1 cytokine production in T cell-macrophage cocultures (611, initially named T cell stimulating factor (TSF),was found to be identical to IL12 (T. Germann, M. K. Gately, D. S. Schoenhauf M. Lohoff, S. Fischer, S-C. Jin, E. Schmitt, and E. Rude, unpublished). IL12 is synthesized by macrophages during the interaction of T H 1 cells with macrophages. ILlO blocks IL12 synthesis in this system, and part but not all of the synthesis of IFNy can be restored by adding exogenous recombinant IL12, even in the presence of ILlO (T. Germann, E. Rude and T. R. Mosmann, unpublished; A. O’Garra, personal cammunication). However, even saturating amounts of IL12 do not fully restore the cytokine response of the TH1 cells indicating that reduction of IL12 synthesis is not the only mechanism whereby ILlO reduces cytokine synthesis by T H 1 cells. Given the number of other surface molecules and cytokines whose synthesis and expression are inhibited by IL10, it is perhaps not surprising that the effect on T cells is not mediated through a single costimulator. Other costimulatory molecules that might be downregulated by ILlO could include cell-surface interaction molecules such as B7 (62) or additional unknown cytokines.
B. EFFECTSON T CELLS In addition to the indirect effects described above on cytokine synthesis b y long-term TH1 clones, ILlO also appears to be responsible for strongly inhibiting the synthesis of IFNy in mixed populations of cells derived directly from animals infected with parasites. Spleen cells from Nippostrongylus- or S. mansoni-infected mice produced large amounts of IL4 and IL5 after stimulation with Con A, but secreted very little IFNy (63,64). The addition of anti-IL10 antibodies to these culture systems resulted in much higher production of IFNy in response to Con A or parasite antigen showing that a cryptic THl-like response was in fact being primed but that ILlO was normally synthesized in the activation cultures at sufficiently high levels to inhibit the expression of this TH1 pattern. Since the APC function of B cells is not inhibited by ILlO (59) this suggests that dendritic- or macrophage-like cells may be the major APC in these spleen cell populations.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
9
ILlO can also indirectly affect the proliferation of T cells by inhibiting the production of IL2 (1,60,65). Under conditions where IL2 production is limiting, this will result in a decrease in the proliferation of the T cells. In one study, ILlO inhibited cytokine synthesis by T cells responding to macrophages or dendritic cells, but proliferation was only inhibited by ILlO if macrophages were used as APC (66). Since ILlO normally causes partial inhibition of cytokine synthesis, it is possible that the dendritic cells were more efficient APC and that even the reduced levels of IL2 induced by dendritic cells in the presence of ILlO were sufficient to support proliferation. In experimental systems in which ILlO does inhibit T cell proliferation, this effect can normally be overcome by the addition of exogenous IL2 and so ILlO does not appear to have directly inhibitory effects on T cell proliferation. Although ILlO strongly inhibits the effector function of mature TH 1 cell clones or TH1-like responses from normal T cell populations, ILlO appears to be much less effective at altering the differentiation of T cells from precursor cells. T helper precursors normally secrete only IL2 when first activated (63,67,68) and then differentiate into mature effector cells secreting TH1, TH2, THO, or other cytokine patterns. IL4 and IFNy have strong effects on this differentiation (29,67; S. Sad and T. R. Mosmann, unpublished), each inducing the production of more cells secreting the same cytokine. ILlO is less effective at influencing differentiation, although variable results have been obtained in different studies. In two studies using T cell receptor (TCR)-transgenicmice, ILlO behaved similarly to IL4 in inducing the production of more TH2-like cells (69),whereas in another study, ILlO or anti-IL10 had little effect on the differentiation of T cells into TH1 or TH2 phenotypes (70). These contrasting results may be related to different endogenous levels ofIL10, IFNy, and other cytokines in the cultures. In addition to inhibiting cytokine synthesis by TH1 clones, ILlO also inhibits IFNy synthesis by cytotoxic T cells, although ILlO has no effect on cytotoxicity oftarget cells by CD8' T cell clones or allospecific normal CD8+ populations (T. A. T. Fong and T. R. Mosmann, unpublished). It is not yet known whether this effect of ILlO is mediated via the APC as is the case for CD4' cells. In other circumstances, ILlO has positive effects on the proliferation of peripheral and particularly thymic T cells. Thymocytes proliferate moderately in response to IL2 and IL4, and proliferation is further increased by the addition of ILlO to the other two cytokines (71). Using limiting dilution cultures it was also shown that ILlO stimulates proliferation and differentiation of CD8+ cells, increasing both the
10
TIM R. MOSMANN
CTLP frequency and the cytolytic activity of the expanded clones (72). This effect was only observed in synergy with IL2 and appears to occur during differentiation.
C. EFFECTS ON NATURAL KILLER(NK) CELLS ILlO inhibits the production of IFNy by NK cells responding to IL2 in the presence of accessory cells (73). Thus ILlO can inhibit the synthesis of IFNy by all of the three major producers of IFNy, TH1, CD8, and NK cells, although this depends on the stimulation conditions; for example, TH1 cells stimulated by B cells as APC are not susceptible to IL10. Although IL4 and ILlO both inhibit synthesis of cytokines by NK cells, this occurs via different mechanisms, as the inhibitory effect of IL4 is mediated directly on purified NK cells, whereas the effect of ILlO requires macrophages/monocytes (73).As in the case of TH1 stimulation, IL12 has been implicated as an important cofactor for stimulation of NK cells (74,75) and ILlO also inhibits the synthesis of IL12 in a mouse NK cell stimulation system (T. Germann, E. Rude, and T. R. Mosmann, unpublished).Reconstitution with recombinant IL12 restored almost all of the ability of the NK cells to synthesize IFNy suggesting that the major mechanism of action of ILlO on NK cells may be indirect, through inhibition of the synthesis of IL12 by macrophages.
D. EFFECTSON MASTCELLS Mouse mast cell lines grown in vitro respond to a number of cytokines such as IL3, IL4, IL9, and stem cell factor. When the ILlO cDNA clone was isolated and recombinant ILlO was available, it was found that ILlO was yet another cytokine that enhanced the proliferation of mast cell lines (26). ILlO synergizes with other cytokines such as IL3 or IL4, suggesting that ILlO acts on the mast cell by an independent mechanism. It is not yet known if this mast cell growth-enhancing activity of ILlO is important for in vivo effects. ILlO also activates transcription of the genes for two mast cell proteases, MMCPl and MMCP2, in bone marrow-derived mast cell lines (76,77).
E. EFFECTSON B CELLS ILlO has a number of effects, mostly stimulatory, on mouse and human B cells. On resting B cells, ILlO induces expression of MHC class I1 antigens (78). In contrast to IL4, which also induces MHC class I1 expression, ILlO does not induce expression of CD23 (the FC-Ereceptor) indicating that ILlO does not act via induction of IL4. ILlO enhances survival of small resting mouse B cells in tissue culture
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
11
(78) and is a potent proliferation factor for human B cells that have been activated by anti-CD4O antibodies (79). Similar effects are seen when the B cells are activated by crosslinking of the antigen receptor and the stimulatory effects of ILlO are additive to those of IL4. In addition to these effects on proliferation, ILlO also induces differentiation of human B cells (79). Activated B cells secrete larger amounts of IgG, IgA, and IgM, and ILlO also induces differentiation of antiCD40-activated B cells to morphologically resemble plasma cells. In addition to these general amplification effects on antibody responses, ILlO also appears to synergize with TGFp in inducing human inimunoglobulin class switching to IgA (80). TGFP may be the actual switch factor whereas ILlO may be required for amplification of the switched cells, as TGFp generally inhibits the synthesis or secretion of all immunoglobulin isotypes, even of IgA by those cells that have already switched to IgA production. TGFP also induces switching to IgA production by mouse B cells, but ILlO does not appear to b e required as a cofactor (81). In contrast to these B cell stimulatory effects, ILlO inhibits antibody secretion by mouse B cells that have been activated by TNP-Ficoll and IL5 (82). VIII. Two Herpesviruses Have Acquired an Ill0 Gene
When the cDNA clone for mouse ILlO was first isolated, a search of the GenBank database indicated that the open-reading frame of mouse ILlO cDNA had high homology to a previously uncharacterized open-reading frame (BCRF1) in the EB virus genome (2,83). This homology occurs in the open-reading frame but not in flanking or leader sequences and the homology is higher at the protein level (84%) than the DNA level (71%) suggesting that the sequence has been conserved for functional reasons. Human ILlO (32) is homologous to these two sequences and in fact BCRFl is more homologous to human than to mouse IL10. Since the mouse ILlO gene contains introns whereas BCRFl does not, it appears that the ILlO gene has been acquired from a mammalian genome by the EB virus (EBV), possibly via a step involving ILlO mRNA and reverse transcriptase provided by a retrovirus. When BCRFl was subcloned into an expression vector (84) it encoded a secreted protein similar in size to human and mouse ILlO. The BCRFl protein displays ILlO activity on both mouse and human cells, particularly in assays involving macrophages and human B cells (57,79,84,85). All of this evidence suggests that the EB virus has captured the mammalian ILlO gene at some time in the recent past and has maintained this gene for the purpose of interfering with
12
TIM R. MOSMANN
the immune response. Another gene with homology to ILlO is present in the genome of an equine herpesvirus (EHV) (86). The two viral ILlO genes may be the result of a single acquisition event that occurred in a common ancestor of EBV and EHV. The rationale for the advantage to EBV and EHV of expressing an IL10-related gene is that ILlO inhibits the synthesis of macrophage and T cell cytokines that would otherwise contribute to an antiviral reaction. These include IFNy, lymphotoxin, and TNF. Thus the production of viral IL10, which occurs in the late phase of lytic infection (87), would be expected to reduce the synthesis of these cytokines in the neighborhood of the infected B cell thus resulting in improved viral replication. In addition to this effect of weakening antiviral immune responses, it is likely that the B cell proliferation-enhancing activity of ILlO (79) is also beneficial to the virus since EBV infects human B cells and ILlO/BCRFl would induce an increased number of activated target cells that would be available for viral infection and replication. EBV may also induce expression of the endogenous ILlO gene, since EBV-transformed B cell lines express human ILlO (45,46). The strategy of acquiring mammalian immune system genes for the apparent purpose of interfering with immune responses now appears to be quite widespread among viruses. In addition to these two herpesvirus examples, poxviruses have acquired genes for the receptors for TNF (88) and IFNy (89). These genes have been modified from the (presumably) original mammalian genes by deletion of the transmembrane region resulting in both cases in small secreted molecules that are still able to bind the relevant cytokine. These molecules could potentially neutralize IFNy or T N F in solution before the cytokines could interact with the true receptors on the cell surface and induce death of the infected cells. IX. Functional Similarities between lLl0 and Other TH2 Cytokines
Although ILlO is produced by a number of cell types, it still appears to play a significant role in the functions of TH2 cells. Many of the TH2 cytokines show coherent functions, i.e., they have similar and overlapping functions on various aspects of the immune response. ILlO fits well with the functions of some of the other TH2 cytokines. Both IL4 and ILlO generally enhance B cell activation, proliferation, and antibody secretion. Several TH2 cytokines, including IL3, IL4, IL9, and IL10, enhance proliferation of mouse mast cell lines. In contrast to these enhancing effects on B and mast cells, both ILlO and IL4 are mainly inhibitory for macrophage function. Although each of
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
13
these cytokines does not always inhibit the macrophage by the same mechanism or in conjunction with the same activation signals, nevertheless both IL4 and ILlO can inhibit cytokine synthesis by certain types of macrophages and can also downregulate intracellular killing of bacteria and parasites. Another described cytokine, P600 or IL13 ( J - M . Heslan, L. J. Guilbert, R. Kastelein, J. F. Elliott and T. R. Mosmann, unpublished; 90-92), also has functions that are overlapping and similar to those of IL4 and IL10. IL13 also enhances IgE production, at least in human B cells, and can inhibit the synthesis of cytokines by activated human monocytes. Thus ILlO fits very well with the general functions of TH2 cytokines and appears to play a major role in overall TH2 ftinctions. It should be noted that these overlapping functions do not necessarily mean that IL4 and ILlO have identical functions or activate the same signaling pathway. In fact there is good evidence in several systems that these two cytokines mediate similar effects via different mechanisms. For example, IL4 and ILlO both inhibit cytokine synthesis by monocytes/macrophages yet IL10, but not IL4, prevents the ability of macrophages to present antigen to T H 1 clones (1). Mast cell responses to IL4 and ILlO are clearly mediated by separate mechanisms since the IL4 and ILlO effects are either additive or synergistic (26). Mouse B cells express MHC class I1 in response to IL4 or ILlO, whereas only IL4 induces CD23 expression (78).Human B cells stimulated with anti-CD40 show increased proliferation in response to either IL4 or IL10, but the effects of these two cytokines are additive, and ILlO induces a limited proliferation that is accompanied by antibody secretion and differentiation to a plasma cell phenotype (79). X. Expression of Ill0 Correlates with TH2 Responses
A. In Vitro STIMULATIONS OF PRIMED CELLS The endogenous expression of ILlO and other cytokines has been measured during a variety of immune responses induced by infectious agents or other manipulations. In many responses a TH2-like cytokine pattern is induced either in viva or in cells derived directly from the animal and stimulated in short-term tissue culture. In general there is a good correlation between the induction of TH2-like responses and the expression of IL10. Examples of this Correlation in vitro include treatment of tissue culture keratinocytes or whole mice with ultraviolet light (47),infection of mice with viable S. mansoni (64)or the retrovirus causing MAIDS (93), and the early response against HIV when the
14
TIM R. MOSMANN
patient’s immune system begins to deteriorate (94). Additional examples involve experimental models of infection in which there are resistant and susceptible strains of mice. During infections by Candida (95) and Trypanusoma cruzi (96)that require a cell-mediated immune response for resistance, ILlO is produced at higher levels by cells from susceptible than from resistant mice. In addition to the enhanced production of ILlO by cells from infected animals, either spontaneously or after stimulation in tissue culture with polyclonal activators, it was also shown for Schistosoma and Trypanosoma infections that the ILlO produced in these cultures was responsible for inhibiting the synthesis of IFNy (64,96) and/or downregulating macrophage function (96). Although clear-cut T H 1 and TH2 responses are often observed during strong immune responses, resistance and susceptibility do not always correlate simply with TH1 and TH2 cytokine patterns. For example, during infection of mice with Eimeria, cells from both resistant and susceptible strains produce similar patterns of cytokines, including both T H l - and TH2-specific cytokines, but ILlO is only expressed by the resistant BALB/c strain (97).
B. In Vivo EXPRESSION OF ILlO More direct evidence for the production of ILlO during certain immune responses has been obtained by a number of groups who have analyzed cytokine mRNA in tissue samples. Once again the production of ILlO correlates well with the expression of other TH2 cytokines, which in turn is correlated with susceptibility to infectious agents or tumors that are more effectively eradicated by a cell-mediated response. ILlO mRNA is found at higher levels in lesions of the lepromatous form of leprosy, which involves high levels of antibody production, than in the tuberculoid form, which involves more DTH-like reactions (98).Similarly, TH2 cytokine mRNAs, including IL10, were elevated in the lesions of patients undergoing the erythema nodosum leprosum reaction, which involves immediate hypersensitivity, whereas lesions of patients undergoing the DTH-like reversal reaction showed reduced ILlO expression (99). Strains of mice susceptible to Leishmania infection show heightened levels of ILlO and other TH2 cytokines (100,101), in contrast to resistant mice which express TH1 cytokines and mount DTH reactions. Ommen’s Syndrome is characterized by high levels of IgE and increased expression of TH2 cytokines, including ILlO (102). In immune responses against basal cell carcinoma, high levels of TH2 cytokines, including IL10, are found in the
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
15
actual basal cell carcinoma lesion (103).In contrast, in a benign growth of epidermis, seborrheic keratosis, a more TH1-like pattern of cytokine mRNA was expressed within the lesion, including IL2, IFNy, and lymphotoxin. Thus ILlO expression in vivo is normally associated with a poor or absent response against infections or tumors whose elimination requires a cell-mediated response. This implicates IL10, at least by correlation, as one of the potential mediators that prevents the development of a strong T H l or cell-mediated immune response. In some cases, such as cancer or infection with a number of intracellular pathogens, excess production of ILlO may therefore be harmful to the generation of an appropriate immune response. As mentioned above for in vitro cytokine data, some cytokine expression patterns in vivo do not fit the simple T H l / T H 2 dichotomy. Although these two cytokine patterns are often found in strong responses, additional cytokine patterns have been identified among mouse and human T cell clones (27,63,104,105), and so it is very likely that further complexity in many immune responses remains to be elucidated. One such example may be a model of experimental autoimmune encephalitis, in which several cytokines, including both IL4 and IFNy, are produced during the acute phase of the disease. However, as the disease begins to resolve, there is a rise in ILlO mRNA that correlates with a rapid decline in the mRNA levels for IL2, IL4, IL6, and IFNy (106). ILlO and other TH2 cytokines are elevated during a chronic GVH reaction (107) whereas it has been suggested that an acute GVH reaction is mediated by inflammatory cytokines and may be inhibited by TH2 cytokines (108). However, the involvement of ILlO and other TH2 cytokines in chronic GVH reactions contrasts with the cytokine patterns observed during tolerance to heart allografts, as ILlO and other TH2 cytokines are associated with tolerance to the graft rather than chronic rejection (109). It is possible that a TH2 response may be more damaging for some types of tissue than others but it is clear that in neither case does a TH2 response lead to acute allogeneic attack. Therefore in autoimmunity and transplant rejection it appears possible that the TH2 response may result in little damage or, at worst, chronic rejection or attack, as opposed to the more acute rejection or damage caused by a T H 1 response. Thus in these circumstances excess production of ILlO may be beneficial. This also raises the possibility of therapeutic use of ILlO in situations requiring inhibition of cellmediated responses.
16
TIM €3. MOSMANN
XI. Effects of in Vivo Manipulation of I l l 0 levels
A. ILlO TREATMENT
In a limited number of experiments, ILlO has been injected during immune responses in vivo to test the predicted antiinflammatory properties of this cytokine. Since ILlO inhibits the synthesis of several cytokines produced by activated macrophages, ILlO has been tested for its ability to inhibit endotoxin-induced toxicity in mice which is thought to be due to the release of macrophage mediators, particularly TNF, after LPS challenge. ILlO pretreatment reduced the amounts of circulating TNF induced by LPS and also inhibited the hypothermia induced by injection of large amounts of LPS (110). Finally, ILlO completely prevented mortality after LPS challenge at a dose normally toxic for 50%ofthe mice. All these effects are consistent with the ability of ILlO to block the secretion of cytokines by activated macrophages. In other experiments, ILlO has been tested for its effect on DTH reactions. During Leishmania infection in resistant mice, a strong DTH reaction is generated, and injection of ILlO causes a small inhibition of an antigen-induced DTH response (R. L. Coffman, personal communication). IL4 also causes some inhibition and the combination of IL4 and ILlO is more effective than either cytokine alone. We have investigated the effect of ILlO on the effector phase of the DTH reaction induced by injecting T H 1 clones plus antigen into naive mouse footpads with or without concomitant injection of IL10. Once again ILlO mediates a moderate inhibition (20-30%)of the DTH reaction (L. Li, J. F. Elliott, and T. R. Mosmann, unpublished). Similar inhibitory effects were observed on DTH initiated by injection of sheep erythrocytes into immunized mice. In a different system studying the induction of DTH rather than the effector phase, injection of supernatants of uv-treated keratinocyte cultures inhibited the generation of a subsequent DTH reaction (47). Since anti-IL10 antibodies prevented the DTH-inhibiting effect of the supernatants it is clear that ILlO is at least partly responsible. Thus the general effects of ILlO injected in vivo are consistent with the in vitro functions of ILlO, i.e., inhibition of macrophage and TH1 cell function.
B. REMOVALOF ILlO In vivo treatment from birth with anti-IL10 antibody resulted in mice that were severely depleted for peritoneal Lyl B cells but were otherwise relatively normal (111). The depletion of Lyl B cells by anti-IL10 could be reversed by the concomitant addition of anti-IFNy
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
17
antibodies, suggesting that the depletion of L y l B cells was secondary to the production of increased levels of IFNy in the absence of IL10. IL10-deficient mice have also been created by disruption of the ILlO gene by homologous recombination (112). The resulting mice do not have major perturbations in the populations of B cells, T cells, macrophages, etc., indicating that ILlO does not have an essential role in hematopoiesis. These IL10-minus mice will be a very important model system in which to examine potential effects of ILlO on the generation of different types of T cell response and the functionality of macrophages during parasite infections. Interestingly, the IL 10minus mice have normal Lyl B cell populations which suggests that ILlO is not essential for the generation of Lyl B cells and that the effects seen with antibody treatment may be due to secondary effects of the antibody in addition to their anti-IL10 effects. In order to reconcile the results of the ILl0-minus mouse with the results obtained by treating normal mice with anti-1110, it can be suggested that the antiILlO treatment induces an immune response since the antibody is a rat IgM which may be immunogenic after repeated injections over an extended period. In the absence of such a strong immune response in the IL10-minus mice, high levels of IFNy may not be produced and thus L y l B cell depletion may not occur. XII. ill0 in Pregnancy
It has been known for some time that during pregnancy the maternal immune response appears less able to mount strong DTH (TH1like) responses but capable of enhanced antibody responses. Thus pregnant women are more susceptible to a number of intracellular pathogens and have reduced symptoms for rheumatoid arthritis, a cell-mediated inflammatory disease (reviewed in 113). On the other hand, an antibody-mediated autoimmune disease, systemic lupus erythematosis, can be exacerbated during pregnancy. We have found that there are high constitutive levels of production of TH2 cytokines in placental tissues (H. Lip, L. J. Guilbert, T. R. Mosmann, and T. G. Wegmann, unpublished). In particular, ILlO is expressed at relatively high levels and the ILlO mRNA has been localized by in situ hybridization to the interface area between maternal and fetal tissues. We have postulated (113) that this local TH2 response, particularly involving IL10, may be important to protect the fetus from the damaging effects of NK and TH1-like responses and that this local TH2 bias can sometimes affect the mother’s entire immune system resulting in reduced ability to combat intracellular pathogens.
18
TIM R. MOSMANN
XIII. The I l l 0 Receptor
The human and mouse ILlO receptors are now being characterized and cDNA clones for one IL10-binding protein of each species have been isolated (K. W. Moore, personal communication). These two clones are about 75% homologous at both protein and DNA levels and the open-reading frames comprise 570 amino acids of which about 220 are in the extracellular domain. The sequences are most homologous to the class I1 cytokine receptor gene family which includes the receptors for IFNaIP and y. There is some indirect evidence that suggests that a second ILlO receptor polypeptide chain might exist. Mouse ILlO binds to COS cells expressing either the human or the mouse recombinant ILlO receptor chains. However, human cells expressing ILlO receptors bind human but not mouse IL10. This differential specificity of binding suggests that the receptor expressed in COS cells may not be the complete receptor expressed on human cells. The identified IL10-binding chain is expressed by a wide variety of cells consistent with the response of many cell types to IL10. XIV. Conclusions
From its initial discovery as acytokine that inhibited cytokine synthesis by a subset of T cells, the importance of ILlO in the immune system has now grown to cover a much wider variety of functions. Several functions of ILlO are centered on inhibition of macrophage activation and function. TH1-like responses are in general inhibited by IL10, which appears to be a consistent part of strong TH2 responses against a variety of pathogens and in several other disease states. The early results regarding ILlO production and ILlO interventions in vivo suggest that ILlO can be deleterious to situations in which a DTH response is required, for example many intracellular pathogen infections. The role of ILlO in reducing immune responses against intracellular agents that might otherwise be protected by cytotoxic responses is supported by the fact that two herpesviruses have paid ILlO a high compliment by appropriating the mammalian ILlO gene and expressing it for the apparent purpose of preventing effective antiviral immune responses. On the other hand, ILlO’s ability to inhibit DTH responses may be useful in certain autoimmune situations and in transplantation where a strong TH1 response may cause acute damage whereas a TH2 response would be more benign and might lead to tolerable immune responses that do not constitute a severe threat to the patients.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
19
REFERENCES 1 . Fiorentino, D. F., Bond, M. W., and Mosmann, T. R. (1989).Two types of mouse T helper cell IV: TH2 clones secrete a factor that inhibits cytokine production by T H 1 clones. J. E i p . Med. 170,2081-2095. 2. Moore, K. W., Vieira, P., Fiorentino, D. F., Trounstine, M. L., Khan, T. A., and Mosmann, T. R. (1990). Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein-Barr virus gene BCRFI. Science 248, 1230-1234. 3. Parish, C. R. (1972). T h e relationship between humoral and cell-mediated immunity. Transplant. Rev. 13, 35-66. 4 . Katsura, Y. (1977). Cellmediated and humoral immune responses in mice. 111. Dynamic balance between delayed-type hypersensitivity and antibody response. lmmunology 32,227-235. 5. Mosmann, T. R., Chenvinski, H., Bond, M. W., Giedlin, M. A,, and Coffman, R. L. (1986). Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. lmmunol. 136, 2348-2357. 6. Del Prete, G . F., D e Carli, M., Mastromauro, C., Biagiotti, R., Macchia, D., Falagiani, P. Ricci, M., and Romagnani, S . (1991). Purified protein derivative (PPD) of Mycobacteriuni t u b e r c u h i s and excretory-secretory antigen(s) (TES) of Toxocara cunis expand in vitro human T cells with stable and opposite (type 1 T helper or type 2 T helper) profiles of cytokine production. J. Clin. Inwest. 88, 346-350. 7. Chenvinski, H. M., Schumacher, J. H., Brown, K. D., and Mosmann, T. R. (1987). Two types of mouse helper T cell clone. 111. Further differences in lymphokine synthesis between T h l and T h 2 clones revealed by RNA hybridization, functionally monospecific bioassays, and monoclonal antibodies. ./. Exp. Med. 166, 1229- 1244. 8. Mosmann, T. R., and Coffman, R. L. (1989).T H 1 and TH2 cells: Different patterns of lymphokine secretion lead to different functional properties. Annu. Reu. Invrnunol. 7, 145-173. 9. Mosmann, T . R., and Coffman, R. L. (1989). Heterogeneity of cytokine secretion patterns and functions of helper T cells. Adu. lrnrnunol. 46, 111-147. 10. Coffman, R. L., Seymour, B. W., Lebman, D. A,, Hiraki, D. D., Christiansen, J. A,, Shrader, B., Cherwinski, H. M., Savelkoul, H. F., Finkelman, F. D., Bond, M. W., and Mosmann, T. R. (1988). T h e role of helper T cell products in mouse B cell differentiation and isotype regulation. lmmunol. Reu. 102, 5-28. 1 1 . Murray, H. W., Spitalny, G. L., and Nathan, C. F. (1985). Activation of mouse peritoneal macrophages in vitro and in vivo by interferon-y. ./. Immunol. 134, 1619-1622. 12. Nathan, C. F., Murray, H. W., Wiebe, M. E., and Rubin, B. Y. (1983).Identification of interferon-y as the lymphokine that activates human macrophage oxidative metabolism and antimicrobial activity. ./. E x p . Med. 158, 670-689. 1 3 . Murray, H. W., Rubin, B. Y., and Rothermel, C. D. (1983).Killing of intracellular Leishmunia donouani by lyniphokine-stimulated human mononuclear phagocytes: Evidence that interferon-? is the activating lymphokine. 1. Clin. Znuest. 72, 1506- 1510. 1 4 . Stevenhagen, A,, and van Furth, R. (1993). Interferon-y activates the oxidative killing of Candida albicons by human granulocytes. CEin. Exp. Zm.munol. 91, 170- 175. 15. van Strijp, J . A,, van der Tol, M. E., Miltenburg, L. A., van Kessel, K. P., and
20
TIM R . MOSMANN
Verhoef, J. (1991). Tumour necrosis factor triggers granulocytes to internalize complement-coated virus particles. Immunology 73, 77-82. 16. Cher, D. J., and Mosmann, T. R. (1987). Two types of murine helper T cell clone. 11. Delayed-type hypersensitivity is mediated by TH1 clones. J. Zmmunol. 138, 3688-3694. 17. Brown, K. D., Zurawski, S. M., Mosmann, T. R., and Zurawski, G. (1989). A family of small inducible proteins secreted by leukocytes are members ofa new superfamily that includes leukocyte and fibroblast-derived inflammatory agents, growth factors, and indicators of various activation processes. J . Zmmunol. 142,679-687. 18. Coffman, R. L., Ohara, J., Bond, M. W., Carty, J., Zlotnik, A., and Paul, W. E. (1986).B cell stimulatory factor 1enhances the IgE response of lipopolysaccharideactivated B cells. J . Zmmunol. 136, 4538-4541. 19. Del Prete, G., Maggi, E., Parronchi, P., Chretien, I., Tiri, A., Macchia, D., Ricci, M., Banchereau, J., de Vries, J. E., and Romagnani, S. (1988). IL-4 is an essential factor for the IgE synthesis induced in vitro by human T cell clones and their supernatants. J. Zmmunol. 140,4193-4198. 20. Sanderson, C. J., O’Garra, A., Warren, D. J., and Klaus, G. G. (1986). Eosinophil differentiation factor also has B-cell growth factor activity: Proposed name interleukin 4. Proc. N a t l . Acad. Sci. U.S.A. 83, 437-440. 21. Enokihara, H., Nagashima, S., Noma, T., Kajitani, H., Hamaguchi, H., Saito, K., Furusawa, S . , Shishido, H., and Honjo, T. (1988). Effect of human recombinant interleukin 5 and G-CSF on eosinophil colony formation. Zmmunol. Lett. 18,73-76. 22. Lopez, A. F., Sanderson, C. J . , Gamble, J. R., Campbell, H. D., Young, I. G., and Vadas, M. A. (1988). Recombinant human interleukin 5 is a selective activator of human eosinophil function. J. E x p . Med. 167, 219-224. 23. Ihle, J. N., Keller, J., Oroszlan, S., Henderson, L. E., Copeland, T. D., Fitch, F., Prystowsky, M. B., Goldwasser, E., Schrader, J. W., Palaszynski, E., Dy, M., and Lebel, B. (1983). Biologic properties of homogeneous interleukin 3. I. Demonstration of WEHI-3 growth factor activity, mast cell growth factor activity, p cell-stimulating factor activity, colony-stimulating factor activity, and histamineproducing cell-stimulating factor activity. J . Zmmunol. 131, 282-287. 24. Mosmann, T. R., Bond, M. W., Coffman, R. L., Ohara, J., and Paul, W. E. (1986). T-cell and mast cell lines respond to B-cell stimulatory factor 1. Proc. N a t l . Acad. Sci. U.S.A. 83, 5654-5658. 25. Moeller, J., Hultner, L., Schmitt, E., Breuer, M., and Dormer, P. (1990).Purification of MEA, a mast cell growth-enhancing activity, to apparent homogeneity and its partial amino acid sequencing. J. Zmmunol. 144, 4231-4234. 26. Thompson Snipes, L., Dhar, V., Bond, M. W., Mosmann, T. R., Moore, K. W., and Rennick, D. M. (1991). Interleukin 10: A novel stimulatory factor for mast cells and their progenitors. J. E x p . Med. 173, 507-510. 27. Gajewski, T. F., and Fitch, F. W. (1988). Anti-proliferative effect of IFN-y in immune regulation. I. IFN-y inhibits the proliferation of Th2 but not T h l murine helper T lymphocyte clones. J. Zmmunol. 140,4245-4252. 28. Fernandez-Botran, R., Sanders, V. M., Mosmann, T. R., and Vitetta, E. S. (1988). Lymphokine-mediated regulation of the proliferative response of clones of T Helper 1 and T Helper 2 cells. J . E x p . Med. 168, 543-558. 29. Le Gros, G., Ben Sasson, S . Z., Seder, R., Finkelman, F. D., and Paul, W. E. (1990). Generation of interleukin-4 (I1-4)-producing cells in vivo and in vitro-11-2 and 11-4 are required for in vitro generation of 11-4-producing cells. J . E x p . Med. 172, 921-929.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
21
30. Swain, S. L., Weinberg, A. D., English, M., and Huston, G . (1990). 11-4 directs the development of Th2-like helper effectors. J. Immunol. 145, 3796-3806. 31. Suda, T., O’Garra, A., MacNeil, I., Fischer, M., Bond, M., and Zlotnik, A. (1990). Identification of‘ a novel thymocyte growth promoting factor derived from B cell lymphomas. Cell. Immunol. 129, 228-240. 32. Vieira, P., de Waal Malefyt, R., Dang, M. N., Johnson, K. E., Kastelein, R., Fiorentino, D. F., deVries, J. E., Roncarolo, M. G., Mosmann, T. R., and Moore, K. W. (1991). Isolation and expression of human cytokine synthesis inhibitory &tor cDNA clones: Homology to Epstein-Barr virus open reading frame BCRFI. Proc. N a t l . Acad. Sci. U.S.A.88, 1172-1176. 33. Mosmann, T. R., Schumacher, J. H., Fiorentino, D. F., Leverah, J., Moore, K. W., and Bond, M. W. (1990). Isolation of MAbs specific for IL4, IL5, and IL6, and a new TH2-specific cytokine, cytokine synthesis inhibitory factor (CSIF, ILlO), using a solid phase radioimniunoadsorbent assay. J. Immunol. 145, 2938-2945. 34. Takebe, Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai, K., Yoshida, M., and Arai, N. (1988). SR a promoter: An efficient and versatile mammalian cDNA expression system composed ofthe simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol. Cell Biol. 8, 466-472. 35. Goodman, R. E., Oblak, J., and Bell, R. G . (1992). Synthesis and characterization of rat interleukin-10 (IL-10) cDNA clones from the RNA of cultured 0x8- 0 x 2 2 thoracic duct T cells. Biochem. Biophys. Res. Commun. 189, 1-7. 36. Moore, K. W., O’Garra, A,, de Waal Malefyt, R., Vieira, P., and Mosmann, T. R. (1993). Interleukin-10. Annu. Reu. Immunol: 11, 165-190. 37. Kim, J. M., Brannan, C. I., Copeland, N. G . ,Jenkins, N. A., Khan, T. A., and Moore, K. W. (1992). Structure of the mouse IL-10 gene and chromosomal localization of the mouse and human genes. J. lmmunol. 148,3618-3623. 38. Bendelac, A., Matzinger, P., Seder, R. A,, Paul, W. E., and Schwartz, R. H. (1992). Activation events during thymic selection. J. Exp. Med. 175, 731-742. 39. Yssel, H., d e Waal Malefyt, R., Roncarolo, M. G . , Abrams, J. S., Lahesmaa, R., Spits, H., and d e Vries, J. E. (1992). IL-10 is produced by subsets ofhuman CD4+ T cell clones and peripheral blood T cells. J . Immunol. 149, 2378-2384. 40. Barnes, P. F., Abrams, J. S., Lu, S., Sieling, P. A,, Rea, T. H., and Modlin, R. L. (1993). Patterns of cytokine production by niycobacterium-reactive human T-cell clones. Infect. Immun. 61, 197-203. 41. Del Prete, G . , De Carli, M., Almerigogna, F., Giudizi, M. G., Biagiotti, R., and Romagnani, S. (1993). Human IL-10 is produced by both type 1 helper ( T h l ) and type 2 helper (Th2) T cell clones and inhibits their antigen-specific proliferation and cytokine production. J. Immunol. 150, 353-360. 42. d e Waal Malefyt, R., Abrams, J., Bennett, B., Figdor, C. G . , and de Vries, J. E. (1991). Interleukin 10 (IL-10) inhibits cytokine synthesis by human monocytes: An autoregulatory role of IL-10 produced by mon0cytes.J. Exp. Med. 174,1209-1220. 43. O’Garra, A,, Stapleton, G., Dhar, V., Pearce, M., Schumacher, J., Rugo, H., Barbis, D., Stall, A,, Cupp, J., Moore, K., Vieira, P., Mosmann, T. R., Whitmore, A., Arnold, L., Haughton, G., and Howard, M. (1990). Production of cytokines by mouse B cells: B lymphomas and normal B cells produce interleukin 10. Irit. lmmunol. 2, 82 1-832. 44. O’Garra, A,, Chang, R., Go, N., Hastings, R., Haughton, G., and Howard, M. (1992). Ly-l B (B-1) cells are the main source of B cell-derived interleukin 10. Eur. J. lmmunol. 22.711-717.
22
TIM R. MOSMANN
. 4 5 . Benjamin, D., Knobloch, T. J,, and Dayton, M. A. (1992). Human B-cell interleukin10: B-cell lines derived from patients with acquired immunodeficiency syndrome and Burkitt’s lymphoma constitutively secrete large quantities of interleukin-10. Blood 80, 1289-1298. 46. Burdin, N., Peronne, C., Banchereau, J., and Rousset, F. (1993). Epstein-Barr virus transformation induces B lymphocytes to produce human interleukin 10. J . E x p . M e d . 177,295-304. 47. Rivas, J. M., and Ullrich, S. E. (1992). Systemic suppression ofdelayed-type hypersensitivity by supernatants from UV-irradiated keratinocytes: An essential role for keratinocyte-derived IL-10. J . lmmunol. 149, 3865-3871. 48. Enk, A. H., and Katz, S. I. (1992). Identification and induction of keratinocytederived IL-10. J . lmmunol. 149,92-95. 49. Fiorentino, D. F., Zlotnik, A,, Mosmann, T. R., Howard, M., and O’Garra, A. 0. (1991). ILlO inhibits cytokine production by activated macrophages. I . lmmunol. 147,3815-3822. 50. Chomarat, P., Rissoan, M.-C., Banchereau, J., and Miossec, P. (1993). Interferon y inhibits interleukin 10 production by monocytes. J . E x p . Med. 177, 523-527. 51. Gazzinelli, R. T., Oswald, I. P., James, S. L., and Sher, A. (1992). IL-10 inhibits parasite killing and nitrogen oxide production by IFN-y-activated macrophages. J . Immunol. 148,1792-1796. 52. Oswald, I. P., Wynn, T. A., Sher, A,, and James, S.L. (1992). Interleukin 10 inhibits macrophage microbicidal activity by blocking the endogenous production of tumor necrosis factor a required as a costiniulatory factor for interferon y-induced activation. Proc. N a t l . A c a d . Sci. U.S.A. 89, 8676-8680. 53. Cunha, F. Q., Moncada, S., and Liew, F. Y. (1992). Interleukin-10 (IL-10) inhibits the induction of nitric oxide synthase by interferon-? in murine macrophages. Biochem. B i o p h y s . Res. Commun. 182,1155-1159. 54. Gazzinelli, R. T., Oswald, I. P., Hieny, S., James, S . L., and Sher, A. (1992). The microbicidal activity of interferon-y-treated macrophages against T r y p a n o s o m a c r u z i involves an L-arginine-dependent, nitrogen oxide-mediated mechanism inhibitable by interleukin-10 and transforming growth factor+. E u r . J . lmmunol. 22, 2501-2506. 55. Oswald, I. P., Gazzinelli, R. T., Sher, A., and James, S. L. (1992). IL-10 synergizes with IL-4 and transforming growth factor-/3to inhibit macrophage cytotoxic activity. J . Immunol. 148,3578-3582. 56. Bogdan, C., Paik, J., Vodovotz, Y., and Nathan, C. (1992). Contrasting mechanisms for suppression of macrophage cytokine release by transforming growth factor-p and interleukin-10. J . Biol. Chem. 267, 23,301-23,308. 57. de Waal Malefyt, R., Haanen, J., Spits, H., Roncarolo, M. G., te Velde, A,, Figdor, C . , Johnson, K., Kastelein, R., Yssel, H., and de Vries, J. E. (1991). Interleukin 10 (IL-10)and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulation of class I1 major histocompatibility complex expression. J . E x p . M e d . 174, 915924. 58. Te Velde, A. A., de Waal Malefijt, R., Huijbens, R. J., de Vries, J. E., and Figdor, C. G. (1992). IL-10 stimulates monocyte Fc y R surface expression and cytotoxic activity: Distinct regulation of antibody-dependent cellular cytotoxicity by IFN7, IL-4, and IL-10. J . Immunol. 149, 4048-4052. 59. Fiorentino, D. F., Zlotnik, A., Vieira, P., Mosmann, T. R., Howard, M., Moore, K. W., and O’Garra, A . (1991). IL-10 acts on the antigen-presenting cell to inhibit cytokine production by T h l cells. J . lmmunol. 146, 3444-3451.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
23
60. Ding, L., and Shevach, E. M. (1992).IL-10 inhibits mitogen-induced T cell proliferation by selectively inhibiting macrophage costinmlatory function. J . lmmunol. 148,3133-3139. 61. Germann, T., Partenheimer, A,, and Rude, E. (1990). Requirements for the growth of lymphocyte-TH1 clones. E u r . J . Immunol. 20, 2035-2040. 62. Freeman, G. J., Gray, G. S., Gimmi, C. D., Lombard, D. B., Zhou, L. J., White, M., Fingeroth, J. D., Gribben, J. G.,andNadler, L. M. (1991). Structure, expression, and T cell costimulatory activity of the murine homologue of the human B lymphocyte activation antigen B7.J. E x p . Med. 174, 625-631. 63. Street, N. E., Schumacher, J. H., Fong, T. A . T., Bass, H., Fiorentino, D. F., Leverah, J. A., and Mosmann, T. R. (1990). Heterogeneity of mouse helper T cells: Evidence from bulk cultures and limiting dilution cloning for precursors of T h l and Th2 cells.]. Zmmunol. 144, 1629-1639. 64. Sher, A., Fiorentino, D., Caspar, P., Pearce, E., and Mosmann, T. (1991). Production of IL-10 by CD4' T lymphocytes correlates with down-regulation of T h l cytokine synthesis in helminth infection. J . Immunol. 147, 2713-2716. 65. Taga, K. and Tosato, G. (1992). IL-10 inhibits human T cell proliferation and IL2 production. J . Immunol. 148, 1143-1148. 66. Macatonia, S. E., Doherty, T. M., Knight, S. C., and O'Garra, A. (1993). Differential effect of IL-10 on dendritic cell-induced T cell proliferation and IFN-y production. J . Immunol. 150,3755-3765. 67. Swain, S. L., Weinberg, A. D., and English, M. (1990). CD4+ T cell subsets: Lymphokine secretion of memory cells and of effector cells which develop from precursors in vitro. J . Zmmunol. 144, 1788-1799. 68. Salmon, M., Kitas, G. D., and Bacon, P. A. (1989). Production of lymphokine mRNA by CD45R' and CD45R- helper T cells from human peripheral blood and by human CD4+ T cell clones. J. Imnaunol. 143, 907-912. 69. Hsieh, C. S., Heimberger, A. B., Gold, J. S., O'Garra, A,, and Murphy, K. M. (1992). Differential regulation of T helper phenotype development by interleukins 4 and 10 in an (Y p T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. U.S.A. 89, 6065-6069. 70. Seder, R. A., Paul, W. E., Davis, M . M., and Fazekas de St. Groth, B. (1992). The presence of interleukin 4 during in vitro priming determines the lymphokineproducing potential of CD4+ T cells from T cell receptor transgenic mice. J . E x p . Med. 176,1091-1098. 71. MacNeil, I. A,, Suda, T., Moore, K. W., Mosmann, T. R., and Zlotnik, A. (1990). IL-10, a novel growth cofactor for mature and immature T cells. J . lmmunol. 145, 4167-4 173. 72. Chen, W. F., and Zlotnik, A. (1991). IL-10: A novel cytotoxic T cell differentiation factor. J. Zmmunol. 147, 528-534. 73. Hsu, D. H., Moore, K. W., and Spits, H. (1992). Differential effects of IL-4 and IL-10 on IL-2-induced IFN-y synthesis and lymphokine-activated killer activity. Int. lmmunol. 4,563-569. 74. Kobayashi, M., Fitz, L., Ryan, M., Hewick, R. M., Clark, S. C., Chan, S., Loudon, R., Sherman, F., Perussia, B., and Trinchieri, G. (1989). Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. J . E x p . Med. 170, 827-845. 75. Chan, S . H., Perussia, B., Gupta, J. W., Kobayashi, M., Pospisil, M., Young, H. A., Wolf, S. F., Young, D., Clark, S. C., andTrinchieri, G . (1991). Induction ofinterferon y production by natural killer cell stimulatory factor: Characterization of the responder cells and synergy with other inducers. J . E x p . Med. 173, 869-879.
24
TIM R. MOSMANN
76. Ghildyal, N., McNeil, H. P., Stechschulte, S., Austen, K. F., Silberstein, D., Gurish, M. F., Somerville, L. L., and Stevens, R. L. (1992). IL-10 induces transcription of the gene for mouse mast cell protease-1, a serine protease preferentially expressed in mucosal mast cells of Trichinella spiralis-infected mice. J . Immunol. 149, 2 123-2 129. 77. Ghildyal, N., McNeil, H. P., Gurish, M. F., Austen, K. F., and Stevens, R. L. (1992). Transcriptional regulation of the mucosal mast cell-specific protease gene, MMCP2, by interleukin 10 and interleukin 3. J . Biol. Chem. 267, 8473-8477. 78. Go, N. F., Castle, B. E., Barrett, R., Kastelein, R., Dang, W., Mosmann, T. R., Moore, K. W., and Howard, M. (1990). Interleukin 10, a novel B cell stimulatory factor: Unresponsiveness of X chromosome-linked immunodeficiency B cells. J . Exp. Med. 172,1625-1631. 79. Rousset, F., Garcia, E., Defrance, T., Peronne, C., Vezzio, N., Hsu, D. H., Kastelein, R., Moore, K. W., and Banchereau, J. (1992). Interleukin 10 is a potent growth and differentiation factor for activated human B lymphocytes. Proc. Natl. Acad. Sci. U.S.A. 89, 1890-1893. 80. Defrance, T., Vanbervliet, B., Briere, F., Durand, I., Rousset, F., and Banchereau, J. (1992). Interleukin 10 and transforming growth factor p cooperate to induce anti-CD40-activated naive human B cells to secrete immunoglobulin A. J. Exp. Med. 175,671-682. 81. Lebman, D. A., Lee, F. D., and Coffman, R. L. (1990). Mechanism for transforming growth factor b and IL2 enhancement of IgA expression in lipopolysaccharidestimulated B cell cultures. J . Immunol. 144, 952-959. 82. Pecanha, L. M., Snapper, C. M., Lees, A., and Mond, J. J. (1992). Lymphokine control of type 2 antigen response: IL-10 inhibits IL-5- but not IL-2-induced Ig secretion by T cell-independent antigens. 1.Immunol. 148,3427-3432. 83. Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C., Tuffnell, P. S., and Barrell, B. G. (1984). DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature (London) 310,207-211. 84. Hsu, D. H., de Waal Malefyt, R., Fiorentino, D. F., Dang, M. N., Vieira, P., de Vries, J., Spits, H., Mosmann, T. R., and Moore, K. W. (1990). Expression of interleukin-10 activity by Epstein-Barr virus protein BCRF1. Science 250, 830-832. 85. Niiro, H., Otsuka, T., Abe, M., Satoh, H., Ogo, T., Nakano, T., Furukawa, Y., and Niho, Y. (1992). Epstein-Barr virus BCRFl gene product (viral interleukin 10) inhibits superoxide anion production by human monocytes. Lymphokine Cytokine Res. 11, 209-214. 86. Rode, H.-J., Janssen, W., Rosen-Wolff, A., Bugert, J. J., Thein, P., Becker, Y., and Darai, G. (1993). The genome of equine herpesvirus type 2 harbors an interleukin 10 (ILlO)-like gene. Virus Genes 7, 111-116. 87. Hudson, G. S., Bankier, A. T., Satchwell, S. C., and Barrell, B. G. (1985). The short unique region of the B95-8 Epstein-Barr virus genome. Virology 147, 81-98. 88. Smith, C. A., Davis, T., Anderson, D., Solam, L., Beckmann, M. P., Jerzy, R., Dower, S. K., Cosman, D., and Goodwin, R. G. (1990).A receptor for tumor necrosis factor defines an unusual family of cellular and viral proteins. Science 248, 1019- 1023. 89. Upton, C., Mossman, K., and McFadden, G. (1992). Encoding of a homolog of the IFN-y receptor by myxoma virus. Science 258, 1369-1372. 90. Minty, A., Chalon, P., Derocq, J.-M., Dumont, X., Guillemot, J.-C., Kaghad, M.,
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
25
Labit, C., Leplatois, P., Liauzun, P., Miloux, B., Minty, C., Casellas, P., Loison, G., Lupker, J., Shire, D., Ferrara, P., and Caput, D. (1993). Interleukin-13 is a new human lymphokine regulating inflammatoiy and immune responses. Nature (London) 362,248-250. 91. Punnonen, J., Aversa, G., Cocks, B. G., McKenzie, A. N. J., Menon, S., Zurawski, G . , de Waal Malefyt, H., and de Vries, J. E. (1993). Interleukin 13induces interleukin 4independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc. Natl. Acad. Sci. U.S.A. 90, 3730-3734. 92. McKenzie, A. N. J., Cnlpepper, J. A., de Wad Malefyt, R., Briere, F., Punnonen, J., Aversa, G., Sato, A., Dang, W., Cocks, B. G., Menon, S.,de Vries, J. E., Banchereau, J., and Zurawski, G. (1993). Interleukin 13, a T-cell-derived cytokine that regulates human monocyte and B-cell function. Proc. Natl. Acad. Sci. U.S.A. 90, 3735-3739. 93. Gazzinelli, R. T., Makino, M., Chattopadhyay, S. K., Snapper. C. M., Sher, A,, Hugin, A. W., and Morse, H. C. (1992). CD4+ subset regulation in viral infection: Preferential activation of Th2 cells during progression ofretrovirus-induced imniunodeficiency in mice. J. Immunot. 148, 182-188. 94. Clerici, M., and Shearer, G. M. (1993). A TEI1+ TH2switch is a critical step in the etiology of HIV infection. Zrnmunol. Today 14, 107-111. 95. Romani, L., Mencacci, A., Cenci, E., Spaccapelo, R., Mosci, P., Puccetti, P., and Bistoni, F. (1993). CD4' subset expression in murine candidiasis: Th responses correlate directly with genetically determined susceptibility o r vaccine-induced resistance. J. Irnrnunol. 150, 925-931. 96. Silva, J. S., Morrissey, P. J., Grabstein, K. H., Mohler, K. M., Anderson, D., and Reed, S. G. (1992). Interleukin 10 and interferon y regulation of experimental Trypanosoma cruzi infection. J. Exp. Med. 175, 169-174. 97. Wakelin, D., Rose, M. E., Hesketh, P., Else, K. J., and Grencis, R. K. (1993). Immunity to coccidiosis: Genetic influences on lymphocyte and cytokine r e sponses to infection with Eirneria uertniformis in inbred mice. Parusite Imrnunol. 15, 11-19. 98. Yamaniura, M., Uyemura, K., Deans, K. J., Weinberg, K., Rea, T . H., Bloom, B. H., and Modlin, R. L. (1991).Defining protective responses to pathogens: CytoLine profiles i n leprosy lesions. Science 254, 277-279. 99. Yaniamura, M., Wang, X. K.,Ohmen, J . D., Uyemura. K.,Hea, T. H., Bloom, B. H., and Modlin, H. L. (1992). Cytokine patterns of' inimunologicallv mediated tissue damage. J. Irnrnunol. 149, 1470-1475. 100. Heinzel, F. P., Sadick, M. D., Mutha, S.S.,and Locksiey, H. M. (1991). Production of interferon y interleukin 2, interleukin 4, and interleukin 10 b y CD4' Ivmphocytes in vivo during healing and progressivc murine leishmaniasis. Proc. NatP. Acad. Sci. U.S.A. 88, 7011-7015. 101. Locksiey, R. M., Heinzel, F. P., Sadick, M. D., Holaday, B. J., and Gardner, K. D., Jr. (1987). Miirine cutaneous leishmaniasis: Susceptibility correlates with differential expansion of helper T-cell subsets. An71. Znst. Pasteur. Zmmunol. 138, 744-749. 102. Schandene, L., Ferster, A., Mascart Lemone, F., Crusiaux, A,, Gerard, C., Marchant, A,, Lybin, M., Velu, T., Sariban, E., and Coldman, M. (1993).T helper type 2-like cells and therapeutic effects of interferon-y in combined immunodeficiency with hypereosinophilia (Onienn's syndrome). Eur. J, Zmniunol. 23, 56-60. 103. Yamamura, M., Modlin, R. L., Ohmen, J. D., and Moy, R. L. (1993).Local expression of antiinflanimatory cytokines i n cancer. J. Clin. Invest. 91, 1005-1010.
26
TIM R. MOSMANN
104. Firestein, G. S., Roeder, W. D., Laxer, J. A., Townsend, K. S., Weaver, C. T., Hom, J. T., Linton, J., Torbett, B. E., and Glasebrook, A. L. (1989).A new murine CD4+ T cell subset with an unrestricted cytokine profile. J. lmmunol. 143, 518-525. 105. Paliard, X., de Waal Malefijt, R., Yssel, H., Blanchard, D., Chretien, I., Abrams, J., de Vries, J. E., and Spits, H. (1988). Simultaneous production of IL-2, IL-4, and IFN-y by activated human CD4+ and CD8' T cell clones. J. Immunol. 141, 849-855. 106. Kennedy, M. K., Torrance, D. S., Picha, K. S., and Mohler, K. M. (1992). Analysis of cytokine mRNA expression in the central nervous system ofmice with experimental autoimmune encephalomyelitis reveals that IL-10 mRNA expression correlates with recovery. 1. Immunol. 149,2496-2505. 107. D e Wit, D., Van Mechelen, M., Zanin, C., Doutrelepont, J. M., Velu, T., Gerard, C., Abramowicz, D., Scheerlinck, J. P., De Baetselier, P., Urbain, J., Oberdan, L., Goldman, M., and Moser, M. (1993). Preferential activation of Th2 cells in chronic graft-versus-host reaction. 1. Immunol. 150, 361-366. 108. Antin, J. H., and Ferrara, J. L. (1992). Cytokine dysregulation and acute graftversus-host disease. Blood 80,2964-2968. 109. Takeuchi, T., Lowry, R. P., and Konieczny, B. (1992).Heart allografts in murine systems: The differential activation of The-like effector cells in peripheral tolerance. Transplantation 53, 1281-1294. 110. Gerard, C., Bruyns, C., Marchant, A., Abramowicz, D., Vandenabeele, P., Delvaux, A,, Fiers, W., Goldman, M., and Velu, T. (1993). Interleukin 10 reduces the release of tumor necrosis factor and prevents lethality in experimental endotoxemia. 1.E x p . Med. 177,547-550. 111. Ishida, H., Hastings, R., Kearney, J.. and Howard, M. (1992). Continuous antiinterleukin 10 antibody administration depletes mice of Ly-1 B cells but not conventional B cells. J. E x p . Med. 175, 1213-1220. 112. Kuhn, R., Rajewsky, K., and Muller, W. (1992). IL4 and lLl0 deficient mice. 8th lnt. Cong. Imm. 203 [Abstract] 113. Wegmann, T. G., Lin, H., Guilbert, L. J., and Mosmann, T. R. (1993). Bidirectional cytokine interactions in the maternal-fetal relationship: Is successful pregnancy a TH2 phenomenon? Immunol. Today, 14,353-356. This article was accepted for publication on 9 December 1993.
ADVANCES IN IMMUNOLOGY, VOL 56
Properties and Functions of Interleukin-10 TIM R. MOSMANN Department of Immunology, Universify of Alberta, Edmonton, Alberta, Canada T6G 2H7
1. Introduction
The initial discovery (1)that led to the characterization and cDNA cloning(2)ofinterleukin-10 ( ILlO) was the demonstration that supernatants from activated T cells could inhibit the secretion of cytokines by TH1 T cell clones. This activity was named cytokine synthesis inhibitory factor (CSIF); after the corresponding recombinant cDNA clone was obtained, it rapidly became clear that CSIF has a large number of functions mediated on multiple cell types and the name ILlO was assigned. ILlO inhibits several macrophage functions, including some microbicidal properties and presentation of antigen to T H 1 cells. In contrast, ILlO has generally enhancing or stirnulatory functions on B cells and mast cells. Since ILlO is produced by macrophages and other cell types in addition to the T cells from which it was originally identified, it is clear that IL10, in common with several other cytokines, has a much more complex role in the immune system than could be inferred from the original activity. II. Discovery
A. THE THlITH2 DICHOTOMY Many strong immune responses tend to involve either mainly delayed type hypersensitivity (DTH) or mainly antibody secretion, and there is considerable evidence that these two responses are often mutually exclusive (3,4).The discovery oftwo types of T helper clones in panels of both mouse (5) and human (6) T cell clones offers some explanation for the reciprocal expression of the two responses. When activated by antigedantigen-presenting cells (APC), TH 1 cells produce IL2, interferon-? (IFNy), and iymphotoxin (LT) (5,7-9); provide limited help for B cell responses (10);and strongly activate cellmediated responses. IFNy is a major macrophage-activating factor (11-13), TNF and IFNy activate granulocytes (14,15), and TH1 cells can initiate DTH reactions (16). The T H l cytokine pattern is often associated with strong DTH reactions in uivo. These functions of T H 1 cells are particularly appropriate for destroying the infected cells dur1 Copyright 0 1994 b y Academic Press, lnc. All rights of reproductmu in m y form reserved.
2
TIM R. MOSMANN
ing infections by intracellular pathogens. In contrast, the TH2 cytokine pattern includes IL4, IL5, IL6, IL9, IL10, and P600 (IL13) (7,17), and TH2 cells are stimulatory for antibody responses but inhibitory for cell-mediated or DTH responses. TH2 cells stimulate B cells by production of IL4, IL5, IL6, and IL10. In very strong TH2 responses this can lead to an allergic reaction since IL4 induces switching to IgE ( 1 8 ~ 9and ) IL5 is the major growth and differentiation factor for eosinophils (20-22). Also, at least in the mouse, several TH2 cytokines (IL3, IL4, IL9, IL10) are stimulatory for mast cell proliferation and activation (23-26). As suggested by this brief description of TH1 and TH2 functions, the secretion of different patterns of cytokines contributes strongly to the major functional differences between these subtypes. Thus the cross-regulation of antibody and DTH responses may be explained in part by cross-regulation of the differentiation and activation of TH1 and TH2 T cells during an immune response. Some of the cross-inhibitory regulators of THl/TH2 derivation and function are known: IFNy is produced by TH1 cells and inhibits the proliferation of TH2 clones (27,28) whereas IL4 is produced by TH2 cells and inhibits the differentiation of TH1 cells (29,30). B. CSIF, A TH2 CYTOKINE THATINHIBITS TH1 CELLS Several years ago we were searching for a cross-regulatory cytokine that would be produced by TH2 cells and inhibit the functions of TH1 cells. We found that TH2 supernatants contained an activity that inhibited cytokine production in cocultures of TH1 cells, APC, and antigen (1).This effect was specific for TH1 cells since TH2 cells responded normally in the presence or absence of the TH2 supernatant factor, CSIF. After immunochemical and biochemical analysis indicated that CSIF was likely to be a novel cytokine, a cDNA clone encoding CSIF was isolated by expression cloning. Characterization of the recombinant cytokine revealed that additional activities of CSIF were already being analyzed in other laboratories. These activities included stimulation of proliferation of mast cells (26) and thymocytes (31).The name “interleukin-10” was then proposed (2). The mouse cDNA sequence was used to isolate a human homologue from a human T cell cDNA library (32), and the biological activities of the human recombinant ILlO were found to be similar to those of the mouse cytokine. Human ILlO acts on both mouse and human cells, whereas mouse ILlO acts on mouse but not human cells. In the sections that follow, the properties and functions of mouse and human ILlO are discussed together unless otherwise specified.
3
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
111. Physical Properties
Mouse ILlO is a homodimeric cytokine with an apparent molecular weight of about 35 kDa (1). During sodium dodecyl sulfate (SDS) gel electrophoresis mouse ILlO monomers migrate in two major bands corresponding to apparent molecular weights of 17 and 21 kDa. Treatment of mouse ILlO with N-glycanase, or synthesis in the presence of tunicamycin, results in nonglycosylated ILlO that migrates at 17 kDa (2).In contrast, human ILlO has little or no glycosylation and migrates as a single band at about 18 kDa. The functions ofglycosylated and nonglycosylated forms of mouse ILlO do not appear to be significantly different, at least in vitro. Chromatography on a hydrophic interaction column resolves three components, corresponding to glycosylation of both, one, or neither of the chains. All three forms have similar specific bioactivities (M. W. Bond, D. F. Fiorentino, and T. R. Mosmann, unpublished). Both mouse and human ILlO are unusually labile in acid solutions and activity is lost rapidly below a p H of5.5. Monoclonal antibodies raised against mouse ILlO revealed that, as for many other cytokines, a significant fraction of ILlO molecules appears to be nonfunctional and to display different antigenic determinants, since two monoclonal antibodies were isolated that bound ILlO but did not recognize any biologically active molecules (33).The properties of mouse and human ILlO are summarized in Table I. IV. cDNA Cloning
A cDNA library was derived from an activated TH2 clone (DlO) in the pcDSRa cloning vector (34)and pools of the resulting clones were screened for their ability to direct the synthesis of CSIF activity in COS cells. A full-length cDNA clone encoding CSIF activity was TABLE I PROPERTIES OF ILl0 AND RELATED GENESA N D PROTEINS
Mol wt Amino acids (mature)
CHO Acid lability Chromosome Exons
Mouse
Human
Viral
16,20
16 160
16
157 +(-)
+
1 5
-
+
-
1 1
4
TIM R . MOSMANN
obtained, and the sequence of the open-reading frame was unrelated to any of the known cytokines. Thus the molecule that mediated CSIF activity was identified as a new cytokine and named IL10. A cDNA clone for human ILlO was isolated by screening a human T cell cDNA library by cross-hybridization with oligonucleotide probes based on the mouse cDNA sequence (32). A rat ILlO cDNA clone was isolated by concanavalin A (Con A) stimulation of T cells from a parasiteinfected rat, followed by polymerase chain reaction (PCR) using primers based on conserved regions of the mouse and human clones (35). The amplified product was then cloned. The nucleotide sequences of the open-reading frames of human and rat IL10 are 81 and 91% homologous to mouse IL10, respectively. The N-terminal 18 amino acids of the open-reading frame are consistent with the presence of a secretion-leader sequence, and mouse and human cDNA clones are readily expressed as secreted proteins in monkey COS cells. The Ntermini of recombinant mouse and human ILlO are Gln22 and SerlS, respectively. There are two potential N-linked glycosylation sites in mouse ILlO and one in human IL10. There are four cysteines in the mature human ILlO protein and five in mouse IL10, although both proteins are noncovalent homodimers (1,36). The 3'-untranslated region of the mRNA contains AT-rich regions similar to those which confer messenger RNA instability in other cytokine mRNAs. Figure 1 shows the protein sequence homologies between human, rat, and mouse IL10, as well as two ILl0-related genes in herpesviruses (discussed below). V. Gene Structure
The genomic clone for ILlO was also isolated from mouse cells (37). The gene contains five exons and spans approximately 5.1 kb of the genome. The noncoding upstream regions of the ILlO gene contain sequences that are also found in the upstream regulatory regions of several other cytokine genes. The mouse and human ILlO genes are both on chromosome 1 (37). VI. Production
Among mouse T cell clones, ILlO is produced by the TH2 and THO subsets of helper (CD4') T cells but not by TH1 cells or CD8+ T cell clones (1,2,33). A subset of mature CD4+ thymocytes expressing low levels of heat-stable antigen also produces ILlO and several other cytokines (38).In all cases, T cells only produce ILlO after stimulation with antigen or polyclonal activators. Among human T cell clones, many but not all clones produce ILlO (39,40), including TH2-like
5
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
ILlO EBV BcRFl EHV-"ILlO" Rat ILlO Mouse ILlO HLlIMn
M
H
s
s
L
-
-
m
u
~
~
m
.ERFUW.Q.....YLAFBX-----TQ.CN..---Q.................T.. .FRAS.-- ...... .A..W.IMCYDSE.Q I I . PI'L. TS..H. .HE..A............. .FG...--.... L . .A..KT.K.HS..N.....V....E..A...Q......K.. .FG...--.... L. .T.M.1.R..YSRED.N.....VOQ...LE.. T...Q......T..
W ILlO Q--Q--QDFDmm
EBV XRFl EV . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . E A .D ............ EHV-"ILlO" . . . .M ..................................... HSTCQE.IH(......K.... Rat ILlO . . . .I....................... K...V........-..E..E.L.....K.... Mouse ILlO . . . .I......................... V. ......-KIIG. E..E.L.....K....
HUmnILlO
EBV -1
......................
I ...............................
I.A.
EHV-"ILlO' .V ...................... S..S......V...................T.MK . Rat ILlO wIQ ...................... D.....D..V....N.......C....V.L.MK . Mouse ILlO .M......................SD.....CQ. V. ...N.......C.....MI .MKS FIG.1. Sequences of mammalian and viral ILlos.
clones and T cells that produce IFNy but little or no IL4 (41). Thus the production of ILlO may not be as precisely confined to T cell subsets in humans, or alternatively, genuine human T H l clones may be less commonly isolated in tissue culture. ILlO is also produced by rat T cells (35). In addition to T cells, a number of other cell types produce this cytokine. Macrophages appear to be a major source of ILlO (42) and synthesis occurs in response to activation by, e.g., lipopolysaccharide (LPS) which also induces synthesis of other cytokines such as IL1, tumor necrosis factor (TNF), and IL6. Mouse mast cell lines express significant levels of ILlO mRNA (2). Normal mouse B cell populations produce ILlO after stimulation (43) and the major B cell producers of ILlO are found in the L y l B cell subset (44). Human B cells also produce IL10, especially after Epstein-Barr (EB) virus transformation (45,46). ILlO is produced by keratinocytes and keratinocyte cell lines (47,48), particularly after exposure to ultraviolet light (Table 11).
~
6
TIM R. MOSMANN
TABLE I1 PRODUCTION OF ILlO
T cells TH2 TH 1 CD8' Mast cell lines Keratinocytes B cells (Lyl)
Mouse
Human
+ +
+ + +? +
-
+ + +
Vil. Biological Effects of Ill0
A. EFFECTSON MACROPHAGES ILlO inhibits the synthesis of several cytokines that are normally secreted by human and mouse monocytes/macrophages in response to activation by LPS (Table 111). These cytokines include IL1, GMCSF, TNF, IL6, IL8, IL10, and IL12 (42,49) (T. Germann, E. Rude, and T. R. Mosmann, unpublished). The production of ILlO by macrophages can be inhibited by ILlO itself (42), thus the secretion of ILlO by macrophages appears to be self-limited. ILlO is secreted relatively late compared to other cytokines, so macrophages may secrete substantial amounts of various cytokines before ILlO inhibition occurs. IFNy also inhibits macrophage secretion of ILlO (50).Thus ILlO and IFNy in some circumstances can each inhibit the synthesis of the other cytokine contributing to a direct cross-inhibitory network. Because ILlO inhibits macrophage cytokine synthesis there are also secondary effects on macrophage function. For example ILlO inhibits the ability of macrophages to kill larvae of Schistosoma mansoni (51). Killing activity is induced by IFNy, which in turn induces TNFa synthesis. ILlO appears to act by blocking the synthesis of TNFa, since supplementation of the cultures with T N F a restored the ability to kill (52). At least part of the killing activity induced by TNFa may be due to the induction of nitric oxide synthesis, which is also downregulated by ILlO in a number of systems (51,53,54). The inhibition of macrophage cytotoxic activity by ILlO is distinct from the mechanisms triggered by two other suppressive agents, IL4 and TGFP, since both of these agents synergize with ILlO to cause increased inhibition of macrophage killing (55).This is consistent with the demonstration that ILlO inhibits macrophage cytokine synthesis by enhancing mRNA
7
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
TABLE 111 FUNCTIONS OF ILlO ~
Macrophages Cytokine production (IL1, IL6, IL8, IL10, IL12, TNF) NO production APC function (for TH1) NK cells Cytokine production T cells Cytokine synthesis CTL differentiation B cells Proliferation MHC I1 expression Antibody secretion Mast cells Proliferation (costimulus) Protease expression In vioo DTH induction DTH effector function
~~
Mouse
Human
Viral
1
1
.1
-1
1
1 1
1
1
.1 t
1
J
t
T
t
5
t t t
1
1
degradation, whereas TGFP appears to act at the translational level (56). In addition to inhibiting cytokine secretion by activated macrophages, ILlO inhibits expression of MHC class I1 antigens on certain classes of monocytes/macrophages (57). In contrast, ILlO stimulates the expression of FcyRl on human monocytes (58).This latter effect is unusual in that ILlO and IFNy mediate similar effects, instead of the usual antagonistic effects of these two cytokines in other assays. Another indirect effect of ILlO that is probably mediated partly via suppression of cytokine synthesis by activated macrophages is the function that was initially used to characterize ILlO-the inhibition of cytokine synthesis by T H 1 cells. Cell-free stimulation methods, such as anti-CD3 antibodies or Con A, induce TH1 synthesis of IFNy that is not inhibited by ILlO (1). TH1 cells stimulated by nonmacrophage APC, e.g., B cells, are also resistant to the effects of ILlO (59). However, when T H 1 cells are stimulated by antigen presented by whole spleen cell populations or macrophages, ILlO partially blocks the secretion of cytokines by the T cells (1). Pretreatment of the macrophage populations with ILlO reduces their subsequent ability to stimu-
8
TIM R. MOSMANN
late T H 1 IFNy production, whereas pretreatment of the T cells has no effect (59). In the absence of exogenous IL2, the proliferation of T cells is also inhibited by IL10, via an effect on the macrophage APC (60), probably due to inhibition of endogenous IL2 production. Thus the CSIF activity of ILlO is mediated via macrophage APC. We and others have examined ILlO inhibition of TH1 stimulation in more detail and found that at least part of this effect appears to be mediated via inhibition of IL12 synthesis. A costimulator required for T H 1 cytokine production in T cell-macrophage cocultures (611, initially named T cell stimulating factor (TSF),was found to be identical to IL12 (T. Germann, M. K. Gately, D. S. Schoenhauf M. Lohoff, S. Fischer, S-C. Jin, E. Schmitt, and E. Rude, unpublished). IL12 is synthesized by macrophages during the interaction of T H 1 cells with macrophages. ILlO blocks IL12 synthesis in this system, and part but not all of the synthesis of IFNy can be restored by adding exogenous recombinant IL12, even in the presence of ILlO (T. Germann, E. Rude and T. R. Mosmann, unpublished; A. O’Garra, personal cammunication). However, even saturating amounts of IL12 do not fully restore the cytokine response of the TH1 cells indicating that reduction of IL12 synthesis is not the only mechanism whereby ILlO reduces cytokine synthesis by T H 1 cells. Given the number of other surface molecules and cytokines whose synthesis and expression are inhibited by IL10, it is perhaps not surprising that the effect on T cells is not mediated through a single costimulator. Other costimulatory molecules that might be downregulated by ILlO could include cell-surface interaction molecules such as B7 (62) or additional unknown cytokines.
