Advances in Cancer Research Volume 58

ADVANCESINCANCERRESEARCH VOLUME 58 This Page Intentionally Left Blank ADVANCES IN CANCERRESEARCH Edited by GEORGE ...

Author: George F. Vande Woude

21 downloads 1148 Views 12MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

ADVANCESINCANCERRESEARCH VOLUME 58

This Page Intentionally Left Blank

ADVANCES IN CANCERRESEARCH Edited by

GEORGE F. VANDE WOUDE Frederick Cancer Research and Development Center Frederick, Maryland

GEORGE KLEIN Department of Tumor Biology Karolinska lnstitutet Stockholm, Sweden

Volume 58

ACADEMIC PRESS, INC. Harcourt Brace Jovanovich, Publishers

San Diego New York Boston London Sydney Tokyo Toronto

This book is printed on acid-free paper. @

Copyright 0 1992 by ACADEMIC PRESS, INC. All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the publisher.

Academic Press, Inc. San Diego, California 92101 Unikd Kingdom Edition published by ACADEMIC PRESS LIMITED 2428 Oval Road, London NW17DX

Library of Congress Catalog Card Number: 52-13360

ISBN 0-1 2-006658-0 (alk. paper)

PRINTED IN THE UNITED STATES OF AMERICA

92939495

9 8 7 6 5 4 3 2 1

CONTENTS

CONTRIBUTORS TO VOLUME 58 .....................................................................................

ix

Epstein-Barr Virus in B Lymphocytes: Viral Gene Expression and Function in Latency ROBERTP . ROGERS. JACK L . STROMINGER.

AND SAMUEL

H . SPECK

I . Natural History of the Virus and Associated Diseases ............................... I1 . Expression and Function of EBV Genes during Latency I11. Structure of Viral Transcripts and Promoters for the EBV Latent Genes ............................................................................ N . Perspective o n Viral Gene Expression in the LCL Model ........................ References .....................................................................................................

1 4 10 17 21

The Physiology of Transforming Growth Factor-a RIKDERYNCK I. I1. 111.

N. V.

VI. VII . VIII .

Introduction .................................................................................................. TGF-a Is a Member of a Growth Factor Family ...... The Structure of T G F a and Its Precursor ................................................. Interactions of T G F a with the EGF/TGFa Receptor ............................. The Transmembrane TGF-a Precursor ...................................................... A Role for T G F a in the Physiology of Normal Cells ................................ T G F a in Normal Development ....................... ................................... A Role for TGF-a in Tumor Development? ............................. References .....................................................................................................

V

27 28 30 34 36 38 41 43 48

vi

CONTENTS

The Role of Raf-1 Phosphorylation in Signal Transduction GISELAHEIDECKER, WALTER KOLCH,DEBORAH K. MORRISON, AND

I. 11. 111.

IV. V.

ULFR. RAPP

The rajoncogene Family ............................................................................. Raf-1 Activation following Growth Factor Stimulation ............................. Sites of Raf-1 Phosphorylation ......................................... .......... Consequences of Raf-1 Activation ..... ........ Conclusion ._.. ................................................ References .....................................................................................................

53 54 59 66 70 70

G Protein-Controlled Signal Transduction Pathways and the Regulation of Cell Proliferation KLAUS SEUWEN AND JACQUES POUksSEGUR

Introduction ....... Signal Transductio Tyrosine Kinase Activity ............................................................................... 111. Signal Transduction through G Protein-Coupled Receptors . IV. Conclusion ................ ........ References .....................................................................................................

I.

75

11.

76

90

Regulation of Muscle Cell Growth and Differentiation by the MyoD Family of Helix-Loop-Helix Proteins LI LI AND ERICN. OLSON I. 11.

111.

N. V.

Introduction . ...................................... Evidence for Myogenic Regulatory Genes ................................................. The MyoD Family of Muscle-Specific Regulatory Factors ......................... Antagonism between Proliferation and Differentiation within the Myogenic Summary ........................................................................................................ References .............

95 96 97

114

vii

CONTENTS

Molecular Genetic Characterization of CNS Tumor Oncogenesis C . DAVID JAMES I. 11.

111. IV. V.

AND

v. PETER COLLINS

Introduction ................................................................................................... Explanation of Model ................................................................................... Comparison of Molecular Genetic and Histopathologic Analysis ........... Status of Identifying and Characterizing Specific Gene Alterations in CNS Tumor Development ............................................................ Implications of Molecular Gen nalysis on CNS Tumor Diagnosis and Treatment .............................................................................. References .......................................................

121 122 129 132 I37 139

Tumor Eradication by Adoptive Transfer of Cytotoxic T Lymphocytes CORNELIS J. M . MELIEF I. 11. 111. IV. V. VI .

VII.

T Cell Immunity ............................................................................................ Processing of Antigens for Recognition by T Cells ................................... Immunogenicity of Tumors Adoptive lmmunotherapy of Virus-Induced Tumors with T Cells .......... Escapes of Tumor Cells from Immune T Cells ........................................... Relationship of LAK Cells, TIL Cells, NK Cells, and T Cells, All with Antitumor Activity and Clinical Results of Adoptive Therapy with LAK and TIL Cells ........................................................................... Cloned T Cells with Autologous Tumor Specificity in Malignant .................................. ............. ................. . ............... ...............

.

VIII.

..

. I . .

143 144 145

154 160

163 166 167 168

Toward a Genetic Analysis of Tumor Rejection Antigens THIERRY BOON I. 11. 111.

IV. V.

Introduction ................................................................................................... tum- Antigens: Genes, Mutations, and Antigenic Peptides ........ A Tumor Rejection Antigen of Tumor P815 .............................................. d on Human Tumors by Autologous CTLs

....................................................... .. ,I..

References .....................................................................................................

INDEX ........................................................................................................................................

177 183 197 201 205 207

21 1

This Page Intentionally Left Blank

CONTRIBUTORS

Numbers in parentheses indicate the pages on which the authors' contributions begin.

THIERRY BOON,Ludwig Institute for Cancer Research, Brussels Branch, B-1200 Brussels, Belgium, and Cellular Genetics Unit, Universiti Catholique de Louvain, B-1200 Brussels, Belgium ( 177) V. PETER COLLINS, Ludwig Institutefor Cancer Research, Clinical Group, S-10401 Stockholm, Sweden, and Division of Neuropathology, Department of Pathology I, Salgrenska Hospital, 941345 Gothenburg, Sweden (121) RIK DERYNCK, Departments of Growth and Development, Anatomy, and Program of Cell Biology, University of California, San Francisco, San Francisco, California 94143 (27) GISELA HEIDECKER, Viral Pathology Section, Laboratory of Viral Carcinogenesis, NCI-Frederick Cancer Research and Development Facility, Frederick, Malyland 21 702 (53) C. DAWD JAMES, Department of Pediatrics, Division of Hematology/Oncology, Emory University School of Medicine, Atlanta, Georgia 30322 (121) WALTER KOLCH,Viral Pathology Section, Laborat09 of Viral Carcinogenesis,NCIFrederick Cancer Research and Development Center, Frederick, Malyland 21 702 (53) CORNELIS J. M. MELIEF, Division of Immunology, The Netherlands Cancer Institute, 1006 CX Amsterdam, The Netherlands' (143) DEBORAH K. MORRISON, ABL-Basic Research Propam, NCI-Frederick Cancer Research and Development Center, Frederkk, Maryland 21 702 (53) ERICN. OLSON, Department of Biochemistry and Mobcular Biology, The University of Texas M . D. Anderson Cancer Center, Houston, Texas 77030 (95)

'Present address: Department of Immunohematology, University Hospital, 2300 RC Leiden, The Netherlands. ix

X

CONTRIBUTORS TO \'OI.UME

58

Lr LI, Department of Biochemist? and Molecular Biology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 (95) JACQUES P O U U S S ~ G U R , Centre de Biochemie-CNRS, Uniuersith de NiwSophia Antipolis, 06034 Nice, France (75) ULFR. RAW, Viral Pathology Section, Laboratory of Viral Carcinogenesis, N U , Frederick Cancer Research and Development Facility, Frederick, Maryland 21 702 (53) ROBERT P. ROGERS, Department of Diagnostic Sciences, The University of North Carolina, School of Dentistry, Chapel Hill, North Carolina 27514 ( I ) KLAUSSEUWEN, Centre de Biochemie-CNRS, Universitb de Nice-Sophia Antipolis, 06034 Nice, France (75) SAMUEL H. SPECK, Division of Tumor Virology, Dana Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts 021 1 5 (1) JACK L. STROMINGER, Division of Tumor Virology, Dana Farber Cancer Institute, Haruard Medical School, Boston, Massachusetts 021 15 ( I )

EPSTEIN-BARR VIRUS IN B LYMPHOCYTES: VIRAL GENE EXPRESSION AND FUNCTION IN LATENCY Robert P. Rogers,* Jack L. Strominger,t and Samuel H. Speckt *Department of Diagnostic Sciences, University of North Carolina School of Dentistry, Chapel Hill, North Carolina 27514 +Division of Tumor Virology, Dana Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts 021 15

I.

Natural History of the Virus and Associated Diseases

11. Expression and Function of EBV Genes during Latency

A. Nuclear Antigens B. Membrane Proteins C. EBERS I l l . Structure of Viral Transcripts and Promoters for the EBV Latent Genes A. Transcription of the EBNA Genes B. Transcription of Viral Membrane Proteins IV. Perspective on Viral Gene Expression in the LCL Model References

1. Natural History of the Virus and Associated Diseases Epstein-Barr virus (EBV) is a herpesvirus that infects all human populations (Epstein and Achong, 1979b). Typically, greater than 95% of the adult population carries the virus, which is normally acquired asymptomatically in early childhood. When primary infection is delayed until adolescence or adulthood, approximately half the cases result in the clinical illness called infectious mononucleosis (IM) (Epstein and Achong, 197913; Henle et al., 1968). Once acquired, the virus persists in the host throughout life. It is carried in “latent” form in peripheral blood B lymphocytes (Yao et al., 1985) and is shed in the form of virus particles from a site, perhaps epithelial (Rickinson, 1984; Sixbey et al., 1984; Wolf et al., 1984; Morgan et al., 1979), in the oropharynx (Epstein and Achong, 1979b; Miller et al., 1973). Infected saliva is thought to be the normal mode of viral transmission, although virions have also been found in genital secretions (Sixbey et al., 1986). The ubiquity of EBV in human populations contrasts with the

1 ADVANCES IN CANCER RESEARCH, VOL. 58

Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

2

ROBERT P. ROGERS E T AL.

geographically restricted occurrence of EBV-associated human cancers, namely nasopharyngeal carcinoma (NPC), which is endemic to regions of southern China (for reviews see Klein, 1979; de The, 1982), and Burkitt’s lymphoma (BL), a childhood malignancy found in the malaria belt of Africa and elsewhere (for reviews see Lenoir and Bornkamm, 1987; Epstein and Achong, 1979a; Rowe and Gregory, 1989).EBV-negative BL cases greatly outnumber EBV-positive cases in nonendemic regions, but both types have characteristic chromosomal translocations involving the myc gene on chromosome 8 and (usually) an immunoglobulin locus on chromosome 2, 14, or 22 (Taub et al., 1982; Lenoir and Bornkamm, 1987). Although EBV transforms human B lymphocytes in vitro, its final contribution to the malignant phenotype of BL and other human cancers is not precisely understood. Knowledge about EBV in epithelial lesions is increasing (for review see Sixbey, 1989). In the past, EBV was thought to be present only in undifferentiated or partially differentiated cases of NPC, but low copy numbers of the genome have now been demonstrated in differentiated cases as well (Raab-Traub et al., 1987). The common poorly differentiated phenotype of NPC may be partly due to expression of a specific viral gene (encoding the viral latent membrane protein, LMP), which morphologically transforms and inhibits cellular differentiation in transfected epithelial cell lines (Dawson et al., 1990; Fahraeus et al., 1990a), though other events must be involved in those cases in which LMP is not expressed (Fahraeus et al., 1988). Passage of NPC tumors in nude mice (Raab-Traub et al., 1983; Busson et al., 1988; Billaud et al., 1989) has facilitated study of viral and cellular functions in this malignancy, which, until a recent report (Yao et al., 1990) has lacked a virus-positive cell culture system. A variant of rare thymic carcinomas with histologic similarity to NPC has been shown to possess a high number of EBV genomes and viral nuclear antigen(s) (Leyvraz et al., 1985).EBV is found in another epithelial lesion, oral hairy leukoplakia, which is associated with acquired immune deficiency syndrome (AIDS) (Greenspan et al., 1985). This apparently indolent lesion is a predictor of subsequent AIDS development, and sometimes contains rearranged viral DNA that may trigger viral reproduction (Patton et al., 1990). A rare human genetic defect gives rise to the EBV-induced X-linked lymphoproliferative (XLP) syndrome (Harada et al., 1982; Sullivan et al., 1983; Okano et al., 1988). Prior to EBV infection, affected males have subtle irregularities in their immune responses, but are generally capable of an effective response to all pathogens except EBV. Infection of susceptible males by EBV usually results in fatality involving fulminant hepatitis or hemophagocytic syndrome of the bone marrow. Failure to

EBV I N B LYMPHOCYTES

3

control both B- and T-lymphoproliferative responses, as well as natural killer cell responses, is characteristic of the disease course. Survivors of acute EBV infection are prone to hypogammaglobulinemia and B lymphocyte malignancy. The XLP genetic locus has been mapped to the region of Xq25 (Skare et al., 1987; Sylla et al., 1989). T h e first cytogenetically observed XLP-associated defect in this region was recently reported as a partial deletion of Xq25 (Wyandt et al., 1989). EBV-infected B lymphocytes are apparently controlled in vivo by cytotoxic T lymphocytes in an HLA-restricted manner (Misko et al., 1980; Rickinson et al., 1980). Immunosuppression caused by organ transplant-associated therapy or acquired immune deficiency syndrome can lead to polyclonal proliferation of EBV-carrying B lymphocytes, presumably by loss of cytotoxic T lymphocyte control. Regression of such polyclonal proliferation may occur after removal of immunosuppressive therapy. True BLs, with the characteristic chromosomal translocations, have also been documented in AIDS patients (for reviews see Lenoir and Bornkamm, 1987; Ernberg, 1989). EBV transforms the B lymphocytes of humans and other primates to continuous proliferation in culture, a process called immortalization (Henle and Henle, 1967; Pope et al., 1968; Gerber et al., 1969). T h e resultant latently infected lymphoblastoid cell lines (LCLs) support a predominantly latent viral life cycle in which only a few of the 100 or so viral genes are expressed. Viral genes expressed during latency are candidate immortalizing genes, and thus have attracted much study. Generally, less than 1% of cells of a given LCL will enter the lytic cycle in which most or all viral genes are expressed, resulting in virion production and host cell death. A number of natural and artificial stimuli can increase the percentage of infected cells entering the lytic cycle, but background triggering of untreated LCLs is not understood. Data have emerged to support the existence of two types of EBV, designated A and B (or 1 and 2) (Rowe et al., 1989; Arrand et al., 1989; Dambaugh et al., 1984; Adldinger et al., 1985; Rickinson et al., 1987). Type B viral isolates transformed B lymphocytes less efficiently than did type A viral isolates, and type B virus-transformed cells displayed a lower growth rate (Rickinson et al., 1987). Recently, virus types A and B were demonstrated at nearly equal frequencies in throat washings from healthy individuals of a United States population (Sixbey et al., 1989). Interestingly, some individuals in this study had both virus types, raising the question of whether infection with one viral strain confers immunity against subsequent challenges from other viral strains. EBV binds B lymphocytes through interaction of viral membrane glycoprotein gp350/220 with CR2, the cell surface receptor for the C3d

4

ROBERT P. ROGERS ET AL.

complement fragment (for reviews see Cooper et al., 1988; Nemerow et al., 199Ob). Among a wealth of supportive data, purified CR2 protein has been shown to bind to purified EBV (Nemerow et al., 1986),and the binding of EBV to B lymphocytes was blocked with CR2-specific antibody (Fingeroth et al., 1984). Soluble CR2 inhibits infection of B lymphocytes, a finding which may be of use in clinical treatment of acute and chronic EBV infections (Nemerow et al., 1990a). Positive immunofluorescent staining with some anti-CRP monoclonal antibodies on epithelial cells of the oropharynx has been reported (Young et al., 1986). These investigators have now found a 200-kDa protein immunoprecipitable by an anti-CR2 monoclonal antibody (mAb) (HB5) from fresh ectocervical epithelial cells (Young et al., 1989). The 145-kDa B lymphocyte CR2 molecule has yet to be identified in normal epithelium. Transcription of the CR2 gene in NPC passaged in nude mice was negative by Northern blotting and faintly positive by S1 nuclease protection in one study (Billaud et al., 1989). CR2 is also present on a small fraction of human thymocytes and on one T cell tumor line (Molt-$) (Fingeroth et al., 1988), but the question of whether normal thymocytes can be infected with EBV has not been adequately explored. II. Expression and Function of EBV Genes during Latency A. NUCLEAR ANTIGENS

The EBV genome is over 170 kilobases (kb) in length, has been completely sequenced (Baer et al., 1984), and has been extensively mapped for RNAs, promoters, open reading frames, and other structural elements (Baer et al., 1984; Farrell, 1989). Viral gene products of the latent cycle in LCLs include a set of nuclear proteins, at least three membrane proteins, and two RNA polymerase I11 transcripts (designated EBERS). The six EBV-encoded nuclear proteins are called Epstein-Barr nuclear antigens (EBNAs) and are numbered EBNA1, 2, 3A, 3B, 3C, and 4, though the nomenclature varies in the literature (see Knutson and Sugden, 1989). The latent viral membrane proteins are called LMP, T P l , and TP2. The membrane protein encoded by BHRFl functions as an early lytic antigen, but may have a function in latency as well (Austin et al., 1988). Of all the viral gene products of the latent cycle, function has been demonstrated most clearly for EBNAl . Plasmid constructs expressing EBNAl and containing the cis-acting “ o r i P DNA sequence replicate stably in transfected cells (Yateset al., 1985),suggesting that EBNAl may


5

function normally to initiate DNA replication at oriP on episomal EBV genomes. The function of oriP as an initiator and terminator of DNA replication has been recently demonstrated (Gahn and Schildkraut, 1989). In addition, EBNAl has been shown to activate an enhancer (Reisman and Sugden, 1986) in region I of omP, which contains 20 tandemly repeated EBNAl-binding sites (Rawlins et al., 1985). T h e EBNA 1-dependent enhancer appears to be significant in the regulation of Cp, one of the two known promoters utilized in the expression of the EBNA family of proteins (Sugden and Warren, 1989). EBNAl also appears to bind in the BamHI Q region of the genome (Rawlins et al., 1985), where the significance of binding is unknown. T h e EBNA2 coding region is deleted in two BLassociated viral strains, P3HR-1 (Jeang and Hayward, 1983) and Daudi (Jones et al., 1984), which differ from wild-type strains in their inability to immortalize B lymphocytes (Miller et al., 1974). Superinfection of the EBVpositive Raji BL line with the immortalization-incompetent P3HR- 1 virus yields recombinant immortalizing virus with restored EBNA2 coding regions (Skare et al., 1985). These data, although suggestive, do not prove the immortalizing function of EBNA2, because the deleted region is known to be multifunctional. It contains a portion of the EBNA4 coding region (Speck et al., 1986; Sample et al., 1986) and splice signals for many of the EBNA messages (for review see Speck and Strominger, 1989). Lingering questions have been resolved by a recent study that demonstrated the immortalizing function of EBNA2 by genetic analysis (Hammerschmidt and Sugden, 1989). The nonimmortalizing P3HR- 1 virus was found capable of immortalizing B lymphocytes in the presence of a helper virus expressing EBNA2, but not in the presence of a helper virus expressing a truncated EBNA2 protein. Restoration of the EBNA2 coding sequence by homologous recombination achieved the same result, whereas a full-length EBNA4 protein was ruled out as a requirement for immortalization. Others using the same basic approach (Cohen at al., 1989) have confirmed the transforming function of EBNA2, and, by deletion mutants, have begun to examine the EBNAQcoding regions necessary for transformation. The uses of genetic analysis newly applied to the study of Epstein-Barr virus have been discussed (Knutson and Sugden, 1989). Consistent with its role as a transforming gene, EBNA2 lowers the serum requirement for cell growth when transfected into Rat-1 fibroblasts (Dambaugh et al., 1986). Another study (Rickinson et al., 1987) linking EBNA2 with cell growth phenotype took advantage of the existence of two serotypes of this protein, namely, EBNA2A (85 kDa in B95-8 virus) and EBNAPB (75 kDa in the BLassociated strain AG876)