B. EFFECTSON T CELLS In addition to the indirect effects described above on cytokine synthesis b y long-term TH1 clones, ILlO also appears to be responsible for strongly inhibiting the synthesis of IFNy in mixed populations of cells derived directly from animals infected with parasites. Spleen cells from Nippostrongylus- or S. mansoni-infected mice produced large amounts of IL4 and IL5 after stimulation with Con A, but secreted very little IFNy (63,64). The addition of anti-IL10 antibodies to these culture systems resulted in much higher production of IFNy in response to Con A or parasite antigen showing that a cryptic THl-like response was in fact being primed but that ILlO was normally synthesized in the activation cultures at sufficiently high levels to inhibit the expression of this TH1 pattern. Since the APC function of B cells is not inhibited by ILlO (59) this suggests that dendritic- or macrophage-like cells may be the major APC in these spleen cell populations.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
9
ILlO can also indirectly affect the proliferation of T cells by inhibiting the production of IL2 (1,60,65). Under conditions where IL2 production is limiting, this will result in a decrease in the proliferation of the T cells. In one study, ILlO inhibited cytokine synthesis by T cells responding to macrophages or dendritic cells, but proliferation was only inhibited by ILlO if macrophages were used as APC (66). Since ILlO normally causes partial inhibition of cytokine synthesis, it is possible that the dendritic cells were more efficient APC and that even the reduced levels of IL2 induced by dendritic cells in the presence of ILlO were sufficient to support proliferation. In experimental systems in which ILlO does inhibit T cell proliferation, this effect can normally be overcome by the addition of exogenous IL2 and so ILlO does not appear to have directly inhibitory effects on T cell proliferation. Although ILlO strongly inhibits the effector function of mature TH 1 cell clones or TH1-like responses from normal T cell populations, ILlO appears to be much less effective at altering the differentiation of T cells from precursor cells. T helper precursors normally secrete only IL2 when first activated (63,67,68) and then differentiate into mature effector cells secreting TH1, TH2, THO, or other cytokine patterns. IL4 and IFNy have strong effects on this differentiation (29,67; S. Sad and T. R. Mosmann, unpublished), each inducing the production of more cells secreting the same cytokine. ILlO is less effective at influencing differentiation, although variable results have been obtained in different studies. In two studies using T cell receptor (TCR)-transgenicmice, ILlO behaved similarly to IL4 in inducing the production of more TH2-like cells (69),whereas in another study, ILlO or anti-IL10 had little effect on the differentiation of T cells into TH1 or TH2 phenotypes (70). These contrasting results may be related to different endogenous levels ofIL10, IFNy, and other cytokines in the cultures. In addition to inhibiting cytokine synthesis by TH1 clones, ILlO also inhibits IFNy synthesis by cytotoxic T cells, although ILlO has no effect on cytotoxicity oftarget cells by CD8' T cell clones or allospecific normal CD8+ populations (T. A. T. Fong and T. R. Mosmann, unpublished). It is not yet known whether this effect of ILlO is mediated via the APC as is the case for CD4' cells. In other circumstances, ILlO has positive effects on the proliferation of peripheral and particularly thymic T cells. Thymocytes proliferate moderately in response to IL2 and IL4, and proliferation is further increased by the addition of ILlO to the other two cytokines (71). Using limiting dilution cultures it was also shown that ILlO stimulates proliferation and differentiation of CD8+ cells, increasing both the
10
TIM R. MOSMANN
CTLP frequency and the cytolytic activity of the expanded clones (72). This effect was only observed in synergy with IL2 and appears to occur during differentiation.
C. EFFECTS ON NATURAL KILLER(NK) CELLS ILlO inhibits the production of IFNy by NK cells responding to IL2 in the presence of accessory cells (73). Thus ILlO can inhibit the synthesis of IFNy by all of the three major producers of IFNy, TH1, CD8, and NK cells, although this depends on the stimulation conditions; for example, TH1 cells stimulated by B cells as APC are not susceptible to IL10. Although IL4 and ILlO both inhibit synthesis of cytokines by NK cells, this occurs via different mechanisms, as the inhibitory effect of IL4 is mediated directly on purified NK cells, whereas the effect of ILlO requires macrophages/monocytes (73).As in the case of TH1 stimulation, IL12 has been implicated as an important cofactor for stimulation of NK cells (74,75) and ILlO also inhibits the synthesis of IL12 in a mouse NK cell stimulation system (T. Germann, E. Rude, and T. R. Mosmann, unpublished).Reconstitution with recombinant IL12 restored almost all of the ability of the NK cells to synthesize IFNy suggesting that the major mechanism of action of ILlO on NK cells may be indirect, through inhibition of the synthesis of IL12 by macrophages.
D. EFFECTSON MASTCELLS Mouse mast cell lines grown in vitro respond to a number of cytokines such as IL3, IL4, IL9, and stem cell factor. When the ILlO cDNA clone was isolated and recombinant ILlO was available, it was found that ILlO was yet another cytokine that enhanced the proliferation of mast cell lines (26). ILlO synergizes with other cytokines such as IL3 or IL4, suggesting that ILlO acts on the mast cell by an independent mechanism. It is not yet known if this mast cell growth-enhancing activity of ILlO is important for in vivo effects. ILlO also activates transcription of the genes for two mast cell proteases, MMCPl and MMCP2, in bone marrow-derived mast cell lines (76,77).
E. EFFECTSON B CELLS ILlO has a number of effects, mostly stimulatory, on mouse and human B cells. On resting B cells, ILlO induces expression of MHC class I1 antigens (78). In contrast to IL4, which also induces MHC class I1 expression, ILlO does not induce expression of CD23 (the FC-Ereceptor) indicating that ILlO does not act via induction of IL4. ILlO enhances survival of small resting mouse B cells in tissue culture
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
11
(78) and is a potent proliferation factor for human B cells that have been activated by anti-CD4O antibodies (79). Similar effects are seen when the B cells are activated by crosslinking of the antigen receptor and the stimulatory effects of ILlO are additive to those of IL4. In addition to these effects on proliferation, ILlO also induces differentiation of human B cells (79). Activated B cells secrete larger amounts of IgG, IgA, and IgM, and ILlO also induces differentiation of antiCD40-activated B cells to morphologically resemble plasma cells. In addition to these general amplification effects on antibody responses, ILlO also appears to synergize with TGFp in inducing human inimunoglobulin class switching to IgA (80). TGFP may be the actual switch factor whereas ILlO may be required for amplification of the switched cells, as TGFp generally inhibits the synthesis or secretion of all immunoglobulin isotypes, even of IgA by those cells that have already switched to IgA production. TGFP also induces switching to IgA production by mouse B cells, but ILlO does not appear to b e required as a cofactor (81). In contrast to these B cell stimulatory effects, ILlO inhibits antibody secretion by mouse B cells that have been activated by TNP-Ficoll and IL5 (82). VIII. Two Herpesviruses Have Acquired an Ill0 Gene
When the cDNA clone for mouse ILlO was first isolated, a search of the GenBank database indicated that the open-reading frame of mouse ILlO cDNA had high homology to a previously uncharacterized open-reading frame (BCRF1) in the EB virus genome (2,83). This homology occurs in the open-reading frame but not in flanking or leader sequences and the homology is higher at the protein level (84%) than the DNA level (71%) suggesting that the sequence has been conserved for functional reasons. Human ILlO (32) is homologous to these two sequences and in fact BCRFl is more homologous to human than to mouse IL10. Since the mouse ILlO gene contains introns whereas BCRFl does not, it appears that the ILlO gene has been acquired from a mammalian genome by the EB virus (EBV), possibly via a step involving ILlO mRNA and reverse transcriptase provided by a retrovirus. When BCRFl was subcloned into an expression vector (84) it encoded a secreted protein similar in size to human and mouse ILlO. The BCRFl protein displays ILlO activity on both mouse and human cells, particularly in assays involving macrophages and human B cells (57,79,84,85). All of this evidence suggests that the EB virus has captured the mammalian ILlO gene at some time in the recent past and has maintained this gene for the purpose of interfering with
12
TIM R. MOSMANN
the immune response. Another gene with homology to ILlO is present in the genome of an equine herpesvirus (EHV) (86). The two viral ILlO genes may be the result of a single acquisition event that occurred in a common ancestor of EBV and EHV. The rationale for the advantage to EBV and EHV of expressing an IL10-related gene is that ILlO inhibits the synthesis of macrophage and T cell cytokines that would otherwise contribute to an antiviral reaction. These include IFNy, lymphotoxin, and TNF. Thus the production of viral IL10, which occurs in the late phase of lytic infection (87), would be expected to reduce the synthesis of these cytokines in the neighborhood of the infected B cell thus resulting in improved viral replication. In addition to this effect of weakening antiviral immune responses, it is likely that the B cell proliferation-enhancing activity of ILlO (79) is also beneficial to the virus since EBV infects human B cells and ILlO/BCRFl would induce an increased number of activated target cells that would be available for viral infection and replication. EBV may also induce expression of the endogenous ILlO gene, since EBV-transformed B cell lines express human ILlO (45,46). The strategy of acquiring mammalian immune system genes for the apparent purpose of interfering with immune responses now appears to be quite widespread among viruses. In addition to these two herpesvirus examples, poxviruses have acquired genes for the receptors for TNF (88) and IFNy (89). These genes have been modified from the (presumably) original mammalian genes by deletion of the transmembrane region resulting in both cases in small secreted molecules that are still able to bind the relevant cytokine. These molecules could potentially neutralize IFNy or T N F in solution before the cytokines could interact with the true receptors on the cell surface and induce death of the infected cells. IX. Functional Similarities between lLl0 and Other TH2 Cytokines
Although ILlO is produced by a number of cell types, it still appears to play a significant role in the functions of TH2 cells. Many of the TH2 cytokines show coherent functions, i.e., they have similar and overlapping functions on various aspects of the immune response. ILlO fits well with the functions of some of the other TH2 cytokines. Both IL4 and ILlO generally enhance B cell activation, proliferation, and antibody secretion. Several TH2 cytokines, including IL3, IL4, IL9, and IL10, enhance proliferation of mouse mast cell lines. In contrast to these enhancing effects on B and mast cells, both ILlO and IL4 are mainly inhibitory for macrophage function. Although each of
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
13
these cytokines does not always inhibit the macrophage by the same mechanism or in conjunction with the same activation signals, nevertheless both IL4 and ILlO can inhibit cytokine synthesis by certain types of macrophages and can also downregulate intracellular killing of bacteria and parasites. Another described cytokine, P600 or IL13 ( J - M . Heslan, L. J. Guilbert, R. Kastelein, J. F. Elliott and T. R. Mosmann, unpublished; 90-92), also has functions that are overlapping and similar to those of IL4 and IL10. IL13 also enhances IgE production, at least in human B cells, and can inhibit the synthesis of cytokines by activated human monocytes. Thus ILlO fits very well with the general functions of TH2 cytokines and appears to play a major role in overall TH2 ftinctions. It should be noted that these overlapping functions do not necessarily mean that IL4 and ILlO have identical functions or activate the same signaling pathway. In fact there is good evidence in several systems that these two cytokines mediate similar effects via different mechanisms. For example, IL4 and ILlO both inhibit cytokine synthesis by monocytes/macrophages yet IL10, but not IL4, prevents the ability of macrophages to present antigen to T H 1 clones (1). Mast cell responses to IL4 and ILlO are clearly mediated by separate mechanisms since the IL4 and ILlO effects are either additive or synergistic (26). Mouse B cells express MHC class I1 in response to IL4 or ILlO, whereas only IL4 induces CD23 expression (78).Human B cells stimulated with anti-CD40 show increased proliferation in response to either IL4 or IL10, but the effects of these two cytokines are additive, and ILlO induces a limited proliferation that is accompanied by antibody secretion and differentiation to a plasma cell phenotype (79). X. Expression of Ill0 Correlates with TH2 Responses
A. In Vitro STIMULATIONS OF PRIMED CELLS The endogenous expression of ILlO and other cytokines has been measured during a variety of immune responses induced by infectious agents or other manipulations. In many responses a TH2-like cytokine pattern is induced either in viva or in cells derived directly from the animal and stimulated in short-term tissue culture. In general there is a good correlation between the induction of TH2-like responses and the expression of IL10. Examples of this Correlation in vitro include treatment of tissue culture keratinocytes or whole mice with ultraviolet light (47),infection of mice with viable S. mansoni (64)or the retrovirus causing MAIDS (93), and the early response against HIV when the
14
TIM R. MOSMANN
patient’s immune system begins to deteriorate (94). Additional examples involve experimental models of infection in which there are resistant and susceptible strains of mice. During infections by Candida (95) and Trypanusoma cruzi (96)that require a cell-mediated immune response for resistance, ILlO is produced at higher levels by cells from susceptible than from resistant mice. In addition to the enhanced production of ILlO by cells from infected animals, either spontaneously or after stimulation in tissue culture with polyclonal activators, it was also shown for Schistosoma and Trypanosoma infections that the ILlO produced in these cultures was responsible for inhibiting the synthesis of IFNy (64,96) and/or downregulating macrophage function (96). Although clear-cut T H 1 and TH2 responses are often observed during strong immune responses, resistance and susceptibility do not always correlate simply with TH1 and TH2 cytokine patterns. For example, during infection of mice with Eimeria, cells from both resistant and susceptible strains produce similar patterns of cytokines, including both T H l - and TH2-specific cytokines, but ILlO is only expressed by the resistant BALB/c strain (97).
B. In Vivo EXPRESSION OF ILlO More direct evidence for the production of ILlO during certain immune responses has been obtained by a number of groups who have analyzed cytokine mRNA in tissue samples. Once again the production of ILlO correlates well with the expression of other TH2 cytokines, which in turn is correlated with susceptibility to infectious agents or tumors that are more effectively eradicated by a cell-mediated response. ILlO mRNA is found at higher levels in lesions of the lepromatous form of leprosy, which involves high levels of antibody production, than in the tuberculoid form, which involves more DTH-like reactions (98).Similarly, TH2 cytokine mRNAs, including IL10, were elevated in the lesions of patients undergoing the erythema nodosum leprosum reaction, which involves immediate hypersensitivity, whereas lesions of patients undergoing the DTH-like reversal reaction showed reduced ILlO expression (99). Strains of mice susceptible to Leishmania infection show heightened levels of ILlO and other TH2 cytokines (100,101), in contrast to resistant mice which express TH1 cytokines and mount DTH reactions. Ommen’s Syndrome is characterized by high levels of IgE and increased expression of TH2 cytokines, including ILlO (102). In immune responses against basal cell carcinoma, high levels of TH2 cytokines, including IL10, are found in the
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
15
actual basal cell carcinoma lesion (103).In contrast, in a benign growth of epidermis, seborrheic keratosis, a more TH1-like pattern of cytokine mRNA was expressed within the lesion, including IL2, IFNy, and lymphotoxin. Thus ILlO expression in vivo is normally associated with a poor or absent response against infections or tumors whose elimination requires a cell-mediated response. This implicates IL10, at least by correlation, as one of the potential mediators that prevents the development of a strong T H l or cell-mediated immune response. In some cases, such as cancer or infection with a number of intracellular pathogens, excess production of ILlO may therefore be harmful to the generation of an appropriate immune response. As mentioned above for in vitro cytokine data, some cytokine expression patterns in vivo do not fit the simple T H l / T H 2 dichotomy. Although these two cytokine patterns are often found in strong responses, additional cytokine patterns have been identified among mouse and human T cell clones (27,63,104,105), and so it is very likely that further complexity in many immune responses remains to be elucidated. One such example may be a model of experimental autoimmune encephalitis, in which several cytokines, including both IL4 and IFNy, are produced during the acute phase of the disease. However, as the disease begins to resolve, there is a rise in ILlO mRNA that correlates with a rapid decline in the mRNA levels for IL2, IL4, IL6, and IFNy (106). ILlO and other TH2 cytokines are elevated during a chronic GVH reaction (107) whereas it has been suggested that an acute GVH reaction is mediated by inflammatory cytokines and may be inhibited by TH2 cytokines (108). However, the involvement of ILlO and other TH2 cytokines in chronic GVH reactions contrasts with the cytokine patterns observed during tolerance to heart allografts, as ILlO and other TH2 cytokines are associated with tolerance to the graft rather than chronic rejection (109). It is possible that a TH2 response may be more damaging for some types of tissue than others but it is clear that in neither case does a TH2 response lead to acute allogeneic attack. Therefore in autoimmunity and transplant rejection it appears possible that the TH2 response may result in little damage or, at worst, chronic rejection or attack, as opposed to the more acute rejection or damage caused by a T H 1 response. Thus in these circumstances excess production of ILlO may be beneficial. This also raises the possibility of therapeutic use of ILlO in situations requiring inhibition of cellmediated responses.
16
TIM €3. MOSMANN
XI. Effects of in Vivo Manipulation of I l l 0 levels
A. ILlO TREATMENT
In a limited number of experiments, ILlO has been injected during immune responses in vivo to test the predicted antiinflammatory properties of this cytokine. Since ILlO inhibits the synthesis of several cytokines produced by activated macrophages, ILlO has been tested for its ability to inhibit endotoxin-induced toxicity in mice which is thought to be due to the release of macrophage mediators, particularly TNF, after LPS challenge. ILlO pretreatment reduced the amounts of circulating TNF induced by LPS and also inhibited the hypothermia induced by injection of large amounts of LPS (110). Finally, ILlO completely prevented mortality after LPS challenge at a dose normally toxic for 50%ofthe mice. All these effects are consistent with the ability of ILlO to block the secretion of cytokines by activated macrophages. In other experiments, ILlO has been tested for its effect on DTH reactions. During Leishmania infection in resistant mice, a strong DTH reaction is generated, and injection of ILlO causes a small inhibition of an antigen-induced DTH response (R. L. Coffman, personal communication). IL4 also causes some inhibition and the combination of IL4 and ILlO is more effective than either cytokine alone. We have investigated the effect of ILlO on the effector phase of the DTH reaction induced by injecting T H 1 clones plus antigen into naive mouse footpads with or without concomitant injection of IL10. Once again ILlO mediates a moderate inhibition (20-30%)of the DTH reaction (L. Li, J. F. Elliott, and T. R. Mosmann, unpublished). Similar inhibitory effects were observed on DTH initiated by injection of sheep erythrocytes into immunized mice. In a different system studying the induction of DTH rather than the effector phase, injection of supernatants of uv-treated keratinocyte cultures inhibited the generation of a subsequent DTH reaction (47). Since anti-IL10 antibodies prevented the DTH-inhibiting effect of the supernatants it is clear that ILlO is at least partly responsible. Thus the general effects of ILlO injected in vivo are consistent with the in vitro functions of ILlO, i.e., inhibition of macrophage and TH1 cell function.
B. REMOVALOF ILlO In vivo treatment from birth with anti-IL10 antibody resulted in mice that were severely depleted for peritoneal Lyl B cells but were otherwise relatively normal (111). The depletion of Lyl B cells by anti-IL10 could be reversed by the concomitant addition of anti-IFNy
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
17
antibodies, suggesting that the depletion of L y l B cells was secondary to the production of increased levels of IFNy in the absence of IL10. IL10-deficient mice have also been created by disruption of the ILlO gene by homologous recombination (112). The resulting mice do not have major perturbations in the populations of B cells, T cells, macrophages, etc., indicating that ILlO does not have an essential role in hematopoiesis. These IL10-minus mice will be a very important model system in which to examine potential effects of ILlO on the generation of different types of T cell response and the functionality of macrophages during parasite infections. Interestingly, the IL 10minus mice have normal Lyl B cell populations which suggests that ILlO is not essential for the generation of Lyl B cells and that the effects seen with antibody treatment may be due to secondary effects of the antibody in addition to their anti-IL10 effects. In order to reconcile the results of the ILl0-minus mouse with the results obtained by treating normal mice with anti-1110, it can be suggested that the antiILlO treatment induces an immune response since the antibody is a rat IgM which may be immunogenic after repeated injections over an extended period. In the absence of such a strong immune response in the IL10-minus mice, high levels of IFNy may not be produced and thus L y l B cell depletion may not occur. XII. ill0 in Pregnancy
It has been known for some time that during pregnancy the maternal immune response appears less able to mount strong DTH (TH1like) responses but capable of enhanced antibody responses. Thus pregnant women are more susceptible to a number of intracellular pathogens and have reduced symptoms for rheumatoid arthritis, a cell-mediated inflammatory disease (reviewed in 113). On the other hand, an antibody-mediated autoimmune disease, systemic lupus erythematosis, can be exacerbated during pregnancy. We have found that there are high constitutive levels of production of TH2 cytokines in placental tissues (H. Lip, L. J. Guilbert, T. R. Mosmann, and T. G. Wegmann, unpublished). In particular, ILlO is expressed at relatively high levels and the ILlO mRNA has been localized by in situ hybridization to the interface area between maternal and fetal tissues. We have postulated (113) that this local TH2 response, particularly involving IL10, may be important to protect the fetus from the damaging effects of NK and TH1-like responses and that this local TH2 bias can sometimes affect the mother’s entire immune system resulting in reduced ability to combat intracellular pathogens.
18
TIM R. MOSMANN
XIII. The I l l 0 Receptor
The human and mouse ILlO receptors are now being characterized and cDNA clones for one IL10-binding protein of each species have been isolated (K. W. Moore, personal communication). These two clones are about 75% homologous at both protein and DNA levels and the open-reading frames comprise 570 amino acids of which about 220 are in the extracellular domain. The sequences are most homologous to the class I1 cytokine receptor gene family which includes the receptors for IFNaIP and y. There is some indirect evidence that suggests that a second ILlO receptor polypeptide chain might exist. Mouse ILlO binds to COS cells expressing either the human or the mouse recombinant ILlO receptor chains. However, human cells expressing ILlO receptors bind human but not mouse IL10. This differential specificity of binding suggests that the receptor expressed in COS cells may not be the complete receptor expressed on human cells. The identified IL10-binding chain is expressed by a wide variety of cells consistent with the response of many cell types to IL10. XIV. Conclusions
From its initial discovery as acytokine that inhibited cytokine synthesis by a subset of T cells, the importance of ILlO in the immune system has now grown to cover a much wider variety of functions. Several functions of ILlO are centered on inhibition of macrophage activation and function. TH1-like responses are in general inhibited by IL10, which appears to be a consistent part of strong TH2 responses against a variety of pathogens and in several other disease states. The early results regarding ILlO production and ILlO interventions in vivo suggest that ILlO can be deleterious to situations in which a DTH response is required, for example many intracellular pathogen infections. The role of ILlO in reducing immune responses against intracellular agents that might otherwise be protected by cytotoxic responses is supported by the fact that two herpesviruses have paid ILlO a high compliment by appropriating the mammalian ILlO gene and expressing it for the apparent purpose of preventing effective antiviral immune responses. On the other hand, ILlO’s ability to inhibit DTH responses may be useful in certain autoimmune situations and in transplantation where a strong TH1 response may cause acute damage whereas a TH2 response would be more benign and might lead to tolerable immune responses that do not constitute a severe threat to the patients.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
19
REFERENCES 1 . Fiorentino, D. F., Bond, M. W., and Mosmann, T. R. (1989).Two types of mouse T helper cell IV: TH2 clones secrete a factor that inhibits cytokine production by T H 1 clones. J. E i p . Med. 170,2081-2095. 2. Moore, K. W., Vieira, P., Fiorentino, D. F., Trounstine, M. L., Khan, T. A., and Mosmann, T. R. (1990). Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein-Barr virus gene BCRFI. Science 248, 1230-1234. 3. Parish, C. R. (1972). T h e relationship between humoral and cell-mediated immunity. Transplant. Rev. 13, 35-66. 4 . Katsura, Y. (1977). Cellmediated and humoral immune responses in mice. 111. Dynamic balance between delayed-type hypersensitivity and antibody response. lmmunology 32,227-235. 5. Mosmann, T. R., Chenvinski, H., Bond, M. W., Giedlin, M. A,, and Coffman, R. L. (1986). Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. lmmunol. 136, 2348-2357. 6. Del Prete, G . F., D e Carli, M., Mastromauro, C., Biagiotti, R., Macchia, D., Falagiani, P. Ricci, M., and Romagnani, S . (1991). Purified protein derivative (PPD) of Mycobacteriuni t u b e r c u h i s and excretory-secretory antigen(s) (TES) of Toxocara cunis expand in vitro human T cells with stable and opposite (type 1 T helper or type 2 T helper) profiles of cytokine production. J. Clin. Inwest. 88, 346-350. 7. Chenvinski, H. M., Schumacher, J. H., Brown, K. D., and Mosmann, T. R. (1987). Two types of mouse helper T cell clone. 111. Further differences in lymphokine synthesis between T h l and T h 2 clones revealed by RNA hybridization, functionally monospecific bioassays, and monoclonal antibodies. ./. Exp. Med. 166, 1229- 1244. 8. Mosmann, T. R., and Coffman, R. L. (1989).T H 1 and TH2 cells: Different patterns of lymphokine secretion lead to different functional properties. Annu. Reu. Invrnunol. 7, 145-173. 9. Mosmann, T . R., and Coffman, R. L. (1989). Heterogeneity of cytokine secretion patterns and functions of helper T cells. Adu. lrnrnunol. 46, 111-147. 10. Coffman, R. L., Seymour, B. W., Lebman, D. A,, Hiraki, D. D., Christiansen, J. A,, Shrader, B., Cherwinski, H. M., Savelkoul, H. F., Finkelman, F. D., Bond, M. W., and Mosmann, T. R. (1988). T h e role of helper T cell products in mouse B cell differentiation and isotype regulation. lmmunol. Reu. 102, 5-28. 1 1 . Murray, H. W., Spitalny, G. L., and Nathan, C. F. (1985). Activation of mouse peritoneal macrophages in vitro and in vivo by interferon-y. ./. Immunol. 134, 1619-1622. 12. Nathan, C. F., Murray, H. W., Wiebe, M. E., and Rubin, B. Y. (1983).Identification of interferon-y as the lymphokine that activates human macrophage oxidative metabolism and antimicrobial activity. ./. E x p . Med. 158, 670-689. 1 3 . Murray, H. W., Rubin, B. Y., and Rothermel, C. D. (1983).Killing of intracellular Leishmunia donouani by lyniphokine-stimulated human mononuclear phagocytes: Evidence that interferon-? is the activating lymphokine. 1. Clin. Znuest. 72, 1506- 1510. 1 4 . Stevenhagen, A,, and van Furth, R. (1993). Interferon-y activates the oxidative killing of Candida albicons by human granulocytes. CEin. Exp. Zm.munol. 91, 170- 175. 15. van Strijp, J . A,, van der Tol, M. E., Miltenburg, L. A., van Kessel, K. P., and
20
TIM R . MOSMANN
Verhoef, J. (1991). Tumour necrosis factor triggers granulocytes to internalize complement-coated virus particles. Immunology 73, 77-82. 16. Cher, D. J., and Mosmann, T. R. (1987). Two types of murine helper T cell clone. 11. Delayed-type hypersensitivity is mediated by TH1 clones. J. Zmmunol. 138, 3688-3694. 17. Brown, K. D., Zurawski, S. M., Mosmann, T. R., and Zurawski, G. (1989). A family of small inducible proteins secreted by leukocytes are members ofa new superfamily that includes leukocyte and fibroblast-derived inflammatory agents, growth factors, and indicators of various activation processes. J . Zmmunol. 142,679-687. 18. Coffman, R. L., Ohara, J., Bond, M. W., Carty, J., Zlotnik, A., and Paul, W. E. (1986).B cell stimulatory factor 1enhances the IgE response of lipopolysaccharideactivated B cells. J . Zmmunol. 136, 4538-4541. 19. Del Prete, G., Maggi, E., Parronchi, P., Chretien, I., Tiri, A., Macchia, D., Ricci, M., Banchereau, J., de Vries, J. E., and Romagnani, S. (1988). IL-4 is an essential factor for the IgE synthesis induced in vitro by human T cell clones and their supernatants. J. Zmmunol. 140,4193-4198. 20. Sanderson, C. J., O’Garra, A., Warren, D. J., and Klaus, G. G. (1986). Eosinophil differentiation factor also has B-cell growth factor activity: Proposed name interleukin 4. Proc. N a t l . Acad. Sci. U.S.A. 83, 437-440. 21. Enokihara, H., Nagashima, S., Noma, T., Kajitani, H., Hamaguchi, H., Saito, K., Furusawa, S . , Shishido, H., and Honjo, T. (1988). Effect of human recombinant interleukin 5 and G-CSF on eosinophil colony formation. Zmmunol. Lett. 18,73-76. 22. Lopez, A. F., Sanderson, C. J . , Gamble, J. R., Campbell, H. D., Young, I. G., and Vadas, M. A. (1988). Recombinant human interleukin 5 is a selective activator of human eosinophil function. J. E x p . Med. 167, 219-224. 23. Ihle, J. N., Keller, J., Oroszlan, S., Henderson, L. E., Copeland, T. D., Fitch, F., Prystowsky, M. B., Goldwasser, E., Schrader, J. W., Palaszynski, E., Dy, M., and Lebel, B. (1983). Biologic properties of homogeneous interleukin 3. I. Demonstration of WEHI-3 growth factor activity, mast cell growth factor activity, p cell-stimulating factor activity, colony-stimulating factor activity, and histamineproducing cell-stimulating factor activity. J . Zmmunol. 131, 282-287. 24. Mosmann, T. R., Bond, M. W., Coffman, R. L., Ohara, J., and Paul, W. E. (1986). T-cell and mast cell lines respond to B-cell stimulatory factor 1. Proc. N a t l . Acad. Sci. U.S.A. 83, 5654-5658. 25. Moeller, J., Hultner, L., Schmitt, E., Breuer, M., and Dormer, P. (1990).Purification of MEA, a mast cell growth-enhancing activity, to apparent homogeneity and its partial amino acid sequencing. J. Zmmunol. 144, 4231-4234. 26. Thompson Snipes, L., Dhar, V., Bond, M. W., Mosmann, T. R., Moore, K. W., and Rennick, D. M. (1991). Interleukin 10: A novel stimulatory factor for mast cells and their progenitors. J. E x p . Med. 173, 507-510. 27. Gajewski, T. F., and Fitch, F. W. (1988). Anti-proliferative effect of IFN-y in immune regulation. I. IFN-y inhibits the proliferation of Th2 but not T h l murine helper T lymphocyte clones. J. Zmmunol. 140,4245-4252. 28. Fernandez-Botran, R., Sanders, V. M., Mosmann, T. R., and Vitetta, E. S. (1988). Lymphokine-mediated regulation of the proliferative response of clones of T Helper 1 and T Helper 2 cells. J . E x p . Med. 168, 543-558. 29. Le Gros, G., Ben Sasson, S . Z., Seder, R., Finkelman, F. D., and Paul, W. E. (1990). Generation of interleukin-4 (I1-4)-producing cells in vivo and in vitro-11-2 and 11-4 are required for in vitro generation of 11-4-producing cells. J . E x p . Med. 172, 921-929.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
21
30. Swain, S. L., Weinberg, A. D., English, M., and Huston, G . (1990). 11-4 directs the development of Th2-like helper effectors. J. Immunol. 145, 3796-3806. 31. Suda, T., O’Garra, A., MacNeil, I., Fischer, M., Bond, M., and Zlotnik, A. (1990). Identification of‘ a novel thymocyte growth promoting factor derived from B cell lymphomas. Cell. Immunol. 129, 228-240. 32. Vieira, P., de Waal Malefyt, R., Dang, M. N., Johnson, K. E., Kastelein, R., Fiorentino, D. F., deVries, J. E., Roncarolo, M. G., Mosmann, T. R., and Moore, K. W. (1991). Isolation and expression of human cytokine synthesis inhibitory &tor cDNA clones: Homology to Epstein-Barr virus open reading frame BCRFI. Proc. N a t l . Acad. Sci. U.S.A.88, 1172-1176. 33. Mosmann, T. R., Schumacher, J. H., Fiorentino, D. F., Leverah, J., Moore, K. W., and Bond, M. W. (1990). Isolation of MAbs specific for IL4, IL5, and IL6, and a new TH2-specific cytokine, cytokine synthesis inhibitory factor (CSIF, ILlO), using a solid phase radioimniunoadsorbent assay. J. Immunol. 145, 2938-2945. 34. Takebe, Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai, K., Yoshida, M., and Arai, N. (1988). SR a promoter: An efficient and versatile mammalian cDNA expression system composed ofthe simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol. Cell Biol. 8, 466-472. 35. Goodman, R. E., Oblak, J., and Bell, R. G . (1992). Synthesis and characterization of rat interleukin-10 (IL-10) cDNA clones from the RNA of cultured 0x8- 0 x 2 2 thoracic duct T cells. Biochem. Biophys. Res. Commun. 189, 1-7. 36. Moore, K. W., O’Garra, A,, de Waal Malefyt, R., Vieira, P., and Mosmann, T. R. (1993). Interleukin-10. Annu. Reu. Immunol: 11, 165-190. 37. Kim, J. M., Brannan, C. I., Copeland, N. G . ,Jenkins, N. A., Khan, T. A., and Moore, K. W. (1992). Structure of the mouse IL-10 gene and chromosomal localization of the mouse and human genes. J. lmmunol. 148,3618-3623. 38. Bendelac, A., Matzinger, P., Seder, R. A,, Paul, W. E., and Schwartz, R. H. (1992). Activation events during thymic selection. J. Exp. Med. 175, 731-742. 39. Yssel, H., d e Waal Malefyt, R., Roncarolo, M. G . , Abrams, J. S., Lahesmaa, R., Spits, H., and d e Vries, J. E. (1992). IL-10 is produced by subsets ofhuman CD4+ T cell clones and peripheral blood T cells. J . Immunol. 149, 2378-2384. 40. Barnes, P. F., Abrams, J. S., Lu, S., Sieling, P. A,, Rea, T. H., and Modlin, R. L. (1993). Patterns of cytokine production by niycobacterium-reactive human T-cell clones. Infect. Immun. 61, 197-203. 41. Del Prete, G . , De Carli, M., Almerigogna, F., Giudizi, M. G., Biagiotti, R., and Romagnani, S. (1993). Human IL-10 is produced by both type 1 helper ( T h l ) and type 2 helper (Th2) T cell clones and inhibits their antigen-specific proliferation and cytokine production. J. Immunol. 150, 353-360. 42. d e Waal Malefyt, R., Abrams, J., Bennett, B., Figdor, C. G . , and de Vries, J. E. (1991). Interleukin 10 (IL-10) inhibits cytokine synthesis by human monocytes: An autoregulatory role of IL-10 produced by mon0cytes.J. Exp. Med. 174,1209-1220. 43. O’Garra, A,, Stapleton, G., Dhar, V., Pearce, M., Schumacher, J., Rugo, H., Barbis, D., Stall, A,, Cupp, J., Moore, K., Vieira, P., Mosmann, T. R., Whitmore, A., Arnold, L., Haughton, G., and Howard, M. (1990). Production of cytokines by mouse B cells: B lymphomas and normal B cells produce interleukin 10. Irit. lmmunol. 2, 82 1-832. 44. O’Garra, A,, Chang, R., Go, N., Hastings, R., Haughton, G., and Howard, M. (1992). Ly-l B (B-1) cells are the main source of B cell-derived interleukin 10. Eur. J. lmmunol. 22.711-717.
22
TIM R. MOSMANN
. 4 5 . Benjamin, D., Knobloch, T. J,, and Dayton, M. A. (1992). Human B-cell interleukin10: B-cell lines derived from patients with acquired immunodeficiency syndrome and Burkitt’s lymphoma constitutively secrete large quantities of interleukin-10. Blood 80, 1289-1298. 46. Burdin, N., Peronne, C., Banchereau, J., and Rousset, F. (1993). Epstein-Barr virus transformation induces B lymphocytes to produce human interleukin 10. J . E x p . M e d . 177,295-304. 47. Rivas, J. M., and Ullrich, S. E. (1992). Systemic suppression ofdelayed-type hypersensitivity by supernatants from UV-irradiated keratinocytes: An essential role for keratinocyte-derived IL-10. J . lmmunol. 149, 3865-3871. 48. Enk, A. H., and Katz, S. I. (1992). Identification and induction of keratinocytederived IL-10. J . lmmunol. 149,92-95. 49. Fiorentino, D. F., Zlotnik, A,, Mosmann, T. R., Howard, M., and O’Garra, A. 0. (1991). ILlO inhibits cytokine production by activated macrophages. I . lmmunol. 147,3815-3822. 50. Chomarat, P., Rissoan, M.-C., Banchereau, J., and Miossec, P. (1993). Interferon y inhibits interleukin 10 production by monocytes. J . E x p . Med. 177, 523-527. 51. Gazzinelli, R. T., Oswald, I. P., James, S. L., and Sher, A. (1992). IL-10 inhibits parasite killing and nitrogen oxide production by IFN-y-activated macrophages. J . Immunol. 148,1792-1796. 52. Oswald, I. P., Wynn, T. A., Sher, A,, and James, S.L. (1992). Interleukin 10 inhibits macrophage microbicidal activity by blocking the endogenous production of tumor necrosis factor a required as a costiniulatory factor for interferon y-induced activation. Proc. N a t l . A c a d . Sci. U.S.A. 89, 8676-8680. 53. Cunha, F. Q., Moncada, S., and Liew, F. Y. (1992). Interleukin-10 (IL-10) inhibits the induction of nitric oxide synthase by interferon-? in murine macrophages. Biochem. B i o p h y s . Res. Commun. 182,1155-1159. 54. Gazzinelli, R. T., Oswald, I. P., Hieny, S., James, S . L., and Sher, A. (1992). The microbicidal activity of interferon-y-treated macrophages against T r y p a n o s o m a c r u z i involves an L-arginine-dependent, nitrogen oxide-mediated mechanism inhibitable by interleukin-10 and transforming growth factor+. E u r . J . lmmunol. 22, 2501-2506. 55. Oswald, I. P., Gazzinelli, R. T., Sher, A., and James, S. L. (1992). IL-10 synergizes with IL-4 and transforming growth factor-/3to inhibit macrophage cytotoxic activity. J . Immunol. 148,3578-3582. 56. Bogdan, C., Paik, J., Vodovotz, Y., and Nathan, C. (1992). Contrasting mechanisms for suppression of macrophage cytokine release by transforming growth factor-p and interleukin-10. J . Biol. Chem. 267, 23,301-23,308. 57. de Waal Malefyt, R., Haanen, J., Spits, H., Roncarolo, M. G., te Velde, A,, Figdor, C . , Johnson, K., Kastelein, R., Yssel, H., and de Vries, J. E. (1991). Interleukin 10 (IL-10)and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulation of class I1 major histocompatibility complex expression. J . E x p . M e d . 174, 915924. 58. Te Velde, A. A., de Waal Malefijt, R., Huijbens, R. J., de Vries, J. E., and Figdor, C. G. (1992). IL-10 stimulates monocyte Fc y R surface expression and cytotoxic activity: Distinct regulation of antibody-dependent cellular cytotoxicity by IFN7, IL-4, and IL-10. J . Immunol. 149, 4048-4052. 59. Fiorentino, D. F., Zlotnik, A., Vieira, P., Mosmann, T. R., Howard, M., Moore, K. W., and O’Garra, A . (1991). IL-10 acts on the antigen-presenting cell to inhibit cytokine production by T h l cells. J . lmmunol. 146, 3444-3451.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
23
60. Ding, L., and Shevach, E. M. (1992).IL-10 inhibits mitogen-induced T cell proliferation by selectively inhibiting macrophage costinmlatory function. J . lmmunol. 148,3133-3139. 61. Germann, T., Partenheimer, A,, and Rude, E. (1990). Requirements for the growth of lymphocyte-TH1 clones. E u r . J . Immunol. 20, 2035-2040. 62. Freeman, G. J., Gray, G. S., Gimmi, C. D., Lombard, D. B., Zhou, L. J., White, M., Fingeroth, J. D., Gribben, J. G.,andNadler, L. M. (1991). Structure, expression, and T cell costimulatory activity of the murine homologue of the human B lymphocyte activation antigen B7.J. E x p . Med. 174, 625-631. 63. Street, N. E., Schumacher, J. H., Fong, T. A . T., Bass, H., Fiorentino, D. F., Leverah, J. A., and Mosmann, T. R. (1990). Heterogeneity of mouse helper T cells: Evidence from bulk cultures and limiting dilution cloning for precursors of T h l and Th2 cells.]. Zmmunol. 144, 1629-1639. 64. Sher, A., Fiorentino, D., Caspar, P., Pearce, E., and Mosmann, T. (1991). Production of IL-10 by CD4' T lymphocytes correlates with down-regulation of T h l cytokine synthesis in helminth infection. J . Immunol. 147, 2713-2716. 65. Taga, K. and Tosato, G. (1992). IL-10 inhibits human T cell proliferation and IL2 production. J . Immunol. 148, 1143-1148. 66. Macatonia, S. E., Doherty, T. M., Knight, S. C., and O'Garra, A. (1993). Differential effect of IL-10 on dendritic cell-induced T cell proliferation and IFN-y production. J . Immunol. 150,3755-3765. 67. Swain, S. L., Weinberg, A. D., and English, M. (1990). CD4+ T cell subsets: Lymphokine secretion of memory cells and of effector cells which develop from precursors in vitro. J . Zmmunol. 144, 1788-1799. 68. Salmon, M., Kitas, G. D., and Bacon, P. A. (1989). Production of lymphokine mRNA by CD45R' and CD45R- helper T cells from human peripheral blood and by human CD4+ T cell clones. J. Imnaunol. 143, 907-912. 69. Hsieh, C. S., Heimberger, A. B., Gold, J. S., O'Garra, A,, and Murphy, K. M. (1992). Differential regulation of T helper phenotype development by interleukins 4 and 10 in an (Y p T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. U.S.A. 89, 6065-6069. 70. Seder, R. A., Paul, W. E., Davis, M . M., and Fazekas de St. Groth, B. (1992). The presence of interleukin 4 during in vitro priming determines the lymphokineproducing potential of CD4+ T cells from T cell receptor transgenic mice. J . E x p . Med. 176,1091-1098. 71. MacNeil, I. A,, Suda, T., Moore, K. W., Mosmann, T. R., and Zlotnik, A. (1990). IL-10, a novel growth cofactor for mature and immature T cells. J . lmmunol. 145, 4167-4 173. 72. Chen, W. F., and Zlotnik, A. (1991). IL-10: A novel cytotoxic T cell differentiation factor. J. Zmmunol. 147, 528-534. 73. Hsu, D. H., Moore, K. W., and Spits, H. (1992). Differential effects of IL-4 and IL-10 on IL-2-induced IFN-y synthesis and lymphokine-activated killer activity. Int. lmmunol. 4,563-569. 74. Kobayashi, M., Fitz, L., Ryan, M., Hewick, R. M., Clark, S. C., Chan, S., Loudon, R., Sherman, F., Perussia, B., and Trinchieri, G. (1989). Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. J . E x p . Med. 170, 827-845. 75. Chan, S . H., Perussia, B., Gupta, J. W., Kobayashi, M., Pospisil, M., Young, H. A., Wolf, S. F., Young, D., Clark, S. C., andTrinchieri, G . (1991). Induction ofinterferon y production by natural killer cell stimulatory factor: Characterization of the responder cells and synergy with other inducers. J . E x p . Med. 173, 869-879.
24
TIM R. MOSMANN
76. Ghildyal, N., McNeil, H. P., Stechschulte, S., Austen, K. F., Silberstein, D., Gurish, M. F., Somerville, L. L., and Stevens, R. L. (1992). IL-10 induces transcription of the gene for mouse mast cell protease-1, a serine protease preferentially expressed in mucosal mast cells of Trichinella spiralis-infected mice. J . Immunol. 149, 2 123-2 129. 77. Ghildyal, N., McNeil, H. P., Gurish, M. F., Austen, K. F., and Stevens, R. L. (1992). Transcriptional regulation of the mucosal mast cell-specific protease gene, MMCP2, by interleukin 10 and interleukin 3. J . Biol. Chem. 267, 8473-8477. 78. Go, N. F., Castle, B. E., Barrett, R., Kastelein, R., Dang, W., Mosmann, T. R., Moore, K. W., and Howard, M. (1990). Interleukin 10, a novel B cell stimulatory factor: Unresponsiveness of X chromosome-linked immunodeficiency B cells. J . Exp. Med. 172,1625-1631. 79. Rousset, F., Garcia, E., Defrance, T., Peronne, C., Vezzio, N., Hsu, D. H., Kastelein, R., Moore, K. W., and Banchereau, J. (1992). Interleukin 10 is a potent growth and differentiation factor for activated human B lymphocytes. Proc. Natl. Acad. Sci. U.S.A. 89, 1890-1893. 80. Defrance, T., Vanbervliet, B., Briere, F., Durand, I., Rousset, F., and Banchereau, J. (1992). Interleukin 10 and transforming growth factor p cooperate to induce anti-CD40-activated naive human B cells to secrete immunoglobulin A. J. Exp. Med. 175,671-682. 81. Lebman, D. A., Lee, F. D., and Coffman, R. L. (1990). Mechanism for transforming growth factor b and IL2 enhancement of IgA expression in lipopolysaccharidestimulated B cell cultures. J . Immunol. 144, 952-959. 82. Pecanha, L. M., Snapper, C. M., Lees, A., and Mond, J. J. (1992). Lymphokine control of type 2 antigen response: IL-10 inhibits IL-5- but not IL-2-induced Ig secretion by T cell-independent antigens. 1.Immunol. 148,3427-3432. 83. Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C., Tuffnell, P. S., and Barrell, B. G. (1984). DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature (London) 310,207-211. 84. Hsu, D. H., de Waal Malefyt, R., Fiorentino, D. F., Dang, M. N., Vieira, P., de Vries, J., Spits, H., Mosmann, T. R., and Moore, K. W. (1990). Expression of interleukin-10 activity by Epstein-Barr virus protein BCRF1. Science 250, 830-832. 85. Niiro, H., Otsuka, T., Abe, M., Satoh, H., Ogo, T., Nakano, T., Furukawa, Y., and Niho, Y. (1992). Epstein-Barr virus BCRFl gene product (viral interleukin 10) inhibits superoxide anion production by human monocytes. Lymphokine Cytokine Res. 11, 209-214. 86. Rode, H.-J., Janssen, W., Rosen-Wolff, A., Bugert, J. J., Thein, P., Becker, Y., and Darai, G. (1993). The genome of equine herpesvirus type 2 harbors an interleukin 10 (ILlO)-like gene. Virus Genes 7, 111-116. 87. Hudson, G. S., Bankier, A. T., Satchwell, S. C., and Barrell, B. G. (1985). The short unique region of the B95-8 Epstein-Barr virus genome. Virology 147, 81-98. 88. Smith, C. A., Davis, T., Anderson, D., Solam, L., Beckmann, M. P., Jerzy, R., Dower, S. K., Cosman, D., and Goodwin, R. G. (1990).A receptor for tumor necrosis factor defines an unusual family of cellular and viral proteins. Science 248, 1019- 1023. 89. Upton, C., Mossman, K., and McFadden, G. (1992). Encoding of a homolog of the IFN-y receptor by myxoma virus. Science 258, 1369-1372. 90. Minty, A., Chalon, P., Derocq, J.-M., Dumont, X., Guillemot, J.-C., Kaghad, M.,
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
25
Labit, C., Leplatois, P., Liauzun, P., Miloux, B., Minty, C., Casellas, P., Loison, G., Lupker, J., Shire, D., Ferrara, P., and Caput, D. (1993). Interleukin-13 is a new human lymphokine regulating inflammatoiy and immune responses. Nature (London) 362,248-250. 91. Punnonen, J., Aversa, G., Cocks, B. G., McKenzie, A. N. J., Menon, S., Zurawski, G . , de Waal Malefyt, H., and de Vries, J. E. (1993). Interleukin 13induces interleukin 4independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc. Natl. Acad. Sci. U.S.A. 90, 3730-3734. 92. McKenzie, A. N. J., Cnlpepper, J. A., de Wad Malefyt, R., Briere, F., Punnonen, J., Aversa, G., Sato, A., Dang, W., Cocks, B. G., Menon, S.,de Vries, J. E., Banchereau, J., and Zurawski, G. (1993). Interleukin 13, a T-cell-derived cytokine that regulates human monocyte and B-cell function. Proc. Natl. Acad. Sci. U.S.A. 90, 3735-3739. 93. Gazzinelli, R. T., Makino, M., Chattopadhyay, S. K., Snapper. C. M., Sher, A,, Hugin, A. W., and Morse, H. C. (1992). CD4+ subset regulation in viral infection: Preferential activation of Th2 cells during progression ofretrovirus-induced imniunodeficiency in mice. J. Immunot. 148, 182-188. 94. Clerici, M., and Shearer, G. M. (1993). A TEI1+ TH2switch is a critical step in the etiology of HIV infection. Zrnmunol. Today 14, 107-111. 95. Romani, L., Mencacci, A., Cenci, E., Spaccapelo, R., Mosci, P., Puccetti, P., and Bistoni, F. (1993). CD4' subset expression in murine candidiasis: Th responses correlate directly with genetically determined susceptibility o r vaccine-induced resistance. J. Irnrnunol. 150, 925-931. 96. Silva, J. S., Morrissey, P. J., Grabstein, K. H., Mohler, K. M., Anderson, D., and Reed, S. G. (1992). Interleukin 10 and interferon y regulation of experimental Trypanosoma cruzi infection. J. Exp. Med. 175, 169-174. 97. Wakelin, D., Rose, M. E., Hesketh, P., Else, K. J., and Grencis, R. K. (1993). Immunity to coccidiosis: Genetic influences on lymphocyte and cytokine r e sponses to infection with Eirneria uertniformis in inbred mice. Parusite Imrnunol. 15, 11-19. 98. Yamaniura, M., Uyemura, K., Deans, K. J., Weinberg, K., Rea, T . H., Bloom, B. H., and Modlin, R. L. (1991).Defining protective responses to pathogens: CytoLine profiles i n leprosy lesions. Science 254, 277-279. 99. Yaniamura, M., Wang, X. K.,Ohmen, J . D., Uyemura. K.,Hea, T. H., Bloom, B. H., and Modlin, H. L. (1992). Cytokine patterns of' inimunologicallv mediated tissue damage. J. Irnrnunol. 149, 1470-1475. 100. Heinzel, F. P., Sadick, M. D., Mutha, S.S.,and Locksiey, H. M. (1991). Production of interferon y interleukin 2, interleukin 4, and interleukin 10 b y CD4' Ivmphocytes in vivo during healing and progressivc murine leishmaniasis. Proc. NatP. Acad. Sci. U.S.A. 88, 7011-7015. 101. Locksiey, R. M., Heinzel, F. P., Sadick, M. D., Holaday, B. J., and Gardner, K. D., Jr. (1987). Miirine cutaneous leishmaniasis: Susceptibility correlates with differential expansion of helper T-cell subsets. An71. Znst. Pasteur. Zmmunol. 138, 744-749. 102. Schandene, L., Ferster, A., Mascart Lemone, F., Crusiaux, A,, Gerard, C., Marchant, A,, Lybin, M., Velu, T., Sariban, E., and Coldman, M. (1993).T helper type 2-like cells and therapeutic effects of interferon-y in combined immunodeficiency with hypereosinophilia (Onienn's syndrome). Eur. J, Zmniunol. 23, 56-60. 103. Yamamura, M., Modlin, R. L., Ohmen, J. D., and Moy, R. L. (1993).Local expression of antiinflanimatory cytokines i n cancer. J. Clin. Invest. 91, 1005-1010.
26
TIM R. MOSMANN
104. Firestein, G. S., Roeder, W. D., Laxer, J. A., Townsend, K. S., Weaver, C. T., Hom, J. T., Linton, J., Torbett, B. E., and Glasebrook, A. L. (1989).A new murine CD4+ T cell subset with an unrestricted cytokine profile. J. lmmunol. 143, 518-525. 105. Paliard, X., de Waal Malefijt, R., Yssel, H., Blanchard, D., Chretien, I., Abrams, J., de Vries, J. E., and Spits, H. (1988). Simultaneous production of IL-2, IL-4, and IFN-y by activated human CD4+ and CD8' T cell clones. J. Immunol. 141, 849-855. 106. Kennedy, M. K., Torrance, D. S., Picha, K. S., and Mohler, K. M. (1992). Analysis of cytokine mRNA expression in the central nervous system ofmice with experimental autoimmune encephalomyelitis reveals that IL-10 mRNA expression correlates with recovery. 1. Immunol. 149,2496-2505. 107. D e Wit, D., Van Mechelen, M., Zanin, C., Doutrelepont, J. M., Velu, T., Gerard, C., Abramowicz, D., Scheerlinck, J. P., De Baetselier, P., Urbain, J., Oberdan, L., Goldman, M., and Moser, M. (1993). Preferential activation of Th2 cells in chronic graft-versus-host reaction. 1. Immunol. 150, 361-366. 108. Antin, J. H., and Ferrara, J. L. (1992). Cytokine dysregulation and acute graftversus-host disease. Blood 80,2964-2968. 109. Takeuchi, T., Lowry, R. P., and Konieczny, B. (1992).Heart allografts in murine systems: The differential activation of The-like effector cells in peripheral tolerance. Transplantation 53, 1281-1294. 110. Gerard, C., Bruyns, C., Marchant, A., Abramowicz, D., Vandenabeele, P., Delvaux, A,, Fiers, W., Goldman, M., and Velu, T. (1993). Interleukin 10 reduces the release of tumor necrosis factor and prevents lethality in experimental endotoxemia. 1.E x p . Med. 177,547-550. 111. Ishida, H., Hastings, R., Kearney, J.. and Howard, M. (1992). Continuous antiinterleukin 10 antibody administration depletes mice of Ly-1 B cells but not conventional B cells. J. E x p . Med. 175, 1213-1220. 112. Kuhn, R., Rajewsky, K., and Muller, W. (1992). IL4 and lLl0 deficient mice. 8th lnt. Cong. Imm. 203 [Abstract] 113. Wegmann, T. G., Lin, H., Guilbert, L. J., and Mosmann, T. R. (1993). Bidirectional cytokine interactions in the maternal-fetal relationship: Is successful pregnancy a TH2 phenomenon? Immunol. Today, 14,353-356. This article was accepted for publication on 9 December 1993.
ADVANCES IN IMMUNOLOGY. VOL. 56
The Mechanism of V(D)J Joining: lessons from Molecular, Immunological, and Comparative Analyses SUSANNA M. LEWIS Division of Biology, California lnstitue of Technology, Pasadena, California 91 125
1. Introduction
Antigen receptor gene assembly is a daunting problem of genetic cngineering. Every fiinctional T or R cell must successfully recombine not one, but two different loci. At each locus, two, three, and sometimes four gene segments must be accurately targeted out of megabases of DNA sequence. The outcome is all the more remarkable given that the V( D)J joining apparatus appears to exhibit an inherent flexibility in target site specificity, in the topography of acceptable substrates, and in the directionality of strand exchange. Site-directed recombination in other biological systems is carried out by recombinases that are extremely discriminatory when it comes to one or more of the above properties, and this discrimination is thought to represent the principal means by which the chemically possible outcomes of a reaction are restricted to the one desired product ( a s , for example, discussed in Mizuuchi, 1992b). It may be that the molecular details ofV(D)J recombination, once revealed, will establish similarities between these other systems and V(D)Jjoining that are not yet apparent. But another possibility is that the demands of carrying out a site-directed recombination reaction in the context of a differentiating tissue are so different from those encountered in “simpler” organisms, that the strategies that ensure accuracy here really have no relevant precedent. Numerous review articles on antigen receptor gene rearrangement have appeared (Lieber, 1991,1992; Alt et al., 1992a,b; Feeney, l992a; Gellert, 1992 a,b; Kallenbach and Kougeon, 1992; Oettinger, 1992; Schatz and Chun, 1992; Schatz et ul. 1992; Sell, 1992; Taccioli et nl. 1992; VanDyk and Meek, 1992; Chen and Alt, 1993; Ferguson and Thompson, 1993).Significant advances in the past few years are responsible for encouraging a closer look at the molecular mechanism of the process. The present goal is somewhat different from previous efforts, however. It seems an appropriate time to attempt an interdisciplinary perspective; to consider what both molecular biologists and immunologists have learned about the V(D)J recombination process, as instructed by cross-species (and cross-locus) comparisons. The question 27 Copylight 0 11194 liv Academic Prew. lnc. All rights of reproduction !TI any form resened.
28
SUSANNA M. LEWIS
that will be considered here is how nature ensures a biologically sensible outcome in antigen receptor gene assembly. In particular, to what degree is a successful outcome attributable to the molecular mechanics of the joining process itself? It. V(D)J Joining Basics ‘4. GENEASSEMBLYFOR IMMUNOGLOBULIN, T CELLRECEPTOR
THESTANDARD EQUATION Immune recognition in vertebrates is based on the antigen receptors manufactured by B and T cells. The antigen-binding polypeptides within these multiunit conglomerates (reviewed in Keth, 1992; Rothenberg, 1992) are encoded at the immunoglobulin (Ig) and T cell receptor (TCR) loci (Fig. 1). In mice and humans seven such loci exist, a pair of which must functionally rearrange in every B or T cell before expression is possible. Through the process called “V(D)J joining,” antigen receptor genes are constructed from multiply reiterated DNA segments in B and T cells. By this means, an enormous number of binding specificities can be generated in lymphoid cells from a relatively minimal amount of germline information (reviewed in Davis and Bjorkman, 1988). Rearranging antigen receptor loci are found in creatures representing every ancient vertebrate radiations (Litman et ul., 1993).All except for possibly the most phylogenetically primitive vertebrates appear to possess Ig superfamily homologues, and to the extent this has been determined, the potential for somatic V( D)J recombination is universally observed (e.g., Greenberg and Flajnick, 1994; Greenberg et al. 1993, reviewed in Litman et al., 1993). Although two other types of genetic manipulation, somatic mutation and gene conversion, figure prominently as a device for generating a diverse immune repertoire in some species (reviewed in d u Pasquier, 1992; Thompson, 1992), the variability that is generated by V(D)J joining is of preeminent importance in others (Davis and Bjorkman, 1988; Jorgensen et ul., 1992). A differentiated B or T cell will have rearranged two loci: one of these contains “V” and “J” segments only, the other contains “V’s”, “D’s”, and “J’s”. The process of V(D)J joining forms what is called the “variable exon” ofTCRand Ig genes. Roughly speaking, on completion, a variable exon will have acquired approximately 95 of its codons from one of many germline V segments, about 2 to 9 codons from each D that was incorporated (if D segments were provided at the locus in question), and the remaining 12-22 codons from one of several J PHODUCTION:
TCR 8
FIG. 1 . The structure of rearranging loci in the mouse. Transcriptional orientation is implied by tlie orientation of the lettering. For ii inore detailed presentation (both mouse and hiinian) see Lai e t d., (1989) and citations in text. T h e total number of ( f h c t i o n a l ) V, D. a i d J segments is represented either by the total number of boxes or, where a groiip has been lxacketetl, by the nunil)er indicated above (Kofler et a/., 1989). Pseudogene V and J segments are not illustrated. N o attempt has been iiiade to draw the niaps to scale: relative distances are presented in Lai rt al. (1989). Slashed lines indicate that orientation of the segments I-elative to the rest of tlie locus is not known. Detailed exonic structures of V and C segments are not shown. T h e 12-bpspacerjoining signals tire indicated b y white triangles; 23-base spacer signals are shaded. At loci where rearrangements occur predominantly Ixtweert restricted sets of V’s and J’s, this restriction is indicated with arrows (for references, see section 111,A).V genes are shown in groupings of like polaritv at the K locus; although this is consistent with available arialyses in niouse (Heinrich et u l . , 1984; Lawler et ul., 1992) and with more extensive studies in human (Pargent et ul., 1991; Lautner-Rieske et ul., 1992), it is not known to be the case in general. An important aspect of locus organization is the relative positioning o f V gene seginents belonging to “faiiiilies” ofrelated sequence. This teatiire is not incorporated into the f i g i r e ; however, discussions may he found, for example, in Brodeur et d.(1988) and Kofler et a / . (1989). Cryptic recombination sites that are used with soiiie regularity at the i g and ~ TCHG loci (see section V I I and citations in text) are indicated by asterisks.
segments (Kahat et d., 1991). The vnriahle exon is then spliced to “eonstaiit” region exoils at the HNA level to template the antigen receptor polypeptide. Immunoglobulins manufactured b y B cells consist of one light chain ( K or A ) encoded by a “two-segment” locus, and a heavy chain (IgH) encoded b y a “three-segment locus.” T cell
30
SUSANNA M . LEWIS
receptors are either alp or y / 6 heteromers; in either case, as for immunoglobulin, one chain is encoded by a two-segment locus ( a or y ) and the other is built on the three-segment plan (p or 6; Fig. 1). V(D)J recombination proceeds by joining one pair of gene segments at a time, in what appears to be a simple cut-and-paste type of operation (Bernard et al. 1978; Sakano et ul. 1979; Seidman et al., 1980). The basic transaction is represented by the equation shown in Fig. 2. Initially, in the germline there is a joining signal at the 3’ border of each V segment, at both the 5’ and 3’ borders of’ every D, and at the 5’ border of all J segments (Max et al., 1979; Sakano et al., 1979; Kurosawa et al., 1981; Sakano et ul., 1981). These conserved motifs provide all the necessary elements for targeting by the rearrangement machinery (Lewis et at., 1985; Akira et al., 1987; Hesse et al., 1987). When two gene segments, V and J for example, undergo recombination, a cut is made in each at the boundary between the coding segment and the joining signal. The four ends thus generated are reconnected to form two products. “Coding joint” designates the union of the V and J coding elements (Bernard et ul., 1978; Max et ul., 1979; Sakano et al., 1979); whereas “signal joint” refers to the reciprocal connection of the corresponding signal ends (Steinmetz et al., 1980; Lewis et al., 1984; Fig. 2). Due to the configuration of the joining signals at most loci, V(D)Jjoining is excisive; codingjoints are retained in the chromosome, and signal joints can be demonstrated on extrachromosomal circular DNA molecules (Fujimoto and Yamagishi, 1987; Okazaki et at., 1987). From the perspective of immune function, the all-important junction is the coding joint. The crossover sites between V, D, and J are located in the exon that encodes the antigen-binding domains of Igs and TCRs and have a critical influence on specificity (reviewed in Kabat et al., 1991; Jorgensen et al., 1992). Hypervariability is generated by the combinatorial possibilities presented by the existence of multiple V’s, D’s, and J’s at a given locus (Weigert et al., 1978) as well as by two other features of the V(D)J recombination process. For one, joining does not occur at a fixed position; the amount of sequence contributed by each germline segment (V, D, and J) can vary by a small (usually less than 10)number of residues (Max et al., 1979; Sakano et al., 1979; Weigert et al., 1980). For another, “extra” residues, not present in either precursor element, appear as junctional inserts (Sakano et ul., 1981; Lafaille et al., 1989; McCormack et al., 1989). In striking contrast to the variability ofa coding joint, the reciprocally formed signal joint has a predictable DNA sequence (Lewis et uZ., 1984,1985).The edges ofthe two signal elements are connected to one
V(D)J JOINING
31
GTCCTCC*CACAGTG-12-ACAAAAACC
GGTTTTTGT-23-CACTGTG*CTCAG
--mi+ (-0 +2 -1)
GTCCTCCGGTCAG
(CODING JOINT)
+ (-0
-0)
GGTTTTTGT-23-CACTGTCACAGTG-12-ACAAAAACC
(SIGNAL JOINT) FIG.2. The standard equation for V(D)J recombination. An example ofV-to-J joining is shown. In this and following figures, joining signals are indicated by triangles, coding segments (or equivalent) are indicated by boxes. The coding joint exhibits variability, while the signal joint product is often an exact connection between the heptamer elements of two signals. Dots in the input sequences locate the coding/signal border. As shown, coding elements may be either truncated or joined without base loss. Insertions of sequences at the junction (underlined italics) are also observed. In cases where there are no junctional inserts, the coding joint may sometimes, but not always, exhibit crossover sites located within a very limited “homology” of one or a few residues.
another at a defined position, end-to-end, and in most cases (though not all) this occurs without base addition or base subtraction. Thus two structurally distinct products are formed in a single event by the V(D)J joining machinery. The coincident formation of an imprecise coding joint and a precise signal joint, as depicted in Fig. 2, is the hallmark ofV(D)J recombination. This essential asymmetry in the V(D)J joining reaction has stimulated much speculation about its mechanism. No other recombination reaction can systematically form similar products,
32
SUSANNA M. LEWIS
although analogies to transposition have been drawn by relating the signal joint to a transposon-mediated junction and the coding joint to host-mediated repair processes. Such analogies are provocative, especially in terms of the evolutionary origins of the mechanism (Sakano et ul., 1979), but have yet to prove particularly helpful in understanding the V(D)J joining reaction. In short, as was recognized early (Bernard et al., 1978), there are as many fundamental differences as there are similarities between V(D)J joining and better understood site-directed rearrangement systems. B. RECOMBINATION TARGETS AND
THE 12/23RULE
Joining signals vary in sequence, but all closely resemble a heptamer-spacer-nonamer consensus (Max et al., 1979; Sakano et al., 1979; Fig. 2). Two kinds of joining signal exist, distinguished only by whether the spacer is 12 or 23 residues in length. A feature of the joining mechanism that is essential to the biological success of a joining event is that it follows the “12/23” rule (Early et al., 1980; Sakano et al. 1980; Fig. 2). Accordingly, segments with unlike joining signals (one with a 12-spacer and one with a 23-spacer signal) can be joined together, while segments with like joining signals are incompatible. This constraint imposes a fundamental order on V(D)J assembly. Evolution has apparently shaped the Ig and TCR loci according to the 12/23 rule, so that joining possibilities are restricted to productive segment combinations. V-to-V (or J-to-J) inversions are prevented because each V segment (and likewise each J) has the same type of signal as every other. The 12/23 rule is discussed in more detail in Section VI1,A; despite its central importance, nothing is yet understood about the underlying molecular basis.
c. NONSTANDARD v(D)J JOINING PRODUCTS V(D)J rearrangement can culminate in the production of alternative or “nonstandard” junction products as illustrated in Fig. 3 (StenzelPoore and Rittenberg, 1987; Elliott et al. 1988; Lewis et al., 1988; Morzycka-Wroblewska et al., 1988; Nickerson et al., 1989; Alexandre et al., 1991; VanDyk and Meek, 1992; Carroll et al., 1993a,b; Fish and Bosma 1994;A. Sollbach and G. Wu, personal communication). Demonstrated nonstandard products can account for all theoretically possible signal end-to-coding end assortments. In a “hybrid joint” (Fig 3B), the signal from one gene segment joins to the coding end of another. In an “open-and-shut joint” (Fig 3C), the signal and coding ends created by site-specific cleavage are simply reconnected to one another
33
V(D)J JOINING
B.
A.
Y
C.
3c
Y
+
acoding joint
signal joint
23-hybrid joint
12-hybrid joint
+
+s12-open and shut joint
23-open and shut joint
Frc. 3. Alternative outcomes of V(D)J recombination. (A) Standard. (B) Hybrid. (C) Open and shut. (See legend to Fig. 2.)
without any gross rearrangement: the input. nonrecombinant configuration is maintained. curious thing about these nonstandard junctions is that despite the deviation they represent. they are nevertheless very similar in fine-structure to standard junctions (see Fig. 2 ) . In fact the only major difference between standard and nonstandard joining events appears to be t h e choice ofends that become connected. A codingend, whether it has been incorporated into a standard, hybrid, or open-and-shut joint, exhibits base loss and addition. Signal ends, a s found in any of the three classes of junction, are usually joined without modification (reviewed in Lewis and Gellert, 1989). Nonstandard junctions warrant mention in a section on V(D)J joining basics because these products exemplify one of the le apparent problems ofjoinirig fidelity. The entire category dard joining product is probably not useful physiologically, but despite
34
SUSANNA M. LEWIS
this, is easily demonstrated on both artificial and endogenous V(D)J recombination substrates. Such products then, must be taken into consideration when asking how V(D)J joining arrives at the desired outcome in uiuo.
D. A NOTE ABOUT TERMINOLOGY The literature on V(D)J recombination has expanded to the point where its terminology threatens the patience of an interested nonspecialist. I have attempted to use terms precisely and consistently throughout this review, and the reader will find a glossary of the corresponding definitions in the Appendix. Alternative terms in use by other authors are also included. 111. The Endogenous Substrate
A.
I G AND
TCR Loci
The physiological substrate for V(D)J joining comes in many shapes and sizes. As was briefly mentioned in the previous section, TCR and Ig loci either contain V and J gene segments or contain V’s, D’s, and J’s. Three basic types of segment configuration (discussed below) have been distinguished, as described by the terms “clustered,” “extended,” and “single-gene” (Litman et al., 1993). In addition, locus architecture varies in several other significant features: V gene segments can occur in the same or in mixed orientations, they may be located 5’ or 3’ of their constant regions, they may be flanked by either 12- or 23-spacer signals at a given locus, and, in general, gene segment copy number can range between one and several hundred (Lai et al., 1989; Reynaud et al., 1989a; Litman et al., 1993). Another conspicuous difference between the various rearranging loci is size. Complete physical maps are available in only a few instances, but within this limited sampling, sizes ranging over two orders of magnitude have been observed. The human IgK and IgH loci each have been estimated to cover 2-3 megabases of DNA (Matsuda et al., 1988; Weichhold et al., 1990), while the human TCRy locus is about 160 kb (Lefranc et al., 1989)and the light-chain locus in chickens is only 30 kb (Reynaud et al., 1989a). Confronted with this variety, one must assume that evolution has run up against few absolute constraints in the construction of a rearranging locus. But it does not follow that questions of orientation and distance are of little consequence to the recombination machinery. Locus organization, especially proximity, is frequently offered as an explanation for the apparent preferential rearrangement of particular V gene seg-
V(D)J JOINING
35
ments in various contexts (Yancopoulos et al., 1984; Perlmutter et al., 1985; Jeong and Teale, 1989; Kleinfield and Weigert, 1989; Nickerson et d., 1989; Malynn e t ul. 1990; Allison and Havran, 1991; Roth e t al., 1991; Thompson et al., 1991; Costa et al., 1992; Shirasawa e t al., 1992; Spiel3 et al., 1992; see discussion in section VI1,E). An explanation for the inverted orientation ofV gene segments at the K locus has been suggested (Tiegs et al., 1993; see discussion in Section VI1,G). It has also been proposed that there is functional significance to the gross organizational differences represented by extended, clustered, and single-gene loci (reviewed in Litman et al., 1993). This third notion is discussed in more detail below, as it provides a basis for a brief, comparative tour of the rearranging loci. Generally speaking, none of these suggestions has been completely verified experimentally, although progress has been made in some areas (section VII). The clustered gene configuration (Litman e t al., 1993) is exemplified, in mice, by the murine IgA locus, where neither V nor J is highly reiterated and the gene segments are arranged into units of the following: V..J.. [Constant Exon] .......V..J..[Constant Exon] ... (Blomberg et al., 1981; Storb e t al., 1989; Fig. 1). V-to-J recombination at the A locus appears to occur mostly within a cluster; a V gene segment from one unit is only rarely found to have joined with a J segment from another (see arrows, Fig. 1; Reilly e t al., 1984; Sanchez et al., 1991). A second example of the clustered organization is the murine TCRy locus, in which one cluster contains four V gene segments and each of three others has a single V (Fig. 1). As with the IgA locus, it appears that Vy-to-Jy joining predominantly occurs within units, not between them (arrows, Fig. 1; Raulet et al., 1985; Lai e t al., 1989; and cited therein). The most extreme example of the clustered type of organization (and that which defined this class of gene segment arrangement) was found in cartilaginous fish, where the V..(D)..J....[Constant Exon] ... unit comprising the individual Ig heavy- and light-chain genes is highly reiterated (Kokubu et al., 1988; reviewed in Litman et al., 1993). In these animals, multiple cluster units appear to be scattered throughout the genome, and, again, intracluster recombination appears to be the rule (Hinds-Frey e t al., 1993). The extended gene segment configuration is one where numerous tandemly arranged V segments have the potential to join to a common pool of multiple J (or D) segments (Litman et al., 1993). The reiterated elements are associated with only one or perhaps two constant regions. An extended arrangement, V. .V..V..V..(etc.)......(D..D.. D.etc.). ...J..J..J. (etc.) ...[Constant Exon] ..., is encountered at the murine IgK, IgH, and TCRP loci (Fig. 1).A further variation, found in both mice and humans,
36
SUSANNA M . LEWIS
is where one extended locus (TCRG) is nested within another (TCRa) (Chien et al., 1987a).V gene segments are shared between these intermixed loci so that, although restricted rearrangement patterns are observed in mature T cells, this appears to be imposed, at least in part, b y cellular selection (Spiel3 et al., 1992). Thus, at extended loci, the recombination unit is the entire locus (as indicated by the absence of arrows in Fig. 1). A single-gene organization is found in chickens, where both Ig heavy- and light-chain loci contain only one V gene segment capable of rearrangement. In this case, recombination cannot provide significant diversity (reviewed in McCorniack et al., 199lb; Weill and Reynaud, 1992). Instead, an array of linked pseudo-V gene segments serve as templates for gene conversion, by which process the repertoire is diversified (Reynaud et al. 1987, 1989b). The functional significance of the gross organizational differences represented b y extended, clustered, and single-gene loci is reviewed in Litman et a l . (1993). I n mammals, the difference may not be of overriding significance. The same locus (TCRy for example) is found to be extended in one species and clustered in another (reviewed in Lai et al., 1989). However, broader phylogenetic comparisons provide a picture with sharper contrasts (Litman et al., 1993). The basic organization of rearranging loci appears to have undergone major changes during evolution, and there is reason to believe that the clustered type of organization is the more archaic (Litman et al., 1993). The changeover from clustered to extended configuration roughly corresponds to an increase in the complexity of'the repertoire. Where the clustered organization might limit a V segment to a particular partner (I3 segment and/or J segment), new conibinatorial possibilities were introduced by the regrouping and diversifying of component segments into an extended arrangement (Litman et al., 1993). It may be that in animals (such as mammals) where both clustered and extended configurations are options, the two plans accommodate different needs. A clustered type of configuration may be desirable to limit variability in the gene products of certain loci and to help generate antigen receptors that have predetermined specificities (Litman ot al., 19931. It'such structure/function relationships indeed underlie locus organization, what exactly defines a recombination unit, and how recombination is limited to within, not between clusters is unknown at present. It may come down to an issue of proximity in some species (e.g., Hinds-Frey et al., 1993) but it is also possible that recombination boundaries are imposed by other means as well. These other means might involve elements such as enhancers, matrix-associated regions
(Blasquez et u l . , 1989; Nu t>t u l . , 1989; Cockerill, 1990; Whitehiirst et al., 1992),or possibly sites that interact specifically with the replication apparatus (Ariizumi e t ul., 1993). It is worth entertainingthe possibility that inuch ofthe gross organization of the various loci, including some of the odder variations such as “nesting,” is the way it is for a reason. Even though mechanistic constraints on locus organization appear to be minimal, it may well be that evolution has sculpted the structure of each locus, in each case, in order to most effectively achieve the desired physiological outcome. The comparative anatomy of rearranging loci, as more is learned in the fiiture, may well reveal important clues to the joining mechanism. This issue is discussed fiirther in Section VII.