6


(Dambaugh et al., 1984). It was found that lymphoblastoid cell lines were more readily established by infection with type A isolates, and that the growth rate of LCLs carrying type B isolates was lower. Conclusions from this kind of study are limited by unknown patterns of viral strain variation at other genetic loci. EBNA2 influences host cell gene expression by induction of cellular antigens CD21 and CD23 in the EBV-negative cell lines Louckes (a BL) (Wang et al., 1987) and BJAB (a B lymphoma) (Wang et al., 1990b). Cotransfection experiments in BJAB showed a cooperative effect of EBNA2 and viral protein LMP in boosting CD23 at the protein and mRNA levels (Wang et al., 1990b). In an EBV-negative BL (BL41) infected with P3HR-1 virus, expression of EBNA2 led to increased levels of CD21 and CD23 mRNA levels (Cordier et al., 1990). Cell surface CD21, but not CD23, expression was increased, whereas soluble CD23 secreted into the medium was increased. CD23 is a B lymphocyte activation antigen (Hurley and Thorley-Lawson, 1988) that is expressed at high levels on EBV-immortalized B lymphocytes (Kintner and Sugden 1981; Thorley-Lawson et al., 1985). The soluble form of CD23 reportedly functions as an autocrine B lymphocyte growth factor (Swendeman and Thorley-Lawson, 1987; for review see Gordon, 1989). A study suggested a connection between EBNA2 and expression of the latent membrane protein of EBV (Murray et al., 198813).It was found that infection of EBV-negative BL cells with P3HR-1 virus (which lacks coding regions for EBNAQand part of EBNA4) resulted in failure to express LMP, whereas LMP was expressed in BL cells infected with B95-8 virus (which expresses EBNA2). Further work (Abbot et al., 1990) with P3HR-l-infected BL lines (BL30 and BL41) has shown that stable transfectants expressing EBNA2 show induced expression of LMP from the endogenous virus. Expression of full-length EBNA4 (EBNA-LP) by transfection into PSHR-l-infected BL cells was found not to induce LMP expression. The ability of EBNA2 to transactivate the LMP promoter in the absence of any other viral genes was demonstrated by cotransfection studies using EBV-negative B cell lines and CAT constructs (i.e., the chloramphenicol acetyltransferase reporter gene) (Wang et al., 1990a). Interestingly, EBNA2B was more effective than EBNA2A in this regard, whereas EBNA2A has been shown to have a more potent up-regulatory effect on CD21 and CD23 (Wang et al., 1990b) and a stronger growth phenotype (Rickinson et al., 1987; Cohen et al., 1989) than EBNA2B. These findings suggest an EBNA2 function outside its role as a transactivator of LMP (Wang et al., 1990a). Internally deleted EBNA2 mutant genes that fail to transactivate LMP also fail to transform B lymphocytes

EBV IN B LYMPHOCYTES

7

when incorporated into recombinant P3HR-1 virus (Cohen et al., 1989; Wang et al., 1990a). These data are consistent with the hypothesis that transactivation of the LMP gene is necessary for the transforming phenotype of EBNAP. One study obtained results inconsistent with the above results (Cordier et al., 1990) in finding LMP expression absent in BL4 1 transfectants stably expressing EBNA2 and containing P3HR-1 virus. Also, the unexplained LMP expression in P3HR-1 cells (African BL cells bearing the same name as the resident viral strain) may reflect an unknown viral or cellular change. In addition to transactivation of LMP, EBNA2 appears to transactivate the promoters of the viral terminal proteins in cotransfection studies using CAT constructs (Zimber-Strobl et al., 1991). Nuclear run-on experiments will be needed to demonstrate conclusively transcriptional up-regulation of the LMP and T P genes by EBNAP. EBNAP is not known to bind DNA generally, and its trans-activating properties are likely to be mediated by effects on cellular proteins. Recently, an EBNA2- responsive enhancer has been described upstream of Cp, a promoter for the EBNA genes (Sung et al., 1991; Woisetschlaeger et al., 1991).The significance of this enhancer during the initial stages of viral infection of primary B lymphocytes is discussed later. EBNASA, EBNA3B, and EBNA3C compose a family of proteins with adjacent coding regions (in BamHI E) and low-level sequence homology to each other (Hennessy et al., 1985, 1986; Joab et al., 1987). Each is encoded in closely spaced small and large exons. Expression of EBNA3C in BALB/c 3T3 cells produced no change in cell morphology, contact inhibition, or serum dependence (Petti et al., 1988),while expression in the Louckes B lymphoma line induced CD21 expression (Wang et al., 1990b). EBNA4 is a repetitive polypeptide encoded by varying numbers of repeated exons (called W1 and W2, which are transcribed from the multiple BamHI W fragments of the viral major internal repeat) and two C-terminal exons (called Y1 and Y2, which are transcribed from the BamHI Y genomic fragment to the right of the major internal repeat) (Sample et al., 1986; Speck et al., 1986; Finke et al., 1987). EBNA4 has a DNA-binding property in vztro that is reportedly lost in the P3HR-1 variant protein, which lacks the C-terminal45 amino acids (Sauter et al., 1988). Expression of an EBNA4 protein with two repeats and an intact C-terminal portion is insufficient to restore the immortalizing function of the P3HR-1 viral strain, but may contribute to the rate of B lymphocyte growth (Hammerschmidt and Sugden, 1989).

8


B. MEMBRANEPROTEINS Based on an analysis of its predicted hydropathicity, the latent membrane protein LMP was predicted to have six membrane-spanning regions, its N and C termini being cytoplasmic (Fennewald et al., 1984). This type of structure has been noted in membrane proteins with ion transport and signal-transducing functions, though no such function has been demonstrated for LMP (discussed in Sugden, 1989; Knutson and Sugden, 1989). LMP is phosphorylated (Baichwal and Sugden, 1987) and has a shorter form expressed from a late lytic cycle promoter located in an intron sequence of the transcript of the full-length “latent form” of LMP (Hudson et al., 1985a).Expression of LMP in Rat-1 cells, a partially transformed fibroblast line, causes tumorigenicity in nude mice (Wang et al., 1985). Studies describing phenotypic changes in transfected EBVnegative BL cells expressing LMP have shown increased cell surface expression of transferrin receptor and CD23 (D. Wang et al., 1988; F. Wang et al., 1990b).An increase in cell clumping (homotypicadhesion) was related to an LMP-mediated rise in cell surface expression of LFA- 1 and ICAM-1 adhesion molecules (D. Wang et al., 1988; F. Wang et al., 1990b). The LFA-3 cell surface adhesion protein involved in heterotypic immune cell recognition was also up-regulated by LMP (D. Wang et al., 1988; F. Wang et al., 1990b). Intracellular calcium levels were reportedly higher in LMP-transfected cells (Wang et al., 1988).The naturally occurring short form of LMP (lacking the amino terminus and first four transmembrane domains) was only expressed at low levels in transfected cells, obscuring interpretation of associated changes (or lack of changes) in cell phenotype (Wang et al., 1988). (Cooperativity of LMP with EBNA2 in the up-regulation of CD23 was mentioned previously.) cDNA sequences and RNA blots indicate that the joined termini of the episomal EBV genome serve as a template for two highly spliced messages potentially encoding two membrane proteins (called the terminal proteins), the shorter of which (TP2; also called LMP2B) is composed of the C-terminal portion of the longer one (TP1; also called LMP2A) (Laux et al., 1988; Sample et al., 1989). Both proteins have now been detected in several laboratories (Longnecker and Kieff, 1990;Rowe et al., 1990; Frech et al., 1990; Hudson et al., 1985b).TP1 and TP2 have been found in LCLs by immunoblot using specific serum generated with and affinity purified against a T P l fusion protein (Longnecker and Kieff, 1990). Immunofluorescence using this serum was positive in almost all cells of EBVinfected cell lines tested, and some of the staining indicated colocalization of TPl with LMP on the cell periphery (Longnecker and Kieff, 1990). The functions of TPl and TP2 are not yet known.


9

The BHRFl protein (EA-R, or restricted early antigen) is readily demonstrated in lytically infected cells, but has not been shown in tightly latent cell lines (Pearson et al., 1987), where expression may be too low to detect with current reagents. However, transcriptional studies, discussed in Section III,B, suggest a role for BHRFl during latency. BHRFl was suggested to encode a membrane protein based on predicted hydropathicity (Pfitzner et al., 1987), which includes a stretch of 21 hydrophobic amino acids near the carboxy terminus. One immunofluorescence study suggested intraluminal or membrane-bound protein localization in the trans-reticular Golgi network (Hardwick et al., 1988). Deletion of the hydrophobic carboxy terminus altered the immunofluorescent pattern to suggest relocalization to the extramembranous cytoplasm (Hardwick et al., 1988). Homologies of the predicted BHRFl protein to polyoma middle T antigen (Pearson et al., 1987) and the oncogene bcl-2 (Cleary et al., 1986; Tsujimoto, 1989; Nunez et al., 1989; Haldar et al., 1989), associated with chromosomal breakpoints in human follicular cell lymphomas, suggest that the BHRFl gene is a potential B lymphocyte-transforming gene. A recent study provides new evidence to support a role for the BHRFl protein in latently infected cells (Kocache and Pearson, 1990). Following release from serum starvation, protein expression, measured on immunoblots of the PSHR-1 BL line, was increased in G, of two successive cycles of cell division. Coincident with peaks in protein expression, antigen-positive cells increased to 100% by immunofluorescence using a previously characterized monoclonal antibody. Controls showed no concurrent induction of two other early viral proteins. Thus, BHRFl protein expression was found to be compatible with cell survival and associated with cells not undergoing the replicative cycle. Similar results were found in other cell lines, including B95-8, but not in cell lines that could not be activated to virus production (Namalwa, EBVconverted Ramos, and IB4). Perhaps BHRFl antigen levels are below the level of detection by current reagents in these latter cell lines. C. EBERS Two small polymerase 111 transcripts (EBERS) compose the most abundant viral RNA species of the latent cycle (for reviews see Kieff et al., 1985; Knutson and Sugden, 1989). Complexed to cellular La antigens, these nonpolyadenylated RNAs have no known function in EBV biology, but are homologous to and complement the function of the adenovirus VAI RNA that is necessary for efficient translation of adenovirus messages at late times after infection (Bhat and Thimmappaya,

10


1985). Recently, recombinant virus from which the EBER genes were deleted was found to be indistinguishable from wildtype virus in the abilities to establish latent infection, transform B lymphocytes, and lytically produce new virus (Swaminathan et al., 1991). 111. Structure of Viral Transcripts and Promoters for the EBV Latent Genes

A. TRANSCRIPTION OF THE EBNA GENES Initially, a component of the Epstein-Barr nuclear antigen complex was mapped to the BumHI K viral genomic fragment when its transfection into mouse LTK - fibroblasts induced a nuclear antigen detected by immunofluorescence with EBV-positive sera (Summers et al., 1982). At the time, it was thought that the promoter for this viral antigen, called EBNAl, was located on the 5-kb BamHI K fragment, because EBNAl was expressed without the specific placement of a eukaryotic promoter on the vector used for transfection. Subsequently, however, it was shown by cDNA analysis that the promoter for EBNAl was located more than 70 kb upstream of the coding region (Speck and Strominger, 1985) (Fig. 1). T h e cDNA clone JYK2 (Speck and Strominger, 1985) provided the first example of the long-range and complex splicing characteristic of transcripts that code for members of the EBNA family. JYK2 is composed of seven exons from the BamHI W, Y, U, E, and K fragments, the last of these bearing the EBNAl coding region, BKRF1. [The open reading frame (ORF) nomenclature is based on the BamHI viral genomic fragments; BKRFl designates “BamHI K right frame one,” meaning the first (leftmost) ORF starting in BamHI K and transcribed in a rightward direction (Baer et al., 1984).] Three other ORFs, including the 3’ portion of the EBNA4 ORF, are located on J Y K P upstream of the EBNA 1 ORF, making the corresponding message potentially polycistronic (capable of being translated into multiple proteins). T h e incomplete 5’ end of the clone prevented identification of the promoter. Two promoters for the EBNA-coding transcripts have since been discovered (Speck et al., 1986; Sample et al., 1986; Bodescot et al., 1986, 1987), one (Wp) in the BamHI W fragment and one (Cp) farther upstream (leftward on the standard genomic map) in the U1 (unique) portion of the BamHI C fragment (Fig. 1). Usage of these promoters has been found by S1 nuclease analysis to be mutually exclusive in different B lymphocyte lines (Woisetschlaeger et al., 1989), although the factors that govern promoter usage are not yet fully understood. Some regulatory elements of these two promoters have been defined. An EBNA 1-

11


EBNA mRNAs

TP

c1 c2

C

wow1 w2

w1 w2

*

w1w2

WP

W

FIG. 1 . Diagrammed is the organization of transcriptional units utilized by the latent virus in immortalized B lymphocytes. The BamHI genomic fragments A, Nhet, h, C, and W are shown eniarged above the schematic drawing of the circularized genome. Promoters (bent arrows) are indicated for genes encoding latent membrane protein (LMP), terminal proteins (TP) 1 and 2, and the nuclear antigens (EBNAs); TR, terminal repeat; onP, latent origin of replication; Wp and Cp, promoters; C1, C2, WO, W1, and W2 are exons.

dependent enhancer in oriP has been shown to up-regulate transcription from Cp (Sugden and Warren, 1989; Woisetschlaeger et al., 1989). A glucocorticoid response element located some 850 bp upstream of Cp is also capable of up-regulating Cp-driven gene expression (Kupfer and Summers, 1990). An enhancer within about 500 bp upstream of Wp has activity in lymphoid DG75 cells but not in epithelial HeLa cells (Ricksten et al., 1988). Whether all of the EBNAs can be expressed from one or the other of these promoters in a given cell line is not yet known, and the utilization of additional promoter(s) for EBNA expression remains a possibility. Some latent viral gene expression in BL biopsies is now known to differ from that in most cultured BL lines (M. Rowe et al., 1987; D. T. Rowe et al., 1986). Thus, biopsy material is the most relevant source of viral RNA for study, both by S1 nuclease protection experiments and cDNA cloning, regarding differential promoter usage in BLs. Several observations suggest the utilization of at least one additional promoter: (1) neither Cp nor Wp appears to be utilized in the Raji cell line

12

ROBERT P. ROGERS E T A L .

(Woisetschlaeger et at., 1989) and (2) in type I BL cell lines, e.g., Rael (see below), only EBNAl is expressed. Rael utilizes neither Cp nor Wp, but on induction with azacytidine (Masucci et al., 1989a), Wp and Cp are sequentially activated (M. Woisetschlaeger et al., unpublished observations). Moreover, the mRNA encoding the EBNAl message in the type I BLs Rael and Akata is distinctly smaller than that found in EBV-transformed lymphoblastoid cell lines (A. B. Rickinson, unpublished observations; B. Schaeffer et al., unpublished observations), suggesting either the utilization of a different promoter or a novel splicing mechanism. T h e absence of cross-hybridization of this EBNAl transcript to a probe containing W1 and W2 exons indicates a distinctly different message structure than the EBNA transcript present in LCLs (B. Schaeffer et al., unpublished observations). T h e JYK2 cDNA clone remains the only characterized cDNA representative of highly spliced EBNA transcripts from the JY LCL. Because S1 nuclease data have shown Cp to be active in JY, it is possible but not proved that the EBNAl message in JY cells is transcribed from this promoter. The location of Cp was tentatively identified by the 5’ boundary of the C1 exon found on EBNA-encoding cDNAs from the B95-8 marmoset cell line (Bodescot et al., 1986; Bodescot and Perricaudet, 1986), and then confirmed by S1 nuclease mapping and primer extension (Bodescot et al., 1987). Transcripts for EBNAl, EBNASA, and EBNA3C have been linked to this promoter by cDNA evidence (Bodescot et al., 1986; Bodescot and Perricaudet, 1986) from B95-8 cells. Structures of the EBV latent transcripts have been recently reviewed (Speck and Strominger, 1989) Fig. 2A). Additional characterization of the EBNAS family of transcripts has come from cDNA work on an LCL that demonstrated an alternative C2 exon splice donor site (Sawada et al., 1989). T h e structure of the EBNASB transcript has been recently clarified by the demonstration of the splice joining BERF2a and BERF2b (Kerdiles et al., 1990). In the IB4 LCL, EBNA cDNAs have been identified with 5‘ boundaries mapping about 25 bp downstream of a consensus eukaryotic promoter in the BamHI W fragment (the “W promoter,” Wp) (Speck et al., 1986; Sample et al., 1986). Transcripts for EBNA2 and EBNA4 have been linked to this promoter by cDNA evidence. T h e EBNA4 ORF relies on a particular splice junction to generate its AUG translation initiation codon (the only translation initiation codon in the entire EBNA4 gene) (Sample et al., 1986; Speck et al., 1986), which has been observed in cDNAs in conjunction with the 5‘ terminal WO exon, which is characteristic of Wp usage (see Fig. 2). T h e C2 exon, characteristic of Cp usage, is also capable of generating the EBNA4 start codon by utilization of

13


A Genomic DNA

14,360

WO EXON Genomic DNA GGTCCTGCAGCTA~CTGGTCGCA~CAGAGGCCCAGGAGTCCACAC14,407 IB4-WY1 TCAGAGGCCCAGGAGTCCACAC GGAGTCCACAC IB4-W2.16 Genomic DNA AAATGTAAGAGGGGGTCI-~CTACCTCTCCCTAGCCCTCCGCCCCCTC 14,454 AAATIB4-WY1 AAAT IB4-W2.16 Genomic DNA CAAGGACTCGGGCCCAGlTCTAAC‘TmCCCCCI-rCCCTCCCTCGTCT 14,502 Genomic DNA TGCCCTGCGCCCGGGGCCACCTTCATCATCACCGTCGCTGACTCCGCCA 14,548

W1 EXON Genomic DNA IB4-WY1 IB4W2.16

TCCAA~CCTA~GGGAGACCGAAGTGAAGGCCCTGGACC ... -GGGAGACCGAAGTGAAGGCCCTGGACC...

CCTAGGGGAGACCGAAGTGAAGGCCCTGGACC.. .

FIG. 2. (A) Aligned sequences of two cDNAs (IB4-WY1 and IB4-W2.16) corresponding to alternatively spliced RNAs are shown in comparison to genomic sequence from BamHI W. One splice acceptor site (open box) yields a translation initiation codon (AT + G) for the EBNA4 gene, while the other (closed box) does not. The CAAT and TATA promoter elements of Wp are boxed. (B) Alternative splicing to the W 1‘ exon (generating the translation initiation codon for EBNA4) or the W1 exon (failing to generate the EBNA4 translation initiation codon). Cp and Wp are used in a mutually exclusive fashion in different cell lines, and are sequentially activated as described in the text.

known splice donors and acceptors. Although this event has yet to be documented by cDNA evidence, its occurrence in total cellular poly(A) RNAs has been demonstrated by S1 nuclease data (Rogers et al., 1990). EBNA4 has also been called “leader protein” (LP), because its ORF occurs upstream of the ORF for EBNA2 on some characterized cDNAs (Sample et al., 1986). Although many cDNAs whose 3’ exons encode EBNAs 1, 3A, or 3C have EBNA4 coding sequences at their 5‘ ends, these cDNAs either lack the necessary splice-generated ATG start codon +

14


for EBNA4 or have incomplete 5' ends, which preclude positive statements about the translatability of EBNA4 from the corresponding messages. An important mechanism for ensuring translation of all the genes in this transcriptional unit appears to be alternative splicing, yielding either an EBNA4 AUG-containing message (from which the downstream ORFs are most likely not e5ciently translated) or a message lacking this initiation codon (which presumably facilitates the e5cient translation of EBNAs 1, 2, 3A, 3B, and 3C encoded downstream) (Rogers et al., 1990) (Fig. 2B). Analysis of Cp and Wp usage in a large panel of LCL and BL cell lines indicated that the majority of cell lines appeared to use Cp. Furthermore, when an exogenous reporter construct containing both promoters was transfected into either Cp- or Wp-utilizing cell lines, the exogenous Cp was preferentially used in all cases (Woisetschlaeger et al., 1900).This demonstrated that the transcription factors necessary to drive Cp are present in Wp-utilizing cell lines, and suggests that the lack of endogenous Cp activity in these cell lines may be the result of mutation(s) of Cp. Indeed, an analysis of the viral genomes present in two Wp-utilizing cell lines showed that they contain relatively large deletions spanning Cp. A role for Wp during the initial stage of viral infection of B lymphocytes was revealed in time course studies in which Wp, but not Cp, was utilized during the first 48-72 hr postinfection, followed by a dramatic rise in Cp activity (Woisetschlaeger et al., 1990). Thus, the role of Wp may be to initiate viral transcription upon infection of quiescent B lymphocytes, followed by a switch to Cp activity. The mechanism and consequences of EBNA gene expression driven from Cp as opposed to Wp are not fully clear, although splicing patterns may vary with promoter usage, thus altering the pattern of EBNA expression. The discovery of an EBNA2-responsive enhancer upstream of Cp (Sung et al., 1991; Woisetschlaeger et al., 1991)has led to speculation on a role for EBNA2 in a switch from Wp to Cp usage after the first few days of infection of primary B lymphocytes. It appears that both an enhancer and suppressor of transcription map to a region from -429 to -245 bp upstream of Cp (Woisetschlaegeret al., 1991). Transcription in the IB4 LCL has been reexamined by nuclear run-on (Sample and Kieff, 1990), demonstrating an absence of transcription upstream of Wp, which is consistent with our findings of the exclusive use of Wp (Woisetschlaeger et al., 1989) and the deletion of Cp (Woisetschlaeger et al., 1990) in this cell line. Low-level transcription to the right of the EBNAl polyadenylation signal (Sample and Kieff, 1990) in the IB4 cell line is intriguing because no latent gene product is known to arise from this region of the genome.


15

A curious aspect of EBV transcription is the great abundance of partially spliced heteronuclear transcripts. One study (van Santen et d., 1981) demonstrated large (up to 22 kb), nuclear, polyadenylated rightward transcripts hybridizing to the BamHI W, Y , and H viral genomic fragments in the IB4 cell line. These transcripts are thought to be precursors of mRNAs that express the EBNAs and possibly the BHRFl protein. Interestingly, a recent study has employed high-resolution in sztu hybridization to demonstrate the presence of highly focused tracklike aggregates of RNAs hybridizing to the BamHI W fragment in the nucleus of the latently infected Namalwa BL line (Lawrenceet al., 1989). Whether this tracklike formation will prove to be a general phenomenon or one restricted to (or readily observable in) cases of long primary transcripts is unknown. Another study (Weigel and Miller, 1983)demonstrated large 12-O-tetradecanoyl phorbol- 13-acetate (TPA)-inducible RNA species hybridizing with the BamHI W fragment in P3HR-1 cells, although the direction of transcription was not investigated. A study of the P3HR-1 subclone, clone 13, has shown that rightward transcription of BamHI W is TPA inducible and unaffected by phosphonoacetic acid (PAA; an inhibitor of the viral DNA polymerase and late lytic viral gene expression) (Rogers and Speck, 1990). Leftward transcription of this region was also observed in B95-8 cells and was found to be TPA inducible and PAA inhibitable, consistent with late lytic gene function. The origin, structure, and function of the leftward transcripts (up to 15 kb in length), which are found in both nucleus and cytoplasm, are unknown. B. TRANSCRIPTION OF VIRALMEMBRANE PROTEINS In contrast to the EBNA genes, the gene encoding the viral latent membrane protein (LMP or LMP1) is transcribed in the leftward direction and has a relatively simple splicing pattern (van Santen et al., 1981; Fennewald et al., 1984; Hudson et al., 1985a) (see Fig. 1). Three closely spaced exons from the BamHI Nhet fragment compose the mature 2.8kb mRNA, which is the most abundant viral mRNA in latently infected cells. Initial studies (Ghosh and Kieff, 1990) with the LMP promoter of latency linked to the CAT gene showed higher reporter enzyme activity in B cells bearing the B95-8 virus as opposed to the P3HR-1 virus. EBNA2 expression from the B95-8 virus appears to mediate this phenomenon (see previous discussion of EBNA2). An EBNAP responsive element was mapped within the -512 to +40 region relative to the mRNA cap site (Wang et al., 1990a). Other workers have shown that EBNA2 overcomes the effect of a &-acting negative regulatory sequence distal to 54 bp upstream of the mRNA cap site, while having no effect on

16


a &-acting positive regulatory sequence proximal to -54 bp in transfected BL cells (Fahraeus et al., 1990b).The region of -634 to -54 acted as an EBNA2-inducible enhancer. Group I BL cell lines, which lack EBNA2 and LMP, also lack the LMP mRNA (Rowe et al., 1987) (see discussion below), implying control of LMP at the level of mRNA transcription. Transcripts for the terminal protein genes were noted as two rightwardly transcribed mRNAs near 2 kb in size in B95-8 cells hybridizing to portions of the unique short (US) region of the viral genome (Hudson et al., 1985b) (see Fig. 1). A cDNA clone encoding TPl revealed nine exons encompassing a protein-coding region that spanned the joined terminal repeats of the circularized genome (Laux et al., 1988). The TP1 promoter was mapped by S1 nuclease studies and inspection of the genomic sequence, which revealed promoter elements and an absence of splice acceptor sites near the projected cap site (Laux et al., 1988). A cDNA for TP2 was shown to have a different 5' exon than the TPl gene, whereas the remaining exons were identical to those of the TPl gene (Sample et al., 1989).Because the first exon of the TP1, but not the TP2, gene has a coding sequence, the corresponding proteins were expected to differ in the presence or absence of hydrophilic amino-terminal domain (Sample et al., 1989). The location of the TP2 promoter was postulated by relating the sizes of the cDNA and the mRNA and by genomic inspection, which showed promoter-like elements and an absence of splice acceptor sites near the projected cap site (Sample et al., 1989). The proximity (within 200 bp) of the promoter elements of the TP2 and LMP genes has led to speculation that they may share regulatory elements (Sample et al., 1989). Recent data support the idea that one of the TP promoters is upregulated by EBNA2 (G. W. Bornkamm, personal communication),similar to the LMP gene. It is of interest to note that the primary transcript of TP1, but not TP2, is complementary to the entire LMP transcript. As discussed above, a role for the BHRFl membrane protein in latency is unproved. However, blots of poly(A)+ RNA from the tightly latent IB4 cell line yield signals with BHRFl probes (Austin et al., 1988). In addition, some cDNAs containing BHRFl show exon structures characteristic of transcripts encoding the EBNAs; i.e., cDNAs from the IB4 LCL (having little viral productive activity) and the B95-8 LCL (having high producer activity) have W1 and W2 exons (see below) (Austin et al., 1988; Bodescot and Perricaudet, 1986; Pearson et al., 1987). One of the B95-8 cDNAs has the C1 exon at its 5' end. BHRFl is also found on messages that are up-regulated in the lytic cycle and transcribed from the bidirectional promoter in BamHI H (Hardwick et al., 1988; Pearson et al., 1987; Austin et al., 1988; Pfitzner et al., 1987), consistent with gene function in the lytic cycle.


17

RNA polymerase I1 and 111 elements for the promoter of the small nonpolyadenylated viral RNAs (EBERs)have been described (Howe and Shu, 1989),but discussion of these genes, whose functions are unknown, is beyond the scope of this review.

IV. Perspective on Viral Gene Expression in the LCL Model Although much progress has been made toward understanding EBV gene expression in LCLs, far less is known of the situation in healthy seropositive individuals, in which EBV-carrying cells in the peripheral blood are estimated at a frequency of to lo-’ among mononuclear leukocytes (Rocchi et al., 1977). This estimate is based on the outgrowth of LCLs from wells seeded with limiting dilutions of donor leukocytes cocultivated with EBV-negative umbilical cord blood leukocytes. This indirect measure is the best available because virus-specific immunofluorescence (nuclear or otherwise) performed on peripheral blood cells is not distinguishable from background, given the low frequency of true positives (Klein et al., 1976). Outgrowth of LCLs as described above occurs largely by a two-step mechanism in which virus shed from an infected cell infects and immortalizes adjacent B lymphocytes in vitro (Lewin et al., 1987; Rickinson et al., 1977). The two-step mechanism has been demonstrated by a reduction in the frequency of LCL outgrowth in the presence of virus-neutralizing antibody, and by demonstrating that cocultivation of EBV-negative donor leukocytes with leukocytes from seropositive donors often yields EBNA-positive LCLs composed of cells from the EBV-negative donor, as determined by sex chromosome typing. Demonstration of a one-step mechanism of LCL generation by direct outgrowth (cellular proliferation in vitro) of in vivo-infected B lymphocytes has been difficult. One study that purports to document one-step outgrowth in the presence of virus-neutralizing antibody and phosphonoformate (an inhibitor of viral replication) also provides evidence of cell-to-cell spread of virus under these conditions, making it difficult to positively assign a one-step mechanism to the initiation of outgrowth of the few resultant LCLs (Lewin et al., 1987). The fact that some peripheral blood cells (presumably B lymphocytes) shed virus upon explantation from the healthy seropositive individual raises the question of whether the stimulus for lytic replication arises in vivo or in vitro. After cell separation and washing procedures, explanted leukocytes are typically cultured in artificial medium supplemented with fetal bovine serum in isolation from lymphatic accessory cells, conditions that may well trigger the lytic cycle. Alternatively, triggering of the lytic

18


cycle in a fraction of infected cells in uiuo may be a natural occurrence in healthy seropositives, perhaps concurrently with gene expression typical of the latent cycle in the same cell. It has not been possible to clone EBNA-positive colonies in soft agar from peripheral leukocytes of healthy seropositive individuals (Hinuma and Katsuki, 1978), in which the percentage of EBV-immortalized cells may be too low to detect by this method. Incidental induction of the lytic cycle in uztro by cloning procedures (or induction in vzvo prior to explantation) may impede clonal expansion in soft agar. Alternatively, EBVimmortalized B lymphocytes may simply not exist in the healthy seropositive individual, a possibility raised by the discussion of Klein (Klein, 1989; Masucci et al., 1989b; Gratama et al., 1988),Rickinson (Yao et al., 1989b) and co-workers; this is further discussed below. In contrast to the situation in the healthy seropositive individual, 0.52% of peripheral blood B lymphocytes of acute IM patients are EBNApositive blasts that are demonstrable by immunofluorescence (which does not distinguish the component proteins of EBNA) (Klein et al., 1976). EBNA-positive clones have been readily cultured in soft agar from peripheral blood leukocytes of these patients even in the presence of neutralizing antibody (Hinuma and Katsuki, 1978).Moreover, EBNApositive leukocytes undergoing mitosis have ostensibly been identified soon after isolation from the peripheral blood of these patients (Robinson et al., 1980). The evidence seems to indicate the presence of EBVimmortalized B lymphocytes in the peripheral blood of IM patients, a circumstance that is less certain in the healthy seropositive individual. It has been hypothesized that the EBNA-positive blasts of IM have viral gene expression similar to that of latently infected lymphoblastoid cell lines (Klein, 1989). Now that antisera for specific latent viral gene products (e.g., EBNA components and membrane proteins) are becoming available, it may be possible to reexamine the B blasts of IM. The relative difficulty of undertaking this task in the case of the healthy seropositive individual with extremely low numbers of circulating EBVpositive cells leaves us only with models, one of which (Klein, 1989) is based on immune considerations and the pattern of viral gene expression found in EBV-positive BLs. EBV-positive BL cells lack blast cell morphology and express EBNAl to the exclusion of other viral proteins of EBV latency (Rowe et al., 1987). Upon explantation and passage of EBV-positive BL cells, a wider array of viral latency proteins (including EBNAP and LMP) is usually expressed, and a lymphoblastoid cell morphology often emerges together with homotypic cell clumping and cell surface antigen expression characteristic of LCLs (Rowe et d.,1987; Gregory et d., 1990). Less com-


19

monly, a BL cell line will retain its exclusive expression of EBNAl and characteristic cellular antigens during prolonged passage, a phenotype designated “group I” (M. Rowe et al., 1987; D. T. Rowe et al., 1986). Interestingly, such a BL line can be induced to up-regulate expression of LMP and EBNAs 2,3A, 3B, and 3C by treatment with the demethylating agent 5-azacytidine (Masucci et al., 1989a). The capacity for an alternative viral latent state with exclusive expression of EBNAl may be advantageous in uzuo, because EBNA2 and LMP are known to be strong antigenic stimulators of the cytotoxic T lymphocyte response (Murray et al., 1988a; Moss et al., 1988; Thorley-Lawson and Israelsohn, 1987). EBNAl is the only viral gene product needed to maintain the episomal viral genome (by binding to and activating the latency origin of replication), and is thus the minimal essential requirement for maintenance of the viral genomes as an episome in proliferating cells. EBNAl has no known cellular transforming function except perhaps an adjunctive one in which it activates the enhancer at oriP, which can help drive expression of EBNA2, a known transforming gene (Sugden and Warren, 1989).The deregulated myc gene characteristic of BL, and perhaps other unknown changes in cellular gene expression, may make the immortalizing function of EBV unnecessary at some point during tumor evolution, though the EBV growth-transforming properties may be necessary during early tumorigenesis (discussed in Rowe and Gregory, 1989). Some workers have suggested that an oncogenic function will eventually be found for EBNAl (Rowe and Gregory, 1989), giving the virus an active role in the maintenance of BL. BL cells are known to evade the EBV-specific cytotoxic T lymphocyte response that is capable of killing autologous LCLs (Rooney et al., 1985). Thus, EBV-specific cytotoxic T lymphocytes from a BL patient will kill LCLs grown spontaneously from the patient’s peripheral blood, but will not kill tumor cells in viuo or in early passage in uitro. Several mechanisms have been suggested to explain this escape from immune surveillance. The first, mentioned above, is the narrowing of viral antigen expression, particularly the down-regulation of EBNA2 and LMP, antigens capable of eliciting a cytotoxic T lymphocyte response. When a fuller array of viral latent antigens is expressed upon BL cell explantation and passage, susceptibility to cytotoxic T lymphocyte killing can increase (Gregory et al., 1988). In one case in which full viral latent antigen expression appeared without increased susceptibility to cytotoxic T lymphocytes, the intercellular adhesion molecule LFA-3 was found to be down-regulated (Gregory et al., 1988; Rowe et al., 1986).The down-regulation correlated with a reduction of immune cell/target cell adhesion capability. Preliminary studies by the same authors have shown undetectable levels of

20


LFA-3 and ICAM-1, and reduced levels of LFA-1, on BL biopsies, suggesting the possibility of a general mechanism of immune surveillance evasion. Another examination of BL biopsies found LFA-1 levels to be undetectable on the majority of specimens (Clayberger et al., 1987).Low expression of LFA-1 (Patarroyo et al., 1988; Billaud et al., 1990) and LFA-3 (Billaud et al., 1990) has been reported in early passages of some EBV-negative as well as EBV-positive BL cell lines, suggesting a mechanism independent of viral gene expression or tumor cell phenotype selection by an anti-EBV immune response. The relative importance of intercellular adhesion molecule downregulation and narrowed latent viral antigen expression in tumor survival deserves further study. In EBV-positive BL, the absence of LMP expression eliminates not only a source of viral antigen for presentation by HLA class I molecules, but also eliminates the possibility of LMPmediated induction of LFA- 1, LFA-3, and ICAM-1, further reducing the possibility of immune recognition (Wang et al., 1988). An earlier study showed that BL cells down-regulate class I HLA molecules, which might otherwise be expected to mediate antiviral cellular immune responses (Masucci et al., 1987). Down-regulation was demonstrated for a single allele at one locus (HLA-A1l),whereas overall HLA expression remained high on the same cells (compared to autologous LCLs). The fact that at least some EBV-negative BL lines have a down-regulated HLA-A11 phenotype suggests that this phenotype is not related to viral infection (Masucci et al., 1987). The importance of this mechanism for BL cell survival in the host has yet to be determined (for review see Wallace and Murray, 1989). The apparent triggering of the cellular immune response by antigenic stimulus provided by EBNAP and LMP leads one to ask how circulating EBV-infected cells survive in the primed, immunocompetent host. A possible survival strategy suggested by the BL model is restricted latent viral gene expression (Klein, 1989; Yao et al., 1989b). The postulated exclusive expression of EBNA 1 in circulating nonmalignant B lymphocytes implies a lack of need for EBV-induced B lymphocyte proliferation for the survival of the virus over the host organism’s life span. Thus, B lymphocytes exclusively expressing EBNAl could serve as a permanent reservoir of virus over the lifetime of the host, responding to host-directed mitotic stimuli, perhaps in germinal centers of lymph nodes. One could hypothesize that, with appropriate stimulation, occasional infected B lymphocytes might trigger the resident virus to progress to an LcLlike or even lytic pattern of viral gene expression, in which cases cytotoxic T lymphocyte recognition would lead to cell elimination. The efficacy of this process would rely on the current competen-


21

cy of the host immune system. The immortalizing capacity of EBV may only be of use in viral biology during initial infection of the host, occurring as IM or an asymptomatic event, when expansion of the numbers (and perhaps kinds) of virus-infected cells is critical. The life-long cellular reservoir of virus in the host organism is uncertain, as is the fundamental question of whether horizontal cell-to-cell spread of the virus occurs on an ongoing basis in the immunocompetent host. Continual or intermittent reinfection of the B cell compartment from an epithelial viral reservoir in healthy carriers is unlikely because month-long acyclovir therapy can eliminate oropharyngeal virus shedding (presumably an epithelial activity) without impacting the numbers of infected circulating B cells (Yao et al., 1989a,b). Resumption of oropharyngeal virus shedding on cessation of acyclovir therapy could results from reinfection of epithelial cells from the B cell compartment, o r reactivation of replicative viral activity from latently infected epithelial cells. Other work has shown the complete disappearance of virus or its replacement with a donor virus strain in bone marrow transplant recipients (Gratama et al., 1988). Eradication from both peripheral blood and the oropharynx was demonstrated. Although the combined anticellular therapies used on these patients can affect both hematopoietic and epithelial cells, the investigators assert that the hematopoietic cells were most drastically affected and constitute the permanent reservoir of virus. Additional data on oropharyngeal shedding, including strain typing, would be most interesting in patients receiving virus-positive marrow transplants. This would presumably address the possibility of virus transfer from hematopoietic to epithelial cells, albeit in an atypical immune environment. To conclude, the discovery that EBV in BL tumors expresses only EBNAl clearly limits the applicability of the LCL model to other situations. RNA from BL biopsy material, which received attention over a decade ago (Dambaugh et al., 1979), and from group I BL cell lines must clearly be a focus of study. Information from such studies, particularly the structure of EBNA 1-expressing transcripts, could aid polymerase chain reaction studies of viral gene expression in peripheral blood B lymphocytes from healthy seropositive individuals, as suggested by Klein (1989).