B. CHHOM.4TIN
THANSCRIPTION, “ACCESSIBILITY”
C ONF IGURAT ION:
METHYLATION,
Only a subset of all possible sites i n the genome is a substrate for V( D)J recombination i n it rearranging cell. For example, on examination of the antigen receptor genes withiii actively rearranging transformed cell lines, it is apparent that these lines carry out recombination at only one or two ofthe seven possible loci (see Table I and citations). In the case of untransforined, normal cells, rearrangement is confined largely to Ig genes i n a B cell and to TCR genes in a T cell (reviewed in A h et ul., 1992a; Benoist and Mathis, 1992; Malissen et al., 1992). Within ii lineage, the activation of recombination at the necessary loci is temporally regulated (see reviews cited). In every case, recombination is at least initiated at the three-segment locus before V-to-1 recombination lwgins at the two-segment locus (for example. IgH before K in a pre-B cell, Alt c)t d . ,1981, or TCRP before a i n a pre-T cell, Raulet ct uZ., 1985).Within a Iocus, the identit), otthe gene segments targeted by the recombination machinery appears to change as a function of’ difierentiation. This is seen for example at three-segment loci where, for TCKP and IgH. 1: genes are not activated for recombination until aftw 13-to-J joining has taken place. A t TCRG, there is evidence that \:-to-Djoining precedes J segment rearrangement (Chien el ul., 19871): Lauzurica and Krangel. 1993, and cited therein). Targeting of gene segments may be even more finely specified still: at certain loci, individual V gene segments appear to rearrange in a temporally defined order (reviewed in Chen and Alt, 1993, and see Goldman et ul.. 1993). For these and other reasons, it is thought that the default state of t h e chroniatin is refractory to \I( D)J recombination, an idea conveyed in general b y the term “accessibility” (Alt et ul., 1987).Much attention
TABLE I CELLLINESACTIVE IN V(D)J RECOMBINATION ~~~~~~~~
Cell line W
m
Phenotypic designation‘
~
Transformed byb
~
~
~
Inducing conditions (if any)d
Pre-B
Ab-MuLV
Pre-B Pre-B
Ab-MuLV Ab-MuLV
33-1
Pre-B
ABC-1 NFS-5
Pre-B Lyl’ pre-B
2017
Pre-T
Ab-MuLV (Igp k transgenic) Ab-MuLV Cas-2 SM MuLV in oivo infection Ab-MuLV
M 14T
Pre-T
HAFTL-I
Progenitor (B cell) B cell
(IgK): Expression of membrane form of p-chain (IgK): Expression of membrane form of p-chain
+
Moloney MuLV i n vivo infection Harvey MuSV 7,12-dimethylbenz(a)anthracene
Ref.r
1
+ / - d IgH
“Typical” Ab-MuLV lymphoid lines P D (300-18) 300-19
38C13
Actively rearranging locic
2 3 4
5 6
(IgH): Overexpression of transcription factor E47
8
TCRa IgH, TCRp
7
(Introduced substrates): Caffeine
9 10
SPL2- 1-2
Immature B
ts All-MuLV
IgH, TCRy
46-6 50.1.1
Pre-B Pro-T
ts All-MuLV Ab-Mu LV
IgH TCRy
1210cl
Early yIG T cell Pre-B (human)
Ab-MuLV (intrathymic injection) Spontaneous
Pro-GMB Pro-B Pro-B Pre-B B cell Pre-B (human) Pre-B (human) Myeloblast Mature B (Human) ? (Hamster)
Balb sarcoma virus Balb sarcoma virus Cas-NS-7 in oioo infection Harvey sarcoma virus myc, raff viral construct Spontaneous (ALL) Spontaneous (ALL) Spontaneous Spontaneous
BLIN-I
w
ED
BAMCl BASC6 C2 NFS70 HSICS BALB-1427 Reh Nalm-6 M1 OCILY8-C3P C H O (“wild-type” or DNA repair-deficient) + RAG-1, -2 A9 + Rag-1, -2 NIH 3T3 + RAG-I, -2 BWlJ +RAG-1, -2
IgK
IgA
(IgH, TCRy): Temperature shift (IgH): Temperature shift (TCRG): In ozuo intrathymic passage and culture with thymic stroma (IgH, TCRy, TCRG): In t h o intrathymic passage ( IgK): Growth in serum-free medium
11 12 13 14
15 16 16 16 16 16 17 17 16 18 19
Fibroblast (L cell dev’t) Fibroblast
20
Hepatocyte
20
20,21
(continues )
T A B L E I-Continued
Cell l i n e HDR37 ( M 1 2 cell l i n e ) + RAG-1, -2 (heat-
Phenotypic designation'
Transformed by'
B-cell
Actively rearranging loci'
I n d u c i n g conditions (if any)d ( I n t r o d u c e d substrates): H e a t shock
Ref.'
22
inducible)
\'drlOuS
(\vlld-typr, AT,
D N A ligase 1(-), Bloom's) +RAG-1, -2
Fibloblast
S\'40
23
(human)
" Designation in reference (01-cited therein), of most closely related normal cell counterpart Note that these are not always unequivocal. All lines are inurine unless otherwise indicated. Trancforniing agent. In the case of in aioo-derived tumors, presence or absence of integrated virus is not always reported in the original citation. All loci listed undergo spontaneous reconibination in parental cells or unnianipulated subclones. No distinction has been made between various types of reconibination at a given locus. In some cases, for example, DJ but not V-to-DJ, recombination niay be observed. Where no locus is listed, the line has been shown to be active for reconibination with introduced substrates. Reference listed reports either de iiotm induction or enhanced recombination for locus in parenthesec. Induction of recombination by cell-cell fusion IS not listed (see for example, Zhao and Storb. 1992; Taccioli et al., 1993; Wang and Rosenberg, 1993). References given are those that reported ongoing recombination activity shown in the table. In most cases, original references for the derivations of the lines shown are cited therein. 1, reviewed in Rosenberg and Witte (1988). Schlissel and Baltimore (1989); 2, Lewis et al. (1982); 3, Reth et oZ. (1985, 1Y87),Daitch r t al. (1952); 4, Iglesias et al. (1991); 5, Persiani et d.(1987); 6, Hardy et al. (1986); 7, Schlissel et al. (1991); 8, Marolleau et 02. (1988), Prinii et al. (1988); 9, Alessandrini et al. (1987), Menetski and Gellert (1990); 10, Roth et al. (1990); 11, Oka et al. (199% Tsukada et al. (1990, 1992); 12, Shirasawa et ul. (1992); 13, Heuze et nl. (1992); 11, Holland et al. (1991); 15, Martin et al. (1991); 16, Lieber et al. (1987); 17, Gauss and Lieber (1993); 18, Stiernholm and Berinstein (1993); 19, Pergola et al. (1993), Taccioli et al. (1993);20, Kallenbach et al. (1992); 21, Schatz et al. (1989), Oettinger et a/., (1990); 22, et al. (1993); 23, Hsieh et al. (1993). Petrini et al. (1994).
'
''
V[D)JJ O I N I N G
41
has been given to the possible cis- and truns-acting regulatory elenients that might govern this accessbility. Although the control of V( D)J joining through the action of enhancer, promoter, and “silencer” elements is central to the topic, this has been discussed elsewhere (relevant reviews are cited above, and see also Winoto, 1991; Schatz et nl., 1992; Serwe and Sablitzky, 1993; Lauster et al., 1993). The influences of various polypeptides (in particular “surrogate” light chains, Ig-p chains, “D-p” proteins, and TCRp chains) in the temporal activation of gene rearrangement are also under intensive investigation (for reviews and discussions, see Chen, 1993a; Ehlich et aZ., 1993; Groettrup et al., 1993; Melchers et al., 1993; Rolink and Melchers, 1993; Shapiro et aZ., 1993). To confine the discussion, the regulatory aspects ofV(D)J joining will not be considered here; the following is fairly narrowly focused on the substrate itself, comprising a review of what might define “rearrangeable” chromatin. Before proceeding to a discussion of chromatin configuration, for reference, the position of known transcriptional regulatory elements relative to V, D, and J segments in the germline are summarized briefiy. Enhancers have been described for all TCR and Ig loci (in mice), and in all cases these are situated either in the J-to-C intron or 3 ’ to the constant region. For the TCR loci; TCRa and p enhancers are found 3 and 6 kb 3’ to Ca and Cp,, respectively, while the TCRG enhancer is intronic (see Leiden 1993 for review and original citations). For the Ig loci, Igh enhancers are found 15.5 kb 3’ to CA,, and 35 kb 3’ to CA,/CA,, the I ~ locus K possesses both an intronic enhancer and one 8.5 kb 3’ of the constant region, and the IgH locus has an intronic enhancer as well as a second element located over 100 k b away at its furthest 3’ reaches (see Staudt and Lenardo 1991 for original citations). Promoter elements are found S’ of all functional V gene segments and additionally, sequences with promoter activity are found 5‘ to D, and Dp (Reth and Alt, 1984; Siu et al., 1984). The state of the chromatin in the neighborhood of rearranging gene segments has been assessed according to three criteria. These are { 1)transcriptional activity, (2) DNase 1 sensitivity, and (3) methylation. Each feature correlates with V( D)J recombination, although none perfectly predicts which joining signals are available for rearrangement. The question of chromatin structure during VCD)J recombination is verv difficult to approach experimentally for reasons that are both technical and theoretical. As assessed in a huik population of cells, the state of the chromatin at the time of observation may o r may not reflect the condition of the substrate during recombination as it exists in an individual cell. Additionally, it is not clear how many different
42
SUSANNA M . LEWIS
“states” need be defined: the chromatin changes that first accompany the onset of recombination, or “opening” of a locus, may be different from that which allows particular elements within the locus to be later targeted. It is also conceivable that the accessible state is achieved through different mechanisms at different stages of gene assembly, so that the features that allow D-to-J joining may be different from those that permit V-to-DJ, V-to-D, or V-to-J rearrangement (Ferrier et d., 1990; Lauzurica and Krangel, 1993; Serwe and Sablitzky, 1993). Consequently, some basic questions still remain to be clearly formulated, and most of the following observations are as yet, only partially interpretable.
1 . Transcription Many studies have shown that it is possible to detect Ig or TCR gene transcription prior to, or concomitant with, the onset of V(D)J rearrangement. Transcripts of unrearranged V gene segments as well as unrearranged J-C regions have been observed (Van Ness et al., 1981; Yancopoulos and Alt, 1985; Cook and Balaton, 1987; Leclercq et al., 1989; Schlissel and Baltimore, 1989; Lennon and Perry, 1990; Martin et al., 1991; Schlissel et al., 1991; Fondell and Marcu, 1992; Madrenas et al., 1992; Thompson et al., 1992; Tsunetsugu-Yokota et ul., 1992; de Chasseval and de Villartay, 1993; Goldman et al., 1993; Shimizu et at., 1993).Transcription and recombination correlate well in several inducible systems (Schlissel and Baltimore, 1989; Martin et al., 1991; Schlissel et al., 1991). V gene segment transcription at the relevant locus is seen in cells poised for V-to-DJ or V-to-J recombination (Yancopoulos and Alt, 1985; Martin et al., 1991; Schlissel et ul., 1991; Fondell and Marcu, 1992; Tsunetsugu-Yokota et at., 1992). Significantly, cells that are inactive for V-to-DJ, but capable of D-toJ H joining (at the same locus) do not transcribe their unrearranged VH gene segments (Schlissel et al., 1991). A particularly striking correlation was found at TCRy where the transcription of unrearranged Vy gene segments rises and falls in parallel with their ordered recombination during ontogeny (Goldman et al., 1993). The essential meaning of the relationship between transcription and recombination is unclear. The data from various studies indicate, above all, that the definitive experiment has yet to be devised. As an example, whereas an estimated 150-fold increase in D-to-J, rearrangement accompanied transfection of a pre-T cell line by the transcription factor E47, the “I-p” transcript that was also induced by this factor, did not actually pass through any D or J segments (Schlissel et al., 1991). Investigation of the link between transcription and V(D)J recombina-
V(D)J JOINING
43
tion with transgenic constructs has supported somewhat varied conclusions as well. Lineage-specific transcription of gene segments parallel rearrangement in some experiments (e.g., Ferrier et al., 199Ob; Lauster et nl., 1993; Chen et al., 1993) but examples of rearrangement in the absence of detected transcription has been found in other cases (e.g., Bucchini et al., 1987; Goodhardt et nl., 1987; Engler et al., 1991a; Kallenbach et al., 1993; Lauster et nl., 1993). Studies with an extrachromosomal plasmid substrate (described in more detail in Section IV,C) showed a constant recombination frequency in tests in which steadystate transcription levels were experimentally varied over four orders of magnitude (Hsieh et a!., 1992).While it is possible that extrachromosoma1 substrates only imperfectly reconstruct the chromatin configuration of the endogenous joining target, taken together, the evidence to date disfavors an obligate link between transcription and recombination. Thus, while transcription may be the one salient feature determining a rearrangeable target site for certain V gene segments (for example, Yancopoulos and Alt, 1985; Schlissel et al., 1991; Goldman et al., 1993), it is difficult to generalize across the board to every category of V(D)J recombination. As many authors note, it would not be surprising to find that either transcription represents only one of several ways to activate the endogenous substrate in some contexts and/or that it is detected as an indirect by-product of “activation.”
2. DNase 1 Sensitivity Nuclease sensitivity provides another means of measuring changes in chromatin configuration. DNase sensitivity studies of either intronic or 3’ enhancers associated with various loci have demonstrated hypersensitive sites early in lymphoid differentiation; in some cases hypersensitivity appears to develop even prior to T or B lineage commitment (Hagman et nl., 1990; Ford ef nl., 1992; Blasquez, 1994). Changes more specifically localized to various gene segments have also been demonstrated. The chromatin of pre-B-like transformants that possess the ability to spontaneously rearrange certain of their Ig loci has been probed in the region surrounding the active J segments, and a consistent correlation between rearrangement and DNase 1 sensitivity was found (Yancopoulos et al., 1986; Persiani and Selsing, 1989). In both T and B lymphocyte lineages, recombination of signal-like elements (unattached to a functional gene segment) occurs with regularity, and such events are likewise linked to the onset of nuclease hypersensitivity (Daitch et al., 1992; de Chasseval and de Villartay, 1993). With introduced substrates, almost all experiments support a relationship between DNase 1 sensitivity and recombination. For example, when
44
SUSANNA M . LEWIS
a substrate containing unrearranged Vp, DP, and Jp segments was tested in a pre-B-like transformant, DP-to-JP joining was observed, but the closely linked Vp gene segment would not rearrange. The introduced Dp and JP gene segment sequences were DNase 1 sensitive when compared to the cell’s endogenous (nonrearranging) Dp and JP gene segments, but, significantly, the nearby, inert, Vp gene segment in the substrate was DNase resistant (Ferrier et al., 1989). DNase 1 sensitivity studies thus appear to pick up global changes that serve as a prelude to recombination as well as more specific changes that create a permissive substrate for rearrangement. The studies indicate, at the very least, that the rearranging loci have a chromatin configuration in primitive embryonic cells, or cells from an irrelevant lineage, different from that in lymphoid progenitors and, further, that within an active cell, differences exist between loci or gene segments that undergo rearrangement and those that do not. These studies thus in a general way substantiate the notion of accessibility on a’molecular level. The precise nature ofthe chromatin conforniational change accompanying nuclease sensitivity remains to be elucidated.
3. Methylation Methylation of cytosine in DNA is an important parameter governing tissue-specific gene expression (reviewed in Razin and Cedar, 1991; Bird, 1992). Early work showed that patterns of CpG methylation change during 1yniphocyte maturation and introduced the notion that such changes might also be relevant for V(D)Jjoining (Storb and Arp, 1983).Within the lymphoid lineage, there is support from studies hoth of the physiological substrate and with introduced sequences for the idea that methylation has consequences for antigen receptor gene assembly. Studies of nontransformed cells indicated that in the region surrounding the JP2 segment, certain sites were less methylated in immature thymocytes when compared to mature T cells, or splenic B cclls (Burger and Radbruch, 1990). A second analysis of methylation o f the J p region in Ixmatopoetic precursors, early fetal thymus, and bone marrow cells also indicated that a hyponiethylated state at the TCRP locus is lineage-specific and is established close in time to the onset o f rearrangement. Further, experimental demethylation, by treating cells with 5-azacytidine, was found to increase recombination in early T lineage cells (Vila ef at., 1993). Studies with introduced substrates have begun to examine demethylation and V(D)J recombination more directly. For example, U. Storb and colleagues found that methylation of a transgenic recombination
substrate was high]). strain dependent and were able to exploit this finding to establish a connection between methylation and rearran ge men t . A 1ocus , name d st rai n- s peci fie modifier- 1 ( S s m -1), was identified that maps to chroniosoine 4 (Engler et al., l Y Y l b ) . By selective crosses it was possillle to derive mice that varied with regard to methylation of the transgene and in this fashion to measure effects of methylatioil on recornhination in a fully in 2iiz;o context (Engler et al.. 1993). A compelling set of observations was that for some lines, the mice had transgene arrays in which individual copies were inethylated to a different extent. The methylation pattern was similar in all tissues (i.e., stable), and within the transgene arra17, recombination was limited to hyponiethylated sequences (Engler et nl., 1993). Tests of the effects of substrate methylation were carried out with introduced plasmid substrates as well (Hsieh and Lieber, 1992). In a provocative study, it was demonstrated that the negative effect of methylation could be reproduced i n an extrachromosomal assay system. Here, a new twist to the story emerged. The minichromosome became resistant to V(D)J recombination only after it was replicated. The joining signals in nonreplicating plasmids recombined, whether methylated or not. This observation argued against the possibility that methylation might interfere directly with the binding of the recombination machinery to its targets. Instead, a change in accessibility was suggested by the resistance of the methylated ininichromosome to restriction enzyme cleavage which, after replication, became even more marked. (It is of interest that for unrelated recombination systems tested in an extrachromosomal assa)., similar effects ofsubstrate methylation are not observed: see Pryciak et d., 1992; Puchta ef al.. 1992.) Based on these obserwtions, the authors suggested that methylation in itself does not IiaI access b y the 1-ecombination machinery, but is a signal that can switcli the chromatin into an inaccessible state afterreplication (Hsieh and Liebel-, 1992). For the present, a great many questions allout the endogenous substrate remain. Is accessil)ility a yes or no situation, or do different states of accessihilit!. exist? How does accessibility correspond to different categories of recoml)ination ( i . c . , D-to-J joining rather than V-to-DJ rearrangement)? Perhaps methylation is only relevant for gene segments that are located near an enhancer, while another feature, such as transcription, is kej. in regulating the recombination of gene segments that are equipped with their own promoters. Some of t h e w issues nia!, be unraveled b y investigating the informative contrasts that exist between the TCKG locus and the other three-segment loci, given that the enhancer dependence of V-to-D versus D-to-J recombi-
46
SUSANNA M . LEWIS
nation is apparently reversed (Lauzurica and Krangel, 1993). There is no question that chromatin configuration is important in this recombination system, and there is much incentive to learn exactly what accessibility means in molecular terms. IV. Model Systems
A. WHYNOT JUSTANALYZEin V~DO-GENERATED JUNCTIONS? As will be detailed in the next section (section V), the structure of the junctions formed in V(D)J recombination events can reveal much about the mechanism. How such junctions are sampled, however, is of key importance. Cells with rearranged antigen receptor genes are readily obtained from normal lymphoid tissues, and, using polymerase chain reaction (PCR) technology, it is possible to generate extensive collections of junction sequences. In real life, selection winnows out a great majority ofV(D)Jjoining products. A number of different repertoires, the “emergent”, the “preimmune”, the “peripheral”, and so forth, can be described for an intact animal, and in any given experiment, it is not always obvious which of these repertoires has been sampled, nor indeed whether selective elimination of an entire category of V(D)J junction might have occurred. Some evidence favors the view that selection can operate on T and B cells, or on antigen receptor gene products, prior to the completion of the rearrangement program (Decker et al., 1991; Mallick et al., 1993; Anderson et al., 1993; Groettrup et al., 1993). One way this might occur is through the incorporation of one of the antigen receptor chains into an immature receptor structure that transduces a signal upon ligation (Takemori et al., 1990; Misener et al., 1991; Groettrup et al., 1992, 1993). Another might be through the association of a component antigen receptor chain with a protein that affects its intracellular fate (Shirasawa et al., 1993). The general problem of selection is not necessarily avoided by limiting an analysis to junctions that arise in partially assembled genes. Promoters upstream of DH (Reth and Alt, 1984), and D p (Siu et al., 1984; Clark et al., 1984) potentiate transcription of chromosomes that have undergone D-to-J joining only, allowing, in theory, for the production of “Vless” peptides. In the case of the Ig heavy chain locus, evidence suggests that a D-p protein can be manufactured in transformed preB cell lines (Reth and Alt, 1984), that has the potential for surface display (Tsubata et al., 1991). It has not yet been established D-p production occurs in normal pre-B cells (Rolink and Melchers, 1993), nevertheless the possibility exists that even D-to-J rearrangements
V(D)J JOINING
47
have in some fashion already been subjected to physiologic selection (e.g., Gu et al., 1991).Oftentimes, “nonproductive” (out-of-frame)joins are presented as examples of unselected junctions. However, when collected from lymphoid cells or tissues, such nonproductive joins are isolated from “successful” cells; their coexistence with productive joins in a functional T or B cell supports the expectation that even out-of-frame junctions may have been subjected to selection on the basis of their coding capacity (or lack thereof). For these reasons, the essential features of the V(D)Jjoining machinery are easiest to analyze when completely removed from the immune environment. It is beyond question that studies of junctions generated in intact animals have drawn attention to features of the joining mechanism that were less emphasized with artificial model systems. It remains the case, however, that having highlighted the possible role of homology in joining or the existence of “P” nucleotides for example (discussed in detail in section V ) such features are not established by in vivo studies. Experimental exploration can go forward only through the use of introduced substrates in systems where the rearranged sequence is of no biological consequence to the cell in which it resides.
B. REARRANGING CELLS:B, T, AND OTHERS V(D)J recombinaton occurs during a defined period early in T and B lymphocyte differentiation, after which the ability to carry out gene assembly is shut down. The complete picture ofhow the recombination process is integrated into the differentiation program is an area of intense research, supported by studies both on normal cells and on transgenic mice that cannot rearrange/express a particular locus (e.g., Chen et al., 1993a; Faust et al., 1993; Itohara et al., 1993; Muegge et al., l993a; Serwe and Sablitzky, 1993; reviewed in Rolink and Melchers, 1993). The isolation of normal cells in the process of V(D)Jjoining initially presented insurmountable technical challenges, so that for a long time immortalized early B lineage cells provided the only experimental opportunities. Oddly, ongoing recombination is not a feature of most transformed pre-B analogs. Hybridomas, where normal pre-B cells are fused to a more mature myeloma cell, are negative for ongoing recombination. Apparently a factor contributed by the myeloma partner downregulates expression of several genes playing a role in V(D)J recombination (Engler et al., 1991a; Zhao and Storb, 1992). A wellstudied pre-B cell line, 702/3,likewise scored negative for recombination activity despite its characteristic pre-B phenotype (Lieber et al., 1987, although rare, recombination positive variants have been se-
48
SUSANNA M. LEWIS
lected; Schatz and Baltimore, 1988). Epstein-Barr virus (EBV)immortalizes human fetal cells, giving rise to transformants that correspond to early stages of B cell differentiation, but their Ig genes do not rearrange during passage in culture (Katamine et al., 1984; Hui et al., 1989; Kubagawa et al., 1989; Nickerson et al., 1989; and cited therein). The only agent that reliably immortalizes cells capable of ongoing Ig gene assembly has proved to be the Abelson-murine leukemia virus (A-MuLV; reviewed in Rosenberg and Witte, 1988). A-MuLV-transformed lymphoid cell lines may be generated by a variety of protocols, usually either by in vivo infection of newborn mice or by in vitro infection of fetal liver or adult bone marrow cells (reviewed in Rosenberg and Witte, 1988). Different protocols yield cells at different stages of B cell differentiation and even some nonB lineage transformants (e.g., Rosenberg and Witte, 1988; Siden, 1993). The typical A-MuLV lymphoid cell line is germline at its Ig lightchain loci and has at least partially rearranged its IgH locus (Alt et al., 1981). Despite having achieved some heavy-chain gene assembly, AMuLV transforinants may or may not be able to synthesize a p heavychain protein and/or carry out further recombination (Lewis et al., 1982; Alt et al., 1984; Ramakrishnan and Rosenberg 1988; Wang and Rosenberg, 1993). Representative phenotypes and gene structures found among lymphoid examples of A-MuLV-transformed cell lines (some of which are T- rather than B-like) are shown in Table 1. Most A-MuLV transformants, even if incapable of rearranging their antigen receptor loci, can recombine defined, introduced substrates (Blackwell and Alt, 1984; Lewis et al., 1984; Lieber et al.. 1987; Ramakrishnan and Rosenberg, 1988; Wang and Rosenberg, 1993).This ability appears to be stable over time (Lieber et al., 1987; Wang and Rosenberg, 1993). A number of different recombination substrates have been used in such studies, as are described in the following section. Only a handful of non-A-MuLV murine lyniphomas and human leukemic cell lines have been reported to actively undergo V(D)J recombination (Kleinfield et al., 1986; Dasgupta and Lilly, 1988; Berrnstein et ul., 1989; Wormann et d.>1989; Roth et a!.- 1990; Martin et al., 1991; Gauss and Lieber, 1993; and see Table I). This alone might indicate that there is something important about the abl protein when it comes to the physiology of a rearranging lymphocyte. This view is underscored by studies with temperature-sensitive variants of AMuLV (as discussed in Rosenberg, 1991) and by the specific depletion of B and T cell progenitors in abl-deficient mice generated by gene targeting (Schwartzberg et al., 1991; Tybulewicz et al., 1991). LilthoughA-MuLV transformants presented the first opportunity to study V(D)J joining as an ongoing event, other sources of clonable,
V(D)JJOINING
49
rearranging cell lines have since been developed. Bone marrow stroina will support B cell lyniphopoeisis (Whitlock and Witte, 1982; reviewed in Dorshkirid and Witte, 1987; Dorshkind, 1990; Rolink et al., 1991) and such long-term culture systems have made it possible to begin to chart the functional relationship between gene rearrangement and other landmarks i n very early B cell differentiation (e.g., Hayashi et al., 1990; Era et al., 1991; Hardy et al., 1991; Cumano and Paige, 1992; Henderson et al., 1992; Palacios and Samaridis, 1992; Cumano et al., 1993; Faust et al., 1993; and reviewed in Kolink and Melchers, 1991). Despite their suitability for the study of regulatory aspects of the V(U)J joining process, long-term bone marrow cultures are far more coniplicated to maintain than A-MuLV-transformed cell lines, and so have not been used extensively to inquire into the recombination mechanism itself. Early B lymphopoiesis has been reconstructed in cultures supported by various lymphokines in the absence of stromal cells. This promises to provide a powerful approach to a single-cell analysis of the coordinate changes accompanying gene rearrangement in very early B cell differentiation (Kee et ul., 1994). Although there is no A-MuLV equivalent for the reproducible derivation of immortalized, rearranging T cells, there are some in vitro systems for studying T cell differentiation. Extrathymic T cell differentiation can be supported in hone marrow cultures (Hurwitz et al., 1988) and a system for analyzing recombination in thymus-dependent lineages involves short-term organ culture of repopulated fetal thymic lobes (Ikuta and Weissmaii, 1991). TCR gene structure has also been analyzed as a function of differentiation for progenitor cell clones grown on thymic epithelial cells (Palacios and Samaridis, 1993). Suspension cultures of thymocytes have been shown to maintain active TCRP gene rearrangement when treated with 11-7 (Muegge et ul., 1993a). In a different type of approach altogether, it has become possible to generate nonlymphoid cell lines with the ability to carry out V(U)J recombination, virtually at will. Co-introduction of the RAG-1 and RAG-2 genes (described in more detail below) into inactive cells potentiates V(D)J joining as measured on introduced substrates (Schatz and Baltimore 1988; Oettinger ct ul., 1990). To date, in every case reported, nonlyinphoid cells have successfully been rendered recombination proficient by this manipulation. Tested lines include (in addition to NIH 3T3 fibroblastoid cells) a fetal mouse hepatoma, an L cell derivative, Chinese hamster ovary cells, and human fibroblastoid lines (Oettinger et al., 1990; Kallenbach et al., 1992; Hsieh et al., 1993; Pergola et al., 1993; Petrini et a/., 1994; Taccioli et al., 1993). This methodology is only just beginning to be exploited, but has great
50
SUSANNA M. LEWIS
potential for uncovering essential information about the mechanics of the recombination system. Increasingly it appears that V(D)J joining requires significant participation of non-tissue-specific functions, thus the ability to look at the products of joining that are formed in mutant cells, in different cell types, and in various species, is particularly relevant.
C. INTRODUCED SUBSTRATES The first systematic explorations of the V(D)J joining process involved the use of artificial recombination substrates introduced into A-MuLV cell lines (Blackwell and Alt, 1984; Lewis et al., 1984).Recombination substrates have subsequently been introduced into normal cells through transgenic technology (reviewed in Rusconi, 1991), where they exhibit lymphoid-specific V(D)J joining (Bucchini et al., 1987; Goodhardt et al., 1987,1993; Ferrier et al., 1990b; Bruggemann et al., 1991; Kawaichi et al., 1991; Matsuoka et al., 1991; Abeliovich et al., 1992; Engler et al., 1992, 1993; Lauster et al., 1993; Lauzurica and Krangel, 1994; Tuaillon e t aZ., 1993). V(D)J joining substrates currently in use may be divided into two main categories: stably integrated and extrachromosomal. Each is well suited to particular applications. Stable introduction of recombination sequences is achieved either b y retroviral infection or DNA transfection. Retroviral vectors are useful where single-copy, nonpermuted integrants are desired (Lewis et al., 1984). A disadvantage of DNA transfection, as compared to virusmediated integration, is that substrate sequences can become partially duplicated or otherwise scrambled in the course of becoming incorporated into the recipient genome (e.g., as was the case in one early experiment, Blackwell and Alt, 1984). Nevertheless, retroviral substrates most often contain functional LTR enhancer/promoter elements, and because this route is limited to infectable cell types, direct DNA transfection is sometimes necessary (Ferrier et al., 1989, 1990b; Engler et al., 1991a,b). A major application for direct introduction is in the generation of transgenic mice, where DNA is either injected into embryos or transfected into ES cells. A prototype construct is shown in Fig. 4a (Lewis et al., 1984). As configured, a site-specific inversion is required in order to activate a drug-resistance marker. The selectable gene becomes flipped by the reciprocal joining of VKand JK gene segments located on either side, and once inversion occurs, the viral LTR promoter drives expression. Recombinant (drug-resistant) cell lines are isolated in selective media, and the new substrate structures can be characterized by a variety of
51
V(D)J JOINING
A. P-
I
(V-to-J inversion)
P-
n
___, (deletion) py early region I
py early region
FIG.4. Introduced substrates for V(D)J joining. For discussion and references, see text. Examples of substrates used in two basic approaches are shown. (A) Retrovirally integrated substrate for testing recombination in a chromosomal context (Lewis et a/., 1984). (B) Episomal shuttle plasinid for use in extrachromosomal assays (Hesse et d., 1987).
methods that may include PCR and DNA sequence analysis. Constructs similar to that shown in Fig. 4a have been developed in a nuniber of laboratories, and for most applications it has been necessary to include a second drug-resistance gene that is expressed independent of recombination (Akira et al., 1987; Landau et ul., 1987; Desiderio and Wolff, 1988; Malynn et al., 1988; Schatz et al., 1989; Hendrickson et ul., 1990; Matsuoka et ul., 1991). Integrated substrates that allow selection based on deletion rather than inversion of D N A sequences have also been developed (Blackwell and Alt, 1984; Engler and Storb, 1987). Stable integration of recombination substrates not only permits isolation of recombinant junctions, but also the retrieval of any cell in a population in which a rare recombination event has occurred. The importance of the latter capability has been amply demonstrated by
52
SUSANNA M. LEWIS
the identification and isolation of the recombination-activating genes, Rag-1 and -2 (Schatz and Baltimore, 1988; Schatz et al., 1989; Oettinger et al., 1990). The second class of recombination substrate (Fig. 4b) does not be1987; come integrated into the recipient cell’s genome (Hesse et d., Lieber et ul., 1987). These shuttle plasmids are transfected into a rearranging cell line and reisolated 2 days later. The substrates contain an SV40 or polyoma early region and thus are maintained extrachromosomally in the interim (Hesse et ul., 1987; Lieber et d . ,1987; Abe et al., 1991; Ramsden and Wu, 1991; Kallenbach et al., 1992; Hsieh et al., 1993; Petrini et al., 1994). [Plasmid replication increases the sensitivity ofthe assay, but is not essential to observe V(D)J recombination (Hsieh et al., 1991).] The recovered DNA is then introduced into Escherichia coli, where it is maintained by virtue of a procaryotic origin of replication. Molecules that underwent V( D)J joining have activated a procaryotic selectable marker and can be isolated and quantified on that basis. Products of recombination can also be analyzed without passing them through E . coli, by Southern blot andlor PCR amplification of DNA prepared from transfected cells ( J . Menetski and M. Gellert, personal communication). Nonintegrated substrates are heavily used in mechanistic studies. Whereas, in principle, an approach with stably introduced substrates might be adapted to allow for quantification of V(D)J recombination frequencies, in practice, such assessments are most reliably accomplished with the extrachromosomal assay (e.g., Lieber et a l . , 1987; Hesse et ul., 1989). The reasons for this are speed, the large sample size yielded by a single experiment, and the ready-to-sequence form in which recombinants are retrieved. These features make the extrachromosomal assay a good choice for making cross-comparison of recombination activity between different cell lines (Lieber et al., 1988b; Hsieh et al., 1993; Pergola et al., 1993; Petrini et al., 1994; Taccioli et al., 1993). Several different reporter genes have been used in V(D)J joining substrates. For eucaryotic selection, these are the guanine-xanthine phosphoribosyl transferase, neomycin phosphotransferase, thymidine kinase, P-galactosidase, and the interleukin-2 (IL2) receptor genes (Akira et al., 1984; Blackwell and Alt, 1984; Lewis et al., 1984; Engler and Storb, 1987; Desiderio and Wolff, 1988; Hendrickson et al., 1991a; Kawaichi et al., 1991). For procaryotic selection schemes, the chloramphenicol acetyl transferase and the p-galactosidase genes have been used (Hesse et al., 1987; Abe et al., 1991; Kallenbach et al., 1992). Particular substrates have been problematic in the past. For example, a transgenic substrate with an inversionally activated p-
\j(ll)l JOINING
53
galactosidase reporter gene gave misleading results (reviewed in Abeliovich et uZ., 1992; Schatz and Chun, 1992),and chloramphenicol acetyl transferase constructs have also been shown to give a background of false positives (Hesse et d.,1989; Abe et d., 1991; Pandey et nf., 1991). As far a s it is known at present, however, there are no technical restrictions on the use of any of the :ivailable substrates, provided that, instructed b y these prior episodes, appropriate caution in the association of a recombinant structure with a positive signal is employed. The sensitivity or utility of any of the above assay systems may be augmented by the use of PCR amplification to either isolate or quantify recombinant junctions (e.g., Abe et uf., 1991; Hendrickson et uf., 19Yla). Although the present systems are quite versatile, there is still sonie room for improvement. The currently available extrachroniosoma1 substrates are used in terminal cultures; down the road it may be advantageous to be able to easily analyze and isolate recombinants without sacrificing the cell line in which rearrangement took place. A substrate that can be both stably and extrachroinosomally maintained might combine the best of both worlds. V. Fine-Structure of Recombinants: Clues to the Mechanism
A. LOCATION OF
THE
CROSSOVER SrrE
I n V(D)J recombination, the crossover site can often be read directly from the D N A sequence. The sequence of one precursor simply ends, and the other begins. In comparing the fine-structure of V(D)J coding joints and signal joints, one feature that is immediately obvious is their asymmetry. Although reciprocally formed, signal joints and coding joints are only rarely exact reciprocals (Lewis et ul., 1985). Moreover, one junction is stereotyped, the other variable. Signal joints contain signal elements that are joined exactly at their borders; suggestive of the probable site of cleavage. The variability of coding joints is consistently related to this hypothetical cleavage site by truncation and/or base addition. Some reports have suggested that the cleavage site might deviate from the position just at the signal edge, where “residual” nucleotides derived from t h e coding region appear a s inserts within signal joints, or vice versa (Malissen et al., 1986; Deev et al., 1987; Okazaki et ul., 1987). However, such junctions are rare, have never been isolated as a coding jointlsigna1 joint reciprocal pair of products, and could easily be explained on the basis of N addition (see below). The only established exception is the special case where, reproducibly, two “coding” bases appear as inserts within signal joints at the TCRG locus (Carroll et nl., 19931)). Here, the se-
54
SUSANNA M . LEWIS
quence flanking DG1 actually contains two overlapping imperfect joining signals, displaced by two bases, each of which has an equal number of identities to the canonical sequence. Thus an apparent variation in the crossover site most probably reflects an invariant recognition of two alternative joining targets (Carroll et al., 1993b). It is not established whether coding and signal ends are fully separated (on both strands) by a double-strand cut prior to strand exchange (for example, models based on single-strand transfers have been suggested in the past: Lewis et al., 1985; Kallenbach and Rougeon, 1992). Evidence, however, favors the possibility that a double-strand break is introduced at or very near the signal border in V(D)J recombination. Southern blot analysis of DNA prepared from newborn thymus revealed the presence of site-specifically broken molecules near the D and J segments of the TCRG locus (Roth et al., 1992a,b). Detailed analysis of the cleaved species showed that the majority of the broken DNA molecules terminated at the signal border were blunt and were 5’ phosphorylated (Roth et al., 1992b, 1993; Schlissel et al., 1993). Although it is possible that the broken molecules detected in thymus DNA arise from a side reaction, or represent aberrant (and thus nonjoinable) products, there is no evidence to date to contradict the simpler interpretation that these structures correspond to intermediates in V(D)J recombination (Gellert, 1992b).
B. JUNCTIONAL INSERTS Two different types of junctional insertion have been described within V(D)J recombination products, these are N regions (or NGEs, for nongermline element) and P (for palindromic) nucleotides (Sakano el al., 1981; Lafaille et al., 1989).A third type of insertion, arising from “oligonucleotide capture” (Roth et al., 1991),has also been proposed to exist (Lieber, 1992). 1 . N Regions and Terminal Deoxynucleotidyl Transferuse Extra bases are incorporated into some recombinant junctions (Sakano et d.,1981; Kurosawa and Tonegawa, 1982). These N regions are typified by an enriched GIC content (Alt and Baltimore, 1982; Roth et ul., 19891, they are rarely longer than roughly 15 nucleotides (Koth et al., 1989),and they are found much more often within coding joints than within signal joints (Lieber et ul., 1988a). The proposition that N regions are introduced by the enzyme terminal deoxynucleotidyl transferase (TdT; Alt and Baltimore, 1982) has been validated. Disruption of the TdT gene resulted in the near-absence of junctional insertion in transgenic animals (Gilfillan et al., 1993; Komori et ul., 1993). (TdT is discussed further in a separate section: see V1,A.)
V(D)J JOINING
55
Because it has been established that virtually all N insertions are due to the activity of TdT, the presence or absence of N regions within recombinant junctions can be interpreted in light of the known in uitro properties of this enzyme (reviewed in Chang and Bollom, 1986). For example, although N inserts can arise in both coding joints and signal joints, in the latter case relatively higher in uiuo levels of TdT activity are required (Lieber et al., 1988a). This observation is fully consistent with the idea that blunt-ended signal termini are generated as cleavage products (discussed above): such molecules would be expected to be relatively refractory to TdT modification (Chang and Bollom, 1986). A second inference is based on the fact that, within signal joints, N nucleotides appear between signals that have been “precisely” interrupted at their borders. This observation indicates that 3’ hydroxyls existed at each signal terminus prior to N modification, consistent with analyses of signal ends generated in uiuo (Roth et al., 1992a, 1993). Disruption of the TdT gene drastically lowered the occurrence of junctional insertion without eliminating them entirely, thus the question remains whether terminal transferase is responsible for every N region. The residual insertion (distinct from P inserts, see below) seen in the gene disruption studies could conceivably be due to low-level TdT activity in the mutant mice (in neither case was the gene deleted in its entirety; Gilfillan et al., 1993; Komori et al., 1993). It seems more likely, however, that some nontemplated insertion occurs in a very minor fraction of coding joints, independent of TdT action. For example, fibroblastoid cells that rearrange V(D)J joining substrates following co-introduction of RAG-1 and RAG-2 do not presumably express TdT (Landau et al., 1987), but still exhibit occasional junctional insertion (Schatz et al., 1992; Taccioli et al., 1993).Regardless, it is evident that TdT is the most physiologically relevant source of insertion in the V(D)Jjoining system (Gilfillan et al., 1993; Komori et al., 1993). A significant feature of N regions is that their occurrence is developmentally regulated. This is a surprisingly general observation; noted in species as diverse as mouse, man, chicken, and frog (Elliott et nl., 1988; Carlsson and Holmberg, 1990; Feeney, 1990, 1991a; Gu et al., 1990; Meek, 1990; Bangs et al., 1991; Bogue et al., 1991; McCormack et al., 1991a; McVay et al., 1991; Schwager et al., 1991; Bonati et al., 1992; Engler et al., 1992; George and Schroeder, 1992; Holman et al., 1992; Mortari et al., 1992; Raaphorst et al., 1992; Roth et al., 1992; Thompson et al., 1992). In fetal or neonatal animals, N regions are low or absent, apparently as a consequence of the developmental regulation of TdT. In close agreement with early studies of the onset
56
SUSANNA M . LEWIS
of TdT protein biosynthesis in the murine thymus during ontogeny (Rothenberg and Triglia, 1983), expression of TdT RNA does not appear until 3 to 5 days after birth (Bogue et al., 1992). TdT expression precedes the appearance of N regions in TCR junctions by a few days (Bogue et al., 1992; see also Bonati et al., 1992, for a similar analysis in humans). It has been suggested that the significance of the delayed onset of TdT expression is that it creates an early repertoire with special properties, possibly allowing for the generation of more polyspecificreceptors in general (Bogueet al., 1991,1993).A second possibility is that absence of TdT allows for the early dominance of certain particular receptors with necessary specificities (Gu et al., 1990; Feeney, 199lb, 1992a; see Section D, Homology, below).
2 . P Nucleotides A second type of junctional insert niay have a less general impact on the physiology of the immune system, but has nonetheless provided an important clue about the joining mechanism. P nucleotides are found in junctions where a coding end has been joined without truncation and constitute a very short inverted repeat of the untrimmed end; hence “P”, for palindrome (Lafaille et al., 1989). A P insert where, for example, a full-length end terminated with the residues “AC”, would be “GT”. Although apparent P insertions were present in many collections of endogenously generated V(D)J junctions, as initially described their infrequent occurrence raised doubts as to their existance. An alternative possibility was that TdT or some other mechanism that introduces random insertions, perhaps coupled with physiological selection, might have generated the apparent pattern. However, several observations have validated the existence of P insertions. One is that P insertions appear in V(D)J junctions formed in cells where it is virtually certain that they were not contributed by terminal deoxynucleotidyl transferase, the major source of random base addition (Komori c,t al., 1989; Kallenbach et al., 1992; Gilfillan et al., 1993). Second, P nucleotides were shown to arise at statistically significant frequencies, regardless of coding end sequence, by the plasmid assay. Here they were distinguished from random base addition and measured in a system that had been removed from physiological selective forces (Meier and Lewis, 1993). The nonrandom nature of P inserts invited speculation about the joining mechanism, even before the inverse-complementary relationship between the patterned inserts and the adjacent coding end had become completely clear (Traunecker et al., 1986; Wysocki et al., 1986; McCormack et al., 1989). A number of experiments now point
V(D)J JOINING
57
toward the possibility that P insertions are present in V(D)J junctions because a hairpin molecule is generated as a cleaved intermediate in joining (Fig. 5 ; Lieber, 1991; and reviewed in Gellert, 1992b; Ferguson and Thompson, 1993). One of the experiments to bring the focus sharply on the hairpin possibility was the provision of direct physical evidence for sitespecifically cleaved coding ends bearing covalently closed termini in thymus DNA (Roth et al., 1992a). Significantly, the cleavage products corresponding to signal ends lacked hairpin termini. This observation was completely in line with the fine-structural data: P insertions had not been found next to signal termini in V(D)J junctions (Lafaille et al., 1989; Lieber, 1991; Meier and Lewis, 1993). A second experiment directly established the link between hairpin-ended DNA molecules and P insertion with the demonstration that introduced synthetic hairpin termini could become joined in A-MuLV cell lines and upon joining did in fact give rise to junctions with P insertions in a large majority of products (Lewis, 1993). A detailed model for the origin of hairpin coding ends and subsequent processing has been provided (Lieber, 1991). For the present, it should be pointed out that this difference between the physical structure ofcoding termini and signal termini could be the key determinant of asymmetry in V(D)Jjoining, (mentioned in section V,A). While signal ends are in ready-to-join form, it may be that the coding ends cannot be connected without additional processing.
C. TRUNCATION The subtraction of a small, variable number of basepairs from the coding ends before joining is a significant source of junctional diversity. In some circumstances where N insertion, somatic mutation, and “combinatorial diversity” are either absent or limited (e.g., in T cells early in ontogeny; Elliott et al., 1988),the major mechanism for antigen receptor diversification is variable truncation (Davis and Bjorkman, 1988).One can inspect virtually any collection of V(D)Jjunctions from any species, tissue or cell type (engineered fibroblasts included), and in many cases the codingends will have lost some residues. Either base loss is intrinsic to the joining mechanism or, if it is due to associated functions, these other functions must be ubiquitous. An early suggestion, which has become fixed in the literature to some extent, is that an exonuclease trims the coding ends after they have been disconnected from their signals and that this processing step precedes joining (Alt and Baltimore, 1982). However, there is no a priori basis for the presumption that “trimming” occurs before liga-
58
SUSANNA M . LEWIS
CATG
t
P
l1
l1
FIG.5. Proposed hairpin origin ofP nucleotide insertions (Lieber, 1991).Both strands of the DNA molecules are indicated. At the top is shown the suggested structure of coding ends immediately following cleavage. Nicking of the hairpin near, but not at, the tip will generate strand extensions. These extensions might suffer a variety of fates prior to ligation. Fill-in polymerization (left) would generate a “P” nucleotide insertion.
tion or even that it is the result of an exonucleolytic rather than endonucleolytic activity (various possibilities are indicated in Fig. 6). The truncation feature of V(D)J joining is reminiscent of base loss that occurs in end-joining reactions, and it is conceivable that there may be a fundamental relationship (Roth and Wilson, 1986). Base loss in end-joining reactions has been attributed to diverse mechanisms which involve an interaction between the two termini: it is not inconceivable that some of these may be relevant to V(D)J joining as well (Roth et al., 1985; Roth and Wilson, 1986; Pfeiffer and Vielmetter, 1988; Ganesh et al., 1993). At present the possibilities have not been significantly restricted experimentally; the sealing of the coding ends in V(D)J joining might involve any one (or more) of the following: (1) a limited exonucleolytic removal of residues starting from the
59
V(D)J JOINING
A
B
C
D
I I I 7
6 exonuclease
7- 7 ‘
4
endonuclease
ligation
4
* * ligation
!,
ligation
trimming
~
4
5
ligation
ligation
FIG.6. Possible modes of base loss during V(D)J joining. (A) A single-strand-specific exonuclease acts prior to ligation; (B) a tlouhle-strand-specific endonuclease acts prior to ligation; (C) a “Hap-ase” exo- or endo-nucleolytically removes tails before ligation; (D) a “Hap-ase” acts after ligation.
terminus, (2) an endonucleolytic break introduced near the terminus, ( 3 )loss following a postulated alignment step that puts the coding ends in register before joining, or (4)base loss occurring as a consequence of endonucleolytic or exonucleolytic removal of “tails,” and/ or mismatch correction following ligation of two offour strands (Figs. 6A-6D). The extent of base loss on V(D)J joining at various loci, at various stages of ontogeny, and within various species has been assessed in the course of a number of studies of naturally occurring junctions. Though complicated by differences in experimental detail, broad comparisons between studies fairly consistently fail to reveal any suggestive correlations (such as were so useful in understanding N addition). Some studies found that base loss was more evident in postnatal or adult samples than in those isolated from fetal lymphoid tissue (La1989; Bangs et d., 1991; McVay et al., 1991; Schwager et faille et d , nl., 1991; Carlsson et al., 1992; Medina and Teale, 1993). However, others have not (Meek et al., 1989; Feeney, l99la; Ikuta and Weissman, 1991; Engler et al., 1992; Raaphorst et nl., 1992). As an example, DJ junctions derived from the IgH locus were isolated from spleens of mice ofvarious ages (Meek, 1990).Populations of DspZto J 1junctions
60
SUSANNA M . LEWIS
were amplified by PCR and tested for the presence of a naturally occurring Rsa 1 restriction site located at a position seven residues inward from the 5‘ end of the J 1 gene segment. The ratio of uncut to cut junctions was quantified and did not vary between fetal and adult samples (Meek, 1990). In contrast a seemingly significant difference in truncation is associated with the primary sequence of a coding end. In a study with plasmid substrates, an almost 10-fold end-specific difference in trimming was found (Meier and Lewis, 1993).There was no parallel variation in overall recombination frequency or in the acquisition of N regions or P nucleotides, nor was there any obvious relationship between truncation and the opportunity for homologous interactions with the “partner” coding end (Meier and Lewis, 1993; and J. T. Meier and S. M. Lewis, unpublished). In a second study, reduced deletion for certain homopolymer coding ends was also observed (Boubnov et al., 1993). Such evidence suggests that some truncation is not based on end-to-end interactions, providing indirect support, at least for the original suggestion that trimming can precede ligation (Figs. 6A and 6B, Alt and Baltimore, 1982). Thus we might look for several different types of endo- or exonuclease to play a role in V(D)J joining. If a nuclease acts prior to strand joining, we might expect it to have some sequence preference (based on the observations described above). If a single entity only is the predominant cause of base loss in V(D)J junctions, then we should anticipate two additional features: (1)it will only cause a limited base removal and (2) its levels should be fairly constant through development. One might alternatively seek a “flap-ase” such as could trim the dangling ends after ligation as shown in Figs. 6C and 6D. Candidate activities are discussed below (section VI).
D. HOMOLOGY An number of studies indicated that within “real” coding joints, the two coding ends may be preferentially connected at positions of homology (Ichihara et al., 1989; Feeney, 1990, 1991b, 199213; Gu et al., 1990, 1991; Manser, 1990; Meek, 1990; Chang et al., 1992). For example, the origin of repeat, “canonical” junctions in some subpopulations of$ T cells, was suggested to reflect a mechanistic predilection for joining within homologies (reviewed in Raulet, 1989),although it is also the case that apparently homology-driven junctional biases are due to cellular selection in other systems (Pandey et al., 1993). The notion that the presence of short one-, two-, or three-base homologies might be of consequence in V(D)J joining (Alt and Baltimore,
V(D)J JOINING
61
1982) has only recently been explored experimentally (Boubnov et
al., 1993; Gerstein and Lieber, 1993b). Plasmid substrates were tested
in a nonselective context, and it could be demonstrated that the presence of homology influenced the recombination process without absolutely constraining the outcome or affecting the overall efficiency (Boubnov et al., 1993; Gerstein and Lieber, l993b). It was also found that the presence of TdT in the cell reduced the representation of homology junctions among isolated recombinants (Gerstein and Lieber, 1993b). Both of these observations indicated that the presence of an homologous (even one-base) region at the two tips of the joined coding ends was not required, a conclusion born out with the TdT knockout experiments (see discussion in Komori et al., 1993). The significance of homology-guided rearrangement in shaping the in .r;ioct repertoire was demonstrated with transgenic substrates which contained TCRy-derived V and J gene segments. These gene segments were identical to their endogenous counterparts except that they contained mutations that prevented expression at the protein level. By far, the major classes ofjunctions in these experiments were those with short homologous overlaps between the joined ends. These junctions corresponded to the canonical sequence observed among epithelialassociated y6 T cells in uioo, but because the joined products were not functional, it was clear that the biased representation was not due to a positive selection for particular receptor specificities (Asarnow et ul., 1993). The same conclusion was reached on the basis of experiments in which the C6 exon was disrupted by gene targeting (Itohara et al., 1993). Directed recombination, to give canonical junctions, appears to be observed at a much greater frequency in the fetal and neonatal repertoires (Lafaille et al., 1989) where two features of the joining mechanism contribute to the effect. One is the homology-guided nature of V(D)J joining (in combination with the sequences that exist at the termini of the joined elements), and the other is the developmentally regulated expression of TdT (reviewed in Feeney 1992a). Somehow TdT expression reduces the homology bias, although the mechanism of this interference is obscure (Feeney, 1992b; Gerstein and Lieber, 1993b; Gilfillan et al., 1993). Curiously, the homology bias is eliminated even among the “N-less” junctions that have been generated in a TdT-positive context (Feeney, 1992b; Gerstein and Lieber, l993b; Gilfillan et al., 1993). This raises the possibility that TdT can block the homology-based interactions of ends, even in the absence of end modification (Gilfillan et al., 1993).Alternatively, the effect is competitive such that the same subfraction of coding termini is a substrate for
62
SUSANNA M. LEWIS
either alignment or TdT modification (Feeney, 1992b; Gilfillan et al., 1993).Although the TdT effect on the frequency of homology junctions might appear to be a minor detail, the inverse relationship between the appearance of canonical junctions (and a generally restricted repertoire for antigen binding) and TdT in development suggests important physiological consequences. Moreover, this sort of detail is very relevant to the still poorly understood steps in V(D)J recombination that occur between cutting and joining. As with truncation, the homology effects in V(D)J joining have been seen before in the recircularization of linear DNA molecules transfected into CV1 cells (Roth and Wilson, 1986).A number of years ago, it was suggested that the joining of cut ends in mammalian somatic cells was facilitated by limited sequence homologies (Wilson et at., 1982). The notion was addressed experimentally in subsequent studies, which suggested that both homology-dependent and homologyindependent processes are materially involved in end joining (Roth et al., 1985; Roth and Wilson, 1986). Alignment factors that appose broken DNA ends and can stabilize feeble 1-bp interactions have been postulated according to the results of in uitro end-joining studies with Xenopus egg extracts (Pfeiffer and Vielmetter, 1988; Thode et al., 1990; Pfeiffer et al., 1994).A role for such factors in V(D)Jjoining has been proposed (Gu et al., 1990). E. OTHER STRUCTURAL FEATURES (OLIGONUCLEOTIDE CAPTURE) Other patterns have been noted in coding junctions. Because these other patterns are either rare or much less specific than the features covered in the above discussion, most will probably prove difficult to establish experimentally. One possibility is that a palindromic pattern of residues might occur adjacent to truncated, as well as nontruncated, ends (Aguilar and Belmont, 1991; Engler et al., 1992).A second suggestion was prompted by an odd frog junction that contained 16 bases of sequence constituting an inverted repeat of the sequence starting 1 base in from the tip of the adjacent JH segment. This example raised the possibility of limited replication during V(D)J joining (Schwager et al., 1991). The above-mentioned inserts, while long enough to look quite different from P or N insertions, are rare, and it is difficult to guess whether they represent exceptional events or instead expose some feature that is typical of a V(D)J joining reaction. A third suggestion was based on the observation that inserts within certain junctions contain DNA segments related by sequence to the two joined ends, but not in the fashion of a P nucleotide insertion. This suggested that an oligonucleotide capture mechanism as described for
V(D)J JOINING
63
end joining (Roth et al., 1991) might be relevant to V(D)J recombination (Lieber, 1992). Experimental tests of oligonucleotide capture, in the case of end joining, indicated that it was infrequent and could only be observed at high injection ratios of oligonucleotide-to-vector DNA end. Capture required that the termini of the captured doublestranded oligonucleotide bear fully compleinentary “cohesive” ends relative to the target DNA. This led the authors to question the relevance of (short) oligonucleotide capture to the generation of “filler” DNA in nonlymphoid systems (Roth et al., 1991). No comparable test of oligonucleotide capture during V(D)J joining has yet been carried out. Although according to one survey of endogenous V(D)J junctions it was suggested that perhaps 2% contain insertions ofgreater than four residues that might have arisen by oligonucleotide capture (Carroll et al., 1993b), it is telling that among over 550 junctions generated in genetically TdT-negative cells, not a single such four-residue possibility was reported (Komori et al., 1993; Gilfillan et al., 1993).
F. GERMLINE JOINING: V(D)J RECOMBINATION LONGAGO AND FARAWAY The Ig and TCR loci, as they exist in the germlines of all vertebrates, bear the imprint of the V(D)J recombination machinery (Kokubu et al., 1988; Lewis et al., 1988). Extensive germline joining most obviously has occurred in the Ig genes of cartilaginous fish (reviewed in Litman et al., 1992). In these species, some copies of the iterated Ig gene clusters (see section III,A, above) are either partially or fully assembled (Kokubu et al., 1988; Hohman et al., 1992; Litman et al., 1993).Complete VDDJ assemblies as well as VDD ...J or VD..DJ structures are found among IgH clusters, and there is also an example of a germline hybrid joint (Kokubu et al., 1988). Extensive germline joining of light chain gene clusters is also observed (Rast et al., 1994). Joined genes may encode functional proteins; it does not appear, however, that joining in the germline is ongoing (Litman et al., 1993; G. Litman personal communication). The sequence conservation between joined and unjoined gene segments is high enough to provide a reasonably good impression of precursor/product relationships. For example, based on existing homologies between the joined genes in Heterodontus francisci (horned shark) and those in an animal of a different elasmobranch order, Raja erinacea (little skate), the V(D)J joining perserved in the genomes of these species probably took place over 200 million years ago (Harding et al., 1990). Judging from the structures of such recombinants, very little of the essential nature of the recombination machinery has
64
SUSANNA M . LEWIS
changed in the ensuing eons. A comparison of the V and D elements in germline-joined genes to either unjoined elements or to a hypothetical consensus is consistent with base loss and addition. In one germlinejoined gene (designated “F101”) the putative inserts at the VD junction (in which these two elements apparently joined without base loss) were consistent with P nucleotide addition; in others cases, base loss and possible N insertion may be seen (Kokubu et al., 1988). To summarize, the fine-structural features of V(D)J recombination products appear to be constant across phyla and through much of the evolutionary history of vertebrates. Despite the variability of V(D)J joining products, this variability follows a pattern: only a few residues are usually lost, only a few are gained, and homology is sometimes used. Some activities that may be responsible for these features are discussed in the following section. VI. Agents of Joining
A few cracks of light are beginning to penetrate what has been described by more than one author as a “black box.” The search for a single “recombinase” has been deflected by an increased appreciation that V(D)J joining may well be carried out b y a collection of loosely related activities. Factors such as RAG-1 and RAG-2, if indeed they serve a catalytic function, may be essential and reaction-specific. Others such as TdT are not essential, but still apparently reaction-specific, and there is the likely possibility that still other components of the recombination machinery are essential for V(D)Jjoining, while at the same time being more generally involved in DNA repair in the cell. A. V(D)JJOINING FACTORS DEFINED BY MOLECULAR GENETICS
1. RAG-I and RAG-2 With a molecular genetic approach, two essential, lymphoid cellspecific, genes called RAG-1 and RAG-2 (for “recombinationactivating gene”) have been identified (Schatz and Baltimore, 1988; Schatz et al., 1989; Oettinger et ul., 1990). A fibroblastoid cell with an integrated recombination substrate was selected for its ability to rearrange (thereby activating a drug-resistance gene) upon transfection of genomic DNA. With recombination as the assay, two linked genes were isolated, which together could potentiate authentic V( D)J joining when introduced by transfection into other nonlymphoid cells (Schatz et ul., 1989; Oettinger et al., 1992). Consistent with a function as a developmentally regulated recombination factor, RAG-1 and -2 are
V(D)J J O I N I N G
65
coexpressed only within tissues and cell lines undergoing active V(D)J recombination (Schatz et al., 1989; Oettinger et al., 1990; Boehm et al., 1991; Turka et al., 1991; Guy-Grand et al., 1992).Although discordant expression of RAG-1 and RAG-2 is observed in some contexts [and for example may occur in a transitional cell type during differentiation (Campbell and Hashimoto, 1993)], there are no examples to date of a recombination-proficient cell that completely lacks expression of one or the other (Oettinger et al., 1990, 1992). Circumstantial evidence all points toward the likelihood that the onset and shut-down of V(D)J rearrangement during lymphoid cell differentiation is accomplished primarily through regulation of the RAGs. RAG mRNA levels drop upon crosslinking antigen receptors in immature T and B cells (Turka et al., 1991; Maet al., 1992).Although the nature of the crosslinking is not fully understood, in the case of T cells, RAG shut-down appears to coincide with positive selection (Brandle et al., 1991; Borgulya et al., 1992; Campbell and Hashimoto, 1993). Recombination appears to cease at a point where cells have begun to be chosen on the basis of their specific interaction with the thymic environment and thus when further alterations in their receptor genes would be detrimental. It has not yet been proven whether the RAGs are part ofthe recombination machinery itself or regulatory in function, although the oddson favorite is the first of these possibilities. Both RAG genes have been knocked out in mice and, in either case, the mutation had specific effects on V(D)J joining only (Mombaerts et ul., 1992b; Shinkai et al., 1992). No defects in any nonlyniphoid tissue were uncovered, and the expression of early lymphoid lineage-specific genes appeared norinal. In tissue culture cells the RAGs’ expression can be manipulated while recombination activity is measured in parallel, and such experiments have revealed a close correspondence (Menetski and Gellert, 1990; Oettinger et al., 1990; Oltz et ul., 1993). Introduction of RAG-1 and RAG-2 fails to cause a recipient fibroblastoid cell to rearrange its endogenous genes or to acquire other markers of early lymphoid differentiation (Schatz et ul., 1989). All told, these observations indicate that either KAG-1 and RAG-2 very specifically and directly regulate the “V( D)J recombinase” or they themselves participate in the recombination reaction. Despite the f k t that the two genes were isolated almost 4 years ago, no sequence-specific DNA binding or cleavage activity has been established for the product of either one. Nor do RAG-1 and RAG-2 proteins appear to associate with one another (Oettinger et al., 1992).
66
SUSANNA M . LEWIS
Neither RAG-1 nor RAG-2 has any significant homologies to other known proteins (Schatz et at., 1989;Oettinger et al., 1990). However, in RAG-1, three sequence motifs have been noted: a nuclear localization signal, a zinc finger-like “Cys-His” motif, and a region with a resemblance to the active sites oftopoisomerases (Schatz et al., 1989; Wang et al., 1990; Freemont et al., 1991). Mutational analyses have investigated how critical each region might be to RAG-1 function. A double-mutant in the nuclear localization signal was indistinguishable from wild type in potentiating recombination of a plasmid substrate in fibroblastoid cells (Silver et aZ., 1993). The Cys-His motif could be altered by point mutation or even deleted entirely, without abolishing recombination. A tyrosine residue at position 998 (of the 1041-residue protein) that had been suggested to relate to the active site tyrosine of type I and I1 topoisomerases (Wang et aZ., 1990) was changed to phenylalanine with little or no effect (Kallenbach et at., 1993; Silver et al., 1993). Recombination was undetected (two orders of magnitude below wild type) with a deletion of4 amino acids from positions 995 to 998 (Kallenbach et al., 1993) as with a deletion from residues 994 to the end (Silver et ul., 1993). Other deletions that took out, for example, the 32 amino acids from residue 1009 to the carboxy terminus, created proteins that exhibited enhanced recombination relative to wild type. Thus these analyses suggest that essential regions for activity reside near the carboxy portion of the RAG-1 protein and are not coincident with the Cys-His motif (which had suggested a transcription factor regulatory-type role; Silver et at., 1993). Despite the radical effects of surgery at residues 995 to 998, it is not clear whether a conformational change is responsible or a functional group on one of the deleted amino acids performs some active catalytic role (Kallenbach et at., 1993). Unfortunately, the cellular localization and protein levels of the carboxy terminal mutants have yet to be defined, due to a lack of useful antibody reagents for these analyses (Silver et a,?., 1993). Clues to RAG-2 function have been equally hard to come by. An acidic region was about the only notable feature of its amino acid sequence (Oettinger et al., 1990), and it was found that most of this could be deleted without effect (Silver et al., 1993). Other regions with weak similarities to a CAMP protein kinase site, a tRNA ligase, and a methylase were noted and mutated, but none had significant effects in the recombination assay (Silver et al., 1993). Two major in vivo phosphorylation sites have been defined, and mutation of one of these sites Ser356affected the activation of V(D)J recombination by RAG-2, without affecting its nuclear localization or steady-state levels
V(D)J JOINING
67
(Lin and Desiderio, 1993). Analysis of the second major site is still in progress. Additionally, the protein kinase ~ 3 4 ' ~ could ' ~ phosphorylate bacterially expressed RAG-2 in oitro. Substitution mutation of the most prominent site, Thr"'), prolonged the half-life of RAG-2 in uiuo, as well as that of chimeric proteins created by fusion of the relevant portion ofRAG-2 to several other genes. It was suggested thatphosphorylation of RAG-2 at the site targeted by ~ 3 4 marked ' ~ ~ the ~ protein for rapid degradation and that this might be essential in coordinating the activity of RAG-2 with other potentially cell-cycle-regulated components of the joining machinery (see Lin and Desiderio, 1993, for a more complete discussion, and Schlissel et al., 1993). As suggested by the analysis ofthe detected in uioo phosphorylations of the RAG-2 protein (Lin and Desiderio, 1993), some necessary posttranslational modification(s)may be lacking in the heterologous expression systems used to generate RAG proteins in most studies. It may be that a shift to an homologous expression system will reveal previously undetected RAG protein interactions, with one another and/or a DNA substrate. While such evidence has been slow in coming, there is still reason to anticipate a future demonstration of an enzymatic function for one or both RAG products. A function for RAG-2, independent of RAG-1, in gene conversion was suggested by its expression pattern in the chicken bursa during ontogeny (Carlson et ul., 1991). RAG-2 is expressed at far higher levels than RAG-1 at a time in B cell development when precursors are essentially finished with Ig gene recombination and have entered into a stage of active gene conversion (Carlson et al., 1991; Reynaud et al., 1992). However, upon deletion of both homologous copies of RAG-2 from a bursal-derived, transformed, B cell line, it was found that the mutated cell was still capable ofgene conversion (Carlson et at., 1991; Takeda et al., 1992). The experiment has since been repeated for a second cell line, with the additional finding that the frequency of homologous recombination is also not affected by the presence or absence of RAG-2 (E. Masteller and C. B. Thompson, personal communication). It remains a puzzle why RAG-2 should continue to be expressed so long after gene rearrangement ceases in the bursa. As mentioned above, in most other contexts, RAG-1 and RAG-2 are suddenly and coordinately downregulated. V( D)J recombination is well over by late embryogenesis in the chicken, and little RAG-1 expression is observed thereafter. RAG-2 expression, on the other hand, is maintained up to 14 weeks posthatching (Carlson et al., 1991). One gets a sense that there is something interesting still to emerge from these observations.
68
SUSANNA M . LEWIS
2. TdT The enzymatic role of TdT in creating the junctional insertions has been touched on in the previous section on N regions (Section V,B). Some additional studies pertaining directly to TdT itself are mentioned here. In mice, two forms of TdT have been identified, each templated by an alternatively spliced precursor RNA. Each has been shown to introduce N regions into V(D)Jjunctions (Landau et al., 1987; Kallenbach et al., 1992; Doyen et al., 1993). TdT is found only in primary lymphoid organs, more specifically, in cortical (immature) thymocytes and in bone marrow cells (Bogue et al., 1992, and references therein). During thymocyte differentiation, TdT expression tracks RAG-1 expression closely, both genes being turned on in immature cells and off in mature cells (Bogue et al., 1992). For these reasons, TdT is considered part of the V(D)J joining machinery, despite the fact that the gene knock-out experiments unambiguously established the optional nature of its participation (Gilfillan et al., 1993; Komori et al., 1993). There is no evidence that TdT exists for any other reason than to diversify V(D)J junctions. The fact that N regions are found in V(D)J junctions of vertebrates representing major evolutionary branch points (Litnian et al., 1993) speaks for the importance of this activity. It remains speculation whether TdT was imported into the vertebrate genome as part of the recombination machinery at the outset, but the preservation of the association throughout vertebrate evolution suggests that, in any case, this association has been very successful. An interesting question is whether TdT and other components of the joining apparatus are physically complexed. TdT itself appears to be associated with the nuclear matrix (Pandey et al., 1989; Di Primio et al., 1991), and by focusing on TdT, it may be possible in the future learn more about the ultrastructural relationships between the V(D)J joining machinery and the organizing elements in the nucleus. A developmental modulation of N insertion is observed in many different species (references cited in section V,B, above). The TdT story constitutes the clearest illustration that an important, tissuespecific component of the V(D)J joining machinery is nevertheless routinely separated from it during ontogeny. Genetically engineered mice lacking N regions are not overtly compromised, the main effect noted to date is that the junctional repertoire in an adult TdT-less mouse resembles that of a neonatal animal (absent N regions and overrepresented canonical junctions; Komori et al., 1989; Gilfillan et ul., 1993). The complement to the gene knock-out approach would be
V(D)J JOINING
69
a “stuff-in” experiment, where the importance of the absence of TdT early in ontogeny might be assessed by creating constitutively TdTpositive animals. It may be significant that attempts to conduct such experiments have only met with partial success: although a human TdT gene has been introduced into the murine germline, the levels of protein are extremely low. One possibility is that a more robust expression is lethal (H. W. Schroeder, personal communication).
B. BIOCHEMICALLY DEFINED The target sites for V(D)J joining were defined almost 15 years ago; easily cultivated cells with ongoing V( D)J joining activity have been available for a decade; and two essential genes in the recombination process (RAG-1 and RAG-2) have been cloned. Still, at the time of this writing, there has been no successful in vitro reconstitution of V(D)Jjoining. Even more modest goals, such as the isolation of activities that specifically bind, cut, or ligate V( D)J joining signals, have been difficult to reach. The state of the effort is summarized below.