REFERENCES Abbot, S. D., Rowe, M., Cadwallader, K., Ricksten, A., Gordon, J., Wang, F., Rymo, L., and Rickinson, A. B. (199O).J. Vzrol. 64, 2126-2134. Adldinger, H. K., Delius, H., Freese, U. K., Clarke, J., and Bornkamm, G. W. (1985). Vzrology 141, 121-134.

22


Arrand, J. R., Young, L. S., and Tugwood, J. D. (1989).J. Virol. 63, 983-986. Austin, P. J., Flemington, E., Yandava, C. N., Strominger, J. L., and Speck, S. H. (1988). Proc. Natl. Acad. Sci. U.S.A. 85, 3678-3682. Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C., Tuffnell, P. S., and Barrel], B. G. (1984). Nature (London) 310,207-21 1. Baichwal, V. R., and Sugden, B. (1987).J. Virol. 61, 866-875. Bhat, R. A., and Thimmappaya, B. (1985). J. Virol. 56, 750-756. Billaud, M., Busson, P., Huang, D., Mueller-Lantzsch, N., Rousselet, G., Pavlish, 0.. Wakasugi, H., Seigneurin, J. M., Tursz, T., and Lenoir, G. M. (1989).J. Virol. 63,41214128. Billaud, M., Roussett, F., Calender, A., Cordier, M., Aubry, J.-P., Laisse, V., and Lenoir, G. M. (1990). Blood 75, 1827-1833. Bodescot, M., and Perricaudet, M. (1986). Nucleic Acids Res. 14, 7103-7114. Bodescot, M., Brison, O., and Perricaudet, M. (1986). Nucleic Acids Res. 14, 261 1-2620. Bodescot, M., Perricaudet, M., and Farrell, P. J. (1987).J. Virol. 61, 3424-3430. Busson, P., Ganem, G., Flores, P., Mugneret, F., Clausse, B., Caillou, B., Braham, K., Wakasugi, H., Lipinski, M., and Tursz, T. (1988). Znt. J. Cancer 42, 599-606. Clayberger, C., Wright, A., Medeiros, L. J., Koller, T. D., Link, M. P., Smith, S. D., Warnke, R. A., and Krensky, A. M. (1987). Lamet ii, 533-536. Cleary, M. L., Smith, S. D., and Sklar, J. (1986). Cell 47, 19-28. Cohen, J. I., Wang, F., Mannick, J., and Kieff, E. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 9558-9562. Cooper, N. R., Moore, M. D., and Nemerow, G. R. (1988). Annu. Rev. Zmmunol. 6,85-113. Cordier, M., Calender, A., Billaud, M., Zimber, U., Rousselet, G., Pavlish, O., Banchereau, J., Tursz, T., Bornkamm, G., and Lenoir, G. M. (199O).J. Virol. 64, 1002-1013. Dambaugh, T., Nkrumah, F. K., Biggar, R. J., and Kieff, E. (1979). Cell 16, 313-322. Dambaugh, T., Hennessy, K., Chamnankit, L., and Kieff, E. (1984). Proc. Natl. Acad. Sci. U.S.A. 81, 7632-7636. Dambaugh, T., Wang, F., Hennessy, K., Woodland, E., Rickinson, A. B., and Kieff, E. (1986).J. Virol. 59, 453-462. Dawson, C. W., Rickinson, A. B., and Young, L. S. (1990). Nature (London) 344, 777-780. de The, G. (1982). In “The Herpes Viruses” (B. Roizman, ed.), pp. 25-103. Plenum, New York. Epstein, M. A., and Achong, B. G. (1979a). In “The Epstein-Barr Virus’’ (M. A. Epstein and B. G. Achong, eds.), pp. 321-337. Springer-Verlag, Berlin. Epstein, M. A., and Achong, B. G. (1979b). In “The Epstein-Barr Virus’’ (M. A. Epstein and B. G. Achong, eds.), pp. 1-22. Springer-Verlag, Berlin. Ernberg, I. (1989). Adv. Viral Oncol. 8, 203-214. Fahraeus, R., Fu, H. L., Ernberg, I., Finke, J., Rowe, M., Klein, G., Falk, K., Nilsson, E., Yadav, M., Busson, P., et al. (1988). Znt. J. Cancer 42, 329-338. Fahraeus, R., Rymo, L., Rhim, J. S., and Klein, G. (1990a). Nature(London) 345,447-449. Fahraeus, R., Jansson, A., Ricksten, A., Sjblom, A., and Rymo, L. (1990b). Proc. Natl. Acad. Sci. U.S.A. 87, 7390-7394. Farrell, P. J. (1989). Adv. Viral Oncol. 8, 103-132. Fennewald; S., van Santen, V., and Kieff, E. (1984).J. Virol. 51, 411-419. Fingeroth, J. D., Weis, J. J., Tedder, T. F., Strominger, J. L., Biro, P. A., and Fearon, D. T. (1984). Proc. Natl. Acad. Sci. U.S.A. 81, 4510-4514. Fingeroth, J. D., Clabby, M. L., and Strominger, J. L. (1988).J. Virol. 62, 1442-1447.


23

Finke, J., Rowe, M., Kallin, B., Ernberg, I., Rosen, A., Dillner, J., and Klein, G. (1987).J. Virol. 61, 3870-3878. Frech, B., Zimber-Strobl, U., Suentzenich, K.-O., Pavlish, O., Lenoir, G. M., Bornkamm, G. W., and Mueller-Lantzsch, N. (1990).J . Virol. 64, 2759-2767. Gahn, T. A., and Schildkraut, C. L. (1989). Cell 58, 527-535. Gerber, P., Whang-Peng, J., and Monroe, J. (1969). Proc. Natl. A d . Sci. U.S.A. 63, 740747. Ghosh, D., and Kieff, E. (1990). 1. Vzrol. 64, 1855-1858. Gordon, J. (1989). Adv. Viral Oncol. 8, 173-185. Gratama, J. W., Oosterveer, M. A. P., Zwaan, F. E., LePoutre, J., Klein, G., and Ernberg, I. (1988). Proc. Natl. Acud. Sci. U.S.A. 85, 8693-8696. Greenspan, J. S., Greenspan, D., Lennette, E. T., Abrams, D. I., Conant, M. A., Petersen, V., and Freese, U. K. (1985). N . Eng1.J. Med. 313, 1564-1571. Gregory, C. D., Murray, R. J., Edwards, C. F., and Rickinson, A. B. (1988).J. Exp. Med. 167, 1811-1824. Gregory, C . D., Rowe, M., and Rickinson, A. B. (1990).J. Gen. Vzrol. 71, 1481-1495. Haldar, S., Beatty, C., Tsujimoto, Y.,and Croce, C. M. (1989). Nature (London) 342, 195198. Hammerschmidt, W., and Sugden, B. (1989). Nature (London) 340, 393-397. Harada, S., Sakamoto, K., Seeley, J. K., Lindsten, T., Bechtold, T., Yetz, J., Rogers, G., Pearson, G., and Purtilo, D. T. (1982).J . Inanaunol. 129,2532-2535. Hardwick, J. M., Lieberman, P. M., and Hayward, S. D. (1988).J. Virol. 62, 2274-2284. Henle, G., and Henle, W. (1967). Cancer Res. 27, 2422-2446. Henle, G., Henle, W., and Diehl, V. (1968). Proc. Natl. Acud. Scz. U.S.A. 59, 94-101. Hennessy, K., Fennewald, S., and KieE, E. (1985). Proc. Natl. Acad. Sci. U.S.A. 82, 59445948. Hennessy, K., Wang, F., Bushman, E. W., and Kieff, E. (1986).Proc. Natl. Acad. Scz. U.S.A. 83,5693-5697. Hinuma, Y., and Katsuki, T. (1978). Int. J . Cancer 21, 426-431. Howe, J. G., and Shu, M. D. (1989). Cell 57, 825-834. Hudson, J. G., Farrell, P. J., and Barrell, B. G. (1985a).J. Virol. 53, 528-535. Hudson, G. S., Bankier, A. T., Satchwell, S. C., and Barrell, B. G. (1985b).Vzrology 147,8198. Hurley, E. A., and Thorley-Lawson, D. A. (1988).J. Exp. Med. 168, 2059-2075. Jeang, D.-T., and Hayward, S. D. (1983).J. Virol. 48, 135-148. Joab, I., Rowe, D. T., Bodescot, M., Nicolas,J. C., Farrell, P. J., and Perricaudet, M. (1987). J . Virol. 61, 3340-3344. Jones, M. D., Foster, L., Sheedy, T., and Griffin, B. E. (1984). E M B O J . 3, 813-821. Kerdiles, B., Walls, D., Triki, H., Perricaudet, M., and Joab, I. (199O).J. Virol. 64, 18121816. Kieff, E., Hennessy, K., Dambaugh, T., Matsuo, T., Fennewald, S., Heller, M., Petti, L., and Hummel, M. (1985). In “Epstein-Barr Virus and Associated Diseases” (P. Levine, G. Pearson, and D. Ablashi, eds.), pp. 22 1-247. Nijhoff, Boston, Massachusetts. Kintner, C., and Sugden, B. (1981). Nature (London) 294,458-460. Klein, G. (1979).In “The Epstein-Barr Virus” (M. A. Epstein and B. G. Achong, eds.), pp. 339-350. Springer-Verlag, Berlin. Klein, G. (1989). Cell 58, 5-8. Klein, G., Svedmyr, E., Jondal, M., and Persson, P. (1976). Znt. J. Cancer 17, 21-26. Knutson, J. C., and Sugden, B. (1989). Adv. Viral Oncol. 8, 151-172.

24


Kocache, M. M., and Pearson, G. R. (1990). Intervirology 31, 1-13. Kupfer, S. R., and Summers, W. C. (199O).J. Virol. 64, 1984-1990. Laux, G., Perricaudet, M., and Farrell, P. J. (1988). EMBO J. 7, 769-774. Lawrence, J. B., Singer, R. H., and Marselle, L.M. (1989). Cell 57,493-502. Lenoir, G. M., and Bornkamm, G. W. (1987). Adu. Viral Oncol. 7 , 173-206. Lewin, N., Aman, P., Masucci, M. G., Klein, E., Klein, G., Oberg, B., Strander, H., Henle, W., and Henle, G. (1987). Int. J. Cancer 39,472-476. Leyvraz, S., Henle, W., Chahinian, A. P., Perlmann, C., Klein, G., Gordon, R. E., Rosenblum, M., and Holland, J. F. (1985). N . Eng1.J. Med. 314, 1296-1299. Longnecker, R., and Kieff, E. (1990).J. Virol. 64, 2319-2326. Masucci, M. G., Torsteindottir, S., Colombani, J., Brautbar, C., Klein, E., and Klein, G. (1987). Proc. Natl. Acad. Sci. U.S.A. 84,4567-4571. Masucci, M. G., Contreras-Salazar, B., Ragnar, E., Falk, K., Minarovits,J., Ernberg, I., and Klein, G. (1989a).J. Virol. 63, 3135-3141. Masucci, M. G., Contreras-Salazar, B., Ragnar, E., Falk, K., Minarovits, J., Ernberg, I., and Klein, G. (1989b).J. Viral. 63, 3135-3141. Miller, G., Niederman, J. C., and Andrews, J.-J. (1973). N . Engl. J. Med. 288, 229-232. Miller, G., Robinson, L., Heston, L., and Lipman, M. (1974).Proc. Nutl. Acad. Sci. U.S.A. 71, 4006-4010. Misko, J. S., Moss, D. J., and Pope, J. H. (1980). Proc. Nutl. Acad. Sci. U.S.A. 77,4247-4250. Morgan, D. G., Niedennan, J. C., Miller, G., Smith, H. W., and Dowaliby, J. M. (1979). Lancet ii, 1154-1157. Moss, D. J., Misko, I. S., Burrows, S. R., Burman, K., McCarthy, R., and Sculley, T. B. (1988). Nature (Lodon) 331, 719-721. Murray, R. J., Wang, D., Young, L. S., Wang, F., Rowe, M., Kieff, E., and Rickinson, A. B. (1988a).J. Virol. 62, 3747-3755. Murray, R. J., Young, L. S., Calender, A., Gregory, C. D., Rowe, M., and Lenoir, G. M. (1988b). J. Virol. 64, 894-90 1. Nemerow, G. R., Siaw, M. F. E., and Cooper, N. R. (1986).J. Virol. 58, 709-712. Nemerow, G. R., Mullen, J. J., 111, Dickson, P. W., and Cooper, N. R. (1990a).J. Viral. 64, 1348-1352. Nemerow, G. R., Moore, M. D., and Cooper, N. R. (1990b). A d a Cancer Res. 54,273-300. Nunez, G., Seto, M., Seremetis, S., Ferrero, D., Grignani, F., Korsmeyer, S. J., and DallaFavera, R. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 4589-4593. Okano, M., Thiele, G. M., Davis, J. R., Grierson, H. L., and Purtilo, D. T. (1988). Clin. Microbial. Reu. 1, 300-312. Patarroyo, M., Prieto, J., Ernberg, I., and Gahmberg, C. G. (1988). Znt.J. Cancer 41,901907. Patton, D. F., Shirley, P., Raab-Traub, N., Resnick, L., and Sixbey, J. W. (199O).J. Vzrol. 64, 397-400. Pearson, G. R., Luka, J., Petti, L., Sample, J., Birkenbach, M., Braun, D., and Kieff, E. (1987). Virology 160, 151-161. Petti, L., Sample, J., Wang, F., and Kieff, E. (1988).J. Virol. 62, 1330-1338. Pfitzner, A. J., Tsai, E. C., Strominger, J. L., and Speck, S. H. (1987).J. Virol. 61, 29022909. Pope, J. H., Horne, M. K., and Scott, W. (1968). Int. J. Cancer 3, 857-866. Raab-Traub, N., Hood, R., Yang, C.-S., Henry, B., and Pagano, J. S. (1983).J . Viral. 48, 580-590. Raab-Traub, N., Flynn, K., Pearson, G., Huang, G., Levine, P., Lanier, A., and Pagano, J. (1987). Int. J. Cancer 39, 25-29.


25

Rawlins, D. R., Milman, G., Hayward, S. D, and Hayward, G. S. (1985). Cell 42,659-668. Reisman, D., and Sugden, B. (1986). M o l . Cell. Biol. 6, 3838-3846. Rickinson, A. B. (1984). Nature (London) 310, 99-100. Rickinson, A. B., Finerty, S., and Epstein, M. A. (1977). Int. J. Cancer 19, 775-782. Rickinson, A. B., Wallace, L. E., and Epstein, M. A. (1980). Nature (London) 283,865-867. Rickinson, A. B., Young, L. S., and Rowe, M. (1987).J. Virol. 61, 1310-1317. Ricksten, A,, Olsson, A., Anderson, T., and Rymo, L. (1988). N u c k Aczds Res. 16,83918410. Robinson, J., Smith, D., and Niederman, J. (1980). Nature (London) 287, 334-335. Rocchi, G., Felici, A., Ragona, G., and Heinz, A. (1977). N . Engl. J. Med. 296, 132-134. Rogers, R. P., and Speck, S. H. (1990).J. Virol. 64, 2426-2429. Rogers, R. P., Woisetschlaeger, M., and Speck, S. H. (1990). EMBO J. 9, 2273-2277. Rooney, C. M., Rowe, M., Wallace, L. E., and Rickinson, A. B. (1985). Nature (London) 317, 629-63 1. Rowe, D. T., Rowe, M., Evan, G. I., Wallace, L. E., Farrell, P. J., and Rickinson, A. B. (1986). EMBO J. 5, 2599-2607. Rowe, D. T., Hall, L., Joab, I., and Laux, G. (1990).J. Virol. 64,2866-2875. Rowe, M., and Gregory, C. (1989). Adv. Viral Oncol. 8, 237-259. Rowe, M., Rowe, D. T., Gregory, D., Young, L. S., Farrell, P. J., Rupani, H., and Rickinson, A. B. (1987). EMBOJ. 6, 2743-2751. Rowe, M.,Young, L. S., Cadwallader, K., Petti, L., Kieff, E., and Rickinson, A. B. (1989).J. Vkol. 63, 1031-1039. Sample, J., and Kieff, E. (199O).J. Virol. 64, 1667-1674. Sample, J., Hummel, M., Braun, D., Birkenbach, M., and Kieff, E. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 5096-5100. Sample, J., Liebowitz, D., and Kieff, E. (1989).J. Virol. 63, 933-937. Sauter, M., Boos, H., Hirsch, F., and Mueller-Lantzsch, N. (1988). Virology 166,586-590. Sawada, K., Yamamoto, M., Tabata, T., Smith, M., Tanaka, A., and Nonoyama, M. (1989). Virology 168, 22-30. Sixbey, J. W. (1989). Adv. Viral Oncol. 8, 187-202. Sixbey, J. W., Nedrud, J. G., Raab-Traub, N., Hanes, R. A., and Pagano, J. S. (1984). N . Engl. J. Med. 310, 1225-1230. Sixbey, J. W., Lemon, S. M., and Pagano, J. S. (1986). Lancet ii, 1122- 1124. Sixbey, J. W., Shirley, P., Chesney, P. J., Buntin, D. M., and Resnick, L. (1989). Lancet ii, 761-765. Skare, J., Farley,J., Strominger, J. L., Fresen, K. O., Cho, M. S., and zur Hausen, H. (1985). J. Virol. 55, 286-297. Skare, J. C., Milunsky, A., Byron, K. S., and Sullivan, J. L. (1987). Proc. Natl. Acad. Scz. U.S.A. 84, 2015-2018. Speck, S. H., and Strominger, J. L. (1985). Proc. Natl. Acad. Sci. U.S.A. 82, 8305-8309. Speck, S. H., and Strominger, J. L. (1989). Adv. Viral Oncol. 8, 133-150. Speck, S. H., Pfitzner, A. J., and Strominger, J. L. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 9298-9302. Sugden, B. (1989). Cell 57, 5-7. Sugden, B., and Warren, N. (1989).J . Virol. 63, 2644-2649. Sullivan, J. L., Byron, K. S., Brewster, F. E., Baker, S. M., and Ochs, H. D. (1983).J. Clin. Invest. 71, 1765-1778. Summers, W. P., Grogan, E. A., Shedd, D., Robert, M., Liu, C.-R., and Miller, G. (1982). Proc. Natl. Acad. Sci. U.S.A. 79, 5688-5692. Sung, N. S., Kenny, S., Gutsch, D., and Pagano, J. S. (1991).J. Virol. 65, 2164-2169.

26


Swaminathen, S., Tomkinson, B., and Kieff, E. (1991). Proc. Nail. Acad. Sci. U.S.A. 88, 1546-1550. Swendeman, S., and Thorley-Lawson, D. A. (1987). EMBO J. 6, 1637-1642. Sylla, B. S., Wang, Q., Hayoz, D., Lathrop, G. M., and Lenoir, G. M. (1989). Clin. Genet. 36, 459-462. Taub, R., Kirsch, I., Morton, C., Lenoir, G. M., Swan, D., Tronick, S., Aaronson, S., and Leder, P. (1982). Proc. Natl. Acad. Sci. U.S.A. 79, 7837-7841. Thorley-Lawson, D. A,, and Israelsohn, E. S. (1987).Proc. Natl. Acad. Sci. U.S.A. 84,53845388. Thorley-Lawson, D. A., Nadler, L. M., Bahn, A. K., and Schooley, R. T. (1985).J. Zmmunol. 134, 3007-3012. Tsujimoto, Y. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 1958-1962. Urier, G., Buisson, M., Chambard, P., and Sergeant, A. (1989). EMBOJ. 8, 1447-1453. van Santen, V., Cheung, A,, and Kieff, E. (1981). Proc. Natl. Acad. Sci. U.S.A. 78, 19301934. Wallace, L. E., and Murray, R. J. (1989). Adv. Virul Oncol. 8, 219-236. Wang, D., Liebowitz, D., and Kieff, E. (1985). Cell 43, 831-840. Wang, D., Liebowitz, D., Wang, F., Gregory, C. D., Rickinson, A. B., Larson, R., Springer, T., and Kieff, E. (1988).J. Virol. 62, 4173-4184. Wang, F., Gregory, C. D., Rowe, M., Rickinson, A. B., Wang, D., Birkenbach, M., Kikutani, H., Kishimoto, T., and Kieff, E. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 3452-3456. Wang, F., Tsang, S.-F., Kurilla, M. G., Cohen, J. I., and Kieff, E. (1990a).J. Virol. 64,340734 16. Wang, F., Gregory, C., Sample, C., Rowe, M., Liebowitz, D., Murray, R., Rickinson, A., and Kieff, E. (1990b).J. Virol. 64, 2309-2318. Weigel, R., and Miller, G. (1983). Virology 125, 287-298. Woisetschlaeger, M., Strominger, J. L., and Speck, S. H. (1989).Proc. Natl. Acad. Sci. U.S.A. 86,6498-6504. Woisetschlaeger, M., Yandava, C. N., Furmanski, L. A., Strominger, J. L., and Speck, S. H. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 1725-1729. Woisetschlaeger, M., Jin, X. W., Yandava, C. N., Furmanski, L. A., Strominger, J. L., and Speck, S. H. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 3942-3946. Wolf, H., Haus, M., and Wilmes, E. (1984).J. Virol. 51, 795-798. Wyandt, H. E., Grierson, H. L., Sanger, W. G., Skare, J. C., Milunsky, A., and Purtilo, D. T. (1989). Am. J. Med. Genet. 33,426-430. Yao, K., Zhang, H.-Y., Zhu, H.-C., Wang, F.-X., Li, G.-Y., Wen, D.-S., Li, Y.-P., Tsai, C.-H. A., and Glaser, R. (1990). Znt. J. Cancer 45, 83-89. Yao, Q. Y., Rickinson, A. B., and Epstein, M. A. (1985). Znt. J . Cancer 35, 35-42. Yao, Q. Y., Ogan, P., Rowe, M., Wood, M., and Rickinson, A. B. (1989a). Znt. J. Cancer 43, 6 1-66. Yao, Q. Y., Ogan, P., Rowe, M., Wood, M., and Rickinson, A. B. (1989b).Int. J. Cancer 43, 67-7 1 . Yates, J. L., Warren, N., and Sugden, B. (1985). Nature (London) 313, 812-815. Young, L. S., Sixbey, J. W., Clark, D., and Rickinson, A. B. (1986). Lancet i, 240-242. Young, L. S., Dawson, C. W., Brown, K. W., and Rickinson, A. B. (1989). Znt. J. Cancer 43, 786-794. Zimber-Strobl, U., Sventzenich, K.-O., Laux, G., Eick, D., Cordier, M., Calender, A., Billaud, M., Lenoir, G. M., and Bornkamm, G. W. (1991).J. Virol. 65, 415-423.

THE PHYSIOLOGY OF TRANSFORMING GROWTH FACTOR-(.11 Rik Derynck Program of Cell Biology, Departments of Growth and Development and of Anatomy, University of California, San Francisco, San Francisco, California 94143

I.

Introduction

11. TGF-a Is a Member of a Growth Factor Family 111. The Structure of TGF-a and Its Precursor

I v. V. VI. VII. VIII.

Interactions of TGF-a with the EGF/TGF-a Receptor The Transmembrane TGF-a Precursor A Role for TGF-a in the Physiology of Normal Cells TGF-a in Normal Development A Role for TGF-a in Tumor Development? References

1. Introduction Animal cells are normally exposed to a variety of extracellular factors that influence and determine their proliferative behavior. Many of these factors are polypeptides that have been secreted by the target cells themselves or by other cell populations. The polypeptide factors that either stimulate or inhibit cell proliferation are collectively called growth factors. The effects of growth factors on cells depend on a variety of factors, such as the nature of the growth factor, the cell type, and the physiological condition of the responding cell and its environment. In addition, the presence and the nature of other factors, including matrix proteins and other growth factors, profoundly influence the growth modulatory activities, frequently resulting in synergistic or antagonistic effects. Thus, individual factors may stimulate some cell types and inhibit others, depending on the conditions (Sporn and Roberts, 1988). In addition, growth factors often have a variety of activities, only some of which seem to be directly related to their effect on proliferation. Thus a great deal of apparent complexity accompanies the action of growth factors on cells. The effect of these growth factors on responsive cells is of major importance in all processes in which the modification or maintenance of a proliferative state of the cells is affected. It is thus expected that growth factors have profound effects in wound healing, in tissue formation, and in development as well as in formation and maintenance of tumors. We 27 ADVANCES IN CANCER RESEARCH, VOL. 58


28

RIK DERYNCK

currently know of the existence of a largc variety of growth factors for mammalian cells, most of which can be classified in families of structurally related polypeptides. One of these factors is transforming growth factor-a (TGF-a), which is the subject of this review. We discuss here our current knowledge of the role of TGF-a in the proliferation of normal cells and its potential importance in tumor development. II. TGF-a Is a Member of a Growth Factor Family

TGF-a is a member of a small family of structurally related growth factors, of which epidermal growth factor (EGF) was the first member to be isolated and biochemically characterized (Savage et al., 1972, 1973). Besides EGF and TGF-a (Marquardt et al., 1984; Derynck et al., 1984; Lee et al., 1985), this family also contains the recently isolated amphiregulin (Shoyab et al., 1988) and heparin-binding EGF-like growth factor (HB-EGF) (Higashiyama et al., 1991). Another recently cloned growth factor derived from schwannoma cells is presumably the murine homologue of human amphiregulin (Kimura et al., 1990). In addition, there are three virally encoded polypeptide factors that also belong to this same family. These are vaccinia virus growth factor (VGF) (Venkatesan et al., 1982; Stroobant et al., 1985), myxomavirus growth factor (MGF) (Upton et al., 1987), and Shope fibroma growth factor (SFGF) (Chang et at., 1987), all encoded by members of the poxvirus family. T h e basis of the structural relationship is the “EGF unit,” a sequence of about 45-50 amino acids containing six characteristically spaced cysteines (CX, CX,-,CX,,- ,,CXCX,C), which are linked in a defined configuration in three disulfide bridges. T h e fully processed forms of EGF, TGF-a, and VGF correspond to this EGF unit and share a sequence identity of about 35%, including the six cysteines. The structural conservation and disulfide bond configuration in the core sequences of the different family members are the basis for the ability of these factors to interact with the same receptor, usually referred to as the EGF receptor (MassaguC, 1983; Stroobant et al., 1985; Lin et al., 1988; Shoyab et al., 1988; Higashiyama et al., 1991). This does, however, not preclude the possibility that these factors also may interact with other related receptors. TGF-a, EGF, amphiregulin, HB-EGF, and VGF are all made as larger precursors with a hydrophobic transmembrane domain, suggesting their existence as transmembrane, cell surface proteins (Fig. 1). T h e EGF domain in each of these growth factor precursors is localized in the extracellular segment of the precursor. In contrast to TGF-a (Derynck et al., 1984; Lee et al., 1985), amphiregulin (Plowman et al., 1990), HB-EGF (Higashiyama et al., 1991), and VGF (Venkatesan et al., 1982) precursors, the EGF

29

PHYSIOLOGY OF TGF-CX NH2

I

MGF

SFGF

& + COOH

COOH

COOH

EGF

TGF-cc

VGF

AR

HB-EGF

FIG. 1. Schematic representation of the precursors of the members of the EGF family. The precursors of EGF, TGF-a, amphiregulin (AR), HB-EGF, and VGF are represented as transmembrane proteins, whereas the precursors for MGF and SFGF are secreted. The black box in each precursor represents the fully processed form containing the EGF unit. The striped segments in the EGF precursor correspond to EGF-like sequences. All precursors have an NHz-terminal signal peptide (dotted). The branched structures represent Nlinked carbohydrate moieties.

precursor is considerably larger and contains a number of additional EGF-like repeats (Gray et al., 1983; Scott et al., 1983). Its large size, some distinct structural features with homology to segments of the low-density lipoprotein receptor (Russell et al., 1984; Sudhof et al., 1985), and the observation that the EGF precursor is often not processed into mature EGF (Rall et al., 1985) have led to the suggestion that the EGF precursor may be a receptor for an unknown ligand (Pfeffer and Ullrich, 1985). There is as yet no experimental confirmation of this hypothesis. A large variety of other polypeptides share one or more EGF-related sequences. One of these proteins is a small peptide “Cripto,”which has a cysteine configuration that is reminiscent of but different from the EGF theme and which may function as a growth factor (Ciccodicola et al., 1989). None of the other polypeptides with EGF-related sequences that

30

RIK DERYNCK

have been described are known to be mitogenic. This large family can be subdivided into several functional groups. One group consists of proteases and protease cofactors, whereas another group contains various polypeptides that play a role in cell-cell or cell-matrix interactions and may be important in development. The possible roles of the EGF-like domains of these proteins have been discussed elsewhere (Carpenter and Wahl, 1990; Davis, 1990). 111. The Structure of TGF-a and Its Precursor

cDNA cloning has revealed that the 50-amino acid TGF-a peptide is synthesized as an internal segment of a 160-amino acid precursor (Derynck et al., 1984; Lee et al., 1985). The sequence coding for this precursor is contained within a mRNA of 4.5-4.8 kb long. The precursor polypeptide sequence starts with an N-terminal signal sequence of 22 amino acids long, which is removed from the rest of the precursor between the residues Ala and Leu (Brachmann et d.,1989). Following the signal peptide cleavage site and preceding the N-terminus of the 50amino acid TGF-a is a sequence of 17 amino acids, referred to as the pro-TGF-a sequence. This short sequence is N-glycosylated at the Asn (position 24) and also carries O-linked carbohydrates (Bringman et al., 1987; Teixid6 et aZ., 1987; Teixido and Massague, 1988).The proteolytic cleavage at the N-terminus of the 50-amino acid TGF-a is between an Ala and Val-Val and is localized in a hydrophobic sequence context. The same cleavage recognition site (Ala-Val-Val)also marks the boundary of the C-terminus of the 50-amino acid TGF-a in the precursor (Derynck et al., 1984; Lee et al., 1985). These specific cleavage sites indicate the involvement of a highly specific protease with elastase-like properties in the excision process of the short TGF-a peptide from the extracellular domain of the TGF-a precursor (Ignotz et al., 1986; Luetteke et al., 1988; Teixido et al., 1900; Massaguk, 1990; F’andiella and Massague, 1991). The C-terminus of the 50 amino acids is followed nine residues downstream by a long, hydrophobic sequence. This hydrophobic sequence is immediately preceded by a dibasic peptide sequence (Lys-Lys),which is the target for another type of proteolytic cleavage (Derynck et al., 1984; Lee et al., 1985; Bringman et al., 1987).The protease responsible for this cleavage is more generally used because many polypeptide precursors undergo proteolytic processing at dibasic residues. The hydrophobic sequence spans the cell membrane and thus defines the extracellular domain and the C-terminal cytoplasmic domain in the precursor (Bringman et al., 1987; Gentry et al., 1987; Teixid6 et al., 1987) (Fig. 2). The cytoplasmic domain downstream of the transmembrane sequence is

PHYSIOLOGY OF TGF-CL

31

Fig. 2. Schematic representation of the TGF-a precursor. An NHP-terminal 22-amino acid sequence is cleaved from the precursor and precedes the short proregion, which contains an N-linked carbohydrate group. The 50-amino acid TGF-a peptide, shown as the bold line segment, has three disulfide-linked cysteine (C) bridges and is flanked by cleavage sites for the Ala-Val-Val-specificprotease (bold arrows). Another cleavage site (light arrow) is at the dibasic peptide immediately preceding the transmembrane sequence (black box). The cysteine residues are marked with C.

39 amino acids long and is rich in cysteines. This same precursor segment has palmitate covalently attached to it. This linkage of the fatty acid occurs at the cysteine residues, but it is not known how many cysteines and which ones have undergone this modification. The function of the palmitoylation of the precursor is unknown, but this modification could be indicative of a close association of this cytoplasmic domain with the membrane or with cytoskeletal elements (Bringman et al., 1987). Characterization of the TGF-a released in conditioned medium of cells overexpressing this growth factor (Bringman et al., 1987; Gentry et al., 1987) and the presence of several proteolytic cleavage sites in the transmembrane precursor (Bringman et al., 1987; Brachmann et al., 1989; Wong et al., 1989) thus indicate that, following removal of the

32

RIK DERYNCK

signal peptide, there are at least two different proteases involved in the release of soluble TGF-a from the transmembrane precursor. As a result of these cleavages, several soluble TGF-a species can be generated (Bringman et al., 1987) (Fig. 3). One possible form is the short, 50-amino acid species, but two larger forms that have retained the propeptide and thus are N-glycosylated can also be generated. Analyses of the TGF-a naturally secreted by various tumor cells suggest that these glycosylated TGF-a forms are far more common than the 50-amino acid form (De Larco and Todaro, 1978; Todaro et al., 1980; Marquardt and Todaro, 1982; Ignotz et al., 1986). It is attractive to postulate that the cleavage of the precursor by the Ala-Val-Val-specific protease is differentially controlled, thus regulating the relative ratios of soluble, diffusible TGF-a and uncleaved, immobilized TGF-a precursor and the relative levels of soluble glycosylated TGF-a and 50 amino acid TGF-a species. A conversion of the cell surface precursor into diffusible TGF-a would then affect a much larger number of target cells and could thus be much more effective, but could also result in different physiological effects. Such posttranslational regulation of the levels of soluble TGF-a and the nature of the soluble TGF-a species would be meaningful in the context of the transition from normal cells toward malignant tumor cells and in wound healing. It is possible that activation of the protein kinase C pathway enhances this posttranslational cleavage, because treatment of the cells with the tumor promoter 12-O-tetradecanoyl phorbol- 13-acetate (TPA), a protein kinase activator, enhances the proteolytic cleavage of the precursor (Pandiella and Massague, 1991). Cell surface immunofluorescence and biochemical characterization have indicated that TGF-a-synthesizingcells usually, if not always, have cell surface TGF-a pecursor molecules that are not cleaved to release soluble TGF-a. In addition, many TGF-a-synthesizing cells do not secrete soluble TGF-a into the medium (Derynck et al., 1987; Brachmann et al., 1989). Two forms of transmembrane TGF-a can exist, according to the model, with different proteolytic cleavages (Fig. 3). One form has undergone cleavage at the Ala-Val-Val at the N-terminal boundary of the 50amino acid TGF-a sequence, whereas the other form has retained the prosequence and is thus N-glycosylated (Brachmann et al., 1989; Massaguk, 1990). An analysis of TGF-a-overproducing cell lines suggests the likelihood that cells contain a mixture of both forms (Bringman et al., 1987; Gentry et al., 1987; Pandiella and Massague, 1991), although the relative ratios of these forms may depend on the cell line and on the physiological conditions. In any case, it appears that the presence of the transmembrane TGF-a at the cell surface is a normal consequence of TGF-a synthesis (Brachmann et al., 1989; Pandiella and Massague, 1991)

't FIG. 3. Schematic representation of the different forms of TGF-a, derived from the precursor in Fig. 2. Three forms, two of which are Nglycosylated (branched structures), are released into the medium. The two other forms, one with and one without N-glycosylation, are transmembrane forms and remain cell associated. The arrows show the proteolytic cleavage sites, whereas the cysteine residues are marked with C.

34

RIK DERYNCK

and is far more common than the actual release of soluble TGF-a into the medium. IV. Interactions of TGF-a with the EGF/TGF-a Receptor

Competition studies have revealed that EGF and TGF-a compete for binding to the same receptor, usually referred to as the EGF receptor (Todaro et al., 1980; MassaguC, 1983). Whereas it is possible that there might be a different unique receptor for TGF-a, it is currently widely accepted that all TGF-a effects are mediated through the common EGF/TGF-a receptor. The existence of multiple forms of soluble and transmembrane TGF-a species raises the possibility that there might be differences between how the individual TGF-a species interact with the receptor. However, the biological effects of TGF-a and especially comparisons between TGF-a and EGF have been evaluated until now using only the secreted 50-amino acid form of TGF-a. In order to address the question whether TGF-a and EGF are functionally equivalent, highly purified, recombinant 50-amino acid TGF-a and 53-amino acid EGF were compared in several biological assays. In some assays, TGF-a and EGF induce very similar activities. This is apparent in the stimulation of DNA synthesis in several cell lines (Schreiber et al., 1986), in the induction of anchorage independence of some rodent fibroblasts (Anzano et al., 1983), and in the acceleration of eyelid opening in newborn mice (Smith et al., 1985). On the other hand, both ligands exert quantitatively different responses in a variety of other systems, although some qualitatively different aspects cannot be excluded. These differences usually result in a higher potency for TGF-a than for EGF. One of these assays measures the effect of TGF-a and EGF on ruffling of the cell membrane. At high doses, the TGF-a-induced response is higher than that of EGF, and pretreatment of cells with TGF-P extends the duration of the TGF-a-induced response, but antagonizes the EGF-induced cell ruffling (Myrdal et al., 1986). TGF-a is also more potent than EGF in several proliferation-dependent assay systems. One example of these differences between EGF and TGF-a is provided by human keratinocytes. TGF-a is more active than EGF in inducing colony formation in monolayers, an event that results from a combination of cell migration and proliferation (Barrandon and Green, 1987; Pittelkow et al., 1989). TGF-a is also stronger than EGF in inducing a mitogenic response in hepatocytes (Brenner et al., 1989). Finally, TGF-a and EGF exert quantitatively different results on several pancreatic carcinoma cell lines. Using these cells, TGF-a is at least 10-fold more potent than EGF in