1 . Factors That Bind Joining Signals Of the three activities a V(D)J joining candidate might possess (the ability to specifically bind, cut, or ligate a joining signal), the greatest effort has been made in attempting to identify factors that might recognize joining signal D N A in a sequence-specific fashion. The development of techniques such as the electrophoretic “mobility shift” assay and the ability to directly screen cDNA expression libraries for clones encoding DNA-binding proteins (Singh et al., 1988) both have contributed to the popularity of the binding quest. A number of candidate factors have been described, and progress in their analysis has been reasonably brisk. In most cases, it is fair to say that the DNA-binding activities have not proved to have features that unambiguously identify them with the V(D)Jjoining operation. In general, expectations were that a good candidate would (1)hind D N A containing a joining signal better than D N A lacking the same, (2)bind less avidly to noncanonical variants that have been shown to be defective targets in V(D)J recombination assays, ( 3 )be present in both early B and T cells, but perhaps not elsewhere, and (4)(hopefully) possess cutting and/or joining activity. About 10 different signal-binding proteins have been described. One of the first to be reported was called “nonamer-binding protein” (NBP; Halligan and Desiderio, 1987; Li et al., 1989). This protein was identified on the basis of its ability to stably complex with DNA fragments containing a 23-spacer signal and was present in lymphoid, but not nonlymphoid, nuclear extracts (Halligan and Desiderio, 1987).
70
SUSANNA M . LEWIS
Further purification and characterization demonstrated that NBP, a 53-kDa protein, was very specific for the canonical nonamer sequence, but did not possess any nucleolytic activity. Another protein identified upon binding a 12-spacer signal DNA was found to interact most specifically with the heptamer, again with an encouraging tissue distribution (Aguilera et al., 1987). No enzymatic activity has been reported subsequently. A third protein was isolated as a cDNA by screening a Xgtll murine pre-B cell library with a 12-spacer signal probe (Shirakata et al., 1991). The clone, T-160 was specific for 12-spacer signals and failed to bind a sequence with a base change in the third position of the heptamer. DNA binding by the 86-kDa T-160 protein could only be detected with Southwestern blot analysis; the in uitro-translated material could not be demonstrated to bind DNA according to electrophoretic mobility shifts or DNA footprint analysis. Its tissue distribution was not reported. The role of the T-160 protein in V(D)J joining is now in question principally because the human homologue was isolated by screening a mature B cell cDNA library with a platinated (non-joining-signal) DNA probe and, moreover, found to be ubiquitously expressed (Bruhn et ul., 1992). A fourth zinc finger protein called “Rc” was also isolated from a Agtll library, constructed from thymocyte RNA, which had been screened with a probe containing both 12- and 23-spacer signals. Rc was found to bind an isolated heptamer only, as well as an unrelated sequence motif. No tissue distribution was reported (Wu et al., 1993). A fifth protein was purified from an A-MuLV extract on the basis of its ability to bind a 23-signal DNA probe (Hamaguchi et al., 1989). This 60-kDa species (named recombination signal binding protein or “RBP-Jk”) was purified 17,000-fold and found to protect the heptamer of the joining signal in DNase 1footprinting studies. Like T-160, RBP-Jk could discriminate between a canonical joining signal and a DNA sequence that contained a mutation in the heptamer (Hamaguchi et al., 1989). The gene for the RBPJk protein was cloned after a partial amino acid sequence was obtained, and RBP-Jk was found to contain a 40-residue region with similarity to the integrase family of site-specific recombinases (Matsunami et al., 1989).However, one of the three putative integrase active-site residues was missing from the region of similarity, as was a subsequently identified motif that has been implicated in enzymatic function (Abremski and Hoess, 1992). The tissue distribution of RBP-Jk was a surprise: it was initially thought to be limited to lymphoid cells but later studies indicated that the protein was uniquitous in mice and that a homologue was present in Drosophila (Furokawa et al., 1992; Hamaguchi et al., 1992). No enzymatic function apart from binding was consistently
V(D)J JOINING
71
observed, although RBP-Jk isolated from A-MuLV extracts copurified with ligation activity (Hamaguchi et al., 1992). A sixth protein or proteins was identified by electrophoretically fractionating early T and B cell extracts and probing with joining signal DNA after transfer to nitrocellulose. A 115 kDa species was identified that was only present in low amounts in mature lymphoid and nonlymphoid cell lines. Probes where there were base changes in either the heptamer or the nonamer regions of the signal showed reduced binding. The factor or factors appeared to be able to bind both 12- and 23-spacer signals (Miyake et al., 1990); however, no further studies beyond this limited characterization were reported. A sequence- and tissue-specific DNA/protein complex has been visualized by electron microscopy, but binding could not be demonstrated with the electrophoretic mobility shift assay (Kottman et al., 1992). The most recent and most promising candidate among the proteins identified on the basis of binding was found in murine thymocytes (Muegge et al., 1993b). Two features distinguish this work. One was that the distribution correlated well with recombination activity: it was present in cell lines that had tested positive for V(D)J joining, and could be visualized in thymus extracts following a postirradiation reconstitution with embryonic precursor cells. Another was that a fairly extensive range of oligonucleotide joining signal variants were tested in the mobility shift assay for binding to “recognition protein” (or RP). Functional joining signal variants were bound but nonfunctional variants, with, for example, a heptamer mutation or a change in spacer length, were not (Muegge et al., 199313). According to its size, 30 kDa, the protein appears to be distinct from previously described binding factors. This small size also tends to argue against its identity as one of the RAG gene products. Thus to date, RP is the only factor to pass all three tests suggested above: it has specificity for joining signals (and this is the only candidate so far that has the property of binding both heptamer and nonanier sequences in 12- and 23-spacer targets); it binds nonfunctional joining signals poorly, but at the same time is insensitive to changes that do not affect V(D)J recombination; and it appears to be confined to cells and tissues that exhibit recombination activity (Muegge et al., 1993b).
2 . Cutting Given the expectation that a distinctive feature of the V(D)J joining machinery ought to be its ability to introduce cuts at the signal border, it was no surprise that, early on, several groups undertook to detect a site-specific nuclease activity in lymphoid cell extracts. None of the
72
SUSANNA M. LEWIS
examples, however, could be shown to be stringently site-specific and little has been reported beyond the initial characterizations (Desiderio and Baltimore, 1984; Kataoka et al., 1984; Hope et al., 1986). There are two reasons why cutting activities might bear some renewed attention. One is that the analysis of broken molecules in thymus DNA has refined predictions for the putative cleaving activity. We might now anticipate a site-specific generation of hairpin coding ends and blunt signal ends; the latter with 5’ phosphoryl groups (Roth et d., 1992a,b, 1993; Schlissel et al., 1993). A second is that, potentially, a cutting function may be both the beginning and the end of the story in terms of any tissue-specific component(s) of the V(D)J joining machinery.
3. Ligation Functions Zfjoining is due to the lymphoid-cell-specific V(D)J joining machinery (rather than to a nonspecific ligase), then predicted properties would perhaps include a relevant tissue distribution and a joining signal dependence. Whether a ligation function ought to be expected to create coding joints and signal joints before a potential involvement in V(D)J joining is considered is debatable. Some would argue that any joining signal-dependent ligation function is worth a second look. An interesting activity was associated with a clone that was initially isolated on the basis of its nonamer-binding properties. The clone, called “V(D)J joining protein” or VDJP has a predicted molecular mass of 47 kDa, and a data base search revealed a domain with amino acid sequence similarity to bacterial (but not yeast or vertebrate) ligases (Halligan et d., 1994). The region of similarity did not coincide with the known active site for ligase, but was provocative enough to encourage further analysis. A joining signal-dependent ligation activity was found to be associated with a bacterially expressed fragment of the VDJP clone. Ligation could only be observed for fragments that contained a joining signal, and ligation between two fragments was abolished or greatly reduced on deletion of the heptamer from either molecule. The joining signal-dependent ligation function was observed in a recombination-positive A-MuLV-transformed cell line and in other pre-B cell lines, but was not observed in fibroblasts (Halligan et al., 1994). It is not yet clear, however, in what way this function may be involved in V(D)J joining. Despite the joining signal dependence, the products do not particularly resemble signal junctions. One piece of information relevant to the possible importance of VUJP is that tests of V(D)J joining in a human ligase l-negative cell showed it to be normal. This indicates that DNA ligase 1, which is implicated in the sealing of Okazaki fragments during DNA replication
V(D)J JOINING
73
(reviewed in Lindahl and Barnes, 1992) is probably not responsible for creating V(D)J junctions (Hsieh et al., 1993; Petrini et al., 1994). Two other maminalian ligases are known to exist (Lindahl and Barnes, 1992) which have not been similarly tested, nevertheless the idea that ligation is performed b y a V(D)J joining-specific function is quite tenable. C. GENETICALLY DEFINED 1 . Severe Combined Zmmunodeficiency (SCZD) In the defective immune systems of scid mice precursor T and B cells are largely unable to complete differentiation (for reviews see Bosma and Carroll, 1991; Bosma, 1992). Scid T and B cells that, phenotypically, correspond to lymphocytes at the onset of Ig and TCR gene rearrangement are easily demonstrated, but those in later stages of differentiation are deleted (Carroll and Bosma, 1991; Osmond et al., 1992; Hothenberg et al., 1993). The possibility that the mutation directly affects the V(D)J joining process itself was first indicated by the observation that spontaneous thymomas, A-MuLV transformants, and long-term bone marrow cultures derived from scid mice had unusually extensive deletions at their antigen receptor loci, reaching both 5’ and 3’ of the normal V(D)J recombination sites (Schuler et al., 1986; Hirayoshi et al., 1987; Witte et al., 1987; Kim et al., 1988; Malynn et al., 1988; Okazaki et al., 1988). Although junctions derived from untransformed scid lymphocytes looked less aberrant in some cases, a defective ability to carry out V(D)J joining was still suggested. Measurement of the frequency of “wild-type” rearrangement in scid lymphocytes has been estimated in a number of studies and was found to occur somewhere between to for VK-to-JK joining (Hendrickson et a/., 1990; Reichman-Fried et al., 1993), at l o - ’ to lo-’ for Vyto-Jy or DH-to-Jt,(Schuler et nl., 1990; Bosma, 1992; Carroll et al., 1993a; Pennycook et al., 1993), and at near wild-type levels for D6to-JS assembly (Carroll and Bosma, 1991; Carroll et al., 1993a; and A. Carroll, personal communication). Because the scid defect effectively blocks differentiation at a point soon after the V(D)J joining program is initiated (Carroll and Bosma, l991), some of these numbers may well reflect differences in cell survival as the program progresses. In cases where D-to-J joining was observed, recombination was limited; both the rearrangement of V gene segments to the UJ structure and the rearrangement of the companion locus needed to template the complete antigen receptor were extremely infrequent (Carroll et al., 1989b, 1993a; Carroll and Bosma 1991; Kotloffet al., 1993a; Pennycook et al., 1993).
74
SUSANNA M . LEWIS
It has been shown that the scid defect also manifests itself as a DNA repair deficiency in nonlymphoid cells (Fulop and Phillips, 1990).A growing literature on the subject consistently points toward an abnormality in sealing double-strand breaks, in particular as it takes place via an end-joining pathway. First, scid cells show a marked sensitivity to DNA-damaging agents that create double-strand breaks, but are no more sensitive than wild-type cells to treatments that create other types of lesions (Biedermann et al., 1991; Hendrickson et al., 19Ylb; Taniguchi et al., 1993).Second, an unusually high frequency ofchromatid exchanges is found following y-irradiation of scid cells (Disney et al., 1992). Ionizing radiation has been demonstrated to induce interallelic homologous recombination (Benjamin and Little, 1992), thus an increased frequency of exchanges in scid could be interpreted to indicate that such an homologous recombination (as opposed to endjoining) pathway is still available to repair DNA damage in these mice. Third, scid cells are more sensitive than wild type to the cytotoxic effects of restriction enzymes when introduced by electroporation (Chang et al., 1993). Finally, a break-repair defect is suggested by one study in which an 11- to 75-fold reduction in the ability of scid cells to stably integrate transfected foreign DNA was observed (Harrington et al., 1992). One interpretation of the above is that some function involved in double-strand break repair is also involved in V(D)J joining (Fulop and Phillips, 1990).A potential relationship between end-joining and V(D)J recombination was perhaps most handily demonstrated by the observation of site-specifically broken hairpin DNA in scid thymocyte DNA (Roth et al., 1992a). An aspect of these experiments that has not been emphasized here is that only in thymocyte DNA from scid mice was it possible to detect coding ends with covalently closed termini. This prompted the suggestion that one step in common between double-strand break repair and V( D)J joining might be that both processes require the cell to be competent in the resolution of a hairpin DNA structure and that it was this resolution of hairpin ends that was specifically defective in scid (Roth et al., 1992a). Defective hairpin DNA metabolism might also explain the somewhat longer P nucleotide insertion observed in endogenous scid junctions (Schuler et al., 1991; Kienker et al., 1991b; Fish and Bosma, 1994; Kotloff et al., 1993b). A test of the hairpin-resolving ability in scid vs wild-type cells failed to show any differences (Lewis, 1994). An A-MuLV-transformed cell line that had been characterized extensively and was representative in terms of its phenotype according to the extrachromosomal V( D)J joining assay was used in the analysis (Lieber et al., 1988b). Hairpin-
ended, linearized, plasmid D N A was recircularized equally well in both scid and wild-type cells. Both scid and normal cells created junctions in which P nucleotides (of similar lengths) were observed, verifying that the joining reaction had involved specific metabolism of the hairpin structure in each case (Lewis, 1994). This study, along with earlier experiments in which linear molecules with a variety of different terminal structures were tested (Lieber et al., l988b; Harrington et nl., 1992; Chang et al., 1993; Lewis, 1994), indicated that none of the enzymatic operations involved i n end-joining appeared to be missing from scid mice. (A summary ofthe DNA-joining defect in scid is presented in Table 11.) The summary presented in Table I1 highlights a central discrepancy in the scid phenotype as it relates to DNA metabolism. The extrachromosonial assay does not reflect the relative success rate of DNA joining as measured in the chromosomal context. Defects appear to be either more or less extreme with the plasmid assay. Because the results are so consistently discrepant, the extrachromosomal/chromosomal difference might itself constitute a useful clue. Two types of defect, not directly involved with catalysis, might be imagined to manifest differently in the chromosomal and extrachromosomal assays. One might be a required “anchoring” function, missing in scid (Lewis, 1994), another, a necessary cell-cycle coordination (Lin and Desiderio, 1993; Schlissel et al., 1993) is disrupted in the mutant strain. I n the latter case, although it is not easy to project the effects of‘ unsynchronized end joining in either the chromosomal or the extrachromosomal contexts, there is precedent for a discrepancy. The repair defect in Ataxia telangiectasia (AT) is thought to result from a failure to postpone replication following D N A damage (Meyn, 1993,and cited therein; reviewed in Murray, 1992). In A T fibroblasts, high spontaneous recombination rates are only measured with chromosomal, not extrachromosomal, substrates (Meyn, 1993). The possibility that scid involves a structural element that functions to hold broken DNA ends also might be entertained. If so, the context in which end joining is measured becomes very important, because the events that might occur via randoni collision (in a recircularization assay, for example) may or may not require the same anchoring function necessary to seal a chromosomal break. In short, the DNA-joining phenotype in scid may appear inconsistent and complex only because the present understanding of whether a particular joining event is “facilitated” or not is incomplete. While it is too early to know whether every detail of the scid phenotype can be rationalized on the basis of either an anchoring defect or a fiailure in cell-cycle coordination, the
TABLE I1 THE SCID (DNA-JOINING) PHENOTYPE ~
~~
Effects on V(D)J Joining Endogenous sequencesa
Quantitative effects: Estimates for the
frequency of “normal junctions” range from 10-‘ to I . Qualitative effects: Deletions at IgH, Igrc, TCRP, TCRy loci in transformed or cells in extended culture, less evident
Effects on Nonspecific End Joining Quanitative and qualitative effects:
Defective repair of DNA broken by Xray (and mimetic agents); cytogenetic evidence of increased rearrangement; defective repair of breaks induced by electroporation of restriction enzymes.
in nontransformed cells; normal junctions at TCRG, IgH (DJ) or at TCRy (VJ) have been detected; long P inserts in some collections, not others; increase in hybrid joint frequency (TCRG); apparent accumulation of hairpin coding ends in thymus DNA samples (TCRG); increase in hybrid joint frequency. Introduced sequences, integrated”
Quantitative effects: Fewer recombinants
(as inversions). Qualitative effects: Some large abnormal
deletions; some normal coding, hybrid, signal joints also observed (with some abnormal).
Quantitative effects: =11-70 x lower
stable transfection efficiency. Qualitative effects: None reported
Introduced sequences, episomal'
-3
4
Quantitative effects: -1000 x fewer coding joints (as inversions or deletions); = 1 5 ~fewer hybrid joints (as deletions); =normal numbers of signal joints (as deletions).
Quantitative effects: None observed for intermolecular end-joining; none observed for recircularization of Compatible 3' overhang ends Incompatible 3' overhang ends Blunt ends Blunt to 3' overhang Hairpin ends.
Qualitative effects: =50% signal joints show abnormal base loss.
Qualitative effects: None observed (for ends as listed).
" V(D)J joining references: Schriler et al. (1986): Hendrickson et nl. (1988); Kim et al. (1988). Malynn ~t a / . (1988); Okazaki et a / . (1988); Blackwell et ol. (1989). Carroll and Bosnia (1989); Petrini et a / . (1990); Kienker e f a l . (199la.h). S c h d e r et al. (1991); Roth et al. (199211);Carroll et ul. (1993a.b); Fish and Bosnia (1993); Kotloff et al. (l993a,b);Pennycook r t al. (1993). DN.4 end-joining references: Fulop and Phillips (1990); Biedermann et a / . (1991); Hendrickson et al. (l99lb); Disney e t d.(1992), Chang et al. (1993). Taniguchi et al. (1993). V(D)J joining references: Hendrickson et n l . (1988, 1990, 1991a): Weaver and Hendrickson (1989);Fel-rier et a / . (1990a). DNA endjoining references: Harrington e l al. (1992) ' V(D)J joining references: Lieber et a / . (1988b) and Taccioli et al. (1993).DNA end-joining references: liarrington ct u / . (1992) and Lewiq (1994).
''
78
SUSANNA M . LEWIS
point is that it may be more productive to attempt to reconcile various observations according to a unifying principle, rather than discounting either the extrachromosomal or endogenous results entirely. 2. O t h e r
A new way to study the V(D)J joining mechanism is afforded by the ability to induce V(D)J joining in virtually any cell type through the introduction of RAG-1 and -2 expression vectors (Oettinger et al., 1990). As first suggested by the scid observations (Fulop and Phillips 1990)several groups have undertaken to look for V(D)J joining defects in DNA repair-deficient cell lines (Hsieh et al., 1993; Pergola et al., 1993; Taccioli et al., 1993; Petrini et al., 1994; E. A. Hendrickson, personal communication). Some of the cell lines that showed sensitivity to DNA-damaging agents were indeed inept at V(D)J joining; significantly, all of these had in common the feature that they were sensitive to ionizing radiation and were, in particular, defective in double-strand break repair (Pergola et al., 1993; Taccioli et al., 1993). For two of the Chinese hamster cell mutants tested, both coding and signal joint formation were depressed relative to wild type, and the signal joints showed an abnormally increased frequency of truncation at the signal ends (Pergola et at., 1993; Taccioli et al., 1993). In one study, it was shown that the CHO mutants (xrs-6 and XR-1; belonging to two different complementation groups) exhibited a normal level of X-ray sensitivity as well as normal V(D)J joining proficiency on fusion to scid fibroblasts (Taccioli et al., 1993).This indicated that the xrs, XR-1, and scid mutations are all separate entities and that each is probably involved in both double-strand break repair and V( D)J joining. One role suggested for the x r s and XR-1 gene products is that they might hold free ends together prior to ligation (Jeggo, 1990). Whether this proves to be so, the fact that V(D)J joining and doublestrand break repair converge outside of the scid system would seem to solidify the relationship (Pergola et aE., 1993; Taccioli et at., 1993). An observation that indicated a need for further analysis, however, was that the V(D)J joining defects in x r s and XR-1 lines (evident when RAG-1 and -2 and substrate DNAs were introduced either in a standard CaPO, transfection or by electroporation with excess carrier DNA) were abolished if the test DNAs were electroporated into cells in the absence of salmon sperm carrier (Pergola et al., 1993). Two additional cell lines (belonging to still other complementation groups) were identified as havingV(D)J joining defects that persisted even in the absence of carrier DNA. One of the lines had a phenotype very similar to that
V(D)J JOINING
79
of scid, while the defect in the other line was fairly subtle (Pergola et al., 1993). Altogether, it is not clear whether the CHO mutant studies indicate four critical V(D)J joining factors (beside s c i d ) , or none. While there seems to be a consistent correlation between double-strand break repair and V(D)J joining (as most explicitly indicated by co-reversion in various tests, Pergola et al., 1993; Taccioli et al., 1993), the carrier effect introduces some uneasiness as to what it all might mean. This is a very enticing approach, regardless, and presents the most immediate hopes for identifying and molecularly cloning additional genes involved in the V(D)J joining pathway.
D.
WHAT’S
LEFT?
1 . Hairpin Nick-use? When hairpin linear DNA was introduced into A-MuLV-transformed lymphoid cells, the ends were connected to give junctions containing the equivalent of P nucleotide insertions (Lewis, 1994). The structure of the junctions had many similarities to coding joints and left little doubt that these cells must be capable of nicking a hairpin-terminated DNA molecule at a position near, but usually not at, the tip. An endonuclease that simply recognizes single-stranded character (similar to S 1 nuclease, for example) might be expected to cleave predominantly near the two bases at the tip of a hairpin, which are certain to be unpaired (hairpin structure is reviewed in van de Ven and Hilbers, 1988). The tendency of the putative hairpin-nicking activity to cut well “off-tip” may distinguish it in a fundamental way from nucleases that are able to target single-stranded DNA (Drew, 1984).
2. Truncation Factors (“Flap-use”)? As discussed previously (Section V), very little is known about the nature of the truncation that is observed in coding joints. It may be due, in part to the endonucleolytic or exonucleolytic removal of “flaps” following the alignment of coding ends at one or more bases of homology (Figs. 6A and 6B). A candidate structure-specific activity has been purified and efforts to clone it are underway in one laboratory (Harrington and Lieber, 1994).A number of coding joints that show no evidence of having been aligned at homologies are truncated as well, however, suggesting that additional mechanisms may contribute to base loss. One possibility is that an exonuclease trims residues from an end independent of any contact with the partner terminus (see discussion, Section V,C).
80
SUSANNA M . LEWIS
To account for the fine-structure of coding joints, the net removal accomplished by this hypothetical nuclease must be somehow limited. One nuclease, BCAN (B cell-associated nuclease), has been detected in extracts prepared from mature B cells (Kenter and Tredup, 1991). This is a 52-kDa 3’-5’ exonuclease, which exhibits some sequence preference, and is nonprocessive. It will liberate a limited number of residues as niononucleotides from its substrate. It has also been shown to have a single-strand DNA preference (S. Sen and A. Kenter, personal communication). Based on its enzymatic activity, BCAN has properties that would particularly suit it to the role of trimming 3‘ extensions generated upon nicking a coding-terminal hairpin structure. However, although the activity was found in mature B cells, it was present at low levels, if at all, in pre-B cells and thymocytes (Kenter and Tredup, 1991). This of course does not rule out BCAN as the truncation factor in V(D)J joining, but some other role specific to (more mature) B cell DNA metabolism appears more likely (Kenter and Tredup, 1991). Regardless, BCAN is instructive as an example of a nuclease possessing many of the particular attributes one might seek in a candidate for the hypothetical truncation factor.
3. A Role f o r Replication? Studies with extrachromosomal plasmid substrates have indicated that plasmid replication is not an obligatory prerequisite for V(D)J recombination (Lieber et al., 1987; Hsieh et al., 1991). For example, an Mbol site located two bases away from the recombination site in one plasmid was not de-methylated in recombinants (this was assayed by digestion with Mbol prior to bacterial transformation; Hsieh et al., 1991).There was in fact multiple Mbol sites on the substrate, any of which would have been recognized by the nuclease where bacterial GATC methylation is lost on eucaryotic replication. Cleavage at even one demethylated GATC site would prevent the recombinant from being scored in the assay. Thus survival of recombinants after Mbol treatment meant that no wholesale replication took place in these molecules, and even a localized replication of the recombination target site, on both strands, must not be required for V(D)J joining. However, as was pointed out, the pattern of nuclease resistance among recombinant molecules remained compatible with the possibility that localized replication, on one strand, might be associated with recombination (Hsieh et ul., 1991). This possibility was investigated further in a study where recombination products were analyzed in much the same manner (i.e., by measuring resistance to restriction enzymes that discriminate between bacte-
V(D)JJOINING
81
rial and mammalian methylation patterns) except that a PCR assay was used in place of bacterial transformation to specifically probe an exised, signal joint product ( J . Menetski, K. Mizouchi, and M. Gellert, personal communication). Again, the status of sequences very near the recombination site were specifically assessed. Surprisingly, even with a substrate lacking the polyoma origin of replication, a significant fraction of the analyzed products appeared to be hemimethylated. These studies suggested that one of the two strand connections as first formed in a recombinant junction may be created by a process (nickor gap-repair) that involves limited DNA synthesis ( J . Menetski, K. Mizuuchi, and M. Gellert, personal communication). VII. The Origins of Order in V(D)J Joining
Antigen receptor gene assembly usually fails. For example, coding joints are created without regard to the reading frame ofthe constructed exon, so that a nonfunctional gene is generated in about two of every three joining attempts (Altenburger et al., 1980; Max et al., 1980; Lewis et al., 1985; Reth et al., 1986a).An incorrect reading frame is only one of a number of pitfalls that must be skirted in the course of constructing a pair of functional antigen receptor genes. Nevertheless, the system works, and daily millions of receptor-positive cells differentiate in the murine bone marrow and thymus. What forces ensure this success? At the two extremes, one could envision a primarily stochastic recombination program that converges on a biologically filnctional outcome only because there is extensive cullingofaberrant cells duringdifferentiation; at the other, orderliness, accuracy, and reproducibility in gene assembly might be intrinsic properties of the V(D)J joining process itself. In support of the former, a census of early B and T cell populations reveals that between the pro-T or -B and mature T or B stages, large numbers of cells fail to make the cut (reviewed in Rothenberg, 1990; Osmond, 1993; Rolink and Melchers, 1993). Whereas positive and negative cellular selection is understood to act on lymphocytes after gene assembly is complete and antigen receptors are displayed on the cell surface (as described in the cited reviews), the extent to which cells with recombination errors and nonproductive rearrangements drop out of the program at an earlier receptor-negative stage is not known. Cell death occurs at the late pro-B and pro-T stage in scid mice (Osmond et al., 1992; Rothenberg et al., 1993), the arrest-point phenotypes corresponding to lymphocytes that have launched, but not completed, gene assembly (Osmond et al., 1992; Godfrey et al., 1993). For the B lineage, there is evidence that the cells that have not tra-
82
SUSANNA M . LEWIS
versed the arrest point are ingested by niacrophages, suggesting the existence of a mechanism that can detect and remove aberrant precursors at an interim stage of the rearrangement program (Osmond et al., 1992). On the other hand, it seems unlikely that cellular selection could be the sole force imposing order on the V(D)J joining process, if only, as discussed in the present section, there is so much that can go wrong. Several attributes of the joining mechanism itself may figure in guiding the process at the reaction level, some of these, such as the 12/23 rule, have long been recognized, but as discussed below other, less-obvious, factors may also play a role One topic that is not covered, although it is extremely important in ensuring that the rearrangement program overall is successful, is the regulation of various stages of V(D)J joining. The targeting of specific loci for rearrangement in specific lymphocyte lineages, the ordered activation of recombination of elements within loci, and the relationship between the shut-down of rearrangement and allelic exclusion are topics that have been covered in several reviews and cannot b e included here (Raulet et al., 1991; Benoist and Mathis, 1992; Malissen et al., 1992; Schatz et al., 1992; Chen and Alt, 1993; Rolink and Melchers, 1993). Instead, the focus is on the mechanical constraints of the joining operation, known or suspected, that confine the process to a productive outcome.
A. THE12/23 RULE The 12/23 rule was first formulated after it was noted that there existed two types of joining signal (those with 12-base and those with 23-base spacers; Early et al., 1980; Sakano et al., 1980). It was readily appreciated that a rule dictating that segments attached to 12-signals can only become joined to those attached to 23-signals provides the basic assembly instructions for gene rearrangement. At the murine Ig heavy-chain locus, once it was discovered that both V and J gene segments were adjoined by 23-spacer signals, the existence of D elements flanked by 12-signals at both sides was predicted on the basis of this rule (Fig. 1; Early et al., 1980; Sakano et al., 1980). The overall organization of 12- or 23-spacer joining signals at various loci indicates the importance of the 12/23 rule (reviewed in Hunkapiller and Hood, 1989; Kabat et al., 1991; Litman et al., 1993). For example, at the Ig light-chain loci, V genes segments have 12-spacer signals at the K locus, but 23-spacer signals at A. Despite the fact that the signals were once apparently “switchable” during evolution, homogeneity of signal type is now observed for all V genes within a locus. There are only rare exceptions (all of which involve D segments; Kokubu et al., 1988;
V(D)J JOINING
83
Greenberg and Flatjnick, 1993),where signal arrangement is not identical for every member within the same class of gene segment. The immediate effect of signal homogeneity is that V-to-V or J-to-J recombination, clearly an undesirable event, is strongly inhibited. The extent to which “homologous” signals are prevented from joining has been measured with introduced substrates. In one test with a retrovirally integrated substrate, no recombination between two 23spacer signals could be detected (Akira et ul., 1987). However, by the extrachromosomal assay, 23- to 23-signal recombination was found to occur at about 2% of the levels measured for the 12-by-23 combination (Hesse et al., 1989; Lewis and Hesse, 1991).The fact that “like” signals recombine, if inefficiently, is in keeping with evidence that some 12/23 rule violations occur during lymphocyte differentiation (see below). Almost all ofthe known, or suspected, 12/23rule exceptions reported to date have involved the IgH locus. The I) segments at the heavychain locus are flanked on both sides by 12-spacer signals (Fig. 1),so that according to the 12/23 rule, D,-to-D, joining is not expected to occur. Nonetheless, in collections of junctions derived from normal tissue, from 1 to 13% of the isolates had structures suggestive of D,to-D, joining (Feeney, 1990; Gu et ul., 1990; Bangs et al., 1991; Sanz, 1991; Yainada et ul., 1991). Most of these putative D,,-D, junctions had been incorporated into fully assembled genes, so that actual DHto-D,%joining could well have been overestimated. This is because a certain amount of guesswork is necessarily involved in assigning the origin of residues found within VDJ joints. Often the designated D was represented by such a small remnant of coding sequence that the alternative possibility of N region addition could not be reliably excluded. In other cases, D segments were connected in a different 5’-to-3’ order than is present in the germline (Gu et al., 1990; Sanz 1991), which strongly suggested that D segments were first reordered by a D-to-J “hybrid inversion” (see section H). Hybrid inversion results in rearrangenient of joining signals such that an ensuing D,-toD, joining event would be completely in keeping with the 12/23 rule. More convincing examples where, for example, 15 or more contiguous residues exactly matched each of the putative D element precursors in the joined sequence (and the “correct” order was preserved) have been provided (eg., Yamada et ul., 1991); however, even so there still remained the possibility that observed D,,-to-D, joining events may not have actually violated the 12/23 rule. It has been suggested that heptamer-like elements embedded within the D-segment coding sequences might, on occasion, provide the necessary 23-spacer recogni-
84
SUSANNA M . LEWIS
tion element (Kurosawa et al., 1981). The involvement of such “cryptic” signals in rare DH-to-D, joining events is relatively difficult to exclude on the basis of coding joint data alone. Conclusive evidence of 12/23 rule violation for endogenous gene segments has instead been provided by an analysis of partially rearranged IgH alleles (Meek et al.,1989). Documentation of both inversional and deletional DH-to-DHrearrangement was obtained by PCR analysis of bone marrow DNA samples using appropriate primers. The fact that DH-to-DHjoining could occur without involvement of a 23signal was incontrovertibly demonstrated on isolation of a signal joint comprised of two fused 12-spacer signals (Meek et al., 1989). The frequency of DH-to-DHjoining at the murine IgH locus was estimated at one junction per 33,000 pre-B cells (Meek e t al., 1989).This number, if taken to reflect the actual occurrence of 12/23 rule violations in the immune system (i.e., unaffected by cellular selection), is lower than both the 2% frequency observed in plasmid test systems and the 1-13% frequencies that were inferred in various studies to exist in fully assembled junctions. In the latter case, the higher frequencies of DH-to-Dbl joining events reported in the studies cited above may have been inflated by misassignment or, as suggested by Meek et al. (1989),could indicate that the receptors templated by genes with DH-DH joints provided some selective advantage. Thus, in mice and humans, although the 12/23 rule is observed, it is not absolute; site-specific recombination between like signals is established for both endogenous and introduced substrates. The data of Meek et al. (1989) and others (Alt et ul., 1984) suggest that this type of joining is rare in differentiating T and B cells; but exactly how rare remains an important question. If there is indeed a discrepancy between introduced and endogenous substrates such that the 12/23 rule is “tighter” in the physiological context (i.e., with a frequency of 1 in 33,000 joining events instead of 1 in 50 or so), it might mean that the orderly assembly of gene segments in vivo is enforced by some additional mechanism(s). Curiously, 12/23 rule exceptions appear to arise with regularity at the IgH locus in the chicken (Parvari et al., 1988; Mansikka and Toivanen, 1991; Peynaud et al., 1991). Chicken DH gene segments, as in mammals, are flanked by 12-spacer signals on both sides (Reynaud et al., 1991),but junctions containing two, and sometimes even three, virtually full-length tandem D elements are found in both partially and fully rearranged IgH alleles (Mansikka and Toivanen, 1991; Reynaud et ul., 1991).No signal joints corresponding to these DH-D, recombination events have been reported, but the studies cited above neverthe-
V(D)J JOINING
85
less strongly indicated that recognition and recombination of two 12spacer signals may occur at an unusually high frequency in this animal. Most of the reservations concerning murine and human junction data were either ruled out or nearly so; first because typically 20 or more residues from the supernumerary D’s were identified within the DNA sequences of the chicken junctions, second because germline sequences provided little $upport for the existence of cryptic 23-signals, and third because examples where the germline 5’-to-3’ order of the D segments was clearly reversed were infrequent (only 1 case in over 30 reported; Mansikka and Toivanen, 1991; Reynaud et al., 1991). It is possible that cellular selection might play a role in the observed frequencies, because a significant expansion of a small number of B cell clones appears to occur in the bursa (Reynaud et al., 1991; Pandey et al., 1993). If so, there must be a strong selection for DD junctions even as they exist in incompletely assembled alleles, the basis ofwhich would be quite mysterious. It is tempting instead to suppose that the 12/23 rule may simply be more relaxed in chickens. The observation that 10-25% of all junctions appeared to arise from 12/23 rule violations in the chicken is one of many special features of the antigen receptor genes in this species. Perhaps the apparent 12/23 rnle violation is related to the extremely restricted gene organization in the chicken, where, at both the heavy- and light-chain loci, the choices” are limited to one V and one J element (Reynaud et al., 1985, 1989b). Gene rearrangement is necessary in order to express Ig genes in chickens, but the event achieves little in terms of combinatorial diversification. Instead, the requirement for antigen receptor diversity in B cells is largely met by postrecombination gene conversion events (reviewed in McCormack et al., 1991b). Relaxation of the 12/23rule in this animal could permit an inherently limited combinatorial diversity to be expanded by D-to-D joining events. The benefits may outweigh the hazards; thus, because of the simple structure of the rearranging loci, the cost in terms of compromising the orderliness in the gene assembly process overall may actually be minimal. In any case, the chicken provides a notable contrast to the mammalian situation and may present the best opportunity to explore the molecular basis of the 12/23 rule and its role in maintaining order during gene assembly. A fundamental question would be whether the enzymatic machinery itself is different in chickens than in mammals. If so one might expect to find evidence for this in the form of increased V-V or J-J joining either at other rearranging loci (e.g., TCRP; Tjoelker et al., 1990),or with introduced substrates. Further, comparative studies may indicate whether 12/23 rule violations are observed only in 1‘
86
SUSANNA M . LEWIS
species that can “afford” it because of simple locus structure. If, against expectation, it should turn out that the apparently high D-to-D joining frequency at IgH is in fact due to selective clonal expansion, this in itself might be an interesting tale, as the selection must unarguably be extremely strong and must be able to operate upon incompletely rearranged DDJ junctions. The centrality of the 12123 rule is perhaps so obvious as to be taken for granted. Yet it is not a simple task to experimentally test the role of the 12/23 rule, apart from other (ill-defined) factors, in maintaining order in V(D)J joining. As becomes evident from the ensuing discussion, the view taken here is that the 12/23 rule is the key binary code for the gene assembly system and that much ofthe information needed to impose order is encrypted in the critical details of locus architecture.
B. JOINING SIGNALS Conserved sequence motifs occur adjacent to every gene segment that is mobilized by the V(D)J joining machinery (Max et al., 1979; Sakano et al., 1979).These small, tripartite elements, “joining signals” or “recombination recognition sites” (HSS) total either 28 or 39 base pairs in length and consist of a heptamer, a spacer of 12 or 23 residues, and a nonamer. A joining signal, even when disconnected from its coding element, can be specifically targeted by the recombination machinery (Lewis et al., 1985; Akira et al., 1987; Hesse et al., 1987). In such cases, the fine-structural features of the recombinant junctions are preserved; typical signal joints are formed and the sequences substituted for V, D, or J coding elements are incorporated into junctions that are in all ways analogous to a true coding joint. In the germline, joining signals are not all created equal, and in fact they vary slightly from a consensus sequence in the vast majority of cases (e.g., almost 90% ofthe time according to one compilation; Hesse et al., 1989).The requirement for each of the three components-heptamer, spacer, and nonamer-in a joining signal has been probed with the plasmid assay (Hesse et al., 1989). Some of the findings of this study are summarized in Fig. 7 (Hesse et al., 1989). Not surprisingly perhaps, the consensus joining signal performed best in the assay, and the most evolutionarily conserved positions correlated with functionally important sites (Fig. 7). The three residues adjacent to the crossover site “CAC” were key determinants of joining signal function: changing any one of them resulted in the most significant reductions. The identity of the next adjacent residue as an A or T was also important. The only other single base changes found to have any marked effect were at positions 6 and 7 of the nonamer (Fig. 7). These residues
87
V(D)J JOINING
*** **** ** ***** A 4CACAGTG
* * .* *
* * *
- -
H 1 2 / 2 3 HA CAA A A A CCI
heptamer
-spacer-
nonamer
heptamer
-spacer-
nonamer
B FIG.7. (A) The consensus joining signal sequence. The relative importance ofvarious positions, as functionally defined with the plasinid assay, is indicated by stars (Hesse et al., 1989). (B) The relative conservation of various residues in the signal motif according to a survey of endogenous sequences is indicated by the bar graph (Hesse et al., 1989).
(AA) comprise part ofa five-base A-tract within the conserved nonamer element. All other positions of the joining signal were less crucial even though their conservation within naturally occurring joining signals is high. For example, interruptions of the A-tract by single base changes at any position other than 6 or 7 had relatively little effect, as did changing the residues located at the three nonamer-proximal positions of the heptamer. A signal in which all positions of the nonamer were changed to a noncanonical identity could still recombine at a very low level (Hesse et al., 1989). Spacer length was also explored in this study. When spacer length was increased by the addition of two or more residues, recombination frequency dropped drastically. However, an addition or subtraction of only one residue in the spacer was fairly well tolerated. This result was consistent with either of two possibilities: (1) spacer length is fixed and the variant nonamer now located at the appropriate position is still acceptable or (2) spacer length is variable, and the machinery can still interact with the consensus nonamer at its new position (Hesse et al., 1989). It remains unresolved whether spacer length is a flexible or fixed feature of the signal, although this issue is of interest both from the point of view of understanding the target preference of the V(D)J joining machinery and in assessing the overall stringency of recombination site selection. For example, it is an open question whether “cryptic” signals processing heptamer-like sequences, but that either lack nonamers or have variable spacer lengths, are physiolog-
88
SUSANNA M. LEWIS
ically relevant. Although there are a number of reports in the literature where “lone” heptamers have apparently been targeted b y the V( D)J joining machinery, these sites always had some traces of nonamer-Iike sequence as well: for example, only rarely were both of the A residues in positions 6 and 7 (as defined by a standard spacer length) absent (Hochtl and Zachau, 1983; Kelley et al., 1985; Moore et al., 1985; Kleinfield et al., 1986; Klobeck and Zachau, 1986; Reth et al., 1986b; Siminovitch et al., 1987; Komori et al., 1989; Shimizu et al., 1991; Usuda et al., 1992). The wide, acceptable variation in joining signal sequence may serve an important function in the developing immune system. Several studies have traced pronounced differences in gene segment joining frequencies in vivo to differences in the joining competence of the involved signals (Ramsden and Wu, 1991; Gauss and Lieber, 1992; Suzuki and Shiku, 1992). In mice, the ratio of K-to-A light chains in the antigen receptors of B cells is about 20 to 1 (reviewed in Ramsden and Wu, 1992). Representative joining signals from the murine K and A loci were compared by the plasmid assay and found to differ by two orders of magnitude or more, suggesting that the joining signals may indeed be a critical determinant of the relative K I A ratios in vivo (Ramsden and Wu, 1992). A second series of studies showed that preferential joining of JH2to DQ52 in normal mouse thymocytes might also be due to a measurably more proficient joining signal as tested with the plasmid assay (Suzuki et al., 1992; Suzuki and Shiku, 1992). Although the basis of the different proficiencies is often difficult to pinpoint, this study indicated that the signal for one of the lessfrequently joined J segments, JHIcould be improved by correcting its shorter-than-normal spacer length (Suzuki and Shiku, 1992). A third type of physiological bias was approached in a study by Gauss and Lieber (1992). It has been observed that among the heavy-chain antigen receptor genes in B cells, inversional D-to-J recombination (which is accomplished through the use of the 12-signals located on the 5‘ side of D segments) is generally far less frequent than deletional Dto-J joining (involving the 3’ D signal; Wood and Tonegawa, 1983; Meek et al., 1989; VanDyk and Meek, 1992).Here again, joining signal competence was found to contribute to a nonstochastic outcome; several 5’ signals (derived from “real” D segments) tested in the plasmid assay were “weaker” than the 3‘ signals (Gauss and Lieber, 1992). Targeting b y the recombination machinery may also be influenced by sequences apart from the canonical heptamer/nonamer motifs of the joining signal. Although the sequences of the joining signal spacers appear to be unconserved according to broad cross-comparisons,
V(D)JJ O I N I N G
89
family- and locus-specific spacer homologies have nevertheless been identified (Schroeder et al., 1989; Schroeder and Wang, 1990; Haire et a]. 1991; Koop et al., 1992). For example, there are strong sequence similarities in the “nonconserved” spacer regions of joining signals within particular V, gene families (in both mice and humans), and it was proposed on this basis that the actual spacer sequence may indeed have an influence on the frequency with which gene segment families are targeted (Schroeder et at., 1989). This interesting notion has not been tested in detail, although two experiments involving spacer sequence variation have been published (Akira et al., 1984; Wei and Lieber, 1993).A global conservation of sequence within all spacers has also been described. One conserved residue was linked to measurable differences in recombination proficiency (D. Ramsden 1993, Ph.D thesis). Studies have suggested that a “good” vs. “bad” recombination target also may be determined b y coding end sequences (Gauss and Lieber 1992; Boubnov et al.,1993; Gerstein and Lieber, 1993a). This is a k e y consideration both for understanding how rearrangement biases are established in vioo and for attempting to enumerate the total genomic burden of signal-like cryptic sites. A depression of recombination frequency of over two orders of magnitude was measured with plasmid substrates in which no changes apart from the sequence of the coding end just next to the joining signal had been introduced (Gerstein and Lieber, 1993a). Such coding sequence effects may figure early in the V(D)J joining reaction, possibly at the point of the initial binding/ cleavage of the target site (see Gerstein and Lieber, l993a, for discussion). The “rules” governing coding end effects, and the generality of the observation, were only partially disclosed by the study, but the data were consistent with a preference for G or C, over T, at the heptamer-proximal position of the coding end. An undesirable coding end sequence was most detrimental when located adjacent to the 12signal. These observations were interpreted in light of the 5’ versus 3’ joining signal bias in DH-to-JHrecombination, where it was suggested that coding end sequence is a significant parameter in this particular example of target site discrimination (Gauss and Lieber, 1992; Gerstein and Lieber, 1993a).A second implication was that there may be hitherto unrecognized context effects governing the frequency with which the V(D)J joining machinery aberrantly targets cryptic sites. Unusual sequence features abutting one reproducibly targeted cryptic recombination site have been noted previously and suggested to play a role (Fuscoe et al., 1991). (Cryptic sites are discussed in greater detail in section VIII.)
90
SUSANNA M . LEWIS
To summarize, the joining signal comprises the target site for V(D)J recombination; yet within the framework of “canonical” sequence recognition, there may be a relevant range of efficiencies with which a gene segment can recombine. As described here, known or postulated sequence-related effects fall into three categories: (1)the presence of an imperfect match to the canonical heptamer and/or nonamer in the signal, (2) (possibly) variation of the sequence within the spacer, and (3) disfavored sequences at the heptamer-proximal positions of the coding segment. It is too soon to give a relative weight to each of these effects; however, the significance of variable target proficiency in the developmental timing, biased repertoires, and fidelity of V(D)J joining is a subject that in general warrants further research.
C . STANDARD RECOMBINATIONWITH ATYPICAL OUTCOMES Some V(D)J joining products, although created in a joining reaction according to the “standard” equation of Fig. 2, are deviant. In such cases the target sites are unusual in one of two ways. As touched on above, one oftwo targeted recombination sites may not be an authentic signal, but rather a cryptic signal-like element. Alternatively, both targeted signals are canonical and functional; however, in combination with one another, they give rise to nonproductive junctions. In this section, a survey of atypical V(D)Jjoining outcomes, and their possible physiological impact, is presented. Belonging to the first category are V gene replacement and locus deletion and, to the second, is “pseudonormal” joining. Together with the array of recombination products derived from nonstandard joining events (Fig. 3; discussed separately in section H, below), this compilation provides a closer look at the wide range of options that exist during gene assembly.
1 . V Gene Replacement The operation referred to as “V gene replacement” (Kleinfield et ul., 1986; Reth et at., 1986b)is one where a fully assembled Ig heavychain gene is targeted for recombination through the recognition of a heptamer-like sequence near the 3’ end of the V gene segment coding sequence. In the mouse, complete VDJ joining ought to preclude successive rearrangement because all D segments are deleted by the assembly process and thus are not available to serve as adapter elements between the remaining upstream V segments and downstream J segments (both VH and JH elements have 23-signals). Nevertheless, V-to-VDJ rearrangement can in fact occur, mediated by a sitespecific recognition of a cryptic signal embedded within the rear-
V(D)J JOINING
91
ranged V segment. This was shown by two different approaches; in one case it was directly demonstrated that an unrearranged V gene segment within an artificial recombination substrate could in fact site-specifically rearrange with a VDJ sequence to produce both a signal joint and a coding joint (Covey et al., 1990),in another, “excision circles” (see section G, below) containing the predicted signal joint product of V gene replacement events were recovered from a transformed cell line that could be induced to carry out V-to-VDJ replacement (Usuda et d . , 1992). Together, these studies established that V gene replacement can take place on either artificial or endogenous substrates, and will produce junctions typical of a standard V(D)Jjoining event. In a similar type of reaction, a cryptic joining sequence that had been fortuitously created from a V-to-DJ fusion was found to serve as a 12-signal in recornbination between the VDJ assemblage and a downstream J (Komori et al., 1989). By either path (V-to-VDJ recombination or VDJ-to-J rearrangement) the outcome of “gene replacement” is a new antigen receptor gene. V gene replacement (or the analogous J segment replacement) has been proposed to salvage cells that have nonfunctional VDJ joins on both alleles (Reth et al., 1986b; Kleinfield and Weigert, 1989) or to allow diversification in situations where rearrangement is biased in favor of recombination of 3’-most V gene segments (Kleinfield et nl., 1986). There has also been speculation that V gene replacement at the heavy-chain locus might figure in “receptor editing” (Tiegs et nl., 1993; see section D). The observation that an “internal heptamer” is conserved within V gene segment sequences at IgH, at TCRy, and similarly at human and murine TCRcu, 6, and p, was taken to indicate the importance of this mechanism (Garman et al., 1986; Kleinfield et al., 1986; Reth et al., l986b; Bernard et nl., 1988; Holman et al., 1992). To date, there is no proof that V gene replacement occurs at any significant frequency during normal T and B cell differentiation. All the evidence for V gene replacement conies from the analysis ofcontinuously rearranging virally transformed cell lines (as cited above), or cells maintained in long-term culture (Tjoa and Kranz, 1992). Two separate studies have attempted to find evidence for the signal joint product of TCR V gene replacement within excision circles isolated from thymus or fetal spleen and have failed to do so (Aguilar and Belmont, 1991; Usuda et al., 1992).Although this is negative evidence, it does raise the question of whether V gene replacement occurs in untransfornied tissues. An alternative possibility is that V gene replacement, where observed, is aconsequence oflong-term, sustained, recom-
92
SUSANNA M. LEWIS
bination activity in immortalized lines. The evident conservation of the cryptic heptamer within V genes in general may be unrelated to any function as a joining signal. The heptamer is embedded in a region that is strongly conserved at the amino acid level (Kabat et al., 1991). It might well be that a requirement for an invariant cysteine in framework three of all V gene segments, in combination with preferred codon usage, is instead the underlying reason for the maintenance of the internal heptamer (T. Hunkapiller, personal communication).
2 . Locus Deletion A second type of cryptic signal interaction creates aberrant structures duringV(D)Jjoining. This occurs when a V , D, or J segment is correctly targeted, but then interacts with a cryptic signal that is unassociated with another coding segment. The first example of its kind was uncovered at the IgK locus (Hijchtl and Zachau, 1983),where a signal joint composed of a J segment signal and a signal-like element was isolated. The germline counterpart of the cryptic element showed no evidence of an adjacent V-like coding region. Since that time, numerous examples of V-to-X, X-to-D, and X-to-J rearrangement have been reported (e.g., Hochtl and Zachau, 1983; Kelley et al., 1985; Moore et al., 1985; Klobeck and Zachau, 1986; Siminovitch et al., 1987; Shimizu et al., 1991). Some of the cryptic sites responsible were probably once real joining signals, but their associated coding segments have since drifted to pseudo-gene status. Other sites may be completely fortuitous, there being no evidence that the sequence that has been targeted by the joining machinery is some type of evolutionary remnant. It has been suggested that recognition of certain cryptic sites by the V(D)J joining machinery might be a determinative event in T or B cell differentiation, perhaps governing the order in which loci are activated for recombination. The recognition of an element designated “RS” in the mouse (Durdik et al., 1984) and its homologue “Kde” in the human (Siminovitch et al., 1985) is located about 25 kb 3‘ of the K constant region (see asterisk, Fig. 1)and mediates deletion of a large area of the locus including the constant region exon and associated regulatory (enhancer) elements (Klobeck and Zachau, 1986; Muller et al., 1990). The RS element is rearranged through transactions with intron two types ofpartner signal: cryptic sites located within the JK-CK (Durdik et al., 1984; Shimizu e t al., 1991; Fig. 1)or VKjoining signals (Kelley et al., 1985). RS (or Kde)-mediated recombination is widespread in B cells that have rearranged A loci (Persiani et al., 1987; Nadel et d.,1990), implying that elimination or activation of K locus sequences may b e a necessary precondition for differentiation into a
V(D)J JOININC:
93
cell that can express the A isotype (Hieter et al., 1981; Durdik et al., 1984; Moore et al., 1985; Siminovitch et ul., 1985). Further studies have not supported certain aspects of this scenario; in particular, the ability of some A-MuLV-transformed lines to rearrange A was not affected by whether RS recombination had taken place (Persiani et ul., 1987), efforts to identify a putative positive trans-activator of A rearrangement were unsuccessful (Daitch et al., 1992), and genetargeting experiments have shown that, in rjiso, A gene rearrangement and expression can take place in normal cells without prior RS recombination (Chen and Alt, 1993; Zou et al., 1993). More complex models (see Chen et al., 1993b; Zou et al., 1993) have not been ruled out. Similar theories surround the bifurcation of TCRaP and y6 lineages, in that specific deletion of the TCRG locus might be necessary in order to allow commitment to differentiation into an a l p T cell (de Villartay et al., 1988; Takeshita et al., 1989). This deletion might be accomplished in one of two ways: by either Va-to-Ja rearrangement (the TCRG locus is nested within TCRa) or by rearrangement between cryptic signals in the region (asterisks, Fig. 1).The signals, termed “6 Rec” recombine with a “pseudo-Ja” signal that is present in both mouse and human (Takeshita et al., 1989).In either case, the deleted interval encompasses JG-CG, and evidence for the deletion of 6 sequences in TCRa-expressing cells has been obtained for untransformed T lineage cells in both mouse and human (Takeshita et d., 1989; Ohashi et al., 1990;de Villartay et al., 1991).Other data indicated that rearrangement of TCRG vs a genes is not a mutually exclusive choice (Thompson et al., 1990a) and that, in general, the lineage determination occurs independently of gene rearrangement (Ohashi et al., 1990; Mombaerts et al., 1992a; Philpott et al., 1992). It has been suggested that the GRec-to-Ja cryptic site recombination is incidental to the activation ofthe region for gene rearrangement, giving the impression of a causal relationship, but actually reflecting the accessibility of the region (Shimizu et al., 1993). Thus, as with gene replacement, the locu5-deletion type of rearrangement may be a case of what can happen does happen (eventually). I n the case of RS recombination at the K locus, the possibility remains that this type of recombination accumulates in cells that have been recombining longer, or more actively, than other cells and may have no role in the K versus A choice. In the case of TCRG deletion, the recombination correlates positively with the accumulation of V(D)J joining-mediated deletion between cryptic sites elsewhere in the genome (Macintyre et al., 1992; Breit et ul., 1993).Either may represent examples of joining mistakes that are not prohibited (or perhaps may
94
SUSANNA M . LEWIS
be positively selected at some level), rather than rearrangements that trigger commitment. Thus, the idea that the mistake-prone target recognition feature of the V(D)J joining machinery is key in programming differentiation, though provocative, has not been supported experimentally. Although neither the K nor the 6 locus deletions have proven to be obligatory in any T or B cell lineage, the possibility that locus deletion may be helpful in preventing expression of a previously aberrantly rearranged allele is not ruled out (Daitch et al., 1992). If so, whether this design is integrated into an effective scheme for dumping “bad” recombination trials is unclear (for example, will RS recombination occur less frequently on a functionally assembled chromosome?). Leaving open the possibility of surprises in the future, an interim conclusion is that no developmental decisions hinge on the tendency of the V(D)J joining machinery to target certain noncanonical signals.
3. Pseudo-normal Joining The concept of pseudo-normal joining is not particularly serviceable, as this type of junction is not distinguished according to any mechanistic, structural, or topographic criteria. Pseudo-normal junctions are a grab bag of products that have in common the fact that they represent nonuseful outcomes of V(D)J joining and/or were not deemed normal by the experimenter. In all cases a pair of authentic joining signals have been targeted according to the 12/23 rule and either a standard inversion or a deletion ensued. Pseudo-normal joining at the Ig heavychain locus, for example, refers to rare instances where the signal 5’ to a D segment is targeted for recombination with the J signal, resulting in a D-to-J inversion (Alt and Baltimore, 1982). There is nothing structurally abnormal about such products and, in theory, inverted DJ junctions ought to be able to serve as intermediates in V(D)J joining. At the K locus, what has been termed “pseudo-normal” is clearly unproductive. Here, a rearrangement occurring subsequent to a primary VKto-JK inversion can involve a V K and JK whose relative locations are such that a signal joint is presumably retained in the chromosome and the coding joint is recovered on excised DNA (Harada and Yamagishi, 1991).Similarly, at the TCRP locus, pseudo-normal joints were isolated from untransformed thyniocytes where coding joints were found on excision products resulting from recombination between an upstream JP gene segment and a downstream DP (Okazaki et al., 1987; see Fig. 1).At TCRS, pseudo-normal joining refers to a pattern of rearrangement where D-to-D fusion involves the two “outside” signals, leaving a signal joint in the chromosome (again, excising the coding joint prod-
V(D)J JOINING
95
uct). Experiments indicate that, in fact, at the TCRG locus, this type of recombination is fairly common, but should tend to limit the chance of constructing a functional gene from the affected allele (Carroll et al., 199313). Altogether, the joining patterns described as pseudo-normal have the common feature that they are of no obvious benefit to the differentiating lymphoid cell. The underlying issue of interest is how these events are avoided: for in fact nonuseful (physiologically speaking) signal-signal combinations present themselves at every locus. There may not be any one single solution. Strategies may be locus-specific and may be in place only where particular hazards attend the pseudonormal transaction in question. For example, pseudo-normal joining might be prevented at loci with a clustered organization (such as Igh or TCRy, or in elasmobranch loci in general) by restricting “intercluster” rearrangement. At IgH, pseudo-normal joining (D-to-J inversion) may be prevented by a locus-specific rule that (somehow) prevents recombination with the 5’ signals of D segments (discussed further in section I ) . Pseudo-normal joining may be of little consequence, or simply not preventable, at other loci such as K .
D. SUCCESSIVE REARRANGEMENT (SECONDARY REARRANGEMENT) Studies of ongoing rearrangement in A-MuLV cell lines indicated that it was possible for V-to-J or D-to-J rearrangement to occur more than once on a given chromosome (Lewis et al., 1982; Reth et al. 1986a; Maeda et al., 1987),consistent with the suggestion that an initial joining event of itself provided no barrier to subsequent recombination (Early and Hood, 1981). It has been shown that successive rearrangement, in transformed cell lines, can replace a bad K gene construction (i.e., one that was out-of-frame or had involved a pseudo-VK gene segment) with a good assembly (capable of templating a lightchain protein; Feddersen and Ness 1990). There is also evidence that ongoing recombination can displace a successfully assembled VKJK junction (Harada and Yamagishi, 1991; Huber et al., 1992). Successive recombination, with similar results, has been demonstrated for the TCRa locus as well (Marolleau et al., 1988), where such events provide a logical explanation for the in vivo pattern of Jct! use during development (Thompson et nl., 1990b; Roth et nl., 1991). It has been theorized that successive rearrangement may serve a dual purpose, one to rescue cells that have almost made it to the end of the differentiation program, but failed to assemble a functional gene at the last step (Feddersen and Van Ness, 1985), and a second to allow remodeling of an antigen receptor gene that, though functional, templates a product with a detri-
96
SUSANNA M. LEWIS
mental “self” specificity (receptor editing; Nemazee, 1992; Radic et al., 1993). Implicit in both of these theories is the notion that the immune system finds it more economical to have a lymphocyte “try again” than to delete the cell. Thus, among features that contribute to the successful assembly of antigen receptor genes, the fact that successive recombination has been demonstrated, and is not generally proscribed, is clearly relevant. However, it is not yet known how many chances to recombine a differentiating lymphocyte is given at each stage of the assembly process, and it may be that successive rearrangement is a more significant option at some points than others. Moreover, successive rearrangement is not always a force for the betterment of the pre-B or -T cell, as it will also increase the likelihood of assembling two functional genes within a single cell, and thus the production of mixed antigen receptors.
E. DISTANCE EFFECTS Proximity has been suggested to explain the observed pattern of gene segment combinations in the in duo-generated repertoire. Initially it was found that V, gene use in A-MuLV transformants appeared to favor segments located nearest to the D cluster (Yancopoulos et al., 1984). It was later determined that repertoires of both murine and human fetal B cells were also dominated by 3’-most VH families (Perlmutter et al., 1985; Schroeder et al., 1987; Malynn et al., 1990). Distance or proximity has been invoked to account for other nonstochastic patterns as well; as in the virtually absent interunit recombination observed at loci with a clustered type of organization (see section 111,A; Reilly et al., 1984; Raulet, 1989; Sanchez et al., 1991; Litman et aZ., 1993),in the use ofnearby VHgenes in “replacement” recombination (section C, above; Kleinfield et al., 1986; Reth et al., 1986a,b; Shirasawa et al., 1992), to explain the order in which J a segments recombine at the TCRa Iocus (Thompson et al., 199Ob; Roth et al., 1991), or to account for prevalent junctions as formed on transgenic constructs (Uematsu et al., 1988; Tuaillon et al., 1993). Despite these many examples, there is no case where rearrangement patterns can be explained strictly on the basis of proximity. For example, the preferred V, gene segment in humans is not the most 3’ element (Schroeder et al., 1989), and, in mice, strain-specific differences in V gene use map outside the IgH locus (Atkinson et al., 1991; Osman et al., 1992; and cited therein). Proximity plays little role at some loci: this issue has been fairly well investigated for the murine IgK locus, where there is no connection between proximity and a
V(D)J JOINING
97
restricted recombination pattern (Kaushik et al., 1989; Teale and Morris, 1989; Kalled and Brodeur, 1990; Medina and Teale, 1993). Even though proximity effects are not necessarily dominant, they could well be important. Given that the physiological biases that have been described often involve distances that vary over tens of kilobases or more, this question is likely to be best approached experimentally with transgenic systems. For example, in one relevant experiment (Engler et al., 1992), recombination between segments residing in a tandemly repeated transgenic substrate was measured. No difference was found between the frequency with which elements separated by 22 kb rearranged relative to those at only 7.5 kb distance (Engler et ul., 1993).Two other groups have constructed transgenic mouse strains containing =50- to 100-kb portions of the human IgH and/or IK loci in unrearranged form (Bruggemann et al., 1991; Taylor et al., 1992; Tuaillon et al., 1993). Whereas certain D segments in the inserted loci, recombined more frequently it is not yet known if these reflect a proximity effect or not. Although the effect of proximity, on a physiological scale, has not been fully explored, several groups have looked into the possibility of short-range influences. These experiments were largely aimed at investigating the notion that the recombination machinery “tracks” along the DNA from one joining signal to the next, with a preference for rearranging the first signal encountered (Wood and Tonegawa, 1983; Yancopoulos et al., 1984). This idea in its most simplistic form was fairly easily tested with plasmid substrates in which three 12spacer joining signals were arranged in tandem (with two basepairs between each copy), at a distance 6.5 kb from a single 23-spacer signal. The observed recombinants were split fairly evenly between the three signals. The same result was obtained when a construct with three tandem 23-spacer signals located 6.5 kb distance from a 12-signal was tested (Gauss and Lieber, 1992). Another group approached the problem somewhat differently i n seeking to explain a DQ52-to-J.2 bias among in uiuo-generated rearrangements (Suzuki et al., 1992). It was possible to reconstruct this bias with extrachromosomal substrates containing 2111 four JH’s and the DQ52 segment (Suzuki and Shiku 1992), but the JH2bias persisted even when the order of the gene segments was reversed. In short, proximity played no detectable role in the recombination frequency in either of these studies (Gau 1992; Suzuki and Shiku, 1992). Crude analyses such as those described above are the best that can be hoped for in the absence of an in uitro joining assay, and are of value even though they do not directly address the question of’ how
98
SUSANNA M . LEWIS
the recombination factors encounter their target sites. For the V(D)J joining machinery, this still might entail some type of linear diffusion along the DNA, but the situation has at least been clarified to the extent that none of the data to date specifically indicate such a model.
F. Cis- AND T~U~S-REARRANGEMENT Whether the V(D)J recombination machinery can carry out recombination between two target sites residing on physically unlinked DNA molecules bears very directly on the question of how order is maintained in V(D)J joining. A strict ban on interchromosomal recombination would, in theory, be helpful, because there are more hazards than benefits in allowing such events. For example, gene assembly by either interchromatid or interhomologue recombination involving inverted gene segments (at the IgK or TCRP loci) would generate dicentric and acentric chromosomes as products. Also, there are cases where V gene segments (termed “orphons”) have become separated from the rest of the locus and relocated to a new chromosome (Lotscher et al., 1986; Matsuda et al., 1990; Robinson et al., 1993);use ofthese gene segments in V( D)J recombination might generate undesirable translocations. Restricting rearrangement to linked target sites avoids the above types of event and also limits the number of cryptic signals that could interfere with the recombination process to sites that exist in cis. It was only fairly recently that evidence has been provided that indicates that interchromosomal V(D)J joining might in fact be quite rare. Three categories of interchromosomal V( D)J recombination are theoretically possible, that between chromatids, between homologues and between nonhomologues (Fig. 8). Unequal sister chromatid exchange was first proposed to account for the retention of signal joints in K-rearranged lymphoid cells (Van Ness et aZ., 1982).However, subsequent analyses revealed instances of nonsegregation of coding and signal joints following K locus recombination, contradicting the predictions of that model (Fig. 8, left; Hochtl and Zachau, 1983; Klobeck et al., 1988; Feddersen and Ness, 1989). These results as well as physical mapping studies (Lorentz et al., 1988; Weichhold et al., 1990) have led to the general acceptance of an alternative, inversion, model for IgK gene rearrangement (Lewis et al., 1982).Interchromatid recombination was also suggested to explain the presence ofmultiple CP-hybridizing rearrangements in one TCRP-rearranged T cell hybridoma (Kronenberg et al., 1985). This increment in the copy number of elements in the locus was consistent with unequal sister chromatid exchange (Fig. 8, left) and was cited as evidence in several reviews. However, the data were inconclusive, because other likely possibilities such
99
V(I>)J JOINING
Inter-chromatid
Inter-homolog
Obligate segregation
No segregation
Inter-chromosome (non-homoloes)
No segregation (chimeric junctions)
FIG.8. T h e predicted consequences of inter uersus intrachromosomal V(D)Jjoining.
as (a) karyotypic abnormality and (b) subclonal heterogeneity might equally well have accounted for the extra Cp copy in this one cell line and had not been ruled out. Subsequent studies indicate instead that interchromosomal recombination occurs rarely, if at all (see below). Interlocus V(D)J junctions (i.e., in which the V segment was from a different locus than D and/or J) have been detected (Baer et al., 1985; Denny et nl., 1986; Tycko et al., 1989; Kobayashi et al., 1991; Lipkowitz et al., 1992).In several cases, the involved loci were situated on two different chromosomes (Fig. 8, right), and the events have been roughly quantified. For example, estimates put the frequency of D6to-Jy junctions (linking chromosomes 13and 14) at 1per 50,000 murine thymocytes (Tycko et al., 1991) and VG-to-JP (a 14-to-7 translocation) at 1 in every 200,000 human peripheral blood lymphocytes (Kobayashi et nl., 1991). The most revealing comparisons of cis and trans recombination frequencies involved measurement of interhomologue junctions (Fig. 8, middle) at the TCRP locus (Aster and Sklar, 1992). Providentially, the NZW and SWR strains of mice possessed the ideal TCRp alleles for such an undertaking: NZW lacks a portion of the Jp2-to-Cp2 region present in SWR; SWR is deleted for a number of Vp gene segments found in NZW deleted. Through PCR amplification of junctions in F1 animals, products involving a Vp from the NZW chromosome and Jp from the SWR chromosome were detected (Aster and Sklar, 1992). These interchromosomal junctions were rare: estimated to be present in only about 1 of every lo5thymocytes. This was an important result; both alleles were presumably accessible at the time ofjoining, thus the
100
SUSANNA M. LEWIS
low frequency of interallelic rearrangement indicated that unlinked targets are somehow out-of-range of one another. Although the above experiments established the rarity of trans Vto-J recombination, whether in fact interchromosomal V( D)J joining is at all possible has not been conclusively demonstrated. There is no doubt that gene segments that, in the germline, were originally located on two separate chromosomes have in fact become connected to one another in these experiments, but it has not yet been determined that the two gene segments were first brought together by V(D)Jjoining rather than by a nonspecific translocation event. Even the low-level truns-recombinants measured in the above studies may actually have arisen through cis V(D)J joining. Analysis of gene structure in bulk populations ofcells can set an upper limit to the frequency of interchromosomal joining (Aster and Sklar, 1992),whereas the specific diagnostic tests that distinguish a trans-V(D)J joining mechanism from other possibilities must be conducted at the single-cell level (section VIII, Fig. 14). Somewhat surprisingly, there has been little experimental exploration of a possible intra-versus-intermolecular V(D)J joining constraint using introduced substrates. Only one group has carried out a preliminary investigation of the issue (Hesse et al., 1987). In this study, intermolecular recombination was tested by cotransfecting a plasmid substrate containing a single 12-spacer joining signal along with another bearing a single 23-spacer joining signal. No intermolecular recombinants were detected, putting the relative frequency of such events below 0.7% that of intermolecular rearrangement. As such, the negative result provided limited information. Potentially, a more suitable approach might involve stably integrated substrates-transgenic or otherwise-where the copy number is controlled and chromosomal location might be better defined. The observed rarity of interchromosomal V(D)J recombination could have one of several explanations; there might be a mechanistic prohibition against an intermolecular joining event (although it is difficult to imagine how molecules are distinguished at the level of a chromosome), there might he some organization with regard to how chromosomes are draped in the nucleus at the time of recombination that limits the possible outcomes, or, less mysteriously, there might simply be a much lower random-collision probability for physicaIly unlinked elements. The third of these has been suggested to be a factor in the “vicinity effects” observed for site-specific and homologous mitotic recombination in yeast (Lichten and Haber, 1989; Sauer, 1992). As mentioned, none of these possibilities has been distinguished experi-
V(D)J JOINING
101
mentally in the case of V(D)J joining. For the present, in the absence of any information about the relationship between the recombination machinery and the architectural elements that physically organize the genome, alternative suggestions involving a more specific restriction in the case of V(D)J joining can reasonably be entertained (Aster and Sklar, 1992).
G. ORIENTATION: DOESIT MATTER? At most loci, gene segments are in the same transcriptional orientation (Fig. l).Thus, as configured, coding joint formation is deletional, and is accompanied by the physical disconnection of the intervening DNA from the chromosome (see Fig. 9D). The excised DNA is sometimes detectable in circular or linear form (Fujimoto and Yamagishi, 1987; Okazaki et al., 1987; Roth et al., 1992a,b), but ultimately, this region is lost from a stably rearranged cell (Sakano et al., 1979; Seidman et al., 1980). At several loci, recombining elements are in opposed transcriptional orientation prior to rearrangement (Fig. l), and their signal orientations dictate that coding and signal joints remain linked after recombination (Fig. 9B), defining the boundaries of an inverted region. The significance of the choice between inversion and deletion can be considered on two levels: in terms of what it might mean about the molecular mechanism and with regard to physiological consequences. Mixed orientation of VK gene segments (Fig. 1) has been demonstrated directly by molecular cloning of the human K locus (Lorentz et al., 1988), and inversion of over a megabase of DNA can be visualized upon V-to-JK joining (Weichhold et al., 1990). Although physical mapping in the mouse is not as complete as for humans, inverted VK gene segments also appear to be prevalent in this animal (Shapiro and Weigert, 1987, and cited therein). Inversionally oriented gene segments have subsequently been described at some TCR loci (see Fig. 1 for murine examples; Malissen et al., 1986; Chien et al., 1987b; Iwashima et al., 1988; Korman et al., 1989). No locus to date is comprised entirely of backward gene segments, and even at K fewer than half of the V gene segments appear to be inverted (Shapiro and Weigert, 1987; Zachau, 1990; Fig. 1).The opposite situation, loci where the polarities of all gene segments are arranged for deletive joining, is common (Lai et aZ., 1989). There may be a physiological advantage to inverted gene segments in some contexts, but, if so, it is not obvious. Although an initial inversion event might bring distant V gene segments nearer to J K for secondary recombination (Shapiro and Weigert, 1987; Kalled and Brodeur,
102
SUSANNA M . LEWIS
’ (””) B ’
-
INPUT
+I
STANDARD
c
HYBRID
1
(NORMALIZED FREQUENCIES)
1
A
1
1
INVERSION
HYBRID HYBRID STANDARD
0.17
0.002
FIG.9. Standard and hybrid outcomes for all possible signal configurations. See text (data are calculated from Lewis et al., 1988). Recombination can be inversional or deletional for every configuration. Reciprocal “excision circles” are diagrammed as small insets for each deletional outcomes.