PHYSIOLOGY OF TGF-CX

35

inducing anchorage-independent colony formation in soft agar (Smith et al., 1987). TGF-a and EGF both have the ability to induce neovascularization in uiuo, but again TGF-a is much more potent than EGF (Schreiber et al., 1986). A similar result is also seen with an organ culture assay in uitro, in which Ca2 release from bones in culture is measured. TGF-a is considerably more potent than EGF in this assay, which is thought to correlate with bone resorption and hypercalcemia in uiuo (Stern et al., 1985; Ibbotson et al., 1986). Yet another example is provided by an arterial blood flow assay. Both factors are vasoactive and increase blood flow in this system, but TGF-a is again more active than EGF. In addition, treatment with EGF induces a refractory period, during which administration of another dose of EGF is without apparent biological effect. I n contrast, TGF-a does not induce such a refractory period and can overcome the EGF-induced refractory period (Gan et al., 1987). In conclusion, TGF-a, which interacts with the same receptor as EGF, is very frequently a superagonist of EGF. As yet very few comparative data on the nature of the interaction of EGF and TGF-a with the EGF/TGF-a receptor are available. At least two studies have shown that the dissociation constants of both ligands with the receptor are very similar (Lax et al., 1988; Ebner and Derynck, 1991). This, however, does not necessarily guarantee that the ligands interact in a similar fashion with the receptor, because it does not give any information about the ligand-receptor interactions during and following internalization and about the trafficking and fate of the ligands and receptors. T h e major quantitative difference in biological activity could be related to the fact that TGF-a dissociates from the receptor at a considerably higher pH than does EGF. This difference is presumably due to differences in PI of both growth factors, which is much higher for TGF-a than for EGF. This difference in pH dependence of dissociation of the receptor-ligand complex makes it likely that TGF-a, but not EGF, dissociates from the receptor immediately following internalization of the receptor-ligand complexes in the gradually acidifying endosomes. In contrast, EGF remains associated with the receptor until its delivery into lysosomes, which have a pH of around 4.8. Such a difference in pHdependent dissociation could be of determining importance to the fate of the receptors and the ligands following internalization and could profoundly affect the degree of down-regulation of the receptors and, thus, the availability at the cell surface of the receptors to new ligands. As a consequence, a large fraction of the total number of EGFITGF-a receptors could remain continuously available, when the cells are in the presence of TGF-a, whereas addition of EGF results in a virtually +

36

RIK DERYNCK

complete down-regulation of the receptor within a short time. This down-regulation of the receptor will then give rise to a period during which the cells are unresponsive to any additional ligand. An evaluation of potential differences in the intracellular trafficking of the receptors and ligands is currently underway (Ebner and Derynck, 1991). V. The Transmembrane TGF-a Precursor

As mentioned before, many TGF-a-synthesizing cells do not release soluble TGF-a peptides into the medium and all TGF-a-expressing cells examined exhibit transmembrane TGF-a precursors at their cell surface. The TGF-a precursors should thus be considered as normal physiological forms of TGF-a. Two independent studies have demonstrated that these TGF-ol forms interact with the EGF/TGF-a receptors on neighboring cells, without actual release of the growth factor (Brachmann et al., 1989; Wong et al., 1989).Thus cell-to-cell contact is sufficient to induce a mitogenic response in a neighboring cell. The relative activities of the two different transmembrane forms, i.e., the unglycosylated and the glycosylated forms, are not known. We also do not know the relative affinity or potency of the interaction of the receptor with this type of ligand, in comparison with the soluble TGF-a. The solubilized transmembrane TGF-a form is about 100-fold less active than the 50amino acid form (Brachmann et al., 1989),but this is presumably a result of the solubilization per se. The major difference between this interaction between the two cell surface molecules and the interaction of the receptor with the soluble TGF-a is that the former interaction remains very localized. Thus only cells in direct contact with the TGF-a-producing cells are stimulated. Obviously an autocrine interaction of this TGF-a form with the receptors can also take place in the same cell. In contrast, the soluble TGF-a is diffusible and can reach a much larger number of target cells. In addition, it is possible that there are qualitative differences between these two types of interactions. Interaction between the receptor and the cell surface TGF-a precludes an internalization of the ligand-receptor complex, in contrast with the interaction of the receptor with soluble TGF-a and EGF. It is conceivable, but not yet demonstrated, that the former interaction results in a more prolonged effect. In addition, this interaction between cell surface ligand and receptor may result in an enhanced adhesion between cells. Published results have demonstrated a low level of adhesion between cell surface TGF-a and EGF/TGF-a receptor-producing cells (Anklesaria et al., 1990), but the low efficiency of this adhesive interaction indicates that

PHYSIOLOGY OF TGF-OL

37

the TGF-a precursor should not be considered as an adhesion protein similar to cadherins and cell adhesion molecules (CAMS). The observation that a cell surface growth factor can productively interact with its receptor has important implications not only for the action of TGF-a, but also for a variety of other growth factors. Indeed, TGF-a is but one member of the family of EGF-like growth factors. Many of the growth factors in this family are thought to be synthesized as transmembrane precursors. This has been shown not only for TGF-a but also for the large EGF precursor that often remains uncleaved as a large cell surface protein (Rall et al., 1985). It is thus likely that the EGF, VGF, amphiregulin, and HB-EGF precursors are all able to interact productively with their receptors on neighboring cells, without actual release of the soluble growth factor. Some evidence supports this notion in the case of the large EGF precursor (Mroczkowski et al., 1989). In addition, there are at least three other growth factors that are made as transmembrane cell surface polypeptides: colony-stimulating factor-1 (CSF-1) (Rettenmier et al., 1987; Rettenmier and Roussel, 1988), tumor necrosis factor (TNF) (Kriegler et al., 1988),and the c-kit-encoded ligand (Anderson et al., 1990). The proteolytic cleavage of these transmembrane forms into soluble growth factors may be subject to regulation. Also in these cases it is likely that the cell surface-linked forms of the precursors can interact with the cell surface receptors on the same or on neighboring cells, thus resulting in a highly localized mitogenic stimulation of the target cells. The interaction of the transmembrane form of TGF-a and the receptor is thus an interaction between two cell surface proteins, during which there is signal transduction going through the receptor into the receptor-bearing cell. However, it is also possible that there is signal transduction through the TGF-a precursor into the TGF-a-producing cell. Thus the EGF/TGF-a receptor could represent a ligand for the TGF-a precursor as a receptor. Whereas such function is as yet still unproved, a possible physiological role associated with the cytoplasmic domain of the TGF-a precursor is substantiated by its extreme sequence conservation among animal species (Derynck et al., 1984; Lee et al., 1985), which is indicative of a conserved biological function. In addition, the spacing of the cysteine residues in the intracellular TGF-a precursor domain is reminiscent of the cysteine patterns that mediate the interactions between the cytoplasmic domains of the CD4 and CD8 cell surface receptors and the cytoplasmic lck protooncogene product, which functions as a tyrosine protein kinase (Shaw et al., 1989, 1990; Turner et al., 1990). It is possible that the somewhat similar sequence in the cytoplasmic domain

38

RIK DERYNCK

of the TGF-a precursor is indicative of and responsible for an interaction with an as yet to be identified cytoplasmic protein. If there is indeed signal transduction through the TGF-a precursor, then the interaction between both cell surface proteins, the precursor, and the EGF/TGF-a receptor would result in a two-directional signal transduction and cellcell communication and in an activation of cellular functions in both cells. If so, this interaction of the transmembrane TGF-a with the receptor would be qualitatively considerably different from the effect of soluble TGF-a on cells. A characterization of a receptor-like function of the TGF-a precursor would then also lead to a definition of a role for the soluble form of the EGFITGF-a receptor, which appears to be secreted by various cells, such as in the brain (Nieto-Sampedro, 1988) and the liver (Petch et al., 1990). This soluble domain could then function as a ligand that would modify biochemical pathways in cells that have the transmembrane TGF-a form.

VI. A Role for TGF-a in the Physiology of Normal Cells TGF-a was originally discovered in the medium of tumor cells (De Larco and Todaro, 1978; Todaro et al., 1980) and a possible function of TGF-a was considered only in the context of tumor cells. However, research during the last few years has now made it evident that TGF-a plays a role in the physiology of normal cells and tissues. Epithelial cells are the major source of TGF-a synthesis under normal conditions. TGF-a synthesis has been demonstrated by Northern hybridization, in situ hybridization, or immunochemical methods in a variety of normal epithelial cells (Valverius et al., 1989), and gastric and intestinal mucosa cells (Beauchamp et al., 1989). It is thus likely that most, if not all, types of normal epithelial cells synthesize TGF-a. These same cells also have EGF/TGF-a receptors (Carpenter and Wahl, 1990), thus making them responsive to the action of TGF-a in an autocrine fashion. Even though there is as yet no direct proof in uivo, it is likely that a normal role of the endogenous TGF-a synthesis in these epithelia is to drive their proliferation. There is certainly plenty of experimental evidence that epithelial cells in culture are responsive to TGF-a or EGF and that TGF-a or EGF addition results in their increased mitogenic activity (Carpenter and Wahl, 1990). Perhaps the best demonstration of this activity has been obtained using keratinocytes. Normal keratinocytes are dependent on exogenous EGF or TGF-a for their proliferation in culture. Following starvation, the proliferation of these cells is stimulated by TGF-a and EGF at subpicomolar levels. The effect of TGF-a and EGF on substrate-


39

dependent colony formation of human keratinocytes has been studied in some detail. Starting from a single keratinocyte, a circular colony can only be formed efficiently when either TGF-a or EGF is present in the medium. The colonies of cells are considerably larger when grown in the presence of TGF-a than when using EGF. This colony formation is the result of cell proliferation and migration, but it is not known what the effects of TGF-a are on keratinocyte migration only (Barrandon and Green, 1987). T h e effects of EGF, TGF-a, and VGF on reepithelialization in pig skin due to keratinocyte proliferation in vivo have also been examined. TGF-a has the ability to induce reepithelialization, supporting the notion that it can induce keratinocyte proliferation in vivo (Schultz et al., 1987). It is as yet unknown if natural wound healing of the skin is accompanied by an enhanced TGF-a synthesis by the keratinocytes at the site of the wound. In vivo studies have also evaluated the expression levels of TGF-a in psoriasis. Psoriasis results in a local inflammation and topical proliferation and incomplete differentiation of skin keratinocytes. Analyses by immunohistochemistry, RNA hybridization, and immunological measurements of the TGF-a protein indicate that the levels of TGF-a expression by keratinocytes in the psoriatic lesions are enhanced in comparison with normal skin at unaffected sites o r in normal volunteers (Elder et al., 1989). These results, together with the responsiveness of keratinocytes to low levels of TGF-a, suggest that enhanced TGF-a expression could effectively contribute to the overproliferation of the skin in psoriasis. It is not known whether there is a direct link between the inflammation and the TGF-a synthesis, but recent data have shown that interferon-? can induce TGF-a synthesis (Kumar and Mendelsohn, 1990). Besides a presumed major role of TGF-a in proliferation of epithelia, TGF-a may also play a role in several other tissues. TGF-a expression has been detected in several structures in the brain and appears to be relatively highly expressed in the olfactory locus and in the pituitary (Kobrin et al., 1988; Wilcox and Derynck, 1988a). It is as yet unclear how the distribution of TGF-a expression in the brain compares with the localization of the EGF/TGF-a receptor expression. Because the detection of this growth factor has been mainly based on in situ hybridization of the TGF-a mRNA, it is hard to predict where exactly TGF-a exerts its activity. By analogy with many other peptides, there may indeed by axonal transport of growth factors and receptors in the neurons. No localization studies of both ligand and receptor at the protein level have been reported. We currently do not know the function of TGF-a in the context of the neurons and brain. There is, however, evidence that EGF, and thus presumably also TGF-a, have a potent neurotrophic activity

40

RIK DERYNCK

(Morrison et al., 1987). The role of the endogenous production of TGF-a and many other growth factors in the brain still needs to be established. TGF-a synthesis has also been reported in activated macrophages (Madtes et al., 1988; Rappolee et al., 1988a).Macrophages have the ability to synthesize a large variety of growth factors (Rappolee and Werb, 1991). The abundant presence of macrophages at sites of inflammation and wound healing and the effects of growth factors on cell proliferation strongly suggest that the role of the macrophage-released TGF-a is to participate in the wound-healing process and to stimulate the proliferation of epithelial cells. In addition, TGF-a is also able to induce proliferation of other cell types that have the EGF/TGF-a receptors, such as fibroblasts or endothelial cells. The abundance of the various growth factors released by macrophages is presumably essential for normal wound repair. Relatively little is as yet known about the regulation of TGF-a synthesis in epithelial cells or other cell types. Estrogen-responsivemammary epithelial cells have been shown to increase their level of TGF-a mRNA and protein synthesis following treatment with estrogen. This same treatment also results in an increased proliferation of such cells, suggesting that this could be due in part to an autocrine action of the higher levels of TGF-a (Liu et al., 1987). However, these cells presumably make several other growth factors, some of which may also be induced following estrogen treatment. Another factor that appears to modulate the synthesis of TGF-a by cells is the phorbol ester TPA. Treatment of cells with TPA, an activator of protein kinase C, induces a strong but transient increase of the level of TGF-a synthesis in keratinocytes and other cells (Pittelkowet al., 1989; Mueller et al., 1989; Bjorge et al., 1989). This increase has been shown to be due only to the activation of the protein kinase C pathway and is not due to any other effect of TPA. This leads to the possibility that exposure of cells to physiological levels of hormones or growth factors that activate the kinase C pathway may lead to an increase of TGF-a synthesis in the target cell. As mentioned above, treatment with TPA also results in an increased cleavage of the cell surface TGF-a form, thus releasing higher levels of soluble TGF-a (Pandiella and Massagut, 1991). Finally, TGF-a synthesis in keratinocytes and other cells is also enhanced following treatment with TGF-a or EGF, although not to the same extent as TPA-induced synthesis (Coffey et al., 1987; Bjorge et al., 1989; Mueller et al., 1989). Thus, there is an autostimulation of TGF-a production in these cells. A molecular analysis of this phenomenon could provide us with insight not only in the regulation of TGF-a synthesis, but also in the activation of expression of other genes that are the


41

target of TGF-a action. It is as yet unclear what the biological meaning of this autoinduction of the TGF-a is. It could represent a simple mechanism to quickly amplify the effect of local TGF-a synthesis. Thus a low concentration of TGF-a released, e.g., by invading macrophages could result in a drastic increase of TGF-a synthesis by keratinocytes or other epithelial cells at a site of wound healing. Another possible consequence of this autoinduction is that such amplification of the TGF-a synthesis and the resulting response give rise to a more or less synchronized induction of cell proliferation. Finally, an autostimulatory mechanism may represent a relatively simple mechanism to maintain the TGF-a synthesis. Following an initial TGF-a induction, this autostimulatory mechanism may then be independent of the much more complex actions of regulators that were responsible for the initial induction of the TGF-a synthesis. Because this autostimulation of TGF-a synthesis has been reported for a few cell types only, it is unclear to what extent this also takes place in other types of normal cells o r tumor cells.

VII. TGF-a in Normal Development Growth factors play major roles in morphogenesis and organogenesis during development. The pattern of TGF-a expression during the development of the mouse has been studied mostly using various RNA detection techniques. Polymerase chain reaction (PCR)-based analysis has detected the presence of TGF-a mRNA in the unfertilized egg (Rappolee et al., 1988b). The TGF-a mRNA is then rapidly destroyed following fertilization and during the initial development of the mammalian embryo, but reappears again in the preimplantation embryo as early as the four-cell stage. The presence of TGF-a protein in virtually all cells of the blastocyst has also been observed by immunostaining (Rappolee et al., 1988b). T h e highest levels of expression occur around days 9-1 1 post coitum. TGF-a is then synthesized in the decidua (Han et al., 1987) and in several structures of the developing fetus (Wilcox and Derynck, 1988b). The levels of TGF-a transcripts in the decidua are highest at day 8 of gestation and decline as the decidua is resorbed. There is no detectable TGF-a mRNA in the nonpregnant uterus or in the pregnant uterus before decidualization (Han et al., 1987). In situ hybridization has revealed that TGF-a transcripts are also present in the developing fetus and that their levels are highest in several structures of ectodermal origin, such as in the branchial arches, the oral and nasopharyngeal epithelia, the otic vesicle, and the developing mesonephric tubules of the kidneys. The levels of TGF-a expression are maximal around days 9 and 10 and decrease at later stages in the fetal development (Wilcox and

42

RIK DERYNCK

Derynck, 1988b). There is, however, no doubt that a more detailed and sensitive analysis would reveal TGF-a synthesis at additional sites and at other stages of the fetal development. Little is known about the development expression of the EGF/TGF-a receptor. Northern hybridization suggests that the receptor mRNA level in the fetus is increased between days 11 and 14. In addition, EGFbinding activity is present in various fetal tissues and in blastocyst outgrowths. Unfortunately, no parallel studies localizing the synthesis of both the ligand and the receptor are available. Results from in uivo experiments or organ cultures using EGF (Carpenter and Wahl, 1990) and from cell culture experiments using TGF-a suggest that the major role of TGF-a in development is to drive the proliferation of various cell populations, especially epithelial cells. The coexpression of the TGF-a and the EGF/TGF-a receptor genes by many epithelial cells likely results in the exertion of the activities of TGF-a in an autocrine manner. Thus TGF-a synthesis could be of major importance in the development of the epithelia and of structures of ectoderma1 origin. A variety of studies, especially by Pratt and colleagues, have examined the effects of exogenous EGF on craniofacial development, particularly of the palate. These results suggest that the function of TGF-a, synthesized by the oral epithelia, is to promote the proliferation of the medial epithelium until the fusion of the palate shelves takes place (Lee and Han, 1990). Several other studies have evaluated the effects of EGF on the development and maturation of intestinal and gastric mucosa and suggest a role for the endogenous TGF-a synthesis in the proliferation and functional maturation of these epithelia (Lee and Han, 1990). A function of TGF-a in the development of epithelia is furthermore also suggested by the histological analysis of epithelia from transgenic mice overexpressing TGF-a (Jhappan et al., 1990; Matsui et al., 1990; Sandgren et al., 1990). Several organs of these mice, developed in three independent studies, had epithelial hyperplasia. This was most striking in the liver, coagulation gland, and intestines. Both colon and duodenum displayed a considerable mucosal hyperplasia. These effects of overexpression of TGF-a on different epithelia in transgenic mice appeared to be most influential during postnatal development, because overexpression of TGF-a had no major influence on the fetal development. Another possible target of the function of TGF-a during development is the mammary gland. Not only are mammary epithelial cells in culture stimulated in their proliferation, but application of TGF-a in a slow-release form to mammary glands of 5-week-old mice results in local alveolar and ductal growth (Vonderhaar, 1987). In accordance, TGF-aoverexpressing transgenic mice exhibit an increased penetration of an

PHYSIOLOGY OF TGF-O1

43

abnormally dense network of mammary epithelial ducts into the mammary fat pad. Thus the TGF-a synthesized in mammary epithelial cells could play an important role in the morphogenesis of the mammary gland. No effects of the overexpression of TGF-a on the mammary epithelial duct system were apparent during the first 4 weeks after birth, suggesting that some additional event or a hormonal stimulus related to puberty is required (Jhappan et al., 1990; Matsui et al., 1990; Sandgren et al., 1990). A further exploration of the role of endogenous TGF-ol synthesis in fetal and postnatal development will eventually require the generation of mice that are defective in TGF-a synthesis. As yet, no mice have been developed in which TGF-a synthesis was abolished following targeted gene disruption.