1990; Weichhold et al., 199O),deletional joining accomplishes this as well (at the expense of the intervening DNA). It has been suggested that the inverted V gene configuration at the K locus is useful because it preserves a larger number of V segments for subsequent rearrangement (Weichhold e t d . ,1990; Tiegs et al., 1993).Indeed, there is a restricted V K gene segment use, observed among early fetal B cells, that appears to favor inversionally oriented elements (Medina and Teale, 1993).However, it was also noted that some of these favored rearrangements are to the C-proximal J K gene segment and, as such, create a topography that is unlikely to be useful in successive recombination attempts (Medina and Teale, 1993).Possibly, the inverted organization of segments at certain loci exists for reasons unrelated to V(D)J joining. For example, the fairly regular flip-flop polarities of the pseudo-V gene segments at chicken Ig loci have been suggested to help stabilize segment number in the germline by preventing their elimination through homology-based recombination (Reynaud et at., 1989b). It is conceivable that inverted V genes arose by happenstance
V(D)J JOINING
103
and exist because they do not have any particularly negative consequences for the joining system. In other words, whether a locus is set up for deletion or instead inversion may be an almost neutral difference in V( D)J recombination. One obvious difference between inversion and deletion, however, is the number of junctions required for chromosome (or substrate) integrity: only one joint need form in a deletion, as opposed to two for an inversion (Fig. 9). The straightforward one-joint/two-joint difference will always somewhat favor deletion (Gauss and Lieber, 1992). As measured with recombination-proficient substrates, in which the signal sequences as well as signal-proximal residues of the coding ends are the same, deletion is consistently favored over inversion by a factor of somewhere between 2- and 4-to-1 (Hesse et al., 1987; Lewis et aZ., 1988; Gerstein and Lieber, 1993a). Beyond the fact that two, rather than one, junctions must be completed for successful inversion, no evidence from plasmid studies to date has indicated that the V(D)J joining operation can “detect” orientation (Gauss and Lieber, 1992). This was inconsistent with the possibility of a “topological filter” such as exists in a number of other site-directed recombination systems (reviewed in Gellert and Nash, 1987). In many cases, a recombinase can discriminate between different target site orientations due to geometric constraints imposed by organized nucleoprotein complexes at synapsis; as a result, orientation preference may reflect thermodynamic considerations (extra looping is required when sites are in one orientation but not another). Alternatively kinetics has been suggested to play a role (on encounter via a rapid, restricted “slithering” of a plectonemic supercoil, the correct geometry for productive complex formation is already approximated for sites in one orientation but not another; Parker and Halford, 1991). To a certain extent it is inappropriate to make comparisons between results obtained with an in uiuo assay of V(D)J joining and those obtained with highly purified components in uitro in other systems. But as a first pass at the problem, the fairly inconsequential effects of orientation when measured on circular plasmid molecules hint that, in contrast to other recombination systems, productive interaction between target sites is not highly constrained by protein:DNA assemblies (Craig, 1988; Echols, 1990; Mizuuchi, 199213). Although all the available evidence converges on the conclusion that inversion and deletion are roughly equivalent mechanistically, there is nevertheless a marked scarcity of inversionally joined D segments at the Ig heavy-chain locus (Wood and Tonegawa, 1983; Meek et al., 1989; Schlissel et d., 1991; VanDyk and Meek, 1992). DHgene
104
SUSANNA M. LEWIS
segments have 12-spacer signals on both sides; thus, based on the results discussed above, inversional D-J recombination would be expected to occur about 1/3 to 114 of the time. Instead the in vivo ratios are very low, closer to 1000 to 1 (Meek et al., 1989; K. Meek, personal communication). This D-to-J inversion bias, and why it exists, is taken up more fully below, following a review of alternative junctions.
H. THE SPECIFICITY OF ENDEXCHANGE: ALTERNATIVEJUNCTIONS IN
V( D)J JOINING
In many site-directed joining systems, detrimental recombination events are prevented, in part, by the ability of the recombinase to detect the relative orientation of target recombination sites (as discussed in the previous section). For those site-specific recombination systems that are not restricted in this fashion, there is nevertheless some built-in strand-exchange specificity. The term “directionality” has been used to indicate two different types of discrimination. Cre or Flp recombinases, for example, manifest directionality in that a particular orientation of target sites leads to a fixed, and predictable, result (reviewed in Sadowski, 1986).The choice between inversion, or resolution (into two circles), is dictated by the relative orientations of the recombination sites of the input substrate. This type of directionality, as studied in the Cre and Flp systems, appears to be imposed on the reaction largely by DNA:DNA interactions during the strandexchange step (Hoess et al., 1986; Senecoff and Cox, 1986; Serre et al., 1992),although some evidence for interactions that impose a polarity on synapsis at a precleavage stage exists as well (Qian et al., 1992). The term “directionality” also has a second meaning, related to the reversibility of the recombination reaction, as applied to Int-mediated events. Phage A integration is not immediately followed by excision (Landy, 1989; Nash, 1990). The formation and obligate breakdown of higher order nucleoprotein structure ensures that the reaction does not simply reverse to expel the integrated phage genome. In this case, DNA:protein interactions are key to the observed orderliness of recombination (Landy, 1989; Nash, 1990). The V(D)J joining system provides an interesting contrast to the above examples of specificity in strand exchange. For one thing, the standard V(D)J joining event is not simply reversible because one of the products, the coding joint, no longer contains a recombination target site. Given this inherent directionality, even if the forward and backward reactions were energetically neutral, there should be no necessity for more elaborate devices to protect new junctions from becoming disassembled by iterative recombination. Further, direction-
V(D)J JOINING
105
ality as exhibited by the Cre or Flp recombinases (that is, the inherent mechanistic restriction that dictates inversion with one sort of signal arrangement and deletion with another) is not observed (Fig. 9). Starting with each of the four possible joining signal configurations as diagrammed in Fig. 9, both inversion or deletion can be detected. The junctions produced are “standard” or “hybrid.” The options actually include three patterns of end exchange (Fig. 3 ) . Nonstandard V(D)J joining events are those in which signal-tocoding end fusion occurs in place of signal-to-signal and coding-tocoding end connections and include both the hybrid and open-andshut pattern (Figs. 3B and 3C). These nonstandard products have been detected not only with introduced substrates (Lewis et al., 1988; Lieber et al., 1988b; Morzycka-Wroblewska et al., 1988; Weaver and Hendrickson, 1989; Lewis and Hesse, 1991)but also on rearrangement of the endogenous substrate in vivo (Stenzel-Poore and Rittenberg, 1987; Elliott et al., 1988; Nickerson et ul., 1989; Alexandre et al., 1991; VanDyk and Meek, 1992; Carroll et al., 1993a,b; S. Fish and M. Bosma, personal communication; A. Sollbach and G. Wu, personal communication). In hybrid joints (Fig. 3B) two gene segments exchange signals. In an open-and-shut joint (Fig. 3C) a coding segment is disconnected and then reattached to its original signal without any net rearrangement. In short, as illustrated in Fig. 3, every possible 5‘ endto-3’ end combination can be found among the products of V(D)J joining. The fine-structure ofall types ofV(D)J joining product is remarkably consistent. Coding ends, whether they are incorporated into a standard, hybrid, or open-and-shut joint, exhibit base loss and addition (including the occasional P nucleotide insert). Signal ends, as found in any ofthe three types ofjunction are joined most often without modification (reviewed in Lewis and Gellert. 1989). In addition, it has been demonstrated that hybrid junction formation follows the 12/23 rule and can be a reciprocal recombination event (Lewis and Hesse, 1991). All of these observations support the view that an event in which “improper” end exchange occurs is very closely related to the normal (standard) V(D)J joining event (Lewis et al., 1988). The lack of end-exchange specificity in V(D)J joining is peculiar. Many other site-directed recombination systems have developed fairly elaborate mechanisms to ensure that the correct ends become connected (for a discussion see Mizuuchi, 19924. At first glance, one might suspect, given the multiplicity of possible outcomes in V(D)J joining, that perhaps the nonstandard junctions are simply innocuous. However, as it presented more fully below, this is not likely to be the case.
106
SUSANNA M . LEWIS
In the present discussion two issues are examined: (1) the prevalence of nonstandard junctions and (2) the possibility that there are mechanisms in place to actively suppress their formation. Given a particular joining signal configuration, either of two situations pertains: a hybrid junction will be formed deletively and standard junctions will form inversionally (for example, substrate A, Fig. 9), or the reverse is true such that hybrid junctions are formed by inversion and a standard junction forms by deletion (e.g., substrate C ) .With the extrachromosomal assay, hybrid junctions can be discriminated from standard recombinants fairly easily and have been found to represent almost 30% of all products in some cases (Lewis et al., 1988). Only one quantification of hybrid formation has been carried out with a stably integrated substrate (in configuration A), but interestingly, 2 hybrids and 21 standard junctions were isolated in that experiment (Morzycka-Wroblewska et al., 1988). This 9% hybrid joint frequency agrees reasonably well with the 17%frequency measured for configuration A on screening large numbers ofjunctions with the extrachromosoma1 assay (Fig. 9). Accordingly, the representation of hybrid joints observed with plasmid substrates has not somehow been grossly exaggerated in the extrachromosomal assay; the fraction is significant when measured with integrated, single-copy substrates as well. Hybrid joints would not appear to be a good thing for a differentiating lymphocyte for two reasons. One is that a hybrid joint represents essentially wasted effort; a cell that forms such a junction has made no progress toward assembling an antigen receptor gene relative to the fully unrearranged state. A second, more serious consideration is that hybrid joint formation is likely to derail the joining process altogether. Formation of a single hybrid joint clearly erodes locus organization in the one feature that has been preserved through millions of years of evolution, that being an arrangement that will create “sensible” junctions according to the 12/23 rule. The hybrid joint outcome results in the attachment of the wrong signal to a gene segment. As shown for the hypothetical locus in Fig. 10, following hybrid joint formation (Fig. 10, second line), a J segment with a 12-signal is suddenly intermixed with J segments with 23-signals (and likewise signal scrambling occurs for the V segment partner). Once gene segments have acquired inappropriate, but otherwise functional, joining signals, several types of aberrant events may ensue (shown as outcomes 1-4 in Fig. 10). Although a correct VJ junction can still form (for example Fig. 10, outcome 3),other recombination events, in particular, J-to-J and V-to-V joining (outcomes 1 and 4), are no longer precluded on the basis of the 12/23 rule (Fig. 10).Given the projected results of
107
V(D)JJOINING
u hybrid inversion
A U 1
2
4
J.
CI 3
standard 2nd events
J
2
J
C
J
C
4
FIG.10. The hypothetical consequences of hybrid joint formation. A hypothetical, “deletional1y”oriented locus is shown. Upon hybrid inversion,anew slateofreconibination events becomes possible. Dots indicate recombination sites. All of‘ the outcomes shown represent standard recombination events. Outcomes 1,2,and 4 represent failures in gene assembly. Not all possibilities are shown, but potentially, outcome 4 might be favored d u e to the close proximity of the two involved joining signals.
hybrid joint formation, it is of interest to learn whether they are actively suppressed. To launch such an inquiry it is essential to quantify hybrid joint formation both in the mouse and in defined, artificial systems. A partial answer from plasmid studies is that there appears to be an intrinsic anti-hybrid joint bias, but that the effect is only significant for substrates in the C and D configurations. This feature can be appreciated by comparing substrate A to substrate C (Fig. 9, bottom). For substrate A, the ratio of hybrid recombinants-to-standard recombinants is 0.17. In contrast, for substrate C, the hybrid-to-standard ratio is only 0.002 (Lewis et al., 1988).The same result is obtained when substrates B and D are compared; the ratios thus appear to be related to the
108
SUSANNA M . LEWIS
topography of the substrate. Events leading to hybrid joints instead of standard joints are thus less likely to be reciprocal (i.e., there is less likelihood that all four ends are successfully reconnected), so that substrate configurations that require inversional hyrid outcomes (Figs. 9C or 9D) apparently disfavor the nonstandard product. Put another way, the values in Fig. 9 (all of which were normalized to an internal recombination control to allow comparison between configurations), indicate that while the ratio of inversion-to-deletion is around 0.3 for the standard outcome, for hybrid joint formation, it is only about 0.03. In absolute terms, the extrachromosomal plasmid measurements indicate an intrinsic “joining hierarchy”: standard deletions are most easily accomplished, followed by standard inversion, then hybrid deletion, and finally hybrid inversion (Fig. 9, bottom). It is possible that the immune system has evolved a locus structure that capitalizes on this hierarchy. A valid generalization is that the prevailing gene segment configuration is of type D (see Fig. 1 and citations in section HI). In this configuration, the hybrid product, which must form via inversion, is the least favored of all outcomes, while the coding joint (a “standard deletion”) is most favored. Thus the observed configuration D (rather than the A or B type) should reduce the hybrid/standard ratio to its minimum, according to results with the plasmid assay. The implications of an intrinsic joining hierarchy are discussed further in Section VII, I. The key question, not yet touched on, however, is how frequently hybrid joints are actually formed in the completely physiological context. Is it possible that the only deterrent in the system is locus organization (and the joining hierarchy), or is there evidence of other forces that decrease the likelihood of the hybrid outcome? Only a handful of studies have attempted to detect endogenously formed hybrid joints (VanDyk and Meek, 1992; Carroll et al. 1993a,b; Sollbach and Wu, personal communication). The most relevant here are those directed at an analysis of D-to-J recombination at the IgH locus (VanDyk and Meek, 1992). At the IgH locus, D-to-J recombination (ignoring, for the time being, the signal 5‘ to the D segment) is formally equivalent to the joining signal configuration “D” shown in Fig. 9. Thus, standard DJ coding joints form by deletion, and the corresponding hybrid joints by inversion. These two outcomes were detected by PCR amplification, and the relative frequency was estimated by limiting dilution analyses. Hybrid inversion was found to occur at no fewer than 1 per 1000 standard D-to-J deletions (VanDyk and Meek, 1992; K. Meek, personal communication). By the extrachromosomal assay, D-type substrates yielded 1 hybrid inversion per 550 standard deletion products
V( D)J J 0 I N I K C;
109
(Lewis et d., 1988, and unpublished observations). Thus, according to these preliminary comparisons, there seems to be a reasonably good correspondence between the extrachromosomal substrate results and the situation in an actual mouse. What this indicates is that, with regard to hybrid joint formation, for the joining signal configuration (D) that is present at most loci, configuration alone is significant in driving the V(D)J joining reaction toward a functional product. A second type of nonstandard product, termed an open-and-shut joint, has also been demonstrated (Lewis et a!., 1988).As with hybrid joints, their impact on the joining process will only begin to be understood after their frequency is characterized in defined experimental systems and this is compared to what is observed physiologically. Open-and-shut junctions are difficult to quantify, either as endogenously generated products or with introduced substrates, because their only distinguishing feature is that they contain small base additions and deletions at the coding/signal border: they are not products of any gross rearrangement. When measured with specially designed extrachromosomal substrates and screening procedures, open-andshut junctions were found to occur at 1% of the frequency of standard junctions (Lewis and Hesse, 1991). Given their rarity in the extrachromosomal assay, and given that such junctions, as nonrecombinants, are “invisible” in most analyses of physiological junctions, it is remarkable that a number of cases of endogenous open-and-shut junctions have nonetheless surfaced. The physiological occurrence of opening and shutting has not yet been quantified, but preliminary indications are that opening and shutting may be reasonably frequent during antigen receptor gene rearrangement in oiuo. Most of the open-and-shut junctions characterized to date were revealed upon analysis ofthe unrearranged 5‘joining signals o f D elements that had become recombined at their 3’ borders. One example involved the unrearranged S‘ signal of a TCR D61 segment which had become joined at its 3‘ side to J S l (Elliott et al., 1988). Another 7 junctions have been isolated from thymocytes, all involving unrearranged 5’ signals of D62 in D-to-J61 recombinants (Fish and Bosma, 1994). Some possible examples of opening and shutting at partially rearranged DD junctions at TCRG have also been reported (Carroll et at., 1993b). Additionally two DNA sequences derived from completely unrearranged PCK-amplified V a gene segments niay also represent open-and-shut events (Roth et al., 1988,1989). Several similiarly unrearranged examples from the TCRG locus have also been obtained (Fish and Bosma, 1994). A particularly provocative observation was that the 7 open-and-shut joints in the D62-toJ61 collection of
110
SUSANNA M. LEWIS
Fish and Bosma were discovered on randomly sequencing only 37 Dto-J junctions (Fish and Bosma, 1994). This is obviously much higher than the 1% frequency of opening and shutting measured with plasmid substrates . Several possibilities suggest themselves (more than one of which may pertain): one is that opening and shutting is much more frequent in the physiological situation than is indicated by the plasmid assay results; another is that the joining machinery might be somewhat processive, accounting for a high frequency of open-and-shut junctions adjacent to nearby DJ junctions (a possibility that has not yet been explored with plasmid substrates); and a third is that some feature peculiar to the TCRS locus may lead to elevated levels of this type of event. Whatever the root cause, it is clear that open-and-shut products are prevalent in at least in one context (and may increase in an agedependent fashion) (Fish and Bosma, 1994). It is thus conceivable that opening and shutting may influence the ultimate success of the in uiuo V(D)J joining operation. One possibility is that opening and shutting results from abortive recombination attempts and that the ability to open and shut contributes in a positive way to joining fidelity. Because of the considerable variation in target site sequence that is accommodated by the V(D)J joining machinery, it might in fact be helpful to be able to discontinue interactions involving inappropriate targets at the strand-exchange step. With this capability, errors in target recognition, which cannot be stringently avoided, still fail to result in recombination; by returning all elements to the starting configuration, the potential for aberrant translocation is neutralized. There is some experimental support, albeit still incomplete, for this notion. One relevant observation is that the ratio of opening and shutting-to-recombination was increased in a substrate where two 23spacer signals were inappropriately paired (see Lewis and Hesse, 1991, for further discussion). In another study, opening and shutting at a canonical signal was only detected when it was paired with a mutant signal (Hendrickson et al., 1991a). However, the latter result, obtained with retroviral constructs, is in conflict with observations with the plasmid assay, where open-and-shut events at a canonical joining signal are observed in the absence of any partner signal whatsoever (Lewis and Hesse, 1991). This discrepency highlights some of the basic questions that need to be answered before open-and-shut results are fully interpretable. Although it has been established that at least some opening and shutting is the result of a two-signal transaction (the evidence is discussed in detail in Lewis and Hesse, 1991), whether there may be “hidden” partners, in the form of fortuitous
V(D)J JOINING
111
signal-like sequences that interact with canonical signals to induce apparent “single” open-and-shut events, is unresolved. That is, it is not known whether opening and shutting can take place in the complete absence of a signal-signal interaction (discussed further in section IX, below). In terms of joining fidelity, opening and shutting, whether it comes about as either a one-signal or a two-signal transaction, may play a corrective role. The decisive experiment, however, is to demonstrate that, for certain noncanonical target sites, opening and shutting occurs more frequently than rearrangement. Otherwise, one must suppose that opening and shutting is simply evidence of a failed recombination attempt, without necessarily playing a role in reducing the overall number of recombination errors.
I. AN ENIGMA: THECASEFOR A “3’D SIGNALRULE” One regularity in V(D)J joining has not been well explained by any of the factors discussed to this point. Inversional D-to-J recombination at the Ig heavy-chain locus (which should arise any time the signal at the 5’ side of D is targeted in a D-to-J joining event) is rarely seen in B lymphocytes (Wood and Tonegawa, 1983; Meek et at., 1989; Schlissel et al., 1991; VanDyk and Meek, 1992; Sollbach and Wu, personal communication). This observation raises two very general questions: Why should this be so and how does this discrimination come about? As discussed earlier, there is little evidence for a mechanistic prohibition against inversion per se in V(D)J recombination (Lewiset al., 1982, 1984; Hesse et al., 1987; Gauss and Lieber, 1992), yet an accounting of all of the expected D-to-J joining products at the IgH locus indicates that in this particular context, the outcome has been restricted (VanDyk and Meek, 1992). In a nutshell, four types of recombinant are possible upon D-to-J joining at the IgH locus (Fig. 11, top), because this locus is a combination of both B and D signal configuration (Fig. 9). On the basis of plasmid studies (with idealized joining signals), all four ought to be detected (Fig. 9). If expectations are somewhat refined, based on the intrinsic joining hierarchy discussed in the previous section, then the relative proportions of products ought to be standard deletion > standard inversion > hybrid deletion > hybrid inversion (Fig. 9). However, not only is standard DH-to-JHinversion rare at the heavy-chain locus, but hybrid inversions (the least-prevalent product in the plasmid assay; Lewis et al., 1988) are detected more readily than hybrid deletions (Meek et al., 1989; VanDyk and Meek, 1992). It should be noted that the comparison between various endogenous recombination products was carried out through an analysis of incompletely rearranged alleles (VanDyk and Meek, 1992), thus reducing
112
SUSANNA M. LEWIS
STANDA R D
5:.......3‘ ..__._..
HYBRID
......_. .
. .
;@-+-
..___...
deletion
..__...‘ deletion
inversion
inversion
Observed IgH locus
NO
YES
NO
YES
substrates
YES
YES
YES
YES
Predicted on the basis of Dp trx
NO
YES
YES
NO
deletion only
NO
YES
YES
NO
3’ preferance
NO
YES
NO
YES
FIG.11. Two gene segments at the IgH locus (circled) could hypothetically interact in one of four possible ways. Shown are the standard (left) and hybrid (right) outcomes, each ofwhich can arise from an interaction between the 23-signal of the J segment and the 12-signal located either 5‘ or 3‘ of D. For discussion, see text.
the possibility that the observed pattern might have been created by cellular selection after the assembly and display of a complete IgH molecule. As to why this strange bias should exist, there is no obvious relationship between the observed products and those that might be biologically “useful.” In principle, both a standard D-to-J inversion and a standard D-to-J deletion accomplish much the same thing. In each case a short stretch of coding sequence is appended to J, and the product coding joint has the appropriate 12-signal needed for subsequent V-to-DJ joining (Fig. 11, left). Once V-to-DJ joining has taken place, all gross structural differences between a chromosome that underwent an intermediate inversion and one that recombined deletively have been erased; the only remaining difference is in the orientation of the interstitial D sequences (usually involving fewer than 20 base pairs). It is hard to imagine that a bias against inversion exists to prevent “backward” D’s in a hypervariable region of the gene. The
V(D)J JOINING
113
hybrid joint observations are even harder to understand: as is argued above, the presence of any hybrid junction allows the 12/23 rule to be bypassed in the formation of unproductive joints (Fig. lo), yet hybrid deletions appear to be significantly more disfavored than hybrid inversions in uiuo. Curiously as measured in two independent studies, hybrid inversions appear to be detected more readily even than the standard coding joint inversion (VanDyk and Meek, 1992; Sollbach and Wu, personal communication; Fig. 11). To explain the observed pattern of D-to-J products in the endogenous context, one might naturally first suspect that some structural/ functional feature of the product is being “sensed” in uiuo. Whatever this putative feature may be, it is specific either to the actual D and J sequences found at the heavy-chain locus or to the physiological context itself, because the pattern is not recreated with idealized joining substrates (as cited above, and Gauss and Lieber, 1992). Some possibilities are shown in Fig. 11. First, although inversion is not prohibited on a mechanistic level, some ability to distinguish between inverted and deleted chromosomal sequences might be considered. As shown, in fact, this possibility cannot account for the observed pattern: inversion, not deletion is favored in the case of endogenous hybrid recombination (VanDyk and Meek, 1992) (Fig. 11). A second possibility is that activation of transcriptional promoters found 5‘ to D segments as they are brought into the vicinity of the heavy-chain enhancer (see Fig. 11)somehow forms the basis of the observed selectivity. Either the transcripts themselves or the production of a truncated C-p-containing peptide might be the determining feature (Reth and Alt, 1984). However, the promotor 5‘ to D is brought into an equivalent position by both standard and hybrid deletion, so that, on the face of it, promoter activation cannot explain the scarcity of the latter. A third possibility is that neither the structure nor the function of the recombination product is critical, but instead there is some discrimination between 5‘ and 3‘joining signals at the time of D-toJ recombination (Schlissel et al., 1991; Gauss and Lieber, 1992; VanDyk and Meek, 1992; Sollbach and Wu, personal communication). Without speculating for the moment as to the mechanism of the purported 5‘-3‘ signal discrimination, one can appreciate that this rule, rather than a structure/function selection, not only explains the observed pattern of D-to-J joining (Fig. l l ) , but also may suggest the reason why this pattern exists. The organization of the IgH locus presents unique problems (Fig. 12). D-to-J joining at the heavy-chain locus causes, in effect, a “signal replacement” very like hybrid joint formation. Once a D-to-J joining has occixred (Fig. 12, top), the 23-
114
SUSANNA M. LEWIS
Ict ~
D-to-J recombination
I
&
I ':------I I
V-to-DJ
DJ-to-J I
I I
p J -
I I
!
(UNDESIRABLE)
FIG.12. At the IgH locus, standard, deletiona1, coding joint formation amounts to a signal-replacement event. Theoretically, it should be possible for DJ-to-Jjoining to occur, although this is rarely observed (e.g.,Alt and Baltimore, 1982; Wang and Rosenberg, 1983).
signal to the 5' side of J is replaced by a short, variable stretch of D coding sequence and a 12-spacer signal (Fig. 12, second line). With four IgH J segments close to one another and presumably all accessible throughout the period of heavy-chain gene rearrangement, nonproductive DJ-to-J inversion would seem a particularly favored possibility (Fig. 12, bottom). A blanket prohibition against the use of the 5' signal in any type of D-to-J rearrangement, however, solves this problem. The rarity of D-to-J coding joint inversion, as well as hybrid joint deletion relative to other outcomes (Fig. 11)may only be an incidental consequence of a mechanism that is in place principally to avoid the hazards of J-J joining. Figure 13illustrates, in flowchart form, how three suggested features of the joining process (the 12/23 rule, the joining hierarchy, and the 3' D signal rule) are theoretically sufficient to constrain the outcome of rearrangement in favor of VDJ formation at IgH. Initially, at the first stage of heavy-chain gene assembly (Fig. 13), one presumably need consider only D and J gene segment interactions because V gene recombination has not yet been activated [the regulated, step wise features of V(D)J joining are reviewed by, Blackwell and Alt, 1989;
l&-l---l-Ft-W&3
115
3 RULE
V
V
O
D
J
J
STAGE 1 (D-to-J)
STAGE 2 (V-to-DJ)
(continue...)
FUNCTIONAL GENE
FIG.13. Rules refining the V(D)Jjoining outcome, as illustrated for the IgH locus (see text for discussion).
Schatz et al., 19921. With regard to all possible outcomes, D-to-D and J-to-J joining (whether hybrid or standard) are precluded by the 121 23 rule (Fig. 13). Of the four possible D-to-J joining options (shown in Fig. l l ) , standard inversion and hybrid deletion fall to the 3’ D signal rule. The allowed transaction then is between the 3’ D signal and a J signal (shown by a heavy line, “stage 1,” Fig. 13); of the two possible outcomes for this combination, standard deletion will dominate hybrid D-to-J inversion for the straightforward mechanical reasons implicit in the joining hierarchy (Fig. 9). Thus given the three constraints (the 12/23 rule, the 3‘ D signal rule, and the intrinsicjoining hierarchy) the manifold possibilities reduce to the production of the desired, standard, DJ coding joint. At the “price” of eliminating the DJ inversional outcome (which type of coding joint might equally serve as a recombination intermediate), a number of deleterious events are suppressed. At the next stage of Ig heavy-chain gene assembly, one needs to consider how to prevent the newly created possibility of DJ-to-J recombination (a bad thing) from occurring, as well as how to target V gene
116
SUSANNA M. LEWIS
rearrangement to the preassembled DJ junction (a good thing). It is not known how the latter is ensured, nor even to what extent, exactly, V-to-unrearranged D joining is actively prevented in normal cells (VanDyk and Meek, 1992; Shin et al., 1993),although this type ofrecombination is rare in A-MuLV transformants (Alt et al., 1984; Schlissel et al., 1991). The question marks in Fig. 13 must serve as placeholders for the issue of V-to-D interactions, because indeed little has even been hypothesized to date about how the recombination machinery might single out the 5’ signal of a rearranged DJ junction in V-to-DJ joining. The same 3’ preference rule active in stage 1,however, could block the DJ-to-J outcome. Thus the possibilities are narrowed to interactions of a 3‘ D signal with a 5‘ J (a successive joining event that “leapfrogs” the original DJ junction) or to a stage 2 interaction of a V signal with the 5’ signal of the DJ junction (heavy lines, Fig. 13).(It is not known whether both possibilities coexist in the same cell, despite suggestive evidence from A-MuLV-transformed cell lines; Reth et al., 1986a; Oka et al., 1990.) In either case, according to the joining hierarchy the hybrid type outcome of these interactions is inversional (light arrows), and thus not favored, instead leaving the coding joint (formed by a standard deletion) as the most probable outcome. If the recombination at this step has been D-to-J, then a stage 2 V-to-DJ trial is still possible; if instead V-to-DJ joining has occurred, then there remain no further options (except perhaps a rare V gene replacement), and the assembly process is complete. T h e 3’ D signal preference rule may be particularly valuable at the IgH locus rather than TCRP and 6 where, due to joining signal configuration, many detrimental recombination events are barred by the 12/23 rule. In fact, however, a 3’ D signal rule may explain restricted joining patterns at the other three-segment loci as well. For example, at the TCRP locus (see Fig. l),D-to-D joining (which would require the use of both 3’ and 5’joining signals, and would follow the 12/23 rule) does not normally take place (Bogue et al., 1991; Feeney, 1991a; George and Schroeder, 1992). This is odd because both D’s must be accessible: recombination of either D into the downstream J cluster is observed (Born et at., 1985;Kronenberg et al., 1985).Further, excision products caused by pseudo-normal joining between the downstream 3’ D signal and an upstream J signal are detected, as are signal joints arising on recombination between a V segment and a 5’ D signal, whereas no excision products related to DP-DP joining are observed (Okazaki et al., 1987).At TCRG, D-D joining is rare in fetal lymphocytes (Chien et al., 1987b; Elliott et al., 1988). These restrictions at TCRG and TCRP loci also imply a 3’ D signal rule, such that, as at IgH, the
V(D)J JOINING
117
5‘ D signal is not readily used in recombination with any element other than V (VanDyk and Meek, 1992). In the case of TCRG and TCRP, there are hints that the 3’ D signal preference is a regulated phenomenon, because D-D joining is observed in adult thymocytes at TCRG (Elliott et al., 1988)and because exceptional D-to-D junctions
at TCRp can readily be detected in TCRa-negative transgenic mice (Mallick et ul., 1993). Two points must be emphasized about the putative 3’ D signal rule. One is that ifthe underlying molecular basis for this rule is the regional modulation of chromatin accessibility, this must be a punctuated accessibility, and the boundaries between the inaccessible and accessible domains (5’ us 3‘ of D) must be extremely sharply defined throughout the D cluster. The other is that if we may fairly generalize to all of the three-segment loci (to include TCRP and TCRG), the observation that the 3‘ D signal preference to be conditional (see above) suggests that it is not solely the result of sequence effects at 5’ uersus 3’ recombination sites. How might a 3‘ D Fignal rule be established in uiuo? To begin, the plasmid assay has provided some clues. If, instead of canonical sequences, actual D, segments and their signals are tested in extrachromosomal substrates, differences in joining frequencies between the 5’ and 3’ sides have emerged (Gauss and Lieber, 1992). Only a small number of D segments have been analyzed in this fashion; but, if all D segments likewise possess “poor” 5‘ recombination sites and “good” 3’ recombination sites, this can at least partially explain the in uivo D-to-J recornbination patterns (Gauss and Lieber, 1992; Gerstein and Lieber, 1993a). However, one indication that target site sequence is not the complete story is that deletion/inversion biases measured with plasmid substrate were at most 28: 1 (Gauss and Lieber, 1992). These modest differences fall short of reconstructing the degree of the bias observed among endogenously generated D-to-J junctions, where deletion may be favored by as much as 1000:1 ( M e e k et ul., 1989; K. Meek, personal communication; Sollbach and Wu, personal communication). Possibly, the extrachromosomal assay, while revealing relative differences between inversion and deletion, is unable to reflect the magnitude of the effect. (Imaginably, the extrachromosomal system “saturates” at some level, even though there has been little evidence of a consistent limitation in the past.) Another possibility is that there is an additional undiscovered mechanism at work. The recombination pattern at the heavy-chain locus has alternatively been interpreted to mean that when it comes to a choice between the 5’ and 3‘ joining signals o f a D segment in DJ joining, the 3’joining
118
SUSANNA M . LEWIS
signal somehow prevails because of its physical location (VanDyk and Meek, 1992). One suggestion is that the choice is made on the basis of a signal’s position (or orientation) relative to conserved promoterlike elements that lie 5’ to D (VanDyk and Meek, 1992). In favor of the idea that the 5’ or 3’ choice is positional or regulated, rather than sequence directed, is that this choice does not apply across the board to all recombination events involving D,. Rare V-to-D joining events, where a completely unrearranged D has been targeted (and thus presents both 5’ and 3’joining signals to the recombination machinery), do not show a similar bias of one signal over another (VanDyk and Meek, 1992). Whatever the basis of the discrimination, the fact that two signals, separated by only 10-22 base pairs, can be consistently distinguished at the level of D-to-JHrecombination in vivo is one of the more amazing feats of the recombination process; if targeting is involved, it occurs with surgical precision, if a structural or functional feature of the Dto-J recombination product is selected (either intracellulary or by extracellular forces), the basis of this is completely mysterious. No fully formulated proposal has been ventured, and accessibility arguments clearly must be refined far beyond those previously postulated for lineage-, locus-, or gene family-specific recombination patterns. There is the possibility that the 3’ D signal rule and the specificity of V-toDJ (over V-to-unrearranged D) joining are phenomena with a common mechanistic basis, and/or that perhaps V( D)J recombination silencers (Lauster et al., 1993) in addition to enhancers play a role. The problem drops fairly cleanly into the canyon between in vivo studies and those with simplified plasmid substrates, and a fair guess is that further elucidation will almost certainly require analyses based on “minilocus” transgenic substrates (Bruggemann et al., 1991; Tuaillon et al., 1993; Lauzurica and Krangel, 1994). J. SUMMARY
To summarize, four key features of the joining mechanism have an impact on the biological success of V(D)J joining. One is the 12/23 rule, another (incompletely characterized) is the vicinity constraint, a third is the mechanism’s ability to recognize a range of target sites, and a fourth is the nonobligatory and variable reciprocity of the strand exchanges, leading to the joining hierarchy favoring of standard deletion over all other outcomes. These intrinsic mechanistic contraints, however, represent only one side of the equation. The other is locus structure and how the endogenous substrate has been modeled to take advantage of built-in biases. Some ideas of how substrate structure
V(D)j JOINING
119
and joining mechanics interact to achieve the desired outcome have been reviewed above (Fig. 13); these considerations lead onward to the very intriguing parts of the story that remain undeciphered. One is the clear limitation in the products of D-to-J recombination at the heavy-chain locus; the 3’ D signal rule suggested by this limitation (VanDyk and Meek, 1992) can be generalized to all of the threesegment loci, but the basis is unknown. Other, conceptually simpler patterns also have no explanation as yet, such as the apparent ban on intercluster recombination (Fig. 1) or the directive that ensures that V gene segments will connect only to rearranged D’s. V111. Fidelity and Pathogenesis
Any process that induces gross chromosomal rearrangements has the potential to disorganize the genome in a detrimental fashion. It was early recognized that the V(D)J joining system might play a role in some T and B cell malignancies (for reviews see Tycko and Sklar, 1990; Reis et al., 1991; Korsmeyer, 1992; Lieber, 1993). Although by now this is a well-established observation, the precise nature of the joining error or errors is still not fully understood. One particularly useful insight was that the V(D)Jjoining machinery might be involved to a variable extent in potentiating oncogenic genome rearrangements (Boehm and Rabbitts, 1989; Tycko and Sklar, 1990). In broad terms, two different scenarios may be relevant. The contribution of the V( D)J joining machinery to chromosomal translocation might be limited to the donation of a site-specifically broken end (Bakhshi et al., 1987) or the V(D)Jjoining machinery might orchestrate the entire event (Aplan et al., 1990; Brown et al., 1990). The “error” involved is qualitatively quite different; in the first case, it might amount to the premature release of cleaved ends, in the second, to the faulty recognition of recombination targets. Some basic questions about the V(D)J joining operation need answers before these and other possibilities can be evaluated. Of key importance is the question of whether the V(D)J joining machinery is able to carry out interchromosomal recombination events (section VII1,F). A second question is how many cryptic joining targets exist in the genome and how frequently these are recognized. A third is how readily (if at all) the joining operation can donate free ends to other DNA metabolic pathways. Underlying the latter question is whether the V(D)J joining process is actually distinct from “other” nonspecific repair pathways. The state of the field with regard to these three issues is summarized below.
120
SUSANNA M. LEWIS
Considering first the question of interchromosomal recombination, even in the absence of a mechanistic barrier to intermolecular recombination, recombination between unlinked sequences might be effectively prohibited by a requirement for proximity. In the most general sense one needs to know how far apart two sites can be and still be able to rearrange in a V(D)Jjoining reaction. It has been established with certainty that gene segments known to have been originally located on separate chromosomes can be found in a site-specifically joined conformation (Tycko et al., 1991; Aster and Sklar, 1992). However, the data available at present are not enlightening as to whether the interchromosomal connection was accomplished by the V(D)J joining machinery (Fig. 14, top) or a nonspecific translocation event (Fig. 14, bottom). Where observed, interchromosomal V(D)J recombination events may have taken place subsequent to a nonspecific translocation: the particulars of the signal configuration following nonspecific translocation would determine whether signal and/or coding joints could then form in an intramolecular V(D)J joining event (Fig. 14, bottom). Elevated levels of interchromosomal V(D)J joining have been observed in agricultural workers and in cells derived from patients with Ataxia telangiectasia (Lipkowitz et aZ., 1990, 1992; Kobayashi et al., 1991). This observation is consistent with the possibility that nonspecific translocation is rate limiting and that induction of such events by chemical exposure or genetic predisposition secondarily increased interchromosomal V(D)J joining. The Aster and Sklar study described in section VII (Aster and Sklar, 1992) set an upper limit on the frequency of apparent interchromosomal V(D)J joining that highlighted the rarity of such events. However, to a large extent, an understanding of how V(D)J joining errors come about hinges on the possibility of trans recombination. For example, if V(D)J joining does not occur between unlinked (or otherwise well-separated sites) this could mean that a nonspecific translocation event is absolutely required to bring cryptic sites into the neighborhood of a rearranging locus, and perhaps also to “open” a normally inactive region at the outset. The nonspecific translocation is then to be regarded as the key event setting a course toward the development of the tumor. If instead V(D)J joining actually can occur between chromosomes, the focus is shifted to a determination of why and how an inappropriate target site was recognized. Does the cryptic site lie within a transcribed region? Is it physically located near the active locus within the nucleus? Are there context effects that make this DNA sequence especially recombination prone? Can trans V(D)J joining be induced? The big question mark regarding interchromosomal joining represents a major roadblock and is a nontrivial prob-
121
V(D)J JOINING
* -
Translocation mediated directly by V(D)J joining
mdmg Job”’
@
%
A
Y
S l g n a l JO,”,
.. n
No segregation (chimeric junctions)
-
-
Translocation by non-specific mechansims, followed by intermolecular V(D)J joining:
”
J J
P U
c
P No segregaiion (chimeric junctions)
1
u
0
D
+=:
Coding Joint (chimeric)
FIG.14. Predictions following two different types ofparticipation ofthe V(D)Jjoining machinery in translocation. T h e box shows the consequences of a direct mediation of the translocation event oia V(D)J recombination (an “interlocus” recombination involving authentic joining sites is shown). Below are indicated the products that could be formed bv V(D)J recombination as a secondary event. Depending on the configuration of the interacting signals following translocation, a coding joint, a signal joint, or both might be formed. The detection of “chimeric” junctions, either singly or as reciprocal pairs, does not uniquely distinguish between the two models. The only definitive prediction is that if translocation were to be catalyzed by the joining machinery as a first event, it should b e possible to demonstrate the existence o f a reciprocal pair of products in a single cell, in which the signal joint and the coding joint are located on different chromosomes.
lem to address; conceivably, studies of transgenic animals bearing defined recombination substrates on different chromosomes may provide an answer. The challenge will be to extend the findings of earlier work to a single-cell analysis (Aster and Sklar, 1992). It is only at the single-cell level that the different predictions for cis and trans V(D)J joining can be tested (see legend to Fig. 14). The second question is whether cryptic sites are targeted in the physiological context and, if so, how many such sites exist. Initially, the idea that cryptic site recombination by the V(D)Jjoining machinery
122
SUSANNA M. LEWIS
was significant in oncogenesis was met with some skepticism, because early examples ofputative recognition mistakes presented fairly unconvincing similarities to joining signals, and often the product junctions departed in a significant way from the structures expected of the V(D)J joining machinery (discussed in Tycko and Sklar, 1990). Nevertheless, examples of signal joints involving the characteristic “precise” connection between a consensus joining signal and a signal-like element have been provided (e.g., Hochtl and Zachau, 1983; Boehm et al., 1988), and, reproducible, site-specific rearrangements of cryptic (non V-,D-, or J-associated) targets have been observed (Aplan et al., 1990; Brown et al., 1990; Fuscoe et al., 1991). These latter junctions were found, collectively, to display all the established features of coding joints (limited base loss/addition, N regions, as well as P nucleotide addition, see section V). Of critical importance, in each case it was possible to show that the recombination sites were localized at (but never interior to) signal-like elements in unrearranged DNA. Moreover, the cryptic signals identified in these studies all contained residues (“CAC”) shown to be essential in functional assays (Hesse et al., 1989). These convincing examples of cryptic site recognition come from two lines of investigation: one of the tall gene, implicated in T cell leukemia (variably designed SCL or TCL5 by different groups) the other of naturally occurring mutations in the hprt locus (Aplan et al., 1990; Brown et al., 1990; Bernard et al., 1991; Fuscoe et al., 1991, 1992; Breit et al., 1993). In each case rearrangement between two cryptic sites created a deletion: either removing about 90 kb of sequence 5‘ to the tall gene (connecting it to a second locus, s i l ) or about 20 kb of the hprt transcription unit. Notably, in each instance, not one but several cryptic signals were found (Aplan et al., 1990; Brown et al., 1990; Bernard et al., 1991). Cryptic signals that have been discovered in rearranged form more than once are listed in Table 111 (additional examples that exist as unique cases are not shown; see Fuscoe et al., 1991; Breit et al., 1993). Cryptic signals that were targeted repeatedly in these events (for example, the sites designated “sil-1” and “hprt-1”) match the consensus joining signal sequence at fewer than 9 of 16 positions (see Table 111). Thus the hprt and tall gene rearrangements highlight two important features of cryptic sites: first, that, where conditions favor their discovery, it is possible to detect numerous cryptic sites in a region, and second, that a cryptic site can diverge from the consensus signal quite radically. The hprt and tall gene deletions established the validity of the notion that mistakes in target recognition by the V(D)J recombination
123
V(D)JJOINING
TABLE I11 CRYPTIC SITES( t a l l , sil, hprt, loci) Site Consensus
sil-1 tal-dl
tal-d2 hprt-1 hprt-3A hprt-3B
****
**
CA CACTC----I2/23--ACAA A A A CC m T C S - - - - 1 2 - - - - GCATCACTT ----23---- TCT TTCAAC CACACCC----12---- GTATATTGC ----23---- T A A C C M A A C ACAGAG----lZ---- GCC A A A A CT ----23---- C ACT A A CCC CACTCTA----12---- GCAGATGCT ----23---- TGGCCT C A T CACACAC----12---- ACAAATACA ----23---- TATGTGTTT CACAGAG----12---- A C M T A T T C ----23---- AATA A A AA A
All“
(*I”
A-Tract“
16 7 6
6 4 4 4 6 6 4 3 3
5 2 1 2 3 4 2 2
8 8 12 9 8 5 11 4 11 11
5 4 5
6
0 4 0 3 4
Note. See citations for original designations of sites; sil-1 and tal-d 1.2 sites are froni Aplan et al. (1Y90): Brown et (11. (1990); Bernard et a!. (1Y‘JI) and hprt; 3A, B are from Fuscor et ol. (1991) (hprt-l and hprt-3A. B). For each site the sequence of the “heptamer” and “noiiamer” is shown assuming a spacer of either 12 or 23 bp. All sites were identified on the basis of repeated observation of “coding joints”. The sil-1 site was found joined to elther tal-dl or tal-d2 sites, likewise hprt-1 was found joined to hprt-3a and hprt3b sites. It is not known which signal served as the 12signal and which as the 23-signal i n any of these transactions. Additional sites identified on the basis o f a single codingjoint exist, but are not listed (see text). Asterisks indicate residues determined to be the most important for target site function according to Hesse et ul. (1989). Underlining: residues that match the canonical signal in each criyptic site.
machinery are physiologically relevant. However, beyond an appreciation ofthe possibility that many cryptic sites might exist in the genome, it is difficult to guess the total number based on those data. Another way to approach the problem is to count the number of cryptic sites that fortuitously exist within a defined plasmid substrate. This type of analysis indicated that there was at least one site per 500 base pairs (S. Lewis, unpublished). This is a surprising number. Clearly, without any means of reducing the fraction ofthe genome available for recombination, this should be a crushing load and ought seriously to interfere with the ability of the recombination machinery to locate authentic targets. It remains to be established whether some critical features such as transcription determines which cryptic sites are potential targets for V(D)Jjoining mistakes in a rearranging cell. Analyses of the transcrip-
124
SUSANNA hl. LEWIS
tion patterns of involved regions in hprt and tall deletions provide some information, though limited. One problem is that a certain amount of guesswork is involved in extrapolating backward to the cell in which the aberrant rearrangement originally took place. The tall gene deletions are found in T cell acute lymphoblastic leukemias arid are strongly correlated with TCRG locus deletion, as well as with surface expression of an alp antigen receptor in some tumors (Machtyre et al., 1992; Breit et al., 1993). This suggests that the tall deletion may be temporally associated with the TCRG deletions that accumulate during normal differentiation of the alp sublineage of T cells (Macintyre et al., 1992; Breit et al., 1993). Expression of the tall gene itself is not typical of cells in the T lineage and is not detected in normal mature T cells (Begley et al., 1989a; Bernard et al., 1990). Only very weak expression has been observed in unfractionated (immature) thymocytes (Begley et al., 1989b; Mouthon et al., 1993).The 5’ breakpoint of the tall deletion lies within a second gene, sil, which is expressed in a variety of hematopoetic cells and tissues (Aplan et al., 1991).Thus, during T cell differentiation, the sil cryptic site is likely located within a transcribed region; but whether sites in the tall locus are likewise being transcribed, even in a relevant subset of progenitor cells, is not clear. Similarly the hprt observations provide no decisive argument for or against a role for transcription. The intragenic deletions are detected in circulating T cells: because the hprt is a “housekeeping” function and is transcribed both in lymphocytes and in proliferating cells in general (Steen et al., 1990),it seems likely that it is expressed at the time that cryptic sites are targeted by the V(D)J joining machinery during T cell differentiation (Fuscoe et at., 1991).It is worth noting, however, that the rate of hprt transcription during T cell development is not known and the steady-state levels of expression in mature lymphocytes are quite low. In human T cells, there are at best fewer than about 6-10 RNA molecules per cell (Steen et al., 1990). In sum, while one can make a case for a transcription requirement in the physiological targeting of a cryptic site (Bernard et al., 1990; Fuscoe et al., 1991; Macintyre et al., 1992; Breit et al., 1993 and cited therein), there are some indications that the requirement either is not absolute or may be different than that in normal V(D)J recombination. A determination of the actual frequency of V(D)J joining mistakes in vivo awaits further study. It may be most rewarding to focus on the hprt gene rearrangements in the future. T cells bearing site-specific hprt gene rearrangement have been quantified in both fetal and adult samples and were found at a level of about 2-4 per lo7normal lymphocytes (Fuscoe et al., 1991, 1992). Spontaneous mutations can accumu-
V(D)j I O I N I N C
125
late within this nonessential purine salvage enzyme in normal lymphocyte populations, and, although it is difficult to know whether the effects of mutation are absolutely neutral, there is certainly no evidence ofthe strong positive selections that exist for oncogenic transformation. The near-neutral effects of mutation, coupled with the fact that very low-level events can be detected through in vitro selection for resistance to purine analogs, make the hprt locus the most tractable system described to date for getting at some of the basic questions surrounding the interaction between the V( D)J joining machinery and chromosomally located cryptic sites. The final question involves the possibility that the V(D)J joining machinery can contribute to lymphoma not through cryptic site recognition, but rather by a process here designated as “end-donation” (Fig. 13). It has been suggested that the joining apparatus creates strand breaks at authentic sites which are then connected to DNA that has been broken through some unrelated process (Bakhshi et ul., 1987). AS distinguished from rearrangements brought about by cryptic site recognition, the term “end-donation” is meant to imply that the V(D)J joining machinery might be only partially involved in the formation of certain translocation junctions (reviewed in Boehm and Rabbitts, 1989; Tycko and Sklar, 1990), without making any assumptions as to the extent of the involvement. In follicular lymphomas, there are numerous examples of translocations between the bcl-2 region and the IgH locus, in which site-specifically connected J H gene segments have become recombined with DNA that bears little resemblance to a cryptic signal in the gerinline context (Bakhshi et al., 1987; Limpens et al., 1991;Wyatt et al., 1992). Positive evidence that the V(D)Jjoining machinery is not fully responsible for these and other such recombinants exists as well. As first described by Bakhshi et al. (1987), some examples of reciprocal translocation products have been provided. Comparison of products to precursors indicated that a short (3 to 20 bp) repeat of the non-V(D)J-containing chromosome existed at the crossover site in both recombinants (Bakhshi et al., 1987; Neri et al., 1988; Lu et al., 1991). Such repeats are typically taken to indicate the fill-in of a staggered break (reviewed in Tycko and Sklar, 1990). Similar evidence of staggered breaks exists in cases oftranslocations that show no evidence of involvement of the V(D)J joining machinery (Bakhshi et al., 1987 and cited therein). By contrast, repeats of DNA sequence are not found on isolation of reciprocal coding and signal joints, nor has there been any other evidence to suggest that staggered breaks are normally created during V(D)J joining (see section V,B). Putting all of these observations together, it is likely that the V(D)J joining
126
SUSANNA M. LEWIS
machinery has a definite, but partial, involvement in many translocations (Bakhshi et al., 1987). T h e end-donation class of event may contribute significantly to neoplastic transformation in lymphoid lineages (Boehm and Rabbitts, 1989; Korsmeyer, 1992). In some circumstances both types of V(D)J joining error are together evident. Oncogenic activation of the tall gene is apparently achieved not only by cryptic site recognition (resulting in fusion to an upstream transcription unit), but also as a consequence of translocation into the TCRG locus by an end-donation type of event (Begley et al., 1989a; Finger et al., 1989). Because it remains possible that the V(D)Jjoining machinery simply cannot catalyze interchromosomal recombination on its own, it may be that end-donation (rather than the interchromosomal targeting of joining signals) is the only significant way that V(D)J joining contributes to chromosomal translocations. End-donation errors are frequent enough that about half of all tonsillectomy specimens have some cells (about 1 in 10’) with this class of rearrangement (in particular a nononcogenic bcl-1 I JH joining; Limpens et al., 1991; Aster and Sklar, 1992). It will be of interest to determine exactly how end-donation comes about, because several distinct routes can be envisioned. For example, at a low frequency, the V(D)J joining machinery might release sitespecifically cleaved ends. On this view, there may be a connection between end donation and the open-and-shut reactions described earlier (section VII); end-donation might constitute a failure in the “shut” part of the event. Alternatively, site-specifically cleaved ends may simply be available, without in any way having been “released,” during the normal course of a V(D)J joining event. Whether the V(D)J joining machinery contributes to genomic rearrangement through cryptic site recognition or through end-donation, a number of authors have described features of the primary DNA sequence that might influence the frequency of errors. Two specific sequence motifs have been postulated to be significant in end-donation types of translocation events (Krowczynska et al., 1990; Kasai et al., 1992; Wyatt et al., 1992). Additionally, purine-pyrimidine tracts (ZDNA) and oligopurine-oligopyrimidine stretches have been pointed out (Boehm et al., 1988; Fuscoe et aE., 1991; Lu et ul., 1991; Aplan et al., 1992). In this regard, it has been suggested that non-B form DNA either might influence the sites at which nonspecific breaks occur (Boehm et al., 1989; Lu et al., 1991) or might dictate which of many possible cryptic sites is actually recognized by the V(D)J joining machinery (Fuscoe et ul., 1991). Experimental tests of the significance of any either DNA motif or structure in translocation are yet to be reported.
V(D)JJOINING
127
To summarize, when it comes to errors in V( D)J recombination, the possibility exists that there are somewhat different rules of engagement. As an example, the nonamer element might be an important determinant of recombination frequency for a V, D, or J segment, but relatively unimportant for a cryptic site. Instead cryptic recognition might be facilitated by a nearby Z-DNA stretch. Or where transcription may be critical for real V segment rearrangement, it may be less so for the pretenders. It might also be that an open-and-shut outcome is more likely to take place when inappropriate sites have been targeted (Lewis and Hesse, 1991). The V(D)J joining machinery is strongly implicated as a major force in the development of some T cell acute lymphoblastic leukemias [reviewed in Larsen et al., 1993 (in French)] and is clearly a contributing factor in many other lymphoid tumors (Tycko and Sklar, 1990; Rabbitts, 1991; Reis et al., 1991; Sawyers et al., 1991; Korsmeyer, 1992; Magrath, 1992). This speaks for the importance of understanding how fidelity is maintained during antigen receptor gene assembly on a molecular level, and of learning about the factors that might increase the probability of a mishap. IX. The Joining Mechanism: A Working Hypothesis
Diagrams that connect triangles and boxes provide one way to describe the “mechanism” of V(D)J joining. How V(D)J recombination is actually accomplished is another matter and has proved to be a remarkably intransigent problem. It may be unrealistic to anticipate a “recombinase” that can recognize, cut, modify, and join the recombination target sites. Instead the difficulties encountered in reconstructing the V(D)J joining reaction in vitro could be an indication that such an entity does not exist. While it may appear that the field is still light years away from the level of analysis achieved in other sitedirected recombination systems, the following section summarizes, in a descriptive way, a working model for the joining operation that fulfills the minimal requirement that it flows from start to finish without any fundamental conceptual gaps. If it is true that V(D)Jjoining is largely a collaborative venture (as many have suggested), it may be that relatively few pieces are missing and a detailed understanding of V(D)J joining is in fact not that far off.
A. SYNAPSIS In almost every site-directed recombination system, including, for example, nuclear pre-mRNA splicing (Guthrie, 1991),DNA transposition (Mizuuchi, 1992b), and conservative site-specific recombination
128
SUSANNA M . LEWIS
(Craig, 1988), considerable protein/nucleic acid structure forms prior to cleavage. The nucleoprotein structures are specific, as indicated by their designations as “spliceosomes,” “resolvosonies,” etc., and are key to organizing the reactants. It is believed that, b y refining the interaction at the outset, a product can be created that is useful to the organism. It is not at all certain, however, that V(D)J recombination is a similar type of transaction. Although most models for V(D)J joining proceed from the engagement of the 12- and 23-signals to synapsis of the sites, there is some reason to question this picture. One indication that cutting of one or both sites might be able to occur in the absence of synapsis is the fact that opening and shutting was observable with substrates containing only one of two canonical joining signals (Lewis and Hesse, 1991). A second is that although recombination is negatively affected by shortening the intersignal distance below about 100 residues (Lewis and Hesse, 1991; Sheehan and Lieber, 1993), the effect was not absolute. Signals only 16 base pairs apart can be connected by the V(D)J joining machinery (Lewis and Hesse, 1991).This distance is too short to allow looping of double-stranded DNA, as required for synapsis of the two recombination sites at the outset. More likely, the two sites were brought together for strand exchange after one or both was cleaved. V(D)J joining is not the only recombination system that can connect two closely linked sites. The elimination of sequences during macronuclear development of some ciliated protozoa involves the removal of very short pieces of DNA (Ribas-Aparicio et al., 1987). An intramolecular excision-ligation reaction, where 13 residues were eliminated, was demonstrated in uitro (Robinson et al., 1989). The size of the excised region in this system exclude models that require synapsis of unbroken double-stranded DNA, although the possibility that sites are cut as a first step was not specifically suggested (RibasAparicio et al., 1987). Even though V(D)J recombination between very closely spacedjoining signals is possible, it is clear that the interaction between two joining signals is hindered when the distance between them is shortened (Sheehan and Lieber, 1993). For both inversion- and deletiontype substrates, placing the signals too near one another reduces the frequency of recombination. Apparently the constrained interaction takes place in advance of strand exchange. This is because both hybrid joint and standard joint events are affected when the intersignal distance drops below about 100 base pairs (Sheehan and Lieber, 1993). These data are not necessarily incompatible with the notion that cutting precedes synapsis. It is entirely possible, for example, that the
V(D)J JOINING
129
recombination machinery cuts as a first step and then hold the ends together after cleavage. If this were the case, there really is no clear “either/or” prediction regarding distance effects. An intermediate type of situation might pertain, where recombination is hindered, but not completely eliminated over short distances. It is also possible that the major pathway leading to productive recombination involves an initial synapsis followed by cleavage, but the steps of the reaction can occur in a different order when necessary. Synapsis has been proposed to involve a “parallel” alignment of joining signals (Sheehan and Lieber, 1993). This suggestion followed the observation that reduction ofthe intersignal distance had the most pronounced effects for substrates in which the signals were configured for standard inversion. For deletionally oriented joining signals, decreasing the distance also reduced recombination, but the effects were noticeable at a significantly shorter separation. If the transaction is depicted in two dimensions, a parallel alignment requires that the D N A must bend back on itself twice in order to synapse signals in an inversional configuration, but only once for deletion (Sheehan and Lieber, 1993).For a transaction in which the reactants are not necessarily coplanar, the predicted difference between the two alignments may not be so intuitively obvious; however, the simplest interpretation is that there is a parallel alignment of joining signals during a constrained step of V(D)J recombination.
B. CLEAVAGE Much of the evidence (the fine-structure of recombinant products, the pattern of P nucleotide insertion, and analyses of broken DNA species at the TCRG locus) supports the following inferences: (1)cleavage occurs at the exact edges of the joining signals, ( 2 ) the breaks are likely to be introduced in both strands prior to any joining step, (3)the immediate cleavage products are two blunt-cut signal ends and two covalently closed coding termini (for discussion and citations see sections V,A and V,B). The suggestion that there is a hairpin intermediate in V(D)J joining provided an explanation for P nucleotides and the possible existence of this intermediate has been supported by several studies (section V,B). The hairpin structure may arise in the course of severing coding ends from signal ends via a transesterification reaction mechanism (Lieber, 199l), which provides the added satisfaction of establishing a possible link between V(D)J joining and other site-directed DNA recombination systems (Gellert, 1992b; Mizuuchi, 1992b). Once the DNA is broken, what then? It may be that the necessary
130
SUSANNA M. LEWIS
involvement ofany site-specific, lineage-specific agent ends with cleavage. A speculative possibility is that successful completion of rearrangement occurs in the context of tethered ends and that this is accomplished by interactions between site-specific components of the joining machinery and nonspecific anchoring function(s) active in double-strand break repair. There is no direct evidence to this effect; however, the involvement of a nonspecific anchoring function that is required in end joining provides a plausible basis for the scid phenotype (Section V1,C). Also the notion that it may be necessary to hold onto ends in V( D)J joining provides a minimalist conceptual framework for thinking about how end-donation mistakes might occur.
C . ENDEXCHANGE From the cleavage step onward, it is conceivable that V(D)J joining and end joining are the same (Lewis and Gellert, 1989). This idea departs from very similar proposals (e.g., Roth and Wilson, 1988; Gu et al., 1990) only in that no distinction is made between signal end and coding end connection: both are presumed to be accomplished by non-sequence-specific end-joining processes. The following summarizes the resolution steps of the V(D)J joining reaction on the basis of such a model. After cleavage, the four ends, which are engaged by both specific and nonspecific binding factors, are held in proximity to one another. It has perhaps not been fully appreciated that the hairpin mechanism very economically explains the differences between coding ends and signal ends in all types of V(D)Jjunction on the assumption that postcleavage enzymatic operations are nonspecific. A signal end, as soon as it is created by the cleavage step, is as a substrate for ligation. A coding end, in contrast, would require modification before any joining is undertaken; at minimum, the hairpin terminus must be opened. Whether or not the opening is variable, as has been suggested by a number of workers, processing by end-joining functions will likely have a stochastic element. Trimming, tailing, alignment, and fillingin will all be favored for certain of the created termini and disfavored for others. The overall pattern of end exchange may likewise be due to the difference between signal ends and coding ends after cleavage. Standard junctions may be favored products simply because there is no initial barrier to signal-to-signal ligation. It could be that on average, by the time the coding ends have been processed to a form that can be joined, the signal joint is already created: coding joints then form by default (the only available partner is the other coding end). Thus
V(D)J JOINING
131
the standard products come about without enforcing any set “stepwise” pattern of strand exchange, and the formation of alternative junctions is not proscribed.
D. INTERIMMODIFICATION, AND LIGATION The various possible fates ofcoding ends and signal ends with regard to their modification may also be dictated by their initial postcleavage structures. For a coding end, following the endonucleolytic nicking, some of the open coding termini with 3’ extensions may be modified by TdT (if present). TdT might also modify signal ends, but less frequently due to their proposed blunt-ended structure. Base-pairing interactions may align two coding ends for joining (section V,D); however such alignment does not appear to be a necessary prerequisite, even for coding joint formation, and so might be completely irrelevant in signal end connections. Base removal could take place prior to and/or after ligation (Fig. 6). Observed sequence-specific truncation implies an exonuclease with some sequence discrimination as well as a limited ability to remove residues; there may also be a distinct nuclease that trims bases in the course of removing flaps after one of the two coding strand connections have formed (Sections V,C and V1,D). The signal ends, being blunt at the time of ligation, would not require any such trimming. As discussed (Section VI,B) the ligation step may or may not be accomplished by a V(D)J joining specific activity. It appears unlikely to be carried out by DNA ligase 1 based on the analysis of V(D)J junctions formed in mutant human cells; however, involvement of other ligases has not been investigated. The many similarities between end-joining products observed in completely nonlymphoid contexts and V(D)J coding joints are suggestive of a significant overlap in these processes that could well extend to the ligation step.
E. SUMMARY Thus, the “new” frontier in V(D)J joining, may be to understand nonspecific end joining. According to the sparest of all possible models the only missing piece specific to V(D)Jjoining would be the nuclease that site-specifically cleaves at joining signals (RAG-1 and/or -2 being the most likely candidates). Other nonspecific players to be considered are 1) an anchoring protein for locating cut ends near one another (perhaps missing in scid), 2) a hairpin nick-ase (to allow resolution of coding ends), 3) an alignment function (as required for the “homologydirected” junctions, 4) nuclease(s) to account for truncation, and 5) the ligation function necessary to make the strand connections.
132
SUSANNA M. LEWIS
X. Conclusion
A picture emerges of V(D)J joining as an orderly process that is the sum of disorderly parts. Variability comes into play at a number of levels: variable crossover sites, variable joining signals, variable strand exchange, variable degrees of reciprocity, and so forth. It is argued here that the main tactic employed by other site-directed recombination systems is not in evidence for V(D)J joining. Determinism is not built into the mechanism. But this does not necessarily shift the problem of winnowing out useless recombination products onto cellular selection. The missing information that pilots the reaction to a successful conclusion may be contained, in part, in the structure of the loci. Certainly evolution has had ample time to refine the substrate, and evidence suggests that major reorganizations have taken place (Litman et al., 1993). The logic imposed at the level of the interaction of the joining machinery with its physiological substrate may not be fully revealed by simplified reconstructions. The upcoming challenge for those interested in biological form and function in this system may be twofold: to approach V(D)Jjoining on its own terms without wholesale adoption of preexisting paradigms (such as synapsis before cleavage or a centerpiece higher order protein:DNA structure) and second to design experiments that accommodate the possibility that the nonidealized substrate may be a significant reservoir of information. Appendix Aberrant junctions. Often used to refer to out-of-frame recombinants, such junctions are not aberrant in the sense of representing a V(D)Jjoining mistake. To avoid ambiguity the term is used sparingly here and only to refers to low-frequency target misrecognition. Coding joint. Th e junction made upon fusing V, D, and J gene segments, or the positionally-analogous sequences, in an endogenous or artificial substrate (actual coding capacity is not implied by the term). Cryptic site. A DNA sequence that can be targeted by the V(D)J joining machinery, but which is not located adjacent to a V, D, or J gene segment. D-p protein. A polypeptide templated by a chromosome that has undergone D-to-J joining. As detected in A-MuLV-transformed cell lines, these have no variable region sequences and are thought to have the potential to become incorporated into an “immature” receptor. End-donation. As used here, this refers to a presumptive V(D)J joining mistake involving the site-specific cleavage at an authentic joining signal that is followed by joining to a DNA end that has not been generated by V(D)J joining activity. Gen e replacement. As used here, the secondary rearrangement of a fully rearranged (V-to-D-to-J)IgH allele, involving recombination ofan unrearranged V or J gene segment with a cryptic target site contained within the VDJ joint. In some publications gene replacement is used to refer to other categories of recombination event that lead to the replacement of an expressed allele.
V(D)J J O I N I N C
133
Hybrid joint. A recornbinant jrrnction i n which a coding end-to-signal end connection is made in place of the usnal coding-to-coding and signal-to-signal end connections (section VI1,F). Joining signals. T h e small heptanierlspacer/nc,namer elements abutting V, D, and J coding segments which are site-specifically targeted by the joining machinery. These are also called “RSS” (recombination recognition sites) i n some publications. Kde. See RS, below. N regions, NGEs. Nongerrnline sequences introduced into V(D)J junctions. All but a small percentage of N regions are the result of terminal deoxynucleotidvl transferase activity. Open-and-shut joint. A nonrecombinant junction formed by the reconnection of a coding end to a signal end after site-specific cleavage (section VI1,F). P nucleotides. Palindromic junctional insertions found adjacent to nontruncated coding ends in V(D)J junctions. Pseudo-normal joining. See text (section VI1,C). Reciprocal joint. A signal joint (see below). This term is now disfavored. RS. A cryptic recombination site at the K locus in mice, which, when recombined causes deletion of the constant region. (The corresponding site in humans is called Kde). RSS. See joining signal. Signal joint. T h e junctions formed by the union of two joining signals. Secondary recornbinationlrearrangement. These terms have been used in various publications to mean very different things: either a VK-to-JK joining that supersedes a preexisting junction on the same allele heavy-chain V-to-VDJ “gene replacement” (see above), the de n o w rearrangement of a second allele a cell, with one chromosome already in recombined form, or the subsequent connection of V to a previously formed DJ joint. Because of this ambiguity, these terms are not used here. “Standard” joining. V(D)Jjoining events that lead to the production of coding joints and signal joints, as opposed to “alternative” joints events that lead to hybrid joints or open-and-shut joints. Successive recombination. Here, the term “successive recombination” refers to a single allrtle. It is used to indicatc the replacement of one coding joint by another by a subsequent recombination event that u s e s gene segments 5‘ and 3’ o f t h e initial joint. This term is also used in some publications to indicate, simply, ongoing recombination. 3’D signal preference rule (see section V11,I). The apparent discrimination between joining signals 5’ and 3’ of D segnients i n all types of endogenous D-to-J joining. 12/23 rule. See text, section VI1,A. V gene replacement. See gene replacement, above. V(D)Jjoining. Used here in a generic sense to refer to the Ig/TCR site-specific gene rearrangement process, whether to actual V, D, and/or J segments or artificial sequences are involved. VDJ; DJ; or VJ junction/joining. A junction or joining event specifically involving the designated elements.
ACKNOWLEDGMENTS Th e author is responsible for all errors and omissions, but would like to thank the following for generously responding to requests for preprints and unpihlished inforniation and/or, providing general guidance in discussion: F. Alt, S. Anderson, J. Aster, I). Baltimore, H. Baer, V. Blasquez, P. Bjorkman, B. Blomberg, G. Bosma, M . Bosma, A. Carroll, S. Desiderio, K. Dorshkind, A. Eastman, P. Engler, A. Feeney, S. Fish, M. Flajnick, M. Gellert, R. Gerstein, A. Greenberg, B. I-lalligan, R. Hardy, E. Hendrickson,
134
SUSANNA M. LEWIS
T. Honjo, S. Kallenbach, B. Kee, A. Kenter, M. Krangel, D. Kranz, T. LeBien, M. Leiber, G. Litman, D. Mathis, J. Menetski, W. McCormack, T. McKeithan, K. Meek, K. Muegge, M. Modak, M. Oettinger, C. Paige, J. Penninger, R. Perlmutter, P. Pfeiffer, D. Raulet, C.-A. Reynaud, N. Rosenberg, D. Roth, E. Rothenberg, N. Ruetsch, D. Schatz, M. Schlissel, H. Schroeder, Jr., L. Schultz, E. Selsing, L. Steiner, U . Storb, G. Taccioli, C. Thompson, J. Teale, B. Van Ness, W. Vielmetter, D. Weaver, J.-C. Weill, G. Wu, H. Yamagishi, and H. Zachau. Thanks go to Howard Lipshitz, Pamela Bjorkman, Susan Celnicker, Norman Ruetsch and especially Ellen Rothenberg for comments on the manuscript. I thank Susie Suh for much-appreciated assistance in all phases of manuscript preparation. This effort is dedicated to my spouse, Howard Lipshitz, in acknowledgement of his enlightened, usually unwavering, support. Work in the author’s laboratory is funded by American Cancer Society Grant No. IM-599B.
REFERENCES Abe, M., Hayashida, K., Takayama, K., and Shiku, H. (1991).lnt. Immunol. 3, 1025. Abeliovich, A., Gerber, D., Tanaka, O., Katsuki, M., Graybiel, A. M., and Tonegawa, S. (1992). Science 257, 404. Abremski, K. E., and Hoess, R. H. (1992). Protein Eng. 5, 87. Aguilar, L. K., and Belmont, J . W. (1991).J . lmmunol. 146, 1348. Aguilera, R. J . , Akira, S., Okazaki, K., and Sakano, H. (1987).,Cell (Cambridge, Mass.) 51, 909. Akira, S., Sugiyama, H., Sakaguchi, N., and Kishimoto, T. (1984). EMBO J . 3, 677. Akira, S., Okazaki, K., and Sakano, H. (1987).Science 238, 1134. Alessandrini, A., Pierce, J. H., Baltimore, D., and Desiderio, S. V. (1987).Proc. Natl. Acad. Sci. U.S.A.84, 1799. Alexandre, D., Chuchana, P., Roncarolo, M.-G., Yssel, H., Spits, H., Lefranc, G., and Lefranc, M. (1991). lnt. Immunol. 3, 973. Allison, J . P., and Havran, W. L. (1991). Annu. Reo. Immunol. 9, 679. Alt, F., and Baltimore, D. (1982). Proc. Natl. Acad. Sci. U.S.A.79, 4118. Alt, F. W., Rosenberg, N., Lewis, S., Thomas, E., and Baltimore, D. (1981).Cell (Cambridge, Mass) 27, 381. Alt, F. W., Yancopoulos, G. D., Blackwell, T. K., Wood, C., Thomas, E., Boss, M., Coffman, R., Rosenberg, N., Tonegawa, S., and Baltimore, D. (1984). EMBO J . 3, 1209. Alt, F. W., Blackwell, T. K., and Yancopoulos, G. D. (1987).Science 238, 1079. Alt, F. W., Oltz, E. M., Young, F., Gorman, J.,Taccioli, G., andChen, J. (1992a).lmmunol. Today 13,306. Alt, F. W., Rathbun, G . , Oltz, E., Taccioli, G., and Shinkai, Y. (1992b).Ann. N . Y. Acad. Sci. 651, 277. Altenburger, W., Steinmentz, M., and Zachau, H. (1980). Nature (London)287,603. Anderson, S. J., Levin, S. D., and Perlmutter, R. M. (1993). Nature (London)365, 552. Aplan, P. D., Lombardi, D. P., Ginsberg, A. M., Cossman, J . , Bertness, V. L., and Kirsch, I. R. (1990). Science 250, 1426. Aplan, P. D., Lombardi, D. P., and Kirsch, 1. R. (1991). Mot. Cell. B i d . 11, 5462. Aplan, P. D., Raimondi, S. C., and Kirsch, I. R. (1992).J . E x p . Med 176, 1303. Ariizumi, K., Wang, S., and Tucker, P. W. (1993).Proc. Natl. Acad. Sci. U.S.A.90,3695. Asarnow, D. M., Goodman, T., LeFrancois, L., and Allison, J. P. (1989).Nature (London) 341, 60. Asarnow, D. M., Cado, D., and Raulet, D. H. (1993). Nature (London) 362, 158. Aster, J . C., and Sklar, J. (1992).J.Erp. Med. 175, 1773.
V(D)JJOINING
135
Atkinson, M. J.. Michnick, S. A., Paige, S. J., and Wu, G. E. (1991).J . fmmunol. 146, 2805. Baer, R., Chen, K., Smith, S. D., and Rabbitts, T. H. (1985). Cell (Cambridge, Mass.) 43, 705. Bakhshi, A., Wright, J. J., Graninger, W., Seto, M., Owens, J., Cossman, J., Jensen, J. P., Goldman, P., and Korsmeyer, S. J. (1987). Proc. N a t l . Acad. Sci. U.S.A.84,2396. Bangs, L. A., Sanz, I. E., and Teale, J. M. (1991).J . Immunol. 146, 1996. Begley, C. G., Aplan, P. D., Davey, M. P., Nakahara, K., Tchorz, K., Kurtzberg, J., Hershfield, M. S., Haynes, B. F., Cohen, D. I., Waldmann, T. A,, and Kirsch, I. R. (1989a). Proc. N a t l . Acad. Sci. U.S.A.86,2031. Begley, C. G., Aplan, P. D., Denning, S. M., Haynes, B. F., Waldmann, T. A., and Kirsch, I. R. (198913).Proc. N a t l . Acad. Sci. U.S.A. 86, 10,128. Benjamin, M. B., and Little, J. B. (1992). Mol. Cell. Biol. 12, 2730. Benoist, C., and Mathis, D. (1992). Curr. Opinion fmmunol. 4, 156. Berinstein, N., Levy, S., and Levy, R. (1989). Science 244, 337. Bernard, O., Hozumi, N., and Tonegawa, S. (1978).Cell (Cambridge, Muss.) 15, 1133. Bernard, O., Larsen, C., Hampe, A., Mauchauffe, M., Berger, R., and Mathieu-Mahul, D. (1988). Oncogene 2, 195. Bernard, O., Gugliemi, P., Jonveaux, P., Cherif, D., Gisselbrecht, S., Mauchauffe, M., Berger, R., Larsen, C., and Mathieu-Mahul, D. (1990). Genes Chromosomes Cancer 1, 194. Bernard, O., Lecointe, N., Jonveaux, P., Souyri, M., Mauchauffe, M., Berger, R., Larsen, C. J., and Mathieu-Mahul, D. (1991). Oncogene 6, 1477. Biedermann, K. A., Sun, J., Giaccia, A. J., Tosto, T. M., and Brown, J. M. (1991).Proc. Nutl. Acad. Sci. U.S.A. 88, 1394. Bird, A. (1992). Cell (Cambridge, Mass.) 70,5. Blackwell, T. K., and Alt, F. W. (1984). Cell (Cambridge, Mass.) 37, 105. Blackwell, T. K., and Alt, F. W. (1989). Annu. Rev. Genet. 23, 605. Blackwell, T. K., Malynn, B. A,, Pollock, R. R., Ferrier, P., Covey, L. R., Fulop, G. M., Phillips, R. A., Yancopoulos, G. D., and Alt, F. W. (1989).E M B O J . 8, 735. Blasquez, V. (1994).In preparation. Blasquez, V. C., Xu, M., Moses, S. C., and Garrard, W. T. (1989).J . Biol. Chem. 264, 1183. Blomberg, B., Trauenecker, A,, Eisen, H., and Tonegawa, S. (1981). Proc. N a t l . Acad. Sci. U.S.A. 78, 3765. Boehni, T., and Rabbitts, T. H. (1989). FASEB J. 3, 2344. Boehni, T., Baer, R., Lavenir, I., Forster, A,, Waters, J. J., Nacheva, E., and Rabbitts, T. H. (1988).E M B O J . 7, 385. Boehm, T., Mengle-Gaw, L., Kees, R. R., Spurr, N., Lavenir, I., Forster, A., and Rabbitts, T. H . (1989).E M B O J . 8, 2621. Boehm, T., Gonzalez-Sarmiento, R., Kennedy, M., and Rabbitts, T. H. (1991). Proc. Nutl. Acad. Sci. U.S.A. 88, 3927. Bogue, M., Candeias, S., Benoist, C., and Mathis, D. (1991).E M B O J . 10, 3647. Bogue, M., Gilfillan, S., Benoist, C., and Mathis, D. (1992).Proc. N a t l . Acad. Sci. U.S.A. 89, 11,011, Bogue, M., Mossmann, H., Stauffer, U., Benoist, C., and Mathis, D. (1993). Eur. J . fmmunol. 23, 1185. Bonati, A,, Zanelli, P., Ferrari, S., Plebani, A., Starcich, B., Savi, M., and Neri, T. M. (1992). Blood 79, 1472. Borgulya, P., Kishi, H., Uematsu, Y. and von Boehrner, H. (1992). Cell (Cambridge, Mass.) 69, 529.
136
SUSANNA M. LEWIS
Born, W., Yagiie, J., Palmer, E., Kappler, J., and Marrack, P. (1985). Proc. Natl. Acad. Sci. U.S.A. 82, 2925. Bosma, M. J. (1992). Zmmunodefic. Reu. 3,261. Bosma, M. J., and Carroll, A. M. (1991). Annu. Reu. Zmmunol. 9, 323. Boubnov, N. V., Wills, Z. P., and Weaver, D. T. (1993). Mol. Cell. Biol., 13, 6957. Brandle, D., Burki, K., Wallace, V. A., Rohrer, U. H., Mak, T. W., Malissen, B., Hengartner, H., and Pircher, H. (1991). Eur. J. Zmmunol. 21, 2195. Breit, T. M., Mol, E. J., Wolvers-Tettero. I. L. M., Ludwig, W.-D., van Wering, E. R., and van Dongen, J. J. M. (1993).J . Exp. Med. 177, 965. Brodeur, P. H., Osman, G. E., Mackle, J. J., and Lalor, T. M. (1988).J. Exp. Med 168, 2261. Brown, L., Cheng, J.-T.,Chen, Q., Siciliano, M. J., Crist, W., Buchanan, G., and Baer, R. (1990).EMBOJ. 9,3343. Bruggemann, M., Spicer, C., Buluwela, L., Rosewell, I., Barton, S., Surani, M. A., and Rabbitts, T. H. (1991). Eur. J. Zmmunol. 21, 1323. Bruhn, S. L., Pil, P. M., Essigmann, J. M., Housman, D. E., and Lippard, S. J. (1992). Proc. Natl. Acad. Sci. U.S.A. 89,2307. Bucchini, D., Reynaud, C.-A., Ripoche, M.-A., Grimal, H., Jami, J., and Weill, J.-C. (1987).Nature (London)326,409. Burger, C., and Radbruch, A. (1990). Eur. J. Zmmunol. 20,2285. Campbell, J. J., and Hashimoto, Y. (1993).J . Zmmunol. 150, 1307. Carlson, L. M., Oettinger, M. A., Schatz, D. G., Masteller, E. L., Hurley, E. A., McCormack, W. T., Baltimore, D., and Thompson, C. B. (1991).Cell (Cambridge,Mass.) 64, 201. Carlsson, L., and Holmberg, D. (1990). Znt. Immunol. 2, 639. Carlsson, L., Overmo, C., and Holmberg, D. (1992). Eur. J. Zmmunol. 22, 71. Carroll, A. M., and Bosma, M. J. (1989). Curr. Top Microbiol. Zmmunol. 152, 63. Carroll, A. M., and Bosma, M. J. (1991). Genes Deu. 5, 1357. Carroll, A. M., Hardy, R. H., Petrini, J., and Bosma, M. J. (1989a).Cum. T o p . Microbiol. Zmmunol. 152, 118. Carroll, A. M., Hardy, R. R., and Bosma, M. J. (1989b).J . Znmunol. 143, 1087. Carroll, A. M., Slack, J. K., and Chang, W. (1993a). Mol. Cell. Biol. 13, 3632. Carroll, A. M., Slack, J. K., and Mu, X. (1993b).J. Zmmunol. 150, 2222. Chang, C., Biedermann, K. A., Mezzina, M., and Brown, J. M. (1993). Cancer Res. 53, 1244. Chang, L. M. S., and Bollom, F. J. (1986). CRC Crit. Reu. Biochem. 21, 27. Chen, J., and Alt, F. W. (1993). Curr. Opinion Zmmunol. 5, 194. Chen, J., Trounstine, M., Alt, F. W., Young, F., Kurahara, C., Loring, J. F., and Huszar, D. (1993a).Int. Zmmunol. 5,647. Chen, J.. Trounstine, M., Kurahara, C., Young, F., Kuo, C., Xu, Y., Loring, J. F., Alt, F. W., and Huszar, D. (1993b).EMBO J. 12, 821. Chien, Y., Iwashima, M., Kaplan, K. B., Elliott, J. F., and Davis, M. M. (1987a). Nature (London)327,677. Chien, Y., Iwashima, M., Wettstein, D. A,, Kaplan, K. B., Elliott, J. F., Born, W., and Davis, M. M. (1987b). Nature (London) 330, 722. Clark, S. P., Yoshikai, Y.,Taylor, S., Siu, G., Hood, L., and Mak, T. W. (1984) Nature (London)311,387. Cockerill, P. N. (1990). Nucleic Acids Res. 18,2643. Cook, W. D., and Balaton, A. M. (1987). Mol. Cell. Biol. 7, 266. Costa, T. E. F., Suh, H., and Nussenzweig, M. C. (1992). Proc. Natl. Acud. Sci. U.S.A. 89, 2205.
V(D)J JOINING
137
Covey, L. R., Ferrier, P., and Alt, F. W. (1990). Int. Immunol. 2, 579. Craig, N. L. (1988). Annu. Reo. Genet. 22, 77. Curnano, A,, and Paige, C. J. (1992). EMBOJ. 11, 593. Curnano, A., Furlonger, C., and Paige, C. J . (1993). Proc. Natl. Acad. Sci. U.S.A. 90, 6429. Daitch, L. E., Moore, M. W., Persiani, D. M., Durdik, J . M., and Selsing, E. (1992). I . Immunol. 149, 832. Dasgupta, U. B., and Lilly, F. (1988). Proc. Natl. Acud. Sci. U.S.A. 85, 3193. Davis, M. M., and Bjorkrnan, P. J. (1988). Nature (London) 334, 395. de Chasseval, R., and de Villartay, J.-P. (1993). Eur. J. Itnmunol. 23, 1294. Decker, D. J . , Boyle, N. E., and Klinman, N. €3. (1991).J. Immunol. 147, 1406. Deev, S. M., Cornbriato, G . , Klobeck, H., and Zachau, H. G. (1987). Nucleic Acids Res. 15, 1. Denny, C. T., Hollis, G. F., Hecht, F., Morgan, R., Link, M. P., Smith, S. D., and Kirsch, I. R. (1986). Science 234, 197. Desiderio, S., and Baltimore, D. (1984). Nature (London) 308, 860. Desiderio, S., and Wolff, K. (1988).J. Exp. Med. 167, 372. de Villartay, J.-P., Hockett, R. D., Coran, D., Korsrneyer, S . J . , and Cohen, D. I. (1988). Nature (London) 335, 170. de Villartay, J.- P., Mossalayi, D., de Chasseval, H., Dalloul, A., and Debri., P. (1991). l n t . Immunol. 3, 1301. Di Prirnio, R., Trubiani, O., and Bollurn, F. J. (1991). Histochemistry 96, 59. Disney, J. E., Barth, A. L., and Schultz, L. D. (1992). Cytogenet Cell Genet. 59,39. Dorshkind, K. (1990). Annu. Reo. Immunol. 8, 111. Dorshkind, K., and Witte, 0. N. (1987). Curr. Top. Microbiol. Immunol. 135, 23. Doyen, N., d’Anton, M. F., Bentolila, L. A., Nguyen, Q. T., and Rougeon, F. (1993). Nucleic Acids Res. 21, 1187. Drew, H. R . (1984).J . Mol. Biol. 176, 535. du Pasquier, L. (1992). APMIS 100, 383. Durdik, J., Moore, M. W., and Selsing, E. (1984). Nature (London) 307, 749. Early, P., and Hood, L. (1981). Cell (Cambridge, Mass.) 24, 1. Early, P., Huang, H., Calame, K. and Hood, L. (1980).Cell (Cambridge, Mass.) 19,981. Echols, H. (1990).J . Biol. Chem. 265, 14,697. Ehlich, A., Schaal, S., Gu, H., Kitamura, D., Muller, W., and Rajewsky, K. (1993). Cell (Cambridge, Mass.) 72, 695. Elliott, J., Rock, J . , Patten, P., Davis, M., and Chien, Y. (1988). Nuture (London) 331, 627. Engler, P., and Storb, U. (1987). Proc. Nutl. Acad. Sci. U.S.A. 84,4949. Engler, P., Roth, P., Kim, J. Y., and Storb, U. (199la).1.Immunol. 146, 2826. Engler, P., Haasch, D., Pinkert, C. A., Doglio, L., Glymour, M., Brinster, R., and Storb, U. (199lb). Cell (Cambridge, Moss.)65, 939. Engler, P., Klutz, E., arid Storb, U. (1992).J. E x p . Med 176, 1399. Engler, P., Weng, A., and Storb, U . (1993). Mol. Cell. B i d . 13, 571. Era, T., Ogawa, M., Nishikawa, S.-I., Okarnoto, M., Honjo, T., Akagi, K., and Yamarnura, K.-I. (1991). E M B O J . 10, 337. Faust, E. A., Saffran, K. C., Toksoz, D., Williams, D. A., and Witte, 0. N . (1993).J. Exp. Med. 177, 915. Feddersen, R., and Van Ness, B. V. (1989). Nucleic Acids Res. 17, 9797. Feddersen, R . , and Van Ness, 8.G. V. (1990). Mal. Cell. Biol. 10, 569. Feddersen, R. M., and Van Ness, B. G . (1985). Proc. Natl. Acad. Sci. U.S.A.82, 4793. Feeney, A. J . (1990).J . E x p . Med. 172, 1377.
138
SUSANNA M . LEWIS
Feeney, A. J. (1991a).J. E r p . Med. 174,115. Feeney, A. J. (1991b).J. Immunol. 147,4343. Feeney, A. J. (1992a). Int. Reu. Immunol. 8, 113. Feeney, A. J. (199213).J. Immunol. 149,222. Ferguson, S. E., and Thompson, C. B. (1993). Curr. Biol. 3, 51. Ferrier, P., Covey, L. R., Suh, H., Winoto, A., Hood, L., and Alt, F. W. (1989). Int. Immunol. 1,66. Ferrier, P., Covey, L. R., Li, S. C., Suh, H., Malynn, B. A., Blackwell, T. K., Morrow, M. A., and Alt, F. W. (1990a).J. Erp. Med. 171, 1909. Ferrier, P., Krippl, B., Blackwell, T. K., Furley, A. J. W., Suh, H., Winoto, A., Cook, W. D., Hood, L., Constantini, F., and Alt, F. W. (1990b). E M B O J . 9, 117. Finger, L. R., Kagan, J., Christopher, G., Kurtzberg, J., Hershfield, H. S., Nowell, P. C., and Croce, C. M. (1989). Proc. Natl. Acad. Sci. U.S.A.86, 5039. Fish, S., and Bosma, M. (1994). Submitted for publication. Fondell, J. D., and Marcu, K. B. (1992). Mol. Cell. Biol. 12, 1480. Ford, A. M., Bennet, C. A., Healy, L. E., Navarro, E., Spooncer, E., and Greaves, M. F. (1992). Proc. Natl. Acad. Sci. U.S.A.89, 3424. Freemont, P. S., Hanson, I. M., and Trowsdale, J. (1991). Cell (Cambridge, Mass.) 64, 483. Fujimoto, S., and Yamagishi, H. (1987). Nature (London) 327,242. Fulop, G . M., and Phillips, R. A. (1990). Nature (London) 347,479. Furokawa, T., Maruyama, S., Kawaishi, M., and Honjo, T. (1992). Cell (Cambridge, Mass.) 69, 1191. Fuscoe, J. C., Zimrnerman, L. J., Lippert, M. J., Nicklas, J. A., O’Neill, J. P., and Albertini, R. J. (1991). Cancer Res. 51, 6001. Fuscoe, J. C., Zirnmerman, L. J., Harrington, K., Burnette, L., Moore, M. M., Nicklaus, J. A., O’Neill, J. P., and Albertini, R. J. (1992). Mutat. Res. 283, 13. Canesh, A., North, P., and Thacker, J. (1993). Mutat. Res. 299,251. Garman, R. D., Doherty, T. J., and Raulet, D. H. (1986). Cell (Cambridge, Mass.) 45, 733. Gauss, G. H., and Lieber, M. R. (1992). Genes Deo. 6, 1553. Gauss, G. H., and Lieber, M. R. (1993). Mol. Cell. Biol. 13, 3900. Gellert, M. (1992a). Annu. Reu. Genet. 26,425. Gellert, M. (199213). Trends Genet. 8, 408. Gellert, M., and Nash, H. (1987). Nature (London) 325, 401. George, J. F., Jr., and Schroeder, H. W., Jr. (1992). J . Immunol. 148, 1230. Gerstein, R. M., and Lieber, M. R. (1993a). Genes Deo. 7, 1459. Cerstein, R. M., and Lieber, M. R. (1993b). Nature (London)363, 625. Gilfillan, S., Dierich, A., Lemeur, M., Benoist, C., and Mathis, D. (1993). Science 261, 1175. Godfrey, D. I., Kennedy, J., Suda, T., and Zlotnick, A. (1993). J. Immunol. 150, 4244. Goldman, J . P., Spencer, D. M., and Raulet, D. H. (1993).J. E x p . Med 177, 729. Goodhardt, M., Cavelier, P., Akimenko, M. A., Lutfalla, G., Babinet, C., and Rougeon, F. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 4229. Goodhardt, M., Cavelier, P., Doyen, N., Kallenbach, S., Babinet, C., and Rougeon, F. (1993). Eur. J . Immunol. 23, 1789. Greenberg, A., and Flajnik, R. F. (1994). In preparation. Greenberg, A., Steiner, L., Kasahara, M., and Flajnik, R. F. (1994). Proc. Natl. Acad. Sci. U.S.A., 90, 10603.
V(D)J J O I N I N C
139
Groettrup, M., Ungewiss, K., Azogui, O., Palacios, R., Owen, M. J . , Hayday, A. C., and von Boehmer, H. (1993).Cell (Cambridge, Mass.) 75, 283. Groettrup, M., Baron, A., Griffiths, G., Palacios, R., and von Boehmer, H. (1992).EMBO J . 11, 2735. Gu, H., Forster, I., and Rajewsky, K. (1990). E M B O J . 9, 2133. Gu, H., Kitaniura, D., and Rajewsky, K. (1991). Znmunol. Today 12, 420. Guthrie, C. (1991).Science 253, 157. Guy-Grand, D., Broecke, C. V., Briottet, C., Malassis-Seris, M., Selz, F., and Vassali, P. (1992).Eur. J . Zmmunol. 22, 505. Hagman, J., Rudin, C. M., Haasch, K., Chaplin, C . , and Storb, U. (1990).Genes Deu. 4, 978. Haire, H. N., Ohta, Y., Litman, R. T., Ameiniya, C . T., and Litman, G. W. (1991).Nucleic Acids Res. 19, 3061. Halligan, B. D., and Desiderio, S. V. (1987).Proc. N a t l . Acad. Sci. U.S.A. 84, 7019. Halligaii €3. D., Teng, M., and Guillianis, T. G. (1994). Submitted for publication. Haniaguchi, Y., Matsunami, N., Yamamoto, Y., and Honjo, T. (1989).Nucleic Acids Res. 17, 9015. Hamaguchi, Y., Yamamoto, Y., Iwanari, H., Maruyama, S., Furukawa, T., Matsunami, N., and Honjo, T. (1992).J . Biochem. 112, 314. Harada, K., and Yamagishi, H. (1991).J. E x p . Med. 173, 409. Harding, F. A., Cohen, N., and Litman, G. W. (1990).Nucleic Acids Res. 18, 1015. Hardy, R. R., Dangl, J . L., Hayakawa, K., Jager, G., Herzenberg, L. A., and Herzenberg, L. A. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 1438. Hardy, R. R., Carmack, C. E., Shinton, S . A,, Kemp, J. D., and Hayakawa, K. (1991). J . E x p . Med. 173, 1213. Harrington, J., and Lieber, M. (1994). EMBOJ. 13, in press. Harrington, J., Hsieh, C.-L., Gerton, J., Bosma, G., and Lieber, M. R. (1992).Mol. Cell. B i d . 12,4758. Hayashi, S . , Kunisada, T., Ogawa, M., Sudo, T., Kodama, H., Suda, T., Nishikawa, S., and Nishikawa, S. (1990).I . E x p . Med. 171, 1683. Heinrich, G., Traunecker, A., and Tonegawa, S. (1984).J. E x p . Med 159, 417. Henderson, A. J., Narayanan, R., Collins, L., and Dorshkind, K. (1992).J . Zmmunol. 149, 1973. Hendrickson, E. A., Schatz, D. G . , and Weaver, D. T. (1988). Genes Deu. 2, 817. Hendrickson, E. A., Schlissel, M. S., and Weaver, D. T. (1990).Mol. Cell. B i d . 10,5397. Hendrickson, E. A., Liu, V. F., and Weaver, D. T. (1991a).Mol. Cell. Biol. 11,3155. Hendrickson, E . A., Qin, S., Bump, E. A,, Schatz, D. G., Oettinger, M., and Weaver, D. T. (1991b). Proc. Natl. Acad. Sci. U.S.A. 88, 4061. Hesse, J . E., Lieber, M . R., Cellert, M., and Mizuuchi, K. (1987). Cell (Cambridge, Mass.) 49, 775. Hesse, J. E., Lieber, M. R., Mizuuchi, K., and Gellert, M. (1989). Genes Dev. 3, 1053. Heuze, F., Pardoll, D., Diez, E., Ezine, S., and Jotereau, F. (1992). Eur. J . Zmmunol. 22, 2077. Hieter, P. A., Korsmeyer, S. J., Waldniann, T. A., and Leder, P. W. (1981). Nature (London)290,368. Hinds-Frey, K. R., Nishikata, H., Litman, R. T., and Litman, G. W. (1993).J . E x p . Med. 178, 815. Hirayoshi, K., Nishikawa, S., Kina, T., Hatanaka, M., Habu, S., Nomura, T., and Katsura, Y. (1987). Eur. J . Zrnmunol. 17, 1051. Hochtl, J . , and Zachau, H. G. (1983).Nature (London)302,260.
140
SUSANNA M . LEWIS
Hoess, R., Wierzbicki, A., and Abremski, K. (1986). Nucleic Acids Res. 14, 2287. Hohman, V. H., Schluter, S. F., and Marchalonis, J. J. (1992). Proc. Natl. Acad. Sci. U.S.A. 89, 276. Holland, G. D., Ito, K., Kaehler, D. A,, Tonegawa, S., and Risser, R. (1991).Proc. Natl. Acad. Sci. U.S.A. 88,3700. Holman, P. 0.. Lacy, M. J., Roth, M. E., and Kranz, D. M. (1992). Zmmunogenetics 35, 33. Hope, T. J., Aguilera, R. J., Minie, M. E., and Sakano, H. (1986). Science 231, 1141. Hsieh, C.-L., and Lieber, M. R. (1992). E M B O J . 11, 315. Hsieh, C.-L., McCloskey, R. P., Radany, E., and Lieber, M. R. (1991). Mol. Cell. B i d . 11, 3927. Hsieh, C.-L., McCloskey, R. P., and Lieber, M. R. (1992).J.Biol. Chem. 267, 5613. Hsieh, C.-L., Arlett, C. F., and Lieber, M. R. (1993).J. Biol. Chem. 268, 20105. Huber, C., Klobeck, H., and Zachau, H. G. (1992). Eur. J. Immunol. 22, 1561. Hui, M. F., Lam, P., and Dosch, H.-M. (1989).J. Immunol. 143, 2470. Hunkapiller, T., and Hood, L. (1989).A d o . Immunol. 44, 1. Hurwitz, J . L., Samaridis, J., and Pelkonen, J. (1988). Cell (Cambridge, Mass.) 52,821. Ichihara, Y., Hayashida, H., Miyazawa, S., and Kurosawa, Y. (1989). Eur. J. Imniunol. 1849. Iglesias, A., Kopf, M., Williams, G. S., Buhler, B., and Kohler, G. (1991). E M B O J . 10, 2147. Ikuta, K., and Weissman, I . L. (1991).J. E x p . Med. 174, 1279. Itohara, S., Mombaerts, P., Lafaille, J.J., Iacomini, J., Nelson, A., Clarke, A. R., Hooper, M. L., Farr, A., and Tonegawa, S. (1993). Cell (Cambridge, Mass.) 72, 337. Iwashima, M., Green, A., Davis, M. M., and Chien, Y. (1988). Proc. N a t l . Acad. Sci. U.S.A. 85, 8161. Jeggo, P. A. (1990). M u t a t . Res. 239, 1 . Jeong, H. D., and Teale, J. M. (1989).J . Immunol. 143, 2752. Jorgensen, J. L., Reay, P. A., Ehrich, E. W., and Davis, M. M. (1992). Annu. Reu. rmmunoi. 10,835. Kabat, E. A,, Wu, T. T., Perry, H. M., Gottesman, K. S., and Foeller, C. (1991).“Sequences of Proteins of Immunological Interest.” U S .Department of Health and Human Services, Bethesda MD. Kalled, S. L., and Brodeur, P. H. (1990).J. E x p . Med 172, 559. Kallenbach, S., and Rougeon, F. (1992).Res. Immunol. 143, 873. Kallenbach, S., Doyen, N., D’Andon, M . F., and Rougeon, F. (1992). Proc. Natl. Acad. Sci. U.S.A. 89,2799. Kallenbach, S., Brinkmann, T., and Rougeon, F. (1993). I n t . Immunol. 5, 231. Kallenbach, S., Babinet, C., Pournin, S., Cavelier, P., Goodhardt, M., and Rougeon, F. (1993).E u r . 1 . Immuttol. 23, 1917. Kasai, M., Maziarz, R. T., Aoki, K., Macintyre, E., and Strominger, J. L. (1992). Mol. Cell. B i d . 12, 4751. Katamine, S., Otsu, M., Tada, K., Tsuchiya, S., Sato, T.. Ishida, N., Honjo, T., and Ono, Y. (1984).Nature (London) 309, 369. Kataoka, T., Kondo, S., Nishi, M., Kodaira, M., and Honjo, T. (1984).Nucleic Acids Res. 12, 5995. Kaushik, A., Schulze, D. H., Bona, C., and Kelsoe, G. (1989).J.E x p . Med 169, 1859. Kawaichi, M., Oka, C., Reeves, R., Kinoshita, M. and Honjo, T. (1991).J. Biol. Chem. 226,8387. Kee, B. L., Cumano, A., Iscove, N . N., and Paige, C. J. (1994). Znt. Immunol. 6, in press.
V(D)J J O I N I N G
141
Kelley, D. E., Wiedemann, L. M., Pittet, A,, Strauss, S., Nelson, K. J., Davis, J., Van Ness, B., and Perry, R. P. (1985). Mol. Cell. B i d . 5, 1660. Kenter, A. L., and Tredup, J . (1991). Mol. Cell. Biol. 11, 4398. Kienker, L. J., Kuziel, W. A., Garni-Wagner, B. A., Kuniar, V., and Tucker, P. W. (1991a). J. Zmmunol. 147, 4351. Kienker, L. J., Kuziel, W. A., and Tucker, P. W. (1991b).J. E x p . Med. 174, 169. Kim, M. G., Schuler, W., Bosnia, M. J.. and hlarcu, K. B. (1988).J. Immunol. 141, 1341. Kleinfield, R. W., and Weigert, M. G. (1989).J. Zmmunol. 142,4475. Kleinfield, R., Hardy, R. R., Tarlinton, D., Dangl, J., Herzenberg, L. A,, and Weigert, M. (1986).Nature (London)322, 843. Klobeck, H., and Zachau, H. G. (1986).Nucleic Acids Res. 12, 4591. Klobeck, H . , Adolph, S., Hanieister, H . , and Zachau, H. G . (1988). Nucleic Acids Res. 16, 6243. Kobayashi, Y., Tycko, B., Soreng, A. L., and Sklar, J. (1991).J.Zmmunol. 147, 3201. Kofler, R.., Duchosal, M. A,, and Dixon, F. J. (1989).Zmmunogenetics 29, 65. Kokubu, F., Litman, R., Shaniblott, M. J., Hinds, K., and Litman, G. W. (1988). E M B O J. 11, 3413. Komori, T., Sugiyama, H., and Kishinioto, S. (1989).J . Zmmunol. 143, 1040. Komori, T., Okada, A,, Stewart, V., and Alt, F. W. (1993).Science 261, 1171. Koop, B. F., Wilson, R. K., Wang, K., Vernooij, B., Zaller, D., Kuo, C. L., Seto, D., Toda, M., and Hood, L. (1992). Genomics 13, 1209. Korman, A. J., Maruyama, J., and Raulet, D. H . (1989).Proc. Natl. Acad. Sci. U.S.A. 86, 267. Korsmeyer, S. J . (1992).Annu. Reo. Immunol. 10, 785. Kotloff, D. B., Bosma, M. J., and Ruetsch, N. R. (1993a). Znt. Zmmunol. 5, 383. Kotloff, D. B., Bosma, M. J . , and Ruetsch, N. R. (1993b).J . E x p . Med. 178, 1981. Kottman, A. H., Brack, C., Eibel, H., and Kohler, G . (1992).Eur. J. Zmmunol. 22, 2113. Kronenberg, M., Governian, J., Haars, R., Malissen, M., Kraig, E., Delovitch, L. P. T., Suciu-Foca, N., and Hood, L. (1985).Nuture (London) 311, 647. Krowczynska, A. M., Rudders, R. A., and Krontris, T. G. (1990). Nucleic Acids Res. 18, 1121. Kubagawa, H., Cooper, M. D., Carroll, A. J., and Burrows, P. D. (1989). Proc. N a t l . Acad. Sci. U.S.A. 86, 2356. Kurosawa, Y., and Tonegawa, S. (1982).J.E x p . Med 155, 201. Kurosawa, Y., von Boehmer, H.. Haas, W., Sakano, H., Traunecker, A,, and Tonegawa, S . (1981).Nuture (London)290, 565. Lafaille, J. J., DeCloux, A , , Bonneville, M., Takagaki, Y., and Tonegawa, S . (1989).Cell (Cambridge, M o s s . ) 59, 859. Lai, E., Wilson, R. K., and Hood, L. E. (1989). Ado. Zmniuno!. 46, 1. Landau, N. H., Schatz, D. G., Rosa, M., and Baltimore, D. (1987). M o l . Cell. Biol. 7, 3237. Landy, A. (1989).Annu. Reo. Biochem. 58, 913. Larsen, C., Bernard, O., and Mathieu-Mahul, D. (1993).Bull. Znst. Pusteur 91, 17. Lauster, R., Reynaud, C.-A,, Mirtensson, I.-L., Peter, A , , Bucchini, D., Jami, J.. and Weill, J.-C. (1993).E M B O J . 12, 4615. Lautner-Rieske, A., Huber, C., Meindl, A , , Pargent, W., Shable, K. F.,Thiebe, R., Zocher, I., and Zachau, H. G. (1992). Eur. J . Zmmunol. 22, 1023. Lauzurica, P., and Krangel, M. S. (1994).J. Exp. Med., in press. Lawler, A. M., Umar, A,, and Gearhart, P. J. (1992).Mol. Zmmunol. 29, 295. Leclercq, L., Butkeraitis, P., and Reth, M. (1989).Nucleic Acids Res. 17, 6809.
142
SUSANNA M. LEWIS
Lefranc, M.-P., Chuchana, P., Dariavich, P., Nguyen, C., Huck, S., Brockly, F., Jordan, B., and Lefranc, G. (1989). Eur. J . Zmmunol. 19, 989. Leiden, J. M. (1993). Annu. Reu. Zmmunol. 11, 539. Lennon, G. G., and Perry, R. P. (1990).J . Zmmunol. 144, 1983. Lewis, S., and Gellert, M. (1989). Cell (Cambridge, Mass.) 58, 585. Lewis, S., Rosenberg, N., Alt, F., and Baltimore, D. (1982). Cell (Cambridge, Mass.) 30, 807. Lewis, S., Gifford, A,, and Baltimore, D. (1984). Nature (London) 308, 425. Lewis, S., Gifford, A., and Baltimore, D. (1985). Science 228, 677. Lewis, S., Hesse, J. E., Mizuuchi, K., and Gellert, M. (1988). Cell (Cambridge, Mass.) 55, 1099. Lewis, S. M. (1994). Proc. Natl. Acad. Sci. U.S.A. 91, 1332. Lewis, S . M., and Hesse, J. E. (1991). EMBO]. 10,3631. Li, M., Morzycka-Wroblewska, E., and Desiderio, S. V. (1989). Genes Deu. 3, 1801. Lichten, M., and Haber, J. E. (1989). Genetics 123, 261. Lieber, M. R. (1991). FASEBJ. 4, 2934. Lieber, M. R. (1992). Cell (Cambridge, Mass.) 70, 873. Lieber, M. R., Hesse, J . E., Mizuuchi, K., and Gellert, M. (1987). Genes Dev. 1, 751. Lieber, M. R., Hesse, J. E., Mizuuchi, K., and Gellert, M. (1988a). Proc. Natl. Acad. Sci. U.S.A.85, 8588. Lieber, M. R., Hesse, J. E., Lewis, S., Bosma, G. C., Rosenberg, N. R., Mizuuchi, K., Bosma, M. J.,and Gellert, M. (1988b). Cell (Cambridge, Mass.) 55, 7. Lieber, M. R. (1993). In “The Causes and Consequences of Chromosomal Aberrations,” (I. R. Kirsch, ed.), p. 239. CRC Press, Ann Arbor. Limpens, J . , de Jong, D., van Kreiken, J. H. J. M., Price, C. G. A., Young, B. D., van Ommen, G., and Kluin, P. M. (1991). Oncogene 6,2271. Lin, W.-C., and Desiderio, S. (1993). Science 260, 953. Lindahl, T., and Barnes, D. E. (1992). Annu. Reu. Biochem. 61,251. Lipkowitz, S., Stern, M., and Kirsch, I. R. (1990).J . E x p . Med. 172,409. Lipkowitz, S . , Carry, V. F., and Kirsch, I. R. (1992). Proc. Natl. Acad. Sci. U.S.A. 89, 5301. Litman, C . W., Rast, J . P., Hulst, M. A., Litman, R. T., Shamblott, M. J., Haire, R. N., Hinds-Frey, K. R., Buell, R. D., Margittai, M., Ohta, Y., Zilch, A. C., Good, R. A., and Amemiya, C. T. (1992). Prog. Zmmunol. 8, 107. Litman, G. W., Rast, J. P., Shamblott, M. J., Haire, R. N., Hulst, M., Roess, W., Litman, R. T., Hinds-Frey, K. R., Zilch, A., and Amemiya, C. T. (1993). Mol. Biol. Euol. 10, 60. Lorenz, W., Schable, K. F., Thiebe, R., Stavnezer, J., and Zachau, H. G. (1988). Mol. Zmmunol. 25,479. Lotscher, E., Grzeschik, K., Bauer, H. G., Pohlenz, H., Straubinger, B., and Zachau, H. G. (1986). Nature (London) 320,456. Lu, M., Zhang, N., Raimondi, S., and Ho, A. D. (1991). Nucleic Acids Res. 20, 263. Ma, A., Fisher, R., Dildrop, R., Oltz, E., Rathbun, G., Achacoso, P., Stall, A., and Alt, F. W. (1992). EMBO J . 11, 2727. Macintyre, E. A., Smit, L., Ritz, J., Kirsch, I. R., and Strominger, J. L. (1992). Blood 80, 1511. Madrenas, J., Pazderka, F., Parfrey, N. A., and Halloran, P. F. (1992).J . Zmmunol. 148, 612. Maeda, T., Sugiyama, H., Tani, Y.,Miyake, S., Oka, Y., Ogawa, H., Komori, T., Soma, T., and Kishimoto, S. (1987).J . Zmmunol. 138, 2305.
V(D)J JOINING
143
Magrath, I. (1992). Cancer Res. 52,5529. Malissen, M., McCoy, C., Blanc, D., Trucy, J., Devaux, C., Schmitt-Verhulst, A., Fitch, F., Hood, L., and Malissen, B. (1986). Nature (London)319, 28. Malissen, M., Trucy, F., Jouvin-Marche, E., Cazenave, P., Scollay, R., and Malissen, B. (1992). Zmmunol. Today 13,315. Mallick, C. A., Dudley, E. C., Viney, J. L., Owen, M. J., and Hayday, A. C. (1993).Cell (Cambridge, Mass. ) 73, 513. Malynn, B. A,, Blackwell, T. K., Fulop, G. M., Rathbun, G. A., Furley, A. J . W., Ferrier, P., Heinke, L. B., Phillips, R. A., Yancopoulos, G. D., and Alt, F. W. (1988). Cell (Cambridge, Mass.) 54, 453. Malynn, B. A., Yancopoulos, G. D., Barth, J. E., Bona, C. A., and Alt, F. W. (1990). J . Erp. Med 171,843. Manser, T. (1990). Mol. Immunol. 27,503. Mansikka, A., and Toivanen, P. (1991).Scand. ]. Immunol. 33, 543. Marolleau, J., Fondell, J. D., Malissen, M., Trucy, J., Barbier, E., Marcu, K. B., Cazenave, P., and Primi, D. (1988). Cell (Cambridge, Mass.) 55, 291. Martin, D., Huang, R., LeBien, T., and Van Ness, B. (1991).J. Erp. Med 173,639. Matsuda, F., Lee, K. H., Nakai, S., Sato, T., Kodaira, M., Zong, S. Q., Ohno, H., Fukuhara, S., and Honjo, T. (1988). EMBO]. 7, 1047. Matsuda, F., Shin, E. K., Hirabayashi, Y., Nagaoka, H., Yochida, M. C., Zong, S . Q., and Honjo, T. (1990). EMBO J. 9,2501. Matsunami, N., Hamaguchi, Y., Yamamoto, Y., Kuze, K., Kanagawa, K., Matsuo, H., Kawaichi, M., and Honjo, T. (1989). Nature (London)342, 934. Matsuoka, M., Nagawa, F., Okazaki, K., Kingsbury, L., Yoshida, K., Muller, U., Larue, D. T., Winer, J. A., and Sakano, H. (1991). Science 254,81. Max, E. E., Seidman, J . G., and Leder, P. (1979). Proc. Natl. Acad. Sci. U.S.A. 76, 3450. Max, E. E., Seidman, J. G., Miller, H., and Leder, P. (1980).Cell (Cambridge, Mass.) 21, 793. McCormack, W. T., Tjoelker, L. W., Carlson, L. M., Petryniak, B., Barth, C., Humphries, E., and Thompson, C. B. (1989). Cell (Cambridge, Mass.) 56, 785. McCormack, W. T., Tjoelker, L. W., Stella, G., Postema, C. E., and Thompson, C. B. (1991a).Proc. Natl. Acad. Sci. U.S.A. 88, 7699. McCormack, W. T., Tjoelker, L. W., andThompson, C. B. (1991b).Annu. Reu. Zmmunol. 9, 219. McVay, L. D., Carding, S . R., Bottomly, K., and Hayday, A. C. (1991).EMBO]. 10,83. Medina, C. A,, and Teale, J. M. (1993).J.Erp. Med. 177, 1317. Meek, K. (1990). Science 250, 820. Meek, K., Hasemann, C. A., and Capra, J. D. (1989).]. Erp. Med. 170,39. Meier, J. T., and Lewis, S. M. (1993).Mol. Cell. Biol. 13, 1078. Melchers, F., Karasuyama, H., Haasner, D., Bauer, S., Kudo, A., Kakaguchi, N., Jameson, J., and Rolink, A. (1993). Immunol. Today 14, 60. Menetski, J. P., and Gellert, M. (1990).Proc. Natl. Acad. Sci. U.S.A. 87, 9324. Meyn, M. S . (1993).Science 260, 1327. Misener, V., Downey, G. P., and Jongstra, J. (1991). Znt. Immunol. 3, 1129. Miyake, S., Sugiyama, H., Tani, Y., Fukuda, T., and Kishimoto, S. (1990).J. Zmmunogenet. 17, 67. Mizuuchi, K. (l992a).]. Biol. Chem. 267, 21,273. Mizuuchi, K. (1992b). Annu. Reu. Biochem. 61, 1011. Mombaerts, P., Clarke, A. R., Rudnick, M. A,, Iacomini, J., Itohara, S., Lafaille, J . J.,
144
SUSANNA M. LEWIS
Wang, L., Ichikawa, Y.,Jaenisch, R., Hooper, M. L., andTonegawa, S. (1992a).Nature (London)360,225. Mombaerts, P., Iacomini, J., Johnson, R. S., Herrup, K., Tonegawa, S., and Papaioannou, V. E. (1992b). Cell (Cambridge, Mass.) 68,869. Moore, M . W., Durdik, J., Persiani, D. M., and Selsing, E. (1985). Proc. Natl. Acad. Sci. U.S.A.82, 6211. Mortari, F., Newton, J. A., Wang, J. Y., and Schroeder, H. W. Jr. (1992).Eur.J.Zmmunol. 22, 241. Morzycka-Wroblewska, E., Lee, F. E. H., and Desiderio, S. V. (1988). Science 242,261. Mouthon, M . A., Bernard, O., Mitjavila, M. T., Romeo, P., Vainchenker, W., and MathieuMahul, D. (1993). Blood 81,647. Muegge, K., Vila, M. P., and Durum, S. K. (1993a). Science 261, 93. Muegge, K., West, M., and Durum, S. K. (1993b).Proc. Natl. Acad. Sci. U.S.A.90,4151. Muller, B., Stappert, H., and Reth, M. (1990). Eur. J. Immunol. 20, 1409. Murray, A. W. (1992).Nature (London) 359,599. Nadel, B., Cazenave, P., and Sanchez, P. (1990). EMBOJ. 9, 435. Nash, H. A. (1990). Trends Biochem. 15,222. Nemazee, D. (1992). Res. Immunol. 143, 272. Neri, A., Barriga, F., Knowles, D. M., Magrath, I. T., and Dalla-Favera, R. (1988). Proc. Natl. Acad. Sci. U.S.A. 85, 2748. Nickerson, K. G., Berman, J., Glickman, E., Chess, L., and Alt, F. W. (1989).J . E x p . Med. 169, 1391. Oettinger, M. A. (1992). Trends Genet. 8,413. Oettinger, M. A., Schatz, D. G., Gorka, C., and Baltimore, D. (1990). Science 248, 1517. Oettinger, M. A., Stanger, B., Schatz, D. G., Glaser, T., Call, K., Housman, D., and Baltimore, D. (1992).Immunogenetics 35, 97. Ohashi, P. S., Wallace, V. A,, Broughton, H., Ohashi, C. T., Ferrick, D. A., Jost, V., Mak, T. W., Hengartner, H., and Pircher, H. (1990). Eur. J . Immunol. 20, 517. Oka, Y., Sugiyania, H., Tsukada, S., and Kishimoto, S. (1990).J . Immunol. 145, 361. Okazaki, K., Davis, D. D., and Sakano, H. (1987). Cell (Cambridge, Mass.) 49, 477. Okazaki, K., Nishikawa, S., and Sakano, H. (1988).J.Immunol. 141, 1348. Oltz, E. M., Alt, F. W., Lin, W.-C., Chen, J., Taccioli, G., Desiderio, S., Rathbun, G. (1993). Mol. Cell. B i d 13, 6223. Osman, G. E., Brodeur, P. H., Rosenberg, N., and Wortis, H. H. (1992).J. Immunol. 148, 1928. Osmond, D. G. (1993). Immunol. Today 14,34. Osmond, D. G., Kim, N., Manoukian, R., Phillips, R. A., Rico-Vargas, S. A., and Jacobsen, K. (1992).Blood 79, 1695. Palacios, R., and Samaridis, J. (1992). Mol. Cell. Biol. 12, 518. Palacios, R., and Samaridis, J. (1993). Blood 81, 1222. Pandey, A., Tjoelker, L. W., and Thompson, C. B. (1993).J . E x p . Med. 177, 329. Pandey, V. N., Dave, V. P., and Patil, M. S. (1989). Mol. Biol. Rep. 13, 179. Pandey, V. N., Dave, V. P., Amrute, S. B., Rosenbach, K., and Modak, M. J. (1991). Biochem. Biophys. Res. Commun. 181, 95. Pargent, W., Meindl, A., Thiebe, R., Mitzel, S., and Zachau, H. G. (1991). Eur. J. Immunol. 21, 1821. Parker, C. N., and Halford, S. E. (1991). Cell (Cambridge,Mass.) 66, 781. Parvari, R., Avivi, A., Lentner, F., Ziv, E., Tel-Or, S., Burstein, Y., and Schechter, I. (1988).EMBO J . 7, 739. Pennycook, J. L., Chang, Y. T., Celler, J., Phillips, R. A., and Wu, G. E. (1993).J. E x p . Med., 178, 1007.
V(D)J JOINING
145
Pergola, F., Zdzienicka, M. Z., and Lieber, M. (1993).Mol. Cell. Biol. 13,3464. Perlmutter, R. M., Kearney, J. F., Chang, S. P., and Hood, L. E. (1985). Science 227, 1597. Persiani, D. M., and Selsing, E. (1989). Nucleic Acids Res. 17, 5339. Persiani, D. M., Durdik, J., and Selsing, E. (1987).J. E x p . Med. 165, 1655. Petrini, J. H., Carroll, A. M., and Bosnia, M. J . (1990).Proc. Natl. Acad. Sci. U.S.A. 87, 3450. Petrini, J . H., Donovan, J. W., Dimare, C., and Weaver, D. T. (1994).J. Immunol. 152, 176. Pfeiffer, P., and Vielmetter, W. (1988).Nucleic Acids Res. 16, 907. Pfeiffer, P., Thode, S., Hancke, J., and Vielmetter, W. (1993). Submitted for publication. Philpott, K. L., Viney, J. L., Kay, G., Rastan, S., Gardiner, E. M., Chae, S., Hayday, A. C., and Owen, M . J. (1992). Science 256, 1448. Prinii, D., Clynes, R. A., Jouvin-Marche, E., Marolleau, J.-P., Barbier, E., Cazenave, P.-A., and Marcu, K. B. (1988).Eur. J. Zmmunol. 18, 1101. Pryciak, P. M., Sil, A,, and Varmus, H. E. (1992).E M B O J . 11, 291. Puchta, H., Kocher, S., and Hohn, B. (1992). Mol. Cell. B i d . 12, 3372. Qian, X.-H., Inman, R. B., and Cox, M. M. (1992).J . Biol. Chem. 267, 7794. Raaphorst, F. M., Timmers, E., Kenter, M. J. H., Van Tol, M . J. D., Vossen, J. M., and Schuurman, R. K. B. (1992).Eur. J . Zmmunol. 22, 247. Rabbitts, T. H. (1991).Cell (Cumbridge, Mass.) 67, 641. Radic, M. Z., Erikson, J., Litwin, S., and Weigert, M . (1993).J . E x p . Med. 177, 1165. Ramakrishnan, L., and Rosenberg, N. (1’388). M o l . Cell. B i d . 8, 5216. Ramsden, D. A., and Wu, G. E. (1991).Proc. Nutl. Acad. Sci. U.S.A. 88, 10,721. Ramsden, D. A,, and Wu, G . E. (1992). Res. Immunol. 143, 811. Rast, J . P., Hulst, M. A., Ota, T., Litman, R. T., Margiltai, M., Shamblolt, M., and Litman, G . W. (1994).Zmmunogenetics, in press. Rathburn, G., Oltz, E. M., and Alt, F. W. (1993).Znt. Zmmunol. 5, 997. Raulet, D. H . (1989).Annu. Bet;. Zmmrcnol. 7, 17.5. Raulet, D. H., Garman, R. D., Saito, H., and Tonegawa, S. (1985).Nature (London)314, 103. Raulet, D. H., Spencer, D. M., Hsiang, Y.-H., Goldman, J. P., Bix, M., Liao, N.-S., Zijlstra, M., Jaenisch, R., and Correa, I. (1991). Zmmunol. Reo. 120, 185. Razin, A., and Cedar, H. (1991).Microbiol. Rez;. 55, 451. Reichman-Fried, M . , Bosma, M. J., and Hardy, R. R. (1993).Znt. Zmmunol. 5, 303. Reilly, R. B., Blomberg, B., Imanishi-Kari, T., Tonegawa, S., and Eisen, H. N . (1984). Proc. N a t l . Acud. Sci. U.S.A. 81(2484), Reis, M . D., Griesser, H., and Mak, T. W. (1991).Biochim. Biophys. Acta 1072, 177. Reth, M . (1992).Annu. Reo. Immunol. 10, 97. Reth, M . G., and Alt, F. W. (1984).Nature (London) 312, 418. Reth, M . G . , Ammirati, T., Jackson, S., and Alt, F. (1985). Nature (London) 317, 353. Reth, M. G . , Jackson, S . , and Alt, F. W. (1986a). E M B O J . 5,2131. Reth, M., Gehrmann, R., Petrac, E., and Wiese, P. (1986b). Nature (London) 322, 840. Reth, M . , Petrac, E., Wiese, P., Lobel, L., and Ah, F. W. (1987). E M B O J . 6, 3299. Reynaud, C.-A,,Anquez, V., Dahan, A,, and Weill, J.-C. (1985).Cell (Cambridge, Mass.) 40, 283. Reynaud, C.-A., Anquez, V., Grimal, H., and Weill, J.-C. (1987).Cell (Cambridge, Mass.) 48, 379. Reynaud, C.-A,, Dahan, A,, Anquez, V., and Weill, J.-C. (1989a). In “The Immunoglobulin Genes” (T. Honjo, F. W. Alt, and T. H. Rabbitts, eds.), p. 151. Academic Press, New York.
146
SUSANNA M. LEWIS
Reynaud, C.-A,, Dahan, A,, Anquez, W., and Weill, J.-C. (1989b). Cell (Cambridge, Mass.) 59, 171. Reynaud, C.-A., Anquez, V., and Weill, J.-C. (1991).Eur. J. Zmmunol. 21,2661. Reynaud, C.-A., Imhof, B. A., Anquez, V., and Weill, J.-C. (1992).EMBOJ. 11, 4349. Ribas-Aparicio, R. M., Sparkowski, J. J., Proulx, A. E., Mitchell, J. D., and Klobutcher, L. A. (1987).Genes Deu. I, 323. Robinson, E. K., Cohen, P. D., and Blackburn, E. H. (1989). Cell (Cambridge, Mass.) 58, 887. Robinson, M. A., Mitchell, M. P., Wei, S., Day, C. E., Zhao, T. M., and Concannon, P. (1993). Proc. Natl. Acad. Sci. U.S.A.90,2433. Rolink, A., and Melchers, F. (1991).Cell (Cambridge, Mass.) 66, 1081. Rolink, A., and Melchers, F. (1993).Curr. Opinion Zmmunol. 5, 207. Rolink, A., Kudo, A., Karasuyama, H., Kikuchi, Y., and Melchers, F. (1991).EMBOJ. 10,327. Rosenberg, N. (1991). Semin. Virol. 2, 365. Rosenberg, N., and Witte, 0. N. (1988).Adu. Virus Res. 35,38. Roth, D. B., and Wilson, J. H. (1986).Mol. Cell. Biol. 6,4295. Roth, D., and Wilson, J. (1988). In “Genetic Recombination” (R. Kucherlapati and G. R. Smith, eds.), p. 621. American Society for Microbiology, Washington, DC. Roth, D. B., Porter, T. N., and Wilson, J. H. (1985).Mol. Cell. Biol. 5, 2599. Roth, D. B., Chang, X.-B., and Wilson, J. (1989). Mol. Cell. Biol. 9,3049. Roth, D. B., Proctor, G. N., Stewart, L. K., and Wilson, J. H. (1991).Nucleic Acids Res. 19, 7201. Roth, D. B., Menetski, J. P., Nakajima, P., Bosma, M. J., and Gellert, M. (1992a).Cell (Cambridge, Mass.) 70, 983. Roth, D. B., Nakajima, P. B., Menetski, J. P., Bosma, M. J., and Gellert, M. (199213). Cell (Cambridge, Mass.) 69, 41. Roth, D. B., Zhu, C., and Gellert, M. (1993). Proc. Natl. Acad. Sci. U.S.A. 90, 10788. Roth, M. E., Lacy, M. J., McNeil, L. K., and Kranz, D. M. (1988).Science 241, 1354. Roth, M. E., Lacy, M. J., McNeil, L. K., and Kranz, D. M. (1989).Science 245, 1032. Roth, M. E., Holman, P. O., and Kranz, D. M. (1991).J. Zmmunol. 147, 1075. Roth, M. E., Tjoa, B. A., Schlueter, C. J., Wilson, E. R., Lunn, B. C., and Kranz, D. M. (1992).Mol. Zmmunol. 29, 1447. Roth, M. S., Weiner, G. J., Allen, E. A., Terry, V. H., Harnden, C. E., Boehnke, M., Kaminski, M. S., and Ginsburg, D. (1990). J . Zmmunol. 145, 768. Rothenberg, E., and Triglia, D. (1983).J. Zmmunol. 130, 1627. Rothenberg, E. V. (1990).Zmmunol. Today 11, 116. Rothenberg, E. V. (1992).Adu. Zmmunol. 51, 85. Rothenberg, E. V., Chen, D., and Diamond, R. A. (1993).J. Zmmunol., 151, 3530. Rusconi, S. (1991).Erperientia 47, 866. Sadowski, P. (1986).J. Bacteriol. 165, 341. Sakano, H., Huppi, K., Heinrich, G., and Tonegawa, S. (1979).Nature (London) 280, 288. Sakano, H., Maki, R., Kurosawa, Y., Roeder, W., and Tonegawa, S. (1980).Nature (London) 286,676. Sakano, H., Kurosawa, Y., Weigert, M., and Tonegawa, S. (1981).Nature (London)290, 562. Sanchez, P., Nadel, B., and Cazenave, P.-A. (1991).Eur. J. Zmmunol. 21, 907. Sanz, I. (1991).J. Zmmunol. 147, 1720. Sauer, B. (1992).J. Mol. Biol. 223, 911.
V(D)J JOINING
147
Sawyers, C. L., Denny, C. T., and Witte, 0. N. (1991).Cell (Cambridge,Mass.) 64,337. Schatz, D. G., and Baltimore, D. (1988).Cell (Cambridge, Mass.) 53, 107. Schatz, D. G., and Chun, J . J . M. (1992). New Biol. 4, 188. Schatz, D. G., Oettinger, M. A., and Baltimore, D. (1989).Cell (Cambridge, Mass.) 59, 1035. Schatz, D. G., Oettinger, M. A,, and Schlissel, M. S. (1992). Annu. Reo. Zmmunol. 10, 359. Schlissel, M., Voronova, A., and Baltimore, D. (1991). Genes Deo. 5, 1367. Schlissel, M. S., and Baltimore, D. (1989). Cell (Cambridge, Mass.) 58, 1001. Schlissel, M. S., Corcoran, L. M., and Baltimore, D. (1991).J . E x p . Med. 173, 711. Schlissel, M . S., Constantinescu, A , , Murrow, T., Baxter, M., and Peng, A. (1993).Genes Dea. 7, 2520. Schroeder, H. W. Jr., and Wang, Y. Y. (1990).Proc. Natl. Acad. Sci. U.S.A.87,6146. Schroeder, H. W. Jr., Hillson, J . L., and Perlmutter, R. M . (1987).Science 238, 791. Schroeder, H. W. Jr., Hillson, J. L., and Perlmutter, R. M. (1989).Int. lmmunol. 2, 41. Schuler, W., Weiler, 1. J., Schuler, A,, Phillips, R. A,, Rosenberg, N., Mak, T. W., Kearney, J . F., Perry, R. P., and Bosma, M. J. (1986). Cell (Cambridge, Mass.) 46, 963. Schuler, W., Schuler, A,. and Bosma, M. J. (1990). Eur. J . lmmunol. 20, 545. Schuler, W., Reutsch, N . R., Amsler, M., and Bosma, M. J. (1991).E u r . J .lmmunol. 21, 589. Schwager, J., Burckert, N., Courtet, M., and Du Pasquier, L. (1991).E M B O J . 10,2461. Schwartzberg, P. L., Stall, A. M., Hardin, J. D., Bowdish, K. S., Humaran, T., Boast, S., Harbison, M. L., Robertson, E. J., and Goff, S. P. (1991).Cell (Cambridge,Mass.) 65, 1165. Seidrnan, J. G., Nau, M. M., Norman, B., Kwan, S., Scharff, M., and Leder, P. (1980). Proc. Natl. Acad. Sci. U.S.A.77, 6022. Sell, S . M. (1992).Comput. Chem. 12, 125. Senecoff, J., and Cox, M. (1986).J . B i d . Chem. 261, 7380. Serre, M., Evans, B. R., Araki, H., Oshinia, Y., and Jayararn, M. (1992).J.M o l . Biol. 225, 621. Serwe, M., and Sablitzky, F. (1993).E M B O J . 12,2321. Shapiro, A. M., Schlissel, M. S., Baltimore, P., and DeFranco, A. L. (1993).Mol . Cell. Biol. 13, 5679. Shapiro, M . A., and Weigert, M . (1987).1. lmmunol. 139, 3834. Sheehan, K. M., and Lieber, M. R. (1993). Mol. Cell. B i d . 13, 1363. Shimizu, T., Iwasato, T., and Yamagishi, H. (1991).J . E x p . Med 173, 1065. Shimizu, T., Takeshita, S., Muto, M . , Kubo, E., Sado, T., and Yamagishi, H. (1993). Znt. Zmmunol. 5, 155. Shin, E. K., Matsuda, F., Fujikura, J., Akamizu, T., Sugawa, H., Mori, T., and Honjo, T. (1993). Eur. J . Zmmunol. 23, 2365. Shinkai, Y., Rathbun, G . ,Lam, K.-P., Oltz, E. M., Stewart, V., Mendelsohn, M., Charron, J., Datta. M., Young, F., Stall, A. M., and Alt, F. W. (1992).Cell (Cambridge, Mass.) 68, 855. Shirakata, M., Huppi, K., Usuda, S., Okazaki, K., Yoshida, K., and Sakano, H. (1991). M o l . Cell. Biol. 11, 4528. Shirasawa, T., Miyazoe, I., Hagiwara, S., Kimoto, H., Shigemoto, K., Taniguchi, M., and Takemori, T. (1992).J . E r p . Med. 176, 1209. Shirasawa, T., Ohnishi, K., Hagiwara, S., Shigemoto, K., Takebe, Y., Rajewsky, K., and Takemori, T. (1993). E M B O J . 12, 1827. Siden, E. J. (1993).J . Immunol. 150,4427.
148
SUSANNA M . LEWIS
Silver, D. P., Spanopoulou, E., Mulligan, R. C., and Baltimore, D. (1993). Proc. Natl. Acud. Sci. U.S.A. 90,6100. Siminovitch, K. A., Bakhshi, A., Goldman, P., and Korsmeyer, S. J. (1985). Nature (London)316,260. Siminovitch, K. A., Moore, M. W., Durdik, J., and Selsing, E. (1987).Nucleic Acids Res. 15, 2699. Singh, H., LeBowitz, J. H., Baldwin, A. S., Jr., and Sharp, P. A. (1988).Cell (Cambridge, Muss.) 52, 415. Siu, G., Kronenberg, M., Strauss, E., Haars, R., Mak, T. W., and Hood, L. (1984).Nuture (London)311,344. SpieR, S., Kuhriiber, A., Shimbeck, R., and Reimann, J. (1992). Eur. J . lmmunol. 22, 1939. Staudt, L. M., and Lenardo, M. J. (1991). Annu. Reo. Immunol. 9, 373. Steen, A., Luthman, H., Hellgren, D., and Lambert, B. (1990). E x p . Cell Res. 186,236. Steinmetz, M., Altenburger, W., and Zachau, H. G. (1980). Nucleic Acids Res. 8, 1709. Stenzel-Poore, M. P., and Rittenberg, M. B. (1987).J . Zmmunol. 138, 3055. Stiernholm, N. B. J., and Berinstein, N. L. (1993). Eur. J . Immunol. 23, 1501. Storb, U., and Arp, B. (1983).Proc. Natl. Acud. Sci. U.S.A. 80, 6642. Storb, U., Haasch, D., Arp, B., Sanchez, P., Cazenave, P.-A., and Miller, J. (1989).M o l . Cell. B i d . 9, 711. Suzuki, H., Abe, M., Nishikawa, S., Nakayama, E., and Shiku, H. (1992). Znt. Immunol. 1, 643. Suzuki, H., and Shiku, H. (1992). Eur. J . lmmunol. 22,2225. Taccioli, G. E., Rathbun, G., Shinkai, Y., Oltz, E. M., Cheng, H.-L., Whitmore, G., Staniato, T., Jeggo, P., and Alt, F. W. (1992). Curr. Top. Microbiol. Immunol. 182, 107. Taccioli, G. E., Rathbun, G., Oltz, E., Stamato, T., Jeggo, P. A., and Alt, F. W. (1993). Science 260, 207. Takeda, S., Masteller, E. L., Thompson, C. B., and Buerstedde, J. (1992).Proc. Natl. Acud. Sci. U.S.A. 89,4023. Takemori, T., Mizuguchi, J . , Miyazoe, I., Nakanishi, M., Shigemoto, K., Kinioto, H., Shirasawa, T., Maruyama, N., and Taniguchi, M. (1990).EMBO J . 9, 2493. Takeshita, S., Toda, M., and Yamagishi, H. (1989). EMBO J . 8, 3261. Taniguchi, S., Hirabayashi, Y., Inoue, T., Kanisawa, M., Sasaki, H., Komatsu, K., and Mori, K. J. (1993). Proc. Nutl. Acud. Sci. U.S.A. 90,4354. Taylor, L. D., Carmack, C. E., Schramm, S. R., Mashayekh, R., Higgins, K. M., Kuo, C., Woodhouse, C., Kay, R. M., and Lonberg, N. (1992). Nucleic Acids Res. 20, 6287. Teale, J. M., and Morris, E. G. (1989).J . lmmunol. 143, 2768. Thode, S., Schafer, A., Pfeiffer, P., and Vielmetter, W. (1990). Cell (Cambridge, Mass.) 60,921. Thompson, C. B. (1992).Trends Genet. 8,416. Thompson, S . D., Pelkonen, J . , and Hurwitz, J. L. (199Oa).Proc. Nutl. Acud. Sci. U.S.A. 87, 5538. Thompson, S. D., Pelkonen, J., and Hurwitz, J . L. (1990b).J . Immunol. 145, 2347. Thompson, S. D., Manzo, A. R., Pelkonen, J., Larche, M., and Hurwitz, J. L. (1991). Eur. J . lmmunol. 21, 1939. Thompson, S. D., LarchC, M., Manzo, A. R., and Hurwitz, J. L. (1992). Zmmunogenetics 36,95. Tiegs, S. L., Russel, D. M., and Nemazee, D. (1993).J. E x p . Med. 177, 1009. Tjoa, B., and Kranz, D. M. (1992).J. lmmunol. 149, 253.
V(D)JJOINING
149
Tjoelker, L. W., Carlson, L. M., Lee, K., Lahti, J., McCormack, W. T., Leiden, J. M., Chen, C.-L. H., Cooper, M. D., and Thompson, C. B. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 7856. Traunecker, A., Oliveri, F., Allen, N., and Kajalainen, K. (1986). EMBO J. 5, 1589. Tsubata, T., Tsubata, R., and Reth, M. (1991). Eur. J . Zmmunol. 21, 1359. Tsukada, S., Sugiyama, H., Oka, Y., and Kishimoto, S. (1990).J. Zmmunol. 144,4053. Tsukada, S., Oka, Y., and Sugiyama, H. (1992). Mol. Zmmunol. 29, 401. Tsunetsugu-Yokota, Y., Minekawa, T., Shigemoto, K., Shirasawa, T., and Takemori, T. (1992). Mol. Zmmunol. 29, 723. Tuaillon, N., Taylor, L. D., Lonberg, N., Tucker, P. W., and Capra, J. D. (1993). Proc. Natl. Acad. Sci. U.S.A. 90, 3720. Turka, L. A., Schatz, D. G., Oettinger, M. A., Chun, J. J. M., Gorka, C., Lee, K., McCormack, W. T., and Thompson, C. B. (1991).Science 253, 778. Tybulewicz, V. L. J., Crawford, C. E., Jackson, P. K., Bronson, R. T., and Mulligan, R. C. (1991). Cell (Cambridge, Mass.) 65, 1153. Tycko, B., and Sklar, J. (1990). Cancer Cells 2, 1. Tycko, B., Palmer, J. D., and Sklar, J. (1989). Science 245, 1242. Tycko, B., Coyle, H., and Sklar, J. (1991).J . Zmmunol. 147, 705. Uematsu, Y., Ryser, S., DembiC, Z., Borgulya, P., Krimpenfort, P., Berns, A., von Boehmer, H., and Steinmetz, M. (1988). Cell (Cambridge, Mass.) 52, 831. Usuda, S., Takemori, T., Matsuoka, M., Shirasawa, T., Yoshida, K., Mori, A., Ishizaka, K., and Sakano, H. (1992). EMBOJ. 11,611. Van de Ven, F. J., and Hilbers, C. W. (1988). Eur. J. Biochem. 178, 1. Van Ness, B. G., Weigert, M., Coleclough, C., Mather, E., Kelley, D. E., and Perry, R. P. (1981). Cell (Cambridge, Mass.) 27, 593. Van Ness, B. G., Coleclough, C., Perry, R. P., and Weigert, M. (1982). Proc. Natl. Acad. Sci. U.S.A. 79, 262. VanDyk, L., and Meek, K. (1992).Intern. Reo. Zmmunol. 8, 123. Vila, M., Durum, S. K., and Muegge, K. (1994). In preparation. Wang, J. C., Caron, P. R., and Kim, R. A. (1990). Cell (Cambridge, Mass.) 62, 403. Wang, L. C., and Rosenberg, N. (1993). Mol. Cell. Biol. 13, 3890. Weaver, D., and Hendrickson, E. (1989). Curr. Top. Microbiol. Zmmunol. 152, 77. Wei, Z., and Lieber, M. R. (1993).J . Biol. Chem. 268, 3180. Weichhold, G. M., Klobeck, H., Ohnheiser, R., Combriato, G., and Zachau, H. G. (1990). Nature (London)347,90. Weigert, M., Gatmaitan, L., Loh, E., Schilling, S., and Hood, L. (1978).Nature (London) 276, 785. Weigert, M., Perry, R., Kelley, D., Hunkapiller, T., Schilling, J., and Hood, L. (1980). Nature (London)283,497. Weill, J.-C., and Reynaud, C.-A. (1992). Ann. N.Y. Acad. Sci. 651, 295. Whitehurst, C., Henney, H. R., Max, E. E., Schroeder, H. W., Jr., Stuber, F., Siminovich, K. A., and Garrard, W. T. (1992). Nucleic Acids Res. 18, 4929. Whitlock, C. A., and Witte, 0. N. (1982). Proc. Natl. Acad. Sci. U.S.A. 79, 3608. Wilson, J. H., Berget, P. B., and Pipas, J. A. (1982). Mol. Cell. Biol. 2, 1258. Winoto, A. (1991). Curr. Opinion Zmmunol. 3, 199. Witte, P. L., Burrows, P. D., Kincade, P. W., and Cooper, M. D. (1987).J . Zmtnunol. 138,2698. Wood, C., and Tonegawa, S. (1983). Proc. Natl. Acad. Sci. U.S.A.80, 3030. Wormann, B., Anderson, J. M., Liberty, J. A., Gajl-Peczalska, K., Brunning, R. D., Silberman, T. L., Arthur, D. C., and LeBien, T. W. (1989).J . Zmmunol. 142, 110.
150
SUSANNA M. LEWIS
Wu, L.-C., Mak, C.-H., Dear, N., Boehm, T., Foroni, L., and Rabbitts, T. H. (1993). Nucleic Acids Res. 21, 5067. Wyatt, R. T., Rudders, R. A., Zelenetz, A,, Delellis, R. A., and Krontiris, T. G. (1992). J . Erp. Med. 175, 1575. Wysocki, L. J., Manser, T., Gridley, T., and Gefter, M. L. (1986).J.Zrnmunol. 137,3699. Xu, M., Mammer, R. E., Blasquez, V. C., Jones, S. L., and Garrard, W. T. (1989).]. B i d . Chem. 264, 1190. Yamada, M., Wasserman, R., Reichard, B. A,, Shane, S., Caton, A. J., and Rovera, G . (1991).1.Erp. Med. 173, 395. Yancopoulos, G. D., and Alt, F. W. (1985). Cell (Cambridge, Mass.) 40, 271. Yaucopoulos, G. D., Desiderio, S. V., Paskind, M., Kearney, J. F., Baltimore, D., and Alt, F. W. (1984). Nature (London)311, 727. Yancopoulos, G. D., Blackwell, T. K., Suh, H., Hood, L., and Alt, F. W. (1986). Cell (Cambridge,Muss.) 44, 251. Zachau, H. G. (1990). Biol. Chem. Hoppe Seyler 371, 1. Zhao, J., and Storb, U. (1992). Deu. Zmniunol. 2, 285. Zou, Y.-R., Takeda, S., and Rajewsky, K. (1993). E M B O J . 12,811. This article was accepted for publication on 9 December 1993.