VIII. A Role for TGF-a in Tumor Development? A possible link between the production of TGF-a and the transformed character was apparent from the initial discovery of this growth factor. TGF-a was indeed first detected in the medium of murine sarcoma virus-transformed cells and several other retrovirus-transformed fibroblasts. Its name originated from the observation that preparations of this growth factor, even though impure, had the ability to induce phenotypic transformation of normal rat kidney cells, an immortalized fibroblast cell line, in culture. This transforming activity, which was apparent from the acquisition of anchorage independence in soft agar and from a different appearance and loss of contact inhibition in monolayer culture, was phenotypic and reversible, because removal of the TGF-a preparations resulted in a reversal to the normal phenotype (De Larco and Todaro, 1978; Todaro et al., 1980). We now know that the full transforming effect of these preparations was due to a synergism between TGF-a and TGF-P, and that neither of these factors alone has this ability to its full extent (Anzano et al., 1983). The transforming activity and the initial finding that TGF-a was only made in transformed fibroblasts and not in their normal counterparts have resulted in the concept that TGF-a could significantly contribute to malignant transformation and tumor development. Examination of a variety of cell lines subsequently showed that TGF-a was not only synthesized by fibroblasts transformed by retroviruses, but also by SV40- and polyoma-transformed cells (Kaplan and Ozanne, 1982; Kaplan et al., 1981). In addition, transformation with the ras oncogene or polyoma middle T coding sequences was sufficient to induce TGF-ol expression in the host cell (Kaplan and Ozanne, 1980; Salomon et al., 1987; Ciardiello et al., 1988). More recent studies have shown that the

44

RIK DERYNCK

induction of endogenous TGF-a expression by immortalized fibroblasts can also be achieved by introduction of and concomitant transformation by a variety of other oncogenes (Ciardielloet al., 1990). However, not all oncogenes had the ability to induce TGF-a synthesis, even though all transfected cells were transformed, indicating that TGF-a expression is not the result of transformation per se, but of a biochemical pathway triggered by selected oncogenes. Although there has not been a systematic study, the current data suggest that expression of oncogenes with gene products localized in the nucleus and presumably directly involved in transcription, does not induce TGF-a expression. In contrast, expression of ras and oncogenes that induce tyrosine phosphorylation or are tyrosine kinases themselves results in TGF-a expression. Examination of human tumor cell lines and biopsies revealed that TGF-a expression is fairly common among tumor types (Derynck et al., 1987; Bates et al., 1988; Nistkr et al., 1988).Hematopoietic tumors apparently do not synthesize TGF-a, but a variety of solid tumors do. Among the latter, carcinomas are most likely to synthesize TGF-a. More than half of the mammary carcinomas and all squamous and renal carcinomas examined synthesize TGF-a. Also, most hepatomas, melanomas, and glioblastomas exhibit an endogenous TGF-a synthesis. The incidence of TGF-a synthesis among tumors of mesenchymal origin is less common, but is by no means rare. Thus, TGF-a synthesis is prevalent among epithelial and other ectodermally derived tumors (Derynck et al., 1987). It is apparent that expression of TGF-a is frequently accompanied by enhanced synthesis of the EGF/TGF-a receptor, at least as assessed by Northern hybridization of the mRNA. This is most striking in the case of squamous and renal carcinomas, which consistently synthesize high levels of TGF-a and EGFITGF-a receptor (Derynck et al., 1987). It is likely that high receptor levels result in an enhanced sensitivity of the cell to the autocrine stimulation of TGF-a, thus considerably amplifying the effects of the growth factor (Di Fiore et al., 1987; Di Marco et al., 1989). It is not known whether the transition from a TGF-asynthesizing epithelial cell to a fully transformed carcinoma results in an increase of TGF-a synthesis, although anecdotal data on unmatched samples suggest that this may be the case. The endogenous synthesis of TGF-a in tumor cells could be of importance in tumor development and maintenance. Unfortunately, results of direct experiments, e.g., aimed at an abolition of TGF-a synthesis in normally TGF-a-synthesizingtumor cells, have as yet not been reported. Thus our knowledge about the role of TGF-a in tumorigenesis is primarily based on a variety of observations from indirect experiments.

PHYSIOLOGY OF TGF-a

45

Because TGF-a is mitogenic for many cells, we assume that the TGF-a produced by tumor cells enhances proliferation of these same cells in an autocrine way, provided these cells have EGFITGF-a receptors. Indeed, most, if not all, TGF-a-producing tumor cells have EGF/TGF-a receptors, and, as mentioned above, an enhanced receptor expression level is frequently encountered. Ligand and receptor could interact in an autocrine fashion in several ways. The most common interaction takes place at the cell surface, but could in principle also occur in cytoplasmic vesicles, such as the exosomes, making these interactions oblivious to the neutralizing effects of antibodies or proteases. Internal ligand-receptor interactions are thus possible and have been unambiguously documented in the case of the platelet-derived growth factor B chain (Keating and Williams, 1988). T h e extracellular TGF-a could exert its activities either as a soluble secreted and diffusible ligand, which thus can interact with many cells in proximity to the producer cells, or as the uncleaved transmembrane form of TGF-a, which can interact only with the neighboring cells in contact with the producer cells. Various experiments strongly suggest that endogenous TGF-a synthesis provides the means for an increased proliferation rate to the tumor cells. A good example of this effect is provided by a study comparing the susceptibility to exogenous TGF-a of untransformed mammary epithelial cells and their polyoma middle T-transformed and rm-transformed counterparts (Salomon et al., 1987). The normal cells and the polyoma middle T-transformed cells are strongly stimulated in their proliferation, whereas the rm-transformed cells are not. T h e polyomatransformed cells have a low level of endogenous TGF-a synthesis and their proliferation rate is enhanced by exogenous TGF-a to a level very similar to that of the rm-transformed cells. The latter cells have a high level of endogenous TGF-a synthesis and are not very dependent on exogenous growth factors. The autocrine stimulation by a high level of TGF-a synthesis may be responsible in part for the very high proliferation rate of the rm-transformed cells, which cannot be further stimulated. Other experiments, comparing the rate of tumor formation in nude mice by papilloma cells that were or were not transfected by a TGF-a expression vector, clearly established an increased tumor size and proliferation rate as a consequence of the TGF-a production (Finzi et al., 1988). Considerable attention has been given to the question whether endogenous TGF-a synthesis by cells is able and sufficient to convert untransformed cells into transformed and tumorigenic cells. The basis for this hypothesis was the original observation that TGF-a preparations

46

RIK DERYNCK

were able to induce phenotypic transformation. In addition, the original autocrine hypothesis (Sporn and Todaro, 1980) proposed that endogenous expression of TGF-a and concomitant autocrine interaction and stimulation of the producer cell lines by these factors resulted in independence of exogenous growth factors, a basis for malignant transformation. Thus cells were transfected with a TGF-a expression plasmid, and selected TGF-a-producing cell lines were examined for their acquisition of characteristics of malignant transformation. Results from various studies established that a high level of TGF-a synthesis can indeed result in transformation and tumorigenicity, but that this clearly depends on the choice of the cell line and on the assays used as criteria for the transformed phenotype. Some immortalized cell lines such as the Rat-1 (Rosenthalet al., 1986)and NRK (Watanabeet al., 1987) fibroblasts and the epithelial NOG-8 cell line (Shankar et al., 1989) clearly lost contact inhibition and anchorage independence when transfected with a TGF-a expression vector and thus were transformed. Also, expression of TGF-a in Rat-1 cells (Rosenthal et la., 1986) and of EGF in Fisher rat 3T3 cells (Stern et al., 1987) resulted in tumorigenicity in animals. However, TGF-a expression in early-passage NIH 3T3 cells resulted only in a higher cell density in the monolayer, but not in anchorage independence or tumorigenicity (Finzi et al., 1987), whereas TGF-a expression in cultured primary epidermal cells did not result in tumor formation either (Finzi et al., 1988). In addition, TGF-a overexpression in skin papillomas did not result in neoplastic progression, but only in increased size of the resulting benign tumors (Finzi et al., 1988). All these results suggest that TGF-a expression can induce transformation and tumorigenicity only when the cells have already evolved closely to the transformed character. A parameter that is very important for the effect of TGF-a expression on the acquisition and establishment of transformation and tumorigenicity is the number of EGF/TGF-a receptors. Indeed, overexpression of the receptors can result in ligand-dependent transformation and there is a minimal quantitative requirement of cell surface receptors in order to obtain the TGF-a-induced malignant phenotype (Di Fiore et al., 1987; Di Marco et al., 1989). It is therefore likely that a high level of TGF-a synthesis, combined with a high receptor expression level, as seen in squamous carcinomas or renal carcinomas, can be of considerable importance to the behavior, the phenotype, and the malignant character of some tumor cell types. Transgenic mice that overexpress TGF-a developed a variety of neoplastic lesions (Sandgren et al., 1990; Jhappan et al., 1990; Matsui et al., 1990). Depending on the mouse strain and the promoter that directs the

PHYSIOLOGY OF TGF-(Y

47

transcription of the TGF-a coding sequence, these mice displayed development of coagulation gland carcinomas, mammary adenocarcinomas, and hepatocellular carcinomas. Thus, expression of the TGF-a gene can be oncongenic in vivo. There is not necessarily a discrepancy between these findings and the result from in vitro transfection experiments, which suggested that the cells had to be already close to transformation in order to see a transforming effect of TGF-a expression. T h e tumors that develop in transgenic mice appear only after an extended period of postnatal development and are often found together with hyperplastic areas in the same tissues or organs. This suggests that the overexpression of TGF-a and the high autocrine responsiveness of the cells and tissues result in an extensive proliferation, before tumor development is initiated. Thus the high proliferation rate may considerably increase the probability of tumor development. The induction of TGF-a expression can thus be seen as a tumor-promoting effect or as a contributing step in the progression of the cell toward a fully transformed phenotype. It is not known to what extent these tumor cells in the transgenic mice are dependent on TGF-a for their neoplastic character and behavior. A recent study has established that a high level of TGF-a expression also influences motility and the capability of the cell to digest the extracellular matrix (Gavrilovic et al., 1990). Expression of a transfected TGF-a cDNA in the NBTII rat carcinoma cell line resulted in the conversion from an epithelial to a vimentin-positive fibroblastic phenotype. These cells also acquired a highly motile behavior and secreted significant levels of a 95-kDa gelatinolytic metalloproteinase, presumably corresponding to a type IV collagenase, which was virtually absent in the parent, untransfected cells. These changes, resulting from the expression of TGF-a, could contribute to a more invasive phenotype in vivo. No experiments have as yet been done to evaluate the role of TGF-a in the invasiveness in vivo and the metastasis of these TGF-aproducing tumor cells. T h e ability of TGF-a to induce neovascularization (Schreiber et al., 1986) could also provide an additional advantage to tumor formation. Solid tumors are indeed very dependent on vascularization, as soon as they reach a critical diameter, which does not allow sufficient access to oxygen and nutrients by diffusion. In order to grow beyond this critical size it is imperative that neovascularization takes place (Klagsbrun and Folkman, 1990). the endogenous synthesis of TGF-a can contribute to this process of angiogenesis, because it has been shown that this growth factor is a potent inducer of angiogenesis in vivo (Schreiber et al., 1986). We can assume that TGF-a may not be the only angiogenic factor released by these cells, because a variety of other growth factors can also

48

RIK DERYNCK

induce neovascularization. It is thus likely that the effect of TGF-a occurs in concert with other factors. Finally, TGF-a secreted by the tumor cells in vivo could also influence calcium metabolism and could contribute to a hypercalcemic state. Malignancy-associated hypercalcemia occurs relatively frequently in patients with renal carcinoma, squamous carcinoma, melanoma, or breast carcinoma (Mundy et al., 1985). Tumors of these types are very consistent producers of TGF-a. I n vitro studies have shown that TGF-a is able to induce Ca2+ release from bone cultures (Stern et al., 1985; Ibbotson et al., 1986),thus suggesting that the TGF-a synthesis and release by these tumors could contribute to the induction of malignancy-induced hypercalcemia. It is, however, important to recognize that TGF-a-induced Ca2+ release may only be one mechanism, because parathyroid hormone-related polypeptide synthesized by tumors could also play a role in this type of hypercalcemia (Mundy et al., 1985). The latter factor could maybe synergize with TGF-a, whereby TGF-a would exert its effects mostly at the local level, e.g., at the site of tumor development or at the site of growth of a metastatic nodule, and the parathyroid hormone-like peptide would represent a more systematic activator of Ca2+ release. As is evident from this review, we know as yet little about the biology and the physiological role of TGF-a. Our current knowledge clearly indicates that TGF-a expression is not restricted to tumors, but is very common in normal cells, especially epithelial cells. Thus TGF-a should be considered as a perfectly normal physiological ligand of the EGFITGF-a receptor, one that plays a role in cellular proliferation not only in the adult, but presumably even more importantly in organ and tissue development. Its role in normal tissues certainly does not exclude a role in the establishment and maintenance of the malignant character of tumor cells. In this context, TGF-a could play a role in and contribute to phenotypic transformation, and could certainly stimulate the proliferation of the tumor cells and of the tumor in vivo. In addition, TGF-a expression may influence the invasive behavior of the tumor cells and contribute to the induction of neovascularization of the tumors and to malignancy-induced hypercalcemia. REFERENCES Anderson, D. M., Lyman, S. D., Baird, A,, Wignall, J. M., Eisenmann, J., Rauch, C., March, C. J., Boswell, H. S., Gimpel, S. D., Cosman, D., and Williams, D. E. (1990). Cell 63, 235-243. Anklesaria, P., Teixid6, J., Laiho, M., Pierce, J. H., Greenberger, J. S., and Massague, J. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 3289-3293.

PHYSIOLOGY OF TGF-CL

49

Anzano, M. A., Roberts, A. B. Smith, J. M., Sporn, M. B., and De Larco, J. E. (1983). Proc. Natl. Acad. Sci. U.S.A. 80, 6264-6268. Barrandon, Y., and Green, H. (1987). Cell 50, 1131-1137. Bates, S. E., Davidson, N. E., Valverius, E., Freter, C. E., Dickson, R. B., Tam, J. P., Kudlow, J. E., Lippman, M. E., and Salomon, D. S. (1988). Mol. Endocrinol. 2, 543-555. Beauchamp, R. D., Barnard, J. A., McCutchen, C. M., Cherner, J. A,, and Coffey, R.J. (1989). J. Clin. Invest. 84, 1017-1023. Bjorge, J. D., Paterson, A. J., and Kudlow, J. E. (1989). J. Biol. Chern. 264, 4021-4027. Brachmann, R., Lindquist, P. B., Nagashima, M., Kohr, W., Lipari, T., Napier, M., and Derynck, R. (1989). Cell 56, 691-700. Brenner, D. A,, Koch, K. E., and Leffert, H. L. (1989). DNA 8, 279-285. Bringman, T. S., Lindquist, P. B., and Derynck, R. (1987). Cell 48, 429-440. Carpenter, G., and Wahl, M. I. (1990). I n “Peptide Growth Factors and Their Receptors” (M. B. Spron and A. B. Roberts, eds.), pp. 69-171. Springer-Verlag, New York. Chang, W., Upton, C., Hsu, S.-L., Purchio, A. F., and MacFadden, G. (1987). Mol. Cell. Biol. 7 , 535-540. Ciardiello, F., Kim, N., Hynes, N., Jaggi, R., Redmond, S., Liscia, D. S., Sanfilippo, B., Merlo, G., Callahan, R., Kidwell, W. R., and Salomon, D. S. (1988). Mol. Endocrinol. 2, 1202- 1215. Ciardiello, F., Valverius, E. M., Colucci-DAmato, G. L., Kim, N., Bassin, R. H., and Salomon, D. S. (1990). J. Cell Biochem 42, 45-57. Ciccodicola, A,, Dono, R., Obici, S., Simeone, A,, Zollo, M., and Persico, G. (1989). EMBO J. 8, 1987-1991. Coffey, R. J., Derynck, R., Wilcox, J. N., Bringman, T. S., Goustin, A. S., Moses, H. L., and Pittelkow, M. R. (1987). Nature (London) 328, 817-820. Davis, C. G. (1990). New B i o l o p t 2, 410-419. De Larco, J. E., and Todaro, G. J. (1978). Proc. Natl. Acad. Sci. U.S.A. 75,4001-4005. Derynck, R.,Roberts, A. B., Winkler, M. E., Chen, E. Y., and Goeddel, D. V. (1984). Cell 38, 287-297. Derynck, R.,Goeddel, D. V., Ullrich, A,, Gutterman, J. U.,Williams, R. D., Bringman, T. S., and Berger, W. H. (1987). Cancer Res. 47, 707-712. Di Fiore, P. P., Pierce, J. H., Fleming, T. P., Hazan, R.,Ullrich, A., King, C. R., Schlessinger, J., and Aaronson, S. A. (1987). Cell 51, 1063-1070. Di Marco, E., Pierce, J. H., Fleming, T. P., Kraus, M. H., Molloy, C. J., Aaronson, S. A., and Di Fiore, P. P. (1989). Oncogene 4, 831-838. Ebner, R., and Derynck, R. (1991). Cell Regul. 2, 599-612. Elder, J. T., Fisher, G. J., Lindquist, P. B., Bennett, G. L., Pittelkow, M. R., Coffey, R. J., Ellingsworth, L., Derynck, R., and Voorhees, J. J. (1989). Science 243, 811-814. Finzi, E., Fleming, T., Segatto, O., Pennington, C. Y., Bringman, T. S., Derynck, R., and Aaronson, S. (1987). Proc. Natl. Acad. Sca. U.S.A. 84, 3733-3737. Finzi, E., Kilkenny, A,, Strickland, J. E., Balaschak, M., Bringman, T., Derynck, R., Aaronson, S., and Yuspa, S. H. (1988).Mol. Carcinog. 1, 7-12. Can, B. S., Hollenberg, M. D., MacCannell, K. L., Lederis, K., Winkler, M. E., and Derynck, R. (1987). J. Phurmacol. Exp. Ther. 242, 331-337. Gavrilovic, J., Moens, G., Thiery, J. P., and Jouanneau, J. (1990). Cell Regul. 1, 1003-1014. Gentry, L. E., Twardzik, D. R., Lim, G. J., Ranchalis, J., and Lee, D. C. 91987). Mol. Cell. Biol. 7, 1585-1591. Gray, A., Dull, T. J., and Ullrich, A. (1983). Nature (London) 303, 722-725. Han, V. K. M., Hunter, E. S., Pratt, R. M., Zendegui, J. G., and Lee, D. C. (1987). Mol. Cell. Biol. 7 , 2335-2343.