ADVANCES IN IMMUNOLOGY, VOL. 56
Generating the Antibody Repertoire in Rabbit KATHERINE 1. KNIGHT A N D MARY A. CRANE Department of Microbiology ond Immunology, Loyob University Chicago, Moywood, Illinois 60 153
1. Introduction
Rabbits preferentially utilize one V, gene in their VDJ gene rearrangements. Because, at birth, these genes are undiversified, rabbits have a limited antibody repertoire and are essentially immunoincompetent. With time, the Ig genes diversify and the rabbits become fully immunocompetent. In this paper, we review the rabbit humoral immune system and propose a model for development of the functional antibody repertoire. Our model for B cell development and generation of the antibody repertoire in rabbits is different from that for other mammals. The model gives rise to several predictions that can be readily tested and we hope that it will stimulate interest in researching this system. In the 1960s one of the major debates in immunology was about the genetic basis for antibody diversity. Immunologists argued either that the germline contained multiple V genes, each encoding a particular antibody specificity, or that the germline contained only a few V genes and that the antibody repertoire developed by somatic diversification. We now know that both ideas are correct: the germline does indeed have multiple V genes, and a large amount of the primary antibody repertoire is generated by combinatorial joining of these V gene segments with D and/or J gene segments. The resulting VJ and VUJ gene rearrangements can then be diversified by somatic diversification to develop the secondary antibody repertoire. Rabbits are unusual among mammals in that they have multiple germline V, genes, but they rearrange only one ofthem, VJ, in most B lymphocytes (Knight and Becker, 1990).That means that combinatorial joining of multiple V,, D, and J H gene segments contributes relatively little to the generation of antibody diversity and that the initial antibody repertoire of rabbits is rather limited. Becker and Knight (1990) showed that much of the antibody diversity in rabbits is generated by somatic gene conversion of rearranged VDJ genes. This observation was quite unexpected because in other mammals diversification of rearranged Ig genes occurs by somatic mutation and little, if any, 179 Copvright 0 18Y4 tn Ac,tdemi< Pie\\, Inc All rights ol reproduction 111 aiw fiirin reserved
180
KATHERINE L. KNIGHT AND MARY A. CRANE
occurs by somatic gene conversion (Gearhart et al., 1981; Clarke et ul., 1985; French et al., 1989; Kocks and Rajewsky, 1989; Maizels, 1989; Wysocki and Gefter, 1989). The task before us here is to determine, in rabbit, when and in what location somatic gene conversion occurs and whether it is active in generating the primary and/or secondary functional antibody repertoires. B cells from avian species also utilize only one V gene in their VDJ and VJ gene rearrangements (Reynaud et al., 1985, 1989). In these species, the primary antibody repertoire is generated in the bursa, during embryogenesis, by somatic gene conversion (Reynaud et ul., 1987; Thompson and Neiman, 1987). Because there are histological similarities between the avian bursa and the rabbit gut-associated lymphoid tissue (GALT), especially the appendix and sacculus rotundus (Archer et d., 1963), we suggest that in rabbit, the GALT is the bursal equivalent and that the primary antibody repertoire develops there by somatic gene conversion and somatic mutation. We begin by reviewing the rabbit B lymphoid system including B cell ontogeny, Ig gene organization and rearrangement, and development of the antibody repertoire. Then, we explore the idea that GALT is the bursal equivalent in rabbit, and, finally, we propose a model for the role of GALT in development of the primary antibody repertoire. ti. B lymphocyte Development
A. B LYMPHOPOIESIS In most mammals lymphopoiesis generally occurs throughout the life of the animal, with approximately 2 x lo' B cells produced daily in mouse bone marrow (Raff et al., 1976; Pearl et al., 1978; Osmond, 1990). In this section, we review the data concerning generation of pre-B and B cells in fetal and neonatal rabbits and discuss the possibility that little, if any, B lymphopoiesis occurs in adult rabbits. In mouse and human, the fetal liver, omentum, and bone marrow serve as primary sites for B cell development (Lawton et al., 1972; Velardi and Cooper, 1984; Solvason et al., 1991; Solvason and Kearney, 1992). In rabbit, several groups investigated the distribution of pre-B cells in these organs. One major difficulty in working with rabbit is the limited number of monoclonal antibodies and of DNA probes specific for molecules of immunologic relevance. (For informational purposes, we developed a list of rabbit-specific DNA probes and monoclonal antibodies for molecules of immunologic interest; Table I.) Because no markers for rabbit pre-B cells are available, pre-B cells
GENERATING T H E ANTIBODY REPERTOIRE I N RABBIT
181
were identified as those that are surface-Ig-negative but have cytoplasmic p-chain. Using those criteria, Hayward et ul. (1978) and McElroy et al. (1981)showed that pre-B cells first appear in liver at 17-21 days of fetal development, and they appear in bone marrow by 25 days. Solvason and Kearney (1992) reported the presence of pre-B cells in fetal omentum, but the time ofappearance was not determined. In liver, the level of pre-B cells peaked a few days after birth, and, b y day 10, the pre-B cells were barely detectable. In bone marrow, Hayward et al. (1978) reported that pre-B cells are at the highest level, approximately 9%, one day after birth and rapidly decrease to approximately 2% two days after birth and to 1% b y day 21. McElroy et (11. (1981)reported that the level of pre-B cells in bone marrow can also reach 9%, but in their experiments this peak occurred at 2-3 weeks of age. Others show that the levels of pre-B cells in newborn bone marrow range from 9.6 to 18.0% and decline as the rabbits age (Gathings et al., 1981, 1982). In all of these studies, the levels of preB cells in bone marrow from adult rabbits were estimated at 1-3%. The presence of 1-3% pre-B cells in adult rabbit bone marrow might be used to argue that B lyinphopoiesis continues to occur in adult rabbits just as it occurs in adult mice (Osmond, 1990). However, we suggest that in adults, these pre-B cells are quiescent, that B lymphopoiesis occurs early in ontogeny, that the B cells are self-renewing, and that, as in chicken (Pink et ul., 1986; Cooper and Burrows, 1989), little, if any, B lymphopoiesis occurs in adults. Several observations support these ideas. First, all rabbit B cells are CD5" (Raman and Knight, 1992), and one of the k e y characteristics of CDS' B cells, in mouse, is that they are generated early in ontogeny and are self-renewing (Hayakawa et al., 1986; Fiirster and Rajewsky, 1987). If rabbit CD5' B cells are functionally analogous to the murine CD5' B cells, and results from allotype suppression experiments in mice and rabbits suggest that they are, then rabbit B cells may also be generated early in ontogeny and be self-renewing. In the allotype suppression experiments, mice heterozygous for the IgH locus were injected with antiIgH antibody directed against one of the allelic products, and Ig bearing the allotype against which the antibody was directed was suppressed. The suppression was short-lived, as Ig molecules of the suppressed allotype appeared in serum within 6 weeks (Lalor et ul., 1989). Lalor et al. (1989) analyzed the B cells in mice that had broken suppression and discovered that the B cells that had broken suppression were all CD5-. The CD5' B cells remained suppressed, indicating that, once eliminated, they were not regenerated.
ANTIBODIES AND
Molecules CD1 CD4 CD5 CD8p C D l l a (LFA-1) CD11b (MAC-1) CDllc CD18 CD19 CD25 (IL2Ra) CD40L CD43 (leukosialin) CD44 CD45 CD58 (LFA-3) ILl IL4 IL8 ILlO MHC class I hlHC class I1 DPaIDPP
DNA
Probes" M26249 S44055 LO3204 Yes No NO
No No Yes Yes Yes
No
TABLE I MOLECULESOF
PROBES TO SELECTED
No No No X02852 Yes Yes Yes KO2819 M22640 M21465-68 M 15557
Antibodies NO
Yes Yes' Yes Yes Yes Yes Yes No Yes No Yes Yes Yes Yes No No Yes No Yesd No Yes
IMMUNOLOGIC INTEREST IN
RABBIT"
Reference Calabi et al., 1989 Kotani et al., 1993a; Hague et al., 1992 Raman and Knight, 1992; Kotani et al., 1993a DeSniet et al., 1983; Sawasdikosol et al., 1993 Kotani et a/., 1993a Smet et al., 1986; Galea-Lauri et al., 1993a Blackford and Wilkinson, unpublished data Galea-Lauri et al., 1993a Winstead and Knight, unpublished Kotani et al., 1993b; Sawasdikosol et al., 1993 Boonthum and Knight, unpublished Jackson et a / . , 1983; Wilkinson et al., 1992a Jackson et a/., 1983; Galea-Lauri et al., 1993b DeSmet et al., 1983; Jackson et al., 1983; Wilkinson et a!., 1993 Wilkinson et al., 1992b Furutani et al., 1985 Boonthum and Knight, unpublished Yoshimura and Yuhki, 1991; Harada et al., 1993 Boonthum and Knight, unpublished Marche et al., 1985; LeGuern et al., 1987 Sittisombut and Knight, 1986; LeGuern et a!., 1985 Lobel and Knight, 1984, Sittisombut and Knight, 1986; LeGuern et al., 1986
DRaIDRP
Yes
Yes
DOP Complement component C3 TNFa TNFP TCRa TCRP
M96942 M32434 M 12846 M60340 M 12885 M 14577 M14576 Yes Yes KO0752 500666 Yes X00353 100666 KO075 1 M12762 X00412 M77666 M77667 Yes
No Yes No No No No
Spieker-Polet et al., 1990; Sittisonibut and Knight, 1986; Laverriere et al., 1989 Chouchane et al., 1993 Kusano et al., 1986 Ito et al., 1986 Shakhov et al., 1990 Marche and Kindt, l986a Marche and Kindt, 1986b; Angiolillo, 1985
No No Yes Yes No Yes Yes Yes Yes Yes No No No
Sawasdikosol et al., 1993 Sawasdikosol et al., 1993 Heidmann and Rougeon, 1982a; Bernstein et al., 1983a Bernstein et al., 1983b; Knight et al., 1985 Knight et al., 1985 Knight et al., 1984 Bernstein et al., 1982; Gallarda et al., 1985 Heidmann et al., 1981; Dreher et al., 1983, Bernstein et ul,, 1983c Duvoisin et al., 1984 Mostov et al., 1984 Fuschiotti et al., 1993 Fuschiotti et al., 1993 Short, Raman, and Knight, unpublished
TCR Cy TCR C6 Ig heavy chain Cy CP CE
F
o$
W
Ca VH Ig K-chain Ig A-chain PIgR (secretory component) RAG-1 RAG-2 MB1
Cross-reactive antibodies produced against molecules from other species are not included.
* Available GenEMBL accession numbers of representative DNA sequences are included.
Anti-CD5 mAbs from Raman and Knight (1992)were made against the product of the cloned CD5 gene; anti-CD5 mAb made by Kotani et ol. (1x334 was made against rabbit thymocytes. The anti-RLA mAb is specific for RLA I of the T cell line, RL-5.
184
KATHERINE L. KNIGHT AND MARY A. CRANE
In similar studies with rabbits, Mage and Dray (1965) showed that rabbits heterozygous for the V,a or C,b allotypes, that were neonatally exposed to anti-V,a or anti-C,b alloantisera, did not express Ig of the allotype against which the antisera were directed. Such allotype suppression lasted for at least 2 years, during which time little or no suppressed allotype was found in serum or on B cells, although it was found in secretory IgA after 2-3 months (Mage and Dray, 1965; Harrison and Mage, 1973; Eskinazi et al., 1979b). Thus, the long-term allotype suppression of CD5+ B cells in rabbit is similar to the longterm allotype suppression in mice, and we suggest that the rabbit CD5' B cells are functionally analogous to murine CD5+ B cells and that, once eliminated, they are not readily regenerated. We should point out that in the allotype suppressed rabbits, low levels of pre-B cells and B cells that expressed the suppressed allotype were identified (Harrison and Mage, 1973; Simons et al., 1979).Although the presence of these cells may be used to argue against the idea that B lymphopoiesis is limited in adult rabbits, it should be noted that these cells appeared in young rabbits, between birth and 10 weeks of age, an age at which B lymphopoiesis may still be ongoing. For this reason, and because the state of allotype suppression may not represent a normal physiological state, we think that these data do not argue against limited B lymphopoiesis in adult rabbits. Additional evidence for limited B Iymphopoiesis in adult rabbits came when we searched for undiversified VDJ gene rearrangements in bone marrow by using an RNase protection assay. The rationale for this experiment was that, if B cells were continuously being produced in the bone marrow, then they would express newly rearranged, and therefore undiversified, VDJ genes. In an RNase protection assay, the RNA of these B cells would protect a probe derived from the V,l gene, which is the V, gene used in VDJ gene rearrangements in 80% of B cells (Knight and Becker, 1990). We found that RNA from bone marrow cells of 1 to 6-week-old rabbits was able to protect the V,1 probe, indicating that these cells contained mRNA derived from undiversified VDJ genes (Fig. 1).In contrast, the RNA from bone marrow of adult rabbits protected only the leader region of the probe and not the V, region of the probe, indicating that all mRNA was diversified (Fig. 1). We suggest that the B lineage cells in adult bone marrow are mostly recirculating cells whose VDJ genes have undergone somatic diversification and, further, that few if any B ceIls are newly generated. Finally, the expression patterns of the recombinase genes RAG-1 and RAG-2 give credence to the idea that limited B lymphopoiesis occurs in adult rabbits. Roux and colleagues cloned rabbit RAG-1 and
GENERATING THE ANTIBODY REPERTOIRE IN RABBIT
185
FIG. 1. RNase protection assay for undiversified V H 1 mRNA in bone marrow of 1993): 10pg of RNA young and adult rabbits. (A) Method (see Spieker-Polet et d., was hybridized to 32P-VH1antisense probe and strbser~iientlvdigested with RNase and analyzed on 5% polyacrylamide gels. The VH1probe contains the Fj’-untranslated (UT) region, leader, leader intron, and 280 bp of the V, region. Two fragments of 120 and 280 b p of the probe are protected by RNA from cells utilizing undiversified vH1; only the S’UT and leader regions of 120 b p are protected by RNA from cells utilizing VH1 that is diversified. (B) Autoradiogram of RNase-protected RNA from a positive control B lineage cell line PBL-1 that expresses a VDJ gene that utilizes undiversified VH1 (lane 1, left); bone marrow of 5-week-old rabbit (lane 2); bone marrow of three adult rabbits (lanes 3-5). Data are from M. Kingzette and K. L. Knight, unpublished data.
186
KATHERINE L. KNIGHT AND MARY A. CRANE
RAG-2 genes and performed Northern analysis of RNA from several lymphoid tissues (Fuschiotti et al., 1993). They found that RAG-1 and RAG2 were highly expressed in thymus and in newborn bone marrow, but they could not identify significant levels of either RAG-1 or RAG2 in adult bone marrow (Roux et al., 1993). The lack of expression of these genes in adult bone marrow is consistent with the idea that most VDJ gene rearrangements occur early in ontogeny and that little, if any, B lymphopoiesis occurs in adult rabbits. Taken together, the observations from CD5 expression on B cells, allotype suppression, RNase protection of undiversified VDJ genes, and expression of RAG-1 and RAG-2 genes make a strong case for the idea that B lymphopoiesis occurs early in development but does not occur in the adult rabbit. None of these experiments, however, provides direct proof for the lack of B lymphopoiesis in adults, and this issue needs to be addressed directly. B. ONTOCENY OF THE IMMUNE RESPONSE Newborn rabbits are considered to be relatively immunoincompetent. At birth, all peripheral lymphoid tissues are underdeveloped, including the spleen, which is small and has no germinal centers. The appendix, which does not have a lymphoid compartment at birth, begins to develop rapidly within the first week of life and continues until 4-6 weeks of age, at which time it fills with lymphoid follicles and germinal centers (Thorbecke, 1960). The appendix is the first peripheral organ to develop a mature lymphoid structure, which in adults contains 30-40% B cells (Harrison and Mage, 1973; Hayward et al., 1978); the spleen, Peyers’ patches, and the sacculus rotundus develop more slowly and later in ontogeny (Cooper et al., 1968). The Peyer’s patches and sacculus rotundus can usually be observed by about 2-3 weeks of age. To determine whether newborn rabbits were capable of synthesizing antibodies, investigators examined the formation of Ig and antibodies in neonatal and young rabbits. Thorbecke (1960) found that Ig was not synthesized in appendix until 1 week of age. In spleen and other lymphoid tissues it was not synthesized until 4 weeks of age. Dray and Mage and their colleagues (Vice et al., 1969; Harrison and Mage, 1973) studied allotype suppression and found that the circulating Ig of newborn rabbits was primarily of maternal origin and that Ig of the offspring’s allotype did not appear until 2 weeks of age; the levels of the offspring’s allotype Ig then increased rapidly beginning between 4 and 6 weeks of age. Tlaskalova-Hogenova and Stepankova (1980) studied the development of spontaneously arising antibodies to bacte-
GENERATING TH E ANTIBODY REPERTOIRE I N RABBIT
187
rial antigens in young rabbits, and they found that antibacterial plaqueforming cells (PFCs) occurred first in GALT, notably in the appendix, but not before 4 weeks of age. Such antibacterial PFCs did not appear in spleen or lymph node until after 12 weeks of age. Hemolytic antibodies to sheep red blood cells (SRBC)also appeared late in development, without previous immunization, between 4 and 12 weeks of age, and the cells producing these antibodies first appeared in the spleen. Taken together, these studies suggest that newborn rabbits do not synthesize Ig. On the basis of the limited development of lymphoid tissue at birth and the delayed onset of Ig production, one would predict that newborn rabbits that are immunized with antigen would be unable to mount a specific immune response to that antigen within the first 1-2 weeks of age. In fact, several investigators studied the specific immune responses of newborn and young (2- to 3-week-old) rabbits and showed that, indeed, they did not mount a normal specific immune response to a variety of antigens, including bovine serum albumin, SRBC, typhoid bacilli, and Salmonella purutyphi B (Freund, 1930; Sterzl and Trnka, 1957; Bridges et al., 1959). In an effort to determine whether the lack of ability to respond to antigen was due to the inability of the neonatal cells to respond or whether it was due to the lack of appropriate signals in their environment, Dixon and Weigle (1959) transferred neonatal cells to adult rabbits and found that they readily formed antibodies. This observation suggests that the neonatal cells are differentiation competent but that environmental factors necessary for their differentiation are absent in the neonate. These environmental factors may include growth and nutritional factors, bacterial flora, and other factors found in a fully developed rabbit. Taken together, these studies indicate that newborn rabbits are relatively immunoincompetent. The bulk of the lymphoid tissue in the spleen and gut develops after birth, and the first antibodies begin to appear in the appendix at approximately 1 week of age and in other organs a couple weeks later. Immunocompetency develops within approximately 1 week after the appendix develops. Further, it appears that an environmental factor(s) may be necessary for differentiation of immature B cells. 111. lg Genes and Gene Rearrangements
Central to the development of an antibody repertoire is the rearrangement of v, (D), and J gene segments. In this section we discuss the organization ofthe rabbit H- and L-chain genes. This organiza-
188
KATHERINE L. KNIGHT A N D MARY A. CRANE
tion is largely similar to that of other mammals (Fig. 2), except that rabbit has only 1 C y gene and 13 C a genes, compared with 4 Cy genes and only 1 or 2 C a genes in human, mouse, rat, and cow (Flanagan and Rabbitts, 1982; Shimizu et al., 1982; Knight et al., 1985; Bruggemann et al., 1986; Burnett et al., 1989).
A. VH, D, AND JH GENES As with other mammals, the rabbit genome contains a large pool of V, genes that can contribute to the antibody repertoire. The V, chromosomal region contains an estimated 200 V, genes, separated by an average of 5 kb (Currier et at., 1988). Five functional and one nonfunctional JH gene segments reside 63 kb downstream of the VH
K LIGHT CHAIN LOCUS
...
VK
JK ‘K1
...--* VK
/I.
JK
ct
-1Mb
b LIGHT CHAIN LOCUS Vk2
Vk3 vVi4
JiCk5
JkCi6
+-H+3kb
M
FIG.2. Organization of heavy-chain, K light-chain, and A light-chain genes. The organization of the C, genes shown in parentheses is not yet known: however, within the two clusters ofC, genes (Gal, C,2, C,3, C,7, C,10, and C,11) and (C,8 and C,9), the order is as shown. Heavy-chain gene organization is from Becker et al., (1989) and Burnett et al. (1989); K-chain gene organization is from Emorine and Max (1983) and Hole et al. (1991b); A-chain organization is from Duvoisin et al. (1988); the linkage of V, genes to C, genes is arbitrary as the association of these V, and C, genes has not been established either by overlapping phage/cosmid clones or by their association in cDNA clones.
GENERATING T H E ANTIBODY REPERTOIRE IN RABBIT
189
genes, with 11 known D gene segments i n between (Becker et ul., 1989; Friedman et ul., 1994). The VH genes are generally more than 80% similar and consequently are members of 1 large V, gene family (Bernstein et ul., 1985; McCormack et al., 1985; Currier et ul., 1988; Knight and Becker, 1990) as compared with niurine and human V, genes, which are grouped into 10 and 6 V,, gene families, respectively 1989; Pascual and Capra, 1993). (Brodeur and Riblet, 1984; Lai et d., The high similarity among rabbit V, genes enhances their ability to function as donors in gene conversion events (McCormack and Thompson, 1990a). On the basis of the nucleotide sequence of 49 germline V, genes, approximately one-half of them appear functional as they encode a normal leader and VH region and have conserved heptamer/nonamer recombination sequences (Bernstein et at., 1985; Gallarda et ul., 1985; McCormack et al., 1985; Currier et ul., 1988; Fitts and Mettzer, 1990; Knight and Becker, 1990; Roux et ul., 1991; Short et al., 1991; Raman et ul., 1994). We note, however, that even though one-half of the V, genes appear functional, the promoter regions of most of these are not characterized because the V, genes are generally cloned on small PstI fragments that do not include the promoter regions. Consequently, we cannot be certain that all potentially functional VH genes have functional promoter regions and are expressible. In most species, the first Ig gene rearrangements to occur are D to JH on both heavy-chain alleles in early B lineage cells (reviewed in Cooper and Burrows, 1989). Second, in pre-B cells, a V,, gene rearranges to the DJ,, gene rearrangement on one allele and a p heavy chain is synthesized. Subsequently, the light-chain genes rearrange and a complete Ig molecule is produced. H-chain genes are also the first Ig genes to rearrange in rabbit B lineage cells, as evidenced by the fact that pre-B cells in newborn rabbit bone marrow have cytoplasmic H chains but lack L chains (Gathings et al., 1982). Although the order of rabbit V,, D, and J H gene rearrangements is not yet known, Southern analysis of DNA from B cells of normal rabbits identified unrearranged JH gene segments. The presence of germline JH gene segments suggests that J,, gene rearrangements may occur on only one allele (Becker et ul., 1990; Allegrucci et ul., 1991). Even though we do not know the actual percentage of B cells that have unrearranged JH gene segments on the unexpressed allele, preliminary data (C. Tunyaplin and K. L. Knight) suggest that this is true in nearly all B cells. This means that, unlike other species, rabbit DJH gene rearrangements do not occur on both H-chain chromosomes. This suggests either that one H-chain chromosome is inactive or that the first
190
KATHERINE L. KNIGHT AND MARY A. CRANE
H-chain gene rearrangements are VH to D on both chromosomes followed by a rearrangement of VD to J H on one allele. Indeed, we have cloned a VD gene rearrangement from a leukemic B cell line (Table 11), and several VD gene rearrangements have been amplified by polymerase chain reaction (PCR) from DNA of normal spleen and bone marrow cells (S. K. Zhai and K. L. Knight, unpublished data). We have also PCR-amplified DJ gene rearrangements from DNA and from cDNA derived from normal spleen and bone marrow cells, indicating that the H-chain gene rearrangements can occur as either V, to D or D to J H . It is not known whether one or both VD and DJ gene rearrangements can serve as intermediates for VDJ gene rearrangements. To elucidate the order of v,, D, and J H gene rearrangements, we need to examine the DNA rearrangements that have occurred in clonal populations of pre-B and B cells. It has been difficult to study Ig gene rearrangements in individual clones of lymphocytes because no rabbit B lineage-transforming virus has been identified and because no successful rabbit B lineage fusion partner has been developed. In an attempt to generate stable B cell lines, Knight et al., (1988a,b) developed transgenic rabbits with the c-myc gene driven by either the H-chain enhancer (E,) or the K-chain enhancer (EJ. Transgenic rabbits with the E,-myc transgene developed B cell leukemia, whereas some of those with the E,-myc transgene developed B lymphoma. Three stable B lineage cell lines were developed from these transgenic rabbits, and, on the basis of morphology and surface Ig expression, they appear to b e either late TABLE I1 HEAVY-CHAIN GENEREARRANGEMENTS ON THE UNEXPRESSED ALLELEI N RABBIT LEUKEMIC B LINEAGE CELLS Name
Cell Type
PBLl
Pre-B B cell B cell
55D1 79E
Rearrangement on unexpressed allele
VD
Germline J (VDJ)" Noneb
" By Southern analysis, J H genes of the unexpressed allele (a3)were unrearranged early in developnient of the cell line but rearranged to a VDJ gene during culture. 'I By Southern analysis, J H and D genes on unexpressed chromosome were on germline-sized fragments.
GENERATING THE ANTIBODY REPERTOIRE I N RABBIT
191
pre-B or early B cells (Knight et al., 1988a,b; P. Setupathi and K. L. Knight, unpublished data). The H-chain gene rearrangements of these three cell lines were examined, and all had functional VDJ gene rearrangements on one H-chain chromosome. However, on the unexpressed chromosome, each of the cell lines differed in their H-chain gene organization (Table 11).One of the cell lines, 79E, appeared to have no D or JH gene rearrangement, one, PBL1, had a VD gene rearrangement, and the other, 55D1, had a VDJ gene rearrangement. The presence of functional VDJ gene rearrangements on both heavychain chromosomes, a'la3 in the cell line, 55D1, defies the rule of allelic exclusion and we think that the VDJ gene rearrangement on the a3 chromosome occurred during in vitro culturing. Southern blot analysis of D N A taken from these cells early in the in uitro culture period revealed that the JHgenes on the a3 chromosome were in germline configuration but, after several months, the JH genes on the a3 chromosome were rearranged. Although data from these cell lines show that rabbit B cells rearrange their VH, D, and J H gene segments differently than mouse and human B cells, they do not establish the order in which these genes are rearranged. It will be important to establish normal long-term B cell lines either by activating them with CD40L and IL4 (Banchereau et al., 1991) or by immortalizing them by viral transformation or by somatic cell fusion with a rabbit fusion partner. B. CH GENES The rabbit CHchromosomal region is unique in that it contains 16 CHgenes that span over 200 kb and include 13 C, genes plus one each ofC,, C,, and C,genes (Fig. 2 ) (Knight et al., 1985;Burnett et al., 1989). The C, and C,genes are separated by 55 kb, whereas the remainder of the CH genes are separated by 10-15 kb. A switch region is found approximately 2 kb upstream of each CHgene. No gene for C, has been identified in the rabbit. Because Wilder et al. (1979) and Eskinazi et nl. (19794 identified immunochemically an Ig-like molecule that was non-IgM, non-IgA, and non-IgG, on the surface ofmost B lymphocytes, we extensively searched the DNA between the C, and C, genes for a 8-like heavy-chain gene. Using the human and mouse C, probes (Tucker et al., 1980; White et al., 1985),we found no specific hybridization in this region of DNA, which suggested to us that the rabbit genome does not have a C, gene. We point out, however, that 8heavy chains are evolutionarily the least conserved of the heavy-chain isotypes, and we cannot exclude the possibility that the rabbit germline
192
KATHERINE L. KNIGHT A N D MARY A. CRANE
has a C , gene but that we did not detect it because it may have low homology with mouse and human probes. Just as no C , gene could be cloned from a genomic DNA library, no C, cDNA has been identified in cDNA libraries constructed from splenic RNA. We screened cDNA libraries for potential Cgencoding clones by probing first with V, to identify H-chain-encoding clones and then with p, a, y, and E probes to identify a cDNA clone that hybridized with a V, probe but that did not hybridize with p., a , y, or E probes. To date no such clone has been identified. Although these data support the notion that rabbit does not have IgD, we cannot rule out the posibility that IgD is present but is expressed at levels too low to be identified by this method, especially because the cDNA libraries were derived from total splenic RNA, including RNA from plasma cells, rather than from RNA of purified B cells. Perhaps the most unusual characteristic of the rabbit H-chain chromosomal region is the presence of 13 C, genes (Fig. 2). Nucleotide sequence analyses of these genes indicate that each encodes a functional protein. To test whether the 13 C, genes are expressed, hybrid mouse x rabbit a-chain genes were constructed by ligating each of the 13 C, genes to a murine VDJ gene (Schneiderman et al., 1989). The constructs were transfected into a murine L-chain-secreting hybridoma, and stable transfectoma cell lines were tested for their ability to secrete chimeric rabbit x mouse IgA molecules. Results from these studies showed that at least 12 of the 13 IgA genes are expressible. Further, Schneiderman and colleagues showed that each of these chimeric IgA molecules bound secretory component and that they activated complement by the alternative pathway (Schneiderman et al., 1989; 1990). By RNase protection assays, Spieker-Polet et a1. (1993)showed that 11ofthe 13C, genes are expressed but that they were differentially expressed in various mucosal tissues, including gut, appendix, mesenteric lymph node, and mammary tissue. Surprisingly, only 1 of the genes, C,4, was expressed in lung and tonsil. C,4 is the 5’-most C, gene and Spieker-Polet et al. (1993) proposed that IgA-producing cells may be derived from B cells that have initially undergone isotype switching to C,4 followed by isotype switching to a more 3’ C, gene. However, no direct data to support this idea are available. Because rabbits belong to one of two families of lagomorphs and because Burnett et al. (1989) showed that members of each family have multiple germline C, genes, the expansion of germline C, genes must have occurred in acommon ancestor oflagomorphs. The immunologic significance of 13 IgA isotypes is not clear. The 13 C, genes are generally more than 80%similar, but they differ extensively from each
GENERATING THE ANTIBODY REPERTOIRE IN RABBIT
193
other in the hinge region and we suggest that the functional differences among the IgA isotypes may be due to differences in the hinge regions. Burnett et al. (1989) suggested that the rabbits may have a diverse microbial flora in the gut, with these organisms producing several IgA proteases (Plaut et al., 1975). If so, then, the rabbits may need multiple IgA isotypes to protect themselves from these proteases. The IgA proteases that cleave human IgA target the hinge region and, assuming the same would be true for IgA proteases found in rabbit microbial flora, it would make sense that the IgA heavy chains would differ in the hinge region. C.
K
LIGHT-CHAIN GENES
Among mammals, the rabbit K-chain chromosomal region is unusual in that there are two, instead of one, C, genes, C,1 and C g . By pulsedfield analysis, these genes appear to be separated by 1 Mb (Fig. 2) (Benammar and Cazenave, 1982; Emorine and Max, 1983; Heidmann and Rougeon, 1983; Hole et al., 1991b). Each C,gene is associated with a separate 5' cluster of J, genes (Emorine and Max, 1983) and most likely by a 5' cluster of V, genes (Hole et al., 19Ylb). In normal rabbits, K light chains represent 90-95% of total L chains, and nearly all ofthem are derived from C,1 and are designated as the K1 isotype. Five allelic forms of C,1 are known, and they encode the C, allotypes b4, b4v, b5, b6, and b9. The C g gene encodes the K2 isotype of K light chains, but it is rarely expressed, except in some b9 rabbits, wild rabbits, mutant Basilea rabbits, and allotype-suppressed rabbits (Good et al., 1980; Benammar and Cazenave, 1982; Garcia et al., 1982; Emorine and Max, 1983; Heidmann and Rougeon, 1983; Catty et ul., 1985). Relatively little is known of germline V, genes, although Southern analysis of germline DNA identified multiple V,-hybridizing fragments, indicating that the germline contains multiple V, genes. It is not known how many of the V, genes are expressed. The molecular basis for the limited expression of the C g gene is unclear, but Emorine and Max (1983) showed that, compared with the J-C,l intron (Emorine et al., 1983a,b), the J-C,2 intron contains several deletions and mutations, including mutations within the intron-enhancer region. Hole et al. (1991a) tested whether the lack of expression of C$ was due to the lack of a second C, enhancer, 3' of C, genes, that was first identified with the murine C,gene (Meyer and Neuberger, 1989).They found functional 3' enhancers for both C,1 and C$ genes; hence, decreased expression ofthe C g gene is probably not due to the 3'-enhancer region but rather is due to mutations/deletions in the intron enhancer of C$. Results from studying the Basilea rabbit
194
KATHERINE L. KNIGHT AND MARY A. CRANE
discovered by Kelus and Weiss (1977)demonstrate that if the C,1 gene cannot be expressed, then the C,$ gene is readily expressed (Garcia et al., 1982). The Basilea rabbit has a mutation in the acceptor site for RNA splicing in the C,I gene; it is probably this mutation that accounts for the decreased expression of the C,I gene (Lamoyi and Mage, 1985). The Basilea rabbit has increased expression of A light chains as well as C g light chains to compensate for the loss of C,1 light chains (Jaton and Kelus, 1977).
D. A LIGHT-CHAIN GENES Lambda light chains comprise 5-10% of total Ig light chains (Dray et al., 1963b), and because of their low expression in serum, relatively little is known about the proteins. The germline contains a small number of V, and C, genes, and their organization appears similar to that of other mammals (Fig. 2) (reviewed in Selsing et al., 1989). On the basis of Southern analysis, the germline contains up to eight C, genes, six of which are cloned and designated C,l-C,6 (Duvoisin et al., 1986, 1988), but only two of which, c,5 and c,6, appear to be expressed. The c,5 and c,6 genes are separated by 4.7 kb of DNA, and each is associated with a JA gene segment; the other four cloned, but unexpressed C, genes, are not associated with a J, gene segment. Two allotypic specificities, c7 and c21, are associated with A-chains, and, although these allotypes segregate as alleles in some rabbit colonies, they are inherited as linked genes in other colonies (Gilman-Sachs et al., 1969). Hayzer et al. (1987)showed that the CA5 gene encodes the c21 allotype; the gene encoding the c7 allotype is not yet cloned. The germline may well contain another functional J,/C, gene combination that encodes for the c7 allotype. It is not yet known whether all of the J,/C, genes are associated with the same group of VA genes or whether there is more than one cluster of VA-JA/CA genes. By Southern analysis, the germline contains approximately fiveV, genes (Hayzer et al., 1987). Four of these genes are cloned, and two, v,2 and vA3, appear functional. The v$, V,3, and v,4 genes are closely linked to each other but have not yet been linked by cosmid or phage clones to the c,5 and c,6 genes (Hayzer et al., 1987; Hayzer and Jaton, 1989a,b). IV. Development of the Antibody Repertoire
In most mammals, the primary antibody repertoire consists of a vast array of antibodies of diverse specificities formed by combinatorial joining of multiple VH, D, and JH gene segments; association of H and L chains; junctional diversity; and N region addition. Of these,
GENERATING T H E ANTIBODY REPERTOIRE IN RABBIT
195
combinatorial joining is certainly a major contributing factor to the diversity ofthe primary repertoire. In rabbit, the extent to which combinatorial joining can contribute to the generation of antibody diversity and therefore to generation of a diverse primary repertoire is severely limited due to the fact that, although the genome has multiple functional vHgenes, B cells use predominantly one v, gene, VHl, in the VDJ gene rearrangements (Knight and Becker, 1990; Knight, 1992). Rabbit, like chicken, uses somatic gene conversion to generate antibody diversity (Becker and Knight, 1990). Here we examine V, gene usage and the role of somatic diversification in generating the antibody repertoire. Because Knight and Becker (1990)discovered the preferential use of one V, gene in VDJ gene rearrangements while attempting to explain the genetic inheritance of V, allotypes and because, historically, the V, allotypes played an important role in early discussions of antibody diversity (reviewed in Mage, 1981; Kindt and Capra, 1984), we briefly review the enigma posed by the V, allotypes and how the solution of this enigma impacted discussions on the generation of antibody diversity. A. THEVH ALLOTYPEENIGMA With the discovery of VH-region allotypes (Oudin, 1956a, b), rabbit became the species of interest for immunologists studying Ig structure and generation of antibody diversity. The V,a allotypic specificities a l , a2, and a3, are present on approximately 80% of serum Ig heavy chains (Dray e t al., 1963b), and they correlate with particular amino acids at several positions distributed within V, FR1 and FR3 (Mage et al., 1984). These allotypes are inherited in an allelic fashion (Dray e t al., 1963a), and it was this allelic inheritance that was difficult to explain. The argument was that if the germline contained hundreds of V, genes to generate antibody diversity and most of them both encoded the V,a allotype and were expressed in B cells, then we would expect that meiotic recombination among the VHgenes would have shuffled the VHaallotypes such that their allelic behavior would be lost after several generations of progeny. So, the problem was, how could these V, allotypes be encoded by multiple VHgenes and yet be inherited as allelic genes?
B.
VH
GENEUSAGE
1 . Preferential Use of VHl While investigating the V, allotype problem, Knight and Becker (1990) analyzed VDJ gene rearrangements in B cells from leukemic
196
KATHERINE L. KNIGHT AND MARY A. CRANE
E,-myc transgenic rabbits and discovered that the 3'-most VHgene, VHl, was used in most of the VDJ genes (Becker et al., 1990). Because the v H1 gene from the a', a2, and a3 heavy-chain chromosomes encoded the a l , a2, and a3 V, allotypes, respectively, the authors hypothesized that VHf was preferentially utilized in VDJ gene rearrangements in normal B cells and that this preferential utilization explained the allelic inheritance of the VHa allotypes. Support for the idea that VHl was preferentially used in VDJ genes came from studying a mutant rabbit, Alicia, that, practically speaking, is a spontaneously derived V,l knock-out rabbit. The Alicia rabbit, identified by Kelus and Weiss (1986), is genotypically a2/a2and has normal levels of Ig, but the level of a2 Ig is markedly decreased. Analysis of germline DNA from the Alicia rabbit revealed a 10-kb deletion that spanned the a2-encoding gene, VHl (Knight and Becker, 1990; Allegrucci et al., 1990). Thus, the loss of VHl resulted in the loss of VHa2allotype Ig, indicating that most VHa2Ig is probably derived from B cells that utilize vH1 in their VDJ gene rearrangements. Because normally 80-90% of Ig molecules in an a2a2 rabbit are VHa2 (Dray et al., 1963b), it seems that vH1 is preferentially used in VDJ genes in most B cells. Still more confirmation that V,,l is preferentially used in VDJ genes was obtained from studies by Raman et ul. (1994) who examined stable VHa allotypesecreting rabbit x mouse hybridomas developed from fusion of murine SP2/0 cells with adult rabbit spleen cells. In these experiments, eight of nine hybridomas utilized VHl in their VDJ gene rearrangements. Because approximately 80% of serum Ig molecules have V,a allotypic specificities, the finding that eight of nine V,a-secreting B cells from normal rabbits use VHl indicates to us that V,l is the predominantly used V,, gene in rabbit B cells.
2 . Other Utilized V HGenes While approximately 8 0 4 0 % of Ig molecules have VHa allotypic specificities and are encoded by VHl, the remaining 10-20% of Ig molecules do not have V,,a allotypic specificities and are designated VHa-negative(Dray et al., 1963b). The V, genes that encode these V,anegative molecules were studied both in allotype-suppressed rabbits, whose serum Ig molecules were predominantly V,a-negative (Short et nl., 1991), and in mutant Alicia rabbits that predominantly express VHa-negative Ig molecules (DiPietro et al., 1990; Chen e t al., 1993). Short e t al. (1991) developed VHa allotype-suppressed rabbits by injecting newborn a2/a2rabbits with anti-a2 allotype antiserum. They PCR-amplified and cloned the VDJ genes and then examined the V, genes used in the VDJ gene rearrangements. The V, molecules fell into two groups, designated V,x and VHy.A germline counterpart of
GENERATING THE ANTIBODY KEI'ERTOIRE I N KARHIT
197
the VHy gene was cloned and expressed in vitro and shown to encode V, molecules of the y33 allotype, an allotype discovered by Kim and Dray ( 1973) that is associated with V,a-negative molecules. The exact location of the germline V,y-encoding gene is not known, but it is at least 48 k b 5' of VH1. A germline gene encoding V,X molecules has not yet been cloned. In studying the genes encoding the VHa-negative molecules of the Alicia rabbit, DiPietro et al. (1990)and Chen et al. (1993) again found only two major types of Via-negative molecules, VHX
and VHy.
Because some of the studies described above were performed in adult rabbits, after the VDJ genes were somatically diversified, the identity of some of the genes was difficult to establish. Therefore we analyzed VDJ gene rearrangements in young rabbits prior to the time that their VDJ genes would be diversified beyond unequivocal recognition (Friedman et al., 1994). The VDJ genes were PCR-amplified, from cDNA, and we found that all but 2 of 52 VDJ gene sequences utilized v H 1 , V,,x, or V,,y. The other 2 did not appear to encode V,a allotypic determinants, and they presumably encode a minor population of VHa-negativemolecules that were designated V,Z. These data, taken together with data from the leukemic ral)bits, B cell hybridomas, Alicia rabbits, and VHa allotype-suppressed rabbits, indicate that essentially all of the v, repertoire is encoded by 4 vHgenes, VH1,V,X, VHy, and VHZ. Even though the data indicate that V,,1 is the gene used to encode most VHa allotype molecules, the mutant Alicia rabbits and the rabbit x mouse heterohybridonias demonstrate to us that VHaallotype Ig can be derived, albeit infrequently, from a gene other than V,1. In the case of the nine V,,a allotype-secreting rabbit x mouse heterohybridomas, one of them used a gene other than VH1, but its identity and germline location are unknown (Raman et al., 1994). As for Alicia rabbits, despite not having the V,1 gene, up to 30% ofthe Ig molecules in adults express the a2 allotypic specificity. Chen et al. (1993) studied the a2-encoding cDNA molecules from adult Alicia rabbits and found that they fall into two groups, VH1-like and V&-like. Since the Alicia rabbits do not have a V,,1 gene, they must be using another, as-yetunidentified V,, gene. We think it is likely that the a2 Ig molecules result from gene conversion of a V,a-negative-encoding VDJ gene by an upstream V, gene that encodes a2 allotypic determinants.
3. Preferentiul Rearrangement or Selection The preferential usage of V, genes, especially VH1, could be due to preferential V,, gene rearrangement or to antigen selection of B cells that express particular V,, genes. To differentiate between these
198
KATHERINE L. KNIGHT A N D MARY A. CRANE
two possibilities, we need to examine VDJ gene rearrangements in pre-B cells that do not yet have surface Ig expression. Ifthe preferential usage of VHl is due to preferential rearrangement, then we would expect to find that approximately 80% of the VDJ genes utilized VHl, but if the preferential usage is due to selection, then we would expect to find many V, genes rearranged. At present there are no phenotypic markers for pre-B cells in rabbit, and the best source of pre-B cells is neonatal bone marrow. Therefore, Friedman et al. (1994) began to investigate V, gene usage in VDJ genes of bone marrow and spleen cells of newborn rabbits. The authors found that 80% of the VDJ genes cloned from these tissues utilized VHl, and they suggested that preferential usage of vH1 is due to preferential rearrangement rather than to selection. To directly test this idea, these experiments need to be repeated with purified pre-B cells. C. SOMATIC DIVERSIFICATION
1 . Somatic Gene Conversion As mentioned previously, the predominant usage of V H l in VDJ gene rearrangements in rabbit severely limits the extent to which combinatorial joining can contribute to the generation of antibody diversity. The chicken rearranges only one V, and one V, gene, and the rearranged VDJ and VJ genes extensively diversify by somatic gene conversion (Reynaud et al., 1985, 1987, 1989; Thompson and Neiman, 1987; McCormack and Thompson, 1990b).Therefore, Becker and Knight tested whether the rabbit VDJ genes diversify by somatic gene conversion by comparing the nucleotide sequences of diversified VDJ genes with the nucleotide sequence of the germline vH1 gene (Becker and Knight, 1990). They found many examples of diversified VDJ genes, and the diversification included codon insertions and deletions as well as clusters of mutations. Such codon insertions and deletions do not occur by somatic point mutation; rather, they are characteristic of gene conversion. If such mutations resulted from gene conversion, the germline must contain donor V, genes upstream of VHl that have nucleotide sequences identical to the diversified regions. In searching the database of nucleotide sequences of rabbit germline V, genes, Becker and Knight (1990) and Raman et al. (1994) identified several examples in which the nucleotide sequence of the diversified region was identical to a region of a donor VHgene 5’ of vH1 (Fig. 3 ) .We conclude that rabbit uses a somatic gene conversion-like mechanism as a means of generating antibody diversity. In chicken, diversification of the rearranged V, and V, genes occurs by somatic gene conversion during fetal development (McCormack
GENERATING THE ANTIBODY REPERTOIRE IN RABBIT
199
Leader lntron v,1 10-6 V,,b V,l 10-6 V,&
cgnngcactgagtctgggagaggacgtgagtgagagacacagacagtgtgagtgacag/tacctgaccatgtcgtctgtgttttcag
- c - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -9-~"~---~-~--'C-f---------------------g---~----------------------t----.------------- g-~--'--------'C-t------------t---------- 9 - - -1 FRl GT GTC CAG TGT CAG / / I TCG T T G GAG
-- _ _ _ - - _ _ _ _ _ _ _ -- _ _ _ _ _ _ _ _ _ _ _ _
GAG CA- C - GAG CA- C - -
_--
---
FIG.3. Somatic gene conversion of VHl-utilizingVDJ genes. (A) Diversified region of VDJ gene 15-23 spanning 142 bp from the leader intron through FR1, with germline V& as a potential donor gene. (B) Diversified region of VDJ gene 30-10 spanning 103 bp from the leader intron through FR1 with germline vH3 as a potential donor gene. (C) Diversified region of VDJ gene 10-6 spanning 113 bp from the leader intron through codon 5, with germline vH4 as a potential donor gene. Sequence ofthe utilized VH1gene is shown above the diversified sequence and the sequences of the potential donor genes are shown below the diversified gene. (Data are taken from Raman et ~ l , 1994.) Numbers refer to codon numbers according to Kabat et d. (1987).
and Thompson, 1990b) and the chick is born with a diverse primary antibody repertoire. To examine the timing of gene conversion and development of the primary antibody repertoire in the rabbit, VDJ gene rearrangements were examined from lymphoid tissues taken from various organs of rabbits ranging in age from newborn to 2 months old. The VDJ gene rearrangements were cloned and compared to germline V , 1 . In rabbits that were 1-10 days old, the sequences were generally undiversified (Fig. 4), indicating that the gene conversion process had not yet begun in these animals (Friedman et al., 1994). At 4-5 weeks of age, the sequences are stiIl mostly undiversified, although there are some indications of diversification (Crane and
FRl
VH1-a2 599 579 583 675 681 715
CDRl
FR2
Q S V K E S E G G L F K P T D T L T L T C T V S G F S L S S N A I S U V R Q A P UGTCGGTCMGGAGTCCGAGGGAGGTCTCTTCMGCCMCGGATACCCTGA~CT~CCTGU~GTCTCTGGATTCTCCCTCAGTAGCMTGCMTMGCTGGGTCCGC~G~TC~
........................................................................................................................ ........................................................................................................................ ........................................................................................ c............................... ........................................................................................................................ ........................................................................................................................ ........................................................................................................................ G
N
G
L
E
U
I
CDR2 G A
I
G
S
S
G
S
A
Y
Y
A
S
U
A
K
FR3 S R
S
T
I
T
R
N
T
N
L
N
T
V
T
L
K
VH1-a2 599 579 583 675 681 715
GGCMCGGGCTGWATGWTCGWGCCATTGGTAGTAGTGGTAGCGCATACTACGCGAGCTGGGCGAAAAGCCGATCCACCATUCCAGAMCA~CAC~CCTCM~CGGTGACTCT~
VM1-a2 599 579 583 675
ATGACCAGTCTGACAGCCGCGGACACGGCCACCTATTTCTGTGCGAGA
681 715 599 579 583
675 681 715
.....G........................................................G.
............................................................................................ G......................C.... ........................................................................................................................ ........................................................................................................................ ........................................................................................................................ ........................................................................................................................ M
T
S
L
T
A
A
D
T
A
T
Y
F
C
A
R
N-SEG
................................................ ................................................ ................................................ ................................................ ................................................ ................................................
............................... .................................. .................................... .................................... ............................... ....................................... J"
GGA
GATG GATTCCCC TTGAGGGT
GGG
GGC D2a D1 D1 D5 D1 D2b
D"
....................................... ...................... ...................
....................... .............. ...........................
54 J4 J4 J2 J4 J3
FIG.4. Comparison of the nucleotide sequence of germline V H lto the sequences of six VDJ gene rearrangements isolated from cDNA derived from spleen and bone marrow of newborn to 10-day-old rabbits. The germline D and J gene segments used in each VDJ gene rearrangement are indicated. Dots indicate identity. Framework (FR) and complementarity-determining regions (CDR) are according to Kabat et a / . (1987).The nucleotide sequence analyses were performed in only one orientation, J to V.
N-SEG CGA CTTMG CCCTAC AC
cccccc
GENERATING T H E ANTIBODY REPEHTOIHE IN RABBIT
20 1
Knight, unpublished data). At 7-8 weeks of age, the sequences are very diversified (Fig. 5).Much ofthe diversification is consistent with the types of mutations seen in gene conversion events, i.e., codon insertions, codon deletions, and clusters of nucleotide changes. By 2-3 months of age, the VDJ gene rearrangements resemble those seen in adult rabbits in terms of the amount of diversification and, to date, all VDJ genes that have been examined from rabbits 2 months of age or older are diversified, whether they were cloned from PBL, spleen, or appendix. Taken together, the data show that the newborn and young rabbit have relatively undiversified VDJ gene rearrangements, resulting in a limited repertoire. Beginning at about 1 month of age, the somatic gene conversion-like process begins diversifying the initial limited repertoire such that another repertoire is created that is far more diverse than the original. We suggest that this repertoire functions as the primary antibody repertoire and bestows imniunocompetency on the rabbit. We currently do not know whether the gene conversion-like process is antigen-driven or whether it is initiated developmentally, independent of antigen stimulation. Experiments with germfree rabbits could begin to address this issue, at least in terms of the involvement ofmicrobial antigens. Regardless, we suggest that somatic gene conversion is a major mechanism by which rabbit VDJ genes diversify and form the primary antibody repertoire.
2. Somatic Mutution
The D regions of VDJ genes from adult rabbits are quite remarkable because, in general, they are all distinct from one another and they often do not resemble any of the known germline D gene segments (DiPietro and Knight, 1990). In contrast, the D regions of VDJ genes from newborn rabbits are identical to the known germline D gene segments. We conclude that the D regions in VDJ genes of adult rabbits are highly diversified. The D regions are probably diversified by somatic mutation rather than by gene conversion for the following reasons: First, no segments of germline DNA have been found that could function as potential donor sequences for the diversified D regions. Whereas, in chicken, the donor sequences for the D regions are fused with the upstream nonfunctional donor V,, genes (Reynaud et al., 1989), in rabbit, no such ftised germline VD genes have been found (Bernstein et al., 1985; McCormack et ul., 1985; Currier et ul., 1988; Fitts and Metzger, 1990; Knight and Becker, 1990; Roux et d . , 1991; Raman et ul., 1994). Next, analysis of D regions of VDJ genes from newborn to 9-week-old rabbits showed progressive diversification between 3 and 9 weeks of age (Short et d . , 1991). During this
coal FR2 S V K E S E G G L F K P T D T L T L T C T V S G F S L S S N A I S U V R P CAG///TCGGTGAAGWGTCCGAGG~GGTCTCTT~GC~CGGATACCCTGA~CTCACCTG~~GTCTCTGGATTCTCCCT~GTAGC///MT~TMGCT~GTCCGC~G G.C..........T...G.G.G.T............. GAGcA.C T...G.G.G............... C......T.C.AC..G............... G.. C..GG. C. A..T........AGCT.CTGG...T.......-...... FRl
VH1-a2
754 759 760 761 762 763
VH1-a2
754 759 760 761 762 763
VH1-a2
754 759 760 761 762 763
754 759 760 761 762 763
a
................................................................................... ... ...................................................................................... ......................................................................................... ...................... .... ................................... ......... ........................................................................................................................ ................................................................................................ T.CTAC..G...............
CDR2 FR3 A P G N G L E U I G A I G S S G S A Y Y A S Y A K S R S T I T R N T N L N T GCTCCAGGGMCGGGCTGCMTGGATCGGAGCCATT//////GGTAGTAGTGGTAGCGCATACTACGCGAGCTGGGC~GCCGATCCAC~T~C~~~C~CCT~cACG G A........A..........................................................GA....... C.G A........................................................C..... G G.........TG....TATGCT...............A....T...C.........T...TG......T...TC..T.....G...T.G...A..G... A G. G-........ TG TATACT A..C...............T...TG.T T.T.....T.....G.G.A..C..A.......
........... ............................... .............................................. ........ ........... ........ ........... ....... .... ............... .... ........................................................................................................................ ...................... AC ......TT ..........A.....G...... .................................................................
V T L K M T S L T A A D T A T Y F C A R GTGACTCTCAMATGACCAGTCTGACAGCCGCGGACACGGCUCCTATTTCTGTGCGAGA
........................... CG.................... ........... ............G....................... ........................ .GTTGC ..AC..C...A. .....A. ..................TG....A.......... ...T. ....C......A..... .....C.T .............................. ............................ T..... .......................... ............................................................ ..T..... ............................... ..A..... .................................. ...................................... JH
.............T..... ............................ ...................................... ......................................
D5 D2b D2b D3
D4
D2a
DH
I-SEG GGG
GGAGGGG
GacGG
GGGGGG
..........A.. .............G.... ....A....A.....AT..C....... .......... ..A.
A...C..
................ ..M..C.....A......
I-SEG
GGATMGCGCCTTT CcA GGGGCTTGTG CTCCATT GTG
54 54 54 J4 J4 54
FIG.5. Comparison of the nucleotide sequence of germline VH1to the sequences of six VDJ gene rearrangements isolated from peripheral blood lymphocyte cDNA from 7- to 8-week-old rabbits. For additional details, see legend to Fig. 4.
GG
GENERATING T H E ANTIBODY REPERTOIRE IN RABBIT
203
time, the mutations accumulated as one could expect point mutations to accumulate, and no evidence for codon insertions or deletions was found. The authors concluded that the D region diversified primarily by somatic mutation rather than by somatic gene conversion. We cannot however rule out the possibility that the D regions are diversified by exonuclease activity followed by N region addition. It is nearly impossible to determine whether, in addition to being diversified b y somatic gene conversion, the V regions of the VDJ genes are diversified by somatic mutation. This is because the single nucleotide changes characteristic of point mutations can also occur by gene conversion if the “conversion track” of the donor gene differs from the rearranged VH gene by only one or a small number of nucleotides. We consider it likely that somatic mutation contributes to diversification of the VH region because we have evidence both that the JH regions of the VDJ genes are diversified, albeit at a low frequency, and that somatic mutations occur in the region immediately 3‘ of VDJ genes, in the 3‘-JH region (M. Kingzette and K. L. Knight, unpublished data). Although the frequency of mutations in the JH region is not known for the rabbit VDJ genes, several investigators showed that somatic mutation does extend 3’ of the D region in mouse (Both et ul., 1990; Lebecque and Gearhart, 1990; Hackett et al., 1990; Weber et ul., 1991). The large amount of somatic diversification in the D region compared with that in the JH and 3‘-JHregions is striking. At present, we do not know whether the mutation mechanism specifically targets the D region for mutation or whether the frequency of mutation in D is similar to that in the V and/or JH region. If the frequencies are similar, then perhaps the B cells with diversified D regions are selected for expansion, whereas the B cells with mutations in the JH region either have no selective advantage or are selected against. V. GALT and the Antibody Repertoire
Early in embryogenesis of chickens, cells migrate to the bursa of Fabricius, and their V, and V, genes undergo diversification by somatic gene conversion (Reynaud et ul., 1987, 1989). Within the bursa are highly developed follicles that play an important role in this diversification process and, therefore, in the development of the primary antibody repertoire. Because the follicular structure of the rabbit GALT, notably the appendix, resembles that of the bursa and because rabbit VDJ genes also diversify by somatic gene conversion, we are investigating whether the rabbit GALT is functionally equivalent to the avian bursa. If so, GALT may be the site in which the primary
204
KATHERINE L. KNIGHT AND MARY A. CRANE
antibody repertoire develops in rabbit. In this section, we review the early literature describing investigations to determine whether rabbit GALT was the mammalian bursal equivalent and we review studies of germfree rabbits that demonstrate the relationship between the development of GALT and the development of the immune response. Finally, we propose a model for the role of GALT in the development of the primary antibody repertoire in rabbit.
BURSALEQUIVALENT Because Glick (1956) showed the importance of the bursa in B lymphocyte differentiation in chicken, Max Cooper, Robert A. Good, and their associates began to search for a bursal equivalent in mammals (Archer et al., 1963; Cooper et al., 1966).They began their search in rabbit, focusing their attention on GALT because its follicular organization resembles that of the bursa. The appendix is very large in the rabbit and contains approximately 2 x lo9 lymphoid cells. In their studies, they surgically removed the appendix alone, or the appendix, sacculus rotundus, and Peyer’s patches from newborn rabbits and found that these rabbits were remarkably immunocompromised (Cooper et al., 1968). They found decreased antibody responses to bovine serum albumin (BSA), O-agglutinins, and H-agglutinins but not to SRBC. In addition, they saw decreased levels of circulating Ig and circulating lymphocytes, as well as a dramatically decreased survival rate for the rabbits who had their GALT removed. Although these experiments supported the notion that GALT could be the mammalian equivalent of the bursa, studies by Thorbecke and colleagues (Durkin et al., 1975) showed that the appendix was a “peripheral” lymphoid organ rather than a primary or central lymphoid organ. However, we suggest that, in rabbit, the appendix, although not a primary lymphoid organ, such as bone marrow or thymus, may be the site of somatic diversification ofV, and V,genes just as the bursa is in chicken. Recent data obtained from analyzing VDJ genes in germinal centers of rabbit appendix support this idea (P. Weinstein and R. Mage, NIH, personal communication). As such, we suggest that, in rabbit, the appendix may serve as the “bursal equivalent.” A. GALT
AS
B. GALT AND GERMFREE RABBITS Scientists at the Lobund Institute at the University of Notre Dame initiated much of the early work with germfree animals, by establishing conditions that make it possible to successfully establish reproducing colonies of these animals (Pleasants, 1959; Reyniers, 1959). Histori-
GENERATING T H E ANTIBODY REPERTOIRE I N RABBIT
205
cally, these germfree rabbits were used to examine the interactions of microbes with their hosts. In particular, immunologists were interested in the development of the immune systems in animals lacking both a normal microbial flora as well as pathogenic organisms. Stepankov5 and Kov5r;i (1978, 1985) in Prague developed germfree rabbits and studied their immune responses. First, this group looked at the histology of the lymphoid organs and found that, although the thymus appeared normal, the mesenteric lyinph node, spleen, appendix, and sacculus rotundus were poorly developed. Until the age of 34 months, no germinal centers were found in the secondary lymphatic tissue, and comparison of the appendix from germfree rabbits with the appendix from normal rabbits showed a marked decrease in development of the follicular lymphatic tissue, including a large decrease in the number of lymphoblasts and small lymphocytes. Therefore, it appears that a normal microbial flora is necessary for the development ofsecondary lymphatic tissue in the rabbit. To determine how the lack of a normal microbial flora affected the immune response, Tlaskalovh-Hogenovh and Stephnkovh (1980) also examined the appearance of “naturally occurring” antibodies as well as antibodies formed in response to immunization with antigen in germfree rabbits and compared it with that of conventional rabbits. Whereas, in the GALT of normal rabbits, antibacterial PFCs begin to appear by 4 weeks of age and increase in number until at least 12 weeks ofage, no antibacterial PFCs are found in the GALT of gernifree rabbits, even as late as 16 weeks of age. Similarly, germfree rabbits immunized with either Escherichici coli or SRBC do not form antibodies to these antigens, whereas normal rabbits readily form a PFC response to E . coli after immunization at either 6 or 16 weeks of age. In this way, germfree rabbits resemble newborn rabbits, which also show a decreased ability to respond to antigen. Although the effect was not as striking as when SRBC were used as the iniinunogen, the germfree rabbits did respond to a lesser degree than did normal rabbits. In summary, germfree rabbits have highly underdeveloped secondary lymphoid tissue, do not develop natural antibacterial and hemolytic antibodies, and either are unresponsive to immunization with antigen or have markedly deficient immune responses. Therefore, it is clear that the microbial flora plays an essential role in development o f t h e humoral immune response and in the development of the lymphoid tissue itself. Perhaps these events are actually interdependent, S O that the microbes stimulate the development of the GALT and then B cells migrate there to differentiate. Conversely, the B cells may recognize bacterial antigens, proliferate, and begin to populate the GALT. In
206
KATHERINE L. KNIGHT AND MARY A. CRANE
either case it is clear that a normal microbial flora is critical for the development of an immunocompetent rabbit.
c. MODELFOR THE ROLE OF GALT IN DEVELOPMENT OF THE ANTIBODYREPERTOIRE
In this section, we present a model for how the rabbit humoral immune system develops (Fig. 6). During fetal development, the neonatal repertoire is formed from the association of L chains with a restricted set of H chains that are encoded by VDJ genes that primarily use V H land one of six D gene segments, with each D gene segment used preferentially in one reading frame (Table 111).Although we do not know the extent of diversity among L chains, even if the L-chain repertoire is rather diverse, the total antibody repertoire would still be limited, because of the restricted H-chain repertoire. The limited neonatal repertoire may explain, in part, why rabbits are essentially immunoincompetent at birth. Coinciding with this immunoincompetence is the fact that, at birth, the peripheral lymphoid tissues, especially GALT, are undeveloped. As the lymphoid compartment of GALT begins to develop 1-2 weeks after birth, we postulate that B cells with undiversified VDJ gene rearrangements migrate, presumably from the bone marrow to GALT where they proliferate and undergo diversification by somatic gene conversion and somatic Neonatal Repertoire
Fetal Liver/Bone MarrowlOmentum
VD / DJ / VDJ rearrangements
+
Reading Frame Selection
Periphery
Migration to appendix & sacculus rotundus after birth
Primary Repertoire
Appendix & Sacculus Rotundus Interaction with Bacterial antigen
Gene Conversion
Follicle Formation
\
1
Antigen
&
Periphery
Secondary Repertoire
FIG.6. Model for development of the antibody repertoire in rabbit.
GENERATING THE ANTIBODY REPERTOIRE IN RABBIT
207
TABLE I11 READING FRAME (RF) OF D REGIONSI N 44 FUNCTIONAL VDJ GENES FROM NEWBORNRABBITS D
RF1
RF2
RF3
D1 D2a D2b D3 D4 D5
0 1 1 4" 0 0
8"
0 12"
1 0 0 0 0
90
0 2" 6"
~
' Preferred RF.
mutation. We postulate first that, by the time the rabbit is 6-8 weeks of age, this process generates a repertoire of VDJ gene rearrangements that form the functional or primary repertoire in the rabbit, and second that this repertoire makes the rabbit immunocompetent. Further, because we suggest that B cell development occurs early in ontogeny and that little, if any, B lymphopoiesis occurs in adults, this primary repertoire is maintained for the life of the rabbit. There are several reasons why we think that GALT is involved in generating the primary antibody repertoire in rabbit. One is the ontogenetic relationship between the development of GALT and the development of immunocompetency. Shortly after birth, GALT undergoes extensive follicular development resembling that seen in the bursa, and, subsequently, the rabbit develops immunocompetence. Second, the studies of Cooper and Good and colleagues showed that removing GALT from newborn rabbits profoundly decreased their immune response (Cooper et at., 1968).We suggest that, in the absence of GALT, somatic diversification does not occur and the primary antibody repertoire does not develop. The only repertoire available to the rabbits would then be the limited neonatal repertoire. Finally, the studies of Tlaskalova-Hogenova and Stepankova and colleagues showed that germfree rabbits have an undeveloped GALT and a markedly decreased immune response (Stepankova and Kova& 1978,1985; Tlaskalovh-Hogenova and Stepankova, 1980).Together, these studies strongly suggest to us that GALT plays a critical role in generating the antibody repertoire that allows the rabbit to develop a primary immune response. The germfree studies mentioned above also suggest that microbes are directly or indirectly essential for the development of the primary antibody repertoire. We propose that undiversified sIg binds bacterial
208
KATHERINE L. KNIGHT A N D MARY A. CRANE
antigen in GALT and that this interaction results in proliferation of the B cells and diversification of the Ig genes by both somatic gene conversion and somatic mutation. While it is also possible that the B cells are encountering a self-antigen in the GALT or that some other mechanism is stimulating the B cells, we favor the idea that the B cells are directly interacting with the microbes. In any case, the idea that most B cells encounter antigen early in ontogeny is consistent with the observation that by the time the rabbit is 2-3 months old, essentially all VDJ genes are diversified. After the Ig genes are somatically diversified in GALT, we suggest that the B cells enter the periphery and that, because they are selfrenewing, they maintain the primary repertoire. Once these B cells encounter antigen, they undergo affinity maturation by additional diversification of their Ig genes. This diversification presumably occurs in germinal centers of secondary lymphoid tissues and results in formation of the secondary antibody repertoire. We think this round of diversification occurs predominantly by somatic mutation, although we cannot rule out the possibility that somatic gene conversion is also involved. Our model has three major tenets: (1) that B cells develop early in ontogeny and are self-renewing, (2) that GALT is the site at which the primary antibody repertoire develops, and ( 3 )that normal microbial flora is necessary for development of the primary antibody repertoire. These tenets give rise to several testable predictions:
1. If all B cells develop early in ontogeny and are self-renewing, then few, if any, B cells are produced in adult rabbits. We can test for B lymphopoiesis in adult bone marrow and we can test whether peripheral B cells can repopulate irradiated recipients. 2. If GALT is the site at which the primary antibody repertoire develops, then removal of the GALT before the primary repertoire develops should leave the rabbit with the neonatal repertoire. This can be tested by examining VDJ gene rearrangements in rabbits that have had their GALT removed shortly after birth. If this prediction is accurate then most of the VDJ genes would remain undiversified. Further, if our prediction is accurate and GALT is the site to which B cells migrate and undergo VDJ gene diversification, then we can begin to look for homing receptors on B cells that would target their migration to GALT. 3 . If the normal microbial flora is necessary for development of the primary antibody repertoire, then we predict that germfree rabbits will have an undiversified neonatal repertoire. This can be tested by
GENERATING THE ANTIBODY REPERTOIRE IN RABBIT
209
examining VDJ genes in germfree rabbits. If this prediction is accurate, then we can begin to determine the mechanism by which bacteria mediate this process. VI. Summary
We describe a model for B cell development and generation of the antibody repertoire in rabbits. In this model, B cells develop early in ontogeny, migrate to GALT, and undergo the first round of diversification by a somatic gene conversion-like process and by somatic mutation. We designate the repertoire developed by this mechanism as the primary antibody repertoire and it is this repertoire that makes the rabbit inimunocompetent. We invoke GALT as the site for development of the primary repertoire because (1)surgical removal of GALT from neonatal rabbits results in highly immunocompromised animals, (2) in germfree rabbits essentially no lymphoid development occurs in GALT and the rabbits are immunoincompetent, and ( 3 )the follicular development of rabbit GALT is highly similar to that of the chicken bursa, the site in which the primary antibody repertoire develops by somatic gene conversion in chicken. We suggest that once the primary antibody repertoire is formed, it is maintained by self-renewing CD5+ B cells and is expanded to a secondary antibody repertoire after the B cells encounter antigen.
REFERENCES Allegrucci, M., Newman, B. A., Young-Cooper, G . O., Alexander, C. B., Meier, D., Kelus, A. S., and Mage, R. G. (1990).Altered phenotypic expression ofimmunoglobulin heavy-chain variable-region (V,) genes in Alicia rabbits probably reflects a small deletion in the V, genes closest to the joining region. Proc. Nut!. Acad. Sci. f f . S . A . 87, 5444. Allegrucci, M., Young-Cooper, G. O., Alexander, C . B., Newman, B. A,, and Mage, R. G . (1991). Preferential rearrangement in normal rabbits of the 3' VHaallotype gene that is deleted in Alicia mutants: Somatic hypermutatiodconversion may play a major role in generating the heterogeneity of rabbit heavy chain variable region sequences. Eur. J. Immunol. 21, 411. Angiolillo, A. L., Lamovi, E., Bernstein, K. E., and Mage, R. G. (1985).Identification of genes for the constant region of rabbit T-cell receptor p chains. Proc. Natl. Acad. Sci. U.S.A.82, 4498. Archer, 0. K., Sutherland, D. E. R., and Good, R. A. (1963). Appendix of the rabbit: A homologue of the bursa in the chicken? Nature (London)200, 337. Banchereau, J., d e Paoli, P., Valle, A., Garcia, E., and Rousset, F. (1991). Long-term human B cell lines dependent on interleukin-4 and antibody to CD40. Science 251, 70. Becker, R. S., and Knight, K. L. (1990).Somatic diversification of immunoglobulin heavy
210
KATHERINE L. KNIGHT A N D MARY A. CRANE
chain VDJ genes: Evidence for somatic gene conversion in rabbits. Cell (Cambridge, Mass.) 63, 987. Becker, R. S., Zhai, S. K., Currier, S. J., and Knight, K. L. (1989). Ig VH, DH and JH germ-line gene segments linked by overlapping cosmid clones of rabbit DNA. J. Zmmunol. 142, 1351. Becker, R. S., Suter, M., and Knight, K. L. (1990). Restricted utilization of V, and DH genes in leukemic rabbit B cells. Eur. J. Zmmunol. 20, 397. Benammar, A., and Cazenave, P.-A. (1982). A second rabbit K isotype. J. E x p . Med. 156, 585. Bernstein, K. E., Reddy, E. P., Alexander, C. B., and Mage, R. G. (1982). A cDNA sequence encoding a rabbit heavy chain variable region ofthe VHa2 allotype showing homologies with human heavy chain sequences. Nature (London)300, 74. Bernstein, K. E., Alexander, C. B., and Mage, R. G. (1983a). Nucleotide sequence of a rabbit IgG heavy chain from the recombinant F-Z haplotype. Zmmunogenetics 18, 387. Bernstein, K. E., Pavirani, A., Alexander, C., Jacobsen, F., Fitzmaurice, L., and Mage, R. (198313). Use of Trypanosoma equiperdum infected rabbits as a source of splenic mRNA: Construction of cDNA clones and identification of a rabbit p heavy chain clone. Mol. Zmmunol. 20,89. Bernstein, K. E., Skurla, R. M., Jr., and Mage, R. G. (1983~).The sequences of rabbit K light chains of b4 and b5 allotypes differ more in their constant regions than in their 3' untranslated regions. Nucleic Acids Res. 11, 7205. Bernstein, K. E., Alexander, C. B., and Mage, R. G. (1985). Germline VHgenes in an a3 rabbit not typical of any one V,a allotype. J . Zmmunol. 134, 3480. Both, G. W., Taylor, L., Pollard, J. W., and Steele, E. J. (1990). Distribution of mutations around rearranged heavy-chain antibody variable-region genes. Mol. Cell. Biol. 10, 5187. Bridges, R. A., Condie, R. M., Zak, S. J., and Good, R. A. (1959).The morphologic basis of antibody formation development during the neonatal period. J. Lab. Clin. Med. 53, 331. Brodeur, P. H., and Riblet, R. (1984).The immunoglobulin heavy chain variable region (Igh-V) Iocus in the mouse. I. One hundred Igh-V genes comprise seven families of homologous genes. Eur. J. Zmmunol. 14,922. Briiggemann, M., Free, J., Diamond, A., Howard, J., Cobbold, S., and Waldmann, H. (1986). Immunoglobulin heavy chain locus of the rat: Striking homology to mouse antibody genes. Proc. Natl. Acad. Sci. U.S.A.83,6075. Burnett, R. C., Hanly, W. C., Zhai, S. K., and Knight, K. L. (1989). The IgA heavy-chain gene family in rabbit: Cloning and sequence analysis of 13 C a genes. EMBO J. 8, 404 1. Calabi, F., Belt, K. T., Yu, C. Y., Bradbury, A., Mandy, W. J., and Milstein, C. (1989). The rabbit CD1 and the evolutionary conservation ofthe CD1 gene family. Zmmunogenetics 30, 370. Catty, J. P., Hole, N. J., and Catty, D. (1985). Presence of ~2 light chain in normal rabbits and as induced auto anti-allotype antibody in ~1light chain suppressed subjects. Mol. Zmmunol. 22,949. Chen, H. T., Alexander, C. B., Young-Cooper, G. O., and Mage, R. G. (1993). VH gene expression and regulation in the mutant Alicia rabbit: Rescue of VHa2 allotype expression. J. Zmmunol. 150, 2783. Chouchane, L., Brown, T. J., and Kindt, T. J. (1993). Structure and expression of a nonpolymorphic rabbit class I1 gene with homology to HLA-DOB. Zmmunogenetics 38, 64.
GENERATING T H E ANTIBODY R E P E R T O I R E I N RABBIT
21 1
Clarke, S . H., Huppi, K., Ruezinsky, D., Staudt, L., Gerhard, W., and Weigert, M. (1985). Inter- and intraclonal diversity in the antibody response to influenza hemagglutinin. J . E x p . Med. 161, 687. Cooper, M. D., and Burrows, P. D. (1989). B-Cell Differentiation. In “Immunoglobulin Genes” (T. Honjo, F. W. Alt, and T. H. Rabbitts, eds.), p. 1. Academic Press Ltd., London. Cooper, M. D., Perey, D. Y., McKneally, M. F . , Gabrielsen, A. E., Sutherland, D. E. R., and Good, R. A. (1966). A mammalian equivalent of the avian bursa of Fabricius. Lancet 1(452), 1388. Cooper, M. D., Perey, D. Y., Gabrielsen, A. E., Sutherland, D. E. R., McKneally, M. F., and Good, R. A. (1968).Production ofan antibody deficiency syndrome in rabbits by neonatal removal of organized intestinal lymphoid tissues. Int. Arch. Allergy 33, 65. Currier, S. J., Gallarda, J. L., and Knight, K. L. (1988). Partial molecular genetic map of the rabbit V, chromosomal region. J . Imtnunol. 140, 1651. De Smet, W., Vaeck, M., Smet, E., Brys, L., and Hamers, R. (1983). Rabbit leukocyte surface antigens defined by monoclonal antibodies. Eur. J . Inmunot. 13,919. DiPietro, L. A., and Knight, K. L. (1990). Restricted utilization of germ-line VH genes and diversity of D regions i n rabbit splenic Ig mRNA. J . Imnunol. 144, 1969. DiPietro, L. A,, Short, J . A,, Zhai, S . K., Kelus, A. S.,Meier, D., and Knight, K. L. (1990).Limited number of immunoglobulin V, regious expressed in the mutant rabbit “Alicia.” E u r . J . Irnmunol. 20, 1401. Dixon, F. J., and Weigle, W. 0. (1959). The nature o f t h e immunologic inadequacy of neonatal rabbits. J. E x p . Med. 110, 139. Dray, S., Young, G. O., and Gerald, L. (1963a). Inimunochernical identification and genetics of rabbit y-globulin allotypes. J . Immunol. 91, 403. Dray, S., Young, G. O., and Nisonoff. A. (19633b). Distribution of allotypic specificities among rabbit y-globulin molecules genetically defined at two loci. Nature (London) 199, 52. Dreher, K. L., Einorine, L., Kindt, T. J., and Max, E . E. (1983). cDNA clone encoding a complete rabbit immunoglobulin K light chain of b4 allotype. Proc. Nut/.Acad. Sci. U.S.A. 80,4489. Durkin, H. G., Caporale, L., and Thorbecke, G. J . (1975). Migratory patterns of B lymphocytes. I. Fate of cells from central and peripheral lymphoid organs in the rabbit and its selective alteration by anti-immunoglobulin. Cell. Imrnunol. 16, 285. Duvoisiu, R. M., Kocher, H. P.. Garcia, I., Rougeon, F., and Jaton, J.-C.(1984).Nucleotide sequence of a cDNA encoding the constant region of a rabbit imniunoglobulin light chain of the A type. E u r . J . Imwiunol. 14, 379. Duvoisin, R. M., Heidmann, O., and Jaton, J.-C. (1986).Characterization offour constant region genes of rabbit iminunoglobulin-A chains. J . Inzmunol. 136, 4297. Duvoisin, R. M., Hayzer, D. J., Belin, D., and Jaton, J.-C. (1988). A rabbit Ig A L chain C region gene encoding C21 allotypes. J . Immunol. 141, 1596. Emorine, L., and Max, E. E. (1983). Structural analysis o f a rabbit immunoglobulin K2 J-C locus reveals multiple deletions. Nucleic Acids Res. 11, 8877. Ernorine, L., Dreher, K., Kindt, T. J., and Max, E. E. (1983). Rabbit immunoglobulin K genes: Structure of a germline b4 allotype J-C locus and evidence for several b4related sequences in the rabbit genome. Proc. Natl. Acad. Sci. U.S.A. 80, 5709. Eskinazi, D. P., Bessinger, B. A,, McNicholas, J . M., Leary, A. L., and Knight, K. L. (197Ya). Expression of an unidentified immunoglobulin isotype on rabbit Ig-bearing lymphocytes. J . Imnaunol. 122, 469.
212
KATHERINE L. KNIGHT A N D MARY A. C R A N E
Eskinazi, D. P., Knight, K. L., and Dray, S. (1979b). Kinetics of escape from supression of Ig heavy chain allotypes in multiheterozygous rabbits. Eur. ]. Immunol. 9, 276. Fitts, M. G., and Metzger, D. W. (1990). Identification of rabbit genomic Ig-vH pseudogenes that could serve as donor sequences for latent allotype expression. ], Inmunol. 145, 2713. Flanagan, J. G., and Rabbitts, T. H. (1982). Arrangement of human immunoglobulin heavy chain constant region genes implies evolutionary duplication of a segment containing y, E and a genes. Nature (London)300,709. Forster, I., and Rajewsky, K. (1987). Expansion and functional activity of Ly-1' B cells upon transfer of peritoneal cells into allotype-congenic, newborn mice. Eur. ]. Zmmunol. 17, 521. French, D. L., Laskov, R., and Scharff, M. D. (1989). The role ofsomatic hypermutation in the generation of antibody diversity. Science 244, 1152. Freund, J. (1930). Influence of age upon antibody formation.]. Zmmunol. 18,315. Friedman, M. L., Tunyaplin, C., Zhai, S. K., and Knight, K. L. (1994). Neonatal VH, D and JH gene usage in rabbit B-lineage cells. J . Imrnunol. 152, 632. Furutani, Y., Notake, M., Yamayoshi, M., Yamagishi, J., Nomura, H., Ohue, M., Furuta, R., Fukui, T., Yamada, M., and Nakamura, S. (1985). Cloning and characterization of the cDNAs for human and rabbit interleukin-1 precursor. Nucleic Acids Res. 13,5869. Fuschiotti, P., Harindranath, N., Mage, R. G., McCormack, W. T., Dhanarajan, P., and Roux, K. H. (1993). Recombination activating genes-1 and -2 of the rabbit: Cloning and characterization of germline and expressed genes. Mol. Zmmunol. 30, 1021. Calea-Lauri, J., Blackford, J., and Wilkinson, J. M. (1993a). The expression of CD11/ CD18 molecules on rabbit leucocytes: Identification of monoclonal antibodies to CD18 and their effect on cellular adhesion processes. Mot. Intmunot. 30,529. Galea-Lauri, J., Wilkinson, J . M., and Evans, C. H. (1993b). Characterization of nionoclonal antibodies against rabbit CD44: Evidence of a role for CD44 in modulating synoviocyte metabolism. Mol. Zmmunol. 30, 1383. Gallarda, J. L., Gleason, K. S., and Knight, K. L. (1985). Organization of rabbit immunoglobulin genes. I. Structure and multiplicity of germ-line VH genes.]. Zrnmunol. 135, 4222. Garcia, I., Brandt, D. C., Benammar, A., Cazenave, P.-A., and Jaton, J.-C. (1982). BASZLEA rabbits express two types of immunoglobulin light chains: A and K-like. Proc. Natl. Acad. Sci. U.S.A. 79, 4391. Gathings, W. E., Mage, R. G., Cooper, M. D., Lawton, A. R., and Young-Cooper, G. 0. (1981). Immunofluorescence studies on the expression of V" a allotypes by pre-B and B cells of homozygous and heterozygous rabbits. Eur. J. Zmmunol. 11,200. Gathings, W. E., Mage, R. G., Cooper, M. D., and Young-Cooper, G. 0. (1982). A subpopulation of small pre-B cells in rabbit bone marrow express K light chains and exhibits allelic exclusion of b locus allotypes. Eur. J. Zmmunol. 12, 76. Gearhart, P. J., Johnson, N. D., Douglas, R., and Hood, L. (1981). IgG antibodies to phosphorylcholine exhibit more diversity than their IgM counterparts. Nature (Lond o n ) 291,29. Gilman-Sachs, A., Mage, R. G., Young, G. O.,Alexander, C.,andDray, S. (1969). Identification and genetic control of two rabbit immunoglobulin allotypes at a second light chain locus, the c locus. J . Immunol. 103, 1159. Glick, B., Chang, T. S . , and Jaap, R. G. (1956). The bursa of Fabricius and antibody production in the domestic fowl. Poult. Sci. 35, 224. Good, P. W., Notenboom, R., Dubiski, S., and Cinader, B. (1980).Basilea rabbit immunoglobulins: Detection and characterization by specific alloantiserum. J . Immunol. 125, 1293.
GENERATING T H E ANTIBODY REPERTOIRE IN RABBIT
213
Hackett, J., Jr., Rogerson, B. J., O’Brien, R. L., and Storb, U. (1990). Analysis of somatic mutations in K transgenes. J . E x p . A4ed. 172, 131. Hague, B. F., Sawasdikosol, S., Brown, T. J., Lee, K. Reeker, D. P., and Kindt, T. J. (1992). C D4 and its role in infection ofrabbit cell lines by human immunodeficiency virus type 1. Proc. N a t l . Acud. Sci. U.S.A.89, 7963. Hanly, W. C., and Knight, K. L. (1975). Cellular distribution of rabbit IgA allotypes. J . lmnaunol. 115, 590. Harada, A., Sekido, N., Kuno, K., Akiyania, M., Kasahara, T., Nakanishi, I . , Mukaida, N., and Matsushima, K. (1993). Expression of recombinant rabbit IL-8 in Escherichia coli and establishment of the essential involvenwnt of IL-8 in recruiting neutrophils into lipopolysaccharide-induced inflanimatory site of rabbit skin. lnt. Immunol. 5 , 681. Harrison, hl. R., and Mage, R. G . (197:3). Allotype suppression in the rabbit. I. Th e ontogeny of cells bearing ii7iniunoglol,uliii of paternal allotype and the fate of these cells after treatment with antiallotype nntisera. J . E x p . Med. 138, 764. Hayakawa, K., Hardy, R. R., Stall, A. M., Herzenberg, L. A., and Herzenberg, L. A. (1986). Immiinoglobulin-1~earinyB cells reconstitute and maintain the murine Ly-1 B cell lineage. Eur. J . Inmrrnol. 16, 1313. Haywarcl, A. H., Sirnons, M. A., Lawton, A. H., Mage, H. G . , and Cooper, M . D. (1978). Pre-B and B cells i n rabbits: Ontogeny and allelic exclusion of K light chain genes. J . E x p Med. 148, 1367. Hayzer, D. J., and Jaton, J.-C. (1989a). Cloning and sequencing oftwo functional rabbit germ-line immunoglobu~inVA genes. Gene 80, 185. Hayzer, D. J., and Jaton, J.-C. (198%). Inactivation of rabbit immunoglobulin A chain variable region genes by the insertion of short interspersed elements of the C family. Eur. J . Inimunol. 19, 1643. Hayzer, D. J., Duvoisin, R. M., arid Jaton, J.-C. (1987). cDNA clones encoding rabbit imniunoglobulin A chains. Biocheni. J . 245, 691. Heidmann, O., and Rougeon, F. (1982a). Molecular cloning of rabbit y heavy chain mHNA. Nucleic Acids. Res. 10, 153Fj. Heidmann, 0.. and Rougeon, F. (198%). Multiple sequences related to a constantregion K light chain gene in the rabbit genome. Cell (Cambridge,Mass.) 28, 507. Heidmann, O., and Rougeon, F. (1983). Multiplicity of constant K light chain genes in the rabbit genome: A b4b4 homozygous rabbit contains a K-bus gene. EMBO J . 2, 437. Heidmann, 0.. Auffray, C . , Cazenave, P.-A., and Rougeon, F. (1981). Nucleotide sequence of constant and 3’ untranslated regions of a K immunoglobulin light chain mRNA o f a homozygous b4 rabbit. Proc. Natl. Acad. Sci. U.S.A.78, 5802. Hole, N. J. K., Harindranath, N., Young-Cooper, G. O., Garcia, R., and Mage, R. G . (1991a). Identification of enhancer sequences 3’ of the rabbit Iy KL chain loci. J . lnimutiol. 146, 4377. Hole, N. J . K., Young-Cooper, G . O., and Mage, R. G . (1991b). Mapping ofthe duplicated rabbit ininiunoglobulin K light chain locus. Eur. J . Immunol. 21, 403. Ito, H., Shirai, T., Yamamoto, S., Akira, M., Kawahara, S., Todd, C., and Wallace, R. B . (1986). Molecular cloning of the gene encoding rabbit tumor necrosis factor. DNA 5 , 157. Jackson, S., Chused, T. M., Wilkinson, J. M., Leiserson, W. M., and Kindt, T. J. (1983). Differentiation antigens identify subpopulations of rabbit T and B lymphocytes: Definition by flow cytometry. /. E r p . Med. 157, 34. Jaton, J.-C., and Kelus, A. S. (1977). Peptide mapping ofthe A-like chains ofthe BASILEA rabbits. Eur. J . Immunol. 7, 118.
2 14
KATHERINE L. KNIGHT AND MARY A. CRANE
Kabat, E. A.. Wu, T. T., Reid-Miller, M., Perry, H. M., and Gottesnian, K. S. (1987). Sequences of proteins of immunologic interest. United States Department of Health and Human Services. Public Health Service, National Institutes of Health, Bethesda, MD. K Kelus, A. S., and Weiss, S. (1977). Variant strain of rabbits lacking in~n~unoglobulin polypeptide chain. Nature (London) 265, 156. Kelus, A. S., and Weiss, S. (1986). Mutation affecting the expression of immunoglobulin variable regions in the rabbit. Proc. Natl. Acad. Sci. U.S.A. 83, 4883. Kim, 8.S., and Dray, S. (1972). Identification and genetic control ofallotypic specificities on two variable region subgroups of rabbit immunoglobulin heavy chains. Eur. J . Immunol. 2, 509. Kindt, T. J., and Capra, J. D. (1984).“The Antibody Enigma.” Plenum Press, New York. Knight, K. L. (1992). Restricted V, gene usage and generation of antibody diversity in rabbit. Annu. Reo. Immunol. 10, 593. Knight, K. L., and Becker, R. S. (1990). Molecular basis of the allelic inheritance of rabbit immunoglobulin VH allotypes: Implications for the generation of antibody diversity. Cell (Cambridge, Mass.) 60, 963. Knight, K. L., Martens, C. L., Stoklosa, C. M., and Schneiderman, R. D. (1984). Genes encoding a-heavy chains of rabbit IgA: Characterization of cDNA encoding IgA-g subclass a-chains. Nucleic Acids Res. 12, 1657. Knight, K. L., Burnett, R. C., and McNicholas, J. M. (1985). Organization and polymorphism of rabbit immunoglobulin heavy chain genes. 1.Irnrnunol. 134, 1245. Knight, K. L., Spieker-Polet, H., Kazdin, D. S., and Oi, V. T. (1988). Transgenic rabbits with lymphocytic leukemia induced by the c-myc oncogene fused with the inimunoglobulin heavy chain enhancer. Proc. Natl. Acad. Sci. U.S.A. 85, 3130. Kocks, C., and Rajewsky, K. (1989). Stable expression and somatic hypermutation of antibody V regions in B-cell developmental pathways. Annu. Reu. Imnunol. 7,537. Kotani, M., Yamamura, Y., Tamatani, T., Kitamura, F., and Miyasaka, M. (1993a).Generation and characterization of monoclonal antibodies against rabbit CD4, CD5 and C D l l a antigens. J . Immunol. Methods 157, 241. Kotani, M., Yamamura, Y., Tsudo, M., Tamatani, T., Kitamura, F., and Miyasaka, M. (1993b). Generation of monoclonal antibodies to the rabbit interleukin-2 receptor a chain (CD25)and its distribution in HTLV-1-transformed rabbit T cel1s.Jpn.J. Cancer Res. 84, 770. Kusano, M., Choi, N.-H., Toniita, M., Yamamoto, K., Migita, S., Sekiya, T., and Nishimura, S. (1986). Nucleotide sequence of cDNA and derived amino acid sequence of rabbit complement component C3 a-chain. Immunol. Inoest. 15,365. Lai, E., Wilson, R. K., and Hood, L. E. (1989). Physical maps of the monse and human immunoglobulin-like loci. Ado. Immunol. 46, 1. Lalor, P. A., Stall, A. M., Adams, S., and Herzenberg, I,. A. (1989). Permanent alteration of murine Ly-1 B repertoire due to selective depletion of Ly-1 B cells in neonatal animals. Eur. J . Immunol. 19, 501. Lamoyi, E., and Mage, R. G. (1985). Lack of Klb9 light chains in Basilea rabbits is probably due to a mutation in an acceptor site for mRNA splicing. J . E x p . Med. 162, 1149. Laverriere, A., Kulaga, H., Kindt, T. J., LeGuern, C., and Marche, P. N. (1989).A rabbit class I1 MHC gene with strong similarities to HLA-DRA. Iininunogenetics 30, 137. Lawton, A. R., Self, K. S., Royal, S. A., and Cooper, M. D. (1972). Ontogeny of Blymphocytes in the human fetus. Clin. Immunol. Initnunopathol. 1, 84. Lebecque, S. G.. and Gearhart, P. J. (1‘390).Boundaries of somatic mutation in rearranged
GENERATING THE ANTIBODY REPERTOIRE IN RABBIT
2 15
immunoglobulin genes: 5' boundary is near the promoter, and 3' boundary is -1 kb from V(D)J gene.]. E x p . Med. 172, 1717. LeGuern, A., Wetterskog, D., Marche, P. N., and Kindt, T. J. (1987). A monoclonal antibody directed against a synthetic peptide reacts with a cell surface rabbit class I MHC molecule. Mol. Zmmunol. 24, 455. LeGuern, C., Marche, P. N., and Kindt, T. J . (1985).Molecular evidence for five distinct MHC class I1 a genes in the rabbit. Zmmunogenetics 22, 141. LeGuern, C., Weissman, J . D., Marche, P. N., Jouvin-Marche, E., Laverriere, A., Bagnato, M. R., and Kindt, T. J. (1987).Sequence determination o f a transcribed rabbit class I1 gene with homology to N U - D Q a . Immunogenetics 25, 104. Lobel, S. A., and Knight, K. L. (1984). The role of rabbit l a molecules in immune functions as determined with the use of an anti-la monoclonal antibody. lmmunology 51, 35. Mage, R. (1981). Th e phenotypic expression of rabbit immunoglobulins: A model of complex regulated gene expression and ceIlular differentiation. Contemp. Top. Mol. Immunol. 8, 89. Mage, R., and Dray, S. (1965). Persistent altered phenotypic expression of allelic yGimmunoglobulin allotypes in heterozygous rabbits exposed to isoantibodies in fetal and neonatal life.]. lmmunol. 95, 525. Mage, R. G., Bernstein, K. E., McCartney-Fransis, N., Alexander, C. B., Young-Cooper, G . 0..Padlan, E. A., and Cohen, G. H. (1984). T h e structural and genetic basis for expression of normal and latent V,,a allotypes of the rabbit. Mol. Zmmunol. 21, 1067. Maizels, N . (1989).Might gene conversion b e the mechanism of somatic hypermutation of mammalian immunoglobulin genes? Trends Genet. 5 , 4. Marche, P. N., and Kindt, T. J . (1986a). T w o distinct T-cell receptor a-chain transcripts in a rabbit T-cell line: Implications for allelic exclusion in T cells. Proc. Natl. Acad. Sci. U.S.A. 83,2190. Marche, P. N., and Kindt, T. J. (1986b). A variable region gene subfamily encoding T cell receptor @-chains is selectively conserved among mammals. J. lmmunol. 137, 1729. Marche, P. N., Tykocinski, M. L., Max, E. E., and Kindt, T. J . (1985). Structure of a functional rabbit class I MHC gene: Similarity to human class I genes. Zmmunogenetics 21, 71. McConnack, W. T., and Thompson, C. B. (199Oa).Chicken Ig, variable region gene conversions display pseudogene donor preference and 5' to 3' polarity. Genes Deu. 4, 548. McCormack, W. T., and Thompson, C. B. (1990b).Somatic diversification o f t h e chicken immunoglobulin light-chain gene. Adu. Immunol. 48, 41. McCormack, W. T., Laster, S. M., Marzluff, W. F., and Roux, K. H. (1985). Dynamic gene interactions in the evolution of rabbit V, genes: A four codon duplication and block homologies provide evidence for intergenic exchange. Nucleic Acids Res. 13, 704 1. McElroy, P. J., Willcox, N., and Catty, D. (1981).Early precursors of B lymphocytes. I. Rabbit/mouse species differences in the physical properties and surface phenotype of pre-B cells, and in the maturation sequence of early B cells. Eur. J. Immunol. 11, 76. Meyer, K. B., and Neuberger, M. S. (1989). T h e immunoglobulin K locus contains a second, stronger B-cell-specific enhancer which is located downstream of the constant region. E M 3 0 J. 8, 1959. Mostov, K. E., Friedlander, M., and Blobel, G. (1984). The receptor for transepithelial
216
KATHERINE L. KNIGHT AND MARY A. CRANE
transport of IgA and IgM contains multiple immunoglobulin-like domains. Nature (London) 308,37. Osmond, D. G. (1990). B cell development in the bone marrow. Semin. Zmmunol. 2, 173. Oudin, J. (1956a). Reaction de precipitation specifique entre des serums d’animaux de meme espece. C . R . Acad. Sci. D (Paris) 242,2489. Oudin, J. (1956b).L’Allotypie de certains antigens proteidiques du serum. C . R . Acad. Sci. D (Paris) 242, 2606. Pascual, V., and Capra, J. D. (1993). Human immunoglobulin heavy-chain variable region genes: Organization, polymorphism, and expression. Ado. Zmmunol. 49, 1. Pearl, E. R., Vogler, L. B., Okos, A. J., Crist, W. M., Lawton 111, A. R., and Cooper, M. D. (1978). B lymphocyte precursors in human bone marrow: An analysis of normal individuals and patients with antibody-deficiency states. J . Zmmunol. 120, 1169. Pink, J. R. L., Lassila, O., and Vainio, 0. (1986). B-lymphocytes and their self renewal. In “Avian Immunology: Basis and Practice” (A. Toivanen and P. Toivanen, eds.), p. 65. CRC Press, Boca Raton. Plaut, A. G., Gilbert, J. V., Artenstein, M. S., and Capra, J. D. (1975). Neisseria gonorrhoeae and Neisseria meningitidis: Extracellular enzyme cleaves human immunoglobulin A. Science 190, 1103. Pleasants, J. R. (1959). Rearing germfree cesarean-born rats, mice, and rabbits through weaning. Ann. New York Acad. Sci. 78, 116. Raff, M. C., Megson, M., Owen, J. J., and Cooper, M. D. (1976). Early production of intracellular IgM by B-lymphocyte precursors in mouse. Nature (London) 259, 224. Raman, C., and Knight, K. L. (1992). CD5’ B cells predominate in peripheral tissues of rabbit. J. Zmmunol. 149, 3858. Raman, C., Spieker-Polet, H., Yam, P.-C., and Knight, K. L. (1994). Preferential VH gene usage in rabbit immunoglobulin-secreting heterohybridomas. J. Immunology, in press. Reynaud, C.-A., Anquez, V., Dahan, A,, and Weill, J.-C. (1985). A single rearrangement event generates most ofthe chicken immunoglobulin light chain diversity. Cell (Cambridge, Mass.) 40, 283. Reynaud, C.-A., Anquez, V., Grinial, H., and Weill, J.-C. (1987). A hyperconversion mechanism generates the chicken light chain preimmune repertoire. Cell (Cambridge, Mass.) 48, 379. Reynaud, C.-A., Dahan, A., Anquez, V., and Weill, J.-C. (1989). Somatic hyperconversion diversifies the single VH gene of the chicken with a high incidence in the D region. Cell (Canabridge, Mass.) 59, 171. Reyniers, J. A. (1959). The pure-culture concept and gnotobiotics. Ann. N . Y. Acad. Sci. 78, 3. Roux, K. H., Dhanarajan, P., Gottschalk, V., McCormack, W. T., and Renshaw, R. W. (1991). Latent a1 VH germline genes in an a2a2rabbit:Evidence for gene conversion at both the germline and somatic levels. J. Zmmunol. 146, 2027. Roux, K. H., Ray, G., and McCormack, W. T. (1993). Expression of RAG-1 and RAG-2 mRNA in rabbit lymphoid tissues. J . Cell Biochem. 17B, 234. Sawasdikosol, S., Hague, B. F., Zhao, T. M., Bowers, F. S., Simpson, R. M., Robinson, M., and Kindt, T. J . (1993). Selection of rabbit CD4-CD8-TCRy8 cells by in uitro transformation with HTLV-1. J . E x p . Med. 178, 1337. Schneiderman, R. D., Hanly, W. C., and Knight, K. L. (1989). Expression of 12 rabbit IgA Ccy genes as chimeric rabbit-mouse IgA antibodies. Proc. Natl. Acad. Sci. U.S.A. 86, 7561.
GENERATING T H E ANTIBODY REPERTOIRE IN RABBIT
217
Schneiderman, R. D., Lint, T. F., and Knight, K. L. (1990). Activation of the alternative pathway of complement by twelve different rabbit-mouse chimeric transfectoma IgA isotypes. J. Inimunol. 145, 233. Selsing, E., Durdik, J . , Moore, M . W., and Persiani, D. M. (1989).Immunoglobulin A genes. In “Immunoglobulin Genes” (T. Honjo, F. W. Alt, and T. H. Rabbitts, eds.), p. 111. Academic Press Ltd., London. Shakhov, A. N., Kuprash, D. V., Azizov, M. M., Jongeneel, C. V., and Nedospasov, S . A. (1990). Structural analysis ofthe rabbit TNF locus, containing the genes encoding TNF-P (lymphotoxin) and TNF-a (tumor necrosis factof). Gene 95, 215. Shimizu, A., Takahashi, N., Yaoita, Y., and Honjo, T. (1982).‘0rganization ofthe constantregion gene family of the mouse immunoglobulin heavy chain. Cell (Cambridge, Muss.) 28, 499. Short, J. A., Sethupathi, P., Zhai, S. K., and Knight, K. L. (1991). VDJ genes in VHa2 allotype-suppressed rabbits: Limited gerniline VH gene usage and accumulation of somatic mutations in D regions. J. Zmnaunol. 147, 4014. Sinions, M. A,, Hayward, A. R., Gathings, W. E., Lawton, A. R., Young-Cooper, G . O., Cooper, M. D., and Mage, R. C . (1979). Expression ofb4 and b 5 K light chain allotypes by B and pre-B cells in allotype-suppressed and neutralized b4b5 rabbits. Eur. J. Immunol. 9, 887. Sittisombut, N., and Knight, K. L. (1986). Rabbit major histocompatibility complex. I. Isolation and characterization of three subregions of class I1 genes. J. Immunol. 136, 1871. Solvason, N., and Kearney, J. F. (1992). The human fetal omentum: A site of B cell generation. J. E x p . Med. 175, 397. Solvason. N., Lehuen, A,, and Kearney, J. F. (1991). An embryonic source of Ly l but not conventional B cells. Int. Immunol. 3, 543. Spieker-Polet, H., Sittisombut, N., Yam, P.-C., and Knight, K. L. (1990). Rabbit major histocompatibility complex. IV. Expression of major histocompatibility complex class I1 genes. J. Zmmunogenet. 17, 123. Spieker-Polet, H., Yam, P.-C., and Knight, K. L. (1993). Differential expression of 13 IgA-heavy chain genes in rabbit lymphoid tissues. J. Zmmunol. 150, 5457. Stepankova, R., and KovAiG, F. (1978). Development of lymphatic tissues in germfree and conventionally reared rabbits. Proc. 6th Internot. Congr. Lymphol. 290. Stepankovk, R., and KovaiG, F. (1985). Immunoglobulin-producing cells in lymphatic tissues of g e m f r e e and conventional rabbits as detected by an immunofluorescence method. F o l . Microbiol. 30, 291. Sterzl, J., and Trnka, Z. (1957). Effect ofvery large doses ofbacterial antigen on antibody n ) 918. production in newborn rabbits. Nature ( L { ~ i ~ d o179, Thompson, C . B., and Neinian, P. E . (1987). Somatic diversification of the chicken immunoglobulin light chain gene is limited to the rearranged variable gene segment. Cell (Canhrzdge, Muss.) 48, 369. Thorbecke, G. J . (1960). y Globulin and antibody formation in vitro. 1. y Globulin formation in tissues from immature and normal adult rabbits. J. E x p . Med. 112, 279. Tlaskalova-Hogenova, H., and Stepankova, R. (1980). Development of antibody formation in genn-free and conventionally reared rabbits: The role of intestinal lymphoid tissue in antibody formation to E . coli antigens. Fol. Eiol. 26, 81. Tucker, P. W., Liu, C. P., Mushinski, J. F., and Blattner, F. R. (1980).Mouse immunoglobulin D: Messenger RNA and genomic DNA sequences. Science 209, 1353. Velardi, A., and Cooper, M . D. (1984). An immunofluorescence analysis o f t h e ontogeny
218
KATHERINE L. KNIGHT AND MARY A. CRANE
of myeloid, T, and B lineage cells in mouse hemopoietic tissues. J . Immunol. 133, 672. Vice, J. L., Hunt, W. L., and Dray, S. (1969). Zygote transfer to facilitate altered expression of immunoglobulin light chain phenotypes in homozygous rabbits. Proc. SOC. E x p . Biol. Med. 130, 730. Weber, J. S., Berry, J., Manser, T., and Claflin, J. L. (1991). Position of the rearranged V, and its 5’ flanking sequences determines the location of somatic mutations in the J K locus. J. Immunol. 146, 3652. White, M. B., Shen, A. L., Word, C. J., Tucker, P. W., and Blattner, F. R. (1985). Human immunoglobulin D: Genomic sequence of the 6 heavy chain. Science 228,733. Wilder, R. L., Yuen, C. C., Coyle, S. A., and Mage, R. G. (1979). Demonstration of a rabbit cell surface Ig that bears light chain and V,, but lacks p-, a-,and y-allotypesrabbit IgD? J . Immunol. 122, 464. Wilkinson, J. M., Galea-Lauri, J., and Reid, H. W. (1992a).A cytotoxic rabbit T-cell line infected with a y-herpes virus which expresses CD8 and class I1 antigens. Immunology 77, 106. Wilkinson, J. M., Galea-Lauri, J., Sellars, R. A., and Boniface, C. (1992b). Identification and tissue distribution of rabbit leucocyte antigens recognized by monoclonal antibodies. Immunology 76, 625. Wilkinson, J. M., McDonald, G., Smith, S., Galea-Lauri, J., Lewthwaite, J., Henderson, B., and Revell, P. A. (1993). lmmunohistochemical identification of leucocyte populations in normal tissue and inflamed synovium of the rabbit. J. Pathol. 170, 315. Wysocki, L. J., and Gefter, M. L. (1989). Gene conversion and the generation of antibody diversity. Annu. Reo. Biochem. 58, 509. Yoshimura, T., and Yuhki, N. (1991). Neutrophil attractant/activation protein-1 and monocyte chemoattractant protein-1 in rabbit. J . Immunol. 146,3483.
ADVANCES IN IMMUNOLOCY, VOL. 56
lmmunotherapeutic Strategies Directed at the Trimolecular Complex AMITABH GAUR A N D C. GARRISON FATHMAN Deportment of Medicine, Division of Immunology ond Rheumatology, Stanford University Medical Center, Stanford Colifornio 94305
1. Introduction
T cell activation requires interaction among the components ofthe ternary complex: the T cell receptor, MHC gene products, and the nominal peptide antigen. Strategies aimed at inducing unresponsiveness in T cells have targeted each of the components of the activating complex. Prevention and treatment of autoimmune disorders as well as induction of transplantation tolerance are incentives to continue the effort in evolving strategies for establishing specific immune unresponsiveness. This review recapitulates earlier experience in preventing the formation of the ternary complex and discusses some newer attempts to induce unresponsiveness in experimental animals. The three components of the complex serve as independent targets for development of strategies aimed at disrupting the trimolecular complex (Fig 1). II. Target 1 : The T Cell
The earliest attempts at immunotherapy targeting the T cell used anti-lymphocyte serum and monoclonal antibodies directed at the Thy1 antigen, a marker for all T cells, to eliminate or downregulate T cell activation (Like et al., 1979; Maki et al., 1981, 1992; Ledbetter and Seaman, 1982; Cobbold et ul., 1983). The development of hybridoma technology (Kohler and Milstein, 1975; Galfre et al., 1979) made available reagents which could target a specific cell population. Among the target molecules on T cells are the CD3 complex and the CD8 and CD4 molecules. Antibodies to the nonpolymorphic regions of the T cell receptor and to the variable regions of the @-chainof the T cell receptor (TCR)have been used for immunotherapy. T cell vaccination and TCR peptide are the most recent entries into this field of T celldirected imniunotherapy. 219 Copyright 0 1994 b y Academic Press, Inc All rights of reproduction in any Corm reserved.
220
AMITABH GAUR A N D C. GARRISON FATHMAN
Antibodies to *TCR a / p -TCR Vp
*MHC blocking peptides/analogues
f
Antigen Presenting Cell *Antibodies to MHC (la)
FIG.1. Schematic diagram showing the components of the ternary complex. Boxed legends show ways to disrupt the interactions between the components.
A. ANTI-CD3 ANTIBODY The T cell receptor consists of seven polypeptide chains which form the T cell receptor complex. The cup-chains are involved in direct interaction with the antigen MHC complex. The other chains ( y 8 & t 2 ) ofthe complex have important functions in signal transduction. Engagement of these polypeptide chains on the surface b y monoclonal antibodies can result in antigen-independent activation of the T cell. Antibody to the C D 3 complex, OKT3, was among the first monoclonal antibody to be developed for human T cell-surface antigens (Kung et al., 1979). It was quickly employed therapeutically for reversal of acute renal allograft rejection (Cosimi et al., 1981) and then evaluated in multicenter studies for its use in renal allograft rejection (Thistlethwaite et d.,1984; Ortho Study, 1985). Soon it was used as the only immunosuppressive therapy in patients receiving cadaver kidney transplants (Vigeral et d.,1986). The mode of action of antiC D 3 antibody (OKT3) in vivo was initially thought to be the removal
THE TRIMOLECULAR COMPLEX
22 1
of T cells from circulation evidenced by a sharp decline in T cell numbers following anti-CD3 administration. However, the elimination of T cells did not seem to be the prime factor in the success of OKT3 therapy. The antibody does not eliminate T cells for long and CD3-negative T cells reappear. Antibody binding to the T cell surface causes capping, internalization, and shedding of the CD3 complex resulting in a modulated expression of the T cell receptor complex and diminshed antigen recognition and response functions (Chatenoud et al., 1982). The use of OKT3 antibody in reversing transplantation rejection and its attendant side effects and problems has been discussed in detail elsewhere (Transplantation Proceedings, 1987). Antibody to the mouse CD3 was developed and like OKT3 found to inhibit antigen-specific cytolysis by T cells (Leo et al., 1987; Havran et al., 1987). The ability of the mouse CD3 antibody (145.2~11)to induce unresponsiveness was studied in uiuo. For up to 5 weeks after antibody administration cells from the recipient adult mice were completely unresponsive in CTL assays. The mechanisms of unresponsiveness were investigated (Hirsch et al., 1988).Though there was a substantial depletion of T cells from the periphery, spleen and lymph nodes still contained T cells. Anti-CD3 antibody seemed to be acting through mechanisms other than depletion of T cells possible surface modulation of the CD3 complex or delivery o f a “suppressive” or negative signal to T cells (Hirsch et ul., 1988). In a different study, injections of anti-CD3 antibody were given neonatally and the effects were studied in adult mice (Rueff-Juy et at., 1989). Although there was almost complete depletion of T cells in the peripheral organs, there was no significant decrease in thymocytes. However, there was complete suppression of T cell functions. A decrease in “bright” CD3+ cells was seen which was correlated with loss of function. The reappearance of function was correlated with a critical threshold of bright CD3’ cells. No difference in levels of mRNA transcripts for alp TCR and C D ~ was E observed between control and treated mice suggesting no apparent feedback mechanism acting on surface modulation of CD3.9 (Rueff-Juy et al., 1989). Studies mentioned thus far have demonstrated depletion of peripheral T cells following administration of the antibody without affecting the number of thymocytes. However, other studies have shown antiCD3-induced apoptosis in developing thymocytes 40 hr after the antiCD3 injection. Almost complete depletion of double-positive thymocytes was seen and the single-positive CD4+ subset was affected more than the CD8’ cells (Shi et al., 1991). Apoptosis of immature T cells seen in uiuo was confirmation of similar observations in vitro with
222
AMITABH GAUR A N D C. GARRISON FATHMAN
thymic organ cultures (Smith et al., 1989; McConkey et al., 1989; Tadakuma et al., 1990) or with a leukemic T cell line (Takahashi et al., 1989). Though anti-CD3 antibody has been utilized to induce immunosuppression in uiuo, it is interesting to note that the same antibody can induce activation of T cells in uiuo. Anti-CD3 is a potent stimulator of T cells when added to cultures in uitro of either human (Van Wauwe et al., 1980) or murine T cells (Leo et al., 1987; MarusicGalesic et al., 1988). The antibody caused activation of T cells in uiwo was evidenced by induction of interleukin-2 (IL2)receptor and production of colony stimulating factor (CSF). At the doses studied the net result was immunosuppression; however, lower doses might be useful in inducing activation in immunocompromised hosts (Hirsch et al., 1989). The ability of anti-CD3 to induce activation in uiuo is an important caveat, especially when the antibody for immunosuppressive therapeutic effects is administered, and may account for some of the “side affects” observed at least in the early phase of the treatment regimen. Anti-CD3 induces activation of T cells when given intravenously. Release of various cytokines including tumor necrosis factor (TNF), interferon-y (IFNy), IL2, and IL3 in the circulation has been observed. Side effects caused by its activating potential have been discussed (Alegre et al., 1990; Chatenoud and Bach, 1992). Interestingly, the activation potential of anti-CD3 was associated with the intact antibody. F(ab’)2 fragments of the antibody may be more useful as immunosuppressive agents since they lack mitogenic properties (Hirsch et al., 1991). F(ab’)2fragments ofthe antibody given to thymectomized mice resulted in prolonged (up to 3 months) and marked impairment of CD4+ T cell functions including reduced proliferation and IL2 secretion to mitogenic stimulus. IL2 supplementation in uiuo restored T helper functions as evidenced by rejection of skin allografts. CD8+ T cells were not affected by the F(ab’)2 treatment (Hirsch et ul., 1991).Nonmitogenic F(ab’)2portions were shown to prevent lethal murine graft versus host disease (GVHD) in fully allogeneic bone marrow transplant recipients. Both depletion of cells and modulation of CD3/TCR complex were observed in the CD4+ subset. CD8’ T cells were again affected only to a limited degree (Blazar et al., 1993). These results demonstrated the ability of the F(ab’)2portion to induce specific unresponsiveness in the CD4+ subset of T cells without evoking activation-linked side effects associated with the intact antibody treatment. Since CD4+ helper T cells have been implicated in the initiation of different autoimmune diseases, nonmitogenic F(ab’)2 portions of anti-CD3 antibody have been tried in a few experimental models of
THE TRIMOLECULAR COMPLEX
223
autoimmune diseases. The effectiveness of anti-CD3 and its F(ab')2 fragment, in preventing autoimmune diabetes, was compared in the streptozotocin-induced diabetes model in mice. Both intact anti-CD3 and its F(ab')2 fragments were found to suppress insulitis and significantly reduce the occurrence of hyperglycemia as compared to untreated controls. Mice treated with nonmitogenic F(ab')2 did not show any of the signs of morbidity seen in the anti-CD3-treated mice. The depletion of T cells was less pronounced in the case of F(ab')S-treated mice. The cells from treated mice, however, showed reduced activity on challenge with mitogens in vitro (Herold et al., 1992). Apparently, nonmitogenic antibody treatment functioned by rendering the T cells unresponsive by modulating the surface expression of the CD3/TCR complex. In two other murine models of autoimmune diseases, collagen-induced arthritis and Lactobacillus coronary vasculitis (LCA) disease, induction was prevented when anti-CD3 treatment was given at an early stage (Bluestone et al., 1992). B. ANTI-CD4 ANTIBODY In an effort to reach specific populations of the helper/inducer subset of T cells, a specific marker for those cells was used as the target antigen of immunotherapy. Helper T lymphocytes express CD4, a transmembrane glycoprotein (Parnes, 1989)which acts as both an adhesion molecule and a signal transducer through its cytoplasmic tail (Glaichenhaus et al., 1991; Miceli et al., 1991).The use of monoclonal antibodies targeted to CD4 has resulted in subset depletion or inactivation in mice and rats with a concomitant loss of immune function associated with the CD4' T cells. For example, mice depleted of CD4+ helper T cells were unable to mount B cell-dependent IgG responses to a T cell-dependent antigen sheep red blood cells (SRBC) (Cobbold et al., 1984) or to antigens of the herpes simplex virus (Leist et al., 1987). CD4+-depletcd mice lacked DTH responses (Leist et al., 1987) and also exhibited prolonged time in rejecting skin grafts from mismatched donors (Cobbold and Waldmann, 1986).Studies have been carried out on the effects of anti-CD4 treatment in experimental animals by different groups with results very similar to those described above. Using a rat monoclonal antibody GK1.5, directed against mouse CD4 molecule (Dialynas et al., 1983a,b), to treat mice, we examined the effect of such treatment on immune unresponsiveness. BALB/c mice immunized with sperm whale myoglobin did not produce specific antibodies following CD4' T cell depletion with GK1.5 at the time of immunization. This humoral unresponsiveness was long lasting; mice remained unresponsive for more than 4 months despite a
224
AMITABH GAUR A N D C. GARRISON FATHMAN
secondary challenge with sperm whale myoglobin (Goronzy et al., 1986). Similar results were obtained by others using bovine serum albumin or ovalbumin (Wofsy et al., 1985). Interestingly, anti-CD4 treatment 3 or more days following immunization with antigen failed to diminish the immunoglobulin response (Wofsy et al., 1985) suggesting an early requirement for B cell help from CD4+ cells. Benjamin and Waldmann (1986) have shown that antigen immunization at the time of anti-CD4 antibody YTS191.1 (Cobbold et al., 1984) treatment results in specific tolerance to the antigen as evidenced by lack of antibody response on secondary immunization 42 days after the antibody treatment. Responses to other antigens remained unaffected. These and similar observations (Gutstein et al., 1986) indicated the ability of anti-CD4 to induce antigen-specific unresponsiveness. Humoral unresponsiveness following anti-CD4 treatment was not limited to soluble antigens but was also seen in response to alloantigens (Weyand et al., 1989a). Cytotoxic T cell responses induced by CD4+ cells either to allotype dissimilar cells (Weyand et al., 1989a) or to virus-infected cells were also dramatically reduced ( Weyand et al., 198913). Anti-CD4 antibody therapy has been used in experimental animals in an attempt to induce transplantation tolerance. The rationale for this approach came from studies suggesting that CD4+ T cells played a crucial role in rejection of the tissue transplanted across both the MHC “major” or non-MHC “minor” barrier (Mason and Morris, 1986; Steinmuller, 1985; Rosenberg et al., 1987).Work in our laboratory has demonstrated that treatment with anti-CD4 antibody before transplant allowed survival of islet allografts (Shizuru et al., 1987).In these experiments, mice (B6 H-2b) were given a single regimen of treatment with anti-CD4 antibody GK1.5 at the time of allogeneic islet transplant from A/J (H-2a)mice. The recipient mice had been made diabetic by treatment with streptozotocin. Successful retention of the allograft islet transplant was measured by maintenance of normoglycemia in the recipient mice. Our results showed indefinite survival of the engrafted islets of Langerhans (Shizuru et al., 1987) following treatment with anti-CD4. The treatment apparently caused selective depletion of most CD4+ lymphocytes; however, 5%-10% CD4’ cells remained in the spleen and lymph nodes of the treated mice. Cells in the thymus were not depleted by this treatment (Goronzy et al., 1986). In xenogeneic islet grafts (rat to mouse) CD4 antibody treatment of the recipient along with anti-la immunotoxin treatment of the graft substantially increased survival time of the graft (Kaufman et al., 1988). We have also been able to achieve indefinite survival of islet allografts in a rat
THE TRIMOLECULAH COMPLEX
225
model using the mouse anti-rat CD4 antibody 0x38. Pretransplantation treatment of diabetic ACI rats with OX38 allowed acceptance of Lewis rat islets. In the same study, anti-CD8 antibody treatment did not allow long-term allograft survival. Anti-CD8 antibodies when coadministered with anti-CD4 abrogated transplant tolerance and allowed rejection of the allograft. This result suggested that CD8+ cells were soniehow involved in maintaining tissue-specific unresponsiveness (Seydel et al., 1991).This observation was in contrast to earlier observations of Waldmann and co-investigators, in studies in mice, who did not find a requirement of CD8+ cells for induction of anti-CD4mediated tolerance (Waldmann, 1989). Anti-CD4 antibody has additionally been shown to fiacilitate graft survival in skin and bone marrow transplants in mice (Cobbold et al., 1986). Survival of cardiac allografts improved substantially in mice following anti-CD4 therapy (Mottram et al., 1987; Madsen et al., 1987). The mechanism of anti-CD4-mediated “tolerance” in the case of either soluble antigens or transplantation models is not clear. However, some insights into the potential n-rechanism(s) are beginning to emerge. In some models depletion of CD4’ cells is required as suggested by the inability of the nondepleting chimeric CD4 (Alters et ul., 1989) antibodies to successfully treat niurine EAE (Alters et al., 1990). Also, as discussed earlier, humoral unresponsiveness to soluble antigens and survival of allografts seemed to correlate with the depletive capabilities of the antibody. However, nondepletive regimens have also been shown to induce tolerance to soluble antigens (Qin et al., 1987). Additionally, F(ab’)2 portions of anti-CD4 antibodies, though not capable of depleting CD4+ cells, were able to induce tolerance and immunosuppression (Gutstein and Wofsy, 1986; Carteron et d.,1988). Also high doses of a poorly depleting isotype rat IgG 2a anti-CD4 monoclonal antibody allowed tolerance induction again suggesting that depletion was not always required for induction of tolerance (Qin et al., 1989). Even in depletive regimens, cessation of antibody therapy allows repopulation of CD4+ cells to normal levels in approximately 90 days (Goronzy et al., 1986). We attempted to analyze unresponsiveness of the repopulated cells in B6 mice which had not rejected A/ J islets following anti-CD4 therapy. We observed that the repopulated cells responded as well to spleen cells of the donor in an MLR as to a third party. These data suggested the induction of tissue or antigen-specific tolerance but not general unresponsiveness to the donor. In other systems tissue-specific unresponsiveness has been suggested (Dalln-ran et nl., 1987; Armstrong et d., 1987). In a rat cardiac allograft model, we were again able to see
226
AMITABH GAUR A N D C. GARRISON FATHMAN
unresponsiveness when anti-CD4 (0x38)antibody was used for allograft survival. ACI rats received Lewis rat hearts in the abdomen. Only rats treated with OX38 demonstrated indefinite survival of the allograft. A second transplant of a Lewis heart in a different site was accepted without additional treatment while a third party, BN rat heart, was rejected. BN rat hearts were accepted by naive ACI rats following anti-CD4 therapy. As in the mouse islet transplant model system, we observed apparent donor tissue-specific unresponsiveness in rats following anti-CD4 therapy (Shizuru et al., 1990).Similar results have been reported from other groups of rat cardiac allograft systems (Herbert and Roser, 1988; Roser, 1989).Anti CD4-induced donor-specific unresponsiveness persisted in the absence of the transplanted tissue for at least 90 days (the duration of the study) following removal of the transplanted allograft as evidenced by the nonrejection of a second donor-matched cardiac allograft placed 90 days after the removal of the first tolerated graft following anti-CD4 antibody therapy (Shizuru et aZ., 1990). This long-term unresponsiveness in the transplantation system is almost identical to that observed against soluble antigens given following anti-CD4 treatment (Benjamin et al., 1988). In an attempt to elucidate the mechanism of transplantation tolerance following anti-CD4 therapy, our group (Alters et aZ., 1991) studied islet allograft between MHC-disparate mice. The donor islets came from I-E+ mice A/J (I-Ek).In I-E+ mice, T cell receptor V p l l ' and VP5' T cells are deleted in the thymus. In our system, the presence of the I-E+ islet allograft in CD4-depleted recipient mice did not cause clonal deletion of Vp5 or V p l l T cells. No changes in the kinetics of repopulation ofVP5 or V p l l CD4+ cells were observed in transplanted or sham-transplanted anti-CD4-treated mice. FACS analysis using anti-Vpll antibodies 2 months after grafting and following repopulation of CD4+ cells revealed no decrease in VPll' cells. The percentage of V p l l ' T cells seen in anti-CD4-treated transplanted mice were comparable with those of anti-CD4-treated untransplanted mice. Since clonal deletion was obviously not responsible for unresponsiveness in the graft recipients, we assayed T cell receptor crosslinking using solid-phase immobilized Vpll-specific antibodies. Receptor crosslinking usually stimulates specific T cells to proliferate, whereas lack of proliferation is usually correlated with anergy. In our crosslinking experiments, cells from the anti-CD4-treated and I-E islet-engrafted mice failed to respond to anti-Voll crosslinking. There was no difference in the level of stimulation achieved by control antibodies, antiVp8, or anti-CD3between grafted and control mice. Sorted populations of T cells from treated and grafted mice showed little or no stimulation +
227
THE TRIMOLECULAR COMPLEX
in response to Vpl l-specific immobilized antibody in CD4 or CD8 T cells arguing for anergy induction in both CD8+ and CD4 + populations (Alters et at., 1991). To examine the possibility that suppressor cells in transplanted mice caused the receptor crosslinking unresponsiveness, CD4- and CD8-sorted populations were mixed with normal B6 cells (negatively sorted for CD4 or CD8 cells) in an anti-Vp11 stimulation assay. Neither CD4 nor CD8 cells from tolerant mice affected the response of the normal B6 cells in TCR crosslinking (Alters et al., 1991) ruling out any apparent suppressor populations generated by anti-CD4 treatment. Qin et al. (1989, 1990) reported results similar to ours but using nondepleting anti-CD4 antibodies in generating tolerance or anergy. As reported earlier for soluble antigens, e. g., human y-globulin, tolerance induction in their studies required immunization with the antigen under the umbrella of nondepleting CD4 antibodies. The resulting antigen-specific tolerance lasted for a finite period unless immunizations were repeated which could extend and strengthen the specific tolerance. It was postulated that the reversion to the responsive state was due to the arrival of new thymic emigrants which were not tolerant. This hypothesis was supported by the continued unresponsiveness of mice thymectomized after being tolerized. The establishment of tolerance to minor mismatched skin grafts required anti-CD8 antibodies, in addition to anti-CD4 antibodies. However, in this instance, the tolerance was long lasting presumably because of continuous exposure of thymic emigrants to the foreign antigen expressed on the grafted tissue. In a finding similar to that observed by Alters et al., but using nondepleting regimens of antiCD4 antibody, it was found that the Mls 1" (present on the graft)reactive subset of T cells, Vp6 +,was not deleted from the periphery, but rendered anergic as assessed by their inability to proliferate in uitro to either VP6-specific antibody or Mls1"-expressing stimulator cells (Cobbold et al., 1990). GK1.5 treatment, in animal models of autoimmune diseases, has been shown to be effective in blocking or halting the progression of disease. Treatment with anti-CD4 antibody around the time of immunization with myelin basic protein (MBP) prevented experimental autoimmune encephalomyelitis (EAE) (Brostoff and Mason, 1984). Ongoing EAE was also reversed with anti-CD4 treatment (Waldor et al., 1985; 1987a). Experimental autoimmune myasthenia gravis (Christadoss and Dauphinee, 1986), systemic lupus erythematosus (Wofsy and Seaman, 1985), and collagen-induced arthritis (Ranges et al., 1985) have all been treated with anti-CD4 treatment. Using depletive anti-CD4 antibody treatment, our laboratory has prevented the +
+
228
AMITABH GAUR A N D C. GARRISON FATHMAN
development of spontaneous diabetes mellitus in NOD mice (Shizuru et al., 1988).A striking feature ofthe therapy was the long-term absence of disease even after cessation of antibody administration. N o prevention of IDDM was observed if NOD mice were treated for a short course despite adequate depletion. Though we used depleting antibodies for therapy, Carteron et al. (1989) used F(ab')2 fragment of the anti-CD4 antibody in treating another autoimmune disease, mouse lupus, with success. This nondepletive CD4 antibody was demonstrated to be effective in treating autoimmune diseases but again required long-term treatment.
C. ANTI-^^ TCR ANTIBODY About 90% of peripheral T cells express the alp heterodimer; 10% express the y / 6 T cell receptor. The development of monoclonal antibodies (R73 and H57-597) to a nonpolymorphic determinant in the constant region of the rat (Hunig et al., 1989) or mouse (Kubo et al., 1989) alp T cell receptor generated the opportunity for using these antibodies as immunotherapeutics in animal models. Attempts have been made to use these anti-alp TCR antibodies for prevention and treatment of type I1 collagen-induced arthritis in rats (Goldschmidt and Holmdahl, 1991;Yoshino et al., 1991a).Collagen-induced arthritis, an organ-specific autoimmune disease, shares similarities with human rheumatoid arthritis. Administration of anti-alp TCR antibody, either at the time of immunization, with type 11collagen just prior to development of arthritis, or after development of frank symptoms, resulted in inhibition of disease (Goldschmidt and Holmdahl, 1991). Antibody injections given at the time of immunization or before onset of arthritis resulted in complete prevention of disease for the duration of the treatment. The reversal of the disease symptoms in arthritic animals was notable following antibody administration. These impressive effects, however, did not last and after cessation of the antibody therapy severe arthritis was seen in treated animals. Though the antibody was able to deplete large numbers of T cells, the authors suggest functional blockade of the T cell receptor as the mechanism for antibody action. This hypothesis was based on the presence of fairly significant numbers of antibody-coated T cells in the circulation. Also, thymectomized rats went on to develop severe arthritis after a period of disease inhibition during antibody treatment suggesting functional inhibition rather than depletion being responsible for disease inhibitory effects of the anti-alp antibody. In a different rat model, streptococcal cell wallinduced arthritis, which also has similarities with human rheumatoid
THE TRIMOLECULAH COMPLEX
229
arthritis, anti-alp antibodies have been demonstrated to be effective in prevention of chronic disease (Yoshino et al., 1991b).Anti-alp treatment results in minimal destruction of cartilage and very low-level inflamation in the synovium of the tarsal joints. In these studies, rapid but incomplete depletion of the alp TCR' T cells was observed following anti-alp injection. However, by Day 3 85-90% of cells were eliminated and several injections maintained depletion. Following withdrawal of the treatment the alp' T cells returned gradually to about 70% of the normal level. This same group has reported success in using monoclonal anti-alp TCK antibody in treating and preventing adjuvant arthritis (Yoshino et al., 1990).Complete prevention ofspontaneous diabetes in the NOD female mice, a model for the human IDDM, was observed following weekly injections (during 8-24 weeks of age) of monoclonal a l p TCR-specific antibody (Kubo et al., 1989). Twice weekly treatment with F(ab')2 fragments was also shown to be successful (Sempe et al., 1991). Cyclophosphamide-induced acute diabetes in male NOD rnice was also prevented by treatment with a1 p TCR-specific monoclonal antibody. Interestingly, anti-alp treatment was also able to reduce the incidence ofinsulitis in 8-week-old NOD female mice following a single injection of 500 pg. Even overt diabetes could be reversed by anti-alp antibody treatment. After six daily injections of the antibody to six overtly diabetic mice all became normoglycemic, three only for a short period. Treatment of ongoing diabetes by this antibody suggests that cell-mediated effectors are one of its target. When the total IgG anti-alp was used, large-scale depletion of cells from the circulating pool was observed but the splenic population remained unaffected. That depletion was not the major mechanism was also shown by the efficacy of the nondepleting F(ab')2 fragments. N o general immunosuppressive effects were observed following antibody treatment; no significant changes were found in the ability of the NOD mice to maintain allogeneic skin grafts (Sempe et al., 1991).
D. ANTI-TCRVp ANTIBODY The knowledge that there existed a bias for expression of Va- or p-
chains in recognition of specific peptide antigens in the context of MHC molecules suggested yet another potential for immunotherapy. Analysis of antigen-reactive T cell clones revealed a limited heterogeneity in the use of Vp or V a genes in response to well-defined antigens. T cell responses to different model antigens showed limited heterogeneity in T cell receptor usage when analyzed using specific DNA probes or specific antibodies to the T cell receptor chains. Specific examples include pigeon cytochrome C (Fink et al., 1986; Winoto et
230
AMITABH GAUR A N D C. GARRISON FATHMAN
al., 1986; Sorger et al., 1987; Matis et al., 1987; Hedrick et al., 1988),C1 h repressor (Lai et al., 1988,1990),and SWM (sperm whale myoglobin) (Morel et al., 1987; Danska et al., 1990). Immunotherapy based on
this limited TCR expression allowed treatment in both mouse and rat EAE, animal models of multiple sclerosis. Despite the difference in the antigenic epitopes and MHC restrictions essentially a single Vp gene was utilized by almost all the T cell clones analyzed from mice or rats (Happ and Heber-Katz, 1988; Burns et al., 1989; Acha-Orbea et al., 1988; Urban et al., 1988).This led Heber-Katz and Acha-Orbea (1989) to propose the V-region disease hypothesis which implicated the T cell receptor, not only in antigen recognition, but also as an effector in the initiation of the disease process by other unknown mechanisms. Restricted T cell receptor usage has also been reported in experimental autoimmune uveoretinitis where retinal S antigen reactive pathogenic T cell lines use rat homologues of the mouse Va2 and Vp8 (Merryman et al., 1991; Gregerson et al., 1991). All the studies on TCR usage in disease discussed above defined restricted TCR expression in recognition of different antigens on the basis of predominance of a given p- or a-chain in the T cell clones or lines established or maintained in uitro. Restricted TCR usage was also detected in uiuo. More than 90% of the proliferative response to the MBP epitope 1-11 was found in the VpS+ CD4+ T cells when lymph node cells of immunized PL/J (H-2") mice were sorted into Vp8' and Vp8- populations (Acha-Orbea et al., 1988). That limited heterogeneity in TCR usage demonstrated by T cell clones is a true reflection of the immune response in viuo was shown by our work examining the DBAl2 response to SWM. DBAl2 mice immunized with SWM or with an immunodominant determinant (aa110-121)mounted a strong T cell proliferative response which was limited to the Vp8' CD4+ T cell population (Ruberti et al., 1991). These findings showed that the limited heterogeneity in TCR usage demonstrated by the T cell clones was representative of the immune response in uivo. One attractive feature of a limited TCR use in response to defined antigens was the possibility that specific immunointervention could be applied to control a given immune response. Antibodies specific to the variable region of either a- or p-chains of the heterodimeric T cell receptor can be of potential use. Monoclonal antibodies specific for p-chain variable regions have been used for prevention and treatment of MBPinduced EAE in rodents. The (PL/J x SJL)F1 mouse generated predominantly Vp8 encephalitogenic T cells in response to immunization with either MBP or its N terminal epitope Acl-11. H-2" mice, PL/J or (PL/J x SJL)Fl, generate predominantly Vp8.2+, 1-A"+
THE TRIMOLECULAR COMPLEX
23 1
restricted encephalitogenic T cell clones in response to the N terminal Acl-11 epitope of MBP (Acha-Orbea e t al., 1988; Zamvil et al., 1988). F23.1, a depleting monoclonal antibody specific for all members of the Vp8 gene family (Staerz et al., 1985), was used to treat or prevent EAE in H-2" mice (reviewed by Acha-Orbea et al., 1989; Steinman, 1991). In a remarkable study, monoclonal F23.1 antibody was able to cause complete reversal of the disease process in 13 of 16 animals in which disease was induced by transfer of VP8.2+ encephalitogenic cloned T cells. F23.1 eliminated 98% of the Vp8' T cells from circulation and prevented the induction of disease in 18 of 19 mice following immunization with the Acl-11 encephalitogenic epitope of MBP. Even when guinea pig MBP, containing multiple pathogenic epitopes, was used to induce EAE, administration of anti-VP8 after the development of symptoms resulted in substantial (12 of 19) reversal of the disease (Acha-Orbea et al., 1988). Urban et al. (1988) have also used KJ16, another monoclonal antibody (specific for Vp8.1 and 8.2) (Haskins et al., 1984) in preventing EAE in B1O.PL mice. In the B1O.PL (H-2") mice although 84% of T cell clones responding to the N terminal determinant of MBP were Vp8.2' there were some clones (16 in number) which expressed Vp13. Although treatment in vivo with a Vp8.2specific monoclonal antibody F23.2 (Staerz and Bevan, 1985)resulted in almost complete depletion of Vp8.2 cells, it did not completely eliminate proliferative T cell response to MBP nor did it completely prevent the occurrence of MBP-induced EAE. Although 75% of animals treated with anti Vp8.2 did not develop symptoms, 5 of 20 developed fulminant disease in the treated group. Since 1/6th of the MBP-reactive clones expressed VP13 and not Vp8.2 a depleting antiVp13 monoclonal antibody was also used in these experiments. AntiVp13 treatment alone failed to have any impact on disease progression; however, when given along with Vp8.2 specific antibody, it resulted in a dramatic drop (only 1 of 20) in disease incidence (Zaller et al., 19'30). Also, lymph node cells from double antibody-treated animals did not respond to MBP in a proliferation assay. The same mixture of antibodies was found effective in reversing MBP-induced paralysis in the B1O.PL mice (Zaller et al., 1990). Sakai et al., (1988) attempted the use of Vpl7a-specific monoclonal antibody in suppressing EAE in SJL/J (H-2') mice. These mice respond to aa 89-101 of the MBP utilizing largely Vp17a+ clones. However, about half of the clones do not use Vpl7a+ T cell receptor. Whereas both Vp17a+ and Vp17a- clones were effective in transferring disease in naive animals. In this study, depletion mediated by antiVp17a antibody, KJ23a (Kappler et al., 1987), was effective in sup-
232
AMITABH GAUR A N D C. GARRISON FATHMAN
pressing EAE when caused by transfer of 89-101-specific Vp17a T cell clones but was ineffective when the disease was induced by 89-101specific but Vpl7a-negative T cell clones or MBP or even 89-101 peptide. The presence of another epitope nested within 89-101 epitope which is recognized by VP17a- T cells could account for these results. Padula et al. (1991) reported the use of VP4+ T cells in recognizing a new epitope 92-103 in the SJL mice. Anti-VP4 (KT4), when given along with the MBP-specific cell line (57% cells expressing Vp4 TCR) in an adoptive transfer system, was very effective in preventing the development of disease. Three of four mice remained disease free and the fourth had a mild disease as opposed to all five animals which developed severe EAE in the control antibody group. In Lewis rats, an anti-TCR monoclonal antibody recognizing an idiotope on an MBP 68-88-specific rat T cell clone was also used to cause reduction in MBP-induced EAE incidence and severity in 67% of treated animals (Owahashi and Heber-Katz, 1988).The experiments discussed above demonstrate the efficacy of anti-TCR VP-specific monoclonal antibodies in downregulation of immune response and, in the case of autoimmunity, amelioration of disease. The efficacy of this approach depends on the oligoclonality of the T cells in response to a given antigen. Response of a different clonal population (possibly of a lower affinity) on elimination of the main responding population could nullify the immunosuppressive effect. We have shown that despite the neutralizing of the majority of Vp8' cells by SEB treatment mice still developed EAE following immunization with encephalitogenic Acl-11 epitope of MBP. These data were suggestive of the emergence of an encephalitogenic non-Vp8 population having lower affinity for Acl-11 epitope but capable of causing disease (Gaur et al., 1993a). Also, nested epitopes inducing different T cell clonal populations could pose a problem. In situations where more than one TCR is utilized a cocktail of anti-Vp antibodies could be used but oligoclonality of the response remains an essential requirement for the effectiveness of the anti-Vp approach. This was shown in the case of collageninduced arthritis where restricted Vp usage was indicated in disease induction (Banerjee et al., 1988). Use of different Vp monoclonals did not have the desired immunosuppressive effect, possibly because of lack of TCR restriction in the response (Goldschmidt et al., 1990). The situation is further complicated in human autoimmune diseases where no clear restriction in receptor usage has been observed. Analyses of TCR usage in T cell clones obtained from the synovial fluid of a rheumatoid arthritis patient have resulted in conflicting reports. One study demonstrated oligoclonality in clones expanded in vitro (Sta-
THE: TRIMOI,ECUI,AR COMPLEX
233
menkovic et al., 1988) whereas others failed to find any evidence for restricted TCR usage in such T cell clones (Duby et al., 1989).In MS, T cell clones from the cerebral spinal fluid but not from the peripheral blood show limited receptor usage (Hafler et al., 1988).Oksenberg et al. (1993) reported conservation of the junctional sequences of the Vp5.2 from direct polymerase chain reactions (PCRs) of plaques from MS patients. Five different motifs were seen. Interestingly one motif was identical to the V-D-J sequence of an M B P peptide-specific clone isolated from an MS patient. The importance of this finding was underscored by the fact that encephalitogenic rat T cell clones, recognizing a MBP epitope similar to that of the human clone, had same amino acid sequences in the V-D-J region of the TCR p-chain. In another report, Vp usage in the peripheral blood and synovial fluid of rheumatoid arthritis (RA) patients was compared by PCR amplification employing specific Vp oligomers. In the seven RA patients, the frequency of the Vp14' cells in the peripheral blood was extremely low but was significantly increased in the synovial fluid ofthe affected joints. There was no skewing in Vp14' cells in the peripheral blood and synovial fluid of patients with nonrheumatoid arthritis inflammations. The VD-J sequencing of the Vp14 cells showed that 46 to 72% of the Vp14 population in the synovium of HA patients had a single clonotype. The near complete absence of Vp14' cells in the periphery of these patients led the authors to suggest that a superantigen (sharing reactivity with the putative autoantigen at the site of inflammation) could be involved in both elimination of V/314+ cells from the periphery and their oligoclonal expansion in the synovium (Paliard et ul., 1991).The complex etiopathology of autoimmune diseases may not allow such precise but simplistic immunotherapeutic regimens such as the one discussed in this section (Sinha et al., 1990).
E. T CELLVACCINATION In the preceding sections, we have discussed the use of antibodies directed at various proteins on the T eel1 surface in regulating T cell responses, We now examine T cells as effectors of immune regulation. This approach involves the use ofantigen-specific T cell lines or clones as vaccinating agents to elicit "anti-idiotypic" regulator T cells capable of inhibiting the response of the antigen-specific T cell population. As opposed to passive administration of antibodies, this approach involves active participation of the individual's immune system in inducing a regulatory response to the immunizing cells. Using MBP-specific T cell lines for vaccination, Cohen and co-workers were successful in preventing EAE in experimental animals (Ben-Nun et d.,1981).Since
234
AMITABH GAUR A N D C. GARRISON FATHMAN
then, they have tried various vaccination protocols (reviewed by Cohen, 1986,1989) in controlling experimental autoimmune diseases. After activation by antigen myelin basic protein-specific T cells were irradiated (Ben-Nun et al., 1981) and inoculated into Lewis rats. The irradiated cells were able to prevent MBP-induced disease but unable to protect against disease induced by adoptive transfer of MBP-specific T cell lines. Glutaraldehyde crosslinking or pressure aggregation of cell-surface molecules seemed to overcome this problem (Lider et ul., 1987). However, Offner et al. (1989) reported the requirement of both irradiation and pressure treatment of vaccinating T cells to obtain complete protection against active and passively transferred disease (Offner et al., 1989). Even a heterogeneous T cell population like lymph node cells, with few antigen-specific cells, or a nonattenuated subpathogenic dose of a T cell line, was shown to be effective in protecting from active or passive EAE (Lider et al., 1987; Beraud et al., 1989). A nonencephalitogenic T cell clone specific for epitopes other than 72-89 of guinea pig myelin basic protein isolated during the recovery phase of EAE has been used to prevent and treat both active and passive EAE in rats. This clone [expressing Vp8.6 TCR and specific for amino acid 55-69 of GPBP (guinea pig basic protein)] apparently shares a cross-reactive idiotype with encephalitogenic clones, specific for other epitopes. Thus vaccination with this clone downregulates the response of encephalitogenic T cells (Offner et al., 1991a). Besides EAE, T cell vaccination has been used in the prevention of other induced autoimmune diseases including thyroiditis (Maron et al., 1983)and adjuvant arthritis (Lider et al., 1987). Vaccination with irradiated mouse spleen cells primed and activated to thyroglobulin prevented development of EAT (experimental autoimmune thyroiditis) in mice on challenge with thyroglobulin in adjuvant; again such vaccination did not block passive disease induced by adoptive transfer of antigen-specific T cells. The preventative effect of T cell vaccination was not reduced following depletion of CD8+ cells prior to vaccination. Depletion of either CD4+ or CD8+ cells after vaccination did not affect the protective ability of T cell vaccination but depletion of both subsets at the same time abrogated the protective effect of T cell vaccination. This indicated requirement of both subsets to mediate T cell vaccination-induced downregulation of specific immune response (Flynn and Kong, 1991). Experimental autoimmune thyroiditis induced in mice by immunization with thyroglobulin was shown to be prevented by vaccination with a cytotoxic MHC class Irestricted antigen-specific T cell hybridoma. The vaccination was done 3 weeks before induction of disease with the antigen (Roubaty et al.,
T H E TRIMOLECULAR COMPLEX
235
1990).Monoclonal anti-clonotypic antibody specific for this hybridoma was found to be effective in completely preventing antigen-induced thyroiditis in mice (no reduction in autoantibodies to thyroglobulin was seen in treated mice), suggesting that T cell vaccination may well induce anti-clonotypic antibodies, in addition to anti-idiotypic T cells, to neutralize the pathogenic T cells (Texier et nl., 1992). A CD4+ CD8- T cell line specific for mouse testicular antigens has been shown to suppress the induction of autoimmune orchitis (EAO) in mice when given prior to challenge with the autoantigen. Both cellular and antibody responses were suppressed in an antigen-specific manner in treated mice (Itoh et ul., 1992). Experimental autoimmune neuritis (Taylor and Hughes, 1988)and collagen II-induced arthritis (Kakimoto et nl., 1988) have also been suppressed by vaccinations with antigenspecific T cells. Prevaccination with a subuveitogenic dose of antigenspecific T cells resulted in a marked reduction in pathology of experimental autoimmune uveoretinitis (EAU), on subsequent transfer of a disease-inducing dose of the same uveitogenic T cell line. Actively induced disease was not diminished by such treatment. However, anti-idiotypic or anti-ergotypic responses after treatment were observed and could be implicated in regulating the response of pathogenic T cells (Beraud et ul., 1992). MRL/lpr mice spontaneously develop systemic lupus erythematosus (SLE).Vaccination of young mice with low numbers (0.25 million) ofirradiated CD3’ CD4- CD8- cells isolated from hyperplastic lymph nodes of 6-month-old mice resulted in marked reduction in splenic hyperplasia and lymphadenopathy. Transfer of lymph node cells from vaccinated mice to 2-month-old recipients showed a significant decrease in autoimmune signs as evidenced by decreased proteinuria and increased life span (De Alboran et al., 1992). T cell vaccination seems to induce an anti-idiotypic response mediated by CD4’ T cells which “regulate” antigen-specific T cells. CD8’ anti-idiotypic populations have also been generated capable of lysing the idiotype-bearing T cell in uitro. This could account, in part, for certain regulatory effects seen in uivo (Sun et al., 1988). However, the presence of MBP-specific but avirulent T cells in T cell-vaccinated rats suggests the existence of more than one mechanism. How the CD4 arm of the anti-idiotypic response controls the idiotype-positive T cell is not known. However, the CD4 cells do have a suppressive effect as was shown when cells from vaccinated mice inhibited the proliferative response of the idiotype-positive cells to the specific antigen (Cohen, 1986). T cells used in vaccination are more efficient in generating anti-idiotypic responses if they are activated. Antigen or
236
AMITABH GAUR AND C. GARRISON FATHMAN
mitogen-activated cells seem more efficient in vaccination protocols to prevent disease (Cohen, 1986). This was demonstrated when 5 x lo7 nonactivated cells (with the same specificity) were less effective than fewer (