50

RIK DERYNCK

Higashiyama, S., Abraham, J. A,, Miller, J., Fiddes, J. C., and Klagsbrun, M. (199 1). Science 251, 936-939. Ibbotson, K. J., Harrod, J., Gowen, M., D’Souza, S., Winkler, M. E., Derynck, R., and Mundy, G. R. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 2228-2232. Ignotz, R. A., Kelly, B., Davis, R. J., and MassaguC,J. (1986).Proc. Natl. Acad. Sci. U.S.A. 83, 6307-63 1 1. Jhappan, C., Stahle, C., Harkins, R. N., Faustos, N., Smith, G. H., and Merlino, G. T. (1990). Cell 61, 1137-1146. Kaplan, P. L., and Ozanne, B. (1982). Virology 123, 372-380. Kaplan, P. L., Topp, W. C., and Ozanne, B. (1981). Virology 108,484-490. Keating, M. T., and Williams, L. T. (1988). Science 239, 914-916. Kimura, H., Fischer, W., and Schubert, D. (1990). Nature (London) 348, 257-261. Klagsbrun, M., and Folkman, J. (1990). I n “Peptide Growth Factors and Their Receptors” (M. B. Sporn and A. B. Roberts, eds.), pp. 549-586. Springer-Verlag, New York. Kobrin, M. S., Samsoondar, J., and Kudlow, J. E. (1988).J. Bwl. C h . 261, 14414-14419. Kriegler, M., Perez, C., DeFay, K., Albert, I., and Lu, S. D. (1988). Cell 53, 45-53. Kumar, R., and Mendelsohn, J. (199O).J.Biol. Chem. 265, 4578-4582. Lax, I., Johnson, A., Howk, R., Sap, J., Bellot, F., Winkler, M., Ullrich, A,, Vennstrom, B., Schlessinger, J., and Givol, D. (1988). Mol. Cell. B i d . 8, 1970-1978. Lee, D. C., and Han, V. K. M. (1990).I n “Peptide Growth Factors and Their Receptors. 11” (M. B. Sporn and A. B. Roberts, eds.), pp. 61 1-643. Springer-Verlag, New York. Lee, D. C., Rose, T. M., Webb, N. R., and Todaro, G. J. (1985). Nature (London) 313,489491. Lin, Y.-Z., Caporaso, G., Chang, P.-Y., Ke, X.-H., and Tam, J. P. (1988). B i o c h t s t y 27, 5640-5645. Liu, S. C., Sanfilippo, B., Perroteau, I., Derynck, R., Salomon, D. S., and Kidwell, W. R. (1987). Mol. Endorrinol. 1, 683-692. Luetteke, N. C., Michalopoulos, G. K., Teixid6, J., Gilmore, R., MassaguC, J., and Lee, D. C. (1988). B i o c h a t s t y 27, 6487-6494. Madtes, D. K., Raines, E. W., Sakariassen, K. S., Assoian, R. K., Sporn, M. B., Bell, G. I., and Ross, R. (1988). Cell 53, 285-293. Marquardt, H., and Todaro, G. J. (1982).J. Biol. Chem. 257, 5220-5225. Marquardt, H., Hunkapiller, M. W., Hood, L. E., and Todaro, G. J. (1984). Science 223, 1079- 1082. MassaguC, J. (1983).J. Biol. Chem. 258, 13614-13620. MassaguC, J. (1990).J . Biol. Chem. 265, 21393-21396. Matsui, Y., Halter, S. A., Holt, J. T., Hogan, B. L. M., and Coffey, R. J. (1990). Cell 61, 1147-1 155. Morrison, R. S., Kornblum, H. I., Leslie, F. M., and Bradshaw, R. A. (1987). Science 238, 72-75. Mroczkowski, B., Reich, M., Chen, K., Bell, G. I., and Cohen, S. N. (1989).Mol. Cell. biol. 9, 2771-2778. Mueller, S. G., Kobrin, M. S., Paterson, A. J., and Kudlow, J. E. (1989).Mol. Endocrinol. 3, 976-983. Mundy, G. R., Ibbotson, K. J., and DSouza, S. M. (1985). J. Clin. Invest. 76, 391-394. Myrdal, S. E., Twardzik, D. R., and Aversperg, N. (1986).J. Cell Biol. 102, 1230-1234. Nieto-Sampedro, M. (1988). Science 240, 1784-1787. NistCr, M., Libermann, T. A., Betsholtz, C., Petterson, M., Claesson-Welsh, L., Heldin, C.-H., Schlessinger, J., and Westermark, B. (1988). Cancer Res. 48, 3910-3918. Pandiella, A., and MassaguC, J. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 1726-1730.

PHYSIOLOGY OF TGF-(Y

51

Petch, L. A., Harris, J., Raymond, V. W., Blasband, A., Lee, D. C., and Earp, H. S. (1990). Mol. Cell. Biol. 10, 2973-2982. Pfeffer, S., and Ullrich, A. (1985). Nature (London) 313, 184. Pittelkow, M. r., Lindquist, P. B., Abraham, R., Graves-Deal, R., Derynck, R., and Coffey, R. J. (1989).J. Biol. Chem. 264, 5164-5171. Plowman, G. D., Green, J. M., MacDonald, V. L., Neubauer, M. G., Disthche, C. M., Todaro, G. J., and Shoyab, M. (1990). Mol. Cell. Biol. 10, 1969-1981. Rall, L. B., Scott, J., Bell, G. I., Crawford, R. J., Penschow, J. D., Niall, H. D., and Coghlan, J. P. (1985). Nature (London) 313, 228-231. Rappolee, D. A., and Werb, Z. (1991). Curr. T q . Microbiol. Immunol. (in press). Rappolee, D. A,, Mark, D., Banda, M. J., and Werb, 2. (1988a). Science 241, 708712. Rappolee, D. A., Brenner, C. A., Schultz, R., Mark, D., and Werb, Z. (1988b). Science 241, 1823- 1825. Rettenmier, C. W., and Roussel, M. F. (1988). Mol. Cell. Biol. 8, 5026-5034. Rettenmier, C. W., Roussel, M. F., Ashmun, R. A., Ralph, P., Price, K., and Scherr, C. J. (1987). Mol. Cell Biol. 67, 2378-2387. Rosenthal, A., Lindquist, P. B., Bringman, T. S., Goeddel, D. V., and Derynck, R. (1986). Cell 46, 301-309. Russell, D. W., Schneider, W. J., Yamamoto, T., Brown, M. S., and Goldstein, J. L. (1984). Cell 37, 577-585. Salomon, D. S., Perroteau, I., Kidwell, W. R., Tam, J., and Derynck, R. (1987). J . Cell. Physiol. 130, 397-409. Sandgren, E. P., Luetteke, N. C., Palmiter, R. D., Brinster, R. L., and Lee, D. C. (1990). Cell 61, 1121-1135. Savage, C. R., Hash, J. H., and Cohen, S. N. (1973).J. Biol. Chem. 248, 7669-7672. Savage, T. R., Inagami, T., and Cohen, S. N. (1972).J. Biol. Chem. 247, 7612-7627. Schreiber, A. B., Winkler, M. E., and Derynck, R. (1986). Science 232, 1250-1253. Schultz, G. S., White, M., Mitchell, R., Brown, G., Lynch, J., Twardzik, D. R., and Todaro, G. J. (1987). Science 235, 350-352. Scott, J., Urdea, M., Quiroga, M., Sanchez-Pescador, R., Fong, N., Selby, M., Rutter, W. J., and Bell, G. I. (1983). Science 221, 236-240. Shankar, V., Ciardiello, F., Kim, N., Derynck, R., Liscia, D. S., Merlo, G., Langton, B. C., Sheer, D., Callahan, R., Bassin, R. H., Lippman, M. E., Hynes, N., and Salomon, D. S. (1989). Mol. Carcinog. 2, 1-1 1. Shaw, A. S., Amrein, K. E., Hammond, C., Stern, D. F., Sefton, B. M., and Rose, J. K. (1989). Cell 59, 627-636. Shaw, A. S., Chalupny, J., Whitney, A., Hammond, C., Amrein, K. E., Kavathas, P., Sefton, B. M., and Rose, J. K. (1990). Mol. Cell. Biol. 10, 1853-1862. Shoyab, M., McDonald, V. L., Bradley, J. G., and Todaro, G. J. (1988). Science 243, 10741076. Smith, J. J., Derynck, R., and Korc, M. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 7567-7570. Smith, J. M., Sporn, M. B., Roberts, A. B., Derynck, R., Winkler, M. E., and Gregory, H. (1985). Nature (London) 315, 515-516. Sporn, M. B., and Roberts, A. B. (1988). Nature (London) 332, 217-219. Sporn, M. B., and Todaro, G. J. (1980). N. Engl. J . Med. 303,878-880. Stern, D. F., Hare, D. L., Caecchini, M. A., and Weinberg, R. A. (1987). Science 235, 321324. Stern, P. H., Krieger, N. S., Nissenson, R. A,, Williams, R. D., Winkler, M. E., Derynck, R., and Strewler, G. J. (1985).J. Clin. Invest. 76, 2016-2019.

52

RIK DERYNCK

Stroobant, P., Rice, A. P., Gullick, W. J., Cheng, D. J., Kerr, I. M., and Waterfield, M. D. (1985). Cell 42, 383-393. Sudhof, T. C., Russell, D. W., Goldstein, J. L., and Brown, M. S. (1985). Science 228,893895. Teixid6, J., and Massaguk, J. (1988).J. B i d . Chem. 263, 3924-3929. Teixid6, J., Gilmore, R.,Lee, D. C., and Massaguk, J. (1987).Nature (London) 326,883-885. Teixidb, J., Wong, S. T., Lee, D. C., and Massagu6, J. (199O).J. Biol. Chem. 265,6410-6415. Todaro, G. J., Fryling, C., and De Larco, J. E. (1980).Proc. Natl. Acad. Scz. U.S.A. 77,52585262. Turner, J. M., Brodsky, M. H., Irving, B. A., Levin, S. D., Perlmutter, R. M., and Littman, D. R. (1990). Cell 60, 755-765. Upton, C., Macen, J. L., and MacFadden, G. (1987).J. Vzrol. 61, 1271-1275. Valverius, E. M., Bates, S. E., Stampfer, M. R., Clark, R., McCormick, F., Salomon, D. S., Lippman, M. E., and Dickson, R. B. (1989).Mol. Endocrinol. 3, 203-214. Venkatesan, S., Gershowitz, A., and Moss, B. (1982).J. Virol. 44, 637-646. Vonderhaar, B. K. (1987).J. Cell. Physiol. 132, 581-584, Watanabe, S., Lazar, E., and Sporn, M. B. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 12581262. Wilcox, J. N., and Derynck, R. (1988a).J. Neurosci. 8, 1901-1904. Wilcox, J. N., and Derynck, R. (1988b).Mol. Cell. biol. 8, 3415-3422. Wong, S. T., Winchell, L. F., McCune, B. K., Earp, H. S., Teixido, J., Massague, J., Herman, B., and Lee, D. C. (1989). Cell 56,495-506.

THE ROLE OF Raf-1 PHOSPHORYMTION IN SIGNAL TRANSDUCTION Gisela Heidecker,* Walter Kolch,*1 Deborah K. Morrison,t and Ulf R. Rapp* 'Viral Pathology Section, Laboratory of Viral Carcinogenesis, NCI-Frederick Cancer Research and Development Center, Frederick, Maryland 21702,

tABL- Basic Research Program, NCI-Frederick Cancer Research and Development Center, Frederick, Maryland 21702

I. The raf Oncogene Family Raf- 1 Activation following Growth Factor Stimulation A. Modes of Raf-1 Activation B. Raf-1 Activation in Cells Expressing Oncogenically Activated PTKs 111. Sites of Raf- 1 Phosphorylation A. Sites of Serine/Threonine Phosphorylation B. Sites of Tyrosine Phosphorylation I v. Consequences of Raf-1 Activation A. Raf- 1 in Activated Receptor Complexes B. Relative Position of Raf in the Signaling Cascade C. Substrates of Activated Raf-1 V. Conclusion References 11.

1. The raf Oncogene Family Raf proteins are serine/threonine-specific protein kinases that function in signal transduction, transmitting mitogenic signals from the ligand-activated growth factor receptors at the cell surface to the transcriptional machinery in the nucleus. The general properties of raffamily genes and their role in carcinogenesis have recently been reviewed (Rapp, 1991; Kolch et al., 1990a; Storm et al., 1990a). Briefly, so far three active genes, c-raf-1, A-raf-1, and B-raf have been described in human, mouse, rat, and chicken cells. In mouse and chicken cells (in the latter, the gene is called mil), truncated versions of c-raf-1 and B-raf have been found as oncogenes of acutely transforming viruses (Rapp et al., 1983a,b; Jansen et al., 1983, 1984; Sutrave et al., 1984; Evchene et al., 1990), and all three genes can be oncogenically activated in vitro (Huleihe1 et al., 1986; Heidecker et al., 1990; Sithanandam et al., 1990). They have been mapped to three different chromosomes and are located at

Current address: W e c k e AG, Biological Research and Biotechnology, Mooswaldalleel-9, 7800 Freiburg, Germany.

53 ADVANCES IN CANCER RESEARCH, VOL. 58


54

GISELA HEIDECKER ET AL.

sites that are frequently altered in human tumors (Sithanandam et al., 1989; Storm et al., 1990a,b). c-ruf-1 is ubiquitously expressed although at variable levels. A-ruf transcripts are most prominent in urogenital tissues and B-raf expression is most abundant in testis and cerebrum (Storm et al., 1990b). T h e raf genes, like most oncogenes, are highly conserved, and homologues have been identified in Xenopur (Le Guellec et al., 1988) and Drosophila (Mark and Rapp, 1984; Mark et al., 1987), in which one of the two gene family members was first identified as the developmental l(1) polehole gene (Ambrosio et al., 1989) acting in concert with the torso gene, which ,encodes a transmembrane phosphotyrosine kinase. A raf-related gene has recently been isolated from CaenorhabditG elegans (Georgi et al., 1990), which combines a Raf-like kinase domain with an amino-terminal region with similarity to the transmembrane and receptor part of transmembrane receptor kinases found in higher organisms. Based on phylogenetic studies, the raf genes, together with mos, encode the only serine/threonine kinases that belong to the src superfamily, which otherwise encodes protein tyrosine kinases (PTKs) (Hanks et al., 1988). 11. Raf-1 Activation following Growth Factor Stimulation

In this article we will concentrate on the evidence for entry of cytosolic Raf- 1 kinase into activated receptor complexes as well as complexdependent or -independent phosphorylation of Raf- 1 on tyrosine and serine residues, which leads to enzyme activation. So far, very little work in this area has addressed the roles of A- o r B-raJ T h e involvement of Raf-1 has been analyzed in more than a dozen receptor systems, all involved in the transduction of mitogenic signals. The findings have lead to the following conclusions: All mitogens but one stimulated Raf-1 kinase activity. Raf- 1 activation was accompanied b y increased Raf- 1 phosphorylation, leading to a characteristic shift in apparent molecular weight (App et al., 1991; Blackshear et al., 1990; Carroll et al., 1990; K. Dell and L. T. Williams, unpublished observations; Kovacina et al., 1990; Morrison et al., 1988, 1989; Siege1 et al., 1990; Thompson et al., 1991; B. C. Turner et al., 1991). Depending on the receptor system, the entire pool of cellular Raf- 1 is activated within 1-20 min and returns to ground levels within 30-120 min in the absence of stimulation. The only mitogen that so far has failed to activate Raf-1 kinase is interleukin-4 (IL-4). Stimulation with I L 4 also resulted in only intermediate growth induction, indicating that I L 4 is not a complete mitogen (B. C. Turner et al., 1991).

1,2: ras regulated?

3: PKC regulated? FIG. 1. Growth factor receptor activation of Raf-1. These receptor systems include receptors with intrinsic or with associated PTK. Ligand-dependent Raf- 1 kinase activation can be triggered by both receptor categories. Several independent pathways exist for Raf coupling: tyrosine phosphorylation, PKC-dependent serine phosphorylation, and PKCindependent serine phosphorylation. Receptors with intrinsic PTK couple predominantly via the latter pathway; receptors with associated P T K couple predominantly via tyrosine phosphorylation, the exception being TCR and Thy-I in 2B4 cells, which exclusively couple via PKC-dependent serine phosphorylation. Ras function is presumably required for stoichiometric Raf-1 activation since blocking YUS. by use of an inducible dominant negative YUS mutant construct inhibits Raf-1 shift induction by serum (U. R. Rapp and G. M. Cooper, unpublished). Ras control of Raf-1 activation may occur at the level of receptor complex formation, Raf- 1 phosphorylation, or may involve regulation of Raf- 1activating second messengers.

56

GISELA HEIDECKER ET AL.

A. MODESOF Raf-1 ACTIVATION The type of Raf-1 phosphorylation that was detected early after receptor engagement varied, depending on the receptor system as well as the cell type in which the activation was analyzed. Basically, four different modes of Raf-1 activation have been observed so far (Table I and Fig. 1): 1. Activation concomitant with protein kinase C-independent phosphorylation on serine residues. 2. Activation following phosphorylation mostly on serines and to a limited extent (less than 1% of the Raf-1 molecules) on tyrosines. 3. Activation accompanied by phosphorylation on tyrosines and serines to about equal levels. 4. Activation with protein kinase C-dependent serine phosphorylation. 1. Protein Kinase C-Independent Sen'nelThreonine Phosphorylation The first mode of activation is most commonly observed following activation of growth factor receptors with intrinsic tyrosine kinase activity. Members of the four structural classes of transmembrane PTK receptors have been analyzed. Ligand binding of insulin receptor (Kovacina et al., 1990; Blackshear et al., 1990) in epithelial cells, and of epidermal growth factor (EGF) receptor (App et al., 1991)and fibroblast growth factor (FGF) receptor (K. Dell and L. T. Williams, unpublished observations) in fibroblasts, was shown to result in an increase of Raf-1 kinase activity, and the same was observed in myeloid cells activated through the colony-stimulating factor (CSF) receptor (Baccarini et al., 1990). In the cases of the EGF and insulin receptors, pretreatment with phorbol ester for 16 hr did not inhibit Raf activation, demonstrating that protein kinase C (PKC) is not responsible for the serine phosphorylation. Indeed, a Raf kinase kinase has been isolated from insulinstimulated cells (Lee et al., 1991). Raf activation following insulin stimulation was also shown to be insensitive to phenyl arsenite oxide, an inhibitor of tyrosine phosphatase that had been used to uncover cryptic tyrosine phosphorylation in other cases (Blackshear et al., 1990), and the increased activity following the stimulation was not diminished by tyrosine-specific phosphatases but could be reduced to basal levels by serine-specific phosphatases (Kovacina et al., 1990). These results taken together suggest that even a minute level of initial tyrosine phosphorylation plays no role in Raf activation in the case of insulin-dependent activation in epithelial cells.

TABLE I MODES OF Raf-ACTIVATION

Cell type

Signal

~

Fibroblast

BAC1.2F5 PC12 a

Kinase activation

Reference

~~

Insulin Insulin

Ser (Tyr)" Ser Ser Ser Ser, Tyr Not determined Ser Ser

IL2 IL-4 Anti-CD4 AntLCD3

Ser, Tyr N o t determined Ser (Tyr)" Ser

IL-3 GMC-SF 1L3 GM-CSF CSF NGF

Ser, Tyr Ser, Tyr Ser (Tyr)" Ser (Tyr)a Ser Ser

PDGF EGF FGF TPA v-src V f i

HeLa-1R cells H5 hepatoma T cells CTLL-2 CTLL-2 CD4 + 2B4 Myeloid cells FDC-PI DA-3

Raf- 1 phosphor y lation on

Morrison et al. (1988, 1989) Morrison et al. (1988); App et al. (1991) Morrison et al. (1988) Morrison et al. (1988) Morrison et al. (1988) Morrison et al. (1988) Kovacina et al. (1990) Blackshear et al. (1990)

+ + +

Only a small fraction of Raf-1 (2%or less) was phosphorylated on tyrosine residues. K. Wood, S. Halegoua, and T. Roberts (personal communication).

B. C. Turner et al. (1991) B. C. Turner et al. (1991) Thompson et al. (1991) Siege1 et al. (1990) Caroll et al. (1990) Caroll et al. ( 1990) Kanakura et al. (1991) Kanakura et al. (1991) Baccarini et al. (1990) In Morrison (1991)b

58

GISELA HEIDECKER E T AL.

2. SerinelThreonine and Low-Level Tyrosine Phosphorylation The only transmembrane PTK growth factor receptor that has been shown to phosphorylate Raf- 1 on tyrosines is platelet-derived growth factor (PDGF) receptor (Morrison et al., 1989). Direct tyrosine phosphorylation was demonstrated when Raf- 1 and PDGF receptor were coproduced in the baculovirus expression system. However, in mouse BALB 3T3 cells, the stoichiometry of the reaction was very low; less than 1% of the Raf molecules were recognized by antiphosphotyrosine antibodies. Indeed, it is possible that not PDGF receptor but an associated tyrosine kinase is responsible for Raf tyrosine phosphorylation, based on the demonstration that several intracellular src family PTKs bind and are activated by PDGF receptor (Kypta et al., 1990). Phosphorylation of Raf- 1 by a transmembrane receptor complex with associated tyrosine kinase has been demonstrated in a human T cell line following CD4 cross-linking. The CD4 transmembrane receptor is bound to the src family tyrosine kinase Lck (Turner et al., 1990; Shaw et al., 1990), which probably directly phosphorylated a small fraction (

Advances in Cancer Research Volume 58

Advances in Virus Research, Volume 58 (Advances in Virus Research)

Advances in Genetics Volume 58

Advances in Parasitology Volume 58

Advances in Agronomy, Volume 58

Advances in Immunology Volume 